MXPA99012074A - Antigens of leptospira vaccine for the prevention of leptospiro - Google Patents

Abstract

Four antigenic preparations are provided, each of which contains a protein other than Leptospira that can be used immunologically in vaccines for leptospirosis caused by this organism. The invention also provides polynucleotides that encode four proteins and antibodies that bind to proteins for use in the diagnosis of leptospires.

Description

bold font. Figure 2. The complete nucleotide sequence (A) and the deduced amino acid (B) of the membrane permease protein of Leptospira, (ORF2) of pHLE01 1 and pMW310. The initiation and termination codons are underlined in bold. Figure 3. The complete sequence of nucleotides (A) and the deduced amino acid (B) of the membrane mannosyltransferase protein of Leptospira, (ORF3) of pMW50. The initiation and termination codons are underlined in bold. Figure 4. The complete nucleoide sequence (A) and the deduced amino acid (B) of the Leptospira membrane endoflagelin protein of pDFX210. The initiation and termination codons are underlined in bold.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides four immunogenic proteins of the membrane of a pathogenic species of Leptospira. These membrane proteins are kinase, permease, mannosyltransferase and endoflagelin. Any polynucleol sequences encoding these proteins are also included. The four immunogenic proteins of the present invention are useful in pharmaceutical compositions for the induction of immune response to pathogenic Leprospira. genomic tests to detect shared nucleotide sequences and 2) antibody screening of expression libraries to detect shared structural features. Hybridization methods are useful for the screening of 5 recombinant clones by using labeled synthetic mixed oligonucleotide probes, where each probe is potentially the complete complement of a specific DNA sequence in the hybridization sample, which includes a heterogeneous mixture of Denatured double-stranded DNA. For such screening, the hybridization is carried out or preferably in either single-stranded DNA or denatured double-stranded DNA. By using severe hybridization conditions aimed at preventing non-specific binding, it is possible, for example, to allow the autoradiographic visualization of a specific DNA clone by hybridizing the target DNA to that simple probe in the mixture which is its complement. complete (Wallace, et al., Nucleic Acid Research, 9: 879 (1981)). Alternatively, an expression library can be indirectly screened for the four membrane proteins of the invention having at least one epitope per protein, using antibodies to these proteins. Said antibodies can be either polyclonal or monoclonal derivatives and used to detect the expression product indicative of the presence of kinase DNA, permease, mannosyltransferase or Leptospira endophlagelin. Generally, a lambda gt11 library is constructed and immunologically screened according to the procedure of Huynh, et al., (In DNA cloning: A Practical Approach, D.M. Glover, ed, 1:49 (1985)). The development of specific DNA sequences encoding each of the membrane proteins kinase, permease, mannosyltransferase and endophlagelin can also be obtained by: (1) isolation of a double-stranded DNA sequence from genomic DNA, and (2) chemical analysis of a DNA sequence to provide the necessary codons for the protein of interest. The polymerase chain reaction (PCR) technique can be used to obtain or amplify the four individual Leptospira membrane proteins from any Leptospira strain for the subsequent cloning and expression of cDNAs encoding these four proteins (e.g. see U.S. Patent Nos. 4,683,202, 4,683,195, 4,889,818, Gyllensen et al., Proc. Nati, Acad. Sci. USA, 85: 7652-7656 (1988), Ochman et al., Genetics, 120: 621-623 (1988), Triglia et al., Nucí Acids. Res., 16: 8156 (1988), Frohman et al., Proc. Nati, Acad. Sci. USA, 85: 8998-9002 (1988), Loh et al., Science, 243: 217-220 (1989)). Similarly, the PCR technique can be used routinely by those skilled in the art to generate fragments of polynucleotides that encode portions of any of the four Leplospira membrane proteins of the present invention. Methods that are well known in the art can be used to construct expression vectors containing the four Leptospira membrane proteins or fragments thereof that encode suitable transcriptional / translational control sequences and signals. These inducible For example, when cloning in bacterial systems, promoters can be used as the pL of the bacteriophage lambda, plac, ptrp, ptac (hybrid promoter ptrp-lac) and the like; When cloning in insect cell systems, promoters such as the baculovirus polyhedrin promoter can be used: promoters such as the adenovirus late promoter or the 7.5k vaccinia virus promoter can be used to clone into mammalian cell systems. Promoters produced by recombinant or synthetic DNA techniques can also be used for the transcription of the inserted coding sequence of a Leptospira membrane protein or fragment thereof. A series of vectors containing constitutive or inducible promoters can be used in yeast. For a review see, Current Protocols in Molecular Biology, Vol. 2, Ed., Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Cap. 13 (1988), Grant et al., Expression and "15 Secretion Vectors for Yeast, in Methods m Enzymology, Eds. Wu &Grossman, Acad. Press., NY, Vol. 153, pp. 516-544 (1987) , Glover, DNA Cloning, Vol II, IRL Press. ' Wash., DC Cap 3 (1986), and Bitter, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger &Kimmel, Acad. Press. NY, Vol 152, pp. 673-684 (1987) and The Molecular Biology of the Yeast Saccharomyces, Eds., Strathern et al., Cold Spring Harbor Press, Vol I and II (1982). For complementary assays in yeast, cDNA from Leptospira membrane proteins or fragments thereof can be cloned into yeast episomal plasmids (YEp) that replicate autonomously in yeast due to the they then use to infect the Spodoptera frugiperda cells in which the inserted gene is expressed (for example, see Smith et al., J. Biol. 46: 586 (1983), US Patent No. 4 215,051). In cases where an adenovirus is used as the expression vector, the coding sequence of the Leptospira membrane protein or fragment thereof may be linked to an adenovirus transcription / translation control complex, eg, the late promoter. and the tripartite leader sequence. This chimeric gene can then be inserted into the adenovirus genome by in vivo or in vitro recombination. Insertion into a non-essential region of the viral genome (e.g., E1 or E3 region) will result in a recombinant virus that is viable and capable of expressing a Leptospira membrane protein or fragment thereof in infected hosts (e.g., see Logan &Shenk, Proc. Nati, Acad. Sci. USA, 81: 3655-3659 (1984)). Alternatively, the 7.5k vaccinia promoter can be used (for example, see Macketi et al., Proc. Nati, Acad. Sci. USA, 79: 7415-7419 (1982), Mackett et al., J. Virol. ., 49: 857-864 (1984), Panicali et al., Proc. Nati, Acad. Sci. USA, 79: 4927-4931 (1982)). Specific initiation signals may also be necessary for efficient translation of the coding sequence of the Leptospira membrane protein or fragment thereof. These signals include the ATG initiation codon and adjacent sequences. In cases where the entire genome of the Leptospira