MXPA99011756A - Alkaline xyloglucanase - Google Patents

Abstract

A xyloglucanase having a relative xyloglucanase activity of atleast 50%at pH7 and either no or an insignificant cellulolytic activity is obtainable e.g. from a strain of Bacillus. A xyloglucanase comprising an amino acid sequence as shown in positions 30-261 of SEQ ID NO:2 or homologues may be derived from e.g. Bacillus licheniformis, ATCC 14580, and may be encoded by polynucleotide molecules comprising a nucleotide sequence as shown in SEQ ID NO:1 from nucleotide 88 to nucleotide 783;and a xyloglucanase comprising an amino acid sequence as shown in positions 1-537 of SEQ ID NO:4 or homologues may be derived from e.g. B. agaradhaerens, NCIMB 40482, and may be encoded by polynucleotide molecules comprising a nucleotide sequence as shown in SEQ ID NO:3 from nucleotide 1 to nucleotide 1611. The xyloglucanases are useful e.g. in cleaning compositions and for treatment of cellulosic fibres.

Description

XILOGLUCANASAS ALKALINE Field of the Invention The present invention relates to alkaline xyloglucanases, ie enzymes that exhibit Xyloglucanase activity as its main enzymatic activity in the neutral and alkaline pH ranges; to a method of producing such enzymes; and methods for using such enzymes in the textile fiber, detergent and cellulose fiber processing industries.

% Background of the Invention TF 15 Xyloglucan is a major structural polysaccharide in the primary (growth) cell wall of plants. Structurally, xyloglucans consist of a beta-1, 4-linked glucose skeleton similar to cellulose which is frequently substituted with several side chains. The xyloglucans of the majority, of the dicotyledonous plants, some monocots and gymnosperms are highly branched polysaccharides in Ref. 032207 _ * k i f., * i, "* which approximately 75% of the glucose residues in the skeleton support a glycosyl side chain at 0-6. The glycosyl residue that is fixed-directly to the branched glucose residue is £ < "% 5 invariably alpha-D-xylose Up to 50% of the side chains in xyloglucans contain more than one residue due to the presence of the beta-D-galactose or alpha-L-fucose- (1-2) moieties ) -beta-D-galactose at 0-2 - * $ of xylose residues (C. Ohsu i and T. Hayashi (1994) 10 Plant and Cell Physiology 35: 963-967; GJ McDougall and SC Fry (1994) Journal of Plant Physiology 143: 591-595; JL Acebes et al. (1993) Phytochemistry 33: 1343-1345). In acid hydrolysis, xyloglucan extracted from cotton fibers produced glucose, xylose, galactose and 7f 15 fucose in the ratio of 50: 29: 12: 7 '(Hayashi et al, 1988). Xyloglucans produced by solanaceous plants are unusual because typically only 40% of * the beta-1, 4-linked glucose residues carry or support a glycosyl side chain at 0-6. In addition, up to 60% of the xylose residues are replaced in 4 0-2 with alpha-L-arabinose residues and some? Solanaceous plants, such as potatoes, also have xyllogins with beta-D-galactose substituents in 0- Some of the xylose residues (York et al Xyloglucan is thought to function in the primary wall of plants by the cross-linking of 5 cellulose microfibrils, forming a cellulose-xyloglucan network. This network is considered necessary for the structural integrity of the walls of the primary cell (Carpita et al., 1993). Another important function of xyloglucan is that it acts as a reservoir for the subunit oligosaccharides of xyloglucan which are physiologically active regulators of the growth of plant cells. The xyloglucan subunits also modulate the action of the xyloglucan endotransglycosylase (XET), an enzyme associated with the cell wall of which it is hypothesized that it plays a role in the elongation of the walls of plant cells. Therefore, the xyloglucan could play an important role in the loosening of the wall and consequently in the expansion of the cell (Fry et al., 1992). The seeds of many dicotyledonous species contain xyloglucan as the main polysaccharide storage reservoir. This type of xyloglucan, which is located in massive thickenings on the inside of the cell wall of the cotyledon of the seed, is composed mainly of glucose, xylose and galactose (Rose et al., 1996). The tamarind tree seeds Tamarindus indi ca became a commercial source of rubber in 5 1943 when gum is found to be useful as gum or sizing for paper and textiles. Jute and cotton sizing with tamarind xyloglucan has been widely practiced in Asia due to the low cost of rubber and its excellent properties. The applications tamarind xyloglucan foods include use in confections, jams and gelatins and as a stabilizer in ice cream and mayonnaises (W istler et al., 1993). The activity of xyloglucanase is not included in the classification of enzymes provided by the Enzyme Nomenclature (1992). Until now, this enzymatic activity has been classified simply as glucasana activity and has often been thought to be identical to cellulolytic activity (EC 3.2.1.4), ie the activity against ß-1,4-glycosidic linkages in cellulose or the substrates derived from cellulose, or at least to be of a side activity in enzymes having cellulolytic activity. However, a true xyloglucanase in an enzyme Specific for xyloglucan capable of catalyzing the i¡fe s *.

YES. ft solubilization of the xyloglucan with respect to the oligosaccharides of xyloglucan but which do not exhibit a substantial cellulolytic activity, for example a € activity against CMC (carboxymethylcellulose) of the 5 substrates similar to cellulose conventionally used, HE cellulose and Avicel (microcrystalline cellulose). A xyloglucanase unfolds or separates beta-1, 4-glycosidic bonds in the xyloglucan skeleton. 10 Xyloglucasana activity is described by Vincken et al. (1997) that characterizes three different endoglucanases of Tr choderma viride (similar to T. reesei) which all have an elevated activity against cellulose or CMC and shows that Endol (which is actually belonging to family 5 of glycosil hydrolases, see Henrissat, B. et al. (1991, 1993)) essentially has no activity (ie it has a very small activity) against xyloglucan, and that EndoV (which belongs to family 7 of glycosyl 20 hydrolases) and EndoIV (which belongs to the family 12 of glycosyl hydrolases), both have activity against xyloglucan and CMC, respectively, of the same order of magnitude. "* International patent publication WO 25 97/13862 discloses two cellulases of the N400 strain of T '' Aspergillus niger as described in EP-A 0 463 706. The sequence of lacl2 can be attributed to family 12, and the sequence of lac64 was determined to belong to family 5 by comparison with the known homologous celluloses. in the EMBL database. Both enzymes have cellulase and β-glucanase activity. They "have the highest activity against barley ß-glucan, and they show good CMC activity and some xyloglucanase activity. have an optimum pH at 3.5 on the CMC and 5.5 on the ß-glucan in the barley. International Patent Publication WO 94/14953 describes a xyloglucanase (EG II) cloned from the % fungus Aspergillus aculea tus and expressed in the fungus Aspergillus oryzae which has a high xyloglucanase activity and very little cellulase activity. This EG II enzyme which shows xyloglucanase activity in the pH range of 2.5-6 and an optimal activity at pH 3-4 also belongs to the family 12 of the glycosyl hydrolases. In summary, still until now the activity of xyloglucanase has only been found in enzymes of fungi belonging to families 7 and 12 of glycosyl hydrolases and which exhibit this activity in the ** i pH range from acid to near neutral point. However, many important processes, whether industrial or using industrially produced agents, are operating at an alkaline pH. Accordingly, it is an object of the present invention to provide a true xyloglucanase enzyme with A high xyloglucanase activity at an alkaline pH and essentially no activity in cellulose or cellulose derivatives.

Brief Description of the Invention The inventors have now found enzymes that have a substantial xyloglucanase activity in the * alkaline range, such enzymes either do not have or have a negligible cellulolytic activity. Accordingly, the present invention relates to an enzyme preparation comprising an i x-xyloglucanase having a xyloglucanase activity * Relative of at least 50% at a pH of 7 or at a pH above 7, and preferably a minor activity or no activity on cellulose or cellulose derivative substrates T, having for example a ratio of 3 maximum xyloglucanase activity with respect to the maximum activity on the CMC or Avicel of at least 2: 1. The inventors have also succeeded in the cloning and expression of a xyloglucanase, ie the invention relates in its further aspects to a ? xyloglucanase which is (a) a polypeptide produced by Bacillus agaradhaerens, N CIMB 40482, or (b) an e 'polypeptide comprising an amino acid sequence as shown at positions 1-537 of SEQ ID NO: 4 , or (c) an analogue of the polypeptide defined in (a) or (b) which is at least 70% homologous with said polypeptide, or the polypeptide derivative by substitution, deletion or addition of one or more amino acids, or is immunologically reactive with a raised or raised polyclonal antibody against said polypeptide in the purified form; and to a xyloglucanase to which is (a) a polypeptide produced by Bacillus t *? cheniformis, ATCC 14580, or (b) a polypeptide comprising an amino acid sequence as shown in positions 30-261 of SEQ ID NO: 2, or (c) an analog **? *. *, of the polypeptide defined in (a) or (b) which is at least 70% homologous with the polypeptide, or is derived from the polypeptide by substitution, deletion or addition of one or more amino acids, or is immunologically reactive with a raised or raised polyclonal antibody against the polypeptide in a purified form; and to a molecule of "74 isolated polynucleotides encoding a polypeptide having a xyloglucanase activity selected from (a) polynucleotide molecules comprising a nucleotide sequence as shown in SEQ ID NO: 1 from nucleotide 88 to nucleotide 783; ) polynucleotide molecules that encode a polypeptide that is at least 70% identical to the amino acid sequence of SEQ ID NO: 2 from residue 30 of the amino acids to the t residue 261 of the amino acids, and (c) nucleotide sequences degenerate of (a) or (b), and to an isolated polynucleotide molecule encoding a polypeptide having xyloglucanase activity, selected from the group consisting of: (a) polynucleotide molecules comprising a nucleotide sequence as shown in * SEQ ID NO: 3 from nucleotide 1 to nucleotide 1611; (b) polynucleotide molecules that encode a polypeptide that is at least 70% idé to the amino acid sequence of SEQ ID NO: 4 from residue 1 of the amino acids to residue 537 of the amino acids; and (c) degenerating the nucleotide sequences of (a) or (b). In the further aspects, the invention provides an expression vector comprising a DNA segment which is for example a molecule of * polynucleotides of the invention; a cell comprising the DNA segment or the expression vector; and a method of producing an enzyme that exhibits xyloglucanase activity, such method comprises culturing the cell under conditions that allow the production of the enzyme, and recovering the enzyme from the culture. In still another aspect the invention provides an isolated enzyme exhibiting xyloglucanase activity, characterized in that (i) it is free of homologous impurities and (ii) the enzyme is produced by the method described above. The novel enzyme of the present invention is useful for the treatment of a cellulosic material, especially woven or non-woven fabrics, yarns, fibers, containing cellulose. The treatment can be carried out during the processing of the cellulosic material into a material ready for the manufacture of clothes or the manufacture of fabrics, for example in the step of desizing or washing with scouring; or during the home or industrial washing of such fabric or clothing. Accordingly, in the further aspects the present invention relates to a detergent composition comprising an enzyme having a substantial xyloglucanase activity in the alkaline range; and to the use of the enzyme of the invention for the treatment of the woven or non-woven fabric, the yarn, or the fibers containing cellulose. The present invention has now made possible? use a true enzymatic degreasing process in the preparation of the cellulosic material for example for the appropriate response in dyeing operations % c subsequent. In addition, it is contemplated that the detergent compositions comprising the novel enzyme are capable of removing or bleaching certain stains or dyes present in the laundry, especially spots and spots that result from foods containing xyloglucan, plants, and the like. It is also contemplated that treatment with detergent compositions comprising * c the enzyme, novel, can prevent the binding of certain 4 ? 15 spots to the xyloglucan left on the cellulosic material.

Detailed description of the invention Cellulases are found in more than 10 different families of glycosyl hydrolases. Some of the cellulases also exhibit xyloglucanase activity. In our days, such cellulases have been found among those classified in families 5, - »£ 25 7 and 12. The specificity of the substrate, however, does not * - correlate directly with the family: within a family the main enzymatic activity may be the activity of the cellulase or mannanase (family 5), or liquinase, or β-1, 3-glucanase or 5 xyloglucantransferase (family 16). The 'only enzyme It has not been described until now that it has activity against the xyloglucan as the major or main enzymatic activity is that of the Aspergillus aculea tu EG II described in WO 94/14953. As mentioned above, this activity has not yet entered the official Enzyme Nomenclature. In the present context, the term p "enzyme preparation" is proposed to mean that it is any conventional enzymatic fermentation product, possibly isolated and purified from single species of a microorganism, such preparation usually comprises several different enzymatic activities; or a mixture of monocomponent enzymes, preferably enzymes derived from bacterial species and fungi using recombinant techniques »Conventional, such enzymes have been fermented and possibly isolated and purified separately and which can originate from different species, preferably fungal species or bacteria; or the fermentation product of a microorganism which TP- acts as a host cell for the expression of a recombinant xyloglucanase, but such a microorganism simultaneously produces other enzymes, for example xyloglucanases, proteases, or cellulases, which are present in the form in fermentation products of the microorganism, i.e. the enzyme complex conventionally produced by the microorganism that is naturally present, corresponding. In a preferred embodiment, the xyloglucanase 10 has an activity relative to pH 7 of at least 50%, preferably of at least 75%, more preferably of at least 80%, especially of at least 90%, compared to the activity at the optimum pH . In another preferred embodiment, xyloglucanase 15 has a relative activity at pH 8 of at least 50%, preferably at least 60%, more preferably at least 75%, especially at least 90%, compared V with the activity at the optimum pH. In yet another preferred embodiment, xyloglucanase has a relative activity at pH 9 of at least%, preferably at least 20%, more preferably at least 25%, compared to the activity at the optimum pH. In still another preferred embodiment, the , 2- * 25 xyloglucanase has an activity relative to pH 9.5 of at #% at least 5%, preferably at least 10%, more preferably at least 15%, compared to the activity at the optimum pH. In still another preferred embodiment, the xyloglucanase has a relative activity at pH 10 of at least 5%, compared to the activity at the optimum pH. In another preferred embodiment the xyloglucanase has an activity relative to a temperature of 50 ° C, preferably of at least 60%, preferably of at least minus 70%, compared to the activity at the optimum temperature. In still another preferred embodiment, at a temperature of 60 ° C, the activity of the relative xyloglucanase is at least 40%, preferably at least 15 50%; at a temperature of 70 ° C, the relative activity of the xyloglucanase is at least 40%, preferably L at least 45%, especially at least 50%. In a preferred embodiment, xyloglucanase. has a minor activity or no activity on the 20 cellulose or substrates derived from cellulose. A conventional substrate for determining the activity of the * cellulase (activity of endo-β-1,4-glucanase, jf, EC 3.2.1.4) is carboxymethylcellulose (CMC). Another conventional substrate for determining the activity of cellulase 25 or cellobiohydrolase (EC 3.2.1.91) is Avicel, which is a microcrystalline cellulose well known to the person skilled in the art. Preferably, the ratio of The "maximum activity of the xyloglucanase with respect to the maximum activity on either CMC to Avicel is at least 5 2: 1, more preferably at least 3: 1, more preferably at least 4: 1, even more preferably of at least 5: 1, still more preferably at least 8: 1, especially at least 10: 1. The xyloglucanase preparation of the invention may further comprise one or more enzymes selected from the group consisting of proteases, cellulases (endo-β-1, 4-glucanases), β-glucanases (endo-β-1,3 (4) -glucanases), lipases, cutinases , peroxidases, laccases, amylases, glucoamylases, pectinases, reductases, oxidases, phenoloxidases, ligninases, pullulanas, arabinanases, hemicellulases, mannanases, galactanases, xylanases, pectin acetyl esterases, rhamnogalacturonan acetyl esterases, polygalacturonases, rhamnogalacturonases, pectin lyases, pectate lyases, pectin methylesterases, cellobiohydrolases, transglutaminases; or mixtures thereof. In a preferred embodiment, one or more or all of the enzymes in which the preparation is produced using recombinant techniques, ie the enzyme (s) is / are monocomponent enzyme (s) which is / are mixed with the other enzyme (s) to form an enzyme preparation with the desired enzyme mixture. In another aspect, the present invention also relates to a method of producing the enzyme preparation of the invention, the method comprising culturing a microorganism capable of producing the xyloglucanase under conditions that allow the production of the enzyme, and recovering the enzyme from the enzyme. culture. The cultivation can be carried out using conventional fermentation techniques, for example by cultivating in stirred vessels or stirred fermenters to ensure sufficient ventilation on a medium if the enzyme of interest is intracellular, perhaps 17 f followed by additional purification as described in EP 0 406 314 or by crystallization as described in WO 97/15660. In the present context, the term "expression vector" denotes a DNA molecule, linear or circular, comprising a segment encoding a polypeptide of interest operatively linked to additional Z segments that provide for its transcription. Such additional segments may include the promoter and the thermometer sequences, and may optionally include one or more origins of replication, one or more selectable markers, a * mej speaker, a polyadenylation signal, and the like. Expression vectors are generally derived from the plasmid or viral DNA, or may contain elements of both. The expression vector of the invention can be any expression vector that is conveniently subjected to recombinant DNA methods, and the choice of vector will often depend on the host cell in which the vector is to be introduced. 1 20 Therefore, the vector can be a vector that is "A replicates autonomously, that is, a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, by Example 3 a plasmid. Alternatively, the vector can being one which, when introduced into a host cell, is integrated into the genome of the host cell and replicated together with the chromosome (s) in which it has been integrated. The term "recombinantly expressed" or "recombinantly expressed" used herein in relation to the expression of a polypeptide or protein, is defined according to the standard definition in the art. The recombinant expression of a protein is generally carried out using an expression vector as described immediately above. The term "isolated", when applied to a polynucleotide molecule, denotes that the polynucleotide has been removed from its natural genetic environment and is therefore free from other foreign or unwanted coding sequences, and is in a form suitable for its use within production systems of genetically engineered proteins. Such isolated molecules are those that are separated from their natural environment and include the cDNA and the genomic clones. The isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include non-translocated 5 'and 3' regions that are naturally present such as promoters and terminators. The identification of the associated regions -i will be evident to a person with ordinary experience "t in the art (see for example, Dynan and Tijan, Nature 316: 774-78, 1985.) The term" an isolated polynucleotide "can alternatively be called a" polynucleotide ". cloning. "When applied to a protein / polypeptide, the term" isolated "indicates that the protein is found in a condition other than its natural environment.In a preferred form, the isolated protein is substantially free of other resins, particularly other homologous resins (ie "homologous impurities" (see below)). It is preferred to provide the protein in a form with more than 40% purity, more preferably in a form with more than 60% purity. Still more preferably, it is preferred to provide the protein in a highly purified form, ie, with more than 80% purity, more preferably greater than 95% purity, and even more preferably greater than 99% purity, how I know determined by SDS-PAGE. The term "isolated protein / polypeptide" can alternatively be called the "purified polypeptide / protein". The term "homologous impurities" means Any impurity (for example another polypeptide than the polypeptide of the invention) which originates from the homologous cell wherein the polypeptide of the invention is originally obtained therefrom. The term "obtained from" as used herein in relation to the specific microbial source, means that the polynucleotide and / or the polypeptide produced by the specific source, or by a cell in which a gel of the source has been inserted . The term "operatively linked", when referring to DNA segments, denotes that the segments are arranged so that the function is in accordance with their intended purposes, for example initiating transcription in the promoter and proceeding through the coding segment. until the terminator. The term "polynucleotide" denotes a single-strand or double-stranded polymer of the deoxyribonucleotide or of the ribonucleotide bases read from the 5 'end to the 3' end. The polynucleotides include RNA and DNA, and can be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. The term "polynucleotide molecule complements" denotes polynucleotide molecules having a complementary base sequence and a reverse orientation when compared to a reference sequence. For example, the 5 'sequence ATGCACGGG 3' is complementary with 5 'CCCGTGCAT 3'. The term "degenerate nucleotide sequence" denotes a nucleotide sequence that includes one or more degenerate codons (when compared to a molecule of the reference polynucleotide that encodes a polypeptide.Degenerate codons contain triplets different from nucleotides), but encode the same amino acid residue (ie, GAU triplets and GAC that each encode Asp). The term "promoter" denotes a portion of a gene that encodes DNA sequences that provide RNA / polymerase binding and initiation of transcription. Promoter sequences are commonly, but not always, found in the non-coding 5 'regions of the genes. The term "secretory signal sequence" denotes a DNA sequence encoding a polypeptide (a "secretory peptide") that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell which is synthesized. The larger peptide is commonly unfolded to remove the secretory peptide during transit through the secretory pathway.

