MXPA99009488A - Selection marker - Google Patents

Abstract

The invention is concerned with the use of cyanamide hydratase as a selection marker in plant transformation. Cyanamide acts as a herbicide and plants transformed with the gene coding for cyanamide hydratase are able to convert the cyanamide into urea which enables the selection of transformed plants by survival under cyanamide pressure.

Description

SELECTION MARKER Field of Invention The present invention concerns a new selection marker, especially for the use of cinnamide hydratase as a selection marker in plant transformation experiments.

Background of the Invention Cyanamide (H2N = CN) is a nitrile derivative. which, like other nitrile derivatives, is used in agriculture for the stimulation of growth and for the protection of plants. The cinnamide in aqueous solution in the form of its calcium salt is used as a fertilizer providing ammonia to the soil through its metabolic conversion. It also has the additional advantage of acting as a herbicide. For use as fertilizer, it must be applied before planting.

Chemically, cinnamide belongs to the group of nitriles. Despite the presence Ref: 031745 Relatively rare in the nature of compounds containing the nitrile group, enzymes have been found that hydrate this group in bacteria and plants (eg Negasawa T., and Atanabe I (1988) Biochem. Biophys. Res. Commun. (1008-1016; Endo T. And Watanabe I (1989) FEBS Lett 243 61-64) Myro th e ci um verru ca ri has also been found in a nitrile hydrating enzyme (Stransky H. And Amberger A (1973) A. Pflanzenphysiol 70 74-87) that hydrates the nitrile group of cyanamide with urea formation: H2N = C-N + NOH = > H2N-CO-NH2 • Maier-Greiner et al. They have isolated the enzyme and cloned the gene that encodes it (Proc Nati, Acad Sci. USA 8_8_, 4260-4264, 1991). They have shown that this enzyme shows an extremely precise substrate specificity, in which compounds chemically related to cyanamide are not recognized as substrates.

The selection markers must confer a dominant phenotype in the transformed cells that is capable of being used as a selection criterion. This is divided into two classes: a class of genes that give the cell good viability, good lethality in the presence of a selective agent and another class of genes that have negligible effects on the survival of the cell but confer on the transformed cells some distinctive physical characteristic.

In the transformation of plants the fraction of plants the fraction of cells that incorporate in new DNA is generally low, therefore most of the stable transformation schemes use markers that ensure the survival of the transformed cells in the presence of a selective agent .

For many years, several selection markers of this first group have been known and used for plant transformation experiments. Among them are the enzyme acetolactate synthetase (cls), which confers resistance against imidazolinones, sui fonilureas, tria zolopyrimidines and pyrimidyloxyubenzoates and the enzyme hygromycin 3, -Ofosfotrans ferasa (hpt) which confers resistance against hydromycin. Also available are chloramphenicol transferase (cat) that detoxifies chlorophenicol and dihydrofolate reductase (dhfr) that re-effects the toxic effects of methotrexate. Another possibility is to use the bar gene for resistance to the bialaphos herbicide (WO 97/05829).

Although there are already several selection markers available, there is still a need for another marker. This is due to several reasons: when transgenic plants with a new structure are transformed a second time, it is necessary to select the newly formed transformants with the help of a second selection marker; the selection markers mentioned above are not applicable in all plant species; some of the compounds that have to be added to allow selection are antibiotics.

The dissemination of genes that give resistance to antibiotics or herbicides should be minimized as much as possible, to avoid the risk of conferring resistance to pathogens; some of the compounds that have to be added to allow selection are relatively expensive. There is a need for cheaper selection agents.

Description of the invention.

The invention now provides the use of a gene encoding cyanamide hydratase (CAH) as a new selection marker. Preferably, this can be used for the transformation of plants. The gene comprises the nucleotide sequence SEQIDNO: l or the muteins of these with cyanamide hydratase function.

In addition, the invention comprises a method for the selection of transformed plants comprising the construction of a vector carrying a coding sequence for CAH and a gene of interest, the transformation of the vector to plants, parts of plants or plant cells or calluses and the culture of the resulting transformants in a medium containing cyanamide.

The invention is also directed to the use of cyanamide for the selection of plants transformed with a gene encoding CAH.

Another angle of the invention are expression kits that consist of a nucleotide sequence that codes for cyanamide hydratase and a gene of interest. Vectors with this expression kit and hosts, including the .Agrobacterium, which contains said vector also form part of the invention. Transformed plants with said vectors and / or said Agrobacterium are also part of the invention.

DESCRIPTION OF THE FIGURES Figure 1: T-DNA profile in MOG874 Figure 2: T-DNA profile in pMOGH56 Figure 3: T-DNA profile in pMOG1295 Figure 4: T-DNA profile in pMOG1005 Figure 5: Profile of the T-DNA T-DNA in pMOG1278 Figure 6: T-DNA profile in pMOG1295 Figure 7: T-DNA profile in pMOG1253 Figure 8: Profile of the expression cassette in pMOG873 Figure 9: Profile of the expression cassette in pMOG617 Figure 10: Arabidopsis explants transformed with a) pM0G115β or b) pMOG410, both selected in 50 mg / l cyanamide.

Detailed description of the invention The invention is directed to the use of a gene encoding cyanamide hydratase as a selection marker.

The enzyme, cyanamide hydratase (CAH) confers resistance to cyanamide which is a compound with herbicidal activity. It has been discovered that this property of the gene can be used in transformation technology to aid in the differentiation between transformed plants and non-transformed plants. However, the herbicidal activity alone is not sufficient to cause a gene to be expressed in those cells subjected to selection conditions. This can be either by constitutive expression or expression in specific tissues such as callus, seed, embryogenic tissues and maris thematic tissues. In addition, the gene needs to convert the susceptibility of a plant to a toxic compound, in tolerance without any residual toxic activity. Also the presence of a sufficiently large "window" between the concentration of toxic compound required for selection and the concentration at which, in the presence of the selection gene, growth can still be seen, is of importance for the use of a marker gene of selection. On the other hand, the system should preferably operate with sufficient cellular autonomy, such as that of a chimeric tissue (for example a tissue with a mosaic of transformed and non-transformed cells) in which the untransformed cells are not protected by neighboring cells transformed and therefore survive the selection.

Surprisingly, the combination of the gene encoding CAH and the toxic properties of cyanamide qualify for use as a selection marker system.

This invention shows that it is possible to select transformants on the basis of their tolerance to cyanamide.

An additional advantage is that cyanamide is converted to urea, which in plants, is converted to NH3 and CO2. The plant can use NH3 as a nitrogen source. This is an additional possibility of selection to increase the "window" between tolerance and selection. Normally, the culture medium contains ammonia and nitrate (contained in the medium of Murashige and Skoog, see Table 2 and 4). If these are excluded or if their concentration is reduced, the transformed plants containing the CAH gene will convert the cyanamide present in the medium as a selection agent, in urea and later in ammonia, which can be used as a nitrogen source. The untransformed, are unable to do this, therefore in addition to the herbicidal effect of cyanamide, they will also present a competitive disadvantage in terms of nitrogen uptake.

The nucleotide sequence encoding CAH is preferably the sequence described in SEQIDNO: 1. Muteins of this sequence can also be considered as part of the invention. Muteins are nucleotide sequences with altered nucleotide sequence but still have functional and immunological characteristics similar to those of the sequence presented in SEQIDNO: 1. These muteins are also called functional variants. Additionally, the polynucleotides of the invention specifically include those substantially identical sequences (determined as described below) to the sequences of the gene of the invention and which encode proteins that retain the functional activity of the proteins of the invention. Therefore, in the case of the CAH gene advocated in the present invention, the above term includes various nucleotide sequences that have substantial identity with the sequences advocated herein and that encode proteins that continue to have a degradation activity of cyanamide.

"Percent sequence identity" for polynucleotides and polypeptides is determined by comparing two optimally aligned sequences through a comparison window, in which the portion of the polynucleotide sequence or the polypeptide in the comparison window may consist of additions or deletions (e.g., gaps) compared to the reference sequence (which does not consist of additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions in which an identical nucleic acid or amino acid residue base is produced in both sequences to give the number of opposing positions, dividing the number of opposing positions, by the total number of positions in the comparison window and multiplying the result by 100, to obtain the percentage of sequence identity. Optimal alignment of sequences for comparison can be performed by computer implementations of known algorithms (eg GAP, BESTFIT, FASTA and TEAST in the Wisconsin Genetics Software package, from the Computer Genetics Group (GCG), 375 Dr. En Ciencias Madison, WI , or BlastN and BlastX available at the National Center for Biotechnology Information) or by inspection.

The term "substantial identity" or "substantial similarity" means that a polypeptide consists of a sequence that is capable of generating hybrids with the desired polypeptide under stringent conditions. It is understood by rigorous conditions to a solution of 2 * SSC and at a temperature of 65 ° C.

Polypeptides that are "substantially similar" share sequences as mentioned above, except that residue positions that are not identical may differ by conservative amino acid changes. The substitution of conservative amino acids refers to the possibility of exchange of residues that have similar side chains. For example, a group of amino acids having aliphatic side chains are glycine, alanine, valine, leucine and isoleucine; a group of amino acids with aliphatic-hydrophilic side chains are serine and threonine; a group of amino acids with side chains containing amides is aspargine and glutamine; A group of amino acids with aromatic side chains is phenylalanine, tyrosine and tryptophan; a group of amino acids with basic side chains is lysine, arginine and histidine; and a group of amino acids with side chains containing sulfur is cysteine and methionine.

The substantial identity of polynucleotide sequences means that a polynucleotide consists of a sequence having at least 70% sequence identity, preferably at least 80%, preferably at least 90% and better still at least 95%. Another indicative factor if two nucleotide sequences are substantially identical is whether two molecules specifically generate hybrids to each other under stringent conditions. The stringent conditions are dependent sequences and will be different in different circumstances. As usual, stringent conditions are selected around 10 ° C less than the thermal melting point (Tf) for the specific sequences at a defined ionic strength and pH. The Tf is the temperature (under defined ionic strength and pH) in which, 50% of the sequence sought, "generates hybrids in a perfectly coincident test." The Tf of a hybrid, which is a function of both the length and the the composition of the test base can be calculated using information present in Sambrook, T. et al., (1989) Molecular Cloning - A laboratory Manual (second edition), Volume 1-3, Cold Spring Harbor Laboratory, Cold Spring, Typically , stringent conditions for a Southern blot protocol comprise washing at 65 ° C with 0.2 X SSC For preferred oligonucleotide tests, wash conditions are typically around 42 ° C in 6 X SSC.

The present invention provides a chimeric DNA sequence consisting of an open reading frame capable of encoding a protein with cyanamide hydratase activity. The term chimeric DNA sequence will tend to encompass any DNA sequence that consists of DNA sequences not naturally found in nature. For example, the chimeric DNA will tend to encompass DNA consisting of said open reading frame in an unnatural location of the plant genome, even if said plant genome would normally contain a copy of said open reading frame at its chromosomal location natural. Similarly, said open reading frame can be incorporated into the genome of the plant where it is not naturally found, or into a replicon or vector in which it is not naturally found, such as a bacterial plasmid or a viral vector. The chimeric DNA should not be limited to DNA molecules replicable in a host, but should also tend to encompass DNA capable of being linked to a replicon, for example by virtue of specific adapted sequences, physically bound to the open reading frame according to to the invention. The open reading frame may or may not be linked to the elements regulating its direction (in favor of the current and countercurrent) natural.

The open reading frame can be derived from a genomic data bank. In the latter one may be one or more introns separated exons that make up the open reading frame encoding a protein, according to the invention. The open reading frame can also be encoded by an uninterrupted exon, or by a cDNA to the mRNA encoding a protein according to the invention. The open reading frames, according to the invention, also consists of those in which one or more introns have been removed or added artificially. Each of these variants are included in the present invention. Preferably, the open reading frame is derived from the soil fungus Myro the ci a verru ca (as described in Maier-Greiner, U: H: et al., Proc. Natil. Acad Sci. USA 8_8_, 4260- 4264, 1991).

In order to be able to be expressed in a host cell in such a way that the expressed protein can confer resistance to the toxic agent of selection, a chimeric DNA will be provided in an expression cassette according to the invention, with regulatory elements that they allow it to be recognized by the host's biochemical machinery and thus allow the open reading frame to be transcribed translated into the host. Generally, it will consist of a region of transcription initiation that can conveniently derive from any gene capable of being expressed in the host cell of choice, as well as a translational initiation region for the recognition and binding of ribosomes. In cells of eukaryotic plants, an expression kit generally also consists of a region of transcription termination localized in favor of the current of said open reading frame, allowing the transcription to terminate and polyadenylation of the primary transcript to occur . Furthermore, the use of the codon can be adapted to the codon accepted for the host of choice. The principles that govern the expression of a chimeric DNA structure in a chosen host cell, are usually understood by those with a normal skill in the discipline and the construction of expressible chimeric DNA structures, is nowadays a routine for any kind of host cell, either prokaryotic or eukaryotic.

In order to maintain the open reading frame in a host cell, it is generally provided in the form of a replicon consisting of said open reading frame according to the invention linked to DNA recognized and replicated by the chosen host cell. Accordingly, the selection of the replicon is largely determined by the lesson host cell. These principles in governing the selection of appropriate replicons for a particular chosen host fall within the scope of a person normally trained in the discipline.

A special type of replicon is one capable of transferring itself, or a part of it, to another host cell, such as a plant cell, co-transcribing by means of it, the open reading frame according to the invention. for said plant cell. The replicons with said capabilities will be referred to as forward vectors. An example of such a T-plasmid vector which, when present in a suitable host, such as Agroba c t eri a t emefa ci s, is capable of transferring part of itself, the so-called T region, to a plant cell. Currently, different types of T-plasmid vectors are used routinely (see: EP 0 116 718 Bl) to transfer chimeric DNA sequences to plant cells or protoplasts, from which new plants can be generated that stably incorporate said DNA chimeric in their genomes. One particularly preferred form of T-plasmid vectors are so-called binary vectors as asserted in EP 0 120 516 Bl and US 4,940,838). Other suitable vectors, which can be used to introduce the DNA, according to the invention, into a host plant, can be selected from viral vectors, for example non-integrating viral plant vectors, as derivable from double-stranded plant viruses (for example CaMV example) and single filament virus, gemini virus and the like. The use of such vectors may have advantages, particularly when it is difficult to stably transform the host plant. This may be the case with woody species especially trees and vineyards.

