MXPA99010185A - Prrsv antigenic sites identifying peptide sequences of prrs virus for use in vaccines or diagnostic assays - Google Patents

Abstract

The invention provides antigenic sites of PRRSV isolates. The antigenic sites are neutralizing, conserved, non-conserved and conformational, can elicit antibodies and are found on protein GP4 and N encoded by ORF4 and ORF7 of PRRSV. The peptide sequences identified by the sites can be incorporated in vaccines directed against PRRS and in diagnostic tests for PRRS. Also, discriminating tests can be developed that can be used next to marker vaccines in programs designed to eradicate PRRS from pig herds.

Description

ANTIGENIC SITES OF THE SYNDROME VIRUS PORCINE REPRODUCTOR AND RESPIRATORY (PRRS) THAT IDENTIFY PEPTIDE SEQUENCES OF VIRUSES PRRS, FOR USE IN VACCINES OR IN DIAGNOSTIC TESTS FIELD OF THE INVENTION The invention relates to the causative agent of the Mysterious Disease of Pigs, the PRRS virus, to peptide sequences identified in the PRRS virus, and to the incorporation of these sequences in vaccines and in diagnostic assays.

BACKGROUND OF THE INVENTION The PRRS virus (PRRSV) is the causative agent of a disease of pigs, commonly called porcine reproductive and respiratory syndrome (PRRS). The virus is the causative agent of a disease of pigs, observed since approximately 1987 in the United States and since 1990 in Europe, known initially under different names such as REF .: 32017 Mysterious Disease of Pigs, Infertility and Respiratory Syndrome of the Pigs, and many more. The virus itself was also given many names, among which are the Lelystad virus (LV), SIRS virus, and many more, but now it is designated primarily as Porcine Reproductive and Respiratory Syndrome (PRRSV) virus. Causes absorptions and respiratory distress in pigs and was isolated for the first time in Europe in 1991 (European Patent No. 587780, Patent North American No. 5,620,191) and subsequently in the United States and many other countries in the world. PRRSV is a small enveloped virus that contains a positive strand RNA genome. PRRSV grows preferentially in macrophages. In addition to macrophages, PRRSV can grow in the CL2621 cell line and in other cell lines cloned from the monkey kidney cell line MA-104 (Benfield et al., J. Vet, Diagn. Invest. -133, 1992). The PRRSV genome, an adenylated RNA polylase of approximately 15 kb, was subjected to sequencing in 1993 (Meulenberg et al., Virology 192; 62-74, 1993). The strategy of nucleotide sequence, genomic organization and replication, indicated that PRRSV is related to a group of small enveloped viruses that have a positive strand RNA, designated as Arterivirus. This group includes the virus lactate dehydrogenase elevation (LDV), equine arteritis virus (EAV), and simian hemorrhagic fever virus (SHFV). These viruses have a similar genomic organization, a strategy of replication, morphology, and amino acid sequence that viral proteins. The arteriviruses contain a genome of 12.5 to 15 kb and synthesize a set nested in 3 'of six ubiquitous RNAs during their replication. These subgenomic RNAs contain a leader sequence that is derived from the 5 'end of the viral genome. The ORF la and Ib comprise approximately two thirds of the viral genome and encode the RNA-dependent RNA polymerase. Six smaller ORFs, ORFs 2 through 7, are located at the 3 'end of the viral genome. The ORF from 2 to 6 probably encode the enveloped proteins while the ORF 7 encodes the nucleocapsid protein (Meulenberg et al, Virology 206 / 155-163, 1995). PRRSV is the first arterivirus for which it has been shown that all six proteins encoded by ORFs from 2 to 7 are associated with the virion. The 15 kDa N protein (encoded by 0RF7) and the 18 kDa integral membrane protein M (0RF6) are not N-glycosylated, whereas the GP2 protein from 29 to 30 kDa (0RF2), the protein GP3 of 45 to 50 kDa (ORF3), the GP4 protein of 31 to 35 kDa (ORF4), and the GP5 protein of 25 kDa (ORF5) are. These proteins have also been detected in extracellular viruses and in those used in cells infected with a North American isolate of PRRSV, ATCC-VR2332, and other PRRSV isolates.