POLYUCLEOTIDES: Within the preferred embodiments of the invention, an isolated polynucleotide of the invention will hybridize regions of similar dimensions of SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence complementary thereto, under stringent conditions at least intermediate In particular, the polynucleotides of the invention will hybridize to a denatured double-stranded DNA probe comprising either the entire sequence shown in SEQ ID NO: 3 or the entire sequence shown at positions 88-873 of SEQ ID NO: 3 or SEQ ID NO: l having a length of at least about 100 base pairs under strict at least intermediate conditions, but preferably at high stringent conditions as described in detail below. Suitable experimental conditions to determine hybridization in the medium, or high stringent conditions between a nucleotide probe and a homologous DNA or RNA sequence involves pre-shaking the filter containing the DNA fragments or the RNA to hybridize in 5 x SSC (sodium chloride / sodium citrate), Sambrook et al. 1989) for 10 minutes, and prehybridization of the filter in a solution of 5 x SaC, 5 x Denhardt's solution (Sambrook et al., 1989), 0.5% SDS and 100 μg / ml of salmon sperm DNA subjected to the action of sound, denatured (Sambrook et al., 1989), followed by 5 hybridization in the same solution containing a concentration of 10 ng / ml of a probe labeled with 32P-dCTP (specific activity higher than 1 x 109 cpm / μg) Random priming (Feinberg, AP and Vogelstein, B. (1983) Anal. Biochem. 132: 6-13), for 12 hours at ca. 10 45 ° C. The filter is then washed twice for 30 minutes in 2 x SSC, 0.5% SDS at least at 60 ° C (strict intermediate conditions), still more preferably at least 65 ° C (medium / high strict conditions), even more preferably at least 70 ° C 15 (high stringent conditions), and even more preferably at least 75 ° C (very high stringent conditions). The molecules to which the oligonucleotide probe hybridizes under these conditions are detected using an x-ray film. # As previously noted, isolated polynucleotides of the present invention include DNA and RNA. Methods for isolating DNA and RNA are well known in the art. The DNA and RNA genes that ^. The coding genes of interest can be cloned into gene libraries or DNA libraries by methods known in the art. The polynucleotides encoding the polypeptides having endoglucanase activity of the invention are then identified and isolated, for example, by hybridization or PCR. The present invention also provides polypeptides and polynucleotides of the counterpart from different bacterial strains (orthologs or paralogs). Of particular interest are the xyloglucanase polypeptides of the gram-positive alkalophilic strains, including the Bacillus species. The homologous species of a polypeptide with xyloglucanase activity of the invention can be cloned using the information and compositions provided by the present invention in combination with conventional cloning techniques. For example, a DNA sequence of the present invention can be cloned using the chromosomal DNA obtained from the cell type that expresses the protein. Suitable sources of DNA can be identified by probing Northern blots with probes designed from the sequences described herein. A library is then prepared from the chromosomal DNA of a positive cell line. A DNA sequence of the invention that encodes a polypeptide having a xyloglucanase activity can then be isolated by a variety of methods, such as probing with probes designed from the sequences described in the present specification and the claims or with one or more sets of degenerate probes based on the described sequences. A DNA sequence of the invention can also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No. 4,683,202), using primers designed from the sequences described herein. With an additional method, the DNA library can be used to transform or transfect the host cells, and the expression of the DNA of interest can be detected with a raised antibody (monoclonal or polyclonal) against the xyloglucanase cloned from B. licheniformis, ATCC 14850 , or of B. agaradhaerens, NICM 40482, expressed and purified as described in Materials and Methods and Examples 5, 6 and 7, or by an activity test that relates to a polypeptide having xyloglucanase activity.

POLIPEPTIDES: The sequence of SEQ ID NO: 4 and amino acids Nos. 30-261 of ~ SEQ ID NO: 2, respectively, is a mature xyloglucanase sequence of the catalytic active domain. The present invention also provides xyloglucanase polypeptides that are substantially homologous to the polypeptide of SEQ ID NO: 2 or SEQ ID NO: and homologs (paralogs or orthologs) of the species thereof. The term "substantially homologous" is used herein to denote polypeptides having 75%, preferably at least 80%, more preferably at least 85%, and even more preferably at least 90%, identity of the sequence with respect to the sequence shown in SEQ ID NO: 4 or in amino acids 30-261 of SEQ ID NO: 2 or their orthologs or paralogs. Such polypeptides will be more preferably at least 95% identical, and more preferably having 98% or more identity with the sequence shown in SEQ ID NO: 4 or amino acids 226-490 of SEQ ID NO: 2 or their orthologs. or paralogs. The identity of the percentage sequence is determined by conventional methods, by means of computer programs known in the art, such as GAP provided in the GCG program package (Wisconsin Manual Package Program, Version 8, August 1994). , Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) as described in Needleman, SB and Wunsch, CD, (1970), Journal of Molecular Biology, 48, 443-453, which is incorporated herein by reference In its whole. GAP is used with the following adjustments for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP Extension penalty of 0.1. The sequence identity of the polynucleotide molecules is determined by similar methods using GAP with the following settings for comparison of the DNA sequence: penalty of creation of GAP of 5.0 and penalty of GAP extension of 0.3. Substantially homologous proteins and polypeptides are characterized by having one or more substitutions, deletions or additions of amino acids. These changes are preferably of a minor nature, ie substitutions of conservative amino acids (see Table 2) and other substitutions that do not significantly affect the folding or activity of the protein or polypeptide; small deletions, typically from one to about 30 amino acids; and small amino- or carboxyl-terminal spreads, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification (an affinity tag), such as a protein A, of the tract, of poly-histidine (Nilsson et al., EMBO J. _4: 1075, 1985; Nilsson et al. ", Methods Enzymol. 198: 3, 1991. See, in general Ford et al., Protein Expression and Purification 2: 95-107, 1991, which is incorporated herein by reference. Affinity tags encoding the DNAs are available from commercial suppliers (eg, Pharmacia Biotech, Piscataway, NJ, New England Biolabs, Beverly, MA). However, even though the changes described above are preferably of a minor nature, such changes may be of a larger nature such as the fusion of larger polypeptides of up to 300 amino acids or more of both amino- or carboxyl-terminal stretches, a polypeptide of the invention having xyloglucanase activity.

Table 1 Conservative amino acid substitutions Basic arginine lysine histidine Acids: glutamic acid aspartic acid Polar: glutamine asparagine Hydrophobic: leucine isoleucine valine Aromatics: phenylalanine tryptophan tyrosine Small glycine 10 alanine serine threonine methionine In addition, of the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline and a-methyl serine) can be substituted for the amino acid residues of a polypeptide according to the invention. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and non-natural amino acids can be replaced by amino acid residues. The "non-natural amino acids" have been modified after the synthesis of the proteins, and / or • *** $ • "have a chemical structure in their side chain (s) different from that of the standard amino acids.The non-natural amino acids can be chemically synthesized, or preferentially, are commercially available, and include pipecolic acid, thiazolidin carboxylic acid, dehydroproline, 3- and 4-methylproline, and 3, 3-dimethylproline The essential amino acids in the xyloglucanase polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed ut genesis or alanine scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085, 1989) In the latter technique, unique alanine mutations are introduced into each residue in the molecule, and mutant molecules results are tested to verify the biological activity (ie xyloglucanase activity) to identify the amino acid residues that are critical to the for the activity of the molecule. See also, Hilton et al., J. Biol. Chem. 271: 4699-4708, 1996. The active site of the enzyme or other biological interaction can also be determined by physical analysis of the structure, as determined by such techniques. such as nuclear magnetic resonance, crystallography, electronic diffraction or photoaffinity labeling, in conjunction with the mutation of the assumed or putative contact site amino acids. See, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J. Mol. Biol. 5 224: 899-904, 1992; Wlodaver et al., FEBS Lett. 309: 59-64, 1992. The identities of the essential amino acids can also be inferred from the analysis of the homologies with the polypeptides which are related to a polypeptide according to the invention. Substitutions with multiple amino acids can be made and tested using known methods of mutagenesis, recombination and / or intermixing, such as those described by Reidhaar-Olson and Sauer (Science 241: 53-57, 1988), Bowie and Sauer (Proc. Nati, Acad. Sci. USA 86: 2152-2156, 1989), W095 / 17413, or WO 95/22625. Briefly, these authors describe methods for simultaneously randomly locating two or more positions in a polypeptide, or recombination / intermixing of the different mutations (W095 / 17413, W095 / 22625), followed by functional selection of a polypeptide, and then sequencing of the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (eg, Lowman et al, Biochem 30: 10832-10837, 1991, Ladner et al., US Patent No. 5,223,409, Huse, WIPO Publication WO 92/06264) and site-directed mutagenesis. region (Derbyshire et al., Gene 46: 145, 1986; Ner et al., DNA 7: 127, 1988). Mutagenesis / intermixing methods as described above can be combined with high throughput, automatic screening methods to detect the activity of the mutagenized polypeptides cloned in the host cells. The mutagenized DNA molecules encoding the active polypeptides can be recovered from the host cells and rapidly sequenced using modern equipment. These methods allow rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure. Using the methods described above, a person of ordinary skill in the art can identify and / or prepare a variety of polypeptides that are substantially homologous with SEQ ID NO: 4 or residues 30 to 261 of SEQ ID NO: 2 and retain the xyloglucanase activity of the wild-type protein. The xyloglucanase enzyme of the invention, in addition to the enzymatic core comprising the catalytically active domain, may also comprise a cellulose binding domain (CBD), the cellulose binding domain and the enzyme core (the active domain). catalytically) of the enzyme that is operatively linked. The cellulose binding domain (CBD) can exist as an integral part of the encoded enzyme, or a CBD from another source can be introduced into the xyloglucanase thereby creating a hybrid, enzyme. In this context, the term "cellulose binding domain" is proposed to be understood as defined by Peter Tomme et al. "Cellulose-Binding Domains: Classification and Ownership" in "Nzymatic Degradation of Insoluble Carbohydrates", John N. Saddler and Michael H. Penner (Eds.), ACS Symposium Series, No. 618, 1996. This definition classifies more than 120 cellulose binding domains in 10 families (I-X), and demonstrates that CBDs are found in several enzymes such as cellulases, xylanases, mannanases, arabinofuranosidases, acetyl esterases and chitinases.The CBDs have also been found in algae, for example the Porphyra purpurea of red algae as a non-hydrolytic polysaccharide binding protein, see Tomme et al., op.cit.However, most of the CBDs are cellulases and xylanases, the CBDs are found in the terminals N and C of the proteins or are internal Enzyme hybrids are already known in the art, see for example WO 90/00609 and WO 95/16782, and can be prepared by transforming a host cell from a DNA construct that c omit at least one DNA fragment encoding the binding domain of the bound cellulose, with or without a linker, to a DNA sequence encoding xyloglucanase and growing the host cell to express the fused gene. The hybrids of the enzyme can be described by the following formula: CBD-MR-X wherein CBD is the N-terminal region or the C-terminal region of an amino acid sequence corresponding at least to the binding domain of cellulose, MR is the intermediate region (the linker, and may be a bond, or a short linking group preferably from about 2 to about 100 carbon atoms, more preferably from 2 to 40 carbon atoms, or is preferably from about 2 to about 100 amino acids, more preferably from 2 to 40 amino acids, and X is an N-terminal or C-terminal region of a polypeptide encoded by the polynucleotide molecule of the invention.

Substrate of xyloglucan In addition to what has been said above about xyloglucan, it should be noted that the xyloglucan of the tamarind seeds provided by Megazime, Australia has a complex branched structure with glucose, xylose, galactose and arabinose in the ratio of 45: 36: 16: 3. Accordingly, it is strongly believed that an enzyme showing catalytic activity on this xyloglucan also has catalytic activity on other xyloglucan structures from different sources (angiosperms or gymnosperms).

Use in the detergent industry During washing and use, the coloring matters of the fabrics or clothes conventionally dyed will be purged from the fabric which then appears to be vanished and worn. Removal of the surface fibers from the tissue will partially restore the original colors and appearance of the tissue. By the term "color clarification", as used herein, is meant the partial restoration of the initial colors of the clothing or fabric in all the multiple washing cycles.

The term "removal of the balls" denotes the removal of the balls from the surface of the fabric. The term "soak liquor" denotes an aqueous liquor in which laundry can be submerged prior to being subjected to a conventional washing process. This soaking liquor may contain one or more ingredients conventionally used in a washing or laundry treatment process. The term "wash liquor" denotes an aqueous liquor in which laundry is subjected to a washing process, ie usually a combined chemical and mechanical action either manually or in a washing machine. Conventionally, the wash liquor is an aqueous solution of a liquid or powder detergent composition. The term "rinse liquor" denotes an aqueous liquor in which the laundry is submerged and treated, conventionally immediately after being subjected to a washing process, to rinse clothes to wash, ie essentially remove the solution of laundry detergent for washing. The rinse liquor may contain a fabric softening or conditioning composition. Laundry for washing subject to the method of the present invention can be conventional laundry. Preferably, the main part of the laundry is sewn or not stitched fabrics, including knitted fabrics, woven fabrics, cotton drums, yarns, and towel fabrics, made of cotton, cotton blends or natural or made cellulose materials. man (for example they originate from cellulose fibers containing xylan such as those from wood pulp) or mixtures thereof. Examples of the blends are mixtures of cotton or rayon / viscose with one or more accompanying materials such as wool, synthetic fibers (eg polyamide fibers, acrylic fibers, polyester fibers, polyvinyl alcohol fibers, polyvinyl chloride fibers). , polyvinylidene chloride fibers, polyurethane fibers, polyurea fibers, aramid fibers, and cellulose-containing fibers (for example rayon / viscose, ramin, flax / hemp, jute, cellulose acetate fibers, lyocell).