The expression "host cells incorporating a chimeric DNA sequence in their genome, according to the invention" will tend to consist of cells, as well as multicellular organisms containing said cells, as well as multicellular organisms containing said cells, or consisting of essentially in said cells, which stably incorporate said chimeric DNA into their genomes thereby maintaining the chimeric DNA, and preferably transmitting a copy of said chimeric DNA to the progenitor cells, either through mitosis or meiosis. Said host cells may be prokaryotic organisms such as bacteria, but also eukaryotic organisms such as yeasts. Cells from eukaryotes in a staple culture, such as plant cell cultures, or from animals such as mammals, can also be considered to stably introduce the chimeric DNA. According to a preferred embodiment of the invention, plants are provided which essentially consist of cells that incorporate one or more copies of said chimeric DNA in their genomes, and which are capable of transmitting a copy or copies to their progeny, preferably in the manner of Mendel. By virtue of the transcription and translation of the chimeric ASN according to the invention, these cells that produce CAH will show an increased resistance to cyanamide. Although the principles governing the transcription of DNA in plant cells are not always understood, the creation of a chimeric DNA capable of being expressed in tissues subject to selection by cyanamides, such as callus, seed, embryogenic tissues or mersist tissues Emetics, or constitutively, is currently routine. The transcription initiation regions routinely used for the expression of the transformed polynucleotide in a constitutive mode are promoters capable of being obtained from the cauliflower mosaic virus, notably the promoters 35S RNA and 19s copy RNA and the so-called T-DNA promoter. of a record ct er i um t umefa ci ens. In particular, mention should be made of the nopaline synthetase promoter, the octopine synthetase promoter (as disclosed in EP 0122 791 Bl) and the mannopin synthetase promoter. In addition, plant promoters can be used, and can be substantially constitutive, as a promoter of the rice actin gene. The choice of the promoter is not essential, however it should be clear that high-level constitutive promoters should also show expression in the tissue in which the selection occurs. It is also known that the duplication of certain elements, called int ensifiers, can considerably increase the level of DNA expression under their regime (see for example: Kay R. Y col. (1987), Scince 236, 1299-1302; duplication of the sequence between -343 and -90 of the 35s promoter CaMV increases the activity of this promoter). In addition to the 35s promoter, single or double intensified, examples of high level promoters are the promoter capable of being induced by light of the small subunit of ribulose biophosphate carboxylase (rbcSSU) and the promoter of the chlorophyll a / b binding protein ( Cab). Also contemplated by the present invention are hybrid promoters, which consist of elements of different physically linked promoter regions. A well-known example of this is the so-called mannopine promoter intensified by CaMV (US patent 5, 106, 739), which consists of elements of the mannopin synthetase linked to the CaMV accelerator.

Specifically, with the monocotyledone transformation of the introns utilization between the promoter and the marker gene of selection enhances the expression.

The term "promoter" therefore refers to a cross-current region of the structural gene DNA and involved in the recognition and ligation of RNA polymerase and other proteins to initiate transcription. A "plant promoter" in a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and states of development or cell differentiation.

For this invention a constitutive promoter is preferred because the selection of the transformants can be done in several stages and with several tissues. Therefore a constitutive promoter does not limit the possibilities of selection.

In this aspect, the choice of an appropriate constitutive promoter is important for the use of other promoters in the same transformation process. It is known that the supplication of promoters includes in the expression of the genes under the control of said promoters. Since the goal of the expression of a selection marker is only to be used for the selection of plants that are being transformed simultaneously with a gene of interest, it should be taken into account that the use of the same promoter for the selection marker gene and the gene of interest can cause problems.

As for the need for a transcription terminator region, it is generally considered that said region enhances the reliability as well as the efficiency of transcription in plant cells. Therefore, its use is preferred within the scope of the present invention.

Transformation of plant species is currently routine for an impressive number of plant species, including di edible edónea s as mon oco til edónea s. In principle, any transformation method can be used to introduce chimeric DNA according to the invention, into a suitable predecessor cell. Appropriate methods can be selected from the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74, Nergrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363- 373), electroporation of protoplasts (Shilico R: D: et al., 1985 -Bio / Technol- 3_ ~ 2099-2202), microinjection in plant material (Crossway A. et al., 1986, Mol. Gren Genet 202 179-185), (DNA or RNA coated) bombardment of particles of various plant materials (Klein T: M: Y col., 1987, Nature 327, 70), infection with viruses (non-integrators), in-plant transfer of the Agroba ct eri um tum efa ci gene in s mediated by plant infiltration, transformation of mature polesn or mycospores (EP 0 301 316) and Similar. A preferred method according to the invention consists in the transfer of Agroba ct eri um mediated DNA. Especially preferred is the use of the so-called binary vector technology as reported in EP A 120 and US Patent 4,940,838.

The transformation of the tomato is preferably carried out essentially, as described by Van Roekel et al. (Van Roekel, J: S: C: et al., Damm, B, Malchers, L., S., Heokema, A. (1993). Factors Influencing transformation frequency of tomato (Lycopersi with is cul in t um), Plant cell Reports, 12, 644-647). The transformation of the potato is preferably carried out and essentially as described by Hoekema et al. (Hoekema, A. Et al., 7, 273-278 1989).

Although they are considered somewhat more resistant to genetic transformation, monocotyledonous plants are receptive with regard to transformation and can regenerate fertile transgenic plants from cells, embryos or other materials of transformed plants. At present, the preferred methods for the transs formation of monocot monocots are the bombardment of microprojectiles of embryos, explants or cells in suspension, and uptake of DNA or (tissue) electroporation (Shimanmoto, et al 1989, Nature 336, 274-276 ). Transgenic maize plants have been obtained by introducing the bar gene Streptomyces Hygrocospicus, which encodes the phosphinothricin acetyl transferase (an enzyme that inactivates the herbicide phosphinothricin), in embryonic cells of a culture is suspension of corn by bombardment of microprojectiles (Gordon -Kemm, 1990, plant Cell, 2_, 603-618, 1990). Wheat plants were regenerated from embryogenic suspension culture by selection of embryogenic calli for the establishment of embryogenic suspension cultures (Vasil, 1990 Bio / Technol 8_, 429-434 1990). The combination with transformation systems for these crops allows the application of the present invention to monocotyledons.

Monocotyledonous plants, including economically important crops such as rice and cereals, are also shown to be receptive to DNA replication by Agroba ct erium strains (see WO 94-00977, EP 0 159 418 Bl, Gould J. , Michel D., Hasegawa o., Ulian EC, Peterson G., Smith RH., (1991) Plant. Physiol., 95, 426-434, 1991).

To obtain transgenic plants capable of expressing more than one chimeric gene, several alternatives are available, including the following: . The use of DNA, for example a T-DNA in a binary plasmid, with several physically modified genes, linked to a second selection marker gene. The advantage of this method is that the chimeric genes are physically linked and therefore migrate as a single Mendel location. The invention is especially useful in this aspect, since it allows a second selection marker that can be introduced near a selection marker already exists, for a combination that is interesting. Therefore, the selection of formant retrans can be made independently of the nature of the first selection marker.

B. Cross-pollination of transgenic plants each capable of expressing one or more chimeric genes, preferably linked to a selection marker gene, with pollen from a transgenic plant that contains one or more chimeric genes linked to another selection marker. Subsequently, the seed obtained by this crossing can be selected based on the presence of selection markers or in the presence of chimeric genes. The plants obtained from the selected seeds can later be used for subsequent crosses. In principle, the chimeric genes are not in a single location and therefore the genes can segregate as independent locations. Also here, the option of selecting by means of both selection markers is one of the advantages of the present invention. C. The use of most chimeric DNA molecules, for example plasmids, each containing one or more guimeric genes and a selection marker. If the frequency of co-t rans formation is high, then the selection based on a single marker is sufficient. In other cases, selection based on more than one marker is preferred. D. Consecutive transformation of transgenic plants that already contain a first, second (etc.) chimeric gene with new chimeric DNA, optionally consisting of a selection marker gene. As in method B, the chimeric genes are in principle not in a single location and the chimeric genes can therefore be segregated as independent locations. E. Combinations of the strategies mentioned above.

The current strategy may depend on various considerations such as can easily be determined, such as the purpose of the parental lines (direct cultivation, use in a breeding program, use to produce hybrids) but is not critical with respect to the described invention.

Although not necessary for this invention, it is known that practically all plants can be regenerated from cultured cells or tissues. Means for regeneration vary between different plant species, but in general a suspension of transformed protoplasts or a Petri dish with transformed explants is initially provided. The shoots can be induced directly or indirectly (starting from calluses) via organogenesis or embryogenesis and subsequently implanted. Near the selection compound, the culture medium will generally contain several amino acids and hormones, such as auxin and cytokinins. An efficient regeneration will depend on the medium, the genotype and the history of the crop. If these three variables are controlled, regeneration is usually reproducible and repeatable. After the stable incorporation of the sequences of transformed genes in the transgenic plants, the characteristics conferred by them can be transferred to other plants by sexual crossing. Any one can be used, within the different reproduction techniques, depending on the species crossing.