(Other PRRSV isolates are, for example, CNCM 1-1140, ECACC V93070108, CNCM 1-1387, CNCM 1-1388, ATCC-VR2402, ATCC-VR2429, ATCC-VR2430, ATCC-VR2431, ATCC-VR2475, ATCC-VR2385, but many others are known). The inventors hereinabove described the isolation and characterization of a panel of MAbs specific for PRRSV, which were specific for GP3, GP4, M and N (van Nieu stadt et al., J. Virol. 70, 4767-4772, 1996). Interestingly, the MAbs directed against GP4 were neutralizing, which suggested that at least part of the protein is exposed on the surface of the virion. In addition, most MAs directed against N reacted with all PRRSV isolates analyzed. The PRRS itself is a problem of primary interest to the swine industry in most of the world. The introduction of PRRSV in herds of pigs will cause severe economic losses. The diagnostic analysis against PRRS is practiced widely by many veterinarians and laboratories. Most diagnostic assays, such as IPMA, IFT, IFA, ELISA, each comprise suitable means of detection such as conjugated enzymes of luorocrorno s, and other substrates, use interactions between the antigen derived from PRRSV and directed antibodies against PRRSV to measure the presence of either the PRRSV antigen or the antibodies directed against PRRSV in a biological sample, such as blood, serum, tissue, tissue fluids, wash fluids, urine, feces, They sample the animal (such as a pig) that is going to be tested. The antigen and / or antibodies used in these diagnostic tests, or kits or diagnostic tests, for the diagnosis of PRRSV, are defined solely by their origin of, or by their reactivity with, PRRSV. In principle this is sufficient for selective classification tests where high specificity or sensitivity is not explicitly required. However, the ever-present spread of PRRS has caused greater concern in the swine industry, to the extent that it has been considered necessary to eradicate PRRS from all herds of pigs, or even from entire areas, regions, or countries, where pigs are raised. A clear example of this need is the proposed eradication program with reference to PRRS in Denmark. If it is decided to completely eradicate the PRRS, then diagnostic analyzes that exhibit greater specificity or sensitivity than the tests used today are needed. Vaccination against PRRS is also widely practiced. Several examples of live, modified vaccines are known to be used, and several examples of dead vaccines are also known. However, a problem that exists with live vaccines in general, and therefore also with live PRRS vaccines, is that these vaccines have a tendency to spread in unvaccinated pigs, thus spreading, rather than reducing detectable infection in herds of pigs, and thus being counterproductive to complete eradication. If a line marker vaccine that could be serologically differentiated from wild type virus was used, then this problem would be greatly reduced. Additional disadvantages are that live vaccines sometimes cause anaphylactic reactions in vaccinated pigs, due to undefined antigenic components. Although it is reported that killed vaccines, in general, induce protection in vaccinated pigs, and that they have the additional advantage that they do not spread from pig to pig, a disadvantage of dead vaccines is that it can be difficult to accumulate sufficient antigenic mass. in a dose of a vaccine to produce a measurable and protective immune response. Especially dead vaccines that can induce neutralizing, measurable antibody titres in pigs would be beneficial, since measuring these neutralizing antibodies in vaccinated pig populations will help you understand about the level of protection obtained by vaccination in pig herds. . further, if it is successful in collecting necessary antigenic mass, this also means that in the vaccine another undefined antigenic mass is also present, which also gives rise to anaphylactic reactions as described above. In this sense, it would be beneficial to know which specific site in the PRRSV is involved in the neutralization, which will lead to the design of better suitable vaccines, which incorporate the important peptide sequences necessary to produce the neutralizing antibodies. One advantage of the commonly used vaccines, which originate from the PRRSV isolates, isolated in the United States, is that these vaccines, although they are totally protective and cross-react unologicaly, with the European isolates of the PRRSV, contain, as already defined, epitopes or antigenic sites by which the European isolates of the PRRSV can be differentiated. Reciprocally, live vaccines that originate from PRRSV isolates, isolated in Europe, although they are completely protective and cross-react immunologically with the US isolates of PRRSV, contain epitopes or antigenic sites, similar, as already defined, by which can be differentiated from the isolates of the United States, from the PRRSV. If serological tests were available that could discriminate (based on small epitopic differences between the PRRSV isolates) between pigs that are already vaccinated with a vaccine derived from the United States, or infected with a wild type European PRRSV (vaccinated or not ), or that could discriminate pigs that are already vaccinated with a European derived vaccine or infected with a wild type of the United States, of the PRRSV (vaccinated or not), of the marker vaccines and that the corresponding diagnostic tests (which incorporate epitopes of differentiation or antigenic sites) could be developed and would be used with great confidence in eradication programs for PRRS. For example, in Denmark it would be possible to vaccinate with a vaccine derived from the United States and to measure the set of antibodies in Danish pigs, which are directed only against unique epitopes in wild European types of PRRSV and that do not cross-react with strains of U.S. This would allow the unequivocal detection and subsequent elimination of pigs infected with the wild type of Danish herds. Commonly, this discrimination is not possible due to the broad cross-immunological reactivity, overall, between the PRRSV isolates. Needless to say, these combined vaccine screening programs will be the basis for PRRS eradication, and can also be used in other countries, if needed, with different PRRSV antigenic sites using them in vaccines and / or analysis. of di agnós tico. The invention now provides antigenic sites comprising PRRSV peptide sequences that allow the improvement of vaccines, either killed or attenuated vaccines, or vaccines derived through recombinant DNA technology, and antigenic sites that allow the improvement of the methods, analysis and diagnostic kits, and the production of new methods, analysis and diagnostic kits. Artificial changes or substitutions of amino acid residues that maintain antigenicity (defined by reactivity with polyclonal sera or MAb s) and thus the functionality of the antigenic site, can be easily derived from known sequences for constituting an antigenic site of a specific isolate, through the ordinary experience of a person experienced in the technique of peptide design and synthesis. For example, certain amino acid residues can be conventionally replaced by others of comparable nature, for example a basic residue by another basic residue, an acid by an acid, a bulky by a bulky, a hydrophobic or hydrophilic by another hydrophobic or hydrophilic residue, and so on. Other less conventional but more specific changes are also possible, which maintain or even improve the antigenicity of the selected sequence. These changes can be made, for example, by substitutions of amino acids based on PEPSCAN or by substitution techniques (van Amerongen et al., Peptide Research (1992) 5, 269-274). Briefly, the amino acid residues within the antigenic sites provided by the invention can be replaced, for example, conventionally or under the guidance of the replacement mapping, whereby the resulting peptide sequences are functionally equivalent to the antigenic site. The replacement amino acids may be either amino acid residues L or D. In addition, the peptide sequences provided by the invention become even more immunogenic by conjugating them with adjuvants (such as KLH) known in the art. Additionally, the peptides become even more immunogenic by producing peptides with one (such as the peptides in series) or more repeated sequences or by polymerization or circularization. Although it has been previously shown that the N protein is immunogenic (Meulenberg (1995), J. Clin, Diagn.Lab.Immunol.2, 652-656, British Patent No. 2,289,279 A) and that there are conserved and non-conserved regions between the N protein of the European strains (LV) and the North American strains (VR2332) (WO 96/04010), it is hereby demonstrated for the first time that the conserved and non-conserved regions are antigenic and that they can be used individually or in combinations such as antigens for immunization or diagnostic assays. In addition, it is here identified that the antigenic regions in the N protein consist of both linear and conformation-dependent epitopes. The GP4 protein is the first PRRSV structural protein for which it is shown to produce antibodies that can neutralize viruses. A specific region of approximately 40 amino acids was identified and defined, which could be exposed to the surface of the virion as a target for neutralizing antibodies, which would then prevent the virus from infecting the cells. This is a new exciting discovery given that it is generally assumed that the GP5 protein, the main structural protein of PRRSV, is the most important candidate involved in the binding of the host cell. The invention provides a major antigenic site, a neutralization site in GP4 of PRRSV. The invention provides the location of a main neutralization site, important for the design of effective marker vaccines, comprising amino acid core sequences and amino acid sequences flanking the nuclear sequences of the PRRSV isolates, sequences comprising the neutralization site in the ORF4 protein of PRRSV. By incorporating the sequences of the relevant neutralization sites, in the different types of vaccines, it is possible to specifically induce neutralizing antibodies in the vaccinated pig. The killed vaccines comprising the neutralization site provided by the invention are produced to induce measurable neutralizing antibodies. Especially the sequences located at the positions in the PRRSV ORF4 encoded protein, which correspond to those found approximately at amino acids 40 to 79, as found in isolate 1-1102 of the PRRSV, comprise the neutralization site. In addition, the selected peptide sequences are made even more immunogenic, by mixing the peptides with adjuvants or other carriers known in the art. The peptide compositions thus obtained are used as a vaccine. However, also the selected peptide sequences, which comprise the neutralization site, are incorporated into the vector systems of vaccines, either different recombinant vectors, derived from viruses or bacteria, heterologous, but the peptide sequences are also selectively incorporated into the viruses or vector vaccines of PRRSV, derivatives thereof. In a further aspect of the invention, the amino acid sequences located at the corresponding positions from about 52 to 75 more specifically constitute a broadly reactive neutralization site. Other embodiments of the neutralization site provided by the invention can be found among the different isolates of the PRRSV known or to be found (see, for example, the experimental part of this description). It is easy, for anyone working in the field of molecular biology, to compare the sequences containing the neutralization site provided by the invention, with the amino acid sequence of the 0RF4-encoded protein of yet another PRRSV isolate. The invention also provides PRRSV peptide sequences that improve diagnostic assays, whether they are antigen or antibody detection assays. The invention provides several groups of antigenic sites that are used alone or in diagnostic assays. In this way the diagnostic analyzes are provided by the invention and serve the different needs that exist in the field with respect to diagnosis and differential diagnosis. Interactions between antigen and antibody always cause cross-reactive epí topo-para mo interactions, of amino acid sequences that are from 5 to 15 amino acid sequences in length. Thus, the amino acid sequences of 5 to 15 amino acids in length and which partially or completely overlap with the nuclear sequences of the antigenic sites of the invention, and are provided by the invention for incorporation into diagnostic analyzes. These peptide sequences are used to select or design the antigen or antigenic substance that contains the sequences in the analysis to be used. Alternatively, and provided by the invention, synthetic antibodies reactive with the antigenic sites provided by the invention are found. These sites or related sequences react with the synthetic antibody obtained from systems such as the phage displaying libraries or the clonal selection of (heavy chain) antibodies that are molecules similar to antibodies that can be easily expressed in heterologous expression systems. A group provided by the invention comprises the peptide sequence corresponding to the neutralization site, as already explained above. Diagnostic assays comprise this site and / or antibodies directed specifically against this site detect neutralizing antibodies in the pig. Another group provided by the invention comprises a conserved antigenic site, in the N protein. Within the conserved antigenic site the invention provides a nuclear sequence VNQLCQLLGA or VNQLCQMLGK. Diagnostic analyzes comprising this site and / or antibodies specifically directed against this site, detect those antibodies in pigs, which specifically react with most of the PRRSV isolates. Diagnostic assays using antibodies directed against the conserved site are also provided to detect the PRRSV antigen, thereby allowing the analysis, to detect the PRRSV isolates regardless of their origin. Another group provided by the invention comprises a non-conserved antigenic differentiation site, in protein N. Diagnostic assays comprising this site and / or antibodies specifically directed against this site, detect those antibodies in pigs, which react specifically with different isolated from PRRSV, whereby, for example, vaccinated pigs can be discriminated from pigs infected with wild-type PRRSV. Also, diagnostic tests that use antibodies directed against the non-conserved site are provided, to detect the PRRSV antigen, thereby allowing the analysis to differentiate different PRRSV isolates. Within one of those non-conserved sites, the invention provides a nuclear sequence PRGGQAKKKK or PRGGQAKRKK or PRGGQAKKRK or GPGKKNKKKN or GPGKKNKKKT or GPGKKNRKKN or GPGKKFKKKN or GPGKKIKKKN or GPGQINKKIN. Within another non-conserved site, the invention provides a nuclear sequence MAGKNQSQKK or MPNNNGKQTE or MPNNNGKQPK or MPNNNGKQQK or MPNNNGKQQN or MPNNNGKQQK or MPNNNGRQQK. Also, any person experienced in the technique of peptide design and synthesis, can introduce artificial changes that maintain the antigenicity and thus the functionality of the previous nuclear sequences in the GP4 or N protein, in an easy way, such as described above.