DESCRIPTION OF THE DETERGENT AND EXAMPLES Surfactant System The detergent compositions according to the present invention comprise a system of surfactant agent, wherein the surfactant can be selected from nonionic and / or anionic and / or cationic and / or ampholytic and / or zwitterionic and / or semi-polar surfactants. . The surfactant is typically present at a level from 0.1% to 60% by weight. The surfactant is preferably formulated to be compatible with the components of the enzyme present in the composition. In liquid or gel compositions, the surfactant is more preferably formulated in such a way that the stability of any enzyme in these compositions is promoted, or at least not degraded. The preferred systems to be used according to the present invention comprise as one surfactant one or more of the nonionic and / or anionic surfactants described herein. The condensates of polyethylene, polypropylene and polybutylene oxides of the alkyl phenols are suitable for use as the nonionic surfactant of the surfactant systems of the present invention, with the preferred polyethylene oxide condensates. These compounds include the condensation products of the alkyl phenols having an alkyl group containing from about 6 to about 14 carbon atoms., preferably from about 8 to about 14 carbon atoms, in a straight chain or branched chain configuration with the alkylene oxide. In a preferred embodiment, the ethylene oxide is present in an amount equal to from about 2 to about 25 moles, more preferably from about 3 to about 15 moles, of ethylene oxide per mole of alkyl phenol. Commercially available nonionic surfactants of this type include Igepal® co-630, marketed by the GAF Corporation; and Triton® X-45, X-114, X-100 and X-102, all marketed by Rohm & Haas Company. These surfactants are commonly referred to as alkylphenol alkoxylates (eg, alkyl phenol ethoxylates). The condensation products of the primary and secondary aliphatic alcohols with from about 1 to about 25 moles of ethylene oxide are suitable for use as the nonionic surfactant of the nonionic surfactant systems of the present invention. The alkyl chain of the aliphatic alcohol may be either straight or branched, primary or secondary, and generally contains from about 8 to about 22 carbon atoms. The condensation products of the alcohols having an alkyl group containing from about 8 to about 20 carbon atoms, more preferably from about 10 to about 18 carbon atoms, with from about 2 to about 10 moles of sodium oxide are preferred. ethylene per mole alcohol. Approximately 2 to about 7 moles of ethylene oxide and more preferably 2 to 5 moles of ethylene oxide per mole of alcohol are present in the condensation products. Examples of nonionic surfactants available commercially of this type include Tergitol® 15-S-9 (the condensation product of linear alcohol with Cn-Cis with 9 moles of ethylene oxide), Tergitol® 24-L-6 NMW 1 (the condensation product of the primary alcohol with -f -. C-.2-CJL with 6 moles of ethylene oxide with one narrow molecular weight distribution), both marketed by Union Carbide Corporation; Neodol® 45-9 (the condensation product of the linear alcohol with i C1-C15 with 9 moles of ethylene oxide), Neodol® 23-3 (the condensation product of the linear alcohol with C? 2-C? 3 with 3.0 moles of ethylene oxide), Neodol® 45.7 (the > condensation product of the linear alcohol with C? 4-C15 with 7 moles of ethylene oxide), Neodol® 45-5 (the condensation product of the linear alcohol with C? 4-C? 5 with 5 moles of ethylene oxide) commercialized by Shell Chemical Company, Kyro® EOB (the condensation product of the alcohol with C13-C15 with 9 moles of ethylene oxide), marketed by The Procter & Gamble Company, and Genapol LA 050 (the condensation product of alcohol with C-12-C14 with 5 moles of ethylene oxide) marketed by Hoechst. The preferred range of HLB in these products is from 8-11 and is more preferred from 8-10. Also useful as the nonionic surfactant of the surfactant systems of the present invention are the alkyl polysaccharides described in U.S. Pat. No. 4,565,647, which has a hydrophobic group containing from about 6 to about 30 carbon atoms, preferably from about 10 to about 16 carbon atoms and a polysaccharide, for example a polyglycoside, a hydrophilic group containing from about 1.3 to about 10, preferably from about 1.3 to about 3, more preferably from about 1.3 to about 2.7 units of saccharides. Any reducing saccharide containing 5 or 6 carbon atoms can be used, for example, the portions of glucose, galactose and galactosyl can be replaced by the glucosyl portions (optionally the hydrophobic group is fixed in the 2-, 3-, positions), 4-, etc., thus giving a glucose or galactose as opposed to a glycoside or galactoside). The intersaccharide bonds may be, for example, between the first position of the additional saccharide units and the 2-, 3-, 4-, and / or 6- positions of the preceding saccharide units. Preferred alkyl polyglycosides have the formula 0 (CnH2n0) t (glycosyl: wherein R is selected from the group consisting of alkyl, alkylphenyl, hydroxyalkyl, hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain from about 10 to about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3, preferably 2; t is from 0 to about 10, preferably 0; and x is from about 1.3 to about 10, preferably from about 1.3 to about 3, even more preferably from about 1.3 to about 2.7. The glycosyl is preferably derived from glucose. To prepare these compounds, the alcohol or the alkylpolyethoxy alcohol is first formed and then reacted with glucose, or a source of glucose, to form the glucoside (fixation at position 1). The additional glycosyl units can then be fixed between their position 1 and the glycosyl units of the 2-, 3-, 4-, and / or 6-positions above, preferably predominantly the 2-position. The condensation products of the Ethylene oxide with a hydrophobic base formed by the condensation of propylene oxide with propylene glycol are also suitable for use as the additional non-ionic surfactant systems of the present invention. The hydrophobic portion of these compounds will preferably have a molecular weight from about 1500 to about 1800 and will exhibit insolubility in the water. The addition of polyoxyethylene portions to this hydrophobic portion tends to increase the solubility in the water of the molecule as a whole, and the liquid character of the product is retained to the point where the polyoxyethylene content is about 50% of the total weight of the condensation product, which corresponds to the condensation with up to about 40 moles of ethylene oxide. Examples of compounds of this type include certain of the commercially available Pluronic® surfactants commercialized by BASF. Also suitable for use as the nonionic surfactant of the nonionic surfactant system of the present invention, are the condensation products of ethylene oxide with the product resulting from the reaction of propylene oxide and ethylenediamine. The hydrophobic portion of these products consists of the ethylenediamine and the excess propylene oxide, and generally a molecular weight of from about 2500 to about 3000. This hydrophobic portion is condensed with ethylene oxide to the extent that the condensation product contains from about 40% to about 80% by weight of the polyoxyethylene and has a molecular weight of from about 5,000 to about 11,000. Examples of this type of nonionic surfactant include certain of the commercially available Tetronic® compounds, marketed by BASF. Preferred for use as the nonionic surfactant of the surfactant systems of the present invention are the condensates of the polyethylene oxide of the alkyl phenols, the condensation products of the primary and secondary aliphatic alcohols with from about 1 to about 25. moles of ethylene oxide, alkyl polysaccharides, and mixtures thereof. Most preferred are alkyl phenol ethoxylates with C3-C ?4 having from 3 to 15 ethoxy groups and the alcohol ethoxylates with Cs-Cis (preferably on average Cι) having from 2 to 10 ethoxy groups, and mixtures of the same . The highly preferred nonionic surfactants are the polyhydroxy fatty acid amide surfactants of the formula R¿ - C - N - Z, O R1 wherein R1 is H, or R1 is hydrocarbyl with C? _4, 2-hydroxyethyl, 2-hydroxypropyl or a mixture thereof, R2 is hydrocarbyl with C5-C31, and Z is a polyhydroxyhydrocarbyl having a linear hydrocarbyl chain with at least 3 hydroxyls directly connected to the chain, or an alkoxylated derivative thereof. Preferably, R1 is methyl, R2 is straight C11-C15 alkyl or C6-Ci8 alkyl or an alkenyl chain such as coconut alkyl or mixtures thereof, and Z is derived from a reducing sugar such as glucose, fructose, maltose or lactose, in a reduction of reductive amination. Highly preferred anionic surfactants include alkoxylated alkyl sulfate surfactants. Examples here are water soluble salts or acids of the formula RO (A) mS03M wherein R is an unsubstituted C? 0 -C 24 alkyl group or hydroxyalkyl group having an alkyl component with C? Or C 24 , preferably an alkyl or hydroxyalkyl with C? 2-C20, more preferably alkyl or hydroxyalkyl with C? 2-C? 8, A is an ethoxy or propoxy unit, m is greater than zero, typically between about 0.5 and about 6, more preferably between about 0.5 and about 3, and M is H a cation which may be, for example, a metal cation (eg, sodium, potassium, lithium, calcium, magnesium, etc.), ammonium or an ammonium cation replaced. The alkyl ethoxylated sulfates as well as the propoxylated alkyl sulfates are contemplated herein. Specific examples of the substituted ammonium cations include methyl-, dimethyl, and trimethylammonium cations and quaternary ammonium cations such as the tetramethyl ammonium and dimethyl piperidinium cations and those derivatives of alkylamines such as ethylamine, diethylamine, triethylamine, mixtures thereof, and the like. Exemplary surfactants are C12-C18 alkyl polyethoxylate (1.0) sulfate (C? 2-C? 8E (1.0) M), C? 2-C? 8 alkyl polyethoxylate (2.25) sulfate (C12-C? 8 (2.25) M), and C? 2-? ß alkyl polyethoxylate (3.0) sulfate (C? 2-C? 8E (3.0) M), and C? 2-Cis alkyl polyethoxylate (4.0) sulfate (C? 2-C? 8E (4.0) M), where M is conveniently selected from sodium and potassium. Suitable surfactants to be used are the alkyl ester sulphonate surfactants which include the linear esters of C8-C2o carboxylic acids (ie, fatty acids) which are sulfonated with gaseous SO3 according to "The Journal of The American Oil Chemists Society ", 52 (1975), pp. 323-329. Suitable starting materials could include natural fatty substances such as those derived from tallow, palm oil, etc. The alkyl ester sulphonate surfactant, especially for laundry applications, comprises the alkyl ester sulphonate surfactants of the structural formula: OR R¿ - CH C - OR4 S03M wherein R3 is a C8-C2o hydrocarbyl, preferably an alkyl, or combination thereof, R4 is a hydrocarbyl with C? -C6, preferably an alkyl, or combinations thereof, and M is a cation which forms a salt soluble in water with the alkyl ester sulfonate. Suitable salt forming cations include metals such as sodium, potassium, and lithium, and substituted or unsubstituted ammonium cations, such as monoethanolamine, diethanolamine, and triethanolamine.

Preferably, R3 is alkyl with Cio-Ciß, and R4 is methyl, ethyl or isopropyl. Especially preferred are methyl ester sulfonates wherein R 3 is C 10 -C 16 alkyl. Other suitable anionic surfactants include the alkyl sulfate surfactants which are water soluble salts or acids of the formula R0S03M wherein R is preferably a hydrocarbyl with C? Or C C,, preferably an alkyl or hydroxyalkyl having a hydrocarbyl component. alkyl with C? 0-C20, more preferably an alkyl or hydroxyalkyl with C? 2-Ci8, and M is H or a cation, for example, an alkali metal cation (eg, sodium, potassium, lithium), or substituted ammonium or ammonium (eg, methyl-, dimethyl-, and trimethyl ammonium cations and cation quaternary ammonium such as the tetramethyl ammonium and dimethyl piperidinium cations and the quaternary ammonium cations derived from alkylamines such as ethylamine, diethylamine, triethylamine, and mixtures thereof, and the like). Typically, the C? 2_ ?6 alkyl chains are preferred for lower wash temperatures (eg below about 50 ° C) and the C66-C? 8 alquilo alkyl chains are preferred for higher wash temperatures (for example). example above about 50 ° C). Other anionic surfactants useful for detergent purposes may also be included in the laundry detergent compositions of the present invention. These may include salts (including, for example, sodium, potassium, ammonium, and substituted ammonium salts such as the mono-, di-, and triethanolamine salts) of soap, primary or secondary alkan sulfonates with C8-C22, olinsulfonates with C8-C24, acids sulfonated polycarboxylics prepared by the sulfonation of the pyrolyzed product of the alkaline earth metal citrates, for example, as described in British Patent Specification No. 1,082,179, the alkyl polyglycol ether sulfates with C 8 -C 24 (containing up to 10 moles of ethylene oxide), alkyl glycerol sulfonates, acyl glycerol fatty sulfonates, oleyl glycerol sulfates, alkyl phenol ethylene oxide sulfate, paraffin sulphonates, alkyl phosphates, isethionates such as acyl isethionates, N-acyl taurates, succinamates and alkyl sulfosuccinates, monoesters of sulfosuccinates (especially monoesters with saturated and unsaturated C 12 -C 18) and diesters of sulfosuccinates (especially diesters) resins with saturated and unsaturated C6 ~ C? 2), acyl sarcosinates, alkylpolysaccharide sulfates, such as the alkyl polyglycoside sulphates (the non-sulphonated nonionic compounds are described below), branched primary alkyl sulphates, and alkyl polyethoxy carboxylates such as those of the formula RO (CH2CH20) * -CH2COO-M + wherein R is an alkyl with C8-C22, k is an integer from 1 to 10, and M is a cation that forms a soluble salt. Resin acids and hydrogenated resin acids are also suitable, such as rosin, hydrogenated rosin, and resin acids and hydrogenated resin acids in or byproduct derivatives obtained from the chemical production of wood pulp.

The alkylbenzene sulfonates are highly preferred. Linear (straight-chain) linear alkyl benzene sulphonates (LAS) in which the alkyl group preferably contains from 10 to 18 carbon atoms are particularly preferred. Additional examples are described in "Surface Active Agents and Detergents" (Vol. I and II by Schwartz, Perry and Berch). A variety of such surfactants is also generally described in US Patent 3,929,678, (Column 23, line 58 to Column 29, line 23, incorporated herein by reference). When included therein, the laundry detergent compositions of the present invention typically comprise from about 1% to about 40%, preferably from about 3% to about 20% by weight of such anionic surfactants. The laundry detergent compositions of the present invention may also contain cationic, ampholytic, zwitterionic and semi-polar surfactants, as well as anionic and / or nonionic surfactants other than those already described herein. The cationic detersive agents suitable for use in the laundry detergent compositions of the present invention are those having a long chain hydrocarbyl group. Examples of such cationic surfactants include ammonium surfactants such as alkyltrimethylammonium halides, and those surfactants having the formula [R2 (OR3) and] [R4 (OR3) and] 2R5N + X- wherein R2 is an alkyl or alkyl benzyl group having from about 8 to about 18 carbon atoms in the alkyl chain, each R3 is selected from the group consisting of -CH2CH2-, -CH2CH (CH3) -, -CH2CH (CH2OH) -, -CH2CH2CH2-, and mixtures thereof; each R4 is selected from the group consisting of alkyl with C? -C, hydroxyalkyl with C1-C4, benzyl ring structures formed by joining two groups R4, -CH2CHOHCHOHCOR6CHOHCH2OH, wherein R6 is any hexose or hexose polymer having a weight molecular less than about 1000, and hydrogen when and is not 0; R5 is the same as R4 or is an alkyl chain, wherein the total number of carbon atoms or R2 plus R5 is not greater than about 18; each y is from 0 to approximately 10, and the sum of the values y is from 0 to approximately 15; and X is any compatible anion. The highly preferred anionic surfactants are the water-soluble quaternary ammonium compounds useful in the present composition having the formula: R! R2R3R + X "(i) wherein Ri is C8-C6alkyl, each of R2, R3 and R4 is independently alkyl with C? -C4, hydroxyalkyl with C1-C4, benzyl, and - (C2H4o) xH where x has a value from 2 to 5, and X is an anion. No more than one of R, R3 or R4 must be benzyl. The preferred alkyl chain length for Ri is C 12 -C 15, particularly where the alkyl group is a mixture of chain lengths derived from the palm or coconut seed fat or synthetically derived from the accumulated olefin or the synthesis of alcohols 0X0. Preferred groups for R2R3 and R4 are methyl and hydroxyethyl groups and the anion X can be selected from the halide, methosulfate, acetate and phosphate ions.

Examples of suitable quaternary ammonium compounds of the formulas (i) for use herein are: coconut trimethyl ammonium chloride or bromide; coconut methyl dihydroxyethyl ammonium chloride or bromide; decyl triethyl ammonium chloride; decyl dimethyl hydroxyethyl ammonium chloride or bromide; C12-C15 dimethyl hydroxyethyl ammonium chloride or bromide; coconut dimethyl hydroxyethyl ammonium chloride or bromide; Methyl Trimethyl Ammonium Methyl Sulfate; lauryl dimethyl benzyl ammonium chloride or bromide; lauryl dimethyl (ethenoxy) 4 ammonium chloride or bromide; choline esters (compounds of the formula (i) wherein Ri is CH2-CH2-0-C-C? 2-C? 4 alkyl and R2R3R4 are methyl).

OR di-alkyl imidazolines [compounds of the formula (i)].

Other cationic surfactants useful herein are also described in US Pat. No. 4,228,044 and EP 000 224. When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 25%, preferably from about 1% to about 8% by weight of such cationic surfactants. The ampholytic surfactants are also suitable for use in the laundry detergent compositions of the present invention. These surfactants can be broadly described as aliphatic derivatives of the heterocyclic secondary or tertiary amines in which the aliphatic radical can be straight or branched chain. One of the aliphatic substituents contains at least about 8 carbon atoms, typically from about 8 to about 18 carbon atoms, and at least one contains a group that is solubilized in water, anionic, for example carboxy, sulfonate, sulfate. See US Patent No. 3,929,678 (column 19, lines 18-35) for examples of ampholytic surfactants.

When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight, of such ampholytic surfactants. Zwitterionic surfactants are also suitable for use in laundry detergent compositions. These surfactants can be broadly described as derivatives of secondary or tertiary amines, derivatives of heterocyclic secondary and tertiary amines, or derivatives composed of quaternary ammonium, quaternary phosphonium or tertiary sulfonium. See US Patent No. 3,929,678 (column 19, line 38 to column 22, line 48) for examples of zwitterionic surfactants. When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such zwitterionic surfactants. Semi-polar nonionic surfactants are a special category of nonionic surfactants which include water-soluble amine oxides containing an alkyl portion of from about 10 to about 18 carbon atoms and 2 portions selected from the group consisting of alkyl and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; water-soluble phosphine oxides containing an alkyl portion of from about 10 to about 18 carbon atoms and 2 portions selected from the group consisting of alkyl groups and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; water soluble sulfoxides containing an alkyl portion of from about 10 to about 18 carbon atoms and a portion selected from the group consisting of alkyl and hydroxyalkyl portions of from about 1 to about 3 carbon atoms. The semipolar nonionic detergent surfactants include the amine oxide surfactants having the formula:OR R3 (OR) xN (R5) wherein R3 is an alkyl, hydroxyalkyl, or alkyl phenyl group or mixtures thereof containing from about 8 to about 22 carbon atoms; R4 is an alkylene or hydroxyalkylene group containing from about 2 to about 3 carbon atoms or mixtures thereof; x is from 0 to about 3; and each R 5 is an alkyl or hydroxyalkyl group containing from about 1 to about 3 carbon atoms or a polyethylene oxide group containing from about 1 to about 3 ethylene oxide groups. The R5 groups can be attached to each other, for example, through an oxygen or nitrogen atom, to form a ring structure. These amine oxide surfactants in particular include C? 0-C? 8 alkyl dimethyl amine oxides and C8-C? 2 alkoxy ethyl dihydroxy ethyl amine oxides. When included therein, the laundry detergent compositions of the present invention typically comprise from 0.2% to about 15%, preferably from about 1% to about 10% by weight of such semi-polar nonionic surfactants.

Builder System or Accumulator The compositions according to the present invention may further comprise a builder system. Any conventional accumulator system is suitable for use herein, including aluminosilicate materials, silicates, polycarboxylates and fatty acids, materials such as ethylene diamine tetraacetate, metal ion sequestering agents such as aminopolyphosphonates, particularly ethylenediamine tetramethyl phosphonic acid and diethylene triamine penta ethylene phosphonic acid . Although less preferred for environmentally obvious reasons, phosphate builders or accumulators can also be used here. Suitable builders or accumulators can be an inorganic ion exchange material, commonly an inorganic hydrous aluminosilicate material, more particularly a hydrated synthetic zeolite such as the hydrated zeolites A, X, B, HS or MAP. Another suitable inorganic builder material is layered silicate, for example SKS-6 (Hoschst). SKS-6 is a crystalline layered silicate consisting of sodium silicate (Na2Si205).

Suitable polycarboxylates containing a carboxy group include lactic acid, glycolic acid and ether derivatives thereof as described in Belgian Patents Nos. 831,368, 821,369 and 821,370. Polycarboxylates containing two carboxy groups include the water-soluble salts of succinic acid, malonic acid, (ethylenedioxy) diacetic acid, maleic acid, diglycolic acid, tartaric acid, tartronic acid and fumaric acid, as well as the ether carboxylates described in the US Pat. German Nos. 2,446,686, and 2,446,487, US 3,935,257 and the sulfinyl carboxylates described in Belgian Patent No. 840,623. Polycarboxylates containing three carboxy groups include, in particular, water-soluble citrates, aconitrates and citraconates as well as succinate derivatives such as the carboxymethyloxysuccinates described in British Patent No. 1,379,241, Lactoxysuccinates described in Dutch Application 7205873, and oxypolycarboxylate such as the 2-oxa-l, 1,3-propane tricarboxylates described in British Patent No. 1,387,447. Polycarboxylates containing four carboxy groups include the oxydisuccinates described in British Patent No. 1,261,829, the tetracarboxylates of 1, 1,2, 2-ethane, the 1,1,3,3-propane tetracarboxylates containing sulfo substituents include the sulfosuccinate derivatives described in British Patent Nos. 1,398,421 and 1,398,422 and in US Patent No. 3,936,448, and the sulfonated pyrolysed citrates described in British Patent No. 1,082,179 while polycarboxylates containing the phosphone substituents are described in the Patent British No. 1439,000. Alicyclic and heterocyclic polycarboxylates include cyclopentan-cis, cis-cis-tetracarboxylates, cyclopentadienide pentacarboxylates, 2,3,4,5-tetrahydro-furan-cis, cis, cis-tetracarboxylates, 2,5-tetrahydro-furan-cis , dicarboxylates, 2,2,5,5-tetrahydrofuran-tetracarboxylates, 1, 1, 3, 4, 5, 6-hexan-hexacarboxylates and carboxymethyl derivatives of polyhydric alcohols such as sorbitol, mannitol and xylitol. Aromatic polycarboxylates include the melific acid, pyromellitic acid and phthalic acid derivatives described in British Patent No. 1,452,343. Of the above, preferred polycarboxylates are hydroxycarboxylates containing up to three carboxy groups per molecule, more particularly citrates.