Example 1 Cloning of the gene that encodes cyanamide hydratase (CAH) in a heterologous expression kit a) Structures for trans formation in dicotyledons.

The pMOG874 structure contains the coding region of the cyanamide hydratase gene of the soil fungus Myro th e ci um verru ca ri that is feasibly linked to the CaMV 35s promoter and the CaMV 35s terminator. This chimeric gene is cloned in the binary vector pBHOl (Jefferson et al., EMBO J., 6, 3901, 1987) replacing the coding region for β-glucuronides and the terminator nopaline sistetase.

The structure is obtained by adding a Xhol location at the 5 end, and a Sscl location at the 3 end, of a 899 bp cDNA fragment from CAH (position 235-1197 of the sequence published by Maier-Greiner et al (1991) Proc. I was born Acad Sci. USA 88: 4260-4264) by PCR using the manuals Pl: 5 'ACCGAGCTCGAATTCGGCACGAGGTTGACATGATACCTTCCTG3' and P2: GACCTCGAGAATTCGGCACGAGGTACGATCCTACTTCCTCGC 3 'between the Xhol and SstL locations of the expression vector of the plant pRTIOl, both belonging to to the polylinker that is inserted between the 35s promoter and the pRTIOl 35s termination signal (Topfer et al., 1987, Nucí Acids Res 15: 5890).

The chimeric gene is then cleaved with PstL, the protruding ends polished with polymeric T4 DNA and directly cloned into the Smal localization of pBIN19 (Brvan, M. Nucí, Acids Res. 12: 8711-8721, 1984). In the structure pMOG1156 an additional operable ß-glucuronidase gene is inserted, feasibly linked to the 35s promoter and the 35s terminator as the Xhol / Sall fragments in the SalI localization of pMOG874.

Both structures contain in addition to the novel selection marker CAH the conventional selection marker NPTII linked to the nopaline synthetase promoter and the nopaline synthetase terminator in the same way as in pBIN19. b) Structures for the formation in monocotyledons In the same way that pMOG874 was obtained, the expression kit was cloned into a high copy vector (pRTIOl, Tpfer, R and others, Nucí Acids Res., 1_5, 5890, 1987) which resulted in pMOG873 ( Figure 8). A derivative of pMOG22 was obtained (figure 3, deposited at the Central Bureau voor Schimmelcul tures, Baarn, The Netherlands, on January 29, 1990, under the number CBS 101.90) introducing a restriction site Kpn I in the polylinkel of pMOG22 between the EcoR place and the Sma I place. The orientation of the pollen link was also reversed. This plasmid, called pMOG1005, contain a gene resistant to hydromycin between the limits of left and right D.ADN (figure 4). The 1.7 kb expression kit, comprising the cah gene under control of the 35s promoter and the 35S terminator, was cloned between the restriction sites Hind III and BnHI. Said plasmid was named pMOG1278 (figure 5). The binatrial vector pMOG1295 (FIG. 6) is a derivative of pMOG1278 which contains in the restriction site Sa l I a GUS expression cassette, as described in Vacanneyt, G et al. (Mol. Gen. Genet, 220-245, 1990) .

PMOG1253 was made starting with Pmopgld (Sijmons, PC et al., Bio / Technol, 8, 217-221, 1990), which contain in an expression kit the doubly improved 354S promoter, the A1MV RNA4 leader sequence, the GUS gene and the terminator-us, as an EcoRI-Hind III fragment.

Plasmid p35S GUS INT (Vancanneyt, 1990) was targeted with SnaB I and Msc I. The resulting fragment 426 bp, which contains part of the coding region for the GUS gene and for the intron ST-LS1, was isolated and cloned into pMOG18, aligned with SnaB and Msc I. From the resulting plasmid, a 3189 bp EcoR I-Hiund III fragment was isolated and cloned into a pMOG22, which resulted in a PMOG1253 (Figure 7).

PMOG617 (FIG. 9) was obtained by cloning the hydromycin expression kit of pMOG22 at the Hind III site of the high copy vector pM0G18.

Example 2 Transformation of potatoes The Kardal method used for the transformation of stem segment of S ol am un t ube ros um cv is described below. Using Agroba ct eri um t umefa ci ens ens.

Nodal explants from potato plants grown in vitro were used to grow 8-week-old plants. The plants were grown in multiplication medium (MUM) under a light period of 16 h (1700 lux) at 24 ° C and with dark periods of 8 h at 21 ° C (The different means can be found in Table 2) . Stem segments of approximately 5 mm were cut in sterile filter paper soaked with washing medium (WAM) and collected in a bottle with washing medium. For approximately 300 explants the Wash Medium was replaced by a Pre-culture Medium (PRM). The flasks were cultivated at 80 r.p.m. in the same culture conditions described above, for approximately 24 h. All the binary vectors used in this study contained the nptll gene as a plant selection marker and the nptll as a bacterial selection marker, the plasmid pMOG410 also carried a guimeric gus gene that contained an intron (Vancanneyt et al., 'Mol. , Gen, Genet., 220, 245-250, 1990). Plasmid pMOG 1156 also contained the gus gene and the chimeric cah gene encoding cyanamide hydratase. Plasmid pMIG874 also carried the cah gene. The plasmids were maintained in E: Coli and a. Tumefaciens under selection by kanamycin. The Agrobacterium stage used in this study contained a selection marker for rifampicin on a CS8 chromosomal background. The construction of the aid strain EHA105 is described by Hood et al. (1993, Trang. Res. 2_, 208-218).

The Agroba ct eri a were grown overnight in LS medium with antibiotics (rifampicin 20 mg / I, kanamycin 100 mg / l). The overnight culture was diluted to 'OD600 = 0.1 and culture to OD600 = 0.3 in LB without antibiotics in approximately 2h. The bacterial suspensions were centrifuged at 1600 revolutions for 15 minutes at room temperature. The bacteria are resuspended in washing medium and used for cocultivation experiments. The preculture medium was removed from the containers and replaced by the Agroba ct erium suspension. The flasks were incubated for 20 minutes after which the explants were rinsed twice with washing medium. The explants were dried on sterile filter paper and incubated for 48 h. In plates with coculture medium (COM). The explants were then transferred to the post-culture medium (POM) and incubated for 72 hours. Then the explants were transferred to sprout inducers (SIM) with different concentrations of cyanamide or kanamycin. After two weeks the explants were subcultured in the same medium and approximately three weeks after cocultivation the explants were placed in sprouting elongation medium (SEM) with cyanamide or kanamycin as already mentioned. When the shoots were thick enough to be cut, they were transferred to an implantation medium (RIM). The shoots that were able to be implanted were then transferred to the implant-inducing medium with 50 mg / l of cyanamide or 30 mg / l of kanamycin.

Simultaneously, the transgenic nature of the shoots was determined by testing the expression of the gus gene in leaves of the implanted shoots using a GUS histochemical assay. It was observed that for pMOG1156 the implantation of transgenic shoots in medium with cyanamide was completely consistent with the expression of the gus gene.