The invention also provides a group comprising conformation epitopes (which vary greatly among different isolates) which can be found in positions corresponding to those found in isolate 1-1102 from the position of amino acid 51 to approximately 68 (in the sequence nuclear isolate 1-1102 PKPHFPLAAEDDIRHHL) or from 79 to approximately 90 (in the nuclear sequence of isolate 1-1102 SIQTAFNAQGAGT) or from 111 to 124 (in the nuclear sequence of isolate I-1102 HTVRLIRVTSTSAS) in the protein N. The conserved and non-conserved sites, and the differentiation and conformation sites, in the N protein, sites that are provided by the invention, provide diagnostic analyzes that unambiguously diagnose infections by PRRSV. Analyzes are carried out that avoid using non-conserved sites, thus avoiding false negative results. In addition, different non-conserved sites are used in the development of differentiation assays that can discriminate, for example, vaccinated pigs from pigs infected with PRRSV wild-type isolates. Again, as mentioned, it is easy for anyone working in the field of molecular biology to align sequences containing epitope sites, conserved or non-conserved, or conformational, with the amino acid sequences of the encoded protein 0RF7 of yet another PRRSV isolate. The sites provided by the invention are used in new pairs of vaccine discrimination diagnostic analyzes, for use in PRRS eradication programs.

Experimental part Methods and Materials Cells and Viruses The Ter Hu urn e strain (CNCM 1-1102) of the PRRSV was isolated in 1991 (Wensvoort et al., 1991). The North American strain ATCC-VR2332 was isolated by Benfield et al. , (1992). The strain NL1 (Holland, 1991) was isolated in our laboratory, the strain NY2 (England, 1991) was generously provided by T. Drew, the strain DEN (Denmark, 1992) was generously provided by A. Botner, the LUX strain (Luxembourg, 1992 ) was generously provided by Losch, the SPA1 and SPA2 strains (Spain, 1992) were generously provided by Shokouhi and Espuna, respectively, and the FRA strain (France, 1992) was generously provided by Y. Leforban. The PRRSV and VR2332 were cultured in CL2621 cells as previously described (van Nieuwstadt et al., 1996). The seven different European isolates were cultured in porcine alveolar macrophages. The macrophages were maintained as described above (Wensvoort e t al, 1991). BHK-21 cells were maintained in the Dulbecco Minimum Essential Medium supplemented with 5% fetal bovine serum and antibiotics. For transfection experiments, BHK-21 cells were grown in Glasgow Minimum Essential Medium (GIBCO-BRL / Life Technologies Ltd).

Ant i s uero s In the previous experiments, anti-PRRSV serum 21 of porcine and sera 698 and 700 rabbit antipeptide were used. Serum 700 is directed against amino acids 106 to 122 (CLFYASEMSEKGFKVIF) encoded by ORF4 of PRRSV and obtained from a rabbit. The production and characterization of MAbs has been described (van Nieuwstadt et al., 1996). Hybridomas were derived from five consecutive fusion experiments and were directed against the ORF4 protein (MAb 121.4, 122.1, 122.12, 122.20, 122.29, 122.30, 122.59, 122.66, 122.68, 122.70, 122.71, 126.1, 126.7, 130.7, 138.28 ) or the ORF7 protein (MAb 122.17, 125.1, 126.9, 126.15, 130.02, 130.4, 131.7, 138.22, WBE1, WBE4, WBE5, WBE6, SDOW17) and the WBE Mabs were generously provided by Dr. Drew, Weybridge, United Kingdom; the Mab SDOW17 was generously provided by Dr. Benfield, South Dakota, United States.