Preferred accumulator or builder systems for use in the present compositions include a mixture of a water insoluble aluminosilicate accumulator such as zeolite A or a layered silicate (SKS-6), and a water soluble carboxylate chelating agent such like citric acid. A suitable chelating agent for inclusion in the detergent compositions according to the invention is ethylenediamine-N, N'-disuccinic acid (EDDS) or the alkali metal, alkaline earth metal, ammonium, or substituted ammonium salts thereof. , or mixtures thereof. The preferred EDDS compounds are the free acid form and the sodium or magnesium salt thereof. Examples of such preferred sodium salts of EDDS include Na2EDDS and Na4EDDS. Examples of such preferred magnesium salts of EDDS include MfEDDS and Mg2 EDDS. Magnesium salts are most preferred for inclusion in the compositions according to the invention. Preferred builder or accumulator systems include a mixture of a water-insoluble aluminosilicate builder such as zeolite A, and a water-soluble carboxylate chelating agent such as citric acid.

Other builder materials or accumulators that may form part of the builder system for use in granular compositions include inorganic materials such as carbonates, bicarbonates, alkali metal silicates, and organic materials such as organic phosphonates, amino polyalkylene phosphonates and amino polycarboxylates. Other suitable water-soluble organic salts are homo- or co-polymeric acids or their salts, in which the polycarboxylic acid comprises at least two carboxyl radicals separated from each other by not more than two carbon atoms. Polymers of this type are described in GB-A-1,596,756. Examples of such salts are polyacrylates of MW 2000-5000 and their copolymers with maleic anhydride, such copolymers have a molecular weight of from 20,000 to 70,000, especially about 40,000. The builder or builder salts are usually included in amounts of 5% to 80% by weight of the composition. Builder's preferred levels for liquid detergents are from 5% to 30%.

Enzymes Preferred detergent compositions, in addition to the enzyme preparation of the invention, comprise other enzyme (s) which provide benefits in the operation of cleaning and / or care of the tissues. Such enzymes include proteases, lipases, cutinases, amylases, cellulases, peroxidases, oxidases (for example laccases). Proteases: Any protease suitable for use in alkaline solutions can be used. Suitable proteases include those of animal, plant or microbial origin. Those of microbial origin are preferred. Chemically or genetically modified mutants are included. The protease may be a serine protease, preferably an alkaline microbial protease or a trypsin-like protease. Examples of alkaline proteases are subtilisins, especially those derived from Bacillus, for example, subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06269). Examples of trypsin-like proteases are trypsin (for example of porcine or bovine origin) and Fusarium protease described in WO 89/06270. Preferred commercially available protease enzymes include those sold under the trade names Alcalase, Savinase, Primase, Durazym, and Esperase by Novo Nordisk A / S (Denmark), those sold under the trade name Maxatase, Maxacal, Maxapem, Properase, Purafect and Purafect OXP by Genencor International, and those sold under the registered name Opticlean and Optimase by Solvay Enzymes. Protease enzymes can be incorporated in the compositions according to the invention at a level from 0.00001% up to 2% of the enzyme protein by weight of the composition, preferably at a level from 0.0001% to 1% enzyme protein by weight of the composition, more preferably at a level from 0.001% to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% up to 0.2% of the enzyme protein per weight of the composition. Lipases: Any suitable lipase for use in alkaline solutions can be used. Suitable lipases include those of fungal or bacterial origin. Chemically or genetically modified mutants are included.

Examples of useful lipases include Humicola lanuginosa lipase, for example, as described in EP 258 068 and EP 305 216, a Rhizomucor miehei lipase, for example, as described in EP 238 023, a Candida lipase, such such as C. antarctic lipase, for example, the lipase A or B of C. aractica described in EP 214 761, a lipase from Pseudomonas such as a lipase from P. alcaligenes and P. pseudoalcaligenes, for example, as described in EP 218 272, a lipase from P. cepacia, for example, as described in EP 331 376, a lipase from P. stutzeri, for example, as described in GB 1,372,034, a lipase from P. fluorescens, a lipase from Bacillus, for example, a lipase from B. subtilis (Dartois et al., (1993), Biochemica et Biophysica Acta 1131, 253-260), a lipase from B. stearothermophilus (JP 64/744992) and a lipase from B. pu ilus (WO 91/16422). In addition, a number of cloned lipases may be useful, including the lipase from Penicillium camembertii described by Yamaguchi et al., (1991), Gene-103, 61-67), the lipase from Geotricum candidum (Schimada, Y. et al. , (1989), J. Biochem., 106, 383-388), and several Rhizopus lipases such as a lipase from R. delemar (Hass, MJ et al., (1991), Gene 109, 117-113), a lipase from FC niveus (Kugimiya et al., (1992), Biosci, Biotech, Biochem 56, 716-719) and a lipase from R. orizae. Other types of lipolytic enzymes such as cutinases may also be useful, for example, a cutinase derived from Pseudomonas mendocin as described in WO 88/09367, or a cutinase derived from Fusarium solani pisi (for example described in WO 90/09446) . Lipases especially suitable are lipases such as Ml Lipase®, Luma fast® and Lipomax® (Genencor), Lipolase® and Lipolase Ultra® (Novo Nordisk A / S), and Lipase P "Amano" (Amano Pharmaceutical Co. Ltd.). The lipases are normally incorporated in the detergent composition at a level from 0.00001% to 2% of the enzyme protein by weight of the composition, preferably at a level from 0.0001% to 1% of the enzyme protein by weight of the composition, more preferably at a level from 0.001% to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% to 0.2% of the enzyme protein by weight of the composition Amylases: Any amylase (a / ob) suitable for use in alkaline solutions can be used. Suitable amylases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included. Amylases include, for example, amylases a obtained from a special strain of B. licheniformis, described in greater detail in GB 1,296,839. The commercially available amylases are Duramyl®, Termamyl®, Fungamyl® and BAN® (available from Novo Nordisk A / S) and Rapidase® and Maxamyl P® (available from Genencor). Amylases are normally incorporated in the detergent composition at a level from 0.00001% to 2% of the enzyme protein by weight of the composition, preferably at a level from 0.0001% to 1% of the enzyme protein by weight of the composition, more preferably at a level from 0.001% up to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% to 0.2% of the enzyme protein by weight of the composition. Cellulases: Any cellulase suitable for use in alkaline solutions can be used. Suitable cellulases include those of bacterial or fungal origin. Chemically or genetically modified mutants are included. Suitable cellulases are described in US 4,435,307 which describes fungal cellulases produced from Humicola insolens, in WO 96/34108 and WO 96/34092 which describe bacterial alkalophilic cellulases (BCE 103) from Bacillus, and in WO 94/21801, US 5,475,101 and US 5,419,778 which describe Trichoderma EG III cellulases. Especially suitable cellulases are cellulase blowers that have color care benefits. Examples of such cellulases are "cellulases" described in European Patent Application No. 0, 495, 257. Commercially available cellulases include Celluzyme® and Carezyme® produced by a strain of Humicola insolens (Novo Nordisk A / S), KAC-500 (B) ® (Kao Corporation), and Puradax® (Genencor International). The cellulases are normally incorporated in the detergent composition at a level from 0.00001% up to 2% protein of the enzyme per weight of the composition, preferably at a level from 0.001% to 1% of the enzyme protein per weight of the composition, more preferably at a level from 0.001% up to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% to 0.2% of the enzyme protein by weight of the composition. Peroxidases / Oxidases: Peroxidase enzymes are used in combination with hydrogen peroxide on a source thereof (for example a percarbonate, perborate or persulfate). Oxidase enzymes are used in combination with oxygen. Both types of enzymes are used for "bleaching the solution", ie to prevent the transfer of a textile dye from a dyed fabric to another fabric when the fabrics are washed together in a wash liquor, preferably together with a higher agent. speaker as described for example in WO 94/12621 and WO 95/01426. Suitable peroxidases / oxidases include those of plant, bacterial or fungal origin. Chemically or genetically modified mutants are included. The enzymes of peroxidase and / or oxidase are normally incorporated in the detergent composition at a level from 0.00001% up to 2% of the enzyme protein by weight of the composition, preferably at a level from 0.0001% to 1% of the enzyme protein by weight of the composition, more preferably at a level from 0.001% to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% to 0.2% of the enzyme protein by weight of the composition . Mixtures of the enzymes mentioned above are encompassed here, in particular a mixture of a protease, an amylase, a lipase and / or a cellulase. The enzyme of the invention, or any other enzyme incorporated in the detergent composition, is normally incorporated in the detergent composition at a level from 0.00001% to 2% of the enzyme protein by weight of the composition, preferably at a level from 0.0001% up to 1% of the enzyme protein by weight of the composition, more preferably at a level from 0.001% up to 0.5% of the enzyme protein by weight of the composition, even more preferably at a level from 0.01% to 0.2% protein of enzyme by weight of the composition.

Bleaching agents Additional optional detergent ingredients that may be included in the detergent compositions of the present invention include bleaching agents such as PB1, PB4 and percarbonate with a particle size of 400-800 microns. These bleaching agent components can include one or more oxygen bleaching agents and, depending on the bleaching agent chosen, one or more bleach activators. When oxygen bleaching compounds are present, they will be present at levels from about 1% to about 25%. In general, bleaching compounds are optionally added components in non-liquid formulations, for example granular detergents. The bleaching agent component for use herein can be any of the bleaching agents useful for detergent compositions, including oxygen bleaching as well as others known in the art. The bleaching agent suitable for the present invention can be an activated or non-activated bleaching agent. One category of oxygen bleaching agent that can be used encompasses percarboxylic acid bleaching agents and salts thereof.

Suitable examples of this class of agents include magnesium monoperoxyphthalate hexahydrate, the magnesium salt of meta-chloro perbenzoic acid, 4-nonylamino-4-oxoperoxybutyric acid and diperoxydecandioic acid. The whitening agents are described in US Patents 4,483,781, US 740,446, EP 0 133 354 and US 4,412,934. Highly preferred bleaching agents also include 6-nonylamino-6-oxoperoxycaproic acid as described in US 4,634,551. Another category of bleaching agents that can be used encompasses halogen bleaching agents. Examples of hypohalite bleaching agents, for example, trichloro isocyanuric acid and the sodium and potassium dichloroisocyanurates and the N-chloro and N-bromine alloan sulfonamides. Such materials are usually added to 0.5-10% by weight of finished product, preferably 1-5% by weight. The hydrogen peroxide release agents can be used in combination with activators. bleaching agents such as tetraacetylethylenediamine (TAED), nonanoyloxybenzenesulfonate (NOBS, described in US 4, 412, 934), 3,5-trimethyl-hexanoloxybenzenesulfonate (ISONOBS, described in EP '120 591) or pentaacetylglucose (PAG), which are perhydrolyzed to form a peracid as the active bleaching species, leading to an improved bleaching effect. In addition, the bleach activators C8 (6-octanamido-caproyl) oxybenzenesulfonate, C9 (6-nonamido capropil) oxybenzenesulfonate and CIO (6-decanamido capropil) oxybenzenesulfonate or mixtures thereof are very suitable. Activators that are also suitable are acylated citrate esters such as those described in European Patent Application No. 91870207.7. Useful bleaching agents, including peroxyacids and bleaching systems comprising bleach activators and peroxygen bleach compounds for use in cleaning compositions according to the invention are described in USSN application 08 / 136,626. Hydrogen peroxide may also be present by adding an enzymatic system (ie an enzyme and therefore a substrate) which is capable of hydrogen peroxide generation at the start or during the washing and / or rinsing process. Such enziotic systems are described in European Patent Application No. 0 537 381. Bleaching agents other than oxygen bleaching agents are also known in the art and can be used here. One type of oxygen-free bleaching agent of particular interest includes photoactivated bleaching agents such as sulfonated zinc and / or aluminum phthalocyanines. These materials can be deposited on the substrate during the washing process. During irradiation with light, in the presence of oxygen, such as by hanging clothes to dry in daylight, sulfonated zinc phthalocyanine is activated and, as a result, the substrate is bleached. The preferred zinc phthalocyanine and a photoactivated bleaching process are described in US Patent 4,033,718. Typically, the detergent composition will contain about 0.025% to about 1.25%, by weight, of sulfonated zinc phthalocyanine. Bleaching agents may also comprise a manganese catalyst. Manganese catalysts can, for example, be one of the compounds described in "Efficient anganese catalysts for low-temperature bleaching", Nature 369, 1994, pp. 637-639.

Foam Suppressors Another optional ingredient is a foam suppressant, exemplified by silicones, and silica-silicone blends. The silicones may be represented generally by the alkylated polysiloxane materials, while the silica is normally used in the finely divided forms exemplified by the silica aerogels and the xerogels and hydrophobic silicas of various types. These materials can. to be incorporated as particulate materials, in which the foam suppressant is advantageously advantageously incorporated in a water-soluble or water-dispersible detergent impermeable carrier that is substantially non-active on the surface. Alternatively, the foam suppressant can be dissolved or dispersed in a liquid carrier and applied by spraying to one or more of the other components. In preferred silicone foam control agent is described in US Pat. No. 3,933,672. Other particularly useful foam suppressors are self-emulsifying silicone foam suppressors, described in the German Patent Application DTOS 2,646,126. An example of such a compound is DC-544, commercially available from Dow Corning, which is a siloxane-glycol copolymer. The preferred foam controlling agent is especially the foam suppressor system comprising a mixture of silicone oils and 2-alkyl alkanols. Suitable 2-alkyl-alkanols are 2-butyl-octanol which is commercially available under the trade name Isofol 12 R. Such a foam suppressor system is described in European Patent Application No. EP 0 593 841. The controlling agents of the foam, especially preferred, are described in European Patent Application No. 92201649.8. The compositions may comprise a mixture of silicone / silica in combination with a non-porous, fuming silica such as Aerosil®. The foam suppressors described above are normally employed at levels from 0.001% to 2% by weight of the composition, preferably from 0.01% to 1% by weight.

Other components Other components used in the detergent compositions may be employed, such as stain suspending agents, stain releasing agents, optical brighteners, abrasives, bactericides, decolorization inhibitors, coloring agents, and / or encapsulated perfumes or non-encapsulated perfumes. encapsulated Suitable encapsulation materials are especially water-soluble capsules which consist of a polysaccharide matrix and polyhydroxy compounds such as those described in GB 1,464,616. Other suitable water-soluble encapsulation materials comprise dextrins derived from the non-gelatinized starch acid esters of the substituted dicarboxylic acids such as those described in US Patent 3,455,838. These ester-acid dextrins are preferably prepared from starches such as waxy maize, waxy sorghum, sago, tapioca and potato. Suitable examples of the encapsulation materials include N-Lok manufactured by National Starch. The encapsulation material of N-Lok consists of a modified corn starch and glucose. The starch is modified by adding monofunctional substituted groups such as octenyl succinic acid anhydride. Suitable anti-redeposition and stain-suspending agents herein include cellulose derivatives such as methylcellulose, carboxymethylcellulose and hydroxyethylcellulose, and homo- or co-polymeric polycarboxylic acids or their salts. Polymers of this type include the polyacrylates and the maleic anhydride-acrylic acid copolymers previously mentioned as accumulators or builders, as well as copolymers of maleic anhydride with ethylene, methylvinyl ether or methacrylic acid, the maleic anhydride constituting at least 20 percent by weight. mol of the copolymer. These materials are normally used at a level from 0.5% to 10% by weight, more preferably from 0.75% to 8%, even more preferably from 1% to 6% by weight of the composition. Preferred optical brighteners are of anionic character, examples of which are 4,4'-bis- (2-diethanolamino-4-anilino-s-triazin-6-ylamino) stilbene-2: 2'disulfonate disodium, , 4'-bis- (2-morpholino-4-anilino-s-triazin-6-ylamino) stilbene-2: 2 'disodium disulfonate, 4,4'-bis- (2,4-dianilino-s-triazine) -6-ylamino) stilbene-2: 2 'disodium disulfonate, 4,4' '-bis- (2,4-dianilino-s-triazin-6-ylamino) stilbene-2-sulfonate monosodium, 4, 4' -bis- (2-anilino-4- (N-methyl-N-2-hydroxyethylamino) -s-triazin-6-ylamino) stilbene-2,2'-disulfonate disodium, 4,4'-bis- (4- 4,4'-bis- (2-anilino-4- (l-methyl-2-hydroxyethylamino) -s-phenyl-2, 1,3-triazol-2-yl)) stilbene-2,2'-disulfonate -triazin-6-ylamino) stilbene-2, 2 disodium disulfonate, 2 { Silyl-4"- (naphtho-1 ', 2': 4,5) -1,2,3-triazole-2" -sulfonate and 4,4'-bis (2-sulphotryl) biphenyl. Other useful polymeric materials are polyethylene glycols, particularly those of molecular weight 1000-10000, more particularly 2000 to 8000 and more preferably approximately 4000. These are used at levels from 0.20% to 5%, more preferably from 0.25% to 2.5% in weight. These polymers and the homo- or co-polymeric polycarboxylate salts mentioned above are valuable for improving the maintenance of whiteness, the deposition of ash from the fabric, and the operation of the cleaning on the clay, proteinaceous and oxidizable spots in the presence of transition metal impurities. The agents for the release of the stains useful in the compositions of the present invention are the conventional copolymers or terpolymers of terephthalic acid with ethylene glycol and / or propylene glycol units in various arrangements. Examples of such polymers are described in US Patents 4,116,885 and 4,711,730 and EP 0 272 033. A preferred polymer particularly in accordance with EP 0 272 033 has the formula: (CH3 (PEG) 43) 0.75 (POH) 0.25 CT-PO) 2.8 (T-PEG) o.4] T (POH) 0.25 ((PEG)) 43CH3)? 75 where PEG is - (OC2H4) 0-, P is (OC3H60) and T is (pOOC6H4CO). Modified polyesters such as the random copolymers of dimethyl terephthalate, dimethyl sulfoisophthalate, ethylene glycol and 1,2-propanediol, the end groups consisting mainly of sulfobenzoate and secondarily of mono esters of ethylene glycol and / or 1,2, are also very useful. -propandiol. The objective is to obtain a polymer crowned at both ends by the sulfobenzoate groups, "mainly", in the present context most of said copolymers here will be crowned at the ends by sulfobenzoate groups. However, some copolymers will be less crowned at the ends than in their entirety, and therefore their end groups may consist of monoester of ethylene glycol and / or 1,2-propanediol, and therefore consist "secondarily" of such species. The polyesters selected herein contain about 46% by weight of dimethyl terephthalic acid, about 16% by weight of 1,2-propanediol, about 10% by weight of ethylene glycol, about 13% by weight of dimethyl sulfobenzoic acid and about 15% by weight. of sulfurophthalic acid, and have a molecular weight of about 3,000. The polyesters and their method of preparation are described in detail in EP 311 342.

Softening agents Fabric softening agents can also be incorporated into laundry detergent compositions according to the present invention. These agents can be of the organic or inorganic type. The inorganic softening agents are exemplified by the smectite clays described in GB-A-1 400898 and in US 5,019,292. Organic fabric softening agents include the insoluble tertiary amines as described in GB-Al 514 276 and EP 0 011 340 and their combination with quaternary ammonium salts with C? 2-C? 4 is described in EP -B-0 026 528 and the long chain diamides as described in EP 0 242 919. Other useful organic ingredients of the fabric softening systems include high molecular weight polyethylene oxide materials as described in EP 0 299 575 and 0 313 146. The smectite clay levels are usually in the range of 5% to 15%, more preferably from 8% to 12% by weight, with the material being added as a dry mixed component to the remainder of the formulation. Fabric softening agents, organic, such as tertiary insoluble amines in water or long chain diamine materials are incorporated at levels from 0.5% to 5% by weight, usually from 1% to 3% by weight while the High molecular weight polyethylene oxide materials and water soluble cationic materials are added at levels from 0.1% to 2%, usually from 0.15% to 1.5% by weight. These materials are usually added to the spray-dried portion of the composition, although in some cases it may be more convenient to add them as a dry mixed particulate material, or to spray them as a molten liquid over other solid components of the composition.

Agents of inhibition of the transfer of dyes, Polymeric The detergent compositions according to the present invention may also comprise from 0.001% to 10%, preferably from 0.01% to 2%, more preferably from 0.05% to 1% by weight of the polymeric dye transfer inhibiting agents . Polymeric dye transfer inhibiting agents are usually incorporated in detergent compositions to inhibit the transfer of dyes from colored fabrics onto fabrics washed therewith. These polymers have the ability to form complexes or adsorb fugitive dyes removed by washing the dyed fabrics before the dyes have the opportunity to become attached to other articles in the wash. Especially suitable polymeric dye transfer inhibiting agents are N-oxide polymers, N-vinyl pyrrolidone and N-vinylimidazole copolymers, pilivinylpyrrolidone polymers, polyvinyloxazolidones and polyvinylimidazoles or mixtures thereof.

The addition of such polymers also improves the functioning of the enzymes according to the invention. The detergent composition according to the invention can be in the form of liquid, paste, gels, sticks or in granular form. Dust-free granulates can be produced, for example, as described in US Patent Nos. 4,106,991 and 4,661,452 (both by Novo Industri A / S) and can optionally be coated by methods known in the art. Examples of the waxy coating materials are products of poly (ethylene oxide) (polyethylene glycol, PEG) with average molecular weights of 1000 to 20,000; ethoxylated nonylphenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 units of ethylene oxide; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application by fluid bed techniques are given in GB 1483591. The granular compositions according to the present invention can also be in the "compact form", i.e. the same they have a relatively higher density than conventional granular detergents, ie from 550 to 950 g / 1; in such a case, the granular detergent compositions according to the present invention will contain a lower amount of the "inorganic filler salt", compared to conventional granular detergents; typical filler salts are alkaline earth metal salts of sulfates and chlorides, typically sodium sulfate; the "Compact" detergent typically comprises no more than 10% of the filler salt. The liquid compositions according to the present invention may also be in the "concentrated form", in such case, the liquid detergent compositions according to the present invention will contain a lower amount of water, compared to conventional liquid detergents. Typically, the water content of the concentrated liquid detergent is less than 30%, more preferably less than 20%, even more preferably less than 10% by weight of the detergent compositions. The compositions of the invention, for example, can be formulated as laundry detergent compositions by hand or machine including additive laundry compositions and compositions suitable for use in the pretreatment of dyed fabrics, rinsing with softening compositions of the aggregated fabrics, and compositions for use in general hard surface cleaning operations and dishwashing operations. The following examples are understood to exemplify the compositions of the present invention, but are not necessarily understood to limit or otherwise define the scope of the invention. In detergent compositions, the abbreviated identifications of the components have the following meanings: LAS: alkyl sulfonate with Ci2 linear benzene, sodium TAS: sodium alkyl sulphate sodium XYAS: alkyl sulphate with C? - C &Y Sodium SS: secondary soap surfactant of the 2-butyl octanoic acid formula 25EY: A predominantly linear primary alcohol with Ci2-Ci5 with an average of Y moles of ethylene oxide 45EY: A predominantly linear primary alcohol with C14-C15 with an average of Y moles of ethylene oxide XYEZS: an alkyl and sodium sulfate with C? - C &Y condensed with an average of Z moles of ethylene oxide per mole Non-ionic: A stoxylated / propoxylated fatty alcohol mixed with C13-C15 with an average degree of ethoxylation of 3.8 and an average degree of propoxylation of 4.5 sold under the registered name Plurafax LF404 by BASF GmbH CFAA: alkyl with C12-C14 N-methyl glucamide TFAA: alkyl with C? 2-C? 8 N-methyl glucamide Silicate: Amorphous Sodium Silicate (Si02: Na20 ratio = 2. 0) NaSKS-6: Crystalline layered silicate of the formula d-Na2Si205 Carbonate: Anhydrous sodium carbonate Phosphate: Sodium tripolyphosphate MA / AA: Maleic acid / acrylic copolymer 1: 4, average molecular weight of approximately 80,000 Polyacrylate: Homopolymer of polyacrylate with an average molecular weight of 8,000 sold under the trade name PA30 by BASF GmbH Zeolite A: Hydrated sodium aluminosilicate of the formula Nai2 (Alo2Si02) 12. 27H20 having an average particle size in the range. from 1 to 10 microns Citrate: Trisodium citrate dihydrate Citric acid: Citric acid Perborate: Anhydrous sodium perborate bleach, monohydrate, empirical formula NaB02.H202 PB4: Anhydrous sodium perborate tetrahydrate Percarbonate: anhydrous sodium percarbonate bleach of the empirical formula 2Na2C03.3H202 TAED: Tetraacetyl ethylene diamine CMC: Sodium carboxymethyl cellulose DETPMP: Diethyl triamine penta (phosphonic methylene acid), marketed by Monsanto under the Name Registered Dequest 2060 PVP: Polyvinylpyrrolidone polymer EDDS: Ethylenediamine-N, N'-disuccinic acid, isomer [S, S] in the form of the sodium salt Suppressor of the foam: 25% paraffin wax p.f. fifty ° C, 17% hydrophobic silica, 58% paraffin oil Granular foam suppressant: 12% Silicone / silica, 18% stearyl alcohol, 70% starch in the granular form Sulfate: Anhydrous sodium sulfate HMWPEO: High molecular weight polyethylene oxide.

TAE 25: Tallow alcohol ethoxylate (25) Detergent Example 1 A granular tissue cleaning composition according to the invention can be prepared as follows: C12 alkyl benzene sulfonate 6.5 linear sodium Sodium sulfate 15.0 Zeolite A 26.0 Sodium nitrilotriacetate 5.0 Enzyme of the invention 0.1 PVP 0.5 TAED 3.0 Boric acid 4.0 Perborate 18.0 Phenol sulfonate 0.1 minors Up to 100 Detergent Example II A granular, compact tissue cleaning composition (density of 800 g / 1) according to the invention can be prepared as follows: 45AS 8.0 25E3S 2.0 25E5 3.0 25E3 3.0 TFAA 2.5 Zeolite A 17.0 NaSKS-6 12.0 Citrus Acid 3.0 Carbonate 7.0 MA / AA 5.0 CMC 0.4 Enzyme of the invention 0.1 TAED 6.0 Percarbonate 22.0 EDDS 0.3 Granular foam suppressor 3.5 water / minors Up to 100% Detergent Example III The tissue cleaning compositions, granular, according to the invention which are especially useful in washing clothes from colored fabrics were prepared as follows: LAS 10.7 TAS 2.4 TFAA-4.0 45AS 3.1 10.0 45E7 4.0 - 25E3S - 3.0 68E11 1.8 - 25E5 - 8.0 Citrate 15.0 7.0 Carbonate - 10 Citric acid 2.5 3.0 Zeolite A 32.1 25.0 Na-SKS-6 - 9.0 MA / AA 5.0 5.0 DETPMP 0.2 0.8 Enzyme of the invention 0.10 0.05 Silicate 2.5 - Sulfate 5.2 3.0 PVP 0.5 - Poly (4-vinylpyridin) -N- - 0.2 Oxide / copolymer of vinyl-imidazole and vinylpyrrolidone Perborate 1.0 - Sulfonate of phenol 0.2 - Water / Children Up to 100% Detergent Example IV The fabric cleaning compositions, granular, according to the invention, which provide the "Softening through washing" capability, can be prepared as follows: 45AS 10.0 LAS 7.6 - 68AS 1.3 - 45E7 4.0 - 25E3 - 5.0 Coconut-alkyl- 1.4 1.0 dimethyl hydroxyethyl ammonium Citrate 5.0 3.0 Na-SKS-6 - 11.0 Zeolite A 15.0 15.0 MA / AA 4.0 4.0 DETPMP 0.4 0.4 Perborate 15.0 - Percarbonate - 15.0 TAED 5.0 5.0 Smectite clay 10.0 10.0 HMWPEO - 0.1 Enzyme of the invention 0.10 0.05 Silicate 3.0 5.0 Carbonate 10.0 10.0 Granular foam suppressor 1.0 4.0 CMC 0.2 0.1 Water / Children Up to 100% Example Detergent V The liquid, heavy-duty fabric cleaning compositions according to the invention can be prepared as follows: I II Acid form of LAS - 25.0 Citric acid 5.0 2.0 Acid form of 25AS 8.0 - Acid form of 25AE2S 3.0 - 25AE7 8.0 - CFAA 5 _ DETPMP 1.0 1.0 Oily acid - 1.0 Ethanol 4.0 6.0 Propandiol 2.0 6.0 Enzyme of the invention 0.10 0.05 coconut chloride-alkyl-3.0 dimethyl hydroxy ethyl ammonium smectite clay 5.0 PVP 2.0 Water / Children Up to 100% Use in the textile and cellulosic fiber processing industries In the present context, the term "cellulosic material" is proposed to mean fibers, sewn and nonwoven fabrics, including knitted fabrics, woven fabrics, cotton denims, and towel fabrics, made of cotton, cotton blends or materials natural or man-made cellulosics (e.g. originating from cellulose fibers containing xylan such as pulp) or mixtures thereof. Examples of blends are mixtures of cotton or rayon / viscose with one or more companion materials such as wool, synthetic fibers (e.g. polyamide fibers, acrylic fibers, polyester fibers, polyvinyl alcohol fibers, polyvinyl, polyvinylidene chloride fibers, polyurethane fibers, polyurea fibers, aramid fibers), and cellulose-containing fibers (eg rayon / viscose, ramin, hemp, satin / linen, jute, cellulose acetate fibers, lyocell ). The preparation of the present invention is useful in the cellulose fiber processing industry for the pretreatment or retting of hemp, linen or linen. The processing of the cellulosic material for the textile industry, such as for example cotton fiber, into a material ready for the manufacture of clothes involves several steps: the spinning of the fiber into a yarn; the construction of the spun or knitted fabric from the yarn and subsequent preparation, dyeing and finishing operations. Woven fabrics are constructed by undulating a weft thread between a series of warp threads; the threads could be of two different types. The knitted fabrics are constructed by forming a network of interfixing loops from a continuous length of yarn. The cellulosic fibers can also be used for non-woven fabrics. The preparation process prepares the textile material for the appropriate response in the dyeing operations. The substeps involved in the preparation are destemmed (for woven fabrics), washed and bleached. A combined scouring / bleaching process is also used by the industry. Although the preparation processes are more commonly employed in the woven state; Washing operations with scouring, bleaching and dyeing can also be done at the stage of the fiber or yarn. The processing regime can be either batchwise or continuous with the fabric being contacted by the liquid processing stream in a string or open width form. Continuous operations generally use a saturator whereby an approximately equal weight of the chemical bath by weight of the fabric is applied, followed by a hot swelling chamber in which the chemical reaction is carried out. A washing section then prepares the fabric for the next processing step. Batch processing is generally carried out in a processing bath whereby the fabric is contacted with about 8-15 times its weight in a chemical bath. After a period of reaction, the chemical substances are drained, the fabric rinsed and the next chemical substance is applied. The batch processing of discontinuous pads involves a saturator whereby an approximately equal weight of the chemical bath by weight of the fabric is applied to the fabric, followed by a period of swelling which in the case of the cold-pad batch could be one or more days. The woven fabrics are of the prevailing form of the construction of textile fabrics. The undulation process demands a "sizing" of the warp yarn to protect it from abrasion. Starch, polyvinyl alcohol (PVA), carboxymethyl cellulose, waxes and acrylic binders are examples of the typical sizing chemicals used because of their availability and cost. The sizing should be removed after the waving process as the first step in the preparation of the woven fabrics. The fabric with sizing in either the open width or rope shape, it is brought into contact with the processing liquid containing the desizing agents. The desprestado agent used depends on the type of sizing that is going to be removed. For PVA sizing, hot water or oxidizing processes are frequently used. The most common sizing agent for cotton fabric is based on starch. Thus more frequently, woven cotton fabrics are despressed by a combination of hot water, the α-amylase enzyme to hydrolyze the starch and a wetting agent or surfactant. The cellulosic material is allowed to stand with the chemicals "desized during a" retention period "sufficiently long to effect desizing, the retention period depends on the type of processing regime and temperature and can vary from 15 minutes to 2 minutes. hours, or in some cases, several days Typically, desizing chemicals are applied in a saturating bath which generally ranges from about 15 ° C to about 55 ° C. The fabric is then retained in equipment such as a "box J-shaped "which provides sufficient heat, usually between about 55 ° C and about 100 ° C, to improve the activity of desizing agents Chemicals, including the removed sizing agents, are washed apart from the tissue afterwards. of the end of the retention period, to ensure high whiteness or good wettability and stain As a result, the sizing chemicals and other chemical substances applied must be completely removed. It is generally believed that an efficient desizing is of crucial importance for the following preparation processes: scrubbing and bleaching. The degreasing or scrubbing process removes many of the non-cellulosic compounds naturally found in cotton. In addition to non-cellulosic impurities, degreasing or scrubbing can remove dirt, stains and materials introduced into the manufacturing, waste, such as lubricants for spinning, cone or warping. The degreasing or scrubbing process employs sodium hydroxide or related caustic agents such as sodium carbonate, potassium hydroxide or mixtures thereof. Generally, an alkaline stable surfactant is added to the process to improve the solubilization of the hydrophobic compounds and / or to prevent their redeposition again on the tissue. The treatment is generally at an elevated temperature, 80 ° C - 100 °, using strongly alkaline solutions, pH 13-14, of the degreasing agent or for scrubbing. Due to the non-specific nature of the chemical processes, not only the impurities are attacked but also the cellulose itself, leading to damage in the resistance or other desirable properties of the fabric. The softness of the cellulose tissue is a function of the residual natural cotton waxes. The non-specific nature of the strongly alkaline degreasing process at elevated temperature can not discriminate between the desirable natural cotton lubricants and the lubricants introduced for manufacturing. In addition, the conventional degreasing process can cause environmental problems due to the highly alkaline effluent of these processes. The degreasing or washing with scouring stage prepares the fabric for the optimal response in bleaching. An inadequately degreased fabric will require a higher level of the bleaching chemical in the subsequent bleaching steps. The bleaching step discolors the natural cotton pigments and removes any cotton, wood, natural, residual waste components, not completely removed during ginning, carding or degreasing. The main process in use now is an alkaline hydrogen peroxide bleach. In many cases, especially when a very high whiteness is not necessary, bleaching can be combined with degreasing or scrubbing. It is contemplated that the degreasing step can be carried out using the xyloglucanase or the xyloglucanase preparation of the present invention in combination with few of the other activities of the enzyme at a temperature of about 50 ° C - 80 ° C and a pH about 7-11, thereby replacing or supplementing the highly causticizing agents.

MATERIALS AND METHODS Strains: Becillus licheniformis, ATCC 14580, and Bacillus agaradhaerens, NCIMB 40482, respectively, comprises a DNA sequence of the invention encoding a xyloglucanase. _ _ __ Other strains E. coli strain: The cells of E. coli SJ2 (Diderichsen et al., 1990) were prepared for, and transformed by electroporation using a Gene Pulser® electroporator from BIO-RAD as described by the supplier. B. subtilis PL1885. (Diderichsen et al., (1990)). B. subtilis PL2306. This strain is B. subtilis DN1885 with the altered apr and npr genes (Diderichsen et al. (1990)), altered in the transcriptional unit of the known Bacillus subtilis cellulase gene, leading to cellulase negative cells. B. subtilis PL2316. This strain of B. subtilis DN1885 with the altered apr and npr genes (Diderichsen, B., Wedsted, U., Hedegarrd, L., Jensen, BR, Sjfholm, C. (1990) Cloning of aldB, which encodes alpha-acetolactate decarboxylase, an exoenzyme of Bacillus brevis, J. Bacteriol., 172, 4315-4321) altered in the transcriptional unit of the known xylanase gene of Bacillus subtilis, leading to the xylanase negative cells. Alterations were made essentially as described in A. L. Sonenshein et al. (1993). The competent cells were prepared and transformed as described by Yasbin et al. (1975).

Plasmids PSJ1678 (see WO 94/19454). PMOL944. This plasmid is a pUBUO derivative containing elements that make the plasmid propagatable in Bacillus subtilis, the kanamycin resistance gene and having a strong promoter and the signal peptide cloned from the amyL gene of B. licheniformis ATCC 14580. The signal peptide contains a SacII site making it convenient to clone the DNA encoding the mature part of a protein infused with the signal peptide. This leads to the expression of a Pre-protein which is directed towards the outside of the cell. The plasmid was constructed by means of ordinary genetic engineering and is briefly described as follows.

