NL2022984B1 - Therapeutic crosslinking of cytokine receptors - Google Patents

Abstract

The present invention relates to a compound comprising (1) a first binding moiety that binds to an Interleukin 4 receptor; and (2) a second binding moiety that binds to an Interleukin 10 5 receptor or an Interleukin 13 receptor. The compound is preferably a bispecific antibody and able to connect an Interleukin 4 receptor to an Interleukin 10 receptor or Interleukin 13 receptor of a sensory neuron in vivo. The present invention further relates to use of the compound in therapeutic treatment, preferably in the treatment of chronic pain; osteoarthritis; or a condition characterized by (neuro-)inflammation, neurodegeneration, inflammation, and 10 immune activation.

Description

P33979NL00/MJO Therapeutic crosslinking of cytokine receptors Technical field The present disclosure relates to the treatment of chronic pain, osteoarthritis, inflammatory and immune disorders. Background of the disclosure Chronic pain is the number one reason why people seek medical advice in modern medicine. In spite of its multiple causes, chronic pain is accompanied by a cascade of biochemical reactions in the brain, spinal cord, dorsal root ganglia and peripheral nerves leading to neuroinflammation and neurodegeneration.

An example of chronic pain is neuropathic pain, which is often described as a shooting or burning pain. This type of pain can be unrelenting and severe, and often results from nerve damage or a malfunctioning nervous system. Neuropathic pain has multiple causes including amputation, chemotherapy, diabetes, HIV infection, multiple myeloma, multiple sclerosis, nerve or spinal cord compression from herniated discs or from arthritis in the spine, shingles, spine surgery, and other. Neuropathic pain also occurs with no obvious cause. Unfortunately, neuropathic pain often responds poorly to standard pain treatments and occasionally may get worse instead of better over time, For some people, it can lead to serious disability.

Another example of a chronic pain condition is osteoarthritis (OA). OA is the most common joint disorder; the majority of individuals over the age of 65 have radiographic and/or clinical evidence of OA. The most frequently affected sites are the hands, knees, hips, and spine. OA symptoms include chronic pain, significant functional impairment, stiffness, and loss of mobility, Importantly, in OA, the synovial tissue and cartilage produce pro-inflammatory cytokines, that induce chronic pain, inflammation and cartilage breakdown.

Regulatory cytokines such as Interleukin-4 (IL4), IL10 and IL13 and others, have potential in the treatment of chronic pain, inflammatory diseases, immune disorders, and other conditions.

However, cytokines as stand-alone drugs have limited therapeutic effects in chronic pain, immune, inflammatory and other biologic processes, and clinical application of these molecules for inflammatory and immune diseases has been disappointing.

It is an objective of the present disclosure to overcome one or more problems in the prior art, and the present invention discloses a new approach to improve the therapeutic application of regulatory cytokine therapy, in particular interleukin-4 (IL4) and IL10, and IL13.

Summary of the disclosure The inventors developed a novel therapeutic approach, which relates to induction of unique signaling of cells by crosslinking of the receptors of two different cytokines. This unique signaling is neither induced by individual cytokines, nor by the combination of cytokines.

Bringing a receptor binding moiety corresponding to a first cytokine and a receptor binding moiety corresponding to a second cytokine together to induce unique signaling (which does not occur when both receptors are triggered simultaneously by the wild-type cytokines), can be done with various constructs, such as with a bispecific antibody or a fusion protein.

As an example, the first cytokine can be IL4 and the second cytokine may be IL10 or IL13, and the resulting fusion protein can be an IL4-10 fusion protein or an IL4-13 fusion protein, respectively. Administration of the resulting receptor-crosslinking agent, for example a bispecific antibody against IL4-receptor (ILAR) and IL10-receptor (IL10R) or IL13-receptor (IL13R), may completely resolve chronic pain, reduce neuro-inflammation and protect against neurodegeneration in a human or animal subject, whilst administration of a combination of the individual cytokines IL4 and IL10 or IL13 cannot.

Previously, the inventors have reported on the therapeutic effects of the IL4-IL10 fusion protein (N Eijkelkamp et al., J Neuroscience, 2016, 36 (28) 7353-7363). The inventors have now unraveled the mechanisms of action underlying the therapeutic application of the IL4-10 fusion protein according to the prior art, and found that the IL4-10 fusion protein surprisingly, contrary to the combination of IL4 and IL10, promoted clustering of the IL4 receptor (IL4R) and IL10 receptor (IL10R) on sensory neurons, which in turn promotes unique signaling pathways and gene expression profiles that can lead to a full resolution of persistent pain.

The inventors now further found that an 1L4-13 fusion protein induces a unique protection of neurons against the damaging effects of chemotherapeutic drugs in vitro as well as in vivo, which was dependent on cross-linking of ILAR and IL13R, as the combination of wild-type IL4 and wild-type IL13 does not provide such protection.

The approach according to the present disclosure, i.e., to apply cross-linking of at least two or three, preferably two receptors chosen from the group consisting of IL4R, IL10R, IL13R, IL33R, TGFB1R, and TGFB2R by incorporating two or more moieties that bind to said receptors, into one molecule, for example a bispecific antibody, provides a unique treatment for chronic pain, neuro-inflammatory and neuro-degenerative diseases, and inflammatory and immune disorders. Moreover, the compounds disclosed herein, such as bispecific antibodies, have much better manufacturability, pharmacokinetic and safety profiles than cytokine-based drugs.

Detailed description of the invention The present disclosure relates to a compound comprising: - a first binding moiety that binds to a first interleukin receptor, preferably an interleukin 4 receptor (IL4R), interleukin 10 receptor (IL10R), an interleukin 13 receptor (IL13R), an IL33 receptor, a TGFB1 receptor, and a TGFB2 receptor; and - a second binding moiety that binds to a second interleukin receptor, preferably chosen from the group consisting of an interleukin 4 receptor (IL4R), interleukin 10 receptor (IL10R), an interleukin 13 receptor (IL13R), an IL33 receptor, a TGFB1 receptor, and a TGFB2 receptor.

For example, the first binding moiety may bind to an interleukin 4 receptor (IL4R). Or, the first binding moiety may bind to an interleukin 10 receptor (IL10R). Alternatively, the first binding moiety may bind to an interleukin 13 receptor (IL13R). Still alternatively, the first binding moiety may bind to an IL33 receptor. Or, the first binding moiety may bind to a TGFB1 receptor. Further, the first binding moiety may bind to a TGF[2 receptor.

More in particular, the present disclosure relates to a compound comprising: - a first binding moiety that binds to a first interleukin receptor, preferably an interleukin 4 receptor {IL4R); and -a second binding moiety that binds to a second interleukin receptor, preferably chosen from the group consisting of an interleukin 10 receptor (IL10R), and an interleukin 13 receptor (IL13R).

Preferably, the first binding moiety and/or the second binding moiety is not a (wild-type) interleukin, and/or does not comprise a (wild-type) interleukin-derived amino acid sequence. It was found that a compound according to the present disclosure is able to induce unique signaling in neurons, glial cells and other target cells, and can in particular be applied as a treatment of chronic pain.

The compound according to the present disclosure may be any kind of compound that can cross-link IL4R and IL10R or IL13R. This compound can be, for example, a complex, or a polypeptide, a fusion protein, or more preferably a bispecific antibody, a bivalent single chain antibody, a bispecific double chain antibody, a triabody, or a tetrabody. The term “first” and “second” binding moiety does not refer to their relative orientation in the compound, i.e. the first binding moiety can be N- or C-terminal to the second binding moiety, or any alternative configuration may be used. The term “first” and “second” only serves to correctly refer to the two different binding moieties in the present disclosure.

The dual binding (or multi binding) compound according to the present disclosure can be employed to connect (e.g. cluster or cross-link) an IL4R and an IL10R or an IL13R in vivo, preferably an IL4R and an IL10R or an IL13R on a sensory neuron or on a glial cell.

In an alternative embodiment, the present disclosure provides for a combination comprising: - a first binding moiety that binds to an IL4R; - a second binding moiety that binds to an IL10R or an IL13R, wherein the first binding moiety has a linker that binds the second binding moiety or wherein the second binding moiety has a linker that binds the first binding moiety.

Preferably, the first binding moiety and/or the second binding moiety is not a (wild-type) interleukin and/or does not comprise a (wild-type) interleukin-derived amino acid sequence.

The above-mentioned combination can also be employed to connect (cluster or cross-link) an IL4R and an IL10R or an IL13R in vivo, preferably an ILAR and an IL10R or an IL13R of a sensory neuron or a glial cell. In this embodiment, the first binding moiety and/or second binding moiety may comprise a tag, and the linker of the respective other binding moiety preferably is a polypeptide that binds to the tag.

The compound or combination according to the present disclosure is provided particularly for use as a medicament or for use in a therapeutic treatment, preferably the treatment of (inflammatory) pain, e.g. chronic (inflammatory) pain, or neurodegenerative disease.

The first binding moiety, the second binding moiety, and/or the linker according to the present disclosure may be or encompass for example a polypeptide, either or not containing sequences of IL4 and IL10 or IL13, respectively, or more preferably an immunoglobulin molecule or epitope-binding fragment thereof, in particular Fab, F(ab’), F(ab’)2, Fv, dAb, Fd, or a complementarity determining region (CDR) fragment, a single chain antibody (scFv), or single domain antibody. A binding moiety or linker according to the present disclosure may thus be or encompass an intact immunoglobulin molecule such as a polyclonal or monoclonal antibody.

A monoclonal (full) antibody comprises two light chains and two heavy chains, each comprising three CDRs, and has a total of 12 CDRs. A CDR region is a variable sequence involved in the physical binding of the antibody to its antigen.

5 Itis possible to select CDR sequences from other species, e.g. murine, and exchange these with CDR sequences in a human immunoglobulin molecule, to obtain a human immunoglobulin molecule having the specificity that is derived from the other species. This may be advantageous as a human sequence may be less immunogenic to humans as compared to the original framework sequence. Such an exchange of CDR sequences is known as humanization. Hence, the compound, immunoglobulin molecule, or first and/or second binding moiety as provided by the disclosure may be humanized.

The first binding moiety, second binding moiety and/or linker according to the present disclosure preferably specifically binds to its respective target. With the term “specifically bind(s) to” is meant that the binding moiety or linker has more affinity towards its target (e.g. human IL4R or human IL10R) or human IL13R than to other molecules present in the target environment (e.g. the human body). The affinity of an antibody to its antigen is expressed as Ko (the equilibrium dissociation constant between the antibody and its antigen). It is preferred that the Kp of both antigen binding sites of any of the binding moieties disclosed here is lower than 105 M, more preferably lower than 1077 M, more preferably lower than 10° M, more preferably lower than 107° M.

The compound, first binding moiety, second binding moiety and/or linker according to the present disclosure may be or encompass a single domain antibody. Single domain antibodies (sdAb, also called Nanobody, or VHH) are well known to the skilled person. Single domain antibodies are antibodies whose complementarity determining regions are part of a single domain polypeptide. Single domain antibodies thus comprise a single CDR1, a single CDR2 and a single CDR3. Examples of single domain antibodies are heavy chain only antibodies, antibodies that do not comprise light chains, single domain antibodies derived from conventional antibodies, and engineered antibodies. Single domain antibodies may be derived from any species including mouse, human, camel, llama, goat, rabbit, and bovine. For example, naturally occurring VHH molecules can be derived from Camelidae species, for example in camel, dromedary, alpaca and guanaco.

Like a whole antibody, a single domain antibody is able to bind selectively to a specific target. Single domain antibodies contain only the variable domain of an immunoglobulin chain having CDR1, CDR2 and CDR3 and framework regions. With a molecular weight of only about 12-15 kDa, single domain antibodies are much smaller than regular antibodies (150-160 kDa) which are composed of at least two heavy chains and two light chains. The format of a single domain antibody has the advantage of less sterical hindering when bound to its target and may bind to epitopes not accessible to regular antibodies. This is both advantageous for the specific blocking and cross-linking properties as aimed for in the present disclosure. One other advantage may be that in the case of an allogenic source, single domain antibodies may be less immunogenic in other species than (full) monoclonal antibodies. In a further aspect of the present disclosure, the compound, first binding moiety and/or second binding moiety according to the present disclosure may comprise a polypeptide selected from the group consisting of a signal sequence, a His-tag, and an antibody Fc fragment. Additionally, and/or alternatively, the compound, first binding moiety and/or second binding moiety according to the present disclosure may comprise one or more chemical modifications selected from the group consisting of glycosylation, sialylation, fucosylation, and pegylation. In a preferred embodiment, the compound or combination according to the present disclosure is comprised in a pharmaceutical composition, preferably with or in a pharmaceutically acceptable carrier.

The pharmaceutical composition may be formulated with pharmaceutically acceptable carriers or diluents as well as any other known adjuvants and excipients in accordance with conventional techniques (e.g., as described in Remington: The Science and Practice of Pharmacy, 19! Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995).

The term “pharmaceutically acceptable carrier” relates to carriers or excipients, which are inherently nontoxic and nontherapeutic. Examples of such excipients are, but are not limited to, saline, Ringer's solution, dextrose, solution and Hank's solution. Non-aqueous excipients such as fixed oils and ethyl oleate may also be used. A preferred excipient is 5% dextrose in saline. The excipient may contain minor amounts of additives such as substances that enhance isotonicity and chemical stability, including buffers and preservatives. The pharmaceutical composition may be administered by any suitable routes and mode, but preferably by intraarticular or intrathecal administration for example by injection. As will be appreciated by the skilled artisan, the route and/or mode of administration will vary depending upon the desired results.

The pharmaceutical compositions according to the invention may be formulated in accordance with routine procedures for administration of compound or combination by injection into a local compartment such as joint or intrathecal space. The pharmaceutical compositions of the present invention include those suitable for intraarticular or intrathecal administration. Or suitable for administration to any other local compartment in the body. As used herein, “pharmaceutically acceptable carrier’ includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity agents, antioxidants and absorption delaying agents, and the like that are physiologically compatible.

Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical composition of the disclosure is contemplated. Preferably, the carrier is suitable for local injection in a joint or in the intrathecal space. Actual dosage levels of the compound according to the present disclosure may be varied so as to obtain an amount which is effective (“effective amount”) to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient. The selected dosage level will depend upon a variety of factors including the activity of the particular compositions of the present invention employed, the route and time of administration, the duration of the treatment, age, sex, weight, general health and prior medical history of the patient being treated, and like factors well known in the medical arts. In one embodiment, the compound or combination of the present disclosure can be given as a bolus injection, in another embodiment, they can be administered by slow continuous administration via an intrathecal pump or the like, over a long period, such as more than 24 hours, in order to reduce toxic side effects. In yet another embodiment, the compound or combination of the present disclosure can be administered as maintenance therapy, for a period of up to 6 months or more by repeated injections such as, e.g., once a week or 1-10 times per month, for example in a joint or the intrathecal space, or via a pump or any other intrathecal or intraarticular delivery device.

In a further aspect, the present disclosure relates to the compound or combination, or a pharmaceutical composition comprising said according to the present disclosure for use as a medicament.

In an aspect, the present disclosure pertains to the compound or combination, or a pharmaceutical composition comprising the said for use in preventing or treating neuro- inflammation and/or (chronic) pain, for example chronic neuropathic pain experienced during and after chemotherapy, or postherpetic neuralgia, or post-traumatic neuropathic pain, or painful diabetes neuropathy, and other forms of chronic pain, including nociceptive pain and mixed nociceptive and neuropathic pain.

The term “chronic” can be defined at persisting for at least 1, 2, 3, 4, 5, 6, 8, 10, 12 weeks, at least 1, 2, 3, 4, 5, 6, 8, 10, 12 months, and/or at least 1,2, 3,4, 5 years.

Particularly, it was found that the compound or combination of the present disclosure has a cartilage-protective activity.

Therefore, the compound or combination may be used for prevention and treatment of cartilage breakdown, particularly in OA.

The compound or combination may be particularly useful for prevention or treatment of OA (prevention or treatment of cartilage degradation) either or not associated chronic pain.

Moreover, it was also found that the compound or combination of the present disclosure has a neuro-protective activity.

Therefore, the compound or combination may be used for prevention and treatment of neuro-degenerative disorders.

The compound or combination may be particularly useful for treatment of Alzheimer’s disease, Parkinson's disease, Huntington’s disease, amyotrophic lateral sclerosis, or multiple sclerosis.

The compound or combination according to the present disclosure can be used in therapeutic treatment.

In one embodiment, the compound or combination is for, or limited to, topical administration or administration to a local compartment of a human or animal body, and/or wherein the compound or combination is for treatment of a (local) part of the human or animal body, for example a knee, hip, joint, or spine.

Said local compartment typically has a barrier function that prevents that upon administration more than 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 wt.% of the compound or combination per day is absorbed into systemic circulation.

Further, the compound or combination according to the present disclosure is particularly suitable for intrathecal or intraarticular administration, for example by injection into an intrathecal space or intraarticular space.

In a further aspect, the present invention pertains to the compound or combination, or a pharmaceutical composition comprising said according to the present disclosure for use in prevention or treatment of (chronic) pain, a condition characterized by local or systemic inflammation, immune activation, neuro-inflammation and/or neurodegeneration. In an embodiment, said condition characterized by local or systemic inflammation, and/or immune activation is selected from the group consisting of: chronic neuropathic, nociceptive, or mixed neuropathic-nociceptive pain, sepsis, adult respiratory distress syndrome, allo- and xenotransplantation, dermatitis, inflammatory bowel disease, sarcoidosis, allergies, psoriasis, ankylosing spondylarthritis, osteoarthritis, autoimmune diseases such as systemic lupus erythematosus and rheumatoid arthritis, glomerulonephritis, immune complex-induced and other forms of vasculitis, Sjogren's disease, gout, burn injuries, multiple trauma, stroke, myocardial infarction, atherosclerosis, diabetes mellitus, extracorporeal dialysis and blood oxygenation, ischemia-reperfusion injuries, and toxicity induced by the in vivo administration of cytokines or other therapeutic monoclonal antibodies.

In a further aspect, the present invention pertains to the compound or combination according to the present disclosure (e.g. a fusion protein of IL4 and IL10 or IL13 or a bispecific antibody against IL4R and IL10R or IL13R), in a pharmaceutical composition for use in treatment a condition characterized by neuroinflammation or neurodegeneration such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, amyotrophic lateral sclerosis, and multiple sclerosis.

In an embodiment, said condition is characterized by pain and may be selected from visceral or non-visceral nociceptive pain, peripheral and/or central neuropathic pain or mixed nociceptive and neuropathic pain.

According to one embodiment, the compound or combination taught herein can be used for inhibiting production and release of cytokines and other inflammatory mediators by cells, such as macrophages, monocytes, T-lymphocytes and other cells. As a result, the compound or combination of the present disclosure can be used for the preparation of a medicament for attenuating inflammatory reactions by inhibiting the release of cytokines and other inflammatory mediators by these cells in vivo. The compound or combination of the present disclosure can be used as stand-alone drug or in combination with other drugs.

Treatment (prophylactic or therapeutic) may comprise of administering the compound or combination of the present disclosure systemically, intraarticularly, intrathecally, epidurally, or spinally, by injection or by a drug delivery system suitable for local administration. However, other administration routes as set forth above with respect to pharmaceutical compositions comprising the compound or combination recited above may also be employed. The dose and administration regimen may depend on the pharmacodynamic effect aimed at. Typically, the amount of the compound or combination of first and second binding moieties given will be in the range of 0.5 ug to 1 mg per kg of body weight. The dosage can be determined or adjusted by measuring the amount of circulating or local level of the compound or combination upon administration in a biological compartment or space. Typically, the compound or combination of the present disclosure may be formulated in such vehicles at a concentration of from about 50 pg to about 100 mg per ml.

In an embodiment, the compound or combination according to the present disclosure is biologically active and/or able to signal cells to downregulate the production of at least one inflammatory cytokine or mediator such as IL1B, IL6, IL8, TNFa. Preferably, at least TNFa, IL6, and IL8 are downregulated.

In particular, the compound or combination according to the present disclosure can be biologically active and/or able to signal neurons and other cells in the dorsal root ganglion and posterior horn of the spinal cord to activate unique kinase profiles and express unique sets of genes leading to resistance to the damaging effects of e.g. chemotherapeutic drugs.

In another embodiment, the compound or combination according to the present disclosure is biologically active and/or able to signal neurons to normalize hypersensitivity induced by inflammatory mediators such as proinflammatory cytokines or prostaglandins.

In another embodiment, the compound or combination according to the present disclosure is biologically active and/or able to de-activate glial cells in the dorsal root ganglion, the spinal cord and the central nervous system.

The compound or combination of the present disclosure may be prepared by techniques which are routine to the skilled person. For example, it may be prepared using a technique which provides for the production of recombinant proteins by continuous cell lines in culture. For example, the compound or combination of the present invention can be produced in a host cell using a combination of recombinant DNA techniques and gene transfection methods.

For example, to express the compound or combination according to the present disclosure, a nucleic acid molecule encoding the compound or {components of the) combination can be prepared by standard molecular biology techniques. The nucleic acid molecule of the disclosure is preferably operably linked to transcription regulatory sequences such as a promoter, and optionally a 3’ untranslated region. The nucleic acid molecule of the present disclosure may be inserted into a vector, such as an expression vector, such that the genes are operatively linked to transcriptional and translational control sequences. The expression vector and transcription regulatory sequences are selected to be compatible with the expression host cell used. The nucleic acid molecule encoding a compound or (component(s) of the) combination of the present disclosure may be inserted into the expression vector by routine methods.

Additional amino acid sequences may be present at the N- and/or C-terminus of a compound or any one or both of the first and second binding moieties according to the present disclosure, e.g., to facilitate purification. For example, a histidine-tag may be present at the C- or N-terminus to facilitate purification. Alternatively, the compound or combination according to the present disclosure may optionally comprise additional protein moieties, such as moieties capable of targeting, e.g., a protein moiety comprising one or more antibody Fc regions.

The compound or combination according to the present disclosure is preferably an isolated (combination of) protein(s) which can be seen as a protein which is no longer in its natural environment, for example in vitro or in a recombinant host cell.

The present disclosure also encompasses a cell (line) expressing the compound or (first and/or second binding moiety of the) combination as disclosed herein, preferably a Chinese hamster ovary (CHO) cell line, which provides a popular mammalian host for large-scale commercial production of compound or combinations as these cells are safe and allow high volumetric yields.

In another aspect, the present disclosure relates to a host cell comprising a nucleic acid sequence of the present disclosure, or a nucleic acid construct or vector comprising a nucleic acid sequence of the present disclosure. The host cell may be any host cell that can transiently or permanently express the compound or (components of the) combination. The host cell is preferably an animal cell or cell line, such as a mammalian cell or cell line.

In one embodiment the compound or (components of the) combination of the present disclosure is expressed in eukaryotic cell, such as mammalian host cell. Preferred mammalian host cells for expressing include CHO cells (including dhfr-CHO cells, described in (Urlaub et al., 1980), used with a DHFR selectable marker, NS/0 myeloma cells, COS cells, HEK293 cells and SP2.0 cells. When recombinant expression vectors comprising nucleic acid sequences encoding the compound or (components of the) combination are introduced into mammalian host cells, they may be produced by culturing the host cells for a period of time sufficient to allow for expression of the compound or (components of the) combination in the host cells or, more preferably, secretion of thereof into the culture medium in which the host cells are grown. The compound or combination of the present disclosure may be recovered from the culture medium in which the host cells are grown and/or may be purified from the culture medium using standard protein purification methods.

Alternatively, the nucleic acid sequences encoding the compound or (components of the) combination of the disclosure can be expressed in other expression systems, such as e.g. algae, as well as insect cells. Furthermore, the compound or combination can be produced in transgenic non-human animals, such as in milk from sheep and rabbits or eggs from hens, or in transgenic plants. Introduction of the nucleic acid sequence of the present disclosure into a host cell may be carried out by any standard technique known in the art. For expression of the compound or combination of the present disclosure, the expression vector(s) encoding the compound or combination may be transfected into a host cell by standard techniques. The various forms of the term "transfection" are intended to encompass a wide variety of techniques commonly used for the introduction of exogenous DNA into a prokaryotic or eukaryotic host cell, e.g., electroporation, calcium-phosphate precipitation, DEAE-dextran transfection, lipofectamine transfection, and freeze-dry method transfection, and the like. Cell lines that secrete the compound or combination of the present disclosure can be identified by assaying culture supernatants for the presence of the compound or combination. The preferred screening procedure comprises two sequential steps, the first being identification of cell lines that secrete the compound or combination, the second being determination of the quality of the compound or combination such as the ability thereof to inhibit cytokine production by blood cells stimulated with LPS or other Toll-like receptor agonists, and others. In an aspect, the present invention is concerned with a method for producing the compound or combination according to the present disclosure, said method comprising the steps of: culturing a host cell of the present invention under conditions permitting the production of the compound or combination; and optionally, recovering the compound or combination. The skilled person will be capable of routinely selecting conditions permitting production of the compound or combination of the present disclosure. Additionally, a person skilled in the art will be capable of recovering the compound or combination produced using routine methods, which include, without limitation, chromatographic methods (including, without limitation, size exclusion chromatography, hydrophobic interaction chromatography, ion exchange chromatography, affinity chromatography, immunoaffinity chromatography, metal binding, and the like), immunoprecipitation, HPLC, ultracentrifugation, precipitation and differential solubilisation, and extraction. As said above, recovery or purification of the compound or combination of the present disclosure may be facilitated by adding, for example, a Histidine- tag to the fusion protein.

The present disclosure further provides a gene therapy vector containing nucleotide sequence(s) coding for the compound or combination according to the disclosure, for use in the prevention or treatment of a condition characterized by chronic pain, neuro-inflammation and/or neuro-degeneration.

Preferably said condition is further characterized by visceral or non-visceral nociceptive pain, peripheral or central neuropathic pain, or mixed nociceptive-neuropathic pain, neuro- inflammation, and/or neuro-degeneration.

Alternatively, said condition is selected from the group consisting of post-operative orthopedic surgery pain, musculoskeletal pain, irritable bowel syndrome, inflammatory bowel disease, rheumatoid arthritis, ankylosing spondylitis, post-herpetic neuralgia, trigeminal neuralgia, post-traumatic or post-operative peripheral neuropathy, diabetic peripheral neuropathy, inflammatory peripheral neuropathy, HIV-associated neuropathy, painful peripheral neuropathy, nerve entrapment syndrome, chemotherapy-associated pain, chemotherapy- induced allodynia, complex regional pain syndrome, post-spinal injury pain, post-stroke pain, multiple sclerosis, chronic widespread pain, low back pain, osteoarthritis, cancer pain, chronic visceral pain, fibromyalgia, polymyalgia rheumatica, In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one", Brief description of the figures related to the invention

Figure 1. Cytokine-receptors of IL-10, IL-4, IL-13, and TGFB1/2 are expressed in the dorsal root ganglia of human and mouse. To evaluate whether cytokine receptors targeted by fusion proteins of the present invention are expressed by the sensory system, RNAseq data of receptors for IL-10, IL-4, IL-13, and TGFB1/2 in the dorsal root ganglia and spinal cord were extracted from the data base by Ray et al. (Pain 2018;159:1325-1345) as available on hitps haw. utdallas. edu/bbs/painneurosciencelan/sensoryomics/dratxome/?go. RNA sequencing data are expressed as transcripts per million. For comparison, data for expression of the receptors in whole blood are also given.

Figure 2: IL4 and IL10 receptors expressed in sensory neurons are required for analgesia induced by cross-linking IL4R and IL10R. (A) Expression of IL4Ra (left) and IL10Ra (right) in murine dorsal root ganglia. Persistent inflammatory pain was induced by an intraplantar injection of 20 pl of 2% carrageenan (CAR). At days 3, 4 and 5 after intraplantar injection of carrageenan, mice received intrathecal injections of mismatch (mm) or IL4R antisense oligodeoxynucleotides (asODN).At day 6 the dorsal root ganglia were obtained and analysed. (B) Expression of IL4R mRNA (left panel, n=13-18) and protein (right panel, n=4) in the DRG of IL4R asODN treated mice. IL4Ra mRNA levels were measured with QPCR and corrected for housekeeping genes (actin, GAPDH and HPRT). Protein expression was determined by quantifying IL4Ra immunofluorescent staining intensity. As a receptor cross-linking compound IL4-IL10 fusion protein was used. Six days after carrageenan administration mice received an intrathecal injection of 1 pg IL4-10 fusion protein (n=5) and (C) thermal and {D) mechanical sensitivity was followed over time using Hargreaves and Von Frey test, respectively. Right bar graphs represent the analgesic effects of IL4-10 determined as area under the curve (AUC) between 1 and 24 hours after intrathecal injection. (E) Immunofluorescence staining for IL10R expression in DRGs from wild type (WT, left) or Nav1.8-IL10R" (right) mice. At six days after induction of persistent inflammatory pain WT mice and Nay1.8-IL10R* mice received an intrathecal injection of 1 ug IL4-10 fusion protein (n=13-14) and (F) thermal and (G) mechanical sensitivity was followed over time using Hargreaves or Von Frey test, respectively. Right bar graphs represent the analgesic effects of IL4-10 fusion protein determined as area under the curve (AUC) for the effect of IL4-10 fusion protein between 1 and 72 hours after intrathecal injection. Data is represented as mean + SEM. *, **, ™ = p<0.05, p<0.01, and 0.001, respectively.

Figure 3: IL4Ra and IL10Ra in sensory neurons are both required for full analgesic effects of IL4-10 fusion protein. Inflammatory pain was induced by an intraplantar injection of 20 pl of 2% carrageenan in wild type (WT) mice or Nay1.8-IL10R™". At days 3, 4 and 5 after intraplantar injection mice received intrathecal injections of mismatched (mm) or IL4R antisense oligodeoxynucleotides (ODN). Six days after intraplantar injection mice received an intrathecal injection of 1 ug IL4-10 fusion protein to cross-link IL4Ra and IL10Ra (n=5 per group) and (A) thermal and (B) mechanical sensitivity was followed over time using Hargreaves or Von Frey tests, respectively. Right bar graphs represent the analgesic effects of IL4-10 fusion protein determined as area under the curve (AUC) between 1 and 24 hours after intrathecal injection. (C) Quantification of the total number of c-Fos positive neurons in laminae IHII of the spinal cord 24 hours after IL4-10 application. Right top panel: example c- Fos staining of the superficial dorsal horn of the spinal cord. Right bottom panels: representative pictures of c-Fos staining of the dorsal horn of naive (i), carrageenan-injected vehicle-treated WT mice (ii), carrageenan-injected IL4-10-treated WT mice (iii) and carrageenan-injected IL4R asODN and IL4-10-treated Nav1.8-IL1O0R" mice (iv) (n=4-6 per group). Data is represented as mean + SEM. *, **, *** = p<0.05. 0.01, and 0.001, respectively. Figure 4. Crosslinking IL4R and IL13R relieves chemotherapy-induced persistent mechanical allodynia. (A). Paclitaxel (8 mg/kg) was administered intraperitoneally to C57BL/6 mice on days 0, 2, 4 and 6 (grey symbols on the X-axis) to induce persistent chemotherapy-induced polyneuropathy. IL4-13 fusion protein (0.3 [open circle], 1 [open triangle] or 3 pg/mouse [open square]; n=4/group) or vehicle (n=4) was administered intrathecally at day 8, and the course of mechanical allodynia was followed over time using von Frey hairs. Data is represented as mean + SEM. Statistics of the data were analysed with two-way ANOVA followed by Tukey's multiple comparisons test. *, **, *** = p<0.05, p<0.01, and 0.001, 0.3 ug IL4/IL13 fusion protein versus vehicle respectively. &, && = p<0.05, p<0.01 respectively, 3 ug IL4/IL 13 fusion protein versus vehicle. x = p<0.05, 1 ug IL4/IL13 fusion protein versus vehicle. B. On day 15, the length of intraepidermal nerve fibers in the paw skin was determined upon immunofluorescent visualization with the neuronal marker PGP9.5. The data of mice not treated with chemotherapeutic drug (black bar; n=4), or injected with paclitaxel and subsequently treated with vehicle (- ; n=6) or IL4/IL3 fusion protein (IL4-13; n=4), are shown. C. Oxaliplatin (3 mg/kg) was daily injected intraperitoneally in mice for 5 days followed by 5 days no treatment and another 5 days of an oxaliplatin treatment cycle (grey symbols on X-axis). On the day after the last oxaliplatin injection animals received an intrathecal injection of IL4/IL13 fusion protein (0.3 ug; open circles, n=4) or the wild-type cytokines (0.15 ug; n=4, rectangles for IL4 and triangles for IL13); or vehicle only (closed circles). Pain was measured with von Frey test.

Figure 5: Cross-linking of IL4R and IL10R inhibits inflammatory mediator-induced sensitization of sensory neurons. Fura-2 loaded primary sensory neurons were stimulated with 30 nM capsaicin and Ca?* influx was measured as the ratio of F340/F380 normalized to basal levels. Sensory neurons were stimulated overnight with (A) TNFa (50 ng/ml, n=157- 244) or (B) PGE2 (1 uM, n=119-188) in the absence or presence of the IL4-10 fusion protein (100 ng/ml, 3nM). Total calcium fluxes were quantified by determining the maximal amplitude (B, E) of capsaicin-evoked Ca2+ responses (applied at time point 1 minute) and the area under curve (AUC; C, F) of capsaicin-evoked Ca?* influx over 5 minutes. (G) Sensory neurons were stimulated overnight with TNFa (50 ng/ml) and IL4-10 fusion protein (100 ng/ml) in the presence of receptor-blocking antibodies (2 ug/ml) against the IL4 receptor (alL4R) and the IL10 receptor (alLL10R). Inhibition of TNFa-sensitization was measured as percentage of AUC of capsaicin-evoked Ca?* response over 5 minutes. Asterisks represent significant differences compared to the TNFa-sensitized neuronal response. (n=51-164) (H, I) Sensory neurons were stimulated overnight with TNFa (50 ng/ml) in combination with different concentrations (0.6, 6 and 60 nM) of IL4-10 fusion protein or equimolar doses of the combination of both recombinant cytokines. Inhibition of TNFa-sensitization was measured as the percentage of the (H) amplitude or (I) AUC of capsaicin-evoked Ca?* response over 5 minutes (n=107-244).

Data is represented as mean + SEM. *, **, ***= p<0.05, 0.01 and 0.001, respectively (n=51- 244 from at least 3 different cultures). Figure 6. Cross-linking of IL4R and IL13R is required to protect cultured neurons against oxaliplatin-induced damage. Primary sensory neurons were cultured and treated overnight with oxaliplatin (5 ug/ml). Neuronal damage was then quantified by measuring the neurite length upon B3-tubulin staining. Vehicle (-) or IL4/IL 13 fusion protein or the combination of IL4 and IL13 (IL4+1L13) were added at equimolar concentrations during incubation with the chemotherapeutic drug. Neurons cultured in absence of oxaliplatin and cytokines are shown for comparison (black bar).

Figure 7: IL4-10 fusion protein induces heterologous receptor clustering in sensory neurons. Cultured sensory neurons were treated for 15 minutes with 1L4-10 fusion protein (100 ng/ml; right column), the combination of IL4 and IL10 (50 ng/ml each; middle column) or vehicle (left column). After fixation, a proximity ligation assay (PLA) for IL4R and IL10R was performed (red) and combined with immunofluorescent staining for anti-BIll-tubulin to identify sensory neurons (green). Presence of red fluorescence indicates that IL4R and IL10R are at less than 51 nm in proximity to each other. Figure 8. Kinome activity profile in the DRG of mice with chronic pain after cross-linking IL4R and IL10R with a fusion protein. Mice received an intraplantar injection of 20ul of 2% carrageenan and 6 days later received an intrathecal injection with either vehicle, the combination of IL4+IL10 (0.5 ug each), or ILAR-IL10R cross-linking compound, i.e., IL4-10 fusion protein (1 pg). One hour after intrathecal injection DRGs were isolated and DRG homogenates were subjected to PAMGENE analysis. (A-D) List of peptides from the PAM chips which are differentially regulated based on one-way ANOVA analysis.

Blue colour indicates diminished phosphorylation of peptide substrates, and red colour indicates increased phosphorylation of peptides in DRG lysates of IL4-IL10-treated mice compared to those treated with IL4+IL10. Black color indicates no significant changes. (NB) Peptides that are significantly different in the PTK chip. (A) List of peptides differentially regulated between IL4-10 and IL4+IL10-treated animals compared to control-treated animals. (B) List of peptides differentially regulated between IL4-10-treated animals compared to IL4+IL10 treated animals. (C/D) Peptides that are significantly differently phosphorylated in the STK chip compared to vehicle. (C) List of peptides differentially regulated between IL4-10 and IL4+IL10 treated animals compared to control-treated animals. (D) List of peptides differentially regulated between IL4- 10-treated animals and IL4+IL10 treated animals. (E) Predicted upstream kinases that can be inferred from the peptide substrates differentially phosphorylatedon the PAM chips.

Unpaired t-test comparison between samples from IL4-10-treated animals compared to IL4+IL10-treated animals (n=5 animals per group). (lllustration reproduced courtesy of Cell Signaling Technology, Inc, (http:/fwww. gelisignal.com)). (F) Enriched GeneGo process pathway analysis based on peptides that were significantly differentially phosphorylated after t-test comparison between IL4-10 and IL4+IL10-treated animals.

The height of the histogram corresponds to the p-values of signalling pathways that are significantly enriched by differentially phosphorylated peptides.

Figure 9. Transcriptome analysis of the DRG after intrathecal injection of IL4-10 Persistent inflammatory pain was induced by an intraplantar injection of 20u of 2% carrageenan.

Six days later mice received an intrathecal injection of vehicle (control), IL4+IL10 (0.5 ug each) or IL4-10 fusion protein (1ug). Six hours after intrathecal injection, lumbar DRGs (L3-L5) were isolated and subjected to RNA-sequencing. (A) Principal component analysis (PCA) of the differentially expressed genes in all pair-wise comparisons of different animal. (B) Hierarchical clustering heat map of the expression levels of the top 500 differentially expressed genes (based on adjusted p-values). (C) Venn diagram showing the number of differentially expressed genes in IL4-10 fusion protein or IL4+IL10 treated animals compared to vehicle- treated animals. (D) The volcano plot shows the adjusted p-values and fold changes for all transcripts in IL4+IL10-treated mice compared to IL4-10-treated mice.

Differential expression of genes (FDR corrected p-value < 0.05 shown in red) was determined using DESeq2 package in R. (E) Top 25 pathway analysis of genes differentially regulated between IL4-10 fusion protein and the combination of IL4+IL10 (https:/ftoppgene.cchmc.org/).

EXAMPLE To improve the therapeutic potency of regulatory cytokines such as IL4, IL10 and IL13, the present invention discloses that unique signalling of intracellular processes is induced by crosslinking of receptors for these regulatory cytokines and that this unique signalling in cells in the dorsal root ganglia and the dorsal horn of the spinal cord results in an unprecedented analgesic effect.

Moreover, the present invention provides several compounds that can be used to crosslink regulatory cytokine receptors to induce such a unique cell signalling, which can be used as a medicament to treat chronic pain, and neuro-inflammatory and neurodegenerative conditions.

These compounds include genetically engineered bispecific antibody that binds to two different receptors for regulatory cytokines, such as the IL4 receptor (IL4R) and the IL10 receptor (IL10R), or the IL4R and the IL13 receptor (IL13R). Such bispecific antibodies have potent analgesic effects — surprisingly they inhibit chronic pain more effectively than the mere sum of the combination of the two cytokine moieties.

Moreover, injection of the anti-IL4R- IL10R bispecific antibody or anti-IL4R-IL13R bispecific antibody may completely resolve chronic pain in animal models, In order to understand how a bispecific antibody against regulatory cytokine receptors exert its unique analgesic and neuroprotective effects, the inventors considered the mechanisms of action of a fusion protein that binds to both IL4R and IL10R and displays potent analgesic properties.

Similarly, they analysed the potency and mechanisms of a fusion protein that binds to both IL4R and IL13R and which has superior analgesic activity compared to the combination of wild-type IL4 and IL10. To that end, the inventors looked at the way in which cross-linking of IL4R and IL10R may transduce signals to the sensory nervous system.

The inventors envisage that the superior analgesic effects resulting from cross-linking IL4R and IL10R result from a unique signalling process that has a unique effect on pain resolving pathways in sensory neurons.

To confirm the general applicability of cross-linking of regulatory cytokine receptors as a therapeutic approach for chronic pain, neuroinflammation and neuro- degeneration, the inventors also evaluated the effects of cross-linking IL4 and IL13 receptors.

Materials and methods Animals All animal experiments are performed in accordance with international guidelines and with prior approval from the University Medical Center Utrecht experimental animal committee.

Experiments were conducted using both male and female mice, all of which were between 8- 14 weeks old when tested. Observers who performed the behavioral experiments were blind to the mouse genotype and treatment. The following mice were used: wild type (WT) C57BL/6 mice (Envigo, The Netherlands). For generation of nociceptor-specific IL10R knockout mouse strains we used the Cre-loxP system (Sauer B & Henderson N (1988) Site-specific DNA recombination in mammalian cells by the Cre recombinase of bacteriophage P1. Proc Natl Acad Sci U S A 85(14):5166-5170). Floxed IL10R mice (Pils MC, et al. (2010) Monocytes/ macrophages and/or neutrophils are the target of IL-10 in the LPS endotoxemia model. Eur J Immunol 40(2):443-448) were crossed with Na,1.8-Cre mice (Nassar MA, et al. (2004) Nociceptor-specific gene deletion reveals a major role for Nav1.7 (PN1) in acute and inflammatory pain. Proc Natl Acad Sci U S A 101(34):12706-12711) in which Cre expression is driven by the Na,1.8 promoter that is expressed in >90% of nociceptors (Shields SD, et al. (2012) Nav1.8 expression is not restricted to nociceptors in mouse peripheral nervous system. Pain 153(10):2017-2030).

Hyperalgesia models Mice received an intraplantar injection of 20 pl A-carrageenan (2% (w/v), Sigma-Aldrich) dissolved in saline solution (NaCl 0.9 %) in both hind paws. To induce transient chemotherapy- induced polyneuropathy (CIPN), paclitaxel (2 mg/kg, Cayman Chemical Company) was injected intraperitoneally on days O and 2. To induce persistent paclitaxel-induced CIPN paclitaxel (8 mg/kg, Cayman Chemical Company) was injected intraperitoneal on day 0, 2, 4 and 6. To induce persistent oxaliplatin-induced polyneuropathy, mice received two treatment cycles, each consisting of 5 daily intraperitoneal injections of 3 mg/kg oxaliplatin (Tocris) with a 5 days free interval.

To induce transient chemotherapy-induced polyneuropathy (CIPN), paclitaxel (2 mg/kg, Cayman Chemical Company) was injected intraperitoneally on days 0 and 2. To induce persistent paclitaxel-induced CIPN paclitaxel (8 mg/kg, Cayman Chemical Company) was injected intraperitoneal on day 0, 2, 4 and 6. To induce persistent oxaliplatin-induced polyneuropathy, mice received two treatment cycles, each consisting of 5 daily intraperitoneal injections of 3 mg/kg oxaliplatin (Tocris) with a 5 days free interval.

Thermal hyperalgesia was assessed by determining the heat withdrawal latency times using the Hargreaves test (IITC Life Science) (Hargreaves K, Dubner R, Brown F, Flores C, & Joris J (1988) A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32(1):77-88). Mechanical thresholds were determined using the von Frey test with the up-and-down method (Chaplan SR, Bach FW, Pogrel JW, Chung JM, & Yaksh TL (1994) Quantitative assessment of tactile allodynia in the rat paw. J Neurosci Methods 53(1):55- 63). All experimenters were blind to genotype and/or treatment.

Drugs & administration IL4-10 protein was produced in HEK293 cells and purified as described previously (Eijkelkamp N, et al. (2016) IL4-10 Fusion Protein Is a Novel Drug to Treat Persistent Inflammatory Pain. J Neurosci 36(28):7353-7363). Similarly, a fusion protein of IL4and IL13 (IL4-13) was produced. 1L4-10 and IL4-13 fusion protein concentrations were determined based on IL10 ELISA (IL4 Pelipair ELISA kit, Sanquin; IL13 and IL10, DuoSet ELISAs, R&D Systems), as well as on Bicinchoninic Acid Protein Assay (BCA Pierce Protein Assay Kit, ThermoFisher Scientific).

Intrathecal (i.t.) injections of different compounds (5 ul/mouse) were performed as described before (Eijkelkamp N, et al. (2010) GRK2: a novel cell-specific regulator of severity and duration of inflammatory pain. J Neurosci 30(6):2138-2149) under light isoflurane/O2 anaesthesia. The IL4-10 fusion protein (1 pg/mouse) or equimolar doses of recombinant human IL4 and IL10 (Sigma) were injected intrathecally at day 6 after intraplantar A-carrageenan injection.

IL4Ra expression in sensory neurons was knocked down by intrathecal injections of antisense oligodeoxynucleotides (asODN) directed against IL4Ra mRNA (Ripple MJ, et al.

(2010) Immunomodulation with IL-4R alpha antisense oligonucleotide prevents respiratory syncytial virus-mediated pulmonary disease. J Immunol 185:4804-4811). This approach has been shown to successfully inhibit the expression of several proteins in dorsal root ganglia (DRG) neurons (Stone LS & Vulchanova L (2003) The pain of antisense: in vivo application of antisense oligonucleotides for functional genomics in pain and analgesia. Adv Drug Deliv Rev 55(8):1081-1112). AsODN were dissolved in saline (15 pg per 5 pl) and injected intrathecally at day 3, 4 and 5 after intraplantar A-carrageenan injection. ASODN had a phosphorothioate backbone. The following ODN were used: Mismatch ODN (mmODN): TGGAAAGGCTTATACCCCTC (SEQ ID NO:1); ILAR asODN: CCGCTGTTCTCAGGTGACAT (SEQ ID NO:2).

Tissue preparation & immunochemistry Mice were deeply anaesthetised with an injection of pentobarbital (60 mg/kg; intraperitoneal) and transcardially perfused with Phosphate-buffered saline (PBS; 140 mM NaClz, 20 mM Na2HPO,, 2.4 mM NaH2PO,4) followed by 4% paraformaldehyde (PFA) in PBS (Klinipath).

Lumbar DRGs and spinal cords (lumbar L3-L5 section) were isolated and postfixed in 4% PFA cryoprotected in sucrose, and embedded and frozen in optimal cutting temperature (OCT) compound (Tissue-Tek, Sakura). For IL4R and IL10R stainings, DRGs were directly frozen in OCT without prior fixation. Spinal cords and DRGs were cut in 20 um and 10 pm thick sections respectively using a cryostat (CM 3050S; Leica). Sections were collected on SuperFrost plus microscope slides (VWR International).

IL4R and IL10R: Sections were fixed with 10% neutral buffer formalin for 10 min and incubated in PBS containing 0.3% Triton X-100 (PBS-T) and 5% normal donkey serum (NDS)). Cultured primary sensory neurons were fixed with 4% PFA for 10 minutes and incubated in PBS containing 0.05 % Tween-20, 1% bovine serum albumin (BSA) and 5% NDS). Sections and cells were incubated overnight at 4°C with rabbit anti-IL4Ra (sc-686, Santa Cruz; 1:100), rabbit anti-IL10Ra (sc-985, Santa Cruz; 1:100), mouse anti-Neurofilament 200 (NO142, Sigma;

1.500), mouse anti-Peripherin (MAB1527, Millipore; 1:100) or Isolectin B4 (B1205,Vector; 1:50) diluted in antibody diluent (PBS-T with 2% BSA). Subsequently, sections were incubated with alexafluor 488- or 594-conjugated secondary antibodies (Thermofisher, 1:1000) followed by DAPI (1:1000, Sigma) staining before sections were mounted on slides with FluorSave reagent (Millipore).

For staining of c-Fos, a marker for neuronal activation, we performed a colorimetric staining as described previously (64) with some modifications. Serial spinal cord sections were incubated in PBS-T containing 0.1% BSA and 2% NDS. Subsequently, sections were incubated with rabbit anti c-Fos (sc-52, Santa Cruz; 1:500) overnight at 4°C. After washing, sections were incubated with Biotin SP conjugated donkey anti+abbit IgG (1:250, Jackson IR Laboratories) for 90 minutes. Subsequently, sections were incubated with Vector ABC-Elite (1:50, Vector Laboratories) for 90 minutes. Thereafter, sections were developed with diaminobenzidine (DAB)-Nikel solution (0.05M Tris HCI pH 7.6; 3mg/ml (NH4):Ni(SO4)2; 25mg/ml DAB (1:100, Sigma), hydrogen peroxide (0.1ul/ml). Finally, the sections were dehydrated and mounted with DePeX (Serva).

Images were taken using a Zeiss Axio Lab A1 (Zeiss). Pictures were analysed with ImageJ (NIH).

Culture of DRG neurons DRGs were cultured as described previously (Eijkelkamp N, et al. (2013) A role for Piezo2 in EPAC1-dependent mechanical allodynia. Nat Commun 4.1682). Briefly, DRGs were dissected and placed on ice-cold dissection medium (HBSS w/o Ca?" and Mg?*, 5mM HEPES, and 10mM glucose). After dissection, axons were cut and dissection medium was replaced by filtered enzyme mix (HBSS w/o Ca?* and Mg?*, 5mM HEPES, 10mM glucose, 5mg/ml collagenase type XI (Sigma), and 10mg/ml Dispase (Gibco)). The DRGs were incubated in enzyme mix for 30 minutes at 37°C and 5% CO.. Subsequently, enzyme mix was inactivated with heat-inactivated foetal bovine serum (FBS, Sigma). Cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% FBS (Gibco), 2 mmol/L glutamine (Gibco), 10,000 IU/ ml penicillin- streptomycin (Gibco) on poly-L-lysine (0.01 mg/ml, Sigma) and laminin (0.02 mg/ml, Sigma) - coated glass coverslips in a 5% CO: incubator at 37°C. Cells were used the following 1-2 days.

Tu evaluate the effect of cross-linking 1L4R, IL10R and IL13R on the damage to neurons induced by chemotherapeutic drugs, cells were incubated in 24 wells plates for 24 hours in presence of paclitaxel (1 uM) or oxaliplatin (5 ug/ml) to induce neurotoxicity. IL4-10 fusion protein (100 ng/mL), IL4-13 fusion protein (100 ng/mL), IL4 an IL13 (50 ng/mL each), IL4 (50 ng/mL), IL10 (50 ng/mL), and IL13 (50 ng/mL.) were added together with the chemotherapeutic agent. As controls cells were also cultured in absence of chemotherapeutic drugs or cytokines, and in presence of chemotherapeutic drugs only. After fixation with 4% paraformaldehyde, cells were stained with rabbit anti-mouse Billl-tubulin (ab18207, 1:1000; Abcam). Neurites were visualized with a Zeiss Axio Lab A1 microscope (Zeiss — Oberkochen, Germany) and using a random sampling method, at least 10 images per glass slide were made at a magnification of 10x. The length of neurites was measured with the ImageJ plugin Simple Neurite Tracer76.

The averages of neurite length per neuron for a minimum of five neurons per condition were compared between groups for the three individual primary sensory cultures.

Calcium imaging DRG neurons used for calcium imaging experiments were stimulated overnight with TNFa (50 ng/ml, Peprotech) with or without the IL4-10 fusion protein (100 ng/ml; 3 nM), recombinant IL4 and IL10 (50 ng/ml each; 3.3 and 2.9 nm, respectively) and/or receptor blocking antibodies targeted against mouse IL4R or IL10R (2ug/ml, BD pharmingen).

To measure changes in the capsaicin-evoked calcium response, cells were loaded with 5uM Fura-2-AM (Invitrogen) for 25 minutes in 140mM NaCl, 4mM KCI, 1mM MgCl., 2mM CaCls, 10mM HEPES, and 10mM Glucose; pH 7.4. Cells were excited at 340 and 380 nm wavelengths and fluorescence was collected every 3 seconds at 510 nm using an Axio Observer A1 inverted microscope (X20 objective, Zeiss). The ratio 340/380 is directly correlated with the amount of intracellular calcium.

Recordings were performed as previously described (66) with some modifications. Briefly, every experiment included a 5 minutes baseline measurement followed by a stimulation of the cells by superfusion with capsaicin (0.03 uM) for 21 seconds followed by superfusion of medium. A subsequent 5 minutes of superfusion with high K*-buffer (4mM NaCl, 140mM KCI, 1mM MgCl, 2mM CaCl,, 10mM HEPES, and 10mM Glucose; pH 7.4) was added at the end of each experiment to depolarize the neurons to confirm cell viability and functionality.

RNA extraction and quantitative PCR Lumbar DRGs were homogenized using TRIzol (Invitrogen). Total RNA was extracted using the RNeasy Mini Kit (Qiagen) and 1 jg of total RNA was used to synthesize cDNA. cDNA was synthesized using SuperScript reverse transcriptase (Invitrogen). RNA concentrations were determined using a NanoDrop 2000 (Thermo Scientific).

The real-time PCR reaction using SYBRgreen master mix (BioRad) was performed on an iQ5 Real-Time PCR Detection System (BioRad). Primers used for qPCR are listed in table 1. The MRNA expression levels were normalized for GAPDH, HRPT and actin.

Table 1: List of primers used Gene Forward Reverse GAPDH 5-TGAAGCAGGCATCTGAGGG-3' 5-CGAAGGTGGAAGAGTGGGAG-3’ (SEQ ID NO:3) (SEQ ID NO:4) HRPT 5-TCCTCCTCAGACCGCTTTT-3 5-CCTGGTTCATCATCGCTAATC-3' (SEQ ID NO:5) (SEQ ID NO:6) Actin 5-GATGCACAGTAGGTCTAAGTGGAG-3 5-CACTCAGGGCAGGTGAAACT-3’ (SEQ ID NO:7) (SEQ ID NO:8) IL4RA 5-TCTGCATCCCGTTGTTTTGC-3 5-GCACCTGTGCATCCTGAATG-3 (SEQ ID NO:9) (SEQ ID NO:10) In situ Proximity Ligation Assay (PLA) IL4Ra antibody was labelled to thiol-MINUS-oligo with the dual-crosslinker sulfo-SMCC (ThermoFisher). IL10Ra antibody was labelled with biotin using EZ-Link™ Sulfo-NHS-LC-Biotin SMCC (ThermoFischer). The Biotin-PLUS-probe was later bound to the antibody with streptavidin, Primary DRG cultures were treated with IL4-10 fusion protein (100 ng/ml; 3 nM) or the combination of IL4 and IL10 (50 ng/ml each; 3.3 and 2.9 nM, respectively) for 15 minutes and fixed with 4% PFA for 10 minutes.

In situ PLA was performed as described (Soderberg O, et al. (2008) Characterizing proteins and their interactions in cells and tissues using the in situ proximity ligation assay.

Methods 45(3):227-232) with some modifications.

Samples were blocked with blocking buffer (PBS containing 0.05% Tween-20, 1% BSA and polyA 1:100). Subsequently, samples were incubated overnight at 4°C with the following antibodies: MINUS probe-labelled rabbit-anti IL4Ra and biotin-labelled rabbit-anti-IL10Ra.

For controls biotin- labelled rat anti-CD200 (Serotec) was used instead of anti-IL10Ra antibody.

Next, samples were incubated with streptavidin (5 pg/ml) for 25 minutes at room temperature and incubated with biotin linked to a PLUS probe for 30 minutes at room temperature.

T4 DNA ligase (5 Weis units/pl) and the circle and linker probes were added (in the presence of 0.1M DTT and 3 mM ATP) and incubated at 37°C for 50 minutes in PHI buffer (50 mM Tris-HCI, 10 mM MgCl, 10 mM (NH4)2S04, pH 7,5+0,05% Tween20). After washing, samples were incubated with PHI polymerase (kindly donated by Toshiro Kobori), in the presence of 1 mM dNTPs and 0.1 M DTT for 90 minutes at 32°C.

Next, samples were stained with antibody against BllI-tubulin, to stain neurons, for 1 hour at RT.

After washing, samples were incubated with Cy5-oligonucleotide probe to label amplified DNA and secondary anti-rabbit antibody conjugated with Alexa488. For the minimal (Min) and Maximal (Max) staining control only MINUS probe antibodies were used and the incubation with streptavidin was skipped. For the Max control Biotin-PLUS was added after the ligase incubation. Images were taken using a Zeiss LSM confocal microscope (Zeiss). Kinase Activity Profiling Lumbar DRGs were homogenized using M-PER mammalian Extraction buffer (Pierce) supplemented with phosphatase and protease inhibitor cocktails (Pierce). Protein concentration was determined using the Bradford assay (Bio-Rad). Kinase activity profiling was performed using the Tyrosine Kinase PamChip® (PTK) Array and the Serine/Threonine Kinase PamChip® (STK) Array for Pamstation®12 (PamGene International B.V.). For the PTK arrays

7.5 ug of protein lysate per array were used while for the STK Arrays 2 ug of protein lysate per array were used. Image quantification and statistical analysis were performed using BioNavigator® Software (PamGene International B.V.). Upstream kinase analysis was performed using BioNavigator® Software with peptide-kinase mapping using Kinexus phosphonet enrichment files (hitp//www.phosphonst.cal). Kinome tree illustration was constructed using data from the interactive PamGene BioNaviagor Upstream Kinase Tool (htip:/wwwkinhub org/kinmap/index.himi). For pathway analyses peptides found to be significantly differentially phosphorilated (p < 0.05) between IL4-10 and the combination of the individual cytokines were subjected to pathway analysis using the GeneGo pathway analysis package RNA sequencing RNA libraries were prepared with the poly A selection method followed by multiplexing and sequencing on the lllumina NextSeq500® platform in a 1 x 75bp single-read and 350 million reads per lane (Utrecht Sequencing Facility). All samples passed the read quality checks performed using FastQC (Andrews S (2010) FastQC: a quality control tool for high throughput sequence data. Available online at: http. bicinformatics. babraham, sc.uk/projects/fasige.). The sequencing reads from each sample were aligned to the recent reference human genome GRCh38 build 79 assembly from Ensembl (Genome Reference Consortium Human Build 38) using STAR aligner (Cunningham F, et al. (2015) Ensembl 2015. Nucleic Acids Res 43(Database issue):D662- 669; Anders S, Pyl PT, & Huber W (2015) HTSeg--a Python framework to work with high- throughput sequencing data. Bioinformatics 31(2):166-169). Gene expression data for the annotated genes was generated using HTSeq-count (Anders S, Pyl PT, & Huber W (2015) HTSeg--a Python framework to work with high-throughput sequencing data. Bioinformatics 31(2):166-169). The samples exhibited batch effect due to different days of isolation and library preparation. The batch effect was corrected using R package RUVSeq (Risso D, Ngai

J, Speed TP, & Dudoit S (2014) Normalization of RNA-seq data using factor analysis of control genes or samples. Nat Biotechnol 32(9):896-90). Differential gene expression analysis and variance-stabilizing transformation (to obtain normalized read counts) were performed using R/Bioconductor package DESeq2 (Love MI, Huber W, & Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15(12):550).

RESULTS Expression of receptors for regulatory cytokines by sensory neurons and glial cells in the dorsal ganglia and spinal cord.

To identify whether sensory neurons are able to respond to regulatory cytokines, it was analyzed which receptors for regulatory cytokines are expressed by sensory neurons and glial cells. RNAseq data of receptors for IL-19, IL-4, IL-13, and TGFB1/2 in the dorsal root ganglia and spinal cord were extracted from the data base by Ray et al. (Pain 2018;159:1325- 1345) as available on https//www‚utdallas edu/bbs/painneurosciencelat/sensoryomics/drgtxome/7go. RNA sequencing revealed expression of receptors for IL-10, IL-4, IL-13, TGFB1 and TGFB2 in the dorsal root ganglia and spinal cord of human and mouse (Figure 1; data are expressed as transcripts per million).

Next, expression of the alpha chain of both cytokine receptors, IL4R (IL4Ra) and IL10R (IL10Ra) in vivo in mice was studied. IL10Ra was expressed in almost all sensory neurons of the DRG, whilst IL4Ra is expressed in subsets of sensory neurons in the DRG (Figure 2A). In culture, both IL4Ra and IL10Ra are expressed in NF200-, peripherin-expressing neurons and non-peptidergic IB4+ neurons, often by the same cells.

Cross-linking regulatory cytokine receptors in dorsal root ganglion and spinal cord results in a potent analgesic effect.

Intrathecal administration is a well-known method to deliver drugs and other compounds in the direct environment of cells in the dorsal root ganglion and spinal cord. To test the requirement of IL4Ra expression by sensory neurons for the analgesic activity of IL4R-IL10R cross-linking compound, the inventors used intrathecal administration of antisense oligodeoxynucleotides (asODN) targeting IL4Ra mRNA. Three daily intrathecal injections of IL4Ra asODN significantly reduced IL4Ra mRNA and protein expression in the DRG by ~70% compared to mismatched (mm) ODN-treated animals (Figure 2B). IL4-10 fusion protein was used to cross-link IL4R and IL10R. Intrathecal injection of IL4-IL10 fusion protein (1 ng) at 6 days after the induction of persistent inflammatory pain completely inhibited carrageenan induced mechanical and thermal hyperalgesia in mice treated with mmODN confirming the potent analgesic properties of crosslinking IL4R and IL10R. It is to be noted that cross linking

IL4R and IL10R may not completely abolish ability to detect sensory stimuli, but rather normalizes aberrant pain sensation . IL4Ra knockdown in the DRG markedly reduced the analgesic effect of the IL4R-IL10R cross-linking compound compared to animals treated with mmODN (Figure 2C and 2D). Knockdown of IL4Ra during established carrageenan-induced hyperalgesia did not affect the magnitude of mechanical hypersensitivity.

Nav1.8+ sensory neurons mediate inflammatory pain (Abrahamsen et al Science. 2008 Aug 1;321(5889):702-5). To identify the role of IL10Ra expression in the analgesic properties of the IL4R-IL10R cross-linking compound, IL10Ra was selectively ablated in Nav1.8+ neurons (Figure 2E). The course of carrageenan-induced persistent inflammatory hyperalgesia was indistinguishable between wild-type and Nav1.8-IL10R™ animals.

Intrathecal injection of the IL4R-IL10R crosslinking compound (1 ug) at day 6 after induction of inflammatory pain attenuated thermal and mechanical hyperalgesia in wild type animals (Figure 2F and 2G). In contrast, deletion of IL10Ra in Nav1.8+ nociceptors partially ablated the analgesic effect of the IL4R-IL10R cross-linking compound (Figure 2F and 2G), indicating that nociceptor IL10Ra may be required in part for the pain inhibiting effects of IL4R-IL10R cross-linking compound.

Since both receptors are required for full analgesic effect of cross-linking IL4R and IL10R, the inventors next considered if ablation of both receptors in sensory neurons would completely prevent the analgesic actions of the IL4R-IL10R cross-linking compound.

To that end, IL4R expression was knocked down in Nav1.8-IL10R-/- mice with intrathecal IL4Ra asODN injections.

Knockdown of both IL4Ra and IL10Ra itself does not affect the course of persistent inflammatory pain.

Importantly, knockdown of both IL4Ra and IL10Ra expression in the DRGs completely prevented resolution of pain by the IL4R-IL10R cross-linking compound (Figures 3A-D). An increase of spinal immediate-early gene c-Fos expression can be used as a proxy of spinal neuronal activation in the dorsal horn of the spinal cord.

At day 7 after intraplantar carrageenan injection the number of c-Fos positive neurons in the superficial layers of the dorsal horn was significantly increased compared to naive animals (Figure 3C). Intrathecal administration of 1L4-10 fusion protein significantly reduces the number of dorsal horn spinal cord c-Fos positive neurons.

Knockdown of IL4Ra and IL10Ra in sensory neurons completely prevents IL4R-IL10R cross linking compound mediated attenuation of the c-Fos expression (Figure 3C). Overall this indicates that both IL4Ra and IL10Ra in sensory neurons are required for the full inhibition of persistent inflammatory pain resulting from cross-linking IL4R and IL10R.

The potential of cross-linking IL4R and IL13R to inhibit pain was investigated in chemotherapy- induced neuropathy models. Mice received 4 injections of paclitaxel (8 mg/kg) every other day from day O to 6. Paclitaxel induced mechanical hyperalgesia that started on the first day after the first injection and that persisted at least 3 weeks after chemotherapy-treatment was stopped. Two days after the last paclitaxel injection, mice were injected intrathecally with 3 different doses of IL4-13 fusion protein (0.3, 1 and 3 ug/mouse) to cross-link IL4R and IL13R on cells in the dorsal root ganglion and the spinal cord (Figure 4A). An almost normalization of mechanical hyperalgesia lasting for at least a week was observed, demonstrating the potential of cross-linking IL4R and IL13R for long-lasting resolution of chemotherapy-induced polyneuropathy. Importantly, cross-linking IL4R and IL13R also reduced paclitaxel-induced intra-epidermal nerve fibre loss in the paw skin (Figure 4B), demonstrating that this intervention prevents neuronal damage in vivo.

To confirm that ross-linking IL4R and IL13R provides neuroprotection against a broader spectrum of chemotherapy-induced polyneuropathy, toxic neuropathy was also induced in mice using a platinum-based chemotherapeutic drug, oxaliplatin. Two cycles of 5 times a daily injection of oxaliplatin, separated by 5 days without intraperitoneal injection, induced mechanical allodynia that persisted for at least 3 weeks (Figure 4C). Intrathecal injection of IL4- 13 fusion protein on the second day after the last oxaliplatin injection reduced mechanical allodynia significantly for 4 days (Figure 4C). Intrathecal injection of either wild-type IL4 or wild- type IL13 transiently inhibited oxaliplatin-induced mechanical allodynia for about 1 day, which effect was significantly shorter than that of cross-linking IL4R and IL13R by the fusion protein. Cross-linking IL4R and IL10R or IL4R and IL13R has unique effects on neurons Pro-inflammatory mediators sensitize sensory neurons for noxious and innocuous stimuli.

To test whether cross-linking of IL4R and IL10R inhibits inflammatory mediator-induced sensitization of capsaicin-induced calcium responses in sensory neurons, cultured neurons were treated with TNFa (50 ng/ml) with and without IL4-10 fusion protein, which was used to cross-link IL4R and IL10R (100 ng/ml, 3 nM). TNFa significantly increased the magnitude of capsaicin-induced calcium influxes compared to untreated cells (Figure 5A-C). Co-treatment with IL4-10 fusion protein completely prevents the sensitization of capsaicin-evoked calcium influx by TNFa. In a control experiment, it was excluded that IL4-10 fusion protein affects capsaicin-induced calcium responses in non-sensitized neurons (not shown). Similarly, cross- linking IL4R and IL10R inhibits PGE2-induced sensitization of capsaicin-induced calcium responses (Figure 5D-F), without affecting normal capsaicin-induced calcium fluxes (not shown). This indicates that cross-linking IL4R and IL10R prevents neuronal sensitization by inflammatory mediators.

To identify whether the inhibitory effects of IL4-10 fusion protein on neuronal sensitization requires both cytokine binding moieties, separate receptor blocking antibodies were added. Blocking either IL4R or IL10R slightly reduced IL4-10 fusion protein-induced inhibition of TNFa-induced sensitization of capsaicin evoked calcium responses. Interestingly, blocking both IL4R and IL10R receptors completely abrogates inhibition of neuronal sensitization induced by IL4-10 fusion protein (Figure 5G). Next the inventors considered to what extent cross-linking IL4R and IL10R to normalize neuronal sensitization by inflammatory mediators is superior to those of the combination of the wild-type cytokines. IL4-10 fusion protein dependently inhibits TNFa-induced sensitization of capsaicin-evoked calcium influx. At a concentration of 3 nM, it completely reversed TNFa- induced sensitization, whilst the combination of individual cytokines at the highest dose tested (30 nM) inhibited the TNFa-induced sensitization to a maximum of 50%. This indicates that cross-linking IL4R and IL10R has a superior potency over the combination of wild-type IL4 and IL10 to reduce neuronal sensitization by inflammatory mediators.

Next, the inventors investigated whether such unique effects of crosslinking IL4R and IL10R on neurons also could be found for cross-linking IL4R with IL13R. To evaluate this, mouse sensory neurons were cultured in presence of oxaliplatin with or without IL4-13 fusion to cross-link IL4R and IL13R, or equimolar concentrations of wild-type IL4 and IL13 protein. Neurite length was measured to assess neurotoxicity. Oxaliplatin had a significant negative effect on neurite length when compared to the control group (Figure 6). IL4-13 fusion protein completely protected against oxaliplatin-induced neurotoxicity, whilst the combination of equimolar concentrations of wild-type IL4 and IL13 did not.

Thus, these data together demonstrate that cross-linking IL4R and IL10R, or IL4R and IL13R induces effects in neurons that normalize the hypersensitization by inflammatory mediators and protect the cells against damage. Importantly, these effects are unique to cross-linking involved receptors, since they are not induced by combinations of the wild-type cytokines tested at concentrations equimolar to that of the fusion proteins.

1IL4-10 fusion protein crosslinks IL4R and IL10R in sensory neurons To further investigate the mechanisms of the unique effects of IL4-10 fusion protein and IL4- 13 fusion proteins, the inventors decided to analyse the cellular processes induced by IL4-10 fusion protein in more detail. The inventors hypothesized that the IL4-10 fusion protein causes heterologous clustering of IL4R and IL10R, thereby inducing unique signalling in sensory neurons, i.e. signalling that is not induced by wild-type cytokines, and even not by the combination of wild-type cytokines. First, cross-linking of IL4R and IL10R by IL4-10 fusion proteins on neurons was demonstrated. Sensory neurons were incubated IL4-10 fusion protein or the combination of the respective interleukins for 15 minutes in vitro followed by a proximity ligation assay (PLA) to assess clustering of IL4R and IL10R. This method enables the inventors to detect clustering of the 2 receptors within a 51 nm range. IL4-10 fusion protein (100 ng/ml, 3 nM) treatment indeed cluster IL4R and IL10R receptors in sensory neurons, whilst receptor clustering did not occur after treatment with equimolar concentration of the combination of the respective cytokines or after vehicle (Figure 7). Clustering of IL4R and IL10R is specifically induced by the fusion protein as clustering of IL4R and another highly expressed membrane protein, CD200, was not observed (data not shown).

Cross-linking IL4R and IL10R induces a distinct kinase activity profile compared to the combination of wild-type cytokines The ability of IL4-10 fusion protein to cross-link IL4 and IL10 receptors raises the possibility that this drives unique downstream signaling events. To elucidate downstream signaling in sensory neurons in an unbiased manner, the inventors performed PAMgene kinase activity profiling to assess global protein tyrosine kinases (PTK) and serine/threonine kinases (STK) activity in homogenates of lumbar DRGs of mice with persistent inflammatory pain after administration of IL4-10 fusion protein. Kinomic profiles were assessed at 30, 60 and 240 minutes after intrathecal administration with either the anti-IL4R-IL10R bispecific antibody, the combination of cytokines or PBS. Analyses of the 3 different time points indicates that the most prominent changes in kinome profiles were found at 60 minutes after intrathecal injection, whilst differences are less pronounced at the other time points examined (Figure 8). Analyses of the peptides that are differentially phosphorylated by PTK present in the DRG homogenates at 60 minutes after treatment shows that in total 38 peptides are differentially phosphorylated when in IL4-10 fusion protein-treated mice compared to vehicle treated mice, and 19 peptides when compared to IL4+IL10 treated mice. Cross-linking IL4R and IL10R induces stronger phosphorylation of 5 peptide substrates for PTKs that were also activated by the combination of cytokines. Interestingly, 33 peptides are only phosphorylated by homogenates from mice treated with IL4-10 fusion protein and from mice treated with the combination of IL4 and IL10, indicating that anti-IL4R-IL10R bispecific antibody activates a unique set of PTK. Next the inventors evaluated the differentially phosphorylated STK peptides. Intriguingly DRG homogenates of mice treated with the combination of the cytokines phosphorylate 14 STK peptides to a lesser extent compared to vehicle-treated mice, whilst the homogenates from mice treated with IL4-10 fusion protein induced an increased phosphorylation of these peptides when compared with vehicle.

These data indicate that both PTK and STK activity are differentially regulated upon cross- linking of IL4R and IL10R in vivo compared to the effects of the combination of wild-type cytokines. Each of the peptides present in the kinase activity array can be substrates for different kinases, and one kinase or family of kinases can phosphorylate different peptides.

To predict the putative upstream kinases activated specifically by cross-linking IL4R and IL10R , the differential phosphorylation profiles are loaded into PhosphoNET. These analyses predict that several kinases are activated at 60 minutes after injection based on the observed phosphorylation patterns of the peptides (Figure 8). The inventors identified, including the PTK platelet-derived growth factor receptor A (PDGFRa), KIT, fms like tyrosine kinase 3 (FLT3), MER or RET tyrosine kinases; the calcium calmodulin kinases (CAMK) such as CHK2, CAMK4 or DCAMKL2; AMPK, JAK1, and the Protein kinase A/G/C family such as AKT3, PKCb or NDR1/2. Pathway analysis of these predicted differentially can activate kinases indicates that the most active cellular processes induced by anti-IL4R-IL10R bispecific antibody treatment are mapped to immune responses, altered transcription, cell adhesion or cell cycle. The top 5 kinase substrates ranked by occurrence in the top 50 of the pathway analysis were NAPDH oxidase P47-phox, p120GAP , Rb protein, CDC25A and ZAP70. Overall this indicates that cross-linking IL4R and IL10R drives the activation of sets of kinases not activated by the combination of IL4 and IL10 and drives stronger activation of several kinases also activated by the combination of IL4 and IL10.

Cross-linking IL4R and IL10R in vivo induces a unique transcriptome To further explore the potential capacity of cross-linking IL4R and IL10R to elicit downstream effects that differ from that of the combination of IL4 and IL10, the inventors performd RNA sequencing of DRGs, six hours after a single intrathecal injection of 1L4-10 fusion protein, the combination of IL4 and IL10, or PBS alone in mice with persistent nociceptive pain. Principal component analysis (PCA) indicates that 75% of the variance in gene expression can be explained by the first two principal components. The first principal component captures 55% variance of the data and separates the mice with cross-linking of IL4R and IL10R, while the second principal component may capture 20% variance of the data and separates vehicle treated animals indicating that IL4-10 fusion protein induces different transcriptome changes (Figure 9). Hierarchical clustering of the top 500 differentially regulated genes may show that based on their transcriptional profile the individual animals clustered based on the three different treatments. Thus cross-linking IL4R and IL10R induces a different transcriptional profile compared to mice treated with IL4 and IL10 or vehicle. Treatment of mice with the combination of IL4 and IL10 resulted in 4905 genes differentially expressed (FDR corrected p-value < 0.05) compared to those injected with PBS. KEGG Pathway analysis indicated that these genes aggregate in pathways affecting TLR signaling, oxidative phosphorylation,

ribosomal proteins and lipid metabolism.

In the mice injected intrathecally with IL4-10 fusion protein, 3995 genes are differentially expressed (FDR corrected p-value < 0.05) compared to those injected with vehicle.

Pathway analysis of the differentially expressed genes reveals that neuronal-related genes such as axon guidance and calcium signaling or energy production such as oxidative phosphorylation are downregulated in mice upon cross-linking

IL4R and IL10R.

Moreover, genes involved in inflammatory pathways like interferon signaling, antigen processing and presentation, complement and interleukin signalling are affected.

Interestingly, when genes induced by cross-linking of IL4R and IL10R are compared with those induced by the combination of the cytokines, 3025 genes are differentially expressed

(Figure 9). Analysis of these genes indicates that the expression of 1650 genes is increased, whilst 1375 are downregulated upon cross-linking IL4R and IL10R, as compared to the combination of cytokines.

Importantly, 1675 genes are uniquely regulated by IL4-10 fusion protein.

From these uniquely regulated genes, the expression of 981 genes is increased by the fusion protein, whilst 894 are downregulated.

Pathway analysis of the genes that are differentially expressed upon crosslinking of IL4R and IL10R as compared to the transcriptome of animals receiving the combination of wild-type IL4 and IL10 indicates that these genes belong to pathways including cytokine signaling, neurotrophin signaling, and pathways affecting innate and adaptative immune system indicating potential DRG-infiltrating immune cells.

Overall, RNAseq data demonstrates that cross-linking IL4R and IL10R induces a unique transcriptome change as compared to animals treated with the combination of IL4 and IL10. Conclusions In the present work the inventors consider that the coupling of IL4R binding region and IL10R binding region or IL4R binding region and IL13R binding region in a single molecule/protein creates a novel molecule that is able to target regulatory cytokine receptors in sensory neurons to trigger unique pain resolution pathways that are not activated by the combination of both wild-type cytokines.

Sensory neurons and other cells in the dorsal root ganglion and spinal cord express functional IL4R, IL10R and IL13R, and cross-linking these receptors by a fusion protein or a bispecific antibody or any other compound that can bind at least two of these receptors in sensory neurons, can be used to stop chronic pain either nociceptive, neuropathic or combined nociceptive-neuropathic pain.

Furthermore, this unique signalling induced by cross-linking of receptors of regulatory cytokines on neurons and glial cells, prevents neuronal damage.

SEQLTXT

SEQUENCE LISTING <110> UMC Utrecht Holding B.V. <120> Therapeutic crosslinking of cytokine receptors <130> P33979NL00 <160> 10 <170> PatentIn version 3.5 <21e> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 1 <400> 1 tggaaaggct tatacccctc 20 <2105 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 2 <400> 2 ccgctgttct caggtgacat 20 <2105 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 3 <400> 3 tgaagcaggc atctgaggg 19 <2105 4 <211> 20 <212> DNA <213> Artificial Sequence Pagina 1

SEQLTXT <220> <223> 4 <400> 4 cgaaggtgga agagtgggag 20 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> 5 <400> 5 tcctcctcag accgctttt 19 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 6 <400> 6 cctggttcat catcgctaat c 21 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 7 <400> 7 gatgcacagt aggtctaagt ggag 24 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 8 Pagina 2

SEQLTXT

<400> 8 cactcagggc aggtgaaact 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> 9

<400> 9 tctgcatccc gttgttttgc 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> 10

<400> 10 gcacctgtgc atcctgaatg 20 Pagina 3

Claims (21)

232. CONCLUSIONS A compound comprising: - a first binding group that binds to an interleukin 4 receptor; and - a second binding group that binds to an interleukin 10 receptor, wherein the first binding group and / or the second binding group is not a wild-type interleukin. A combination comprising: - a first binding group that binds to an interleukin 4 receptor; - a second binding group that binds to an interleukin 10 receptor, wherein the first binding group has a linker that binds the second binding group or wherein the second binding group has a linker that binds the first binding group, and wherein the first binding group and / or the second binding group is not a wild type interleukin. A compound or combination according to any of the preceding claims, wherein the first binding group and / or the second binding group is a polypeptide, preferably an immunoglobulin molecule or epitope-binding fragment thereof, more preferably Fab, F (ab ') , F (ab ') 2, Fv, dAb, Fd, a complementarity determining region (CDR) fragment, a single chain antibody (scFv) or single domain antibody. A compound according to any of claims 1 and 3, wherein the compound is a polypeptide, preferably a bispecific antibody, a bivalent single chain antibody, a bispecific double chain antibody, a trial body or a tetral body. A compound or combination according to any of the preceding claims, wherein the compound or combination is capable of cross-linking an interleukin 4 receptor to an interleukin 10 receptor of a sensory neuron in vivo. Combination according to any of claims 2-5, wherein - the first binding group and / or second binding group comprises a tag; and - the linker of the first binding group and / or the linker of the second binding group is a polypeptide that binds to the tag. A compound or combination according to any of the preceding claims, wherein the compound, first binding group and / or second binding group is a polypeptide -33- selected from the group consisting of a signal sequence, a His tag and an antibody Fc fragment. A compound or combination according to any of the preceding claims, wherein the compound, first binding group and / or second binding group comprises one or more chemical modifications selected from the group consisting of glycosylation, sialylation, fucosylation and pegylation. A compound or combination according to any of the preceding claims, wherein the compound or combination is comprised in a pharmaceutical composition comprising the compound or combination and a pharmaceutically acceptable carrier. A compound or combination according to any of the preceding claims, wherein the compound or combination is for use in therapeutic treatment. A compound or combination according to any of the preceding claims, wherein the compound or combination is for therapeutic treatment by administration to a local compartment of a human or animal body. The compound or combination of claim 11, wherein the local compartment is an intrathecal compartment or an intra-articular compartment and / or wherein the compound or combination is administered intrathecally or intra-articularly. A compound or combination according to any of the preceding claims, wherein the compound or combination is for the treatment of a local condition. A compound or combination according to any of the preceding claims, wherein the compound or combination is for use in the prevention or treatment of rheumatoid arthritis; osteoarthritis; other form of arthritis; pain; chronic pain; multiple sclerosis; neuro-inflammatory or neurodegenerative disease; inflammatory bowel disease; inflammatory skin condition; or a condition characterized by local or systemic inflammation, immune activation and / or lymphoproliferation. A compound or combination according to any of the preceding claims, wherein the compound or combination is for use in the prevention or treatment of a condition characterized by chronic pain, neuroinflammation and / or neurodegeneration. -34- A compound or combination according to claim 15, wherein said condition is further characterized by visceral or non-visceral nociceptive pain, peripheral or central neuropathic pain, or mixed nociceptive-neuropathic pain, neuroinflammation and / or neurodegeneration. A compound or combination according to claim 15 or 16, wherein the condition is selected from the group consisting of postoperative orthopedic surgery pain, musculoskeletal pain, irritable bowel syndrome, inflammatory bowel disease, rheumatoid arthritis, ankylosing spondylitis, postherpetic neuralgia, trigeminal neuralgia, post-traumatic or post-operative peripheral neuropathy, diabetic peripheral neuropathy, inflammatory peripheral neuropathy, HIV-associated neuropathy, painful peripheral neuropathy, nerve entrapment syndrome, chemotherapy-associated pain, chemotherapy-induced allodynia, complex regional pain syndrome, post-spinal injury pain, post-stroke pain, low back pain, multiple sclerosis , osteoarthritis, cancer pain, chronic visceral pain, fibromyalgia, polymyalgia rheumatica, myofascial pain syndrome, Alzheimer's and Parkinson's disease, Huntington's disease and / or amyotrophic lateral sclerosis or multiple sclerosis. A cell or cell line expressing the compound or combination of any of the preceding claims. Gene therapy vector containing nucleotide sequence (s) encoding the compound or combination of any one of the preceding claims, for use in the prevention or treatment of a condition characterized by chronic pain, neuroinflammation and / or neurodegeneration. The gene therapy vector of claim 19, wherein the condition is further characterized by visceral or non-visceral nociceptive pain, peripheral or central neuropathic pain, or mixed nociceptive-neuropathic pain, neuroinflammation and / or neurodegeneration. The gene therapy vector of claims 19 or 20, wherein the condition is selected from the group consisting of postoperative orthopedic surgery pain, musculoskeletal pain, irritable bowel syndrome, inflammatory bowel disease, rheumatoid arthritis, ankylosing spondylitis, postherpetic neuralgia, trigeminal neuralgia, post-operative peripheral or postoperative neuropathy , diabetic peripheral neuropathy, inflammatory peripheral neuropathy, HIV-associated neuropathy, painful peripheral neuropathy, nerve entrapment syndrome, chemotherapy-associated pain, chemotherapy -35. induced allodynia, complex regional pain syndrome, post-spinal injury pain, post-stroke pain, multiple sclerosis, chronic widespread pain, low back pain, osteoarthritis, cancer pain, chronic visceral pain, fibromyalgia, polymyalgia rheumatica, myofascial pain syndrome, Alzheimer's disease and Parkinson's, Huntington's disease, and / or amyotrophic lateral sclerosis or multiple sclerosis.