Table 1: Frequencies of transformation of segments of potato stem. pMOG1156 (cah-gu-nptll pMOG410 (gus-nptll) pMOG874 (cah-nptll) d. undetermined Table 2: Composition of the different media Media WAM PRM COM POM SIM SEM RIM MUM Macro salts lxms lxms lxms lxms lxms lxms l / 2x l / 2x MS MS Vitamins B5 B5 B5 B5 B5 B5 1 / 2R 1 / 2R 3 3 Sucrose sprout 39- "32- -30, 0. ng. N o, 1 o. * O o o * 0 y> o" o? X "o? - 'o Agar 0.8% 0.8% 0.8% 0.8% 0.8% 0.8% 0.8% MONTH (gr / 1) 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 PH 5.8 5.8 5.8 5.8 5.8 5.8 5.8 5.8 Zeatin riboside 0.5 0.5 3.0 3.0 3.0 2.4-D 1.0 1.0 IBA 0.1 Cefotaxin 200 200 200 100 Vancomycin 100 100 100 50 M.S. : Murashige and Skoog, Physol. 15, 473-479, 1962. B5: Gamborg B5 (Gamborg, Ori et al., Exp. Cell Res. 50, 151-158, 1986) Example 3 Tomato transformation The method used for the transformation of cotyledons of Lycopers i con es cul in t um cv is described below. Money marker using Agroba c t eri um t umefa ci s s. The binary vectors and strains of Agrobacteria for this transformation method are identical to those described above. The tomato seedlings were germinated in germination medium (GEM) under a light period of 16 hours (1700 lux) at 24 ° C and a dark period of 8 hours at 21 ° C: (The compositions of the various media can be observed in Table 4). The cotyledon explants of 5 to 7 days old seedlings were cut on sterile dilute paper soaked with Washing Medium (WAM) and placed on plates with coculture medium (COM). The plates, each with approximately 50 explants, were incubated overnight, under the same conditions previously described.

The pre-incubated explants were carefully immersed in an Agroba ct erium inoculum for 20 minutes. The explants were then dried on sterile filter paper and incubated for 48 hours in the second set of coculture plates. The explants were incubated in series for 72 hours on plates with Post-culture medium (POM) after which the explants were transferred to an outbreak-inducing medium (SIM) with various concentrations of cyanamide or kanamycin. Every three weeks the explants were subcultured in it. After approximately 8-12 weeks the shoots were cut and placed in Implant Inductor Medium (RIM). The shoots that were able to be implanted were then transferred to an implant-inducing medium with 50 mg / l of cyanamide or 30 mg / l of kanamacin. Simultaneously, glue leaves of the implanted shoots were subjected to tests for the extension of the gus gene in a histochemical GUS test.

Table 3: Transformation results of cotyledon tomato explants pMOG1156 (gus-nptll-cah) pMOG410 (gus + nptll pMOG874 (cah-nptll d without determining Table 4: Composition of the different media Medium: WAM CQ POM SIM RIM GEM MS Micro salt lx lx lx lx lx l / 2x Vitamins B5 B5 B5 B5 B5 B5 Sucrose 3% 3% 3% - 1% 1% Glucose - - - 1% - - Agar - 0.8% 0.8% 0.8% 0.8% 0.8% MONTH (gr / l) 0.5 0.5 0.5 0.5 0.5 0.5 PH 5.8 5.8 5.8 5.8 5.8 5.8 Zeatin riboside 2.0 2.0 2.0 (mg / l) IAA 0.1 0.1 0.1 2.4D 0, 05 IBA 0.25 Carbencillin 500 Cefotaxime 200 200 Vacomycin 50 Acetosyringone 0.2 (mM) Example 4 Transformation of arabidopsis The method used for the transformation of segments of Arabidops is thaliana cv is described below. C24 using Agrobacterium tumefaciens. The binary vectors for this transformation method are identical to those described above.

Six mg of seeds were germinated of Arabidops is in a bottle with liquid Germination Medium (GM) under a light period of 16 hours (1700 lux) at 24 ° C and darkness of 8 hours at 21 ° C at 80 rpm. (Table 4 shows the contents of different media). Roots of 9-day-old seedlings were isolated in a sterile petri dish and collected in a drop of Germination Medium (GM). Roots were cut into segments of approximately 3-5 mm and approximately 100 explants were spread evenly on a nylon membrane (0 8 cm) which was placed on plates containing callus inducing medium (MIC): plates were incubated 3 days under the same conditions described above.

The strain of a groba ct eri um used in this study contained a rifampicin selection marker in a C 58 chromosome medium. The construction of "the MOG101 attendant strain has been described by Hood et al., (1993). During the night in LB medium with antibiotics (rifampicin f20 mg / l, kanamycin 100 mg / l), the culture was diluted overnight at 1:10 in LB without antibiotics and cultured for approximately 3 hours. They were set at 1600 xg for 15 minutes at room temperature, the bacteria were resuspended in GM and adjusted to OD600 = 0.1 and used coculture paw.The membrane containing approximately 100 explants was incubated for 2 minutes with the Agrobacterium suspension and dried on a sterile filter paper to remove excess bacteria The membrane with explants is cultured for 48 hours on CIM plates After rinsing the membrane and the explants with GM These were incubated in plates with sprout inducers (SIM) with different concentrations of cyanamide or kanamycin. After 5 days the membranes with the explants were transferred to the same medium (SIM) for subculture. The second subculture was after 2 weeks. Approximately four weeks after cocultivation, 60 shoots were cut per concentration of cyanamide and placed on plates with shoot elongation medium (SEM) containing 30 mg / l cyanamide. The transgenic character of the buds that were able to implant through the test of small leaves and flowers for expression of the gus gene using a GUS histochemical test was proved.

Three experiments were carried out. The outbreaks that were obtained from Experiment 98-8 and 98-11 a rooting medium was transferred (SEM) containing 30mg / liter of cyanamide. The shoots obtained from Experiment 98-13 were transferred to a rooting medium containing the same concentration as the selection medium (SIM), obtaining the results of the Table 4a. The outbreaks that were obtained with the kanamycin selection (50 mg / liter) were transferred to a rooting medium containing Kanamycin 25 mg / l.

Table 4: Means needed for the transformation of the root of Arabi dops i s th a l i a na C24.

Components Medium GM CIM SIM .SEM of the medium Ingredients Microelements B5 B5 B5 MS Microelements B5 B5 B5 MS Vitamins B5 B5 B5 B5 Sucrose (g / l) 10 Glucose (g / 1) 20 20 20 Agar Daichin 10 10 10 (g / D Hormones 2.4-D 0.5 Kinetin 0.05 2-ip 5 IAA 0.15 Antibiotics Vamcomycin 100 50 Carbenicillin 500 Cefotaximes 100 The root explants transformed with pMOG 410 could not be regenerated in a medium containing cyanamide. Even 20 mg / liter of cyanamide was sufficient to prevent regeneration of the explants transformed with a construct without the cah gene. From 20 to 40 mg / liters of cyanamide some callus development was observed, although at 50 mg / liter and more the explants were not viable and turned completely brown.

On the other hand, explants transformed with the cah gene (pMOG 1156) were able to regenerate at all concentrations of cyanamide, even at 80 mh / liter. At low concentrations the regeneration of the shoots was faster than with kanamycin.

Although more outbreaks were available, 60-65 shoots were collected per treatment, and placed in the middle of rooting. At low concentrations of cyanamide the same number of shoots was developed as with the kanamycin selection (approximately 70-100 per petri dish).

Table 4a. Results of the transformation of Arabidfopsis with pMOG1156 (1) The total number of plants consists of those shoots that developed in plants and that were able to form root in a medium containing cyanamide. (2)% of shoots with root. Number of plants / total number of shoots * 100% (3)% of plants with blue spots, compared to the number of plants.

Table 4b. Percentages of Arabidopsis plants GUS expression, obtained through selection with cyanamide or kanamycin 1. % of plants with blue spots 2. All shoots pMOG 410 were rooted in # Kanamycin 25 mg / liter 3. C = Cyanamide (mg / liter) 4. K = Kanamycin (mg / liter) 5. Concentration in rooting medium Ahem 5 Rice transformation Subsequently, the method used for the transformation of calluses derived from escutiform organs of mature embryos of Ory sativa cv. Taipei 309 using Agrobacterium tumefaciens, the strain LBA1119-pMOG1295 (which hosts the cah gene) and the strain LBA1119-pMOG1253 (control). Called sterile rice seeds were germinated on plates with callus induction medium (MIC) in the dark at 28 ° C. (Table 5 shows the content of different media). After 3 weeks the embryogenic callus derived from the escutiform organ is isolated and subcultured in the same medium under the same conditions. After 2-3 weeks the embryogenic calli were cut into segments of approximately 2-3 mm and plated with MIC for 4 days. The Agrova c t er i um strain used in this study contained a rifampicin selection marker on a C 58 chromosome medium. The construction of the assistant strain EHA105 has been described by Hood et al. (1993). Agroba ct eri a were cultured for 4 days on plates with AB medium with antibiotics (rifampicin 20 mg / l, kanamycin 100 mg / l). Agroba c t eri a was collected in LIM and the OD600 was adjusted to 1.0-1.5. This suspension is used for cocultivation. The calluses were incubated for 10 minutes with the Agroba ct erium suspension and dried on sterile filter paper to remove excess bacteria. The calluses were cultured for 48 hours on plates with coculture medium (COM) in the dark at 25 ° C. 50 callipers pMOG1295 and 20 callus pMOG1253 were cultured by concentration of cyanamide. The following concentrations of cyanamide were used: 0, 15, 30, 60, 100, 150, 200, 300 and 500 mg / l. Hygromycin was applied at a concentration of 50 mg / l. The calli were incubated in plates of the first Selection Medium (FSM) containing various concentrations of cyanamide or hygromycin, in the dark, at 28 ° C. After 3 weeks the calluses were transferred to embryo-inducing medium I (EIM) with the same concentration of cyanamide or hygromycin. After another 3 weeks the calluses were subcultured in Embryo II Inductor Medium (EIM II) with the same concentration of cyanamide or an increased concentration of hygromycin. The calli are transferred to the sprout-inducing medium (SIM) with the same concentration of cyanamide as during FSM, EIM I, EIM II and were cultured under a light period of 12 hours (2600 LUX) and 12 hours of darkness at 20 °. C. Approximately 3 weeks after transferring the calluses to SIM, there was regeneration of shoots and they were cut and placed in jars with pre-greenhouse medium (PGM). At concentrations of cyanamide 100 mg / L or greater, no callus was formed. At concentrations of cyanamide of 35 mg / l, the frequency of regeneration of calluses from both constructions was the same (in pMOG1253, 7 of 16 calluses were able to regenerate and in pMOG 295, 17 of 44). At a cyanamide concentration of 30 mg / l only 11 calluses of pMOG 1295 showed green callus development and 6 were able to be regenerated.

Table 5: Means necessary for the trans formation of Oryza sativa Taipei 309.

Comps. Media Media CIM COM LIM FSM EIM EIM IISI PGM M Macroele Ingredients. N6 R2 R2 R2 LS LS LS 1 / 2MS (g / D Microele B5 R2 R2 R2 LS LS LS 1 / 2MS Vitamins B5 R2 R2 R2 LS LS LS / 2b5 Sucrose 30 30 30 30 40 10 Glucose 10 10 Agarose 7 7 7 7 7 type I Fitagel 2.5 2, 5 PH 5.8 5.2 5.2 6.0 5.8 5.8 5.8 5.8 Hormones 2.4D 2.5 2.5 2.5 2.5 2.5 (mg / l) IAA 0.5 BAP 0.3 NAA 0.05 Additives Proline 500 (mg / l) Glutamine 500 (mg / l) Hydrolyzate 300 enzymatic casein (mg / l) Acetosiri 100 100 ngona (μM) Water 100 100 coconut (mi) Vancomici Antibiotics 100 100 100 100 na (mg / l) Cefotaxim 400 100 100 100 a Example.6 Transformation of rice by means of a particle flow cannon Later, the method using the transformation of non-morphogenic cell suspensions of Oryza sativa cv IR 52 using a particle flow gun (P.IG) according to Finer et al. (Plant Cell Rep I_I 323-328, 1992).

A long-lasting non-morphogenic suspension culture was subcultured from Oryza sa t i va cv. IR 52 at weekly intervals in liquid medium LS-4 (Linsmaier and Skoog, Plysio Plant 18, 100-127, 1962) and kept in a rotary shaking (110 rpm) at 28 ° C in the dark (The contents of the medium LS-4 can be found in table 2). 3-4 days after the last subculture, 1.5 ml of this cell suspension (approximately 1.5 X 106 cells) were evenly spread on filter paper (Whatman No. 4, which was subsequently placed in solidified and cultivated LS-4 medium. in the dark at 28 ° C for 24 hours and subsequently using directly for bombardment.For the bombardment of microprojectiles, a homemade particle flow (PIG) gun was used according to Finer et al. (1992) 300 μg of particles were loaded of tungsten well coated with pMOG617 (35s gus and 35s hig) or with pMOG873 in a particle holder, the particles were accelerated by a helium pulse of 2.5 bar and had to pass a metal stop screen of 500 m, placed 2 cm below the particle support, the cell suspension was placed 15 cm below the particle support, the PIG was evacuated at 30 mbar before bombardment, after the bombardment, the cells were cultured at 28 ° C. in the dark for 3 days. The filters were then transferred with the cells to the solid LS-4 medium with various concentrations of cyanamide or 50 mg / l of hygromycin (see Table 6)). The subculture was repeated every 9 days. Visible resistant microcallos after 4-6 weeks were transferred to a fresh LS-4 medium with the respective selective agent. Of the two experiments, 7 + 41 calluses, transformed with pMOG 617, were resistant to hygromycin, while the transformation with pMOG873, in the first experiment 7 callus survived at concentrations of cyanamide of 20 mg / l (the results of the second experiment are not yet available) and 0 + 4 callus remained viable at concentrations of 40 mg / l cyanamide. At concentrations of 50 mg / l or greater, no callus was formed. The transgenic nature was confirmed by the gus gene test in parts of the callus by the presence of DNA in the calluses transformed with pMOG873. One of the 4 surviving callipers at the cyanamide concentration of 40 mg / l was positive in a PCR experiment on the cah gene.

Table 6: Means necessary for the transformation of Oryza sa t i va cv. IR 52 LS - 4 solid LS-4 solid Macro-elements LS LS Micro-elements LS LS Vitamins LS LS Sucrose (g / 1) 30 30 Table 7: pMOG617 Agent of No. Clones Gus selection (mg / l) positive resistant plates Cyanamide 20 4 Cyanamide 30 2 Cyanamide 40 Cyanamide 50 Cyanamide 60 Cyanamide 70 Cyanamide 80 Hygromycin 50 Hygromycin 50 pMOG 873 Non-Clone Agent Gus selection (mg / l) positive resistant plates Cyanamide 0 Cyanamide 20 Cyanamide 30 Cyanamide 40 Cyanamide 50 Cyanamide 60 Cyanamide 70 Cyanamide 80 Hygromycin 50 Example 7 Corn extermination curve Cyanamide solutions in water at 10 and 100 mg / ml were prepared and sterilized for storage. The aliquots were stored at -20 ° C.

The media were prepared by adding 1 liter of water, MS medium (4.4 g), sucrose (20 g), 2,4-D), (2.0 mg), and agar (8 g). After autoclaving, the appropriate amount of cyanamide (0.10, 30, 50, 100, 150 mg / l of cyanamide) was added, and the medium was poured into 9 cm petri dishes.

The BMS liquid was prepared as described above, minus agar.

BMS cells were added to the media containing cyanamide in three different ways: to. In a Falcon tube, the BMS cell suspension was added and the liquid was removed. The BMS cells were then placed on the surface of the agar in groups of approximately 5 mm in diameter, at a rate of 5 groups per plate, and of 3 plates per concentration. At the base of each petri dish, the profile of each group was marked. b. A volume of approximately 0.5 ml of agglomerate of cells plus 1.5 ml of BMS liquid was added to the surface of the agar, distributing the cells carefully on the surface of the agar. Three plates were prepared per treatment. c. A volume of approximately 0.5 ml of agglomerate of cells plus 1.5 ml of BMS liguid was added on filter paper on agar. The cells were evenly distributed on the surface of the filter. A plate was prepared by treatment.

The plates were sealed with microporous tape and incubated in the dark at 25 ° C. After 7 and 14 days the cell growth was observed.

RESULTS Day 8 After 8 days the growth of BMS cells in cyanamide was evaluated.

Groups of BMS cells arranged on the surface of the control medium had increased in size and had exceeded their original profile. The cells at 10 mg / ml had not exceeded their original profile but the height of the groups had increased forming an irregular surface. A slight reduction in growth was apparent by increasing the concentration of cyanamide. The maximum effect that was observed on the growth was at concentrations of 50 mg / ml of cyanamide.

The cells that had been distributed on the surface of the control medium had grown well and densely covered the surface of the medium. At the lowest level of cyanamide (10 mg / ml) a significant reduction in growth was observed, although an increase in cell density was clearly visible. A slight increase in cell density was evident at 30 mg / ml, although it was difficult to distinguish different growth rates at higher concentrations.

Cells at all levels of cyanamide remained with their milky white color. No yellowing of the same was observed.

Day 15 (table 9) After 15 days with cyanamide, the reduction in the growth of BMS cells at the 10 mg / ml level was very clear. However, the cells arranged in groups had exceeded their original profile. The cells distributed directly on the surface of the agar showed a response similar to that of those arranged in groups, with a marked reduction in growth at concentrations of 30 mg / ml and more. The cells at the level of 50 mg / l and did not show any signs of growth and the surface of the groups remained very flat, although the cells were still milky white. A similar response was observed with the cells arranged on the filter. However, although slightly elevated groups were observed on the surface of all the filters, they did not develop further in the colony and were evidently constituted by aggregates of larger cells from populations of different sizes that are typical of BMS suspensions.

Samples were taken from all cell groups at all levels of cyanamide for observation under a light microscope. With the increase in cyanamide levels there was a greater number of dead cells, where the cell contents had shrunk and separated from the cell wall, and an increase in the amount of starch grains of darkened bodies. The cells were observed under UV light suspended in water and with FDA dye.

Table 9 The experiment was repeated with a cyanamide concentration of 0, 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100 mg / l. The results were similar to those previously described, for example for cells aggregated in groups, a slight reduction in growth was observed at 10 mg / l. From a concentration of 20 mg / l of cyanamide, no growth exceeding the original profile was observed. Although at the lowest concentrations (<50 mg / l) the groups of cells showed an increase in their height (which decreased with the highest concentrations). Above 50 mg / l the groups showed a slight orange dye.

The results with the cells distributed on the surface of the agar or on the filters were similar in that, at a concentration of 10 mg / l they showed a slight growth (approximately the original cell number was doubled), while at concentrations of 20 mg / l and higher exhibited limited signs of growth.

Example 8 Extermination curves in bananas (Musa) To verify the potential of cyanamide as a selection agent for the transformation into bananas, two extermination curves were drawn with embryo suspension cultures (Ed6b) of 6 days old formed with embryonic suspension Grand nain made substrates routinely in liquid M2, 2,4-D, with a content of 4.32 g / 1 of MS salts, 45 g / 1 of sucrose, standard concentration lx, vitamins MS, 100 mg / l of glutamine, 100 mg / l of myo-inositol, 100 mg / l of malt extract at pH5.3 and added, after autoclaving at 1.2 mg / l of 2, .4-D and 8.0 mg / l of picloram.

The cultures were sieved (> 250μ, < 71μ) and, through a pipette, aliquots of approximately 50μl of sifted culture are distributed in 300μl of liquid volume in two extermination curve media as detailed below (3 repetitions per plate). The growth and survival of the crops were monitored during the following 3 weeks. After 21 days the survival of the cells was evaluated through the dyeing with FDA.

Expression curve of medium A: M2 / MS / 1.02-D, with the exception of 1.0 mg / l of 2.-D, without picloram and + 2.25 g / 1 of gelrite). This medium promotes the rapid division and growth of embryo calluses, but not the growth of embryos.

Expression curve of medium B: M2 / SH, / O, 5 Picloram, 0.5 2,4-D (as M2 / MS / 2,4-D except for 0.5 mg / l of 2,4-D and 0.5 of picloram, SH salts (4.32 g / 1) instead of MS, + 2.25 g / 1 of gelrite). This medium promotes the initial development of embryos, which can then mature and germinate, transferring them to alternative media.

After passage by autoclave, cyanamide was added to both types of media at concentrations of 0, 20, 30, 50, 75, 100, 150 mg / l.

The results are illustrated in Table 10, where the figures on cell growth correspond to approximate visual estimates, not to precise measurements of callus volume. No significant browning of the cultures or release of phenols was observed until concentrations of > 75 mg / l. In general, the cultures stop growing and the division of cells is very inhibited. The cyanamide inhibits the growth of embryogenic callus by 40-50% even at concentrations as low as 20 mg / l, without causing a visually significant damage. The embryogenesis was totally inhibited at the lowest concentrations tested here.

Table 10 Results of cyanamide concentrations in banana cell cultures N / A not applicable Sequence Listing (1) GENERAL INFORMATION: (i) CANDIDATE: (A) NAME: MOGEN International nv (B) STREET: Eintinweg 97 (C) CITY: leiden (E) COUNTRY: The Netherlands (F) ZIP CODE: (ZIP): 2333 CB (G) TELEPHONE: 31 - (0) 71 -5258282 (H) TELEFAX: 31- (0) 71-52211 71 ii) TITLE OF THE INVENTION: New selection marker iii) NUMBER OF SEQUENCES: 4 (iv) ORGANIC LEGIBLE FORM: (A) TYPE OF MEDIA: Floppy disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC- DOS / MS - DOS (D) SOFTWARE: Patent In Relay # 1.0, version # 1.25 (EPO) (2) INFORMATION ABOUT SEQIDNO:!: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 900 base pairs (B) TYPE: nucleic acid (C) FILAMENTO: double (D) TOPOLOGY: linear (ü TYPE OF MELECULA: cDNA (iii ANTI-SENSE: No ; iv) ORIGINAL SOURCE: (A) ORGANISM: Myrothecium verrucaria ix) FEATURES: (A) NAME / KEY: CDS (B) LOCATION: 47..782 (XI) DESCRIPTION OF THE SEQUENCE: SEQIDNO: 1 GTACGATCCT ACTTCCTCGC TTATCTGCTC TA.?CGATTC AACAAG? TG TCT TCT 55 Met Ser Ser 1 TCA GAA GTC AAA GCC AAC GGA TGG ACT GCC GTT CCA GTC AGC GCA AAG 103 Ser Glu Val Lys Wing Asn Gly Trp Thr Wing Val Pro Val Ser Wing Lys 5 10 15 GCC ATT GTT GAC TCC CTG GGA AAG CTT GGT GAT GTC TCC TCA TAT TCT 151 Alo He Val Asp Ser Leu Gly Lys Leu Gly Asp Val Ser Ser Tyr Ser 20 25 30 35 GTG GAA GAT ATC GCG TTC CCT GCG GCA GAC AAA CTT GTT GCC GAG GCA 199 Val Glu Asp Xle Wing Phe Pro Wing Wing Asp Lys Leu Val Wing Gl? Wing 40 45 50 CAG GCC TTT GTG AAG GCC CGA TTG AGT CCC GAA ACC TAC AAT CAC TCC 247 Gln Wing Phe Val Lys Wing Arg Leu Ser Pro Glu Thr Tyr Asn His Ser 55 60 65 ATG CGC GTT TTC TAC TGG GGA ACC GTC ATC GCG AGA CGT TTA CTT CCC 295 Met Arg Val Phe Tyr Trp Gly Thr Val He Wing Arg Arg Leu Leu Pro 70 75 80 GAG CA GCT AAA GAC TTG TCT CCA AGT ACÁ TGO GCA CTG ACÁ TGT CTT 343 Glu Gln Ala Lye Asp Leu Ser Pro Ser Thr Trp Ala Leu Thr Cys Leu 85 90 95 CTG CAT GAC GTT GGT ACT GCG GAG GCA TAC TTT ACÁ TCT ACÁ CGA ATG 391 Leu His Asp Val Gly Thr Ala Glu Ala Tyr Phe Thr Ser Thr Arg Me 100 105 110 115 TTC TTC GAT ATT TAC GOT GGC ATT AAG GCT ATG GAG GTG CTC AAG GTC 439 Ser Phe Asp He Tyr Gly Gly He Lye Wing Met Glu Val Leu Lye Val 120 125 130 CTT GGG AGT AGC ACC GAC CAG GCT GAG GTT GCC GAG GCC ATC ATT 487 Leu Gly Ser Ser Thr Asp Gln Ala Glu Ala Val Ala Glu Ala He He 135 140 145 CGT CAT GAG GAT GTG GGG GTA G? T GGC AAC ATC ACÁ TTC CTC GGT CAG 535 Arg His Glu Asp Val Gly Val Asp Gly Asn He Thr Phe Leu Gly Gln 150 155 160 TTG ATC CAG CTG GCT ACG ("TAT GAC AAT GTC GGG GCC TAC GAT GGÜ 583 Leu He Gln t.eu Ala Thr Leu Tyx? Sp Asn Val Gly Ala Tyr Asp Gly 165 3.70 175 ATT GAT GAT TTT GGT AGC TGG GTT GAT GAC ACC ACA CGC AAC AGT ATC 631 He Asp Asp Phe Gly Ser Trp Val Asp Asp Thr Thr Arg Asn Ser He 180 185 190 195 AAC ACG GC? TTC CCA CAT GGT TGG TGT TCT TGG TTT GCC TGC ACG 679? Sn Thr Wing Phe Pro Arg Hie Gly Trp Cye Ser Trp Phe Wing Cys Thr 200 205 210 GTT CGT AAG GAA GAA AGT AAC AAG CCT TGG TGC CAC ACÁ ACG CAT ATC 727 Val Arg Lys Glu Glu Ser Asn Lys Pro Trp Cys His Thr Thr His He 215 220 225 CCT CAG TTC GAT AAA CAG ATG GAA GCG AAC ACT TTG ATG AAG CCT TGG 775 Pro Gln Phe Asp Lys G n Met Giu Ala Asn Thr Leu Met Lys Pro Trp 230 235 240 GAG TAA C TCTGAGTAAG CAGAGAATAT TTAGCCGGGT AGCTATAGAT GAATCTGGAC 832 Glu * 245 AAATTCAGGC ACATTTGGTT TCACGATACA GGTATTGGAA ATAGCTTGCA GGAAGGTATC 892 ATGTCAAC 10 900 2) I N FORMAC TION S UMBER E N G: 2 (i) CHARACTERISTICS OF THE SEQUENCE 15 (A) LENGTH: 245 amino acids (B) TYPE: amino acids (C) TOPOLOGY: linear (ii TYPE OF MOLECULE: 20 xi protein) DESCRIPTION OF THE SEQUENCE: SEQIDNO: 2 Met Ser Ser Ssr Glu Val Lys Wing Asn Gly Trp Thr Ala Val Pro Val 1 5 10 15 Be Ala Lye Ala He Val Asp Ser Leu Gly Lys Leu Gly Aep Val Ser 20 25 30 Ser Tyr Ser Val Glu Asp He Wing Phe Pro Wing Wing Asp Lys Leu Val 35 40 45 Wing Glu Wing Gln Wing Phe Val Lys Wing Ar «j ..and? Ser Pro Glu Thr Tyr 50 55 60 Asn HSB Ser Met Atv »Val Phe Tyr Trp Gly Thr Val lie Wing Arg Arg 65 70 75 80 Leu Leu Pro Glu Gln Ala Lys Asp Leu Ser Pro Ser Thr Trp Ala Leu 85 90 95 Thr Cye Leu Leu His Asp Val Gly Thr Ala Glu Wing Tyr Phe Thr Ser 100 105 110 Thr Arg Ket Ser Phe Asp He Tyr Gly Gly He Lye Wing Met Glu Val 115 120 125 Leu Lys Val Leu Gly Ser Ser Thr Aep Gln Ala Glu Wing Val Ala Glu 130 L35 140 Ala He He Arg His Glu Asp Val Gly Val Asp Gly Asn He Thr Phe 145 150 155 160 Leu Gly Gln Leu He Gln Leu Wing Thr Leu Tyr Asp Asn Val Gly Wing 165 170 175 Tyr Asp Gly He Asp Asp Phe Gly Ser Trp Val Asp Asp Thr Thr Arg 180 185 190 Asn Ser He Asn Thr Wing Phe Pro Arg Hie Gly Trp Cys Ser Trp Phe 195 200 205 Wing Cys Thr Val Arg Lys Glu Glu Ser Asn Lys Prc Trp Cye Hie Thr 210 215 220 Thr His He Pro Gln Phe Asp Lys Gln Met Glu Wing Asn Thr Leu Met 225 230 235 240 Lys Pro Trp Glu * 245 (2) SEQUIDNO INFORMATION: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 43 base pairs (B) TYPE: nucleic acid (C) FILING: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: Adnc (ii) HYPOTHETICAL: No (xi) DESCRIPTION OF THE SECTION: SEQIDNO: 3 ACCGAGCTCG AATTCGGCAC GAGGTTGACA TGATACCTTC CTG 43 (2) INFORMATION ABOUT SEQIDNO: 4: i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) FILAMENTO: unique (D) TOPOLOGY: linear ü) TYPE OF MOLECULE: cDNA iii) HYPOTHETICAL No (iv) Description of the sequence: SEQIDNO: 4: GCCTCGAGA ATTCGGCACG AGGTACGATC CTACTTCCTC GC 42 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, the content of the following is claimed as property.

Claims (13)

Claims

1. The use of cyanamide hydratase as a selection marker.

2. The use of cyanamide hydratase as a selection marker in plant transformation experiments.

3. The use according to rei indication 2, in which the plants are transformed with a nucleotide sequence encoded by cyanamide hydratase.

4. The use according to claim 3, wherein the nucleotide sequence is used as described in SEQIDNO:!

5. A method for the selection or transformation of plants, characterized in that it comprises: a. the construction of a vector comprising a coding sequence for cyanamide hydratase and a gene of interest, transforming the vector for the plants or parts of the plant or cells of the plant, and the growth of the transformants in a medium comprising cyanamide .

6. The method according to claim 5, characterized in that the nucleotide sequence of SEQIDNOil is used.

7. The use of cyanamide for the selection of transformed plants with a vector comprising a nucleotide sequence encoded by cyanamide hydratase.

8. The expression kit, characterized in that it comprises a nucleotide sequence encoded by cyanamide hydratase and a gene of interest.

9. A vector, characterized in that it comprises an expression cassette according to claim 8.

10. A host cell, characterized in that it comprises the vector according to claim 9.

11. The host cell according to claim 10, characterized in that the host cell is Agroba c t eri um.

12. A plant transformed with a vecto.r in accordance with reivndication 9.

13. The plant transformed by the use of a host cell wall according to claim 11.