Construction of pMOL944 Plasmid pUBUO (McKenzie, T. et al., 1986), was digested with the single restriction enzyme Ncil. An amplified PCR fragment of the amyL promoter encoded on the plasmid pDN1981 (Jfrgensen et al., 1990) was digested with Ncil and inserted into the PUBUO digested with Ncil to give the plasmid pSJ2624. The two PCR primers used have the following sequences: # LWN5494 5'-GTCGCCGGGGCGGCCGCTATCAATTGGTAACTGTATCTCAGC -3 '# LWN5495 5'- GTCGCCCGGGAGCTCTGATCAGGTACCAAGCTTGTCGACCTGCAGAATGAGGCAGCA AGAAGAT -3' Primer # LWN5494 inserts a NotI site in the plasmid. The plasmid pSJ2624 was then digested with Sacl and NotI and a new PCR fragment amplified on the promoter of amyL encoded on pDNl981 was digested with Sacl and NotI and this DNA fragment was inserted into pSJ2624 digested with Sacl-Notl to give the plasmid pSJ2670. This cloning replaces the first cloning of the amyL promoter with the same promoter but in the opposite direction. The two primers used for PCR amplification have the following sequences: # LWN5938 5'- GTCGGCGGCCGCTGATCACGTACCAAGCTTGTCGACCTGCAGAATGAGGCAGCAAGA AGAT -3 '# LWN5939 5'-GTCGGAGCTCTATCAATTGGTAACTGTATCTCAGC -3' Plasmid pSJ2670 was digested with the restriction enzymes PstI and Bcll and a fragment of PCR amplified from a cloned DNA sequence encoding the alkaline amylase SP722 (International Patent Application published as W095 / 26397 which is incorporated herein for reference) was digested with PstI and Bcll and inserted to give the plasmid pMOL944. The two primers used for PCR amplification have the following sequence: # LWN7864 5 '-AACAGCTGATCACGACTGATCTTTTAGCTTGGCAC-3' # LWN7901 5 '-AATTGCAGCCGCGGCACATCATAATGGGACAAATGGG-3' Primer # LWN7901 inserts a SacII site into the plasmid.

Means: TY (as described in Ausubel, F. M. et al., 1995). LB agar (as described in Ausubel, F. M. et al., 1995). LBPG is LB agar supplemented with 0.5% Glucose and 0.05 M potassium phosphate, pH 7.0 AZCL-xyloglucan is added to 0.5% LBPG-agar. AZCL-xyloglucan is from Megazyme, Australia. The BPX medium is described in EP 0 506 780 (WO 91/09129). Medium A: Per container: 30 g of wheat bran, 45 ml of the following solution: 10 g rofec (Roquette 101-0441), 10 g NH4N03 (Merck 1187), 10 g KH2P04 (Merck 4873), 40 g of Solcafloc (Dicacel available from Dicalite-Europe-Nord, 9000 Gent, Belgium), 0.75 g MgSO4.7H20 (Merck 5886), 15 g CaC03, tap water up to 1000 ml, the pH adjusted to 6.5. Treatment in autoclave for 40 minutes at 121 ° C.

Medium B: 30 g of soy flour, 15 g of maltodex 01 (Roquette 101-7845), 5 g of peptone (Difco 0118), 0.2 ml of pluronic (PE-6100, 101-3068), deionized water to 1000 ml . 100 ml in a 500 ml Erlenmeyer flask with two partitions. Treatment in autoclave at 121 ° C for 40 minutes. Medium C: 15 g of wheat bran, 5 g of dextrose, 6.7 g of Bacto Yeast Nitrogen Base, deionized water to 1000 ml. 100 ml in a 500 ml Erlenmeyer flask with 5 partitions. Treatment in autoclave at 121 ° C for 40 minutes. Medium D: 20% sucrose, 5% soy flakes and 1% sodium phosphate. Medium E: 5 g of Yeast Extract, 10 g of Tryptone, 3 g of (NH4) 2S04, 3 g of K2HP0, 2 g of KH2P04, 1 g of CMC, 10 g of maltodextrin, 30 g of wheat bran, deionized water up to 1000 ml, the pH adjusted to 7.0. 100 ml in a 500 ml Erlenmeyer flask with 2 partitions. Treatment in autoclave at 121 ° C for 40 minutes.

Fermentation Procedure: The fungal strains were grown in agitation vessels under the following growth conditions: Medium. A, B or C (see list of media) Temperature: 26 ° C RPM: A, stationary B and C, 125 - 200 Incubation Time: A, 6 - 30 days B and C, 2 - 21 days The bacteria were grown in agitation vessels containing medium D or E at 30 ° C with shaking at 250 rpm for 3-4 days.

Xyloglucanase assay (XGU): The activity of xyloglucanase is measured using the AZCL-xyloglucan from Megazyme, Australia, as the substrate. A 0.2 solution of the blue substrate was suspended in a 0.1 M phosphate buffer at pH 7.5 under agitation. The solution is distributed under agitation to 1.5 ml Eppendorf tubes (0.75 ml each), 50 μl of the enzyme solution are added and they are incubated in an Eppendorf Thermomixer model 5436 for 20 minutes at 40 ° C with mixed at 1200 rpm. After incubation, the colored solution is separated from the solid by 4 minutes of centrifugation at 14,000 rpm and the absorbance of the supernatant is measured at 600 nm. One unit of XGU is defined as the amount of enzyme that results from an absorbance of 0.24 in a 1 cm cell at 600 nm.

Isoelectric focus: Isoelectric focusing was carried out on prefabricated Anpholine PAG plates, pH 3.5-9.5 (Pharmacia, Sweden) according to the manufacturer's instructions. The samples were applied in duplicate and after the electrophoresis the gel was divided in two. An overlayer containing 1% agarose and 0.4% AZCL xyloglucan in water is poured over one half of the gel, a similar overlay containing AZCL HE cellulose is poured over the other half. Incubation at 30 ° C for 2-16 hours. The activity of the enzyme was identified by blue zones.

General methods of molecular biology: DNA manipulations and transformations were performed using standard methods of molecular biology (Sambrook et al. (1989) Molecular Cloning: A laboratory manual, Cold Spring Harbor Lab, Cold Spring Harbor, NY; Ausubel, FM et al. (Eds. ) "Current protocols in Molecular Biology." John Wiley and Sons, 1995, Harwood, CR, and Cutting, SM (eds.) "Molecular Biological Methods for Bacillus." John Wiley and Sons, 1990). Enzymes for DNA manipulations were used according to the specifications of the suppliers. The following examples illustrate the invention.

EXAMPLE 1 Selection of microorganisms that produce alkaline xyloglucanase The microorganisms to be selected were grown in a liquid culture as described in the Materials and Methods Section. After centrifugation the supernatants of the culture were tested to verify the activity of the xyloglucanase and cellulase. The following assays were used: agarose plates containing 1% agarose in 0.08 M Britton-Robinson buffer of pH 7 or pH 9, and 0.2% of AZCL xyloglucan and 0.2% of AZCL HE cellulose, respectively, were applied 10 ml samples in holes of d = 4 mm in the agarose plates, incubation at 30 ° C for 2-16 hours. The activity of the enzyme was identified by blue halos. Culture broths with good activity on the AZCL xyloglucan and without activity or with a low activity on the AZCL HE cellulose were further tested by isoelectric focusing (IEF) as described in the Materials and Methods section. The microorganisms listed in the Materials and Methods section were found to produce an enzyme with activity on the AZCL xyloglucan which by IEF was separable from the activity on AZCL HE cellulose. When selected to verify a xyloglucanase activity, a cellulase activity is also found, and it was determined whether both activities are derived from the same enzyme. This is done by separating the enzymes by isoelectric focusing of IEF which separates the protein according to the charge or pl. After this separation, the different enzymatic activities were again identified using overlaying techniques. The sample was run in two parallel cavities; one dyed for xyloglucanase and the other for AZCL HE-cellulose. If the same strip has both activities, it is a cellulase, if only one strip has xyloglucanase and not cellulase activity, it is a xyloglucanase which can be further characterized either by purification or by cloning.

EXAMPLE 2 Production of a xyloglusanase from Bacillus licheniformis (XG) This example demonstrates a method for producing xyloglucanase from Bacillus licheniformis. Bacillus licheniformis, ATCC 14580, was grown in stirred vessels using PS 1 substrate (20% sucrose and 5% soy flakes and 1% sodium phosphate) at 30 ° C with 250 rpm stirring for 4 hours. days. The culture broth (total 10 liters) was adjusted to pH 7.5 with NaOH, followed by treatment with 50 ml of a cationic flocculating agent under stirring at room temperature and subsequently 470 ml of a 0.1% solution of a flocculating agent. anionic The flocculated material was separated by centrifugation using a Sorval RC 3B 10,000 rpm equipment for 10 minutes. The supernatant was rinsed using a Whatman glass filter of number F. A total of 9 liters was obtained with an activity of 10 XGU per ml. The liquid is concentrated up to 1.5 liters on a filtron with a cut at 10 kDa. Bacitracin cross-linked to Sepharose was used for affinity column chromatography for the removal of proteases. The unbound material was then adjusted to pH 5.0 using acetic acid and applied to a SP-Sepharose column adjusted with 20 mM sodium acetate buffer 5.0. The activity of XG was eluted from the column using a gradient of 0.5 M NaCl. The fractions containing the XG activity were pooled and concentrated on an Amicon cell with a GR 81 Polysulfon membrane with a cut at 8 kDa. The concentrated solution containing 363 XGU per ml was applied to size chromatography using a Superdex 200 column equilibrated with a 0.1 M sodium acetate buffer of pH 6.0. Pure XG 1 was eluted with an apparent molecular weight of 26 kDa and gave a single band on 26 kDa SDSS-PAGE. The specific activity was determined at 221 XGU per A.280.

EXAMPLE 3 Characterization of a xyloglucanase of Bacillus licheniformis The amino acid sequence of the enzyme produced as described in Example 2 was obtained after SDS-PAGE and electrotransfer of the 26 kDa protein. The amino acid sequence is listed in SEQ ID NO: 2 appended. This amino acid shows the highest homology with glycosyl hydrolases of Family 12 which are currently classified as endo-beta-1, 4-glucanases (EC 3.2.1.4): 65% homology with family 12 of Erwinia carotovora ß-l, 4-glucan glucanohydrolase (celS - P16630 Swissprot). Accordingly, the present invention further relates to an enzyme which has the amino acid sequence listed in SEQ ID NO: 2 or has an amino acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, even more preferably at least 90%, especially at least 95%, of homology thereto.

The xyloglucanase enzyme obtained from Bacillus licheniformis was analyzed using the xyloglucan from Megazyme AZCL for the determination of the activity of the xyloglucanase and the AZCL HE cellulose for the determination of the activity of the endoglucanase. The relative release of the blue color was 40 times higher on the xyloglucan substrate compared to the HE cellulose using the same amount of purified enzyme. The same result was found for the xyloglucanase enzyme of Aspergillus aculeatus acid (EG II) described in the patent application WO 94/14953 which also showed 2% relative activity against HE cellulose.

Optimal temperature AZCL xyloglucan from Megazyme was also used to determine the optimal temperature. The activity was measured at different temperatures after incubation with the xyloglucanase of Example 2 for 20 minutes and the release of the blue color was determined at 600 nm. Most of the color was released at 60 ° C, but a relative activity of 50% at 70 ° C was still obtained.

Per p il of pH activity To obtain a realistic pH activity profile, activity determinations were carried out using buffer solutions having a pKa value within 1.0 of the actual pH. The following buffer systems were used: pH 4-5.5 of sodium acetate, pH 6 of buffer (Sigma, pH 6.5-7.5 of Mops buffer (Sigma), pH 8-8.5 of Barbiturate, pH 9-10.5 Glycine. pH was measured after incubation in a tube operated in parallel incubation for 20 minutes at 40 ° C. Final substrate concentration of 1.33 grams of xyloglucan for 1. This is KM (see below for permanent status at pH 7.5) The activity was determined after the measurement of the formation of the reducing ends as described for the permanent state kinetic characteristics.

EXAMPLE 4 Comparison Example: Permanent status characteristics on soluble xyloglucan and CMC A method for the determination of activity against xyloglucan has been developed. The substrate is the xyloglucan (amyloid) of the tamarind seeds (the substrate is commercially available from Megazyme). Sodium phosphate buffer solution 0.1 M, pH 7.5. The substrate is prepared as a storage solution or raw material that contains 5 grams per 1 in the buffer solution. After mixing it is heated using a magnetic stirrer until a clear solution is obtained. The solution is then cooled to 40 ° C and kept in a temperature controlled water bath at 40 ° C. The diluted enzyme solution of 0.5 ml is preheated for 10 minutes and mixed with 1.0 ml of the substrate and incubated for 20 minutes. The formation of the reducing sugars is determined using the modified p-hydroxy-benzoic acid hydrazide (PHBAH) from Lever (1972) using 5 grams of sodium and potassium tartrate plus 1.5 grams of PHBAH. Glucose is used as a reference for the determination of reducing groups. The apparent catalytic properties of 2 known cellulases (endo-beta-1,4-glucanase) on the xyloglucan of tamarind seeds is measured: a. EG I of Humicola insolen (classified as belonging to family 7 of glycosyl hydrolases) described in WO 95/24471. b. EG III of Trichoderma (classified as belonging to family 12 of glycosyl hydrolases) described in US Pat. No. 5,475,101. All enzymes were purified to a high homogeneity giving a single band on SDS-PAGE and the molar extinction coefficient was used to calculate the concentration of the enzyme. The determination was based on different concentrations of the substrate from 0.25 to 3.3 grams per liter. The kinetic determination was according to the Grafit computer program and assuming Michelis kinetics Mind.

Results Enzyme of the invention: Bacillus licheniformis Xyloglucanase 1 with a molecular weight (MW) of 26 kDa. Based on a molar absorbance of 78,000, determined by amino acid analysis, the kcat was 16.5 per second (standard error of 0.6) on xyloglucan at a pH of 7.5, Km 1.1 g / 1 (standard error 0.1). Using the CMC as the substrate it was impossible to measure the kcat below 3 per second. The ratio of the maximum xyloglucanase activity to the maximum activity on the CMC is at least 5: 1. to. Comparison of EG I, alkaline cellulase of Humicola iasolexis, PM 50 ¿Da, molar extinction coefficient of 66310. A cat of 19 per second (standard error of 0.7) on xyloglucan at pH 7.5, Km 0.7 g / 1 (standard error of 0 ^ 08), On the CMC the kcat is 86 per second (standard error of 5). The ratio of the maximum xyloglucanase activity with r-speculate to the maximum activity on the CMC is 2: 9. b .. Comparison of EG III f the acid calnase of Trichoderma, PM 24 kDa, molar extinction coefficient of 71930. A kcat of 16 per second (standard error of 1.7) on the "xyoglusan at pH 7.5, Km of 0.5 g / 1 (standard error of 0.159) On the CMC the kcat is 18 per / second (e-standard error 0.6) The ratio of the maximum xyloglucanase activity to the max activity aobx.e- CMC is 8 :: 9.

EXAMPLE 5 Cloning and expression of the xyloglucanase gene of Bacillus licheniformis Preparation of genomic DNA: The strain of Bacillus licheniformis, ATCC 14580, was propagated in a liquid TY medium. After 16 hours of incubation at 30 ° C and 300 rpm, the cells were collected, and the genomic DNA was isolated by the method deserito by Pitcher et al., (1989), Construction of the genomic library: The genomic DNA was partially digested with the restriction enzyme Sau3A, and size fractionated by electrophoresis on a 0.7% agarose gel. Fragments between 2 and 10 kb in size-were isolated by electrophoresis on the paper of DEAE-cellulose (Dretzen et al., (1981)). The fragments of the isolated DNA were ligated to the plasmid DNA pSJ1678 digested with Ba HI, and the ligation or binding mixture was used to transform E. coli SJ2.

Identification of positive clones: A DNA library in E. coli, constructed as described above, was selected on LB agar plates containing 0.5% AZCL-xyloglucan (Megazyme) and 9 μg / ml of Chloramphenicol and were incubated overnight at 37 ° C. Clones expressing hydrolyzing activity appeared with blue diffusion halos. Positive clones were plated on LB agar plates containing 0.5% AZCL-xyloglucan (Megazyme). The plasmids of these clones were isolated by centrifuged preparations of the Qiagen plasmid on 1 ml of the culture broth overnight (the cells incubated at 37 ° C in TY with 9 μg / ml of Chloramphenicol and shaken at 250 rpm). One of these clones (PL2949) was further characterized by DNA sequencing of the cloned Sau3A DNA fragment. The DNA was characterized by DNA sequencing using the set or sequencing set of the terminal-deoxy-Taq cycle (Perkin-El, USA), the fluorescent labeled terminators and the appropriate oligonucleotides as primers. The analysis of the sequence data was carried out according to Devereux et al. (1984). The sequence encoding the mature protein is shown in - 'SEQ ID N0: 1 (mature signal, the mature part corresponding to positions 88-783). The derived protein sequence is shown in SEQ ID NO: 2, the mature protein corresponding to positions 30-261 of SEQ ID NO: 2.

Subcloning and expression of the xyloglucanase gene of B. licheniformis in B. subtilis: The xyloglucanase encoding the DNA sequence of the invention was amplified by PCR using the primer set by PCR consisting of these two oligonucleotides: Xyloglu .upper.Pstl 5 '-GCCTCATTCTGCAGCAGCGGCGGCTTCGTCATCAAACCCGTCGG-3' Xyloglu .lower. NotI 5 '-GCTGCATCGGCATCGCGGCCGCGGCAATACGTAAGGATGGTATCG -3' The restriction sites PstI and NotlI are underlined. The chromosomal DNA isolated from B. licheniformis as described above was used as the model in a PCR reaction using the Amplitaq DNA Polymerase (Perkin Elmer) according to the manufacturer's instructions. The PCR reaction was established in a PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.01% (w / v) gelatin) containing 200 μM of each dNTP, 2.5 units of Amplitaq polymerase (Perkin-Elmer, Cetus, USA) and 100 pmoles of each primer. The PCR reactions were carried out using a thermal DNA recycling machine (Landgraf, Germany). An incubation at 94 ° C for 1 minute followed by thirty cycles of PCR performed using a denaturation cycle profile at 94 ° C for 30 seconds, annealing at 60 ° C for 1 minute, and extension at 72 ° C for 2 minutes. μl aliquots of the amplification product were analyzed by electrophoresis in 0.7% agarose gels (NuSieve, FMC). The appearance of a DNA fragment size of approximately 0.8 kb indicated the appropriate amplification of the gene segment.

Subcloning of the PCR fragment: Aliquots of forty- μl of the PCR products as described above were purified using the QIAquick PCR kit or kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of lOmM Tris-HCl, pH 8.5. 5 μg of pMOL944 and twenty- μl of the purified PCR fragment were digested with PstI and NotI, subjected to electrophoresis on 0.8% low gelation temperature agarose gels (SeaPlaque GTG, FMC), the relevant fragments were excised from the gels, and were purified using a Juice or QIAquick Gel Extraction Set (Qiagen, USA) according to the manufacturer's instructions. The DNA fragment by isolated PCR was then ligated to pMOL944 digested and purified by PstI-Notl. The binding was carried out overnight at 16 ° C using 0.5 μg of each DNA fragment, 1 U of T4 DNA ligase and T4 ligase buffer (Beohringer Mannheim, Germany). The ligation mixture was used to transform the competent B. subtilis PL2316. The transformed cells were placed on a plate on LBPG-1010 μg / ml of the Kanamycin-agar plates. After 18 hours of incubation at 37 ° C, colonies were observed on the plates. Several clones were analyzed by isolating the plasmid DNA from the culture broth overnight. One such positive clone was streaked several times onto agar plates as previously used, this clone was called PL2954. Clone PL2954 was grown overnight in TY-10 μg / ml of Kanamycin at 37 ° C, and the next day 1 ml of the cells was used to isolate the plasmid from the cells using the Set or Miniprep Set of the Plasmid 'Centrifugado Qiaprep # 27106 according to the manufacturer's recommendations for the preparations of the B. subtilis plasmid. This DNA was sequenced in the DNA and revealed the DNA sequence corresponding to the mature part of the xyloglucanase in SEQ ID NO: 1 which is shown in positions 88-783.

Expression and purification of B. licheniformis xyloglucanase: PL2954 was grown in a 25 x 200 ml BPX medium with 10 μg / ml Kanamycin in 500 ml two separation shakers for 5 days at 37 ° C at 300 rpm.

EXAMPLE 6 Cloning and expression of the xyloglucanase gene of Bacillus agaradhaerens Preparation of Genomic DNA: Strain Bacillus agaradhaerens, NCIMB 40482, was propagated in a liquid medium as described in WO94 / 01532. After 16 hours of incubation at 30 ° C and 300 rpm, the cells were harvested, and the genomic DNA was isolated by the method described by Pitcher et al. (1989).

Construction of the genomic library: Genomic DNA was partially digested with the restriction enzyme Sau3A and fractionated by electrophoresis on a 0.7% agarose gel. The fragments between 2 and 7 kb in size were isolated by electrophoresis on DEAE-cellulose paper (Dretzen, G., Bellard, M., Sassone-Corsi, P., Chambon, P. (1981) A reliable method for the recovery of DNA fragments from agarose and acrylamide gels, Anal. Biochem., 112, 295-298). The isolated DNA fragments were ligated to the plasmid DNA of pSJ1678 digested with BamHI, and the binding mixture was used to transform E. coli SJ2. Cells were plated on LB agar plates containing 0.1% CMC (Sodium-Carboxy-Methyl-Cellulose, Aqualon, France) and 9 μg / ml Chloramphenicol and incubated overnight at 37 ° C.

Identification of positive clones: A DNA library in E. coli, constructed as described above, was selected on LB agar plates containing 0.1% CMC (Sodium-Carboxy-Methyl-Cellulose, Aqualon, France) and 9 μg / ml of Chloramphenicol and incubates overnight at 37 ° C. Transformant agents were plated in duplicate plates subsequently on the same type of plates, and these new plates were incubated 8 hours or overnight at 37 ° C. The original plates were colored using 1 mg / ml Congo Red (SIGMA, USA). The coloration was continued for half an hour with moderate orbital shaking, after which the plates were washed twice for 15 minutes using 1 M NaCl. The yellowish halos appeared at the positions where positive clones of cellulase were present, from duplicate plates these cellulase positive clones were recovered and striated again on LB agar plates containing 0.1% CMC and 9 μg / ml Chloramphenicol and incubated overnight at 37 ° C. One such clone (MB110) was further characterized by the sequencing of 7DNA of the cloned Sau3A DNA fragment. DNA was characterized by DNA sequencing by running the primer, using the set or sequencing set of the terminal-deoxy-Taq cycle (Perkin-Elmer, USA), the fluorescent labeled terminators and the appropriate oligonucleotides as the primers. The analysis of the sequence data was carried out according to Devereux et al. (1984). The sequence encoding the mature protein, subcloned in the following example, is shown in SEQ ID NO: 3. The derived protein sequence is shown in SEQ ID NO: 4.

Subcloning and expression of xyloglucanase in B. subtilis: The DNA sequence encoding the xyloglucanase of the invention was amplified by PCR using the PCR primer set consisting of these two oligonucleotides: Xyloglucanase upper SaclI 5 '-CAT TCT GCA GCC GCG GCA GAA GAT GTC ACT TCG TCA CAG - 3' Xiloglucanase lower Notl 5 '-GTT GAG AAA AGC GGC CGC CAC TTC TAA AGT TCT AAA GCA CG -3' The restriction sites of SacII and Notl are underlined. Chromosomal DNA isolated from B. Agaradherans as described above was used as a template or template in a PCR reaction using the Amplitaq DNA Polymerase (Perkin Elmer) according to the manufacturers' instructions. The reaction by PCR was established in the buffer by PCR (10 mM Tris-HCl, pH 8.3, 50 mM KC1, 1.5 M MgCl2, 0.01% (w / v) gelatin) containing 200 μM of each dNTP, 2.5 units of polymerase AmpliTaq (Perkin-Elmer, Cetus, USA) and 100 pmoles of each primer. PCR reactions were carried out using a thermal DNA recycling machine (Landfrag, Germany). An incubation at 94 ° C for 1 minute followed by thirty cycles of PCR was performed using a denaturation cycle profile at 94 ° C for 30 seconds, annealing at 60 ° C for 1 minute, and extension at 72 ° C for 2 minutes . Five μl aliquots of the amplification product were analyzed by electrophoresis in 0.7% agarose gels (NuSieve, FMC). The calving of a DNA fragment size of 1.6 kb indicated the appropriate amplification of the gene segment.

Subcloning of the PCR fragment: Forty-five μl aliquots of the PCR products generated as previously described were purified using the QIAquick PCR kit or kit (Qiagen, USA) according to the manufacturer's instructions. The purified DNA was eluted in 50 μl of 10 mM Tris-HCl, pH 8.5. 5 μg of pMOL944 and twenty-five μl of the purified PCR fragment were digested with SacII and NotI, subjected to electrophoresis on 0.8% low gelation temperature agarose gels (SeaPlaque GTG, FMC), the relevant fragments were hidden from the gels , and purified using a QIAquick Gel Extraction Kit (Qiagen, USA) according to the manufacturer's instructions. The DNA fragment by isolated PCR was then ligated to pMOL944 digested and purified with SacII-Notl. The binding was carried out overnight at 16 ° C using 0.5 μg of each DNA fragment, 1 U of the T4 DNA ligase and the T4 ligase buffer (Boehringer Mannheim, Germany). The binding mixture was used to transform the competent B. subtilis PL2306. Transformed cells were plated on LBPG-10 μg / ml 0.1% Xyloglucan-AZCL agar plates-Kanamycin. After 18 hours of incubation at 37 ° C, cells that positively express the cloned xyloglucanase were observed as colonies surrounded by blue halos. One such positive clone was repeatedly streaked onto agar plates as previously used, this clone was called MB563. The clone MB563 was grown overnight in TY-10 μg / ml Kanamycin at 37 ° C, and the next day 1 ml of cells was used to isolate the plasmid from the cells using the Set or Set Miniprep of the Centrifuged Plasmid Qiaprep # 27106 according to the manufacturers' recommendations for the preparations of the B. subtilis plasmid.

Expression and Purification of the xyloglucanase of B. agaradhaerens: MB563 was grown in a BPX medium of 25 x 200 ml with 10 μg / ml kanamycin in shaker containers of two 500 ml separators for 5 days at 37 ° C at 300 rpm.

EXAMPLE 7 Characterization of a xyloglucanase from Bacillus agaradhaerens Purification and characterization: A culture fluid was received from the 7000 ml agitation vessel of Bacillus with clone MB 563 expressed as described in example 6. The fermentation medium was adjusted to pH 7.5 with NaOH and flocculated using a C521 cationic flocculation agent. (10% solution) and a 0.1% solution of the anionic agent A130: To 7000 ml of the fermentation medium 168 ml of C521 (10%) are added simultaneously with 335 ml of A130 under stirring at room temperature. The flocculated material is separated by centrifugation using a Solval RC 3B centrifuge machine at 10,000 rpm for 30 minutes. The supernatant was clarified using a Whatman No. F glass filter. In total 6500 ml of a clear solution containing 227,500 units of XGU was obtained. The clear 2500 ml solution was applied to a 1000 ml Q-Sepharose column equilibrated with 50 mM Tris buffer pH 7.0. The bound enzyme was eluted using a NaCl gradient. The partially purified product was concentrated using an Amicon ultrafiltration cell with a membrane with a cut-off value of 6 kDa. A total of 70,000 units of XGU and 2.5 grams of the enzyme were obtained. The pure sample gave a single band on SDS-PAGE with an apparent molecular weight of 61 kDa. A molar extinction coefficient of 123,040 was used to calculate the protein concentration of the enzyme and is based on the amino acid composition deduced from the DNA sequence. The centered fraction was formulated with 40% sorbitol and was used for enzyme tests in detergent and textile applications.

Immunological methods Bacillus agaradhaerens highly purified XEG1 obtained from clone MB 563 was used for the production of the antiserum. The immunization procedure was carried out in a DAKO apparatus using rabbits. Each rabbit was immunized with 100 μl of cellulase (0.4 mg of protein per ml) mixed with 100 μl of the adjuvant. Each rabbit was immunized 15 times with an interval of one week. The rabbit serum was collected and the gammaglobulin was purified from the serum.

Optimal temperature: AZCL xyloglucan from Megazyme was also used to determine the optimal temperature. The activity was measured at different temperatures after incubation with the Bacillus agaradhaerens XEG1 for 20 minutes and the release of the blue color was determined at 600 nm. The main part of the color was released at 50 ° C, but still 20% of the relative activity was obtained at 60 ° C.

Kinetic characteristics of permanent state on soluble xyloglucan and CMC: The method for determining the activity against the xyloglucan described in Example 4 was applied to the xyloglucanase of B. agaradhaerens of the invention. The substrate was diluted to at least 8 different concentrations with 4 below the apparent Km (see below). The following apparent catalytic properties of Bacillus agaradhaerens XEG1 (endo-beta-1,4-xylo-glucanases) on the xyloglucan of the tamarind seeds were found: At pH 7.5 the kcat of 183 per second and an apparent Km of 0.05 grams per 1 was obtained. By comparison of the activity on the CMC (Degree of substitution of 0.7 and a degree of polymerization of 200) using the same permanent state kinetic method with 8 different concentrations of the substrate in duplicate below the Km, the following data were obtained: kcat of 64 per second and one Km of 2.2 grams per 1, indicating that this enzyme prefers the xyloglucan of carboxymethyl cellulose. The alkaline activity, at pH 10 using a glycine buffer and a xyloglucan substrate, led to a Kcat of 90 per second and an apparent Km of 0.08 grams per 1 indicating that this xyloglucanase has a very high alkaline activity. The pH activity profile used by Megazyme xyloglycan AZCL blue indicated that the enzyme has more than 50% relative activity in the pH range of 5.0 to 10.5. In detergent matrices using the Megazyme blue substrate, the following data was obtained. In the US Tide powder detergent, 1 gram per 1 with a hardness of 9 German of water, 66% relative activity with respect to the buffer pH 7.5. Using European conditions and Ariel powder in 5 grams per 1 and hardness of 18 Germán, the relative hardness of 86% was obtained. These data indicate that Bacillus agaradhaerens CEG1 is very suitable for use in detergent matrices.

LITERATURE Ausubel, F. M. et al. (eds.) "Current protocols m Molecular Biology". John Wiley and Sons, 1995.

N. C. Carpita and D. M. Gibeaut (1993) The Plant Journal 3: 1-30, T. Christensen et al. Biotechnology vol 6 page 1419-1422, 1988.

Devereux et al. (1984) Nucleic Acids Res. 12, 387-395.

Diderichsen, B., Wedsted, U., Hedegaard, L., Jensen, B.R., Sjßholm, C. (1990) Cloning of aldB, which encodes alpha-acetolactate decarboxylase, an exoenzyme from Bacillus brevis. J. Bacteriol. 172: 4315-4321.

Dretzen, G., Bellard, M., Sassone-Corsi, P., Chambón, P. (1981) A reliable method for the recovery of DNA fragments from agarose and acryla ide gels. Anal. Biochem., 112, 295-298.

Eriksson, O.E. & Hawksworth, D.L .: Systema Ascomycetum vol 12 (1993).

S. Fry et al (1992) Biochemical Journal 282: 821-828 Hawksworth, D.L. , Kirk, P.M., Sutton, B.C and Pegler, D.N .: Dictionary of the fungi, International Mycological Institute, 616 pp (1995); T. Hayashi and D. P. Delmer (1988) Carbohydrate Research 181: 273-277.

Henrissat, B. 1991. A classification of glycosyl hydrolases based on amino acid sequence similaritites. Biochem. J., 280: 309-316.

Henrissat, B., and A. Bairoch. 1993. New families in the classification of glycosyl hydrolases based on amino acid sequence if ilaritites. Biochera J., 293: 781-788.

Jülich, W.: Higher Taxa of Basidiomycetes, Bibliotheca Mycologia 85, 485 pp (1981).

J0rgensen, P.L. et al., 1990, Gene, 96, p. 37-41.

McKenzie, T. et al., 1986, Plasmid 15: 93-103.

Leatherbarrow, R. J. (1992) Grafit version 3.0 Erithacus Software Ltd. Staines, U.K.

Lever, M. (1972) A new reaction for colormetric deter ination of carbohyds. Anal. Biochem. 47, 273-279.

O'Donnell, K.: Zygamycetes in culture, University of Georgia, US, 257 pp (1979).

Pitcher, D.G., Saunders, N.A., Owen, R.J. (1989). Rapid extraction of bacterial genomic DNA with guanidium thiocyanate. Lett. Appl. Microbiol., 8, 151-156.

J. K. C. Rose et al (1996) Plant Physiology 110: 493-499 TO THE. Sonenshein, J.A. Hoch and Richard Losick (Eds.) (1993) Bacillus subtilis and other Gram-Positive Bacteria, American Society for microbiology, p.618.

Vincken, J.P. , Beldman, G., and Voragen, A.G.J. Subst-specificity of endoglucanases - what determines xyloglucanase activity. Carbohyd Resaarch 298 (4): 299-310, 1997.

Von Arx, J. A .: The geneon of fungi sporulating in culture, 424 pp (1981).

R. L. Whistler and J. N. BeMiller (1993) Industrial gums: Polysaccharides and their derivatives, Academic Press Inc.

Yasbin, R.E., Wilson, G.A. and Young, F.E. (1975) Transformation and transfection in lysogenic strains of Bacillus subtilis: evidence for selective induction of prophage in competent cells. J. Bacteriol, 121: 296-304. W.S. York et al (1996) Carbohyd Research 285: 99-128.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: (A) NAME: NOVO NORDISK A / S (B) STREET: Novo Alie (C) CITY: Bagsvaerd (E) COUNTRY: Denmark (F) POSTAL CODE ( ZIP): DK-2880 (G) TELEPHONE: +45 44 44 88 88 (H) TELEFAX: +45 44 49 32 56 (ii) TITLE OF THE INVENTION: XILOGLUCANASAS ALCALINA iii) NUMBER OF SEQUENCES: 4 (iv) COMPUTER READABLE FORM: (A) TYPE OF MEDIA: Flexible magnetic disk (B) COMPUTER: compatible with IBM PC (C) OPENG SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patentln Relay # 1.0 , Version # 1.30 (EPO) (2) INFORMATION FOR SECTION ID NO: l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 786 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE (A) ORGANISM: Bacillus licheniformis ATCC 14580 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l: GTGAAAAACA ACCATTTGCT AAAATCCATT CTGCTATGGG GTGCCGTATG CATCATAGTG 60 CTGGCAGGGC CGCTCTCAGC ATTTGCCGCT TCGTCATCAA ACCCGTCGGA TAAATTGTAT 120 TTTAAAAACA AAAAATACTA CATATTCAAC AATGTATGGG GAGCCGACCA GGTCAGCGGC 180 TGGTGGCAGA CCATTTATCA TAATAGTGAT TCAGATATGG GCTGGGTGTG GAATTGGCCG 240 AGCAATACAA GCACGGTAAA AGCTTATCCG TCGATCGTCA GCGGCTGGCA TTGGACTGAA 300 GGCTATACTG CCGGAAGCGG CTTCCCGACG CGATTGTCAG ATCAAAAAAA CATCAACACG 360 AAAGTCAGCT ATTCGATCAG CGCAAACGGC ACATACAATG CCGCATATGA CATTTGGCTC 420 CACAATACAA ACAAGGCGAG CTGGGATTCG GCTCCAACCG ATGAGATTAT GATCTGGCTC 480 AATAACACAA ACGCCGGACC TGCCGGTTCC TATGTCGAAA CTGTATCGAT TGGCGGGCAC 540 AGTTGGAAAG TATATAAAGG CTATATTGAT GCTGGAGGCG GCAAAGGGTG GAACGTGTTT 600 TCATTTATCA GAACAGCAAA CACCCAAAGT GCGAACCTGA ATATTCGGGA TTTCACGAAT 660 TATCTTGCCG ACTCCAAACA GTGGCTTTCC AAAACAAAGT ATGTCAGCAG TGTGGAATTC 720 GGTACTGAAG TTTTCGGAGG CACAGGACAA ATTAATATTT CCAATTGGGA CGTAACGGTC 780 CGCTGA 786 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 261 base pairs (B) TYPE: amino acid (C) TYPE OF HEBRA: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein Xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 Val Lys Asn Asn His Leu Leu Lys Ser lie Leu Leu Trp Gly Ala Val 1 5 10 15 Cys Lie Lie Val Leu Ala Gly Pro Leu Ser Ala Phe Ala Ala Ser Ser 20 25 30 Ser Asn Pro Ser Asp Lys Leu Tyr P.he Lys Asn Lys Lys Tyr Tyr He 35 40 45 Phe Asn Asn Val Trp Gly? The Asp Gln Val Ser Gly Trp Trp Gln Thr 50 55, 60 He Tyr His Asn Being Asp Being Asp Met Gly Trp Val Trp Asn Trp Pro 65 70 75 80 Ser Asn Thr Ser Thr Val Lys Wing Tyr Pro Ser He Val Ser Gly Trp 85 90 95 His Trp Thr Glu Gly Tyr Thr Wing Gly Ser Gly Phe Pro Thr Arg Leu 100 105 110 Being Asp Gln Lys Asn He Asn Thr Lys Val Ser Tyr Ser He Be Wing 115 120 125 Asn Gly Thr Tyr Asn Wing Wing Tyr Asp He Trp Leu His Asn Thr Asn 130 135 140 Lys Wing Ser Trp Asp Ser Wing Pro Thr Asp Glu He Met He Trp Leu 145 150 155 160 Asn Asn Thr Asn Wing Gly Pro Wing Gly Ser Tyr Val Glu Thr Val Ser 165 170 175 He Gly Gly His Ser Trp Lys Val Tyr Lys Gly Tyr He Asp Wing Gly 180 185 190 Gly Gly Lys Gly Trp Asn Val Phe Ser Phe He Arg Thr Wing Asn Thr 195 200 205 Gln Ser Wing Asn Leu Asn He Arg Asp Phe Thr Asn Tyr Leu Wing Asp 210 215 220 Ser Lys Gln Trp Leu Ser Lys Thr Lys Tyr Val Ser Ser Val Glu Phe 225 230 235 240 Gly Thr Glu Val Phe Gly Gly Thr Gly Gln He Asn He Ser Asn Trp 245 250 255 Asp Val Thr Val Arg 260 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1614 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE (A) ORGANISM: Bacillus agaradhaerens NCIMB 40482 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 GAAGATGTCA CTTCGTCACA GTTGGATATT CACTCCTATG TAGCTGACAT GCAGCCTGGC 60 TGGAATTTAG GAAATACGTT TGACGCTGTT GGAGATGATG AAACAGCGTG GGGGAATCCT 120 CGTGTAACAA GAGAGTTAAT AAAAACGATT GCTGATGAAG GGTATAAAAG CATTCGTATC 180 CCAGTGACAT GGCAAAATCA AATGGGTGGT TCTCCAGATT ATACGATAAA TGAAGATTAT 240 ATCAATCGGG TGGAGCAAGC GATAGATTGG GCGTTGGAGG AAGACTTATA TGTGATGTTA 300 AATGTGCATC ATGACTCATG GCTGTGGATG TATGATATGG AACATAACTA TGATGAGGTC 360 ATGGCAAGAT ATACAGCTAT TTGGGAACAA TTGTCGGAAA AATTCAAAAG CCACTCCCAT 420 AAGTTGATGT TTGAGAGTGT CAATGAGCCT AGGTTTACGC AGGAGTGGGG AGAGATTCAA 480 GAAAATCATC ATGCTTACTT AGAAGATTTA AATAAGACGT TCTATTATAT TGTCAGAGAG 540 TCAGGAGGCA ATAATGTGGA GCGCCCTTTA GTATTGCCTA CGATAGAAAC AGCCACGTCT 600 CAGGATTTAC TAGATCGCTT GTATCAAACA ATGGAAGACT TGGATGATCC TTATTTAATT 660 GCCACGGTGC ATTATTATGG CTTCTGGCCA TTTAGTGTCA ATATAGCAGG GTACACTCAT 720 TTTGAACAGG AAACACAACA AGATATTATA GACACCTTTG ACCGTGTTCA TAACACATTT 780 ACAGCGCGTG GTGTCCCAGT TGTATTAGGC GAATTCGGTT TGTTAGGCTT TGACAAAAGT 840 ACGGATGTGA TTCAGCAAGG GGAGAAATTA AAGTTTTTTG AGTTTCTCAT CCATCATCTC 900 AATGAACGTG ATATAACCCA TATGTTATGG GATAACGGCC AGCATTTTAA TCGAGAAACT 960 TATGCATGGT ATGATCAAGA ATTTCATGAC ATATTAAAAG CGAGTTGGGA GGGGCGTTCT 1020 GCTACAGCAG AGTCTAATTT GATTCATGTG AAGGACGGAA AGCCAATTAG AGATCAAGAT 1080 ATACAGCTTT ACTTAAACGG AAATGAGCTA ACAGCCTTAC AGGCAGGGGA GGAATCGCTT 1140 GTTCTAGGAG AGGATTATGA ACTAGCAGGA GGCGTATTAA CGCTAAAAGC GGACACCCTC 1200 ACAAGACTAA TTACCCCTGG TCAATTAGGA ACCAATGCAG TCATCACAGC ACAATTTAAT 1260 TCTGGAGCAG ACTGGCGTTT TCAATTACAG AATGTGGACG TGCCAACGGT CGAAAATACA 1320 GATGGCTCAA CATGGCATTT TGCGATCCCT ACCCATTTTA ATGGTGATAG TCTTGCGACG 1380 ATGGAAGCTG TTTATGCAAA CGGAGAATAT GCTGGGCCGC AAGATTGGAC GTCATTTAAA 1440 GAATTTGGCG AGGCGTTTTC TCCTAATTAC GCCACAGGGG AAATTATTAT ATCAGAAGCC 1500 TTCTTTAACG CGGTACGGGA TGATGATATC CATTTAACAT TTCATTTTTG GAGCGGAGAG 156 ACGGTGGAAT ATACCTTACG TAAAAATGGC AATTATGTTC AAGGTAGACG GTAA 161 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 537 amino acids (B) TYPE: amino acid (C) TYPE OF HEBRA: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (i) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: Glu Asp Val Thr Ser Ser Gln Leu Asp He H s Ser Tyr Val Wing Asp 1 5 10 15 Met Gln Pro Gly Trp Asn Leu Gly Asn Thr Phe Asp Wing Val Gly Asp 20 25 30 Asp Glu Thr Wing Trp Gly Asn Pro Arg Val Thr Arg Glu Leu He Lys 40 45 Thr He Wing Asp Glu Gly Tyr Lys Ser He Arg He Pro Val Thr Trp 50 55 60 Gln Asn Gln Met Gly Gly Ser Pro Asp Tyr Thr He Asn Glu Asp Tyr 65 70 75 80 He Asn Arg Val Glu Gln Ala He Asp Trp Ala Leu Glu Glu Asp Leu 85 90 95 Tyr Val Met Leu Asn Val His His Asp Ser Trp Leu Trp Met Tyr Asp 100 105 110 Met Glu His Asn Tyr Asp Glu Val Met Wing Arg Tyr Thr Wing He Trp 115 120 125 Glu Gln Leu Ser Glu Lys Phe Lye Ser His Ser His Lys Leu Met Phe 130 135 140 Glu Ser Val Asn Glu Pro Arg Phe Thr Gln Glu Trp Gly Glu He Gln 145 150 155 160 Glu Asn His His Wing Tyr Leu Glu Asp Leu Asn Lys Thr Phe Tyr Tyr 165 170 175 He Val Arg Glu Be Gly Gly Asn Asn Val Glu Arg Pro Leu Val Leu 180 185 190 Pro Thr He Glu Thr Wing Thr Ser Gln Asp Leu Leu Asp Arg Leu Tyr 195 200 205 Gln Thr Met Glu Asp Leu Asp Asp Pro Tyr Leu He Wing Thr Val His 210 215 220 Tyr Tyr Gly Phe Trp Pro Phe Ser Val Asn He Wing Gly Tyr Thr His 225 230 235 240 Phe Glu Gln Glu Thr Gln Gln Asp He He Asp Thr Phe Asp Arg Val 245 250 255 His Asn Thr Phe Thr Wing Arg Gly Val Pro Val Val Leu Gly Glu Phe 260 265 270 Gly Leu Leu Gly Phe Asp Lya Ser Thr Asp Val He Gln Gln Gly Glu 275 280 285 Lys Leu Lys Phe Phe Glu Phe Leu He His His Leu Asn Glu Arg Asp 290 295 300 He Thr His Met Leu Trp Asp Asn Gly Gln His Phe Asn Arg Glu Thr 305 310 315 320 Tyr Ala Trp Tyr Asp Gln Glu Phe His Asp He Leu Lys Wing Ser Trp 325 330 335 Glu Gly Arg Ser Ala Thr Ala Glu Ser Asn Leu He His Val Val Lys Asp 340 345 350 Gly Lys Pro lie Arg Asp Gln Asp He Gln Leu Tyr Leu Asn Gly Asn 355 360 365 Glu Leu Thr Ala Leu Gln Ala Gly Glu Glu Ser Leu Val Leu Gly Glu 370 375 380 Asp Tyr Glu Leu Wing Gly Gly Val Leu Thr Leu Lys Wing Asp Thr Leu 385 390 395 400 Thr Arg Leu He Thr Pro Gly Gln Leu Gly Thr Asn Wing Val He Thr 405 410 415 Wing Gln Phe Asn Ser Gly Wing Asp Trp Arg Phe Gln Leu Gln Asn Val 420 425 430 Asp Val Pro Thr Val Glu Asn Thr Asp Gly Ser Thr Trp His Phe Wing 435 440 445 He Pro Thr His Phe Asn Gly Asp Ser Leu Ala Thr Met Glu Wing Val 450 455 460 Tyr Wing Asn Gly Glu Tyr Wing Gly Pro Gln Asp Trp Thr Ser Phe Lys 465 470 475 480 Glu Phe Gly Glu Wing Phe Ser Pro Asn Tyr Wing Thr Gly Glu He He 485 490 495 He Be Glu Wing Phe Phe Asn Wing Val Arg Asp Asp Asp He His Leu 500 505 510 Thr Phe His Phe Trp Ser Gly Glu Thr Val Glu Tyr Thr Leu Arg Lys 515 520 525 Asn Gly Asn Tyr Val Gln Gly Arg Arg 530 535 Se it states that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following

Claims (27)

1. An isolated polypeptide capable of unfolding or separating the beta-1, 4-glycosidic bonds in the xyloglucan skeleton, characterized in that the ratio of kcat on the xyloglucan of tamarind seeds to kcat on carboxymethylcellulose (CMC) or microcrystalline cellulose (Avicel) is at least 2: 1, measured at pH 7.5.

2. The xyloglucanase according to claim 1, characterized in that the ratio or ratio is at least 4: 1, preferably at least 5: 1, more preferably at least 8: 1, especially at least 10: 1.

3. The xyloglucanase according to claim 1, characterized in that it does not exhibit activity on carboxymethylcellulase (CMC) or microcrystalline cellulose (Avicel).

4. The xyloglucanase polypeptide according to claim 1, characterized in that it is selected from the group consisting of: (a) polypeptide molecules comprising an amino acid sequence as shown in SEQ ID NO: 4 of amino acid residue 1 to amino acid residue 537; and (b) polypeptide molecules that are at least 70% identical to the amino acids of SEQ ID NO: 4 of residue 1 to residue 537.

5. The polypeptide of xyloglucanase according to claim 4, characterized in that it is produced by Bacillus agaradhaerens, preferably Bacillus agaradhaerens, NCIMB 40482.

6. The xyloglucanase polypeptide according to claim 4, characterized in that it is derived from the polypeptide comprising the amino acids of SEQ ID NO: 4 from residue 1 to residue 537 by substitution, deletion or addition of one or more amino acids.

7. The xyloglucanase polypeptide according to claim 1, characterized in that it is selected from the group consisting of: (a) polypeptide molecules comprising an amino acid sequence as shown in SEQ ID NO: 2 from amino acid residue 30 to amino acid residue 261; and (b) polypeptide molecules that are at least 70% identical to the amino acids of SEQ ID NO: 2 from residue 30 to residue 261.

8. The xyloglucanase polypeptide according to claim 7, characterized in that it is produced by Bacillus licheniformis, preferably Bacillus licheniformis, ATCC 14580.

9. The xyloglucanase polypeptide according to claim 7, characterized in that it is derived from the polypeptide comprising the amino acids of SEQ ID NO: 2 from residue 30 to residue 261 by substitution, deletion or addition of one or more amino acids.

10. The polypeptide of xyloglucanase according to claim 4 or 7, characterized in that it is immunologically reactive with a polyclonal antibody raised against the polypeptide in the purified form.

11. The xyloglucanase polypeptide according to claims 4 or 7, characterized in that it is selected from the group of xyloglucanases belonging to families 5, 7 and 12 of the glycosyl hydrolases.

12. An isolated polynucleotide molecule, which encodes a polypeptide capable of unfolding or separating the beta-1, 4-glycosidic bonds in the xyloglucan backbone and exhibiting a ratio of kcat over the xyloglucan of the tamarind seeds with respect to kCa over the carboxymethylcellulose (CMC) or microcrystalline cellulose (Avicel) of at least 2: 1, measured at pH 7.5, such a polynucleotide molecule is characterized in that it is selected from the group consisting of: (a) polynucleotide molecules comprising a nucleotide sequence as shown in SEQ ID NO: 3 from nucleotide 1 to nucleotide 1611; (b) polynucleotide molecules that encode a polypeptide that is at least 70% identical to the amino acid sequence of SEQ ID NO: 4 from amino acid residue 1 to amino acid residue 537; (c) degenerate the nucleotide sequences of (a) or (b); and (d) polynucleotide molecules that hybridize to a denatured, double-stranded DNA probe, which is selected from the group consisting of DNA probes comprising the sequence shown at positions 1-1611 of SEQ ID NO: 3 and DNA probes comprising a subsequence of positions 1-1611 of SEQ ID NO: 3 having a length of at least about 100 base pairs, under the following conditions: pre-demixing of the filter containing the DNA fragments or RNA for hybridization in 5 x SSC (sodium chloride / sodium citrate) for 10 minutes, prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution, 0.5% SDS and 100 μg / ml of sperm DNA of salmon subjected to sound, denatured, followed by hybridization in the same solution containing a concentration of 10 ng / ml of a probe labeled with 32P-dCTP, randomly primed (specific activity higher than 1 x 109 cpm / μg) for 12 hours a about 45 ° C; and then washing the filter twice for 30 minutes in 2 x SSC, 0.5% SDS at a temperature of at least 60 ° C.

13. The isolated polynucleotide molecule according to claim 12, characterized in that the polynucleotide is DNA.

14. An expression vector, characterized in that it comprises the following operatively linked elements: a transcription promoter; a DNA segment selected from the group consisting of (a) polynucleotide molecules that encode a polypeptide having a xyloglucanase activity comprising a nucleotide sequence as shown in SEQ ID NO: 3 from nucleotide 1 to nucleotide 1611, (b) polynucleotide molecules that encode a polypeptide having xyloglucanase activity that is at least 70% identical to the amino acid sequence of SEQ ID NO: 4 from amino acid residue 1 to amino acid residue 537, and (c) degenerating the nucleotide sequences of (a) or (b); and a transcription terminator.

15. An isolated polynucleotide molecule that encodes a polypeptide capable of unfolding or separating the beta-1,4-glycosidic bonds in the xyloglucan backbone and exhibiting a ratio of kcat over the xyloglucan of tamarind seeds to kcat over carboxymethylcellulose ( CMC) or crystalline cellulose (Avicel) of at least 2: 1, measured at a pH of 7.5, such a polynucleotide molecule is characterized in that it is selected from the group consisting of: (a) polynucleotide molecules comprising a nucleotide sequence as that shown in SEQ ID NO: 1 from nucleotide 88 to nucleotide 783; (b) polynucleotide molecules that encode a polypeptide that is at least 70% identical to the amino acid sequence of SEQ ID NO: 2 from amino acid residue 30 to amino acid residue 261; (c) degenerate the nucleotide sequences of (a) or (b); and (d) polynucleotide molecules that hybridize to a denatured double-stranded 7DNA probe which is selected from the group consisting of DNA probes comprising the sequence shown at positions 88-783 of SEQ ID NO: 1 DNA probes comprising a subsequence of positions 88-783 of SEQ ID NO: 1 having a length of at least about 100 base pairs, under the following conditions: pre-filter the filter containing the DNA or RNA fragments for Hybridization in 5 x SSC (Sodium Chloride / Sodium Citrate) for 10 minutes, prehybridize the filter in a 5 X SSC solution, 5 x Denhardt's solution, 0.5% SDS and 100 μg / ml of salmon sperm DNA subjected to the action of sound, denatured, followed by hybridization in the same solution containing a concentration of 10 ng / ml of a probe labeled with 32P-dCTP, randomly primed (specific activity higher than 1 x 109 cpm / μg) for 12 hor at about 45 ° C; and then wash the filter twice for 30 minutes in 2 x SSC, 0.5% SDS at a temperature of at least 60 ° C.

16. The isolated polynucleotide molecule according to claim 15, characterized in that the polynucleotide is DNA.

17. An expression vector, characterized in that it comprises the following operatively linked elements: a transcription promoter; a segment of DNA selected from the group consisting of (a) polynucleotide molecules that encode a polypeptide having xyloglucanase activity comprising a nucleotide sequence as shown in SEQ ID NO: 1 from nucleotide 88 to nucleotide 783, (b) polynucleotide molecules encoding a polypeptide having xyloglucanase activity that is at least 70% identical to the amino acid sequence of SEQ ID NO: 2 from residue 30 of the amino acids to residue 261 of the amino acids, and (c) degenerating the nucleotide sequences of ( a) or (b); and a transcription terminator.

18. A cultured cell in which an expression vector has been introduced according to claims 14 or 17, characterized in that the cell expresses the polypeptide encoded by the DNA segment.

19. A method for producing a polypeptide capable of unfolding or separating the beta-1, 4-glycosidic bonds in the xyloglucan skeleton, such method is characterized in that it comprises culturing a cell in which an expression vector has been introduced in accordance with the claim 14 or 17, whereby the cell expresses a polypeptide encoded by the DNA segment; and recovering the polypeptide.

20. An isolated enzyme capable of unfolding or separating the beta-1, 4-glycosidic bonds in the xyloglucan skeleton, such an enzyme is characterized in that (i) it is free of homologous impurities, and (ii) it is produced by the method according to the claim 19

21. An enzyme preparation, characterized in that it comprises the xyloglucanase polypeptide according to claims 4 or 7.

22. The preparation according to claim 21, characterized in that it also comprises one or more enzymes selected from the group consisting of proteases, cellulases (endoglucanases), β-glucanases, hemicellulases, lipases, peroxidases, laccases, α-amylases, glucoamylases, cutinases, pectinases, reductases, oxidases, phenoloxidases, ligninases, pullulanases, pectate lyases, xyloglucanases, xylanases, pectin acetyl esterases, polygalacturonases, rhamnogalacturonases, pectin lyases, other mannanases, pectin methylesterases, cellobiohydrolases, transglutaminases; or mixtures thereof.

23. A detergent composition, characterized in that it comprises the enzyme preparation according to claim 21 or the xyloglucanase enzyme according to any of claims 4, 7 and 20.

24. A process for the treatment in a tissue machine, such a process is characterized in that it comprises treating the tissues during a washing cycle of a washing process of the machine with a washing solution containing the enzyme preparation according to claim 21 or the xyloglucanase enzyme according to any of claims 4, 7 and 20.

25. The use of the enzyme preparation according to claim 21 or the xyloglucanase enzyme according to any of claims 4, 7 and 20 in the textile industry to improve the properties of cellulosic fibers, yarns, woven or non-woven fabrics . .

26. The use according to claim 25, wherein the preparation of the enzyme or xyloglucanase enzyme is used in a step of degreasing or scrubbing process.

27. The use of the enzyme preparation according to claim 21 or the xyloglucanase enzyme according to any of claims 4, 7 and 20 in the cellulose fiber processing industry for the classification of the fibers selected from the group that It consists of hemp, jute, satin and linen.