Plasmid constructions Two oligonucleotides located upstream (PRRRSV13) and downstream (PRRSV14) of ORF4 have previously been used to amplify and clone 0RF4 of isolate 1-1102 in pGEM-4Z using the BamH1 and HindIII sites introduced into the primers (Meulenberg et al. ., nineteen ninety five) . The resulting plasmid was designated pABV209. Two oligonucleotides located in a similar position with respect to the start codon (PRRSV4) and the stop codon (PRRSV5) of 0RF4 of VR2332, were used to amplify the 0RF4 of VR2332, by RT-PCR as described in previous studies. The PCR fragment was digested with Ba Hl and partially with HindIII since the 0RF4 of Vr2332 contains an internal HindIII site, and was cloned into pGEM-4Z resulting in the plasmid pABV270. The recombinant DNA techniques were carried out essentially as described by Sambrook et al. (Molecular Cloning, A laboratory manual, Cold Spring Harbor Lab, Cold Spring Harbor, NY, 1989). The nucleotide sequence of the ORF4 of VR2332 in pABV270, determined in a. Automated DNA (Applied Biosystems) was identical to the published sequence (Murtaugh et al., Arch. Virol.; 1451-1460, 1995). Subsequently, the ORF4 of 1-1102 and VR2332 were transferred to the iki Forest virus expression vector pSFV1. PABV209 and pABV270 were digested with BamHl and HindIII (partially for pABV270), fragments of 0RF4 were treated with Klenow polymerase (Pharmacia) to create blunt ends and these were ligated into the S site of the pSFVl, were defo for i laron with calf intestinal alkaline phosphatase (Pharmacia). The 0RF4 containing plasmids, of 1-1102 (pABV265) and VR2332 (pABV271) in the correct orientation, were further analyzed for the expression of the GP protein. In addition, four different chimeric ORF4 genes were produced, from 1-1102 and VR2332. The nucleotide sequence of the ORF4 coding for amino acids 1 to 39 of the GP4 protein of VR2332 was amplified from the plasmid pABV270 with the oligonucleotides PRRSV4 and PRRSV6. The obtained fragment was digested with Ba Hl and SacII. This fragment was ligated into pABV209 digested with Ba Hl and SacII to create a frame fusion between amino acids 1 to 39 of protein GP4 of VR2332 and 40 to 183 of protein GP of 1-1102 in pABV306 . The nucleotide sequence of 0RF4 encoding amino acids 1 to 75 of the GP of VR2332 was amplified with oligonucleotides PRRSV4 and PRRSV9 (see Table 2). This fragment was digested with Kpnl and Ba Hl. The nucleotide sequences of 0RF4 encoding amino acids 80 to 183 of the GP4 protein of 1-1102 were amplified with PRRSV 6 and PRRSV14 and the amplified fragment was digested with Kpnl and BamHl. Both fragments were ligated with each other in pEGM-4Z digested with Ba Hl and HindIII, resulting in the plasmid pABV308. In the same way a complementary construct was created in pABV314 which consisted of a nucleotide sequence encoding amino acids 1 to 79 of the GP protein of I-1102 amplified with PRRSV13 and PRRSV57 linked to a fragment encoding the amino acids of the to 178 of VR2332, which was amplified with PRRSV10 and PRRSV5, in pGEM-4Z. A fourth chimeric construct consisted of a fragment encoding amino acids 40 to 79 of the PRRSV GP protein fused to the fragments encoding amino acids 1 to 39 and amino acids 76 to 178 of the GP4 protein of VR2332. This was achieved by ligating the BamHI / SacII 0RF4 fragment of pABV270 and the SacII / HindIII 0RF4 fragment of pABV314 in pGEM-4Z digested with BamHI and HindIII. This plasmid was designated pABV325. The plasmids pABV306, pABV308, pABV314 and pABV325 were verified with respect to the correct sequence, by means of oligonucleotide sequencing. The chimeric 0RF4 genes were transferred from pABV306, pABV308, pABV314 and pABV325 to PSFV1, identically as described above for the ORF4 genes of VR2332 and PRRSV, resulting in pABV296, pABV305, pABV321, and pABV326, respectively (Figure 3). Two oligonucleotides located upstream were used (LV108; 5 'GGAGTGGTTAACCTCGTCAAGTATGGCCGGTAAAAACCAGAGCC 3') and downstream (LV112 / 5 ' CCATTCACCTGACTGTTTAATTAACTTGCACCCTGA 3 ') of ORF7, to amplify and clone the 0RF7 gene in pGEM-T, resulting in pABV431. The sequences and position of these and other oligonucleotides' used to amplify ORF7 fragments are listed in Table 1. In addition, four different chimeric constructs were produced by PCR-directed mutagenesis. The sequences coding for amino acids 25-26, 28-30 (site B, Figure 3) were replaced by the corresponding sequences of the EAV protein N. This was achieved by PCR amplification of ORF7 with LV108 and LV134 (5 'TGGGGAATGGCCAGCCAGTCAATGACCTGTGCCGGATGTTTGGTGCAA TGATAAAGTCC 3'). The mutated DNA fragment was introduced into pABV431 using the site Ms c l and Pa c1, which resulted in pABV455. The ORF7 region encoding amino acids 51 to 67 was replaced by the corresponding region of the LDV ORF7. The pABV431 was digested with Ec oni and Cial and ligated to a PCR fragment produced with LV98 (5 'CCAGCAACCTAGGGGAGGACAGGCCAAAAAGAAAAAGCAGCCGAAGCT ACATTTTCCCATGGCTGGTCCATCTGAC 3') and LV99 (5 'CGTCTGGATCGATTGCAAGCAGAGGGAGCGTTCAGTCTGGGTGAGGAC GTGCCGGAGGTTCAGATGGACCAGCC 3') primers, digested with the same enzymes. This plasmid was designated pABV463. The region of ORF7 coding for amino acids from 80 to 90 was replaced by the corresponding region of the ORV7 gene of LDV.

The LR 0RF7 gene was mutated in a PCR with the LV101 primers (5 ' GCTTGCAGGCGCCCGTGACGCTTTTCAATCAAGGCGGAGGACAGGCGT CGCTTTCATCCA 3 ') and LV112. The obtained fragment was digested with Na rl and Pací and ligated to pABV431 digested with Cial and Pací. This resulted in pABV453. Finally, the region encoding the C-terminal part of the N protein (amino acids 111-128) was replaced by a sequence encoding the corresponding amino acids of the LDV N protein. The ORF7 gene was amplified with primers LV108 and LV102 (5 ' ATGTCCCGGGCTAAGCGGCGGAGGAATTAGCAGAAGCGTTAATCAGGC GCTGTGTAGCAGCAACCGGCAG 3 ') and cloned into the pGEM-T vector, which resulted in pABV456. The mutated ORF7 and wild-type genes were cut from pABV431, pABV453, pABV455, and pABV463 by digestion with Paci (blunt-ended) and Hap I and pABV456 by digestion with HapI and S wa I. These genes were subsequently inserted into the Sma l des fo foril site of the Semliki Forest virus expression vector pSFVl. The plasmids pABV470, pABV460, pABV462, pABV518 and pABV471 containing the respective ORF7 genes in the correct orientation, were further analyzed for the expression of the N protein. Transcription and in vitro transfection of the ORF7 RNA of the Semliki Forest virus, it was as described above for the SFV-ORF4 constructs. To clone the genes from seven different, European, macrophages, they were infected with NL1, NY2, DEN, FRA, SPA1, SPA2, and LUX, and the RNA was isolated as described by Meulenberg et al. (1993). The ORF4 genes were amplified by RT-PCR with the oligonucleotides PRRSV13 and PRRSV14, and were cloned with Ba Hl and HindIII in pGEM-4Z. For each strain, the nucleotide sequence of the ORF4 of two clones derived from two independent PCRs was determined. The sequences of proteins derived from the nucleotide sequence were aligned using the multiple sequence alignment program CLUSTAL of PCGene (Intel 1 i gene tics Tm).

In vitro transcription and transfection of SFV-ORF4 RNA Plasmids pSFV1 containing different 0RF4 constructs were linearized by Spel digestion and transcribed i n vi tro. The synthesized RNA was transfected into BHK-21 cells in 15 mm wells of twenty-four well plates using lipofectin. The cells were fixed with ice-cold 50% (v / v) methanol / acetone and the GP protein expressed by the different ORF4 constructs was stained with MAbs in the immunoperoxidase monolayer assay (IPMA). To analyze the expression products of ORF4 by immunoprecipitation, 107 BHK-21 cells were transfected with 10 μg in SFV-ORF4 RNA transcribed in vitro, by electroporation. The electroporated cells were plated in three 35 mm wells of six well plates and 18 hours after transfection the cells were labeled.

Pepscan method A complete set of overlapping nonapeptides or dodecapeptides was synthesized from amino acids derived from the ORF4 or 0RF7 sequence of PRRSV, as previously determined (Meulenberg et al., 1993). The synthesis of peptides in solid phase, on polyethylene bars, and selective immunological classification with a type of analysis such as the enzyme-linked immunosorbent assay (ELISA), were carried out in accordance with established Pepscan procedures (Geysen et al., PNAS, 81, 3998-4002, 1984).

RESULTS Previously, a panel of neutralizing MAbs that reacted with a protein of 31 to 35 kDa, of PRRSV, designated GP and a panel of Mabs reactive with protein N, was described by Western immunoblot analysis. It was shown that GP4 was a structural coproduct ion encoded by ORF4, and it was shown that N was the nuc 1 eocáps ide protein encoded by 0RF7. In experiments of immunoprecipitation with Mabs specific for GP, the GP4 protein derived from Used from cells infected with PRRSV, migrated as a discrete band of 28 kDa together with a slight spot of apparent molecular weight somewhat higher. The MAbs inmnoprecipi t a diffuse (glycosylated) GP4 protein of approximately 31 kDa of the extracellular medium infected by PRRSV but not the extracellular medium of ps cells infected eudodes).

Identification of the neutralizing domain in GP4 It was previously shown that the specific Mabs for GP protein recognized I-1102 but not the North American isolate VR2332 (van Nieuwstadt et al., 1996). To identify the binding domain of the neutralizing Mabs in the GP4 protein, fusion proteins of the GP4 protein of 1-1102 and VR2332 were produced. These proteins were expressed in the Semliki Forest virus expression system, developed by Liljestrom et al. , (Biotechnol, 9, 1356-1362, 1991). First, the ORF of 1-1102 was cloned into pXVF1 resulting in the plasmid pABV265 (Figure 1). The transcribed RNA of pABV265 was transfected into BHK-21 cells and 24 hours after transfection the cells stained positively with the neutralizing 15 MAbs panel. The MAbs did not react with the BHK-21 cells transfected with pSFVl RNA. The recombinant GP4 protein was immunoprecipitated with MAb 126.1 of L- [35S] -methionine labeled BHK-21 cells, transfected with pABV265 RNA. It had a similar size to the authentic GP, the protein synthesized in CL2621 cells infected with 1-1102 and also contained N-glycans sensitive to PNGaseF and EndoH. The GP4 protein of VR2332 was also cloned into pSFV1, but this protein was not recognized by MAbs with expression in BHK-21 cells (Figure 1). To further localize the region in the GP protein recognized by Mabs, four ORF4 chimeric genes of 1-11022 and VR2332 were constructed in pSFV1 (Figure 1). The RNA transcribed from the plasmids pABV296, pABV305, pABV321, and pABV326 was transfected into BHK-21 cells and the reactivity of the proteins expressed with the M bs specific for GP4 was analyzed in IPMA. The reaction pattern of these fifteen MAbs was identical, and indicated that these MAbs were targeted to a region of 40 amino acids in the GP4 protein. The expression product of pABV326 consisted of amino acids 40 to 79 derived from the GP protein of 1-1102 of CNCM isolated and surrounded by sequences derived from the GP4 protein of VR2332 and was still recognized by the MAbs panel. To ensure that different GP4 proteins, especially those that were not recognized by MAbs, were adequately expressed in BHK-21 cells, they were immunoprotected from Used BHK-21 cells that were transfected with transcribed RNA in vitro from plasmids pABV265, pABV271, pABV296, pABV305, pABV321, and pABV326. The immunoprecipitation was carried out with porcine anti-PRRSV serum 21, MAb 126.1, and sera 698 and 700 antipeptides. Serum 700 is directed against amino acids 106-122 of GP4 protein of PRRSV, of isolate of CNCM 1-1102, a sequence that is identical in the GP protein of isolate ATCC-VR2332, apart from amino acid 121. Therefore, all GP proteins were immunoprecipitated with serum 700. Their size was indistinguishable when analyzed by SDS-PAGE, except for GP proteins expressed by pABV305 and pABV271 that migrated slightly faster. This is most likely due to the deletion of 4 amino acids in the VR2332 sequence relative to the sequence 1-1102, between amino acids 62-64 (Figure 3). The complete set of specific MAbs for the GP recognized the GP4 proteins expressed from pABV265, pABV296, pABV321, pABV326, but not those expressed from pABV305 and pABV271, which confirmed the results obtained by I PMA (Figure 3). Serum 698 had the same reaction profile as Mabs. Serum 698 is directed against amino acids 62 to 77 of GP4 of PRRSV, which are located within the now identified neutralization domain of GP4 protein. This region is highly heterologous in the 0RF4 of VR2332, and therefore the expression products containing the sequence of VR2332 in this region were not recognized by this serum. However, polyclonal neutralizing pig sera recognize the GP4 protein of 1-1102 and the chimeric GP4 proteins and the GP4 protein of VR2332, indicating that a variety of neutralizing antibodies present in the anti-PRRSV sera of porcine are present. directed against the neutralizing site formed by amino acids 40 to 79 of the GP4 protein.

PEPSCAN of protein ORF4 and ORF7 Since the fifteen MAs reactive with the ORF4 protein all reacted with the GP4 protein in the Western blot analysis, it was expected that they would recognize a linear epitope in a region extending from amino acids 40 to 79 of GP4 of isolate 1 -1102. To further map the binding region of the Mabs, a PEPSCAN analysis was performed using nonapeptides or dodecapeptides and two overlaps, in this region. The peptides were considered to represent antigenic sites if the peaks in that set reproducibly added more than twice the background. Mabs 122-29, 122-30, 122-66, 122-71, 130-7, 138-28 reacted positively with a specific antigenic site consisting of amino acids 59 through 67 (SAAQEKISF) (Figure 2). Mab 122-12 reacted only weakly with this antigenic site, while the remaining 7 MAbs were negative in the PEPSCAN analysis. The polyclonal pig sera also identified this site in PEPSCAN. The neutralizing serum 21, taken at week 6 after the infection of the pig 21 with PRRSV reacted strongly and broadly with the site and its flanking regions. In addition, the polyclonal, neutralizing pig sera (val2 and val4), taken at 54 days after vaccination with the vector virus PRV-ORF4 and at slaughter at 30 days after challenge on day 54 with PRRSV, reacted strongly and more broadly with the neutralization site identified in the PEPSCAN. In isolate 1-1102, the nuclear sequence of the neutralization site comprises the aa SAAQEKISF sequence located from aa position 59-67. In other isolates the nuclear sequence can be found in or around the corresponding aa position, which is an amino acid sequence corresponding to a neutralization site of the GP4 protein, comprising for example the sequences such as SAAQEEISF, or STAQENISF or STAQENIPF or SEESQSVT or SASEAIR or SASEAFR or PAPEAFR or PAPEAIR or SAFETFR or STSEAFR, but it is expected that other PRRSV isolates have corresponding but slightly different nuclear sequences from the neutralization site located at or around the aa position corresponding to aa 59 -67 of the amino acid sequence 0RF4 of isolate 1-1102 of PRRSV. Also, artificial changes that maintain antigenicity and thus the functionality of the above nuclear sequences, can be easily introduced by a person of average experience in the technique of peptide design and synthesis. Also, as is clearly demonstrated by the much broader reactivity in the PEPSCAN of the neutralizing polyclonal sera, the aa sequences containing aa nuclear sequences and aa sequences flanking the nuclear sequences of the different PRRSV isolates further constitute the neutralization site in the 0FR4 protein of PRRSV. Especially, the sequences located in the positions corresponding approximately to aa 40 to 79 constitute the neutralization site (Figure 1). Again, artificial changes that maintain the antigenicity and hence the functionality of the above antigenic sites can be easily introduced by the person of average experience in the technique of peptide design and synthesis. Also, considering the broad reactivity of the neutralizing sera, pol i clonal is, val2 and val4 (Figure 2), the aa sequences located at positions corresponding to from about a to 52 to 75 more specifically constitute a highly reactive neutralization site. Mabs directed against the ORF7 protein reacted in four different groups in the PEPSCAN, group A (4), B (2), C (3), and D (l). Group 1 (D) (in which, among others, Mabs 122.17, 130.3, 130.4, 131.7, WBE1, WBE4, WBE6, SDOW17 and comprising conserved and non-conserved reactive sites) reacted with a conformational epitope not detectable in the PEPSCAN. The group 2 (B) (in which they are among others 125.1, 126.9, NS95 and NS99 and reagents with all the PRRSV isolates analyzed, thus identifying a conserved antigenic site) identify a nuclear sequence VNQLCQLLGA (found in isolate I-1102 from position aa, 22 to approximately 32) or VNQLCQMLGK. Group 3 (C) (in which among others are the Mab 126.15 and mainly reactive with the strains of PRRSV isolated in Europe, thus identifying an antigenic site of differentiation) identifies a nuclear sequence PRGGQAKKKK (found in isolate 1-1102 from a position aa from 41 to about 50 or PRGGQAKRKK or PRGGQAKKRK or GPGKKNKKKN or GPGKKNKKKT or GPGKKNRKKN or GPGKKFKKKN or GPGKKIKKKN or GPGQINKKIN Group 4 (A) (in which are among others the Mab 138.22 and mainly reactive with strains of PRRSV isolated in Europe, thus identifying an antigenic site of differentiation) identifies a nuclear sequence MAGKNQSQKK (found in isolate 1-1102 from position aa 1 to approximately 10) or MPNNNGKQTE or MPNNNGKQPK or MPNNNGKQQK or MPNNNGKQQN or MPNNNGKQQK or MPNNNGRQQK. that maintain the antigenicity and therefore the functionality of the above antigenic sites in the N protein can be introduced easily by the person of average experience in the technique of peptide design and synthesis. Although group 1 does not constitute linear epitopes, the comparison of the aa sequences of the PRRSV with the LDV sequences shows that the conformational epitopes (which vary greatly between the different isolates) can be found in positions corresponding to those found in isolate 1- 1102 from position aa 51 to approximately 68 (in the sequence aa of isolate 1-1102 PKPHFPLAAEDDIRHHL) or from 79 to approximately 90 (in sequence aa of isolate 1-1102 SI QTAFNQGAGT) or from 111 to 124 (in sequence aa of isolate 1-1102 HTVRLIRVTSTSAS). Also, artificial changes that maintain the antigenicity and therefore the functionality of the conformation epitope sites, above, in the N protein, can be easily introduced by the person of average experience in the technique of peptide design and synthesis, especially with information collected by comparison of sequences of the PRRSV isolates, and by comparison with the sequences of the N protein of another Ar t eri viridae. This was determined in the expression of chimeric LDV / PRRSV ORF7 proteins in the SFV expression system (performed as above for the ORF4) and the determination of its reactivity with Mabs of group 1.

Chimeric N proteins Domain D was further mapped with constructs of ORF7 that express chimeric N proteins. Given that 6 out of 10 MAbs directed against domain D recognized both European and North American PRRSV isolates, the regions that were the most conserved between the LV and North American prototype N protein of VR2332 (Figure 4) were mutated. The nucleotide sequence coding for amino acids 51 to 67, 80 to 90, and 111 to 128, was replaced by a sequence encoding the corresponding amino acids of the LDV (Figure 4). Finally, site B (amino acids 25-30) that is also conserved in the European and North American isolates was mutated. Since the amino acid sequence of the N protein of the LV was very similar to that of the N protein of the LDV at site B, this region of the N protein of the LV was replaced by a region encoding the corresponding amino acids of the N protein. of the EAV (Figure 4). When the mutated N and wild-type proteins were expressed in BHK-21 cells using the Semliki Forest virus expression system and analyzed with N-specific MAbs in IPMA, the MAbs specific for D reacted identically (Table 1). Its binding was interrupted by mutations between amino acids 51-67 and 80-90, but not by mutations between amino acids 111-128 or amino acids 25-30 (site B). As expected, N proteins with LDV sequences between amino acids 51-67 and 80-90 were still stained by MAbs directed against sites A, B, and C. However, the number of cells that were stained and the brightness of this dyeing was lower than that observed for the wild type N protein and for the N proteins mutated in amino acids 25-30 (site B) or in amino acids 111-128 (Table 1). These were more likely due to a lower expression of N proteins that contained mutations between amino acids 51-67 or 80-90, since a lower production of these mutant N proteins, compared with the other N proteins, was also obtained when equal amounts of transcripts were transferred in vitro (data not shown). As expected, the N protein containing EAV sequences in site B was not recognized by the MAbs mapped to site B (by the PEPSCAN analysis), but was still recognized by the MAbs mapped to sites A, C, or in domain D. These data indicate that the epitopes mapped to domain D are conformation-dependent and consist (partially) of amino acids 51-67 and 80-90.

Sequence analysis of the GP protein of different strains of PRRSV.

To analyze if the main antigen neutralization site, recognized by GP4-specific antibodies, was conserved between different PRRSV isolates, the reactivity and neutralizing activity of the MAbs was further analyzed in seven different European strains. The results indicated that these MAb s recognized and neutralized another Dutch strain NL1 and an English strain NY, but not the Danish isolate, two Spanish strains SPA1 and SPA2, a French isolate (FRA), and the LUX isolate from Luxembourg. Therefore, interest was focused on the amino acid sequence, in the region of the neutralization site of the GP protein of these isolates. The ORF4 genes were cloned by RT-PCR using primers derived from the PRRSV sequence and the nucleotide sequence was determined. The amino acid sequence of the GP4 protein of the different isolates, derived from this nucleotide sequence, was 86 to 97% identical with that of 1-1102. The alignment of these amino acid sequences showed that the neutralization site (amino acids 40 to 79) is much more divergent than the remaining part of the protein. In this region, especially the amino acid sequences of the strains DAN, SPA1, SPA2 and FRA are different. This coincides with the discovery that these strains are not neutralized by the specific MAbs for I-1102 and further confirms that this site is not highly conserved among European isolates. Another region of greater heterogeneity was observed in the N-terminal part of the GP4 protein. The comparison of the amino acid sequence of the GP4 protein of PRRSV and that of VR2332 and other North American strains, shows that the latter are also heterogeneous at the site of protein neutralization. The alignment of the amino acid sequences results in the introduction of a space in the neutralization site of the North American isolates (Figure 3), which is in agreement with the observation that none of these isolates is recognized by the MAbs. Altogether, a greater diversity was observed between the sequences of the American isolates than between the sequences of the European isolates. This coincides with the peculiar characteristics of the typical viral envelope, identified, for example, in the amino acid sequence of GP4. The potential of the neutralization site for the development of vaccines is of great importance in view of the heterogeneity of the neutralization site. The comparison of the amino acid sequence of the GP4 proteins of different European strains indicated that the neutralization site was much more variable than other parts of the protein, suggesting that this site is susceptible to the immune choice. The comparison of the neutralization site sequences of European and North American strains exhibited a space of 4 amino acids in the North American sequences with respect to the European ones, also illustrating the great amino acid variability of the now identified PRRSV neutralization site. The neutralization site in the GP4 protein described here is the first site identified for the Lelystad virus. For two other arterivirus, the EAV and LDV, the Neutralizing MAbs, and all were directed against the G? / VP3 protein encoded by the ORF5 (Deregt et al., 1994; Glaser et al., 1995; Balasuriya et al., 1995; Harty and Plagemann, 1988). Using neutralization and escape mutants, the EAV neutralization site was mapped to specific amino acids in the Ga ectodomain. Comparisons of similar sequences were made for the PRRSV 0RF7 protein (Figure 4), further illustrating the great variability of the large amino acids of the genotously conserved ant i site and of the now conserved, non-conserved sites of the PRRSV. In this work, four different antigenic sites have been identified in the PRRSV N protein. Three sites, designated A, B, and C, contain linear epitopes and these were mapped between amino acids 2-12, 25-30, and 40-46, respectively. In contrast, the fourth site, designated domain D, contains conformation-dependent epitopes that are (partially) composed of amino acids 51-67 and 80-90. Sites A and C contain epitopes that are conserved in the European isolates, but not in the North American ones, of PRRSV, site B contains epitopes that are conserved in the European and North American isolates of PRRSV, while site D contains both epitopes that they are conserved and not conserved in the European and North American isolates of the PRRSV. The conserved sites in the N protein described herein are of great importance in the development of diagnostic tests used for unequivocal diagnosis of PRRSV infections, and these analyzes should avoid non-conserved sites to avoid false negative results. In addition, knowledge about several non-conserved sites is highly valuable in the development of differentiation analyzes that may, for example, discriminate vaccinated pigs, from pigs infected with wild type isolates of PRRSV.

Legends Figure 1. Schematic diagram of the G proteins expressed in the pSFV1 and its reactivity with the specific MAbs for GP4.

The names of the plasmids containing the different ORF4 genes are indicated. The open bars represent the amino acid sequences derived from the protein G encoded by the ORF4 of the PRRSV, the black bars represent the amino acid sequences derived from the G protein encoded by the ORF4 of the VR2332. The numbers of the amino acids are indicated above the bars. The genes were first inserted into pGEM-4Z and then transferred to pSFV1, as described in detail in the materials and methods section. The complete set of 14 specific MAbs for GP4, reacted identically with the different constructs in IPMA and the reactivity is indicated as positive (+) and negative (-).

Figure 2. PEPSCAN analysis of specific MAbs for GP4 and polyclonal sera with 12-mer overlapping peptides covering the 25 to 94 residues of GP4. The exploration of Mabs 130.7 and Mab 138.28 which recognize four consecutive peptides is shown (2A). Five other MAbs (122.29, 122.30, 122.66, 122.71 and 138.28) exhibited a similar specificity.

Explorations of the polyclonal sera of two pigs before immunization (val2-0 and val4-0), after immunization with an ORF4 expressing the pseudorabies virus vector (val2-54 and val4-54) and after the challenge Subsequent to the PRRSV (val2-sl and val4-sl) are shown (2A and 2B), and also the exploration of the anti-LV serum 21 of porcine, polyvalent (va21) (2D) is shown. The amino acid sequences of the reactive peptides are shown with the core of the common residues in a box.

Figure 3. Alienation of the amino acid sequences of GP4 (A) and N proteins (B) of several strains of PRRSV. Only the amino acids that differ from the 1-1102 sequence are shown. The nuclear peptide sequences recognized by MAbs and / or polyclonal sera, in the PEPSCAN analysis, are underlined.

Figure 4. Location of the antigenic binding sites in the N protein sequence and comparison of the N protein sequence with those of the North American strains VR2332 and LDV. Antigenic sites A, B, C, and domain D are shown shaded. Sites A, B, and C were identified in the PEPSCAN analysis, site D was identified by the construction of chimeric N proteins. The amino acid sequences of the LV that were replaced by the sequences of the corresponding amino acids of the LDV, to map the domain D, are underlined. The amino acids of the EAV N protein that were inserted between amino acids 25-30 to mutate site B are shown below the LDV sequence. The identical amino acids are connected with vertical bars.

Table 1. Dyeing of chimeric N proteins expressed by the Semliki forest virus in BHK-21 cells in IPMA Mutated Plasmid with Mabs in IPMA 138.22 125.1 / 126.9 / NS95 / NS99 126.15 122.15 / 130.2 / 130.4 / 131.9 / WBE4 / WBE5 / WBE6 / SDOW17 pABV470 - +++ +++ ++++ pABV462 25-30 ++ + ++ +++ pABV518 51-67 ++ ++ + pABV460 80-90 ++ ++ PABV471 11-124 +++ +++ ++++ Table 2. Sequence of primers used in PCR to clone the 0RF4 genes of LV and VR2332 and of the chimeric ORF-4 genes in plasmid vectors pGEM-4Z and pSFVl.

Name Sequence3 Restriction Site Incorporated LV13 5 'GGCAATTCGA-TCCATTTGGA 3' .BamHl LV14 5 'AGAAGC- GCGGGCGGAGTC 3' Hindl II LV46 5 'GCCGTCGGTACCCCTCAGTACAT3' Kpnl LV57 5'ATGTACTGAGGGGÜACCGACGGC 3 'Kpnl PRRSV4 5 'GGCAATTGGATCCACCTAGAATGGC 3' BamHl PRRSV5 5 'GCGAGCAAGCGTCCGCGGTCAAGCATTTCT 3' Hindl ll PRRSV6 5 'CTTGCCGCCGCGGTGGTGTTG 3' SacII PRRSV9 5 'ACAGCTGG-G5CCT? TCGCCGTACGGTACGGCATCGA 3' Kpnl PRRSV10 5 'GCGATAGGTACCCCTGTGTATGTTACCAT 3' Kpnl a The nucleotides underlined in these primers are mutated with respect to the original sequence to create restriction sites or outgoing sequences, or to avoid long extensions of a particular nucleotide. The restriction sites in the primers are shown in italics. • It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (27)

1. A peptide that produces neutralizing antibodies, characterized in that it comprises an amino acid sequence of at least 7 to 40 amino acid residues derived from an amino acid sequence corresponding to a neutralization site of the GP4 protein of Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) ).

2. A peptide that produces neutralizing antibodies in accordance with rei indication 1, characterized in that it comprises an amino acid sequence in which the amino acid residues have been replaced conventionally or under the guidance of a replacement mapping.

3. A peptide according to claim 1 or 2, characterized in that the neutralization site comprises the amino acid residues located approximately at amino acid position 40 to 79 of the GP protein of isolate 1-1002 of PRRSV.

4. A peptide according to any one of claims 1 to 3, characterized in that the neutralization site comprises the amino acid residues located approximately at amino acid positions 52 to 75 of the GP4 protein of isolate 1-1102 of PRRSV.

5. A peptide according to any one of claims 1 to 4, characterized in that the neutralization site comprises the amino acid residues located approximately at the amino acid positions 59 to 67 of the GP4 protein of isolate 1-1102 of the PRRSV.

6. A peptide according to any one of claims 1 to 5, characterized in that the amino acid sequence comprises an amino acid sequence selected from the group consisting of SAAQEKISF, SAAQEEISF, STAQENISF, STAQENIPF, SEESQSVT, SASEAIR, SASEAFR, PAPEAFR, PAPEAIR , SAFETFR AND STSEAFR.

7. A peptide that produces antibodies that react with at least two different isolates of PRRSV, characterized in that it comprises an amino acid sequence of at least about 5 to about 15 amino acid residues derived from an amino acid sequence corresponding to a conserved site of the N protein. of the PRRSV.

8. A peptide that produces antibodies that react with at least two different PRRSV isolates, according to claim 7, characterized in that it comprises an amino acid sequence in which the amino acid residues have been replaced conventionally or under the guidance of a reempl azo mapping. .

9. A peptide according to claim 7 or 8, characterized in that the conserved site comprises the amino acid residues located approximately at amino acid position 22 to 32, of protein N of isolate 1-1102 of PRRSV.

10. A peptide according to any of claims 7 to 9, characterized in that the amino acid sequence comprises an amino acid sequence selected from the group consisting of VNQLCQLLGA and VNQLCQMLGK.

11. a peptide that produces antibodies that are capable of distinguishing between at least two different isolates of PRRSV, characterized in that it comprises an amino acid sequence of at least 5 to 15 amino acid residues, derived from an amino acid sequence corresponding to a non-conserved site and of differentiation, of protein N of PRRSV.

12. A peptide that produces antibodies that are capable of distinguishing between at least two different PRRSV isolates, according to claim 11, characterized in that it comprises an amino acid sequence in which the amino acid residues have been replaced conventionally or under the guidance of a mapping replacement.

13. A peptide according to claim 11 or 12, characterized in that the non-conserved site comprises the amino acid residues located approximately at amino acid position 41 to 50, of protein N of isolate 1-1102 of PRRSV.

14. A peptide according to any of claims 11-13, characterized in that the amino acid sequence comprises an amino acid sequence selected from the group consisting of PRGGQAKKKK, PRGGQAKRKK, PRGGQAKKRK, GPGKKNKKKN, GPGKKNKKKT, GPGKKNRKKN, GPGKKFKKKN, GPGKKIKKKN and GPGQINKKIN.

15. A peptide according to claim 11, characterized in that the non-conserved site comprises the amino acid residues located approximately at amino acid position 1 through 10 of protein N of isolate 1-1102 of PRRSV.

16. A peptide according to claim 11, 12 or 15, characterized in that the amino acid sequence comprises an amino acid sequence selected from the group consisting of MAGKNQSQKK, MPNNNGKQTE, MPNNNGKQPK, MPNNNGKQQK, MPNNNGKQQN, MPNNNGKOOK and MPNNNGRQQK.

17. A peptide that produces antibodies directed against a conformational epitope site or PRRSV N protein, and the peptide is characterized in that it has a length of 5 to 15 amino acid residues, the amino acid residues correspond to a localized conformation extension from about amino acid position 68 to 79 or 79 to 90 or 111 to 124 of protein N of isolate 1-1102 of Le lys t ad virus,

18. A peptide according to claim 17, characterized in that the amino acid sequence comprises an amino acid sequence selected from the group consisting of PKPHFPLAAEDDIRHHL, SIQTAFNQGAGT and HTVRLIRVTSTSAS.

19. An immunogenic composition for inducing neutralizing antibodies corresponding to a neutralization site of the GP4 protein of Lelystad virus, characterized in that it comprises at least one peptide according to any of claims 1 to 6.

20. A vaccine for prophylaxis of infections by PRRS, characterized in that it comprises a peptide according to any one of claims 1 to 6, or an immunogenic composition according to claim 19, together with an adjuvant or carrier suitable for administration to an animal.

21. A synthetic antibody characterized in that it reacts with a peptide according to any of claims 1 to 18.

22. A kit for diagnostic analysis, for the detection or identification of antibodies against a PRRSV isolate, characterized in that it comprises at least one peptide of any of the claims of the invention. 1 to 18, together with adequate means for detection.

23. A kit for diagnostic analysis, for the detection or identification of antibodies, directed against or derived from antigens, of a PRRSV isolate, characterized in that it comprises an antibody according to claim 21.

24. The use of a vaccine according to claim 20 or of a test or diagnostic kit, according to claim 22 or 23, to reduce the occurrence of PRRS in a herd of pigs.

25. The use of a kit for diagnostic tests, according to claim 22 or 23, to analyze the presence of PRRS in a pig or in a herd of pigs.

26. The use of a vaccine according to claim 20 or of a test or diagnostic kit, according to claim 22 or 23, in eradication programs, to reduce or end the occurrence of PRRS in a herd of pigs.

27. A method for analyzing the presence of PRRS in a pig or in a herd of pigs, characterized in that it comprises the use of a kit for diagnostic tests, in accordance with claim 22 or 24.