membrane protein, including its own initiation codon and adjacent sequences, is inserted into the expression vectors appropriate, more signals of translation control may not be necessary. However, in cases where only part of the coding sequence of the Leptospira membrane protein is inserted, it must be provided exogenous translation control signals, including the ATG start codon. In addition, the initiation codon must be in phase with the JJ framework. reading of the coding sequence of the Leptospira membrane protein or fragment thereof to ensure translation of the entire insert. These exogenous translation control signals and initiation codons may have a sequence of origins, both natural and synthetic. The efficacy of expression can be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bitter et al., Methods in Enzymol., 153: 516-544 (1987)). In addition, a host cell strain can be chosen that modulates the expression of the inserted sequences, or modifies and processes the product of the gene in the specific manner desired. Expression carried out by certain promoters can be raised in the presence of certain inducers (for example, zinc and cadmium ions for metallothionein promoters). Therefore, the expression of the Leptospira membrane protein or fragment of This obtained by genetic engineering can be controlled. This is important if the protein product of the cloned foreign gene is lethal to the host cells. In addition, modifications (eg, glycosylation) and processing (eg, cutting) of pro- ject production may be important for the function of the pro- ject. The different host cells i X? • They have specific characteristic mechanisms for post-processing and protein modification. Suitable cell lines or host systems can be chosen to ensure the correct modification and processing of the expressed foreign protein. The host cells which contain the coding sequence of the Leptospira membrane protein or fragment thereof and which express the biologically active prodult of the Leptospira membrane protein gene or fragment thereof, can be identified by four general methods: ( a) DNA-DNA hybridization, (b) the presence or absence of "marker" gene functions, (c) the evaluation of the level of transcription measured as the expression of the membrane protein mRNA transcripts of Leptospira in the host cells , and (d) the detection of genetic products of the Lepiospira membrane protein measured by immunoassays or by their biological activity. In the first method, the presence of the coding sequence of the Lepiospira membrane prolein or fragment of this, inserted in the expression vector, can be determined by DNA-DNA hybridization using probes comprising nucleotide sequences that are * 20 homologues to the coding sequence of the membrane protein of Lepiospira or particular parts of it, substantially as it has been recently uncovered (Goeddert et al., 1988, Proc. Nati. Acad. Sci. USA, 85: 4051- 4055). In the second method, the neighbor system of expression / host ; it can be identified and selected based on the presence or absence of certain "marker" genetic functions (e.g., thymidine kinase activity, antibiotic resistance, me'iotrexate resistance, transformation phenotype, baculovirus occlusive body formation, etc.). For example, if the coding sequence of the Leptospira membrane protein or fragment thereof is inserted into a vector marker gene sequence, the recombinants that comprise the coding sequence of the Leptospira membrane prolein or fragment thereof. , can be identified by the absence of the marker gene function. Alternatively, a marker gene can be located under the coding sequence of the Lepiospira membrane prolein or fragment thereof under the control of the promoter used to control the expression of the coding sequence of the . Leptospira membrane protein or a different promoter. The expression of the marker in response to induction or screening indicates the expression of the coding sequence of the membrane protein of Leptospira. In the third method, the transcriptional activity of the coding sequence of the Leptospira membrane protein or fragment thereof can be evaluated by hybridization assays. For example, RNA can be isolated and analyzed by Northern blotting using a probe homologous to the coding sequence of the membrane protein of Leptospira or fragment of this or particular parts thereof substantially as described (Goeddert et al., 1988 Proc. Nati, Acad. Sci. USA, 85: 4051-4055). Alternatively, the tolaic nucleic acids can be extracted from the host cell and their hybridization assayed to such probes. In the fourth method, the expression of the Lepiospira membrane protein product sequence or fragment thereof can be evaluated * - immunologically, for example by Western blots, , * 5 immunoassays such as radioimmunoprecipitation, enzyme immunoassays and ''. ? s% 'similar. Once a recombinant expressing the Leptospira membrane protein or fragment of that is idenified, the gene product should be analyzed. This can be achieved through property-based tests - *., physical, immunological or functional characteristics of the product The Leptospira membrane protein or i-i fragment should be immunoreactive if it is the result of the expression of the sequence *? & gene complemented, from a part of the gene sequence or from two or more * f gene sequences that are linked to direct the production of proteins , 1 15 chimeric. This reaclivity can be demonstrated by conventional immunological techniques, such as radioimmunoprecipitation, r | radioimmunocompetence or immunoblot. ttí * - "The DNA sequences encoding the four membrane proteins of the invention can be expressed in vitro by transfer of DNA to a suitable host cell." Recombinant host cells "or" host cells "are cells in which they can be propagated a vector and express its DNA The term also includes any progeny of the subject host cell It is understood that not all progeny are identical to the parent cell, since there may be mutations that take place in replication. However, said progeny is included in the terms previously used. The term "host cell" as used in the present invention includes not only procapoeia cells but also eucaloides such as yeasts, filamentous fungi, as well as pigeons and animals. The term "procaine" includes all the bacteria that can be transformed with the genes for the expression of the four membrane proteins of Lepiospilla. the invention. Prokaryotic hosts may include Negative Gram bacteria, as well as positive Gram bacteria, such as E. coli, S. lyphimupum and Bacilus * subillis. A recombinant DNA molecule, which encodes the four Leptospira membrane proteins of the invention, can be used to transform a host using any of the techniques known to those skilled in the art. Especially preferred is the use of a plasmid that contains any of the four coding sequences of the membrane proteins of Lepiospira for purposes of prokaryotic transformation. If the host is procapoia, as with E. coli, competent cells can be prepared which are capable of incorporating DNA from cells collected in the exponential growth phase and then irradiated by the CaCl2 procedure by methods well known in the art. . As an ally, MgCl 2 or RbCl can be used. The Iransformation can also be carried out to form a propoplast in the host cell.

In the present invention, any of the four coding sequences of the Leptospira membrane proteins can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a plasmid, virus or other carrier known in the art that has been manipulated by insertion or incorporation of any of the four coding sequences of the membrane proteins of Lepiospira. Said expression vectors contain a promoter sequence that facilitates the efficient transcription of the genetic sequence inserted in the host. The expression vector typically contains an origin of replication, or a promoter, as well as specific genes that allow phenotypic selection of the transformed cells. Transformed prokaryotic hosts can be cultured according to means known in the art to achieve optimal cell growth. Several shuttle vectors have been reported for the expression of foreign genes in yeast (Heineman et al., Naíure, 340: 205 (1989), Rose el al., Gene, 60: 237 (1987)). Biologically functional DNA vectors capable of expression and replication in a host are known in the art. Said vectors are used to incorporate DNA sequences of the invention.

Methods for preparing fused genes are known operably linked and expressed in bacteria, and are shown, for example, in U.S. Patent No. 4,366,246 which is incorporated herein by reference. The genetic constructs and methods described herein may be used for the expression of any of the four Leptospira membrane proteins in prokaryotic hosts. Examples of promoters that can be used in the invention are: rec A, trp, lac, tac and p [R] or p [L] of bacteriophage lambda. Examples of plasmids that can be used in the invention are listed in Maniatis et al., * 5 »4 5 (Molecular Cloning, Cold Spring Harbor Laboratories, 1982). * - - *. The antibodies provided in the present invention are immunoreactive with any of the four membrane proteins of Leptospira. Antibodies are provided which consist essentially of clustered monoclonal antibodies with different epitopic specificities, as well as preparations of different monoclonal antibodies. The monoclonal antibodies are made from fragments of the protein that c > .§ contain antigens by procedures well known in the art g (Kohler et al., Naire, 256: 495 (1975), Currenl Protocols in Molecular Biology, Ausubel ei al., Ed., (1989)). The term "antibody", as used herein, includes intact molecules as well as fragments thereof, such as Fab, F (ab ') 2 and Fv, which 4 are capable of binding by the epitope determinant. These fragments of the antibody retain some ability to selectively bind to their host or receptor and are defined as follows: 20 (1) Fab, a fragment containing a monovalent antigen-binding fragment of an antibody molecule, can be produced by digestion of the whole antibody with the enzyme papain to give rise to an iniacy light chain and a part of a heavy chain. * (2) Fab ', fragment of an antibody molecule, can * Obtained by the irradiation of the complete antibody with pepsin, "followed by reduction, to give rise to a miada light chain and a part of a heavy chain, two Fab 'fragments are obtained per molecule of antibody. (3) (Fab ') 2, antibody fragment that can be obtained by treatment of the whole antibody with the enzyme pepsin without reduction then; F (ab ') 2 is a dimer of two Fab' fragments held together £ 'his? by two disulfide bridges. 1? O (4) Fv, defined as a fragment obtained by genetic engineering iS containing the variable region of the light chain and the variable region of the heavy chain expressed as two chains, and (5) Single chain antibody ("SCA "), defined as a molecule obtained by genetic engineering that contains the variable region of the The light chain and the variable region of the heavy chain are linked by a suitable polypeptide linker as a single chain genetically fused molecule. The methods of obtaining these fragments are known in the art. (See for example Harlow and Lane, Aníibodies: A Laboralory Manual, Cold Spring Harbor Laboraory, New York (1988), I have prayed as a reference here). As used in this invention, the term "epiiope" means any antigenic determinant of an antigen to which the paratope of # 1 an antibody. Epidemic determinants usually consist of groups of chemically active surface molecules, such as amino acids or side chains of sugars and usually have -i specific tridimiensional structural characteristics, as well as 5 specific load characteristics. Antibodies that bind to any of the four Lepiospira membrane proteins of the invention can be prepared using an endogenous polypeptide or fragments containing small peptides of interest, such as the immunization antigen. Any of the proteins or fragments thereof of SEQ ID NO: 1-4 can also be produced by chemical synthesis of the amino acid sequence of any of these four proieins (Goeddert et al., Proc. Nati Acad. Sci. USA, 85: 4051-4055 (1988)), as predicted by the cloning and sequencing of a cDNA encoding any of the four membrane proteins of Leptospira. The four membrane proteins of Leptospira can be chemically synthesized using synthesis procedures of "- * =? *, conventional peptides known in the art. These procedures _. include the solid phase process developed by R. Bruce Merrifield, (Erickson and Merrifield, "Solid-Phase Peptide Syn- thesis in íhe Proleins", Volume 2, J. Neuraii &R. Hill (eds.), Academic Press, Inc. ., New York, pp. 255-257, Merrifield, "Solid phase synthesis", Science, 242: 341-347 (1986)). In • V * "the solid phase procedure, the amino acids are added step by step to a growing peptide chain that is bound to an insoluble matrix, like pearls 4 polystyrene. A great advantage of this method is that the desired product is attached at each stage to beads that can be filtered and washed quickly and thus obviates the need to purify the intermediates. All reactions are carried out in a single container, which eliminates losses due to repeated product transfers. This solid phase process of chemical peptide synthesis can be easily automated by making feasible the routine synthesis of peptides containing about 50 residues with good yield and purity (Síewart and Young, Solid Phase Pepide Synthesis, 2nd Ed., Pierce Chemical Co., (1984), Tam et al., J. Am Chem. Soc, 10 105.6442 (1983)) Any of the proteins or fragments of SEQ ID NO. 1-4 used to immunize an animal can be derived from a translated cDNA or chemical synthesis, which can be conjugated with a carrier protein. Such commonly used carriers that are chemically coupled to the pelleted 15 include keyhole limpet hemocyanin (KLH), thyroglobulin, bovine serum albumin (BSA) and tetanus toxoid. The coupled peptide is then used to immunize the animal (for example a mouse, rat or rabbit). If desired, monoclonal or polyclonal antibodies can be further purified, for example by binding and eluting the matrix to which any of the four proteins or fragments thereof is attached to any of the four proteins by which the antibodies arise. Those skilled in the art will know various common techniques in the art of Yes immunology for the purification and / or concentration of polyclonal antibodies, ^ W w * ©. 1 as well as monoclonal antibodies (see for example, Coligan et al., Unit V ^ 9, Currení "Proíocols in Immunology, Wiley Inlerscience, 1991, incorporated A #, as a reference). 5"It is also possible to use anti-idiotype technology to produce monoclonal antibodies that mimic an epitope. For example, an ani-idiolipic monoclonal antibody manufactured from a first monoclonal antibody will have a binding domain in the hypervariable region which is the "image" of the epiiope bound by the first monoclonal antibody. Minor modifications of the primary amino acid sequence of any of the four proteins of the invention can result in proteins having a substantial equivalent function compared to the native Lepiospira proteins described herein. Such modifications can be deliberate, such as by site-specific directed mutagenesis, or they can be spontaneous. All the companies Those produced by these modifications are included herein as long as the native function existed, ie binding to specific antibodies of any of the four Leptospira membrane proteins. Modifications of the primary amino acid sequence of any of the four membrane proteins also include variations - 1 20 conservatives. The term "conservative variation", as used in the present tense, indicates the replacement of one amino acid residue by another "f 4 biologically similar residue Examples of conservative variations include the substitution of a hydrophobic residue such as isoleucine, valine, leucine • • • • • • • • • • • • • • • • • • • • • • • • • • • • •., aspartic acid by glumemic, or asparagine by glu- amine, and the like. The term "conservative variation" also includes the use of amino acids substituted in place of the non-substituted parental amino acid, provided that the antibodies raised to the susíiuid protein or fragment thereof are also immunoreacted with the unsubstituted prolein or fragment thereof. The isolation and purification of the microbially expressed protein, or fragments thereof, provided by the invention, can carried out by conventional means including preparative chromatography and immunological separations involving monoclonal or polyclonal antibodies. The invention extends to any host modified according to the methods described, or modified by any other method commonly known to those skilled in the art, such as, for example, by the transfer of genetic material using a lysogenic phage, and which results in result in an expression procapoy of any of the Leptospira genes for membrane proteins, kinase, permease, mannosillransferase or endophlagelin. Prokaryotes transformed with any of the four Lepiospira genes encoding the four membrane proteins of the invention are particularly useful for the production of polypeptides which can be used for the immunization of an animal (for example a rabbit).

In one embodiment, the invention provides a pharmaceutical formulation useful for the induction of immune response to pathogenic Lepiospira in an animal, comprising an immunologically effective canine of any of the four membrane proteins of Leptospira in a pharmaceutically acceptable carrier. The term "immunologically effective amount", as used in the description of the invention, indicates the amount of Leplospira angen that is necessary to induce in an animal the production of an immune response to Leplospira. The four Leptospira membrane proteins of the invention are particularly useful for sensitizing the immune system of an animal that, as a result, produces an immune response that alleviates the effect of Lepiospira infection. Any of the Leptospira membrane proteins can be administered parenterally by injection, rapid infusion, nasopharyngeal absorption, dermal and oral absorption. Pharmaceutically acceptable carrier preparations for parenteral adminition include solutions, aqueous or non-aqueous and sterile emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil and injectable organic esters such as ethyl oleate. The vehicles of occlusive coatings can be used to increase the permeability of the skin and stimulate the absorption of amphigens. The liquid dosage forms for oral adminition may generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes - include emulsions, suspensions, solutions, syrups and elixirs containing the inert diiuyeníes used skillfully in the art, as 4. purified water. In addition to inert diluents, said compositions may also include adjuvants, moisturizing agents, emulsifying agents and of suspension, and sweetening, flavoring and odorizing agents. It is also possible for the antigenic preparations that A * contain any of the four membrane proteins of Lepiospira of the 'invention include an adjuvant. The adjuvants are susances that can be used to nonspecifically enhance a specific immune response. Normally, the adjuvant and the antigen are mixed before the presence to the immune system, or were present separately, but in the same case to the animal (including man) that is to be immunized. The coadyuvaníes can be divided in general into several groups based on their composition. %, 15 These groups include oily coadjuvants (for example complete and incomplete Freund), mineral salts (for example AIK (SO4) 2, tAINa (SO) 2> AINH4 (SO4), silica, alumina, AI (OH) ) 3, Ca3 (PO4) 2, kaolin and carbon), polynucleotides (for example, poly IC and poly AU acids) and certain nalural subsides (eg D wax from Mycobacterium tuberculosis, as well as 20 isolates found in Corynebacterium parvum, Bordetella pertussis and members of the genus Brucella). In another embodiment, a method is provided for inducing an immune response to pathogenic Leptospira in an animal (including a :% human). There are many different techniques for the timing of immunizations when a multiple immunization regimen is used. Is it is possible to use the antigenic preparation of the invention more than once to increase the levels of expression diversity of the immune response of the immunized animal. Typically, if multiple immunizations are given, they will -. * separated by two to four weeks. The subjects in which you want a * § - immune response to Leplospira include pigs, cattle and humans. * Generally, the dosage of any of the four -5 Lepiospira membrane proteins of the invention administered to an animal (including a human) will vary depending on factors such as age, condition, sex and extent of the disease, if any, and other variables that can be adjusted by a connoisseur of the technique. The antigenic preparations of the invention can f be administered as a single or multiple dosage and may vary from , t 15 around 10 g to about 1 000 g, for any of the four t membrane protein antigens of Leptospira, per dose, more * * f * i preferably from about 50 g to about 700 g of antigen "* - '' # per dose, most preferred from about 50 g to about 300 g of Anígen per dose. When used for immunotherapy, the monoclonal antibodies of the invention may be labeled or unlabeled with a therapeutic agent. These agents can be coupled directly or indirectly to monoclonal antibodies of the invention. An example of indirect coupling is mediating the use of a spacer radical. These radicals? Faith * Spacers, in turn, can be insoluble or soluble (Diener, et al., Science, 231: 148 (1986)) and can be selected to enable the release of the drug from the monoclonal antibody molecule at the target site. Examples of therapeutic agents that can be coupled to the monoclonal antibodies * 5 of the invention for immunotherapy are media chambers, radioisotopes, lecines and toxins. The labeled or unlabeled monoclonal antibodies of the invention can also be used in combination with therapeutic agents as described above. . -i The therapeutic combinations that are especially preferred are They include the monoclonal antibody of the invention and immunomodulators and other biological response modifiers. When the monoclonal antibody of the invention is used in combination with various therapeutic agents, such as those described herein, the administration of the monoclonal antibody and the therapeutic agent normally takes place simultaneously at the same time. The term "substance simultaneously" means that the monoclonal antibody and the therapeutic agent are reasonably administered juni with respect to time. Usually, it is preferred to administer the therapeutic agent before the monoclonal antibody. For example, the therapeutic agent can be administered 1 to 6 days earlier than the monoclonal antibody. The administration of the therapeutic agent may be daily, or at any other interval, depending on such factors as, for example, the nature of the disease, the condition of the patient and the half-life of the agent. The dosage ranges for the administration of monoclonal antibodies of the invention are sufficiently long to produce the desired effect in which the symptoms of onset of the disease of Leptospira are alleviated. The dosage should not be large enough to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the subject and can be determined by one skilled in the art. The dosage can be adjusted by the doctor individually in case of complications. Dosage may vary in around 0, 1 mg / kg to about 2,000 mg / kg, preferably from about 0.1 mg / kg to about 500 mg / kg, in one or two daily dose administrations, for one or several days. Generally, when the monoclonal antibodies of the invention are administered conjugated to therapeutic agents, lower doses comparable to those used for in vivo diagnostic imaging can be used. The monoclonal antibodies of the invention can be administered parenterally by injection or gradual perfusion over time. The monoclonal antibodies of the invention can be administered by intravenous, infraperitoneal, inramuscular, subcutaneous, incavalial or transdermal routes, alone or in combination with effector cells. Preparations for parenteral administration include aqueous or non-aqueous solutions and sterile emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil and injectable organic esters such as ethyl oleate. Aqueous vehicles include water, alcohol / water solutions, emulsions or suspensions, including saline and saturated media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose, and sodium chloride; lactated Ringer's intravenous vehicles include supplements of nulrienols and fluids, electrolyte supplements (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present, such as, for example, antimicrobials, antioxidants, chelating agents and inert gases and the like. In still another embodiment, the invention provides a method for deifying a disease associated with pathogenic Lepiospira in an animal (including humans) comprising contacting a cellular component with a reagent that binds to the cellular component. The cellular component can be nucleic acid, such as DNA or RNA or it can be proiein. When the component is nucleic acid, the reagent is a nucleic acid probe or PCR primer. When the cellular component is proiein, the reagent is an antibody probe. The probes are detectably labeled, for example with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate or an enzyme. Those skilled in the art will know other suitable markers to bind the antibody, or they will be able to delermine them using routine experiments.For the purposes of the invention, an antibody or nucleic acid probe specific for any of the four Leptospira proteins of the invention can be used to deify the presence of this protein (using antibodies) or polynucleotide (using a nucleic acid probe) in fluids or biological tissues. Any specimen that contains a detectable amount of any of the four membrane protein antigens of Leptospira or polynucleotides can be used. A preferred specimen of this invention is blood, urine, cerebrospinal fluid or tissue of endothelial origin. When the cellular component is a nucleic acid, it may be necessary to amplify the nucleic acid prior to binding to the specific probe.

Lepiospira. Preferably the polymerase chain reaction (PCR) is used, however, other nucleic acid amplification methods such as ligase chain reaction (LCR), ligated activated transcription (LAT) and sequence-based amplification can be used. of nucleic acids (NASBA). Another technique that can result in increased sensitivity is the coupling of antibodies to low molecular weight hapines. These haptens can then be detected specifically by means of a second reaction. For example, it is common to use haptens as biotin, which reacts with avidin, or dinitrophenyl, pyridoxal and fluorescein, which can react with specific anti-hapten antibodies. As an alignane, any of the Leptospira membrane proteins of the invention can be used to detect antibodies of any of these four proteins in a specimen. The Leptospira membrane proteins of the invention are particularly suitable for use in immunoassays in which they can be used in liquid phase or bound to a solid phase carrier. In addition, any of the four membrane proteins of Lepiospira used in these assays can be detectably labeled in various ways. Examples of immunoassays that can use any of the four membrane proteins of the invention are competitive and non-competitive immunoassays with direct and indirect format. Examples of such immunoassays are the radioimmunoassay (RIA), the immunosorbent assay, the sandwich test (immunomodrug), the precipitin reaction, the gel immunodiffusion test, the agglutination test, the < immunofluorescence assay, proinin A immunoassay and immunoelectrophoresis immunoassay, and Western blot assay. The detection of antibodies that can bind to any of the four Lepiospira membrane proteins of the invention can be carried out using immunoassays that work in a direct, inverse or simulinary mode, including immunohistochemical assays in physiological samples. The The concentration of the membrane protein used will vary depending on the type of immunoassay and the nature of the detectable marker used.

However, regardless of the type of immunoassay used, the. The concentration of Leptospira membrane protein used can be easily determined by a person skilled in the art using routine experimentation. Any of the Leptospira membrane proteins of the invention can bind to many different carriers and be used to detect the presence of the antibody specifically reactive with the protein. Examples of well-known carriers include glass, polyesirene, polyvinyl chloride, polypropylene, polyethylene, polycarbonate, dexirane, nylon, amyloses, naíural and modified celluloses, polyacrylamides, agaroses and magnetite. The nature of the carrier may be either soluble or insoluble for the purposes of the invention. Those skilled in the art will know other suitable carriers for the binding of any of the Leplospira membrane proteins of the invention or will be able to determine them using routine experimentation. There are many different marking markers and methods known to those skilled in the art. Examples of the types of labels that can be used in the present invention include enzymes, radioisotopes, colloidal metals, fluorescent compounds, chemiluminescent compounds and bioluminescent compounds. For the purposes of the invention, the antibody that binds to any of the Leptospire membrane proteins of the invention may be present in various biological fluids and tissues. Any sample containing a delectable amount of antibodies from any of the four membrane proteins of Lepiospira can be used. Normally, a sample * - is a liquid such as urine, saliva, cerebrospinal fluid, blood, serum or the like or a solid or semi-solid such as tissue, feces and the like. The monoclonal antibodies of the invention, directed to any of the four Leptospira membrane proteins of the invention, are also useful for the in vivo detection of the animal. The manually labeled drug is given in a dose that is effective for diagnosis. The term "effective for diagnosis" means that the amount of monoclonal antibody labeled reliably is administered in sufficient quantity to enable the detection of any of the four antigens of Lepiospira membrane proteins for which the monoclonal antibodies are specific. The concentration of monoclonal antibody detectably detectable to be administered should be sufficient for binding to those cells, body fluids or tissues having one of the four Leptospira membrane proteins, to be detectable compared to the background. In addition, it is desirable that the detectably labeled monoclonal antibody rapidly disappear from the circulatory system to give the best target signal ratio thoroughly. As a rule, the dosage of the labeled monoclonal antibody detectable for in vivo diagnosis, will vary depending on factors such as the age, sex, and extent of the animal's disease (including humans). The dosage of the monoclonal antibody may vary from about 0.001 mg / m2 to about 500 mg / m2, preferably from 0.1 mg / m to about 200 mg / m, most preferred from about 0.1 mg / m2 to around 10 mg / m2. Said dosages may vary, for example, depending on whether multiple injections are given, and other factors known to those skilled in the art. For in vivo diagnostic imaging, the type of detection instrument available is an important factor in the selection of a given radioisotope. The chosen radioisotope must have the type of degradation that is deible for the given type of incident. Another important factor in selecting the radioisotope for in vivo diagnosis is that the half-life of the radioisotope is sufficiently long so that it remains detectable at the time of maximum incorporation by the target, but sufficiently short so that the lethal radiation with respect to the host is minimized. Ideally, a radioisotope used for in vivo imaging will lack a particle emission, but will produce a large number of photons in the key range of 140-250, which can be easily detected by conventional gamma cameras. For in vivo diagnosis, radioisotopes can be linked to immunoglobulin directly or indirectly using an intermediate functional group. Intermediate functional groups that are often used to bind radioisotopes that exist as ionic ions to immunoglobulins are bifunctional chelanoid agents such as diethylene diaminopentaic acid (DTPA) and eilendiaminoleiracetic acid (EDTA) and similar molecules. Typical examples of melamic units that can be linked to monoclonal antibodies of the invention are 11ln, 97Ru, 67Ga, 68Ga, 72As, 89Zr and 201TI. The monoclonal antibodies of the invention can also be labeled with a paramagnetic isotope for the purpose of a live diagnosis, such as in magnetic resonance imaging (MRl) or electron spin resonance (ESR). In general, any conventional procedure can be used to visualize the diagnostic images. In general, gamma and positron emitting radioisotopes are used for camera imaging and paramagnetic radioisotopes for MRl. Elements that are particularly useful in such techniques include 157Gd, 55Mn, 162Dy, 52Cr 56r- and Fe. * The monoclonal antibodies of the invention can be used to control the course of healing of the disease associated with Leptospira. Thus, by measuring the growth or decrease of any of the four Lepiospira membrane proteins of the invention or antibodies to any of the four Leptospira membrane proteins present in various fluids or tissues, it would be possible to determine whether a particular therapeutic regimen aimed at the cure of the disease is effective. The materials for use in the process of the invention are ideally suited for the preparation of a spirit. Said stream comprises a compartmentalized carrier medium for receiving in confinement one or more container means such as vials, tubes, and the like, each of the containers comprising one of the elements separately for use in the process. For example, one of the packaging means may comprise a binding reagent to any of the four membrane proteins of Leptospira, such as an antibody. A second container may also contain any of the four membrane proteins of Leptospire recognized by said antibody. The constituents may be present in liquid or lyophilized form, as desired. The following examples are understood to illustrate but not limit the invention. Although typical of those to be used, other methods known to those skilled in the art may be used as an alternative.

EXAMPLES The following examples describe the identification of four Leptospira membrane proteins, ie kinase, permease, mannosyltransferase and endophlagelin as important Leptospira proteins that are produced during active Lepiospira infection of an animal. The methods by which these genes were cloned and sequenced are described. Sequence analysis and homology studies are shown, further indicating that these proteins are pathogenic membrane proteins of Lepiospira and therefore are excellent candidates for vaccines.

EXAMPLE 1 Bacterial strains and growth conditions Strains 2966 of Leptospira interrogans sv pomona and Hb197 of Leptospira borgpetersenii sv hardjobovis were obtained from frozen stock solutions of an original bovine field isolate. All in vitro cultures of Leptospira were propagated at 30 ° C in PLM-5 broth. The strain DH5a from Escherichia coli was propagated in Luria-Bertani medium, with or without 100 g / ml ampicillin, or 50 g / ml kanamycin. Strain LE392 of E. coli was used in the construction and amplification of the genomic genomic minibank. All E. coli cultures were propagated at 37 ° C. In some cases (pDF210, ORF1) the expression of the hereditary proteins in an E. coli host was effected using the heat shock promoter pL. Under these conditions the strain was initially propagated at 30 ° C in 2 × yeast yeast medium to reach an optical density (695 nm) of 0.5. The culture was increased to 42 ° C to induce the expression of the protein.

Animal subculture of L. interrogans sv pomona and L. borqpetersenii sv hardiobovis Hb197 Animal subculture of virulent cultures in Syrian hamsters was performed using liver homogenates from infected animals as inoculum for the following subcultures. A toyai of 0.2 cm3 of a 10"1 dilution of infected liver homogenate in Sluart medium or PLM-5 supplemented with 0.1% agarose was used to inoculate hamsters for subculture by subcutaneous administration routes (L pomona) and inírapepíoneal (L. hardjobovis) The microscopic examination of homogenized spots was performed to confirm the presence of spirochetes.

Extraction and purification of bacterial mRNA from infected hamster liver Hamsters infected with Leptospira were sacrificed by CO2 followed by cervical dislocation. The livers were collected by necropsy and washed twice with ice-cold PBS. The livers were resuspended in 10 ml of PBS (room temperature) to which an equal volume of 4M guanidine isofiocyanalum in sodium citrate 50 was added. mM and 0.1% sodium dodecylsulfate. This suspension was incubated on ice with intermittent vortex agitation until the tissue visibly dissociated. Immediately, phenol saturated with water (pH 5.2) was added to facilitate the elimination of DNA. The mixture was vortexed for one minute, then centrifuged at 10,000 x g at ambient temperature for 30 minutes. The aqueous phase, which contains the nucleic acids, was expectorated twice with phenol embedded with TRIS (pH 8.0): chloroform: isoamyl alcohol (25: 24: 1). This aqueous phase containing predominantly RNA was precipitated by addition of 0.1 volume of 3M sodium acetate (pH 4.5) and 2.5 volumes of 95% ethanol and incubated overnight at -20 ° C. The precipitated nucleic acids were pelleted and washed. To further facilitate the removal of the remaining DNA, the pellet was exiguated with 5 ml of 3 M sodium acetylate (pH 6.0). The extraction was repeated until the nucleic acid pellet remained clear. The quality and quantity of the RNA was determined by spectrophotometry by examining the absorbance ratios at 254 nm / 280 nm, and at 260 nm / 230 nm. The eukaryotic mRNA was removed from the preparation with an oligo dT cellulose column using the FastTrack mRNA isolation kit (Invitrogen Corporation) with a modification in the manufacturer's instructions. In summary, the NaCl concentration of the RNA preparation was adjusted to 0.5 M using 5 M NaCl. The preparation was then added to 50 mg oligo dT cellulose which had been pre-equilibrated with 1 ml of the binding buffer of the kit. The mixture was then incubated for 60 minutes at room temperature with frequent gentle agitation. Following the incubation, oligo dT cellulose was sedimented at ambient temperature by centrifugation at 2000 x g for 10 minutes. The supernatant, which contains the bacterial mRNA, was removed and precipitated by the addition of 0.1 volume of sodium acellium (pH 4.5), 2.5 volumes of 95% ethanol and incubated overnight at -20. ° C. The bacterial mRNA was stored in the same way as was necessary. The bacterial RNA was isolated from the propagated strain of PLM-5 followed by incubation for 96 hours at 30 ° C. Bacterial cells were removed from the agar by scraping, and washed four times in ice-cold PBS. RNA was isolated as described above, without exiration with oligo dT cellulose.

CDNA Synthesis The bacterial mRNA isolated from the infected livers or from the cultures propagated in PLM-5 was used as a template for the synthesis of double-stranded cDNA using the reverse transcriptase of the bird meoblastosis virus (AMV) and the synthesis of RiboClone cDNA (Promega Corporation, Madison, Wl, USA) following the manufacturer's instructions. The newly synthesized cDNA was irradiated with RNAse free of RNAse for 30 minutes at 37 ° C, exfoliated once with phenol: chloroform: isoamyl alcohol and precipitated. The second chain was immediately synthesized after the synthesis of the first chain according to the manufacturer's instructions. The cDNA from the bacteria propagated in PLM-5 was bioin- ilylated using the BioNick Labeling System (BRL Life Technologies, Gailhersburg, MD) following the manufacturer's instructions. In the preparation of the substrate hybridization the double-stranded cDNA preparations were denatured by incubation at 95 ° C for 5 minutes, followed by rapid cooling in an ice bath.

Susceptible Hybridization The technique of hybridization was used to isolate the Leplospira genes of the present invention (Utt, E.A. et al., Can.J. Microbiol 41: 152-156 (1995)). This technique can be used to isolate a particular mRNA when. There are two types of cells, one of which expresses the RNA and the other does not. In the present invention it was determined that certain Leplospira genes were activated and expressed during the active infection of this microorganism in a hamster model. These four genes are not expressed when Leptospira grows in culture media. The mRNA of hamster livers infected with Leptospira ("target cells or Vir +") is used as a substrate to prepare a set of cDNA molecules corresponding to all the expressed genes. To eliminate sequences that are not specific to the target cells, the cDNA preparation is extensively hybridized with the Leptospira mRNA grown in culture media ("Vi cells"). This step removes all sequences of the cDNA preparation that are common to both cell types. After discarding all the cDNA sequences that hybridize with the other mRNA, those that remain hybridize with the mRNA of the target cell to confirm that they represent the coding sequences. These clones contain sequences specific for the mRNA population of Vir + cells. For subtractive hybridization, a total of 50 g denatured bacterial cDNA in vivo of liver extract (Vír +) was hybridized with 250 g of denatured biotinylated cDNA from (Vir ") propagated in PLM-5 in a hybridization buffer containing Tris. mM, 0.6 M NaCl, 2 mM EDTA and 0.2% sodium dodecyl sulfate (final concentration) Hybridization took place at a constant temperature of 70 ° C for 48 hours The 1: 4 ratio of the two populations of cDNA helped to ensure the formation of cDNA hybrids for all common transcpptional species.The selective elimination of all biotinylated double-stranded cDNA hybrids was performed by incubation of the hybridization mixture with paramagnetic beads coated with slrepiavidin (Dynal, Inc. 5) A 200 I lofal of Dynal syrep- avidin beads was placed in 1.5 ml Eppendorf tubes and washed 3 times with Dynal 2x binding buffer (10 mM Tris (pH 7.5), 1 mM EDTA, NaCl 2.0 M). After the final wash the beads were resuspended in 200 μl of 2 × binding buffer, to which an equal volume of the subtracted hybridization mixture was added. Esío was incubated in a royatopa plaíaforma at ambient temperature during 15 minutes at 85 rpm. TO ! * • Following the incubation, biotinylated cDNA hybrids bound to paramagnetic beads were removed by magnetic extraction according to Dynal's instructions. The nucleic acids in the supernatant resin were precipitated by the addition of 0.1 volume of 3 M sodium hydroxide (pH 5)., 3) and 15 0.8 volumes of isopropyl alcohol. The cDNA products remaining in the supernatant putatively represent the differences in genetic expression between L. interrogans propagated in the liver and propagated in PLM-5. These products are consequently referred to as products of subtraction. Amplification of the Subtractive Hybridization Products The double-stranded cDNA substrates were digested with Sau3A restriction endonuclease, and then ligated in tandem to the 21-unit PCR primer adapters. Adapters AUS 1 (5'GATCGGACGGTGAATTCTCGAGATG3 '), and AUS 2 (5'GACACTCTCCGAGAATTCACCGTCC3'), both with Sau3A sites, were phosphophoresed and annealed to each other by heating at 94 ° C and cooling to room temperature (25 ° C) before linking to the products of subtraction. The complementary primer AUS 2 was used in the next step of PCR amplification. The PCR reaction conditions were 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 2.5 mM MgCl2, 10 mM dNTP each, AUS 2 1 pmol and 10 units of Taq DNA polymerase (all concentrations end). The reaction volume was 100 ml. A Perkin-Elmer Ceius model 9600 thermal cycling device was used using the following program, with rapid temperature gradients: 94 ° C, 60 sec; 37 ° C, 30 sec; 55 ° C, 60 sec, for a tolal of 35 cycles.

Isolation and identification of differentially expressed qenomic iocytes Plasmids pUC18 and pGEMT EASY were used as vectors for cloning in E. coli DH5a. All minibank genetic engineering, transfections, pore formation, plasmid isolation, digestion with resigning endonucleases and other genetic manipulations were performed according to conventional procedures (Maniatis, et al., 1982). The PCR scavenging products were cloned directly into the commercial vector pGEMT-Easy (Promega). Positive clones were selected on Luria Bertani plates with ampicillin X-Gal, and the cloned inserts were analyzed by DNA sequencing (Advanced Generics Analysis Corporation, Minneapolis, MN). The DNA sequences were identified by searching the sequence database using the BLAST algorithm. One clone, pHLEOOl, showed homology with several hisiidine kinase genes bound bacterial membrane. Since the susiration product represented a partial gene, that gene was labeled with digoxigenin (DIG) using the Genius system (Boeringer Mannheim Biochemicals, Indianapolis, IN, USA), according to the manufacturer's instructions. The susiration product was then used as a probe in a Southern hybridization of genomic DNA of Leptospira interrogans sv pomona digested with the reslinding endonuclease EcoRl. The pHLEOOl probe was hybridized to a fragment of 1,200 bp. An EcoRI genomic minibank was generated in the size range from 800 bp to 2500 bp and was used to recover the 1,200 bp fragment. This fragment was donated in the plasmid pUC18 and designated as pHLE01 1. Subsequently, it was determined that this clone contained elements of both ORF1 and ORF2. Separate protein expression vectors were used to express the identified ORFs at sufficient levels for small-scale protein purification and vaccine screening approaches. Additional cloning was carried out using the Vectorette scan (Genosys, Woodlands, TX). This methodology was used to examine the genomic genomes of EcoRI Vecloreil to find the Residian parts of the genes. Briefly, specific primers were designed from the known sequenced portions to examine the upstream strand as the original PCR product. This strategy resulted in the amplification of fragments of several PCR primers derived from subtractions. These clones and their putative identities are summarized in Table 1. The DNA sequence analysis of this 1,200 bp insert was achieved using the Sanger dideoxy chain termination method using the automated DNA sequencer from Applied Biosystems. DNA sequence analysis of clone pHLE01 1 using the DNASTAR program revealed two open reading frames (ORF). The frames designated as ORF1, ORF2 and ORF3 consist of 603 bp, 1131 bp and 618 bp, respectively.

TABLE 1 Clones of subtractive hybridization identified in this study Clone Vector Insert size Sequence pHLE011 pUC18 1,200 bp ORF1 / ORF2 pMW43 pFLEXIO 1.110 bp ORF1 pMW310 pFLEXIO 1150 bp ORF2 pMW48 pFLEXIO 680 bp ORF3 Construction and screening of Vemariorette PCRs Vectorette PCR (Genosys Inc.) was used, following the manufacturer's instructions, in an attempt to isolate the remaining parts of both ORF. Briefly, PCR primers were designed for the 5 'end of ORF1 to extend it upstream. For ORF2, primers were designed so that the 3 'end of ORF2 was extended downstream. The Verarireite libraries were generated using restriction digestion with Pvull, Hindill, Hpal, Rsai, EcoRI, Sspl, Dral or Mfel of the genomic DNA of L. interrogans, followed by binding to the specific binding site of the Vectorette primer at one end, according to manufacturer's instructions. The PCR Vectorette using the previous libraries resulted in the generation of several products of various lengths. The DNA sequence analysis of the specific products was used to align the sequences and allow completing ORF2 and the truncated version of ORF1. The substraction clones are highlighted in table 1.

Construction and scoring of the qenomic qenoicca of the ZAP phage A complete BmHI genomic gene for L. borgpetersenii sv hardjobovis was constructed as a client genoec packet by Stratagen (La Jolla, CA, USA) using the ZAP Express vector. It was in a genoeic area where the endophlagelin protein was identified. The library was assessed and amplified according to the manufacturer's instructions using XL1-BLue MRF 'from Escherichia Coli. As the plates appeared, dried nylon filters (Nyíran), which had been pre-wetted with 5 M IPTG, were placed on the plates and incubated inverted overnight at 37 ° C. After the nocillum incubation, the plates were cooled for 1 hour at 4 ° C. The tubes were lifted and washed three times with PBST. The filters were then blocked by incubation for one hour at ambient temperature in PBST / dry milk without 3% fat. After washing the fillros blocked with PBST several times, rabbit immune antiserum was added to each filter in 1: 5,000 dilution in PBST. The primary antibody was incubated with the filters for three hours at 37 ° C. The fillings were then washed several times, five minutes each, with PBST, and the secondary anti-rabbit alkaline phosphatase conjugate antibody was added at a 1: 5,000 dilution. The filters were incubated at 37 ° C for two hours. After incubation with the secondary antibody, the strands were washed once with PBST for five minutes, followed by two times for five minutes with PBS. Positive plates were visualized by immersion of the filters in BCIP solution for one minute at ambient temperature.

Isolation and identification of ZAP phage library clones. An ion of fourteen plaques reacted strongly with immune rabbit antisera. Each of these positive phages was converted to phagemid and transformed into XLOR cells of Escherichia coli for plasmid isolation and amplification. Each of these clones and their insert size are desidered in Table 2. The positive plaques were extracted and converted into phagemids in vivo using the procedure supplied by the manufacturer.

TABLE 2 Clones of the ZAP expression library identified in this study Clone Vector Insert size ORF pDFX210 pFLEXIO 900 bp endoflagelin Northern Analysis Bacterial RNA samples were analyzed by Northern hybridization using the 32 k-labeled cloned 3.2 kb fragment of pHLE01 1 using the Multiprime DNA Labeling Kit (Amersham International Foot, Amersham, UK) following the manufacturer's instructions. Hybridization conditions were: 5x SSC, 50% formamide, 0.02% SDS, 0.1% N-lauroyl sarcosine, 2% salmon cut sperm DNA and 20 mM sodium maieate (pH 7.5) ). Hybridization took place at 42 ° C for 16 hours. The severity washes were: twice with SSC x2, 0.1% SDS for five minutes at room temperature, and twice with 0.5x SSC, 0.1 I% SDS for 15 minutes at 55 ° C. The signals were visualized by radiography.

DNA sequence analysis Bi-directional double-stranded DNA sequence analysis was performed for selected clones using the ABI 200 PRISM System (staining terminator) from LARK (The Woodlands, Texas, USA).

DNA analysis and primary sequence The DNA sequence analysis of the hybridization clones showed three main open reading frames (ORF). The original suspending clone pHLE01 1 contained two partial ORFs, designated ORF1 and ORF2. Using these partial sequences, Vectorette PCR was used to complete both ORF1 and ORF2 sequences, which were then subcloned into pFLEXI O to give pMW43 (Fig. 1) and pMW310 (Fig. 2) respectively. DNA sequence analysis of a separate suspension clone, pHLE004, identified another major ORF designated as ORF3. This partial sequence was used to design PCR primers for Vectorelte PCR. This completed the ORF3 sequence (Fig. 3). The primary sequence of the three ORFs was deduced using the DNASTAR software package. The primary sequences deduced from the ORFs identified putative proteins of molecular masses of 41,000 Da, 43. 000 Da and 25,000 Da, respectively. The entire ORF of the endoflagelin gene was found to be 849 bp in length. The primary sequence deduced was a protein of 283 amino acids with a calculated molecular weight of 32. 000. Analysis of the sequence database A similar search of these four sequences of Leptospira was carried out in the sequence databases by means of the BLAST e-mail server of the National Biotechnology Center (NCBI). The BLASTn and BLASTx sequence analysis algorithms were used in an attempt to identify DNA and primary sequence homologies. The identities of the putative genes are highlighted in Table 3.

TABLE 3 Homologies of the BLAST database of potential cloned antigens identified in this study CLON GEN HOMOLOGY pMW43 ORF1 membrane kinase pMW310 ORF2 membrane permease pMW50 ORF3 mannosyltransferase pDFX210 endoflagelin endophlagelin EXAMPLE 2 Model of infection caused by Leptospirosis in Syrian Hamster Female Syrian hamsters from one to four months of age were used for all subcultures and infections caused. For the model of infection caused with sv pomona the hamsters were infected subcutaneously using 0.2 ml of liver homogenate containing viable bacteria, as determined by phase contrast microscopy. Dilution rates range from 1: 1000 (4 x 10 5 bacteria / ml) to 1: 10 (4 x 10 7 bacteria / ml). For the hardjobovis-induced infection, the hamsters were infected intraperitoneally using 0.5 ml of liver homogenate containing viable bacteria, as determined by phase contrast microscopy. Dilution rates range from 1: 1000 (4 x 10 5 bacteria / ml) to 1: 10 (4 x 10 7 bacteria / ml). The hamster liver tissue containing viable leptospires was surgically removed, followed by necropsy and processed as follows. Approximately one gram of tissue was placed in a glass dounce homogenizer, then a total of 9 ml of PLM-5 supplemented with 0.1% agarose was added to the tissue.The tissue was homogenized to uniform consistency.This represents a dilution 10"1 of the bacteria. All the following dilutions were made using the PLM-5 diluent.

Expression of the recombinant protein Depending on the expression vector used the proteins were induced using a heat shock for the plasmid of the PL promoter or with IPTG using the lacZ promoter plasmid. All protein expression was performed in E. coli DH5 (lacZ) or E. coli LE392 (PL), while propagation was carried out in 2x yeast triphone broth (YT 2x broth). In summary, cultures using the expression of lacZ propagated at 37 ° C had reached an optical density (at 695 nm) of 0.4 to 0.5.

Recombinant proteins were induced by the addition of 1 mM IPTG (isopropylthio- -D-galactopyranoside). Incubation continued between 2 and 12 hours, depending on the expected protein yield. The constructions using the PL promoter system were propagated at 30 ° C until reaching an optical density (at 695 nm) of 0.4 to 0.5. Recombinant proteins were induced by increasing the culture time at 42 ° C and continuing the incubation for 2 to 4 hours. The bacterial cells were harvested by centrifugation at 8,000 x g for 15 minutes at 4 ° C. The cells were used in two steps through a French press at 20,000 psi (134 mPa). Cell debris was removed by centrifugation at 20,000 x g and supernatants were stored at -20 ° C until needed. The protein extracts were assayed by SDS-PAGE according to the usual procedures (ref).

Data on the protective efficacy of vaccine vaccines in the model of hamster lepiospirosis. Protein extracts from the recombinant clone containing pHLEOl 1 protected 4/6 hamsters (67%) of the lethal infection in the infection model with sv pomona. The recombinant protein purified from pMW43, which contains only ORF1 of pHLEO1, resulted in 2/6 hamsters (33%) of the infection in the model of infection of sv pomona. The recombinant protein purified from pDFX210 did not provide any protection against infection with sv pomona. The protective potential of each of these antigens in the sv hardjobovis model is under experiment. Table 4 summarizes the results of the vaccine infection for all tested antigens. For experimental vaccinations the animals are vaccinated twice, separated two weeks, with around 5 g of the experimental protein. Two weeks after the last vaccination the animals were infected with another serum variation using the procedure indicated above.

TABLE 4 Protective potential of selected antigens against the lethal infection caused by Leptospira in the model of infection caused in the Syrian hamster of Leptospirosis.

Claims (18)

NOVELTY OF THE INVENTION CLAIMS

1. - An isolated Leptospira membrane protein kinase comprising the amino acid sequence of SEQ ID NO: 1 or conservative fragments or variants thereof.

2. An isolated Leptospira membrane permease protein comprising the amino acid sequence of SEQ ID NO: 2 or fragments or conservative variants thereof.

3. An isolated Leptospira membrane protein manniltransferase comprising the amino acid sequence of SEQ ID No. 3 or conservative fragments or variants thereof.

4. An isolated Leptospira membrane endophlagelin protein comprising the amino acid sequence of SEQ ID No. 4 or conservative fragments or variants thereof.

5. An isolated sequence of Leptospira membrane kinase polynucleotides comprising the sequence of SEQ ID No. 5 or fragments or conservative variants thereof.

6. An isolated sequence of Leptospira membrane permease polynucleotides comprising the sequence of SEQ ID No. 6 or conservative fragments or variants thereof.

7. An isolated sequence of Lepiospira membrane mannosyltransferase polynucleotides comprising the sequence of SEQ ID No. 7 or conservative fragments or variants thereof.

8. An isolated sequence of Leptospira membrane endophlagelin polynucleotides comprising the sequence of SEQ ID No. 8 or conservative fragments or variants thereof.

9. A polynucleotide sequence comprising the open frame of a polynucleotide sequence selected from the group consisting essentially of SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 or fragments or conservative variants of these.

10. A pair of double-stranded DNA primers of at least 12 nucleotides in length for the detection of a polynucleotide sequence encoding a Lepiospira membrane protein from any pathogenic Lepiospira strain, the pair of primers being selected from the group consisting of nucleosides 1-301 and 302-603 of SEC N ID 5, resulting in the use of the primers in a chain reaction with polymerase, the synthesis of a DNA comprising all or at least 12 contiguous nucleosides of a gene encoding a Lepiospira membrane proiein of any pathogenic strain of Lepiospira .

11. A pair of single-stranded DNA primers of at least 12 nuclei in length for the de dection of a polynucleotide sequence encoding a Leplospira membrane prolein of any pathogenic Leptospira strain, the pair of primers being selected from the group formed by nucleotides 1-566 and 567-1131 of SEQ ID NO: 6, resulting in the use of the primers in a polymerase chain reaction synthesizing a DNA comprising all or at least 12 contiguous nucleotides of a gene encoding a Leptospira membrane protein from any pathogenic strain of Leptospira. 12.- A pair of single-stranded DNA primers of at least 12 nucleotides in length for the detection of a polynucleotide sequence encoding a Leptospire membrane protein from any pathogenic strain of Leptospire, the pair of primers being selected from the group consisting of nucleotides 1-309 and 310-618 of SEQ. ID 7, resulting in the use of the primers in a polymerase chain reaction the synthesis of a DNA comprising all or at least 12 contiguous nucleotides of a gene encoding a Lepiospira membrane protein of any pathogenic strain of Leptospira . 13. A pair of single-stranded DNA primers of at least 12 nucleotides in length for the deviation of a polynucleotide sequence encoding a Lepiospira membrane protein from any pathogenic strain of Lepiospira, with the pair of primers selected from the group formed by the nucleolides 1-424 and 425-849 of the SEQ ID No. 8, resulting in the use of the primers in a polymerase chain reaction, the synthesis of a DNA comprising iodines or at least 12 contiguous nucleosides of a gene encoding a Lepiospira membrane proiein of any pathogenic strain of Lepiospira. 14. A procedure for the removal of a Leptospira pathogen comprising the steps of: (a) isolating the DNA of an animal infected with the pathogen, or of the pathogen itself, (b) subjecting the DNA to the polymerase chain reaction using at least one primer with sequence identity with at least 12 contiguous nucleotides of a sequence selected from the group consisting essentially of the nucleotides of SEQ. ID 5, nucleotides of SEQ ID NO: 6, nucleosides of SEQ ID NO: 7 and nucleolides of SEQ ID NO: 8, and (c) designate the Lepiospira pathogen by visualizing the product or amplification products of the chain reaction with polymerase. 15. A method for the isolation of a polynucleotide sequence that encodes a Leptospira membrane protein of a Leptospira pathogen, comprising the steps of: (a) isolating the DNA of an animal infected with the pathogen, or of the pathogen same, (b) subjecting the DNA to the polymerase chain reaction using at least one primer with sequence identity with at least 12 contiguous nucleotides of a sequence selected from the group consisting essentially of the nucleotides of SEQ ID NO: 5, nucleotides of SEQ ID NO: 6, nucleotides of SEQ ID NO: 7 and nucleotides of SEQ ID NO: 8; and (c) isolate the amplification product or products from the chain reaction with polymerase. 16. A pharmaceutical composition useful for inducing an immune response to pathogenic Leptospira in an animal, comprising an immunologically effective amount of a Leplospira membrane protein selected from the group consisting essentially of kinase, permease, mannosyltransferase and endoflagelin in a pharmaceutically vehicle. acceptable. 17.- A procedure for confirming a clinical diagnosis of Leptospirosis in an animal suspected of having Leptospirosis, comprising carrying out an assay to determine the presence of a Leptospira membrane protein or fragment thereof, selected from the group formed by kinase, permease, mannosyltransferase and endophlagelin in a biological fluid or tissue of the animal, wherein the assay comprises contacting a sample of the biological fluid or tissue obtained from the animal with an antibody that specifically binds to the membrane protein of Leptospirosis or fragment of this, or a Fab fragment that binds specifically to the membrane protein of Leprospirosis, in which the presence of the Leptospirosis membrane proiein or fragment thereof confirms the clinical diagnosis of Leptospirosis. 18. The method of claim 17, wherein the assay comprises a test selected from the group consisting of radioimmunoassay, immunosorbent assay, sandwich assay, precipitin reaction, gel immunodiffusion assay, agglutination assay, immunofluorescence, proinin A immunoassay, immunoelectrophoresis assay and western blot assay.