MXPA99007793A - Compositions and procedure to protect animals against diseases associated with lentivirus, like the virus of immunodeficiency fel - Google Patents

Abstract

The present invention relates to a new strain of feline immunodeficiency virus, designated herein FIV-141, and to attenuated forms of the virus produced by mutating specific regions of the viral genome, the virus and the mutated forms of the virus can be used for induce the production of antibodies against FIV-141 and in vaccines designed to protect cats against F

Description

COMPOSITIONS AND PROCEDURES FOR PROTECTING ANIMALS AGAINST DISEASES ASSOCIATED WITH LENTIVIRUS. LIKE THE VIRUS OF THE FELINE IMMUNODERCIENCE.

FIELD OF THE INVENTION.

The present invention relates to a new strain of feline immunodeficiency virus (FIV) and a variety of mutated forms of this virus. Compositions and methods that can be used in the protection of animals against diseases associated with lentiviruses are described.

BACKGROUND OF THE INVENTION.

Feline immunodeficiency virus (FIV) infection causes cats with a disease similar to that caused by infection of human immunodeficiency virus 1 (VHI-1) in humans. The course of the disease begins with a transient acute phase (8-10 weeks), followed by a prolonged asymptomatic phase (lasting from weeks to years) and a terminal symptomatic phase [Ishida et al .; Jpn. J. Vet. Sci; 52, 645-648 (1990)]. It has been shown that viral load in plasma is related to the stage of the disease in infected cats and can be used to predict the course of the disease in accelerated FIV infection [Diehl et al .; J. Virol; 70, 2.503-2.507 (1996)] Structurally, the IVF provirus contains two long terminal repeats (LTR), one at each end of the genome [Talboot et al .; Proc. Nat'l. Acad. Sci. USA, 86, 5743-5747 (1989)]. There are three large open reading frames [Gag (group antigens), Pol (polymerase) and ENV (envelope)] and three small open reading frames that encode regulatory proteins [Rev (virion expression regulator, a protein that binds to the "RRE" elements present in all viral transcripts and promotes their translocation from the nucleus to the cytoplasm of infected host cells), Vif (virion infectivity factor) and ORF (2) (open reading frame 2)]. The FIV Gag precursor polypeptide is processed into three mature structural proteins: a matrix protein (MA), a capsid protein (CA) and a nucleocapsid (NC) protein. The Pol gene encodes four enzymatic proteins: a protease (PR), a reverse transcriptase (RT), a deoxyuridine triphosphatase (DU) and an integrase (IN). Finally, the ENV precursor polypeptide is processed into two enveloping proteins: a surface protein (SU) and a transmembrane protein (TM). There have been several attempts to develop a safe and effective vaccine against IVF. Matteucci found that cats inoculated with a conventional fixed cell vaccine were protected against homologous virus infection despite an apparent absence of neutralizing antibodies after vaccination. It was found that the protection was short-lived and difficult to reinforce [Matteucci et al; J. Virol; 70, 617-622 (1996), and Matteucci and others; J.Virol, 71, 8368-8366 (1997)]. These results can be counterbalanced with those of Vershoor who did not observe any protection after administering a fixed cell vaccine [Verschoor et al .; Vet. Immunol. Immunopathol; 46, 139-149 (1995)]. Another type of conventional vaccine that has been tested is composed of the complete inactivated IVF virus. Yamamoto reported that more than 90% of cats given such a vaccine exhibited essentially complete protection against homologous viruses and light protection against heterologous viruses [Yamamoto et al .; J. Virol. 67; 601-605 (1993)]. Both humoral and cellular immunity was induced against FIV and a high level of anti-ENV, antinucleus and virus neutralizing (VN) antibodies was observed in the vaccinated cats. In contrast vaccination of cats with inactivated complex IVF incorporated in immune stimulating complexes (ISCOM) did not protect animals against homologous viruses [Hosie et al .; Vet. Immunol. Immunopathol. 35, 191 -197 (1992)]. Another method of vaccine development has involved the use of subunit vaccines containing recombinant core protein, synthetic V3 peptides and recombinant ENV protein [Elyar et al., Vaccine, 15, 1437-1444 (1997)]. Although such vaccines induced significant levels of antibodies, none was identified that could protect against homologous FIV infection [Huisman et al .; Vaccine, 16, 181-187 (1998); Flynn and others; J. Virol, 71, 7,586-7,592 (1997); Tijhaar and others; Vaccine, 15, 587-596 (1997)].

The results suggest that it is probably difficult to obtain protective immunity against FIV using subunit vaccines. Recently, Cuisinier published trials conducted with a DNA vaccine against FIV [Cuisinier et al; Vaccine, 15, 1085-1.094 (1997)]. Cats were vaccinated with a plasmid carrying FIV structural genes, including ENV gene and p10 gene. Although intense humoral immune responses were observed, all cats eventually succumbed to infection by homologous viruses.

BRIEF DESCRIPTION OF THE INVENTION The present invention is based, in part, on the isolation and characterization of a new strain of feline immunodeficiency virus, designated herein FIV-141. The complete genomic sequence of the virus has been determined and is distinct from all other known IVF sequences. A plasmid coding for FIV-141 has been deposited as ATCC No. 203001.

A. Compositions and methods based on the FIV-141 virus In its first aspect, the present invention relates to a substantially purified FIV-141 virus having a genomic sequence corresponding to SEQ ID No. 1, to infected host cells with the virus and virus descendants produced in the host cells. The term "substantially purified" means that FIV-141 has been separated from all other strains of the virus and, particularly, from all other FIV strains. Host cells that can be used for virus development include peripheral blood mononuclear cells (PBMC). Descendant viruses can be isolated using the conventional procedures described below. The FIV-141 virus and host cells infected with the virus can be used to infect animals for the purpose of inducing the production of antibodies that preferentially relate to one or more FIV strains. "Preferential binding" of antibodies, as used herein, refers to an antibody that has at least 100 times greater affinity for FIV than to any other virus or to any other protein other than FIV. The antibodies can be generated in any of the animals commonly used for this purpose (such as, for example: mice, rabbits, goats or sheep) although, preferably, the antibodies will be made in domestic cats. When viruses are used to induce the production of antibodies, they can be inactivated, if desired, before infection. Inactivation procedures may involve treating the virus with formalin, paraformaldehyde, phenol, lactopropionate, ultraviolet light, heat, psoralens, platinum complexes, ozone, or other virucidal agents. When host cells expressing FIV-141 are used to induce antibody production, they can be fixed before infection. Typically, this will involve treating the cells with paraformaldehyde as described herein, although other methods may also be employed. The antibodies themselves made by FIV-141 are included in the scope of the invention and can be purified using procedures well known in the art [see, for example, Harlow et al .; "Antibodies: A Laboratory Manual". Cold Spring Harbor Laboratory, N.Y. (1988)]. In another aspect, the invention relates to a whole virus vaccine comprising inactivated FIV-141 virus. An immune response can be induced in cats by administering this vaccine at a dose and for a duration sufficient to induce protective immunity against subsequent infection with IVF-141. Typically, the vaccine will be administered parenterally, giving two or more inoculations at intervals of, for example, two to eight weeks. The invention also includes a fixed cell vaccine, which is composed of a host cell infected with the FIV-141 virus. The administration of this vaccine will follow the same general procedures used for the whole virus vaccine. To optimize the immunization protocols, conventional procedures well known in the art can be used.

B. Compositions and procedures based on a qenomic nucleic acid of FIV-141. In another aspect, the present invention relates to a substantially purified nucleic acid molecule (DNA or RNA) having a sequence corresponding to SEQ ID No. 1. As used in this context, "substantially purified" means that the desired product is substantially free of contaminating cellular components. A "substantially pure" nucleic acid will typically constitute at least 85% of a sample, with higher percentages being preferred. The contaminants can include proteins, carbohydrates or lipids. A method for determining the purity of a nucleic acid is to electrophoresis a preparation in a matrix, such as polyacrylamide or agarose. Purity is evidenced by the appearance of a single band after staining. Other methods for evaluating purity include chromatography and analytical centrifugation. The nucleic acid of FIV-141 can be used in place of the whole virus to transfect host cells and thereby induce the production of the virus descendant or of viral proteins. The invention also comprises methods of inducing the production of antibodies by FVI-141 by directly injecting nucleic acid into an animal or by administering host cells transfected with the nucleic acid. As with the procedures discussed above in relation to whole viruses, host cells can be fixed prior to administration. The antibodies can be purified from animals and used in assays designed to detect the presence of FVI in culture media or in a biological fluid.

Also, in a vaccine to immunize cats, host cells transfected with genomic DNA of FIV-141 can be used. If desired, such cells can be fixed to reduce viral infectivity, for example, by treatment with an agent such as paraformaldehyde. The vaccine can be administered using a conventional immunization protocol optimized for the induction of protective immunity against subsequent infection with FIV-141 or, if desired, with some other FIV strain. C. F-141 attenuated viruses and vaccines. Before administering a complete virus to an animal as a vaccine, it must be converted to a non-pathogenic form. As discussed above, this can be done by inactivating the virus or by binding host cells. An alternative procedure involves introducing mutations into the virus to transform it into an attenuated form. The phrase "attenuated form", as used in the present context, refers to a virus that has an essentially reduced ineffectiveness compared to its wild-type analogue. The ineffectiveness in PBMC can be measured, as described in the "Examples" section of the present specification. The invention therefore relates to an attenuated FIV-141 virus which exhibits a significantly reduced effectiveness towards feline T lymphocytes with respect to the wild-type (i.e., non-mutated) virus. The attenuated virus is produced by mutating one or more genes in the FIV-141 gene selected from the group consisting of Vif, MA, ORF (2), ENV, CA, NC, SU, TMf, CT, IN, DU, V3-4 , V7-8, and RRE. In this report, we describe appropriate mutations of each of these genes. Examples of several specific mutations that can be used to make attenuated viruses include "MA", "ENV", "V3-4", "V7-8", "TMF", "CT", Vlf, "del Vifc", "del Vifn", "del ORF (2)", "del CA", "del NC", "del IN", "del DU", "del SU", and "del RRE" . The invention also comprises host cells infected with the attenuated viruses and with the descending viruses produced by said cells. Once produced, attenuated viruses can be purified from host cells using conventional methods. It can induce the production of antibodies by infecting an animal with the attenuated virus or, alternatively, infected host cells can be used. If desired, the virus can be inactivated or the host cells can be fixed prior to administration to an animal and antibodies from animals can be purified using conventional methods. Furthermore, the invention comprises a vaccine using the attenuated complete virus discussed above or a host cell infected with one of these viruses. Attenuated viruses can also be inactivated and the host cells can be fixed. Such treatments can provide added security from which the vaccines themselves will not cause infection. Vaccines based on one or more attenuated FIV-141 viruses can be used to induce protective immunity in a cat. In the administration of vaccines, conventional immunization protocols can be followed to optimize the induction of protective immunity against subsequent infection with IVF-141.

D. Compositions and procedures based on qenomic DNA of mutated FIV-141. In another aspect, the present invention relates to a nucleic acid (DNA or RNA) substantially purified from FIV-141, having a sequence corresponding to SEQ ID No. 1 but which has been mutated to encode an attenuated virus. Mutations must be in one or more genes selected from the group consisting of Vif, MA, CA, NC, SU, TMf, ORF (2), CT, ENV, Vifc, IN, DU, V3-4, V7-8 and RRE and they must be done in such a way that, upon introduction into a host cell, a virus having significantly reduced infectivity towards feline T lymphocytes (or towards other susceptible cell types) with respect to the wild-type virus is produced. Examples of several specific mutations that can produce an appropriate attenuated virus are described herein include: "of the MA", "of the ENV", "of the V3-4", "of the V7-8", "," of the TMf " , "del CT", "del Vif", "del Vifc", "del Vifn", "del ORF (2)", "del SU", "del CA", "del NC", "del IN", " of the DU ", and" of the RRE. "The invention includes host cells transfected with the mutated nucleic acid and with FVI-descendant viruses produced by the host cells Also included within the scope of the invention is a method of inducing the production of antibodies in front of the IVF in a animal by injecting the mutated nucleic acid described above or a host cell that has been transfected with the nucleic acid. If desired, the host cell can be fixed prior to administration. The antibodies produced can be purified using conventional methods and can be used in assays designed to detect the presence of IVF. The nucleic acid, preferably DNA, which has been mutated can be in a vaccine in which it is present at a sufficient concentration to induce protective immunity after its administration to a cat. Alternatively, a vaccine may include a host cell transfected with said DNA and, if desired, the host cell may be fixed after expressing viral proteins. Vaccines can be administered to a cat at a dose and for a duration sufficient to induce an immune response in a cat and immunization protocols can be optimized to induce protective immunity against subsequent infection by IVF-141.

E. Procedures for producing and using attenuated lentiviruses. The methods described herein in relation to the production of attenuated FIV-141 can be applied to the attenuation of other FIV strains and to other types of lentivirus. A virus having significantly reduced infectivity can be made with respect to its wild-type, non-mutated analog, by mutating one or more genes selected from the group formed by MA, CA, NC, DU, ENV, SU, TMf, CT, Vif, ORF (2), Vifn, Vifc, IN, V7-8 and RRE. Mutations must be made that eliminate or substantially reduce the activity of the product gene. This can be done by deleting the entire gene or by deleting a large fraction (eg, a quarter) of the entire gene. The invention comprises attenuated lentiviruses made using the methods described, host cells infected with these viruses and methods of inducing the production of antibodies by injecting attenuated viruses into a mammal. The antibodies can be purified from injected mammals and used in immunoassays. Alternatively, purified antibodies, or serum containing antibodies derived from attenuated virus infected animals, can be used to treat a mammal infected with lentivirus. As used herein, the phrase "protective immunity induction" and similar phrases are used in general to include the induction of any immune response to vaccination, including an antibody or a cell-mediated immune response, or both responses, which serves to protect the vaccinated mammal against the particular lentivirus. The terms "protective immunity", "protective response", "protect" and similar terms, as used herein, refer not only to the absolute prevention of any of the symptoms or ailments in the mammal, resulting from the infection with the particular lentivirus but also to any detectable delay at the beginning of any of said symptoms or ailments, to any detectable reduction in the degree or speed of infection by the particular lentivirus or to any detectable reduction in the severity of the disease or of any symptom or ailment resulting from infection by the particular lentivirus. Preparations of the vaccines according to the present invention should be administered at a dose for a duration sufficient to reduce one or more clinical signs and viral load associated with the infection of the mammal. When the lentivirus is an IVF strain, the treated mammal must be a cat and the signs associated with the infection will include immunological abnormalities such as an abnormally low level of CD4 + T lymphocytes or an abnormally high number of CD8 + T lymphocytes. Other clinical signs will typically include alopecia, anemia, rhinitis, chronic, conjunctivitis, diarrhea, emancipation, enteritis, gingivitis, hematochezia, neurological abnormalities, and dermatitis. Attenuated lentiviruses (for example, an attenuated strain of FIV) or host cells infected with said viruses can be used in a vaccine at a concentration sufficient to induce immunity when administered to a mammal (e.g., a cat). An immune response can then be induced by administering said vaccine at a dose and for a duration sufficient to induce protective immunity against a subsequent infection by at least one lentivirus strain.

F. Procedures for preparing and using mutated lentivirus nucleic acid. The present invention also relates to a method of producing a nucleic acid suitable for use in a vaccine against an infection caused by lentiviruses, for example, by FIV. This is done by reverse transcription of the lentivirus genomic RNA, cloning the reverse transcript, mutating one or more genes selected from the group consisting of MA, CA, NC, SU, TMf, ORF (2), CT, ENV, Vif, Vifn, Vifc, V3-4, V7-8, IN, DO, and RRE, and then cloning the mutated nucleic acid. Preferably, the mutations should be such that, upon introduction into a host cell, an attenuated virus is made having significantly reduced infectivity with respect to the lentivirus produced by the wild-type, non-mutated nucleic acid. In the case of IVF, iinfectivity towards feline T lymphocytes should be reduced or eliminated. The mutated lentivirus nucleic acid can be purified and used to transfect host cells, prepare descending viruses and prepare antibodies in the same manner described above for FIV-141. In addition, the nucleic acid or host cells transfected with the nucleic acid can be incorporated into a vaccine and used to induce a protective immunity in a mammal. Preferably, the nucleic acid will encode an attenuated strain of FIV that has significantly reduced infectivity in feline PBMCs, including T lymphocytes, as FeP2 cells. Under these circumstances, the immune response will be induced in a cat.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: Production of IVF from transfected cells. Crandell cat kidney cells (CRFK) were transfected with a plasmid comprising the complete genome of FIV-141. Starting 24 hours after transfection, the supernatant cells were harvested and the presence of the p26 protein of the FIV capsid was assayed using an enzyme immunoassay. Figure 2: Infection of FeP2 T lymphocytes by coculture. CRFK cells were cultured in 6-well plates and transfected with plasmid DNA encoding the complete genome of FIV-141. Forty-eight hours after transfection, 2x10 6 FeP2 cells were introduced into each well. Beginning 72 hours after cocultivation, the FeP2 cells were separated and in the supernatants the presence of the p26 protein of the FIV capsid was tested by an ELISA assay. Figure 3: Infection of FeP2 cells by absorption. 2 × 10 6 cells were suspended in 200 μl of conditioned medium containing FIV-141 virus, derived from CRFK cells transfected with the full infectious clone of FIV-141. Beginning four days after infection, the presence of the FIV-141 virus was tested in the FeP2 supernatant cells using an ELISA assay of the p26 protein. Figure 4: Viral protein expression of FIV-141 by deletion clones. A variety of mutated clones were prepared for suppress genes or regulatory regions of FVI and transfected into CRFK cells. After 48 hours, the presence of the p26 protein of the IVF capsid was tested in the supernatant cells by an ELISA assay. The results are shown for each molecular clone of wild type FIV-141. Figures 5-10: Infection of FeP2 T lymphocytes by FIV-141 mutants. CRFK cells were cultured in six-well plates and infected with one of three different deletion clones of FIV-141: "from TMF", "from ENV" or "from NC". After 48 hours, FeP2 cells were added to each well and the cocultures were maintained for an additional 72 hours. Then the FeP2 cells were separated from the CRFK cells and the presence of p26 antigen was tested using an ELISA assay. The follow-up of p26 levels was repeated every 3-4 days and the results are shown in figure 5. The experiment was repeated using: "del Vifn", "del Vifc" and "del Vif" (figure 6), " of the MA "and" of the CA "(figure 7)," of the V3 / 4"," of the V7 / 8"and" of the CT "(figure 8)," of the ORF (2) "(figure 9) and" of the DU "," of the SU "," of the IN "and" of the RRE "(figure 10).

DETAILED DESCRIPTION OF THE INVENTION A. Production of IVF-141 AND DNA encoding the virus The present invention relates to a new strain of feline immunodeficiency virus (referred to herein abbreviated as "FIV-141") which is distinguished from all similar strains for his genomic sequence of nucleic acid and its biological functions. Although the genome of FIV-141 consists of RNA, it is reverse transcribed into DNA and integrated into the genome of an infected host. It should be understood that all references made in the present disclosure to IVF sequences and to mutated forms of said sequences comprise both the reverse transcribed RNA sequences and those of the corresponding DNA itself. It is well known that techniques such as site-directed mutagenesis (SDM) can be used to introduce variations in the structure of nucleic acids. Mutations in the nucleic acid sequence of FIV-141 introduced by this or by similar methods are encompassed by the invention, provided that at least one major biological characteristic of the resulting virus, eg, its antigenicity, remains substantially the same as that of the virus from which it was derived. In a preferred but not limiting embodiment, mutations that detectably reduce the infectivity of FIV-141 compared to that of the wild-type strain are within the scope of the invention. For example, a specific mutation in the ENV gene that produces a virus that replicates but shows a very low infectivity is described in the present description. The present invention includes both this mutation and other mutations that cause a substantially reduced viral infectivity. As will be discussed in the "Examples" section, the complete genome of FIV-141 has been cloned and deposited, as ATCC number 203001, a plasmid that contains the complete sequence. A conventional methodology can be used to isolate this plasmid and transfect it into host cells capable of supporting virus production. It has been found that Crandell cat kidney cells (CRFK) are suitable for this purpose, but other types of cells can also be used, such as, for example, feline T lymphocytes. In some cases, host cells expressing the virus can be used directly, for example, they can be collected and used in a vaccine or to generate antibodies. Alternatively, the virus produced in the cells can be isolated in highly purified form using known separation techniques, such as centrifugation with a sucrose gradient. Said methods are effective both for the wild-type virus and for mutant forms of the virus. An alternative procedure for obtaining the FIV-141 genome is to perform amplification by polymerase chain reaction (PCR) using primers corresponding to elements of SEQ ID No. 1. In general, the primers should have a length of approximately 20 to 50 bases. A strategy can be designed to amplify the entire genome of FIC-141 or alternatively, portions of the genome can be amplified separately and then joined together to form the complete sequence. The "Examples" section describes specific primers and methods that have been found to be effective, although alternative methods can also be developed and used.

If the virus is isolated from a natural source, then the primers for PCR amplification must correspond to sequences unique to FIV-141. Successful amplification using such primers will indicate that a virus responsible for an infection is, in fact, FIV-141. Therefore, PCR can be used in both diagnostic and virus isolation procedures.

B. Production of inactivated viruses and fixed host cells The FIV-141 virus can be used in vaccines and to generate antibodies in an appropriate host. In both cases, it should usually be desirable to inactivate the virus before administering it to an animal. Inactivation can be performed by any means known in the art. For example, the virus can be purified and inactivated after incubation for approximately 24 hours in 0.8% formalin or 1.25% paraformaldehyde. Such methods can be used with wild-type or mutant viruses. Antibodies can also be generated or immunizations can be performed using host cells infected with FIV-141 or with mutated forms of the virus. Any host cell capable of supporting viral replication, including peripheral blood mononuclear cells (PBMC), can be used. Ordinarily, cells must be fixed before being administered to an animal. Fixation can be performed by treating the cells with paraformaldehyde (e.g., 1.25%) for a period of approximately 24 hours at 37 ° C. The other methods discussed above for inactivating viruses as well as any other method described in the art can also be used to fix the cells.

C. Production of attenuated viruses As discussed above, vaccines can be produced using inactivated viruses or fixed host cells. An alternative procedure is to use a virus that has been attenuated by mutating one or more genes in the viral genome. The goal is to produce a virus that is not infectious when administering a cat. Viral replication rates can be determined in vitro by infecting cells (eg, PBMC) with viruses and then determined how virus levels change over time. Replication can be followed using an immunological assay that measures an FIV-specific antigen, by quantitative PCR or by measuring the activity of a virus-specific enzyme (e.g., reverse transcriptase). Infectivity can be determined by exposing feline T lymphocytes (e.g., FeP2 cells) to the virus by determining the extent to which the cells absorb the virus and support replication (see example 4). Mutations in the FIV-141 genome can be made by site-directed mutagenesis. One way to do this is to amplify viral genes with primers that induce alterations to the normal sequence of the genes. For example, unique restriction sites can be introduced into a selected region of the genome and then the sequence deleted between said sites by digestion with restriction enzymes. After the deletion, the remaining portion of genomic DNA can be re-ligated and introduced into an appropriate host cell to produce mutated viruses. Examples 3 and 4 provide a detailed description of the preparation and testing of mutated viruses and mutated viral genomes. In table 1 you can find a summary of various mutations that have been introduced.

TABLE 1 Mutations in the F1V-141 TABLE 1 (CONTINUED) Mutations in IVF-141 TABLE 1 (CONTINUED) IVF-141 mutations 15 TABLE 1 (CONTINUED) IVF-141 mutations TABLE 1 (CONTINUED) Mutations in IVF-141 Examples of several specific mutations that produce attenuated viruses suitable for administration to animals to induce antibody production or to be used in vaccines are "MA", "ENV," V3 / 4"," V7 / 8" , "del TMf," del CT ', "del Vif", "del Vifc", "del Vifn", "del ORF (2)", "del CA", "del NC", "del SU", "del IN "," del DU "and" del RRE ". Therefore the mutated viruses are any of the Vif, MA, ORF (2), ENV, Vifn, Vifc, V3 / 4, V7 / 8, TMf, CT, SU, CA, NC, IN, DU, or RRE genes they are attenuated viruses, and other deletions or alterations of nucleotides that inactivate these genes must produce viruses with similar characteristics.

C? Generation of antibodies against FIV-141 and treatment of infected cats. Antibodies to FIV-141 can be produced in any of the animals typically for the production of antibodies, including mice, rabbits etc. However, it is preferred to produce the antibodies in cats. If wild-type virus is used as an antigen, the virus must be inactivated before administration. When mutated viruses, for example, mutated viruses are used to reduce or eliminate their infectivity, inactivation or binding of host cells is not required although, if desired, these procedures can be performed. The virus-containing compositions can be administered to animals by any route but typically the animals are injected intramuscularly, subcutaneously or intravenously. Generally, the virus preparation will include an adjuvant, for example, complete or incomplete Freud's adjuvant. Appropriate preparations for injections, injection schedules and similar factors are well known in the art and can be used for FIV-141 and its mutants [see, for example, Harlow et., "Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory. , NY (1988), and Klein, "Immunology: The Science of Self-Nonself Discrimination" (1982).] Monoclonal antibodies can also be used that can be prepared using conventional procedures [Kennett et al., "Monoclonal Antiboides and Hybridomas: A New Dimension in Biological Analyzes "(1980); and Campbell, "Monocland Antibody Technology" in "Laboratory Techniques in Biochemistry and Molecular Biology" (1984)]. Also, antibodies or fragments of antibodies that react with FIV-141 with specificity (ie, have at least 100 times greater affinity to FIV-141 than any other) can be used in any of a variety of immunoassays. virus). For example, antibodies can be used to detect FIV-141 in radioimmunoassays or in immunometric assays, also known as "site 2" or "sandwich" assays (see Chard, "An Introduction to Radioimmune Assay and Related Techniques"). "Laboratory Techniques in Biochemistry and Molecular Biology", North Holland Publishing Co. NY (1978)] In a typical immunometric assay, an amount of an unlabeled antibody is bound to a solid support that is insoluble in the fluid to be tested, by example, blood, lymph, cell extracts, etc. After the initial binding of antigen to immobilized antibody, an amount of a detectably labeled second antibody (which may or may not be the same as the first) is added to allow detection and / or quantification of antigen [see, for example, Kirkham et al. (ed), "Radioimmune Assay Methods", pp. 199-206, E &S Livingstones, Edimburgh (1970).] Many variations of these variations are known in the art. kind s of tests that can be used for the detection of IVF.

E. CONVENTIONAL VACCINES AND VACCINATION PROCEDURES Vaccines and vaccination procedures employing different strains of IVF or closely related viruses have been discussed by a number of authors [Elyar et al., Vaccine, 15, 1437-1444 (1997); Yamamoto et al., J. Virol., 67, 601-605 (1993); Murphey-Corb et al., Science, 240,1293-2297 (1989); Jarrett et al., AIDS, 4, S163-S165 (1990); Desrosiers et al., Pro Nat'l. Acad. Sci. USA, 86, 6353-6357 (1989) J. In the case of FIV-141, there are three types of vaccines that can be used: complete virus vaccines, fixed cell vaccines, and attenuated virus vaccines. Typically, a vaccine will contain between about 1 x 10 6 and about 1 x 10 8 virus particles in a volume between about 0.5 and about 5 ml. The formulation can be made using standard procedures, such as those described in Pharmaceutical Sciences, Remington, 16th edition, Mack Publishing Co., Easton, PA 81982): Preparations may contain inactivated viruses, fixed host cells or attenuated viruses, together with a vehicle and one more adjuvants. Vaccines are generally designed to be administered parenterally, although the present invention is also compatible with other forms of administration. Most preferred vaccines will contain attenuated viruses that are completely or essentially non-infectious complete when administered to cats. Immunization procedures will typically involve several inoculations with the vaccine (eg, 3 inoculations) spaced at intervals of 3 to 10 weeks. Methods for optimizing inoculation programs and other parameters associated with immunization are well known in the art.

F. DNA vaccines References that describe vaccines and vaccination procedures using nucleic acids (DNA or mRNA) including US Pat. Nos. 5,703,055, 5,580,859 and 5,589,466. The immunogens provided in this manner elicit a humoral and cytotoxic immune response. These methods can be used to produce a vaccine against FIV, in which a nucleic acid corresponding to an attenuated FIV-141 is administered to a cat. DNA or RNA that encode the attenuated FIV-141 genome can be used in vaccines, but DNA is generally preferred. The DNA may be present in "isolated" form or it may be administered together with an agent that facilitates cell absorption (e.g., liposomes or cationic lipids). The typical route of administration will be by intramuscular injection of between approximately 0.1 and 5 ml of vaccine. The total polynucleotide in the The vaccine should generally be between about 0.1 μg / ml and about 5.0 mg / ml. The polynucleotides may be present as part of a suspension, solution or emulsion, but aqueous vehicles are generally preferred. Immunization of cats can be performed using DNA vaccines by a single inoculation or by several separate divided dose inoculations, for example, at intervals of 3 to 10 weeks. If desired, serum from inoculated animals can be collected and tested for the presence of antibodies against FIV-141 or against other FIV strains.

G. EXTENSION OF THE METHODOLOGY TO OTHER LENTIVIRUS The methods discussed above for attenuating FIV-141 and for producing mutated viral nucleic acids suitable for use in vaccines can be applied to other FIV strains and to other types of lentiviruses. In all cases, the viral genome is cloned and mutated in one or more genes selected from the group consisting of MA, CA, NC, DU, ENV, SU, TMf, CT, ORF (2) M Vifn, Vif, V3 / 4, V7 / 8, IN and RRE. The mutation must be designed to inactivate the gene product. Usually this can be done most easily by deleting the active gene or a significant portion of the gene. Although the specific methodology used to produce mutations will vary depending on the virus, the basic procedures are routine in the art and, using as a guide the procedures described herein Memory, can easily be performed by an expert molecular biologist. The production of antibodies, manufacture and administration of vaccines, etc., can be carried out, as discussed in this Report for FIV-141, making minor adaptations if necessary. In addition, it is contemplated to be able to use antibodies against certain lentiviruses to provide passive immunity to an animal or man infected with the virus. For this purpose, purified antibody or serum containing antibody can be used and the preparations can be administered periodically until an improvement in one or more signs associated with the viral infection is observed.

EXAMPLES Example 1: Construction of an infectious IVF proviral DNA clone A. Isolation and cloning of FIV-141 Virus isolation FIV-141 was isolated from the plasma of a cat infected with IVF. The virus was amplified by administering plasma from the infected animal to a cat free of specific pathogens (SPF). Inoculated cat infection was confirmed by virus isolation and seroconversion. The cat was sacrificed 12 weeks after infection, tissues were taken and the spleen was used as the origin and virus for the molecular cloning of the FIV-141 genome. Genomic DNA was isolated from the infected spleen using a DNA extraction kit (Stratagene, La Jolla, CA) according to the protocol provided by the manufacturer. Purified genomic DNA was dissolved in TE buffer at a concentration of 1 μg / ml and stored at -70 ° C.

PCR AMPLIFICATION AND CLONING OF THREE SEGMENTS OF THE GENOME OF FIV-141 Three sets and oligonucleotides were designed based on the published sequence of other FIV isolates [Talbott et al., Proc. Nat'l. Acad. Sci. USA, 86, 5743-5747 (1989); Miyazawa et al., J. Virol., 65, 1572-1577 (1991); Talbott et al., J. Virol., 64, 4605-4,613 (1990)]. These oligonucleotides were used to amplify three segments of the FIV-141 genome, one at the 5 'end one at the 3' end and one at the middle of the genome. Due to a low number of copies of the IVF progenitor genome in infected tissue, two PCR amplification processes were performed using a semi-closed set of primers for each segment. Three primers were used to clone a segment from the 5 'end of the progenitor genome of FIV-141, which extends from nucleotide 118 to 646. This region covers most of the 5' long terminal repeat, the intermediate sequence between the 5 'long terminal repeat and the Gag open reading frame, and the N-terminal portion of the Gag gene. The sequence of the primers were as follows: direct primer (pr-1): (1 17 - CCGCAAAACCA-CATCCTATGTAAAGCTTGC-146; SEQ ID No. 2) and both reverse primers: pr-2 (646 CGCCCCTGTCCATTCCCCATGTTGCTGTAG-617; SEQ ID No. 3) and pr-8 (1047 - TTACTGTTTGAATAGGATATGCCTGTGGAG-1.018; SEQ ID No. 4). The first PCR amplification process was performed using 200 ng of each of pr-1 and pr-8 as primers and 1 μg of genomic DNA as a template, with a mixture of 0.5 Tao units; DNA polymerase (Gibco, BRL Gaithersburg, MD) and 1 unit of Pfu DNA polymerase (Stratagene, La Jolla, Ca). The amplification was performed at 94 ° C for one minute, followed by 30 cycles of denaturation at 94 ° C for 45 seconds, reanillation at 52 ° C for 45 seconds and extension at 72 ° C for two minutes. The second amplification process was carried out using pr-1 and pr-2 primers together with 2 μl of the products of the first PCR amplification process as a template. The same conditions used in the first amplification process were applied to the second process, except that the reanillamiento took place at a temperature of 55 ° C. Three oligonucleotides were also used to clone a segment from the 3 'end of the proviral genome of FIV-141. This segment includes nucleotides 8,874 to 9,367, which make up most of the 3 'long terminal repeat and the intermediate sequence between the 3' long term repeat and the ENV gene. The sequences of the three primers were as follows: the two direct primers pr-5 (8,793 -GCAATGTGGCATGGTCTGAAAAA-GAGGAGGA-8882; SEQ ID No. 5) and pr-7 (8,874 - TCTTCCCTTTGAG-GAAGATATGTCATATGAATCC-8.907; SEQ ID No. 6), and reverse primer pr-6 (9.367 TCTGTGGGAGCCTCAAGGGAGAACTC-9.342; SEQ ID No. 7). Primers pr-5 and pr-6 were used to perform the first amplification process and pr-6 and pr-7 were used to perform the second amplification process. The same conditions used in the amplification of the segment from the 5 'end of the FIV-141 written above were applied to the present amplification. To clone a segment from the central part of the FIV-141 genome, which extends from nucleotides 5.147 to 5.631 and which covers the C-terminal portion of the IN gene and the N-terminal portion of the Vif gene, a first process was performed of amplification using the direct primer pr-3 (4738 -ACAAACAGATAATGGACCAAATTTTAAAAA-4.767ÍSEQ ID No. 8) and the reverse primer pr-10 (5.631 - TTTCAATATCATCCCACA-TAAATCCTGT-5.604, SEQ ID No. 9). A second amplification process was performed using pr-9 as a forward primer (5.147 TTAAAGGATGAAGAGAAGGGATATTTTCTT-5.176, SEQ ID No. 10) and pr-10 as reverse primer. After the second PCR amplification process was completed, the products were applied to a 1% agarose gel and the bands expected for the three regions were purified by a Wizard PCR Preps kit (Promega, Madison, WI). Purified PCR amplification fragments were cloned into PCR-Script Amp vectors SK (+) (Stratagene, La Jolla, CA) according to the procedure recommended by the manufacturer. The inserted elements were confirmed by digestion with restriction enzymes followed by sequencing of the two strands of the plasmid DNA (Advanced Genetic Analysis Center, St. Paul, MN). To eliminate "errors" in the IVF sequences generated by the DNA polymerases during the amplification, three independent clones of three PCR amplifications were sequenced in each region. The consensus sequence of the three independent clones was considered as an authentic sequence of IVF-141. The combination of the sequences from the 5 'and 3' end segments suggests that the long terminal repeat of FIV-141 consists of 354 bases, including 208 bases in the U3 region, 79 bases in the R region and 67 bases in the U5 region. The inverse terminal repeats of 2 bases, the TATA box, the polyadenylation signal and a series of optional cis-acting promoter-enhancer elements were perfectly preserved with respect to other IVF isolates.

Amplification by PCR and cloning of the proviral genome COMPLETE OF THE IVF-141 The sequence information obtained using the three cloned segments described above was used to design specific primers of FIV-141 that can be used to amplify and clone the genome Provisional full in two pieces, half 5 'and half 3'. Each half was amplified by two amplification processes with a semi-set of primers. To amplify the 5'-half of the FIV-141 genome (from nucleotide 1 to 5,460), the first amplification process was performed using pr-11 (1-TGGGAAGATTATTGGGATCCTGAAGAAATA-30; SEQ ID No. 11) as direct primer and PR-10 as reverse primer. The amplification protocol followed that provided with the Advantage Genomic PCR kit from Clonetech (Palo Alto, CA). In summary, the PCR reaction was performed in a total volume of 50 μl containing 1 μl of genomic DNA template (1 μg / μl), 1 μl of each primer (100 ng / μl), 5 μl of 10x Tth buffer for the PCR reaction, 2.2 μl of 25 mM Mg (OAc) 2, 1 μl of 50X-dNTP mixture (each 10 mM), 1 μl of 50X Advantage Tth polymerase mixture, 1 μl of Pfu polymerase (2.5 U / μl) and 36.8 μl of sterile water. The reaction mixture was heated at 94 ° C for 2 minutes, followed by 30 cycles of amplification: at 94 ° C for 30 seconds and at 68 ° C for 6 minutes. The second amplification process was carried out using 2 μl of the product of the first PCR process as the template, the same pr-11 as direct primer and pr12 (5,460-CATATCCTATATAATAATC-ACGCGTATGAAAGCTCCACCT-5.421, SEQ ID No. 12) as reverse primer. To facilitate the construction of a complete genome of FIV-141 from the two halves, the Mlu I site (underlined) of the restriction enzyme was incorporated into the pr-12 primer. In the second process, the same conditions used in the first amplification process were applied and the production of an amplification fragment with the size of 5,460 base pairs. To clone the 3 'half of the progenitor genome of FIV-141, three primers pr-9, pr-13 and pr-14 were initially used to perform amplifications. The first PCR amplification process was performed using pr-9 as a forward primer and pr-14 (9,464-TGCGAGGTCCC-TGGCCCGGACTCC-9,441, SEQ ID No. 13) as reverse primer. The second amplification process was performed using pr-13 (5,421 -AGGTGGAG-CTTTCATACGCGTGATTATTATATAGGATATG-5.469, SEQ ID No. 14) as a forward primer and the same pr-14 as reverse primer. Primer pr-13 was designed to overlap with the pr-12 primer used in the amplification of the 5 'half of the genome. As in primer pr-12, a site (underlined) Mlu I of the restriction enzyme was incorporated into pr-13 to facilitate construction of the full IVF clone. Unfortunately, after two cycles of PCR amplification, no specific DNA band was observed. It was concluded that the inability to amplify the 3 'half of the FIV-141 genome was probably due to a high GC content., and a very stable secondary structure in primer pr-14. Therefore, a new primer, pr-16 (944-CTCCAGGGATTCGCAGGTAAAA-GAGAAATTA-9416, SEQ ID No. 15) was designed. This sequence ends 20 bases upstream of the last base of the FIV-141 genome. The first cycle of amplification by PCR was carried out using the forward primer pr-9 and the reverse primer pr-16. This was followed by an amplification using the direct primer pr-113, and again the reverse primer pr-16. A DNA fragment with the expected size was obtained after the second amplification cycle. The DNA fragments from the 5 'half and the 3' half of the FIV-141 genome were purified using the Wizard PCR Preps DNA purification assay kit (Promega, Madison, Wl), and cloned into pCR cloning vectors. -Script SK SK (+) (Stratagene, La Jolla, CA). Three clones were sequenced from three independent PCR reactions for each of the clones of the 5 'half and the 3' half. Both strands of the plasmid DNA were sequenced, and the true consensus sequence for the whole genome was obtained by comparing the results obtained for the three independent clones. The DNAStar program (DNAStar Inc., Madison, Wl) was used to carry out sequence coupling, comparison and analysis.

B. Molecular characterization of the cloned F-141 virus. Results of the sequences and analysis of the complete aenoma of the IVF-141. The complete proviral genome of FIV-141 was found to contain 9,464 bases. The genome is organized in a typical lentivirus fashion and consists of: 5 'and 3' long terminal repeats; three large open reading frames (ORF) containing the Gag, Pol and ENV genes; and three small open reading frames containing the regulatory proteins Vif, Rev and ORF (2). Long terminal repeats share 78. 6% and 93.9% sequence homology with FlV-Petaluma isolates [Olmsted et al; Proc. Nat'l. Acad. Sci. USA, 86, 2448-2452 (1989)] and of FIV-USIL [Sodora et al; AIDS Res. Hum. Retroviruses, 11, 531-533 (1995)], respectively. The poiiprotein Gag shares 88.4% and 94.4% amino acid homology with FlV-Petaluma and FIV-USIL isolates, respectively. The Gad gene encodes the matrix protein (MA) (bases 627 to 1031), the capsid protein (CA) (bases .032 to 1724) and the nucleocapsid protein (NC) (bases 1,725 to 1,976). ). The Gag gene and the Pol polyprotein overlap 97 bases with the Pol ORF, starting at nucleotide 1880 and ending at nucleotide 5.239. A seven-nucleotide reading frame change signal (5'-GGGAAAC-3 ') is located 100 bases upstream of the 3' end of the overlap. As a result of a change of the reading frame of -1 during translation, a fusion of Gag / Poly polyprotein occurs. Compared with FlV-Petaluma and FIV-USIL isolates, the Pol polypeptide of FIV-141 exhibits 85.07% and 92.2% amino acid identity, respectively. The Pol gene encodes: a leader sequence from nucleotide 1880 to 1978; a protease (PR) from nucleotide 1.979 to 2.326; a reverse transcriptase (RT) from nucleotide 2.327 to 3.994; a deoxyuridine triphosphatase (DU) from nucleotide 3,995 to 4,393; and an integrase (IN) from nucleotide 4.394 to 5.239.

The Vif ORF overlaps eight bases with the Pol gene and shares 80.2% and 91.3% amino acid homology with FlV-Petaluma and FIV-USIL isolates, respectively. Immediately after the Vif gene is the ORF (2) gene, which starts at nucleotide 5.988 and ends at 6.224, which reveals 62% and 92.4% sequence homology with FlV-Petaluma and IVF isolates. USIL, respectively. The ENV polyprotein shares 79.3% and 88.6% amino acid identity with isolates of FIV-141 and FIV-USIL, respectively. The gene encodes: a surface protein (SU), from nucleotide 6,262 to 8,088; and a transmembrane (TM) protein, from nucleotide 8.089 to 8. 826. The Rev protein results from the translation of a mRNA from multiple cuts and splices. The first exon of the optional gene Rev shares apparently an initiation condom with the ENV gene, which starts at nucleotide 6.262 and ends at 6.505. The second exon of the Rev gene starts at nucleotide 8.947, extends into the U3 region of the 3 'long terminal repeat and ends at nucleotide 9.161. The Rev protein of FIV-141 has 67.3% and 83.9% amino acid homology with FlV-Petulama and FIV-USIL isolates, respectively. The element responsible for the Rev (RRE) of 151 bases overlaps 52 bases with the ENV gene, starting at nucleotide 8.775 and ending at 8.925. Based on the comparisons of the sequences in the V3 region of the SU glycoprotein, FIV-141 is a type B isolate. Apparently, FIV-141 is more intimately related to FIV-USIL, another type B isolate.

C. Construction of a complete molecular clone of IVF-141. To construct a complete clone of IVF-141, the 20 bases of the 3 'end of the genome must be added to the 3' half of the clone. In addition, a consensus sequence was identified by comparing the sequences of three independent clones. Site-directed mutagenesis (SDM) was then used to adjust the sequences of the 5 'and 3' halves of the clones to match those of the consensus prior to constructing the full viral clone.

Addition of the 20 absent bases at the 3 'end of the IVF-141. To add the 20 bases to the 3 'half of the FIV-141 clone, the long terminal repeat was first amplified by PCR and cloned into a PCR-Scrip Amp SK (+) cloning vector using the 5' half of the clone and as forward primer pr-21 (5'-TTACAAGAATTCAACTGCAGTGGG-AAGATTATTGGGATCCTGAAGAAT-3 '; SEQ ID No. 16) and as reverse primer pr-20 (5'-TTCAAGGAGCTCTTTTGTCGACAACTGCGAGGTCCCTG-GCCC-3'; SEQ ID No. 17). To facilitate the cloning of the PCR fragment, two (underlined) sites of restriction enzymes, EcoRI and Pst I, were incorporated into the forward primer, pr-21, and two sites (underlined), Sac I and Sal I, into the primer inverse, pr-20. The specific sequences of IVF-141 are shown in italics. The resulting clone was sequenced and designated pCR-LTR. A Restriction fragment of p FIV-LTR, generated by digestion with Sacl and Nhel, was cloned in one of the 3 'halves of the FIV-141 clone. The resulting clone was named pFIV3'-2A-1 + and the presence of the 20 bases at the 3 'end of FIV-141 was confirmed by nucleotide sequencing.

Construction of council sequence in the 5 'and 3' halves of the clones To establish the sequence of advice in the 5 'and 3' halves of the existing clones of the FIV-141 genome, an SDM was performed. To introduce sequence changes in the first half of the genome, one of the 5 'halves of the clone (designated "pFIV5'-D-1 1") was used as template. There were a total of 15 nucleotide changes in pFIV5'-D1 1, compared to the consensus sequence. Two changes were located in the 5 'non-coding region, A602G and A612G, and seven nucleotide changes in the coding region were silent mutations. The other six changes in the coding region resulted in a substitution of amino acids at each change, three in the RT region (a change of nucleotides A2890G, which causes an amino acid substitution I to M, a change G3461A which causes a substitution E to K; and a change G3737A that originates a substitution E to K), one in the DU protein (a change C4383T that causes a substitution T to I) and two in the IN protein (a change A4597G that originates a substitution I to M; change A5007T originating a substitution Q to L). Seven oligonucleotides were designed to make the two changes in the non-coding region and six changes in the region encoding that originate amino acid substitutions. The oligonucleotides were as follows, with the mismatched underlining: Oligo pF-1, designed to repair the A602G and A612G errors: 5'- GATTCGTCGGGGGACAGCCAACAAGGTAGGAGAGATTCTACAGCAAC-ATGGGG-3 * (SEQ ID No. 18). Oligo pF-2, designed to fix the error A2890G: 5'-TCAATATATGGATGATATCTATATAGGATCAAATTTAAGTAA-3 '(SEQ ID N ° 19). Oligo pF-3, designed to repair the error G3461G: 5'- GTGA-TATAGCTCTAAGGGCATGTTACAAAATAAGAGAAGAATCCATTATAAG-AATAGG-3 '(SEQ ID N ° 20). Oligo pF4, designed to repair the G3737A error: 5'-CGGGCAGATGGCAGGTAATGGAAATAGAAGGAAGTAATCAAAAAGC-3 '(SEQ ID N ° 21). Oligo pF-5, designed to repair error C4383T: 5'-AGAAAG- GGATTTGGGTCAACTGGAGTCTTTTCTTCATGGGTGGA-3 '(SEQ ID N ° 22). Oligo pF-6, designed to repair error A4579G: 5'-GGGGGACAATTAAAGATTGGACCTGGCATATGCCAAATGGACTGTACACA C-3 '(SEQ ID N ° 23) and: Oligo pF-7, designed to repair error A5007: 5'- GGCTCCTTATGAATTATACATACAACAGGAATCATTAAGAATACAAGAC-S' (SEQ ID No. 24).

To make sequence changes in the 3'-half of the genome, the 3 'half of the clone, "pFIV3'-2A +", was used as a template to perform SDM. There were nine changes in clone pFIV3'-2A-1 + compared to the consensus sequence. Two nucleotide changes in the coding region were silent. The other seven changes originated a substitution of amino acids: one in the Vif protein (T5508CH to Y); one in the ORF region (2) (A6041T, D to E); three in the SU protein (A6922G, V a i; G7007T.S to N); one in the TM region (A8405T, I to N); and one in the Rev region (A8976G, E to K). Seven mutagenesis oligonucleotides were designed to repair these seven amino acid substitutions: Oligo pF-8, designed to repair the T5508C error: 5'-CAAAATAGTTTAAGATTGIATGTTATATAACGAAT-3 '(SEQ ID N ° 25), Oligo pF-9, designed to repair the A6041T error: 5'-CAGAAAAGTTAGATAGAGAAGCAGCTATTAGATTGTTTAT-3 '(SEQ ID N ° 26). Oligo pF-10, designed to repair the error A6922G: 5'-TAAAAGCAAATGGTTAATATAAGTATACAAGAAGGACCTAC-3 '(SEQ ID N ° 27), Oligo pF-11 designed to repair the error G7007T: 5'-AAAAGC-TACAAGGCAATGCAGAAGGGGAAGGATATGGAAG-3' (SEQ ID No. 28).

Oligo pF-12, designed to repair error A7814G: 5'-AGAGGACCTTATTGTACAATTTAATATGACAAAAGCAGTGGAAA-3 '(SEQ ID N ° 29). Oligo pF-13, designed to repair the error A8405T: 5'-CCCTCAATCTGTGGACAATGTATAACATGACTATAAATCA-3 '(SEQ ID N ° 30) and: Oligo pF-14, designed to repair the error A8976G: 5'-GACAACGCAGAAGAAGAAAGAAGAAGGCCTTCAAAAAATT-3' (SEQ ID No. 31). Single-stranded DNA preparations were made as a template for the two clones, pFUV5'-D-11 and pFUV3'-2A-1 +, essentially following the protocol provided by the manufacturer (Promega, Madison, Wl). Briefly, plasmids DNA from the two clones were transfected into the CJ236 strain of E. coli. Single-stranded DNA was rescued using the auxiliary phage R408 and purified by extraction with phenol / chloroform. Single-stranded DNA was dissolved in TE buffer estimating its concentration by making samples of 2 μl of mold preparations on a 1% agarose gel. The oligonucleotides were phosphorylated according to the protocol provided by the manufacturer (Gibco BRL, Gaithersburg, MD). The oligonucleotides were annealed to the template in a total reaction volume of 30 μl. This contained 0.2 pmol of single-stranded DNA as a template (pFIV5 '-D-1 1 or pFIV3' -2-A-1 +), 4 pmol of each oligonucleotide (ie, pF-1 to pF-7). for the mold of pFIV5 '-D-1 1 and pF-8 to pF-14 for the mold of pFIV3 '-2A- 1 +), 3 μl of resuscitation buffer (0.2M Tris-HCl, pH 7.4, mM MgCl 2 and 0.5 M NaCl). The mixture was incubated for 5 minutes at 85 ° C and then gradually cooled to room temperature at a rate of about 1 ° C per minute. To synthesize the complementary DNA strand, the following components were added to the reannealing mixture: 3 μl of synthesis buffer [4 mM dNTP, 7.5 mM ATP, 175 mM Tris-HCl (pH 7.4), 37.5 mM MgCl 2 and DTT 215 mM], 3 μl of T4 DNA ligase (3U / μl) and 3 μl of the diluted T7 DNA polymerase (0.5 units per μl): The reaction was incubated at 37 ° C for 3 hours, followed by thermal inactivation at 68 ° C for 10 minutes. Two μl of the SDM reaction mixture was used to transfect competent DHa-5 cells of E. coli. In each 5 'half of the clone, pFIV5' -D-11, the incorporation of one of the mutagen genes oligonucleotides, PF-5, caused an addition of an Hinc II site. A preliminary screening with Hinc II resulted in the identification of four positive mutants that were designated pFIV5 '-D-11 / M-4, pFIV5' -D-11 / M-22, pFIV5 '-D-1 1 / M-28 and pFIV5 '-D-1 1 / M-52. These four mutants were completely sequenced to verify the incorporation of the other seven desired mutations. The results of the sequencing revealed that three of the four clones contained the eight mutations. One clone, pFIV5 '-D-11 / M-28, had only seven positions that had mutated.

The clone pFIV5 '-D-11 / M-52 was selected as a 5' half of the clone to be used to construct the complete clone of FIV-141. In the 3 'half of the clone, pFIV3' -2-A-1 +, a preliminary screening with digestion by BspH I identified 10 mutants in which the BspH I restriction site had been removed due to the incorporation of the mutagenesis oligonucleotide pF13 . Complete sequencing revealed that 8 of the 10 clones contained mutations in the seven desired positions. One of the mutants, "pFIV3 '-2-A-17M-21", contained the 8 changes and was selected to be used as a 3' half of the clone to construct the full clone of FIV-141.

Construction of the complete IVF-141 clone To construct the complete IVF-141 clone, a 5.5 kb Mlul / Xhol fragment, derived from the 5 'half of the clone pFIV5 * -D-11 / M-52, was ligated, at the 3 'half of clone pFIV3' -2-A-17M-21, which had been digested with the same two restriction enzymes. The complete ligation product was screened by PCR amplification using a forward primer directed to the 5 'half of the clone and a reverse primer directed to the 3' half of the clone. The forward primer, pr-9, had the following sequence: 5 '- (5,147) -TTAAAGGATGAAGAGAAGGGATATTTTCTT - (5.176) -3' (SEQ ID N ° 10). The reverse primer, pr-10, had the following sequence: 5 '- (5,631) -TTTCAATATCATCCCACATAAATCCTGT - (5604) -3' (SEQ ID N ° 9). Positive clones were confirmed by restriction digestion and by sequencing One of the resulting complete clones was designated "pFIV-141 B-1" and was selected for characterization both in vitro and in vivo.

EXAMPLE 2 Demonstration that the complete molecular clone is infectious Transfection Crandell cat kidney cells (CRFK) were grown in six-well plates to a confluence of 40 to 60%. Transfection was performed by introducing 2 μg of plasmid DNA and following the basic protocol recommended by Trans IT Polyamine Transfection Reagents (Mirus, Madison, Wl): In summary, 10 μl of Trans IT Lt-1 (Panvera) was mixed with 1 ml of RPMI 1640 medium and incubated at room temperature for 15 minutes. Two μg of plasmid DNA was added to the RPMI Lt-1 solution and incubated for another 15 minutes at room temperature. The medium was removed from the wells, the cells were washed once with PBS and the DNA cocktails were added to the cell monolayers. After incubation at 37 ° C in a CO2 incubator for four hours, the DNA cocktails were removed from the wells and 2 ml of RPMI 1650 medium supplemented with 3% fetal serum (FS) was added to each well. Twenty-four hours after transfection, the production of IVF, reverse transcriptase (RT) activity and viral infectivity were tested in the supernatant cells. suspend in 40 μl of lysis buffer from the kit and then the FIV production from transfected CRFK cells After transfection, supernatants from the transfected CRFK cells were harvested daily and FIV capsid protein production was assayed using the FIV antigen test kit (IDEXX, Portland , ME) according to the protocol recommended by the manufacturer. The enzyme immunoassay was designed to detect the antigen associated with the predominant group of the p26 protein of the FIV capsid. The pIV antigen of FIV was detected 24 hours after transfection, reached a peak 72 hours after transfection and then decreased to background levels 1 1 days after transfection (see Figure 1). To confirm the virus production from the transfected CRFK cells, a reverse transcriptase (RT) activity assay (Boehringer Mannheim, Indianapolis, IN) was performed to detect virion-associated RT activity in the transfected supernatants. Briefly, 200 μl of supernatant cells were collected and centrifuged for 5 minutes in a microcentrifuge giving cell pellets and cell debris. The supernatants were centrifuged at 20,000g for 20 minutes at 4 ° C in an oscillating paddle rotor giving granules of IVF virus particles. The granules of viral particles were resuspended in 40 μl of lysis buffer of the kit and then the tests were carried out following the manufacturer's recommendations. 48 hours after transfection, the production of virus from transfected cells was demonstrated in the supernatant cells.

CRFK cell infection The wild-type FIV-141 virus does not infect CRFK cells. To determine if the molecular clone virus exhibits a similar behavior, CRFK cells were cultured in 6-well plates and inoculated with 200 μl of p26 + conditioned medium from transfected CRFK cells. After incubating for 2 hours at 37 ° C, the cells were washed once with PBS and 2 ml of RPMI medium supplemented with 3% FS was added to each well. Then, in the supernatants, virus production was followed by an FIV p26 ELISA assay every 3-4 days after transfection. It was found that, like the wild-type virus, the FIV-141 clone does not infect CRFK cells.

Infection of FeP2 cells by coculture with transfected CRFK cells. CRFK cells were cultured in 6-well packs and transfected as described above. 48 hours after transfection, 2x1016 FeP2 cells were added to each well transfected with p26 +. After coculturing the cells for 72 hours, the FeP2 cells (non-adherent) were separated from the CRFK (adherent) cells. The supernatants of the FeP2 cells were collected and the virus production was followed by an ELISA p26 ELISA test every 3-4 days. Four days after cocultivation, high levels of virus production were demonstrated in the FeP2 supernatant cells (see Figure 2). The virus titration reached a constant 6 days after transfection, which indicates that the molecular clone of FIV-141 is infectious in FeP2 cells. The results also suggest that the infection of CRFK cells is blocked in the first phase of the viral infection, that is, at the time of entry of the virus into the cells. In summary, the conclusion is that, after transfection in CRFK cells, the molecular clone of FIV-141 can be replicated in the cell and the viral particles released from the cells are infectious towards the FeP2 T lymphocytes.

Infection of FeP2 cells by adsorption FeP2 cells (2x106) were suspended in 200 μl of p26 + conditioned medium obtained from transfected CRFK cells and incubated at 37 ° C for two hours. The cells were washed with PBS, suspended in 2 ml of Opti-MEM medium supplemented with 10% heat-inactivated FCS and incubated at 37 ° C. Supernatants were collected and virus production was monitored by ELISA p26 ELISA every 3-4 days. Four days after infection, virus release from infected FeP2 cells was detected in the supernatants and a peak was reached three weeks after infection (FIG. 3). The results indicate that cell-producing infection can be achieved FeP2 by FIV-141 by adsorption or by coculture with transfected CRFK cells. Compared with co-culture infection, virus production reached a constant value much more slowly when infection occurred by adsorption (Figures 2 and 3).

EXAMPLE 3 FIV-141 mutant clones and their use in vaccines To develop possible FIV-141 vaccines, the infectious clone of wild-type FIV-141 was used to construct a series of clones with deleted genes. The general criteria for making the mutant clones are: 1) Deletions or mutations introduced into the FIV-141 genome must be sufficiently severe to substantially reduce (attenuate) the infectivity of the virus after transferring the clones to cultured cells in vitro or to administer them in vivo to cats and 2) deletions or mutations introduced into the FIV-141 genome must not override the competence of replication of the viral genome nor the ability to express viral proteins at high levels. Other factors to consider are whether the genome with suppressed genes will be integrated into host chromosomes, whether defective virus particles will form and the level of viral structural proteins that will be expressed. Based on these considerations, the deletion of a series of genes and elements was programmed. Because it had to be maintained replication of the viral genome, the RT or PR genes of FIV-141 were not mutated.

A. Deletions in the Gaq region The Gag polyprotein contains three virion structural proteins, MA, CA and NC. Three clones with suppressed genes were constructed, with one deletion in each of these proteins.

Mutation "of MA" Site-directed mutagenesis was performed to create Spe I restriction sites in the C-terminal portion of the MA protein using the 5 'half of clone pFIV5' - D - 11 / M - 52 as a template and following mutagenesis primers: Mpma-1 (5'-AGTAAAGAAATTGACATGGCGATTAC-TAGTTTAAAAGTTTTTGCATGGC-3 ': SEQ ID No. 32) and Mpma-2 (5'-CCATCTATAAAAGAAATGGGACTAGTGAAGAAGGACCTCCACAGGC-3'; SEQ ID No. 33). The Spe I sites introduced by the primers are underlined in the sequences. The SDM was performed as described above to repair the optional errors in the 5 'and 3' halves of the clones. The mutants were screened by restriction digestion of Spe I and positive clones were used to construct the deletion clone. Spe I digestion was performed to release the Spe I fragment and the remaining part of the clone was self-ligated to create the deletion clones. These were screened by PCR amplification using sets of primers bordering the suppressed region and confirmed by nucleotide sequencing. The 5 'half of the clone with the deletion was ligated to the 3' half of clone pFIV3 '-2A-17M-21 generating the entire clone with the deletion. This clone was called "FIV-141 with MA deletion" clone and contained a deletion of 123 bases from nucleotide 879 to nucleotide 1,001, corresponding to 41 amino acids of residues 85 to 125 in the C-terminal portion of the protein Ma.

"CA" mutation An SDM was performed to create two Spe I sites in the CA region of FIV-141 using the 5 'half of the clone pFIV5 * - D-11 / M-52 as template and, as primers, Mpca-1 (5 '-ATTCAAA- CAGTAAATGGAGGAACTAGTTATGTAGCCCTTGATCCAAAAATG-3': SEQ ID No. 34) and Mpca-2 (5 'ACAGCCTTTTCAGCTAATTTAACTAGTACTGATATGGCTA-CATTAATTATG-3'; SEQ ID No. 35). After deletion of the Spe I restriction fragment, the 5 'half of the clone was ligated to pFIV3' -2A-1 + / M-21 generating the complete clone with the deleted gene. This clone had a deletion of 114 base pairs from nucleotide 1056 to 1169, corresponding to the 38 amino acids from position 9 to 46 in the N-terminal portion of the CA protein.

Mutation "of the NC" The 5 'half of the clone has unique sites Sea I and Sma I in nucleotides 1,635 and 1,876, respectively. The clone was digested with Sea I and Sma I releasing a fragment of 242 base pairs. The remaining portion of the 5 'half of the clone was self-ligated and then attached to the 3' half of the clone generating the entire clone with deleted genes. The deletion consists of 63 bases (21 amino acid residues) in the CA region, 27 bases (9 amino acid residues) between the CA and NC proteins, and 152 bases (51 amino acid residues) in the N-terminal portion of the protein NC The deletion also caused a change of the reading frame of -1 and, therefore, the C-terminal portion of the NC protein can not be expressed by this clone.

B: Deletions in the ENV region The ENV precursor glycoprotein is processed to produce two mature proteins: SU and TM. Six deletion clones were constructed in the ENV region.

"ENV" mutation An SDM was performed to create two BstE II sites in the ENV region using the 3 'half of clone pFIV3"-2A-17M-21 as a template and, as primers of mutagenesis, Mpenv-1 (5' -ACTA- TAGTCTATTTACTAACTGGTTACCTGAGATATTTAATAAGCCATAG-3 ': SEQ ID N ° 36) and Mpenv-2 (5 '-TACTTATATGCTTGCCTACATTGGGTTACC- GTATAAGAAACTGTACTAATAAAA-3 '; SEQ ID No. 37). The BstE II sites of the first primer are underlined. After deletion of the BstE II fragment, the self-ligated clone was bound to pFIV5'-D-11 / M-52. The resulting clone has a deletion of 2,103 bases of nucleotide 6,577 to 8,679, corresponding to the central 701 amino acids of the ENV protein (residues 106 to 806). The 105 N-terminal residues, most of which overlap with the first exon of the Rev protein, and the 45 C-terminal residues that overlap with the responsible element Rev (RRE), were retained in the deletion clone.

"SU" mutation Two Spe I sites were generated in the SU region of FIV-141 by SDM using clone pFIV3 '-2A-17M-21 as template and, as mutagenesis primers, Mpsu-1 (5' -GAGGTATAAAGGT - AAACAAAAAACTAGTGCCATTCATATTATGTTAGCCCTTGC- 3 '; SEQ ID N ° 38) and Mpsu-2 (5' ACTAACTATAGTCTATTTACTAACAACTAGTTTGAGATATTTAATAAGCCCA TAGAAAC-3 '; SEQ ID N ° 39). The Spe I fragment was deleted by Spe I digestion followed by self-ligation of the large remaining fragment. The resulting clone was ligated to pFIV5'-D-11 / M52. This region has a deletion of 1509 bases from nucleotides 6,577 to 8,085, corresponding to a deletion of 503 amino acids (residues 106 to 608) of the SU protein. The clone retains the N-terminal 105 amino acids of the Su protein.

"V3 / 4" mutation An SDM was performed to create two Sph I sites bordering the V3 and V4 regions of the SU protein. The clone pFIV3 '-2A-17M-21 was used as a template together with the mutagenesis primers; Mpenv-5 (5 '-ATACCGAAATGTGGATGGTGGAATCAAG- GCATGCTATTATAATAATTGTAAATGGGAAGAAGC-3'; SEQ ID No. 40) and Mpenv-6 (5'-GCACTATGTACAATTGTTCCTTACAGGCATGCTTCACTATGAAAA-TAGAGGACCTTAT-3 '; SEQ ID No. 41). The Sph I sites are underlined. After digestion to remove the Sph I fragment, the clone became self-ligating and then bound to pFIV5 '-D-1 1 / M-52. This clone contains a deletion of 432 bases from positions 7,339 to 7,770, corresponding to a deletion of 144 amino acids (from the remainder 360 to 503) of the SU protein, which covers the V3 and V4 regions.

Mutation "of V7 / 8" SDM was used to create two Sph I sites bordering the V7 and V8 regions of the TM protein. This was done using the clone pFIV3 '-2A-17M-21 as a template and, as primers for the mutagenesis, Mpenv-7 (5' -GAATCAATTCTTTTGTAAGATCGCATGC-AATCTGTGGACAATGTATAACATGACTA-3 '; SEQ ID No. 42) and Mpenv-8 (5 * -GGGAAAATTGGGTGGGATGGATAGGTAAGATCGCTATTTAAAAG-GACTTCTTGGTAG-3 '; SEQ ID No. 43). The Sph I sites are underlined. The digestion with Sph I resulted in the removal of 216 bases from nucleotide 8,380 to 8,595 and was followed by ligation of the large fragment. The resulting clone was then joined to the 5 'half of clone pFIV5' -D -1 1 / M-52 generating the "of V7 / 8". This contains the deletion of 72 amino acids (from rest 98 to 169) of the TM protein that covers the various V7 and V8 regions.

Mutation "of TMf" The 3 'half of the IVF-141 clone has a unique Age I site in nucleotide 8.145. An SDM was performed to create an Age I site at position 8.071. The 3 'half of the clone was used as a template together with Mpenv-3 (5'-GGAAGAAGTTATGAGGTA-TACCGGTAAACAAAAAAGGGCC-3'; SEQ ID No. 44) as the primer of mutagenesis. A fragment of 75 bases between the two Age I sites was deleted by digestion with restriction enzyme, followed by self-ligation of the large restriction fragment. The resulting clone was ligated to the 5 'half of the clone generating the "del TMf." This contains a deletion of 25 amino acids in the cleavable link between the SU and TM proteins.Amored amino acids include 6 C-terminal residues of the SU protein [ 4 of which are basic (ko R) and are required for the processing of the SU / TM cleavage site] and 19 N-terminal residues of the TM protein fusion peptide (required for the fusion of the membrane between the envelope of the virion and the cell membrane).

"CT" mutation An SDM was performed to truncate the cytoplasmic tail of the TM protein using the 3 'half of clone pFIV3' -2A-17M-21 as a template and, as a primer of mutagenesis, Mpenv-4 (5 'CTACTTATATGCTTGCCTACATTGGTCGACTGATGATGAAAC - TGTACTAATAAAATATTGGG- 3 '; SEQ ID N ° 45). A Sal I restriction site (underlined) was incorporated into the oligonucleotides by silent mutation to facilitate the screening of mutants. In the primer located just after the transmembrane domain of the TM protein, three translation stop codons were incorporated, repeated in series (in italics). The resulting clone was ligated to the 5 'half of the clone generating the "CT". This has a truncation of 136 bases from nucleotide 8,686 to 8,823 (corresponding to a truncation of 46 amino acids of the cytoplasmic domain of the TM protein).

C. Deletions in the Pol region Pol polyprotein consists of four enzymatic proteins: PR, RT, DU and IN. Two deletion clones were constructed in the Pol region.

"DU" mutation An SDM was performed to create two Spe I sites in the SU region using the 5 'half of clone pFIV5' -D- 1 1 M-52 as template and, as primers for mutagenesis, Mpdu-1 ( 5 'GATGGTTATAGAAGGTGAAGGAATTACTAGTAAAAGATCAGAAGATGCAG GATATG- 3'; SEQ ID N ° 46) and Mpdu-2 (5 'GAAATAATAATGGATTCAGAAAGAG- GAACTAGTGGATTTGGGTCAACTGGAGTCTTTTC-3'; SEQ ID N ° 47). The Spe I sites of the primers are underlined. A deletion of 345 bases from nucleotide 4.019 to 4.363 was achieved by Spe I digestion followed by self-ligation of the large restriction fragment. The resulting clone was joined to clone pFIV3 '- 2A - 17M - 21 generating the "DU". The clone contains a deletion of 15 amino acids, corresponding to almost all the DU protein.

Mutation "of IN" Two Spe I sites were created by SDM in the IN region of FIV-141 using pFIV5 '-D-11 / M52 as a template and, as primers of mutagenesis, Mpin-1 (5"-CTTCATGGGTGGACAGA-AtTGAAACTAGTGTATTAAATCATGAAAAATTTCACTCAG - 3 '; SEQ ID N ° 48) and Mpin-2 (5'-GCAATGGGTGTATTATAAAGATCAGAACTAAGTAAAAAG-TGGAAGGGACCAATGAGAGTAG-3'; AEQ ID No. 49) The Spe I sites of the primers are underlined After deletion of the Spe I fragment Y of the self-ligating, the resulting clone was joined with pFIV3 '- 2A-17M-21 generating the "IN". This contains a deletion of 669 bases nucleotide 4,418 to 5,036, corresponding to all the complete IN protein (223 amino acids, from rest 9 to 231 of the IN protein).

D. Deletions in genes or regulatory elements Three regulatory proteins identified in the IVF are Rev, Vif and ORF (2). A responsible element of Rev has been indicated at the 3 'end of the FIV genome. Five deletion clones were constructed in these regions.

"Vifn" mutation A single Mlu site was introduced in the middle part of the Vif gene of the 5 'half of clone pFIV5' -D-D-1 1 / M-52. An MDS was performed to create a second Mlu I site in the N-terminal portion of the Vif gene using pFIV3'-D-1 1 / M-52 as a template and, as a primer of mutagenesis, Movif-1 (5'-AGAAGACTCTTTGCAGTTCTCCAATGAACGCGTAGAGTGCCATGTTA -TACATATCG-3 '; SEQ ID No. 50). The Mlu I site of the primer is underlined. A restriction fragment of 150 bases from nucleotide 5286 to 5,435 was deleted by Mlu I digestion, followed by self-ligation of the large fragment. The resulting deletion clone was bound to pFUV3'-2A-1 + / M-21 generating the "del Vifn". This contains a deletion of 50 amino acids (from residue 19 to 68) in the N-terminal portion of the Vif protein.

Mutation "of the Vifc" The 3 'half of the clone pFIV3'-2A-1 + / M-21 has a unique Mlu I site in the Vif region. A second Mlu I site was created and by SDM in the C-terminal portion of the Vif protein using pFIV3'-2A-1 + / M-21 as a template and, as a primer of mutagenesis, Mpvif-2 (5'-CGTGTGGCAAAGAGGC -TAAAACGCGTAGAGGCTGTTGTAATCAG-3 '; SEQ ID No. 51). The Mlu I site of the primer is underlined. After deletion of the Mlu I fragment, the resulting clone was ligated to the 5 'half of the clone pFIV5'-D-11 / M-52 generating the "del Vifc". This contains a deletion of 438 bases from nucleotides 5,436 to 5,873, corresponding to a deletion of 146 amino acids (from residue 69 to 214) of the terminal portion of the Vif protein.

"Vif" mutation To construct "from Vtf", the restriction fragment Xho l / Mlu I of the Vifc protein was replaced by a 5.3 kb Xho I / Mlu I fragment from "Vifn". The resulting clone contains a deletion of 588 bases from nucleotides 5286 to 5,873, corresponding to a deletion of 196 amino acids (from the rest 19 to 214), almost all the Vif protein.

Mutation "of the ORF (2)" Two Mlu I sites were created by SDM in the nulceotides 5,998 and 6,224 [in the N- and C-terminal portions of the ORF protein (2)]. This was done using pFIV-3'-2A-1 + / M-21 as a template and, as primers for mutagenesis, Mporf-1 (d'-GTGGACGGAGAATTATGAACGCGTGAACTAATC-CCACTGTTTAATAAGGTTACAG-3 '; SEQ ID No. 52) and Mporf- 2 (5'-CTACATTATCCATAAATACTGCCTAGACGCGTTTCTTTTAATATTTCATCTG CAG-3 '; SEQ ID No. 53). The Mlu I sites of the primers are underlined. In addition to the sites created by SDM, there is an Mlu I site in nucleotide 5.436 of the clone. To construct "from the ORF (2)", a 5.4 kb Mlu l / Xho I fragment from the 5 'half of clone pFIV5'-D-1 / M-52 was ligated to the large Mlu l / Xho I fragment of the 3 'half of the clone? FIV3'-2A-1 + / M-21. Then an Mlu I fragment of 552 bases was inserted from position 5,436 to 5,988, generating the resulting clone. The "ORF (2)" contains a deletion of 237 bases, covering the entire ORF (2) gene.

"RRE" mutation An SDM was performed to create two Spe I sites in the RRE region using pFIV3'-2A-1 + / M-21 as a template and, as primers for mutagenesis, Mprre-1 (5'-GGCATATCTGAAAAAGAGGAGGAATGAACTAGTATATCA- GACCTGTAGAATACA-3 '; SEQ ID N ° 54) and Mprre-2 (d-GAGGAGGATGTGTC-ATATGAATCAAATACTAGTCAAAAATAACAGTAAAATCTATATTG-3': SEQ ID N ° 55). The Spe I sites of the primers are underlined. Deletion of the Spe I fragment was achieved by Spe I digestion followed by self-ligation of the large fragment. The resulting deletion clone was ligated to pFIV5'-D-11 / M-52 generating the "RRE". This contains a deletion of 84 bases from nucleotide 8,827 to 8,910.

EXAMPLE 4 Characterization of the deletion clones of the FiV-141 gene A. Expression of viral proteins and / or production of defective viruses Each plasmid of the deletion clones was transfected into CRFK cells as described above. FIV p26 ELISA assays were performed to detect protein expression and / or production of virus particles in the transfected supernatant cells. 48 hours after transfection, samples from 13 of the constructs were found to produce an intense positive signal comparable to that observed in the wild-type FIV-141 molecular clone (see Figure 4).

The highest levels of virus particle production were observed in the six deletion clones in the ENV region, including "of the ENV", "of the TMf," of the SU "," of the CT "," of the V3 / 4"and "of V7 / 8" Comparable levels of virus particle production were obtained in seven other deletion clones, including three deletion clones in the Vif region ("Vifn", "Vifc" and "Vif '), "of the MA", "of the DU", "of the IN" and "of the ORF (2)". The results indicate that the deletions made by these 13 clones does not interfere with the formation and release of virus particles from. of the transfected cells. A relatively weak positive signal was detected in "del CN", which indicates that the deletion in this region affects the assembly and release of virus particles. No production of virus particles was detected in the supernatants of cells transfected with "del CA" or "del RRE". The deletion in the C-terminal portion of the CA protein can override the formation of virus particles or cause loss of the epitope recognized by the monoclonal antibody (MAb) used in the p26 ELISA assay kit. As expected, the deletion in the RRE region caused a blockade of the export of viral RNA not cut or spliced from the nucleus to the cytoplasm, causing a total lack, or an extraordinary decrease, of the expression of viral structural proteins.

B. Intracellular RT-PCR for the detection of MARCA viral RNA expression. Intracellular RT-PCR was performed to detect expression of viral RNA in the two "CA" and "RRE" deletion clones. Plasmid DNA from each clone was transfected into different CRFK cells. Forty-eight hours after transfection, total RNA was isolated from the transfected cells using an RNeasy kit (Qiagen, Chatsworth, CA). The RNA was eluted in 50 μl of DEPC water and 2 μl of each RNA sample was used to synthesize the first strand of cDNA using Superscript II (Gibco BRL, Gaithersburg). A fragment of 585 base pairs, from nucleotide 2.958 to 3.542, was amplified using, as a forward primer, Sp-8 (5'-TATTATGGTGGGGATTTGAAAC-3 '; SEQ ID No. 56) and, as reverse primer, Sp-20 (5'-TAApAGATTTGATTCCCAGGC-3 '; SEQ ID No. 57). Two μl of cDNA from each reaction was used as a template in PCR reactions and, as a control, 2 μl of total RNA from each preparation. Each reaction was performed in a volume of 100 μl using a PCR amplification kit (Gibco BRL, Gaithersburg). The reaction proceeded as follows: 25 cycles at 94 ° C for 30 seconds, 55 ° C for 30 seconds and 72 ° C for another 30 seconds. Ten μl of each reaction was then loaded on a 1% agarose gel. A specific band of the expected size was observed in the two "CA" and "RRE" clones, which indicates that the expression of viral RNA occurred in the cells transfected with these clones. The results suggest that the non-detection of p26 protein expression by "CA" ELISA test is probably due to the lack of formation of virus particles or a lack of the epitope recognized by the antibody used in the p26 ELISA assay. In the RRE deletion clone, expression of viral genes was demonstrated by intracellular RT-PCR, but p26 protein expression was not detected using the ELISA assay. The discrepancy may reflect a much higher sensitivity of the RT-PCR assay compared to the ELISA assay.

C. Encapsidation of viral chemistry and RT enzyme in defective virus particles. Transfection of CRFK cells by most of the deletion clones of FIV-141 resulted in the production and release of defective virus particles. To determine whether viral genomes with suppressed genes and the RT protein were encapsidated in virus particles, RT-PCR assays associated with virions and RT activity were performed. Briefly, 48 hours after transfection, 200 μl of the supernatant liquid from each culture of transfected CRFK cells was collected and centrifuged in a microcentrifuge for 5 minutes to pellet the cells and cell debris. Virus particles from the supernatants were pelleted by centrifugation at 20,000 g for 20 minutes at 4 ° C in an oscillating paddle rotor. To test the encapsidation, the virus granules were resuspended in 350 μl of RLT buffer from the RNeasy kit and the viral RNA was purified by elution in 50 μl of DEPC water, following the manufacturer's recommendations. The first strand of the cDNA was made using Superscript II and PCR amplification was performed as described above using the set of primers Sp-8 and Sp-20. Fourteen of 16 deletion clones showed a specific band after PCR-RT amplification, indicating that the transfection of CRFK cells by these clones produced defective virus particles and that the viral genomes with deleted genes were encapsidated. The 14 clones consisted of 6 clones from the ENV region (including "of the ENV", "of the TMf '," of the SU "," of the CT "," of the V3 / 4"and" of the V7 / 8"), 3 clones of the Vif region ("del Vifn", "del Vifc" and "del Vif"), 2 clones of the Pol region ("of the DU" and "of the IN"), 2 clones of the regulatory region of genes / elements [ "of the ORF (2)" and "of the RRE"] and a clone of the Gag region ("of the MA"). According to the p26 ELISA analysis data, "CA" showed a negative signal in the PCR-RT assay associated with virions. The NC protein is required for the encapsidation of the viral genome in the virion and, as expected, in the RT-PCR "NC" assay, no viral RNA genome with suppressed genes was detected. In "del RRE", it was shown that viral RNA was present with suppressed genes, associated with virions, but no production of virus particles was detected using the p26 ELISA assay. The discrepancy in these results may also reflect a much higher sensitivity of the RT-PCR assay with respect to the ELISA. To test the encapsidation of the RT enzyme (ie, reverse transcriptase) in defective virus particles, virus granules were resuspended in 40 μl of the ELISA-kit lysis buffer.

RT and the assay was performed following the manufacturer's recommendations. In accordance with data obtained using p26 ELISA assays and virion-associated PCR-RT assays, virion-associated RT activity could be detected in 14 deletion clones, including "of the ENV", "of the SU", "of the TMf," of the V3 / 4"," V7 / 8"," of the CT "," of the MA "," of the DU "," of the IN "," of the Vifn "," of the Vifc "," of the Vif ', "of the ORF (2) "and" of the NC ". No RT activity associated with virions was detected in the "CA" or "RRE" clones.

D. In vitro infectivity of clones with genes suppressed from F1V-141. CRFK cells were cultured in six-well plates and transfected as described above. Forty-eight hours after transfection, 2 × 10 6 FeP2 cells were added to each well. After coculturing the cells for 72 hours, the FeP2 cells were separated from the CRFK cells and the supernatants were collected from the cultures of the FeP2 cells and virus production was followed using the FIV p26 ELISA assay every 3-4 days for a total of 4-6 weeks. It was found that twelve clones did not have a significant level of expression of the p26 protein of the capsid during the follow-up period. These clones included: "of the ENV", "of the TMf" and "of the NC" (figure 5), 3 deletion clones of the Vif region ("of the Vifn", "of the Vifc", and "of the Vif ') (figure 6); the clones "of the MA" and of the CA "(figure 7), the clones" of the V3 / 4"," of the V7 / 8"and" of the CT "(figure 8), and the clone" of the ORF (2) " (Figure 9) The results indicate that the deletions introduced in these clones completely cancel out the infectivity of the virus in the FeP2 cells. Moderate levels of virus replication were detected in four deletion clones, including "DU", "SU", "IN" and "RRE" (Figure 10).

Conclusions "of the ENV" The clone "of the ENV", which has a deletion of 701 amino acids in the central part of the ENV protein (residues 106 to 806), completely lost the ability to infect FeP2 cells. However, the ability to collect and release defective virus particles, to encapsidate the viral genome and to perform reverse transcription of RNA was retained. The main function of the ENV protein is to mediate the entry of the virus into target cells during the first phase of the infection. The deletion of most of the ENV protein can block the entry of the virus and, therefore, the infectivity of the virus. "of the TMF" The clone "of TMf, which contains a deletion of 25 amino acids in the cleavable junction between the SU and TM proteins, is not infectious in FeP2 cells.The deletion can block the cleavage process of the ENV precursor protein and this it may be caused that viral particles do not bind to or enter target cells.It has been reported that cleavage of the ENV glycoprotein cleavage site of the IVF results in the expression of a non-cleaved ENV precursor protein, however, the recombinant protein expressed maintains its antigenic properties, as it becomes manifested by its interaction with monoclonal antibodies determined using Western blotting and radioimmunoprecipitation assays [Rimmelzwaan et al., J.Gen.Virol., 75, 2.097-2.112 (1994)]. After transfection into CRFK cells, the deletion clone produces defective virus particles at a level comparable to a wild type FIV-141 clone. The defective viral genome and the RT enzymes were encapsidated in the defective virions.

"SU". "SU" has a deletion of 503 amino acids from the rest 106 to 608 of the SU protein. It was found that it maintained production levels of virus particles approximately equal to the wild-type clone. Both the viral genome with the suppressed gene and the RT enzyme were encapsidated. However, unlike "ENV", cells transfected by "SU" produced virus particles that are infectious in FeP2 cells, although to a much lesser extent than wild-type virus. Therefore, it seems that the deletion of the SU protein from the FIV-141 genome attenuated the virus. It is believed that the binding of FIV to cellular receptors, which is at the first stage in viral infection, is mediated by the SU protein when associated with the TM protein. The mechanism by which the mutant virus binds to target cells and enters them is unknown. An alternative route for the mutant virus to enter host cells may be responsible for the lower observed infectivity associated with the deletion clone. "of the V3 / 4 and" of the V7 / 8"In" of the V3 / 4"and in" of the V7 / 8"were deleted, respectively, one hundred forty-four amino acids from the rest 360 to 503 of the SU protein (which cover variable regions V3 and V4) and 72 amino acids from rest 98 to 169 of the TM protein (covering the V7 and V8 regions.) After transfection into CRFK cells, each clone produced defective viruses at levels similar to those observed in the wild-type clone As with other ENV-related deletion clones, "V3 / 4" and "V7 / 8" encapsidated their viral genomes with the deleted gene and RT enzymes in virions.The infective assay indicated that the deletion of the V3 and V4 region of the SU protein and the deletion of the V7 and V8 region in the TM protein completely abolished the infectivity of the virus in FeP2 cells.The variable region V3 is the immunodominant domain and it has been reported that it is involved in multiple functions, including virus tropism, viral pathogenesis and epitope It is currently unclear at what stage the viral infection is blocked in these two deletion clones.

"CT" The FIV TM protein has a relatively long cytoplasmic tail (46 amino acids long). The truncation of this The tail in the "CT" clone caused a loss of infectivity of the virus in FeP2 cells. However, the truncation had no effect on the formation of virus particles and on the encapsidation of the viral genome and the RT protein. A specific functional interaction between the MA protein and the cytoplasmic tail of the TM protein has been published, both in FIV and in HIV-1. It has been suggested that this interaction is important for the incorporation of the ENV protein in virions. The truncation of the cytoplasmic domain in "the CT" can eliminate the functional interaction between the MA and TM proteins, which blocks the incorporation of the ENV protein. "of the MA" The MA protein contains a deletion of 41 amino acids from the rest 85 to 125 of the C-terminal portion of the MA protein. After transfection into CRFK cells, the clone produced defective viruses at a level comparable to that produced using the wild type FIV-141 clone. This indicates that the deletion of the domain of the C-terminal portion does not have a significant effect on the collection and release of virus practices. The viral genome with the suppressed gene and the RT protein were encapsidated in the defective virus particles. When these virus particles were released from transfected CRFK cells, they were not infectious with respect to FeP2 cells. "of CA" A deletion of 38 amino acids from residue 9 to 46 in the N-terminal potion of the CA protein abolished the formation of viral particles, as evidenced by a negative signal in the p26 ELISA assay, in the intravirionic RT-PCR assay and in the RT activity assay: However, the intracellular RT-PCR assay of transfected CRFK cells showed that the deletion does not block the expression of viral RNA. Therefore, the non-detection of the p26 protein or the non-production of defective viruses in the supernatants of transfected cells is due to the blocking of the assembly of viral particles, not to the expression of viral proteins. "of the NC" In the "NC" clone all the NC protein is deleted. Cells transfected with this clone produced defective viruses at a significantly reduced level, compared to that of the wild-type clone, which indicates that the deletion impaired the assembly or release of particles. It has been reported that the HIV-1 NC protein is not required for the assembly of virus-like particles. The deletion in the NC clone did not affect the encapsidation of the RT enzyme in defective virions. As expected, no viral genome was encapsidated in the viral particles. "del Vif". "del Vifc" v "del Vifn" Three deletion clones were constructed in the vif gene, namely "del Vifn", "del Vifc" and "del Vif": The clone "del Vifn" had a Deletion of 50 amino acids in the N-terminal portion of the Vif protein. The "Vifc" clone had a deletion of 146 amino acids in the C-terminal region of the almost whole Vif protein. The three clones exhibited similar properties. Cells transfected with any of the three clones produced viral particles at a level comparable to that of the wild type FIV-141 clone. In all three clones, both the viral genomes and the RT enzyme are encapsidated in virions. The virions released from cells transfected by the three clones were not infectious with respect to the FeP2 cells, which indicates that the Vif protein is required for the repiication of viruses in T lymphocytes. "of the ORF (2)" In the clone "of the ORF (2)" the entire open reading frame of ORF (2) is deleted. Cells transfected with the clone assembled and released viral particles at a level comparable to the wild-type clone. Although both the viral genome and the RT enzyme were encapsidated in the viral particles, the clone was not replicated in FeP2 cells, which suggests that the gene product of ORF (2) is required for virus production in these cells. "of the RRE" In "of the RRE" are deleted eighty four of the 150 total bases that constitute the sequence of the protein RRE of the FIV. This deletion severely impairs the expression of structural proteins and the production of viral particles in transfected cells. No production of p26 was detected in the supernatants of transfected CRFK cells. Similarly, the activity of non-encapsidated RT was measured. The results are in great agreement with the proposal that the RRE protein sequence is required for the export of excised single-stranded viral RNA and spliced from the nucleus to the cytoplasm of the cells. However, it was demonstrated by RT-PCR that the genomic RNA associated with virions was present and that the viral particles were infectious in FeP2 cells, although at a remarkably low level compared to that of the wild type FIV-141 clone. Taken as a whole, these results indicate that the deletion of the RRE protein sequence extraordinarily decreases the expression of viral proteins. However, it appears that the deletion did not completely abolish the expression and a trace amount of infectious virion particles was produced by the transfected cells. "from the IN" In the "IN" clone almost all the IN protein is suppressed. After transfection in CRFK cells, the clone exhibited a level of expression of Viral and viral particle production proteins comparable to that of the wild-type clone. The PCR-RT assays associated with virions and RT activity indicated that both viral genomic RNA and RT enzyme were encapsidated in viral particles. Surprisingly, the virions recovered from the cells transfected with the clone were infectious and could replicate in FeP2 cells, albeit at a reduced level compared to the wild-type virus. Integration is a required step required for a productive infection of a series of retroviruses, including HIV-1. The data suggest that the IN protein of RIV, unlike in HIV, may not be an obligatory requirement for the expression of viral proteins and viral replication in FeP2 cells.

"DU" In the clone "DU" almost all the DU gene is deleted. The product of this gene converts dUTP into dUMP. The deletion of the DU gene in the clone did not affect the expression of viral proteins or the production of viral particles in transfected CRFK cells. Both the viral genome and the RT enzyme were encapsidated and the virions produced from transfected cells were infectious for FeP2 cells. However, the deletion clone was replicated in FeP2 cells at a lower rate than the wild-type FIV-141 virus. This indicates that the DU gene is required for maximum replication of the virus. The data is in accordance with the reports of that the FIV with the suppressed DU protein retains its ability to propagate in T lymphocytes.

DEPOSIT OF BIOLOGICAL MATERIALS The following biological materials were deposited at the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, MD, 20852, USA, on July 1, 1998 and assigned the following registration numbers: ATCC registration number Cepa Viral FIV-141 VR-2619 Plasmid pFIV-141-B1 203001 All patents, patent applications and publications cited above are incorporated herein in their entirety as reference. The present invention is not limited in scope by the specific embodiments, which are intended to be simple illustrations of individual aspects of the invention. The functionally equivalent compositions and methods are within the scope of the invention.

LIST OF SEQUENCES < 1 10 > PFIZER PRODUCTS, INC. < 120 > Compositions and procedures to protect animals against diseases associated with lentiviruses, such as the feline immunodeficiency virus < 130 > PC10173A < 140 > To be assigned < 141 > 1999-08-23 < 150 > 60 / 097,645 < 151 > 1998-08-24 < 160 > 57 < 170 > Patentln Ver. 2.0 -beta < 210 > 1 < 21 1 > 9464 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 1 tggyatqatt r.ttgggat c Ugaagaaata gaaaaaatgc taatggactg aggacgtaca 60 taaaca >g acagatgyaa acagc gaat atgactcaat gctagcagct gcttaaccgc I2C aaaacc. ' a- cctaLgta & a gcttgccgat gacgtgtatc ttgctccatt ata = gag-at 180 • a aac.cagtg tLttgtaaaa gnttcgagga gtct t tgt lgaggyci.il cgayC ci: 240 cr.tgagg t- ccacagatac aataaaaaac ¡.yagctttga qattgaaccc tg cttqtat 300 otgtgtuatt tctcttacct cgaatccct ggagtccggg ccaggyac t gcagt ggc 360 gcccgaacag ggacttgaaa aggagtgatt agggaagtga agctagagca atarjaaaycL 420 gtcaagcaga actcctgcag gccttgtatg yggagcagtt gcagacgctg ctggcagtga ctag 480 gtatc Lggagcggac ctgagctctg yat-aagtca gcctagataa ctgctcacag agattatc 540 g gtgactcttc gcggatcgt-: aaaccagggg to tcgtcggg ggacagccaa 600 canggtagga Gagat CTAC agcaacatgg ggaatgqaca ggggcgagac tggaaaatcg 660 ccattaayag a- gtagtaat gttyctgtag gggtagggag caggagtaaa caatt ggag '20 aaggaaattt tagatgggcc ataaggatgg ctaatgtaac r.acngg.icg.i gaac tggr.g 780 aLataccagn gact tagaa cagctaagn. "caatcatttg tgacttacaa gacagaagag G40 aacaatatgg atc'.aqtaaa gaaat.tgaca tcgcaatta ca cLLaaaa and tL -. ^ yy 900 tsgr-.aggaat tctaaafcatg actgtaac a ctgccacagc agctgaaaat atgtatgctc 960 agat gggatt agacaccaga ccatctaLaa aagaaagtgg gggaaaagaa gaaggacctc 1020 ca.caggc > .ta tcetattcaa qagcaccaca acagtaaatg guatgtagcc ctt.cjai.ccaa 1080 TATTT aaatggtgtc TATG gagaaggcaa qagaygggct agyaggtgaa gaagt.ccaac V.40 tgtggtttac ayccttttca gctaa-ttaa catcaactga tatggctaca gt t.taatt.a 1200 ctgg ccgca ct.gtgcagca gataaagaaa zcctagatga aacac gaaa cagatgacag 1260 ctgagtatya rcgtacccat cctccLgatg ggcctagacc gctgccctat ttcactgccg 1320 cagaqatcat ggggatagga ttgactcaag aacaacaagc agaa or agg t.tf gcc cag 1380 ccagaatgca gtgtagag a Lggtatcttg aa catr.agg aaagctagc gccataaaag 1440? 'iijaatctc; ctrt.¿; c¿at ..? caattgcag agggagc-.aa a? aggacta t'CL a Ci. 11.00 caqatagict att: t gct caá at-.ngatcd.aq agongaaca aq tgaggta í? Qcz'j-. . t f. 15 R? aaai'aaT. ttLynC face q raaa t gcta c aco-.rg taagagagca aUyaqt itc 1 '.taaaccaga < iagC.ct-.fa gaagagaaac tgag gcctg caggaaata jgatcgccog l '?' dC gata í-aaa gcaactaztg gaagaggcrc Ltacteggg scaaaca tl caagcaaaag 4 C qacca.-ggci.- aqta gpttc aattgtaaaa e.-iocaggaca cctgqccaga caatgtag / jc: OC aageaaagag aty ' -aaraaa tgtggaaaac ctggtcactt agctg aac tqttqgcaaq 136C gagylaaaaa gtccccggga aacgggg ga iggggcgagc tqcagcc ca gLaaaL aag 152C tgcágcnagt yataccnr. t gcacccccgg tagaggagaa aLtgttayat atgtaaacta 1980 taataaagtg ggtaccacca caactttaya aaaaagacct gaaa acaaa? .át.icgt.aaa 2040 - tgggtatcct ataaaat.ttt Lattagatac aggagcagau ataacaattt taaacagaaa 2100 agactttcag atacg aatr. ctatagaaaa tgggaaacag aatatgat-tg gagcaggagg 2160 cggaaagaga gcasca? att atatcaatg. ycatttagaa attagagatg aaaattataa 2220 gacacagtgt atatttggaa atgtgUgtgt cttggaggat aattcaf.aa tacaaccatt 2280 attgyy¿aga gatsacaLga ttaagttcaa cataaggttg gtaatggctc aaatttcaga 2340 gaaa & ttcca a ' "agtaaaag taagaatgaa agscccr.act caagyg TC- aggtaaaaca 24 0 atgyccatta tcaáatgaga aanttgaagc tctaactgac ogtaaaca ggttagaaoa 2460 agagggnaag g ^ aaaaagag ctgatccaaa taatccttgg aacactcccg tatttgcaat 2520 caagaaaaag aatggtaaat ggagaatgcc catagattt "agggtcctaa ataa LUaa 2560 aqacaaaggg gcagaagtl.c: ag taggact c.: l.oatcc: gctggattac attqa = aaa 2640 acaaqtaacr. gtaLL gaca zaggggacgc atattttact attcctctag atc dgatL? 2700 tgctccttat actgcatLLa cactacctag aaddaacaat gcaggaccog ggaggagata 2760 caLatggtgt agtlLaccac aagggtyygt cttgagtcca ttgatatatc dgaguaccti 2820 agacaaLata ctccaa Clt ttattaaaca caatcctgaq ttagatatt atcaatatat 2880 ggatq ta c tatalaqgat caaatt aay taaaaaggaa ontaaacLaa aagtagaaya 2S4C attaagaaaa r.tgttaLUat ggtggggatt Lgaaaccccg gaagataaat tacaagaaga 3C0C gcccccc at aagtggatgg GCTA gaatt aeatccal.La acgtggt aa tacagcaaaa 3360 gcadUtagaa attccagaqa gn ccacatt aaatgaatta cagaaottag caggtaagat 3120 taactyygct aaa agt to ttccagactt gagcataaaa AAAC aacta atafgnrgag 31R0 asgaqatca- aagtlagact caataagaga atgqacgaca atgaagtgga gaggccaaga 3240 gaaagctaag agagcaatug aqacacaggc ACAG tattatgatc c ^ Tagga aatcgaga 3300 Ldtatgct aaa ttgtggga uaotc acatcaacta c agctatcagg tgtatcataa 3360 cngntattaL aaacccagaa aatgaauagg ggtatgggaa cagaagaaar. aagcagnaaa 3420 atagctctaa tacttgtgaL gggcatgtta caaaataaga ATCCA Gaag ttataagaat 34S0 -aggaaaagaa ccagtatatg aaatacctac atccagayaa gcttgggaa ca-.o ctaat 2540 tagazctcca tatcttaagg cclcaccacc tgaggtggaa tuLatacatq ctgcct aaa 3600 gcrctaagca tataaaaaga tgatacnaga tgcccetata ttgggagcag aaacatggta 3660 catagatggg ggaagaaaac aaggaaaagc ogcaagagca c ', Uattgga cagatacggg 3 ~? N cagatgycag gtaatggaaa tagaaggaag taaicaaaaa gcagaagtac; .lagctttatt 3780 attggcccta caggcaggac cagaggaaat gaatattata acagattcac aatatattgt 3840 gaa :: att £ tt: aLcaacaac cag? C tgat ggaagqnatt tggcaayaac Lctwgaaja 3910 aatggaaaag aaagtagcaa Lctttatagn ttgggtaccL gqacataaa rtattccagg 39G0 aaataaagag guagatgaac tttglcaaac gatgatggtt atagaaggtg aaggaatatt 4020 tcagaagatg agataaaaga caggatatga tttattagct qcacaagaaa tor.ofctctt 4080 gcctggggag ylaagag ag tac aacaag aacaaagata dtgtldce-to aaggatattg 4140 atgggaaaaa gggattaata gttcaatggg aagcaaagga ttagatgtat aggaggagt 420C tatagatgaa ggatatagag gayaattagg ggtgataatg dttaacctat ctaaaaaatc 4260 aataacatta cagaaaaac aaaaa? tagc acaattaata atattacclL yLaaacatqa 4J2Ü aagctta aa aaqgagaaa taataatgga ttcagaaaga ggaagaaagg gatttg? gtc 4330 aactygagtc ttttcLtcat gggtgga ag aattgaggaa gcagaat cd atcatgaaaa 4440 attt ^ < .? ct.-a gaccca aat acttaagaa doddl l l rfrfl < : t. < ? .cagac. taqtagcaga 4500 and jajdLaaaa ngaaaatgtc ccttatytaq aatcagasgg gaacaaqtd-- t-guyacaati '560 aiagatl'jya cctg ^ c-n r.t gg-.naatgga ctgtacaca t-aatyjaa aas aa- ^ C 462; LgLcccagtg catgtggaat cag? ttatt atgggcacag gcaartcca .: aggagacrgc 468C agattylaca gttaaagctc tcatgcaact tatcagtgct cataaty.ta -agaactaca 47'0 dicacataat ggaccaaatL Ltaaaaatca gaaaatggaa ggactac aa atta atggg &0U cs.taddc.cac aaatt ggt.a taccaggtaa cccacaatca caagcat - '. ay Lagaada gc 4PCC taacca ara L-aaaatctt atttctctca ggattcaaaa gaaacttctt ctttggacaa 4921 cgcattggcc ctagccttat actgcctcaa ttttaaacaa aggggtagac Lagggag = ai 4981 gg tccttat gaattataca atcattaaga tacaacagga atttttcaca atacaagact 5o4- aat ccacaa oaattaatga tgcaatgggt gtattataaa gatcagaaag ataaaaagtg S10C gaaggga-ca to gagagtag aatattgggg acaaggatca gUaCattaa agaatgaaga 516T, gaaqggata-; t tcttgtac ctaggagaca cataagaaga gtcccagaac cctgcactct 522C tcctgaaggg gatgagtgac gaagattggc aggtaagtag aagactcttt gcagtt aka 5280 aaggaggagt aaatagtgcc otgttataca tatcgaattt acctgaaaca gaacaggcac 534G aatataaaaa qqactttaag aaaaggctct Lagaaaagga gactggattc atcLaLayat 540C taagaaaagc tgaaggaata aggtggagct ttcatacgcg tgattattat ataggatatg 5463 taagauagat ggtggctggg tctagcctac aaaatagttt aagattgtaL and LLLatataa 5520 gcaatccatt and; qqcatcag tcataccgtc ctggcctgac aaattttaat acagagtggc 5580 cttLLgtaaa tatgtggata aagacaggat ttatqtqgga tgatattgaa agccaaaata 5640 tttgcaaagg aqgagagatc tcacatggat ggggacctgg aatggtggga attgtgataa 5700 aagparttag -gtggagaa aggaagatac aaattactcc tgtcatgatt. atnagaggtg 5 / 6U agatagaccc acagaaatgg tgtggagatt yUUggaaUct catgtgwctt aaatattcar 5820 ttcsaaatac attgcaqagg c tgctatgc tggcgtgtgg caaagaggct a.iagaatgga 58S0 gaggctqtLg taatcagcg frtgtttctc ctutcagaac dccctytyat tagaggtcg 5940 tccagaacaa ycctaaaagg aatttattgt ggacgggaga attatgaatg gaagaaataa 6000 tcccactgtt taataaggt.L acagaaaagt tagatagaga agcagctatt agattgttta 6060 tttagctta t aggtagac agatgcagat ttattagaat tttacaat to ttactttgga 6120 gagatagnt.- taagtcaatc aattctaaat attgtttatg ctggctgtgc cgcaagtctg 6180 ctt.nttggcg c-.Ugcaatct acattatcca taaatactgc ctagaaatat tttaat ttc 6240 atttcatctg cagatataaa ggaggattta catggcagag ctoaaaatca acaatggata 6300 AAQC gggccagaay gaaga attgttagat tttgatatag ctgtecaaat gaatgaaga > - 6360 ggtccattaa to caggagt aaacccattt agggtaccag gaattacctc tcaagaaaag 6420 yatgattatt gtcagatt t acaaccaaaa ctacaagaat taaagaatga aatcaaagag 648C gtaaaacttg acgaaa & caa tgcaggtaag tttagaaagg cangatatt aagatottct 654C gatgagagtg tactaactat ag ctattta ctaacaggat atttgagata tttaataagc 6600 catagaaac taggatcutt aagacatgat atagatatag aagcaccaca acaagagcac 6660 tataatgata sngaaaaggg tactacttta aatataaagt atgggagaag atqttg-att 6720 agcacattac ttctatattt aatcctcrtc tcagggatag gaatttggct t.ggaaccaaa 6780 gcacaagtag tgtggayact ccctccttta gtagtgccag tagatgagac agaaataata 6840 tttLgggatt gttgggcgcc agaggaacca gcctgtcaag attttctggg aacaatgata 6900 catttoaaag caaatgttaa tataagtata caagaaggac ctacnttggg aaottgggca 6960 agggaaattt ggtctacatt aLLtaaaaaa gctacaaggc aatgcagaag gggaaggata 7020 tgqaagaaat ggaatgagac tataacagga cctaaaggat gtgcaaataa tacctgttat 7080 aata.Utcaq tagtggtacc tgattatcaa tgttatgtag acagagtaga racatgqctg 7110 caaggaaaag ttaatatctc actatgtttg acaggaggaa agatgctata taataaaaat 72 00 acaaaacaat taagttactg tacagatcca Utacaaatac cattaattaa tacacattt 7260 ggacctaacc aaacttgtat g ggaacaca tctttaatca aagaccctga gataccgaaa 7320. tgtggatgyt ggaaccaggc agcctatuau aataattgta aatgggaaga aqctaatqtg 7330 acatttcaat "gCTcaaagatc acaaagtc a ccaggat a". ygyLLdgyag aaLetctt to 7440 tgg «j'j aaa gaaacagatp gg.Hytggagg agactttg aaagugagaa.'í.gtaaamt? 75QC tcattacasr gtaaLaq tac aasasn-tL acttttgcr.a tgagaagr.ts -agtga -d-- 756C rntg? L.-C aaggag ~ atu yd aaat.t ggatqttata gaaatsaatc 762C d yyjagcaa attíaqaat aagn gtaaa tggaet.gn.-g gaaagaat t -.tcL ^ t '. 7680 gataca ytq ggacta LLc aaatgtgaca ggayccaacc ctgtagattg tactatgaaa 7740 d aaacac'-a tgtacaattg ttcx'.Lacaa qata t-.t.ci cuatgaaaat gaggaccui 730C atty_a < - &at t aataLgac aaaagcngtc yaaa-qrata atattg r.gg gaattgg ct 736"tqtacatc-_g < = t taccaa dgggzgggqa ta atgaaat qtaattgtac oaatgccact / 921 gaLgqggaga ataaaatgaa atgccctagy aarcagggra rrttaagaaa ctggtacaa 798: cag-.tycag ga taaga a agctctt .-rtg aaytaUcaaa tagtaaaacn nccagapr.nt 8041 LLgq-ggtac cggaaqaagt r.atga yLat aaaggtaaa aaaaaaggg g taLLcat 8100 attaugttag cccttgcCac ggtgt.tatct atagctggag caggnar: gg gccactg t 8160 aLcqg -at-yg -gacacacta t.cagcaagtt ttggctacc: atcagcaggc attggacaaa 8220 'ataa tgagg cactgaaaat aggttaatca aaacaactta r.waagtatta ctttagaaca 8280 gtgatagggt -aaaag aga gyctatagaa isattcctat aLacagcttt tgctatgcaa gaatt 8340 & gqat gtaatcagaa tcaattcttt tgtaagattc ccc caatct gtggacaa 8400 g ta-aacatya ctataaatca Lacacta gg aatcatggaa d-ataacttt gggagaatgg 846U tataatcaaa caaaaagttt aceagaaaaa ULtatgaga taattatgga r. atagaacaa 8520 aataatyUac aagggaaaaa tqqaa acaa caattacaaa aatqggaaaa ttgggtggga 8580 tggatagg ti aaatccctca atfiULtaaaa ggacttcrtg g-sgt. -_gtL. gggaatagga 8640 ctaggaatcr cta tac U tatatgcttg CCTA Altag taqattgtat dagaaactgt 8700 tattgcgata actcaraaad gcaatgcctg acagttatt aaatagatga tqagqaaqta 8760 cacccdt tggaattgag aq gaqaaatggc aggcadUyLg gcatatctga aaaagagcag 6820 gcatttcaga qaatgatgga cctgtacaat acaggagtaa tgctyaycty agttcttccc 8880 tr.tgaggaqq to gtgtcata • .gaatccatt. tcaaatcdda aataacagta aaatctatat 8940 acgaaaaaga tgtaaggcaa caacgcagaa gaagaaagaa gaaggccutc aaaaaattga 9000 tgc ggattt agaggctcga tttaaaycgt tgtttgaaac accttcagct acagaatata 9060 ct.gcaga and qacagaagaa yagactcttg niaaagaaaa aagygtggac tqqqaagatt 9120 attgggatcc tgaagaaata gaaaaaatqe taatggtct.g aggacgtac-to tddd dd Lg 9180 acagctgaal ncagatggaa atqactcaa gctagcagct. geztaaccg saaaccacat 9240 cctat.g-aaa gcttgccgr.t gacgtgtatc ttgctccatt ataagagtat atddccagug 9300 ttttgtaaaa gctr.cgagga g ctctctgt. tgagggcLtt cgagttctcc cttgaggctc 9360 ccacagatac aataaaßaac tgagctttga cattgaaccc tgtcttgtat ctgtgUadtt 9420 L tcttacct gsgaatccct ggagtccggg c agggacct cgca 9464 < 210 > 2 < 211 > 30 < 212 > Dna < 213 > Feline immunodeficiency virus < 400 > 2 ccgcaaaacc acatcctatg taaagcttgc 30 < 210 > 3 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 3 cgcccctgtc cattccccat gttgctgtag 30 < 210 > 4 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 4 ttactgtttg aataggatat gcctgtggag 30 < 210 > 5 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 5 gcaatgtggc atgtctgaaa aagaggagga 30 < 210 > 6 < 211 > 34 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 6 tcttcccttt gaggaagata tgtcatatga atcc 34 < 210 > 7 < 211 > 26 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 7 tctgtgggag cctcaaggga gaactc 26 < 210 > 8 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 8 acaaacagat aatggaccaa attttaaaaa 30 < 210 > 9 < 211 > 28 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 9 tttcaatatc atcccacata aatcctgt 28 < 210 > 10 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 10 ttaaaggatg aagagaaggg atattttctt 30 < 210 > 11 < 211 > 30 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 11 tgggaagatt attgggatcc tgaagaaata 30 < 210 > 12 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 12 catatcctat ataataatca cgcgtatgaa agctccacct 40 < 210 > 13 < 211 > 24 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 13 tgcgaggtcc ctggcccgga ctcc 24 < 210 > 14 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 14 aggtggagct ttcatacgcg tgattattat ataggatatg 40 < 210 > 15 < 21 1 > 29 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 15 ctccagggat tcgcaggtaa gagaaatta 29 < 210 > 16 < 211 > 49 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 16 ttacaagaat tcaactgcag tgggaagatt attgggatcc tgaagaaat 49 < 210 > 17 < 21 1 > 42 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 17 ttcaaggagc tctttagtcg acaactgcga ggtccctggc cc 42 < 210 > 18 < 211 > 53 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 18 gattcgtcgg gggacagcca acaaggtagg agagattcta cagcaacatg ggg 53 < 210 > 19 < 211 > 42 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 19 tcaatatatg gatgatatct atataggatc aaatttaagt aa 42 < 210 > 20 < 211 > 58 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 20 gtgatatagc tctaagggca tgttacaaaa taagagaaga atccattata agaatagg 58 < 210 > 21 < 211 > 46 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 21 cgggcagatg gcaggtaatg gaaatagaag gaagtaatca aaagc 46 < 210 > 22 < 211 > 44 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 22 agaaagggat ttgggtcaac tggagtcttt tcttcatggg tgga 44 < 210 > 23 < 211 > 51 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 23 ggggacaat taaagattgg acctggcata tggcaaatgg actgtacaca c 51 < 210 > 24 < 211 > 49 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 24 ggctccttat gaattataca tacaacagga atcattaaga atacaagac 49 < 210 > 25 < 211 > 36 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 25 caaaatagtt taagattgta tgtttatata agcaat 36 < 210 > 26 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 26 cagaaaagtt agatagagaa gcgctatta gattgtttat 40 < 210 > 27 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 27 taaaagcaaa tgttaatata agtatacaag aaggacctac 40 < 210 > 28 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 28 aaagctaca aggcaatgca gaaggggaag gatatggaag 40 < 210 > 29 < 211 > 44 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 29 agaggacctt attgtacaat ttaatatgac aaaagcgtg gaaa 44 < 210 > 30 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 30 ccctcaatct gtggacaatg tataacatga ctataaatca 10 < 210 > 31 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 31 gacaacgcag aagaagaaag aagaaggcct tcaaaaaatt 40 < 210 > 32 < 211 > 50 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 32 aglaaagaaa ttgacatggc gattactagt ttaaaagttt ttgcagtggc 50 < 210 > 33 < 211 > 47 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 33 ccatctataa aagaaagtgg gactagtgaa gaaggacctc cacaggc 47 < 210 > 34 < 211 > 51 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 34 attcaaacag taaatggagc aactagttat gtagcccttg atccaaaaat g 51 < 210 > 35 < 211 > 51 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 35 acagcctttt cagctaattt aactagtact gatatggcta cattaattat g 51 < 210 > 36 < 211 > 50 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 36 actatagtct atttactaac tggttacctg agatatttaa taagccatag 50 < 210 > 37 < 211 > 54 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 37 tacttatatg cttgcctaca ttgggttacc gtataagaaa ctgtactaat aaaa 54 < 210 > 38 < 211 > 54 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 38 gaggtataaa ggtaaacaaa aaactagtgc cattcatatt atgttagccc ttgc 54 < 210 > 39 < 211 > 58 < 212 > DNA < 2 3 > Feline immunodeficiency virus < 400 > 39 actaactata gtctatttac taacaactag tttgagtat ttaataagcc atagaaac 58 < 210 > 40 < 211 > 62 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 40 ataccgaaat gtggatggtg gaatcaggca tgctattata ataattgtaa atgggaagaa 60 ge 62 < 210 > 41 < 211 > 58 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 41 gcactatgta caattgttcc ttacaggcat gcttcactat gaaaatagag gaccttat 58 < 210 > 42 < 211 > 56 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 42 gaatcaattc ttttgtaaga tcgcatgcaa tctgtggaca atgtataaca tgacta 56 < 210 > 43 < 211 > 61 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 43 gggaaaattg ggtgggatgg ataggtaaga tcgcatgcta tttaaaagga cttcttggta 60 g 61 < 210 > 44 < 211 > 40 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 44 ggaagaagtt atgaggtata ccggtaaaca aaaaagggcc 40 < 210 > 45 < 21 1 > 62 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 45 ctacttatat gcttgcctac attggtcgac tgatagtgaa actgtactaa taaaatattg 60 99 62 < 210 > 46 < 211 > 56 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 46 gatggttata gaaggtgaag gaattactag taaaagatca gaagatgcag gatatg 56 < 210 > 47 < 211 > 59 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 47 gaaataataa tggattcaga aagaggaact agtggatttg ggtcaactgg agtcttttc 59 < 210 > 48 < 211 > 57 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 48 cttcatgggt ggacagaatt gaaactagtg tattaaatca tgaaaaattt cactcag 57 < 210 > 49 < 211 > 59 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 49 gcaatgggtg tattataaag atcagactag taaaagtgg aagggaccaa tgagagtag 59 < 210 > 50 < 211 > 57 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 50 agaagactct ttgcagttct ccaatgaacg cgttagagtg ccatgttata catatcg 57 < 210 > 51 < 211 > 44 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 51 cgtgtggcaa agaggctaaa acgcgtagag gctgttgttaa tcag 44 < 210 > 52 < 211 > 56 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 52 gtggacggga gaattatgaa cgcgtgaact aatcccactg tttaataagg ttacag 56 < 210 > 53 < 211 > 55 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 53 ctacattatc cataaatact gcctagcgc atttcttata atatttcatc tgcag 55 < 210 > 54 < 211 > 54 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 54 ggcatatctg aaaaagagga ggaatgaact agtatatcag acctgtagaa taca 54 < 210 > 55 < 211 > 59 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 55 gaggaggatg tgtcatatga atcaaatact agtcaaaaat aacagtaaaa tctatattg 59 < 210 > 56 < 211 > 22 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 56 tattatggtg gggatttgaa ac 22 < 210 > 57 < 211 > 22 < 212 > DNA < 213 > Feline immunodeficiency virus < 400 > 57 taattagatt tgattcccag ge 22

Claims (82)

NOVELTY OF THE INVENTION CLAIMS

1. - The substantially purified FIV-141 virus, wherein said virus has a genomic nucleic acid sequence corresponding to SEQ ID N.

2. A host cell infected with the virus according to claim 1.

3. The virus descendant of FIV-141, produced in the host cell according to claim 2.

4.- A method of inducing the production of antibodies to FIV-141, which comprises infecting an animal with the virus according to claim 1.

5. The method according to claim 4, wherein said virus is inactivated before inoculation.

6. A method of inducing the production of antibodies against FIV-141, which comprises infecting an animal with the host cell according to claim 2.

7. The method according to claim 6, wherein said cell is fixed before infection.

8. The method according to any one of claims 4-7, further comprising isolating said antibodies from said animal.

9. An antibody produced by the method according to any one of claims 4-7.

10. A vaccine of complete viruses, comprising the FIV-141 virus according to claim 1, wherein said virus has been inactivated. 1.

A vaccine of fixed cells, comprising a host cell infected with the virus according to claim 1, wherein said host cell has been fixed.

12. A method of inducing an immune response in a cat, comprising administering the vaccine according to claim 10 or claim 1 to said cat at a dosage sufficient to induce protective immunity against subsequent infection by the IVF-141. .

13. A substantially purified nucleic acid molecule having a sequence corresponding to SEQ ID No. 1.

14. The nucleic acid molecule according to claim 13, wherein said nucleic acid is DNA.

15. A host cell transfected with the nucleic acid according to claim 13.

16. The virus descendant of FIV, produced by the host cell according to claim 15.

17. - A method of inducing the production of antibodies against FIV-141 in an animal, comprising injecting said animal with the nucleic acid molecule according to claim 13.

18.- A method of inducing the production of antibodies in an animal , which comprises infecting said animal with the host cell according to claim 15.

19. The method according to claim 18, wherein said host cell is fixed before infection.

20. The method according to any one of claims 17-19, further comprising isolating said antibodies from said animal.

21. An antibody produced by the method according to any one of claims 17-19.

22. A fixed cell vaccine, comprising a host cell transfected with the nucleic acid according to claim 13, wherein said host cell has been fixed.

23. A method of inducing an immune response in a cat, comprising administering the vaccine according to claim 22 to said cat at a dosage sufficient to induce protective immunity against subsequent infection by FIV-141.

24.- An attenuated FIV-141 virus that replicates after entering a host cell but exhibits significantly reduced infectivity towards feline T lymphocytes compared to that of the wild type virus, in which the cited attenuated virus is produced by mutating a gene in the FIV-141 genome selected from the group consisting of Vif, MA, ORF (2), ENV, CA, NC, SU, TMf, CT, IN, DU, V3-4, V7 / 8 and RRE.

25. The attenuated FIV-141 virus according to claim 24, wherein said gene is selected from the group consisting of Vif, MA, ORF (2) and ENV.

26. A host cell transfected with the attenuated virus according to claim 24.

27.- The attenuated FIV-141 virus produced in the host cell according to claim 26.

28.- The process of inducing the production of antibodies against FIV-141, which comprises infecting an animal with the attenuated FIV-141 virus according to claim 24.

29. The method according to claim 28 wherein said attenuated FIV-141 virus is inactivated before the infection.

30. A method of inducing the production of antibodies against FIV-141, which comprises infecting an animal with the host cell according to claim 26.

31.- The method according to claim 30, wherein said Host cell is fixed before infection.

32. The method according to any one of claims 28-31, further comprising purifying said antibodies from said animal.

33. An antibody produced by the method according to any one of claims 28-31.

34. A vaccine of attenuated complete viruses, comprising the virus according to claim 24 or claim 25.

35.- A method of inducing an immune response in a cat, comprising administering the vaccine according to claim 34 to said cat at a sufficient dosage to induce protective immunity against subsequent infection by IVF-141.

36.- A vaccine of attenuated host cells, comprising the host cell according to claim 26.

37.- A vaccine of attenuated host cells, comprising a host cell infected with the virus according to claim 25.

38. A method of inducing a immune response in a cat, comprising administering the vaccine according to claim 36 or claim 37 to said cat at a dosage sufficient to induce protective immunity against a subsequent infection by FIV-141.

39.- A nucleic acid molecule substantially purified from FIV-141, having a sequence corresponding to SEQ ID No. 1, but in which said nucleic acid molecule is mutated in a gene selected from the group formed by Vif, MA, CA, NC, SU, TMf, ORF (2), CT, ENV, Vifn, Vifc, IN, DU, V3 / 4, V7 / 8 and RRE, and in which the mutated molecule, after its introduction in a host cell, produces a virus that replicates but has significantly reduced infectivity in cells peripheral blood mononucleases with respect to the wild-type IVF-141.

40. The nucleic acid molecule according to claim 39, wherein said gene is selected from the group consisting of MA, Vif, ORF (2) and ENV.

41. The nucleic acid molecule according to claim 39 or claim 40, wherein said nucleic acid is DNA.

42.- A host cell transfected with the nucleic acid molecule according to claim 39.

43.- A virus descendant of FIV-141, produced by the host cell according to claim 42.

44.- A method of inducing the production of antibodies against FIV-141 in an animal, which comprises injecting said animal with said nucleic acid molecule according to claim 39.

45.- A method of inducing the production of antibodies against FIV-141 in a animal, which comprises injecting said animal with the host cell according to claim 42.

46. The method according to claim 45, wherein said host cell is fixed before infection.

47. The method according to any of claims 44-46, further comprising isolating said antibodies from said animal.

48. An antibody produced by the method according to any one of claims 44-46.

49. A vaccine comprising the nucleic acid molecule according to claim 39 at a concentration sufficient to induce immunity when administered to a cat.

50.- The vaccine according to claim 49, wherein said nucleic acid is DNA.

51. A vaccine comprising a host cell transfected with the nucleic acid molecule according to claim 39.

52. The vaccine according to claim 51, wherein said host cell has been fixed.

53. A method of inducing a immune response in a cat, comprising administering the vaccine according to any one of claims 49-52 to said cat at a dosage sufficient to induce protective immunity against subsequent infection by the FIV- 141.

54. A method of making an attenuated lentivirus that replicates in host cells but has significantly reduced infectivity with respect to its wild-type analogue, said method comprising mutating one or more genes selected from the group consisting of MA, CA, NC , DU, ENV, SU, TMf, CT, V3 / 4, V7 / 8, Vif, Cifn, Vifc, IN, RRE, and ORF (2).

55. - The method according to claim 54, wherein said gene is selected from the group consisting of MA, ORF (2) and ENV.

56.- The method according to claim 54 or claim 55, wherein said lentivirus is a strain of FIV.

57.- The attenuated lentivirus produced by the method according to claim 54 or claim 55.

58.- A host cell infected with the attenuated virus according to claim 57.

59.- A method of inducing the production of antibodies against a lentivirus, which comprises infecting a mammal with the attenuated virus according to claim 57.

60.- A method of inducing the production of antibodies against a lentivirus, which comprises infecting a mammal with the host cell according to the invention. Claim 58.

61. The method according to claim 60, further comprising purifying said antibodies from said mammal.

62.- An antibody produced by the method according to claim 59 or claim 60.

63.- A method of treating a mammal infected by a lentivirus, comprising administering the antibody according to claim 62 to said mammal at a dosage sufficient to reduce one or more associated symptoms, with the aforementioned infection.

64. - A complete attenuated virus vaccine, comprising the virus according to claim 54 or 55.

65.- A method of inducing an immune response in a mammal, comprising administering the vaccine according to claim 64 to said mammal at a sufficient dosage to induce protective immunity against a subsequent infection by at least one strain of said antivirus.

66.- A vaccine of attenuated host cells, comprising a host cell infected with the lentivirus according to claim 58.

67.- A method of inducing an immune response in a mammal, comprising administering the vaccine according to the invention. Claim 66 to said mammal at a dosage sufficient to induce protective immunity against a subsequent infection by at least one strain of said lentivirus.

68.- A method of producing a nucleic acid suitable for use in a vaccine against a lentivirus infection, comprising: a) reverse transcribing genomic RNA of said lentivirus, b) cloning the reverse transcribed RNA of step a), c) mutating a gene in the cloned nucleic acid of step b), wherein said gene is selected from the group consisting of MA, CA, NC, SU, TMf, ORF (2), CT, ENV, V3 / 4, V7 / 8, Vif, Vifn, Vifc, IN, DU, and RRE, d) clone the mutated nucleic acid of step c).

69. The method according to claim 68, wherein the fined molecule, after its introduction into a host cell, produces an attenuated virus that replicates but has significantly reduced effectiveness with respect to that of the lentivirus produced from the nucleic acid of wild type, not mutated.

70. The method according to claim 69, wherein said lentivirus is a strain of FIV and said attenuated virus replicates but has a significantly reduced effect on feline T lymphocytes compared to that of FIV produced from the acid. wild-type nucleic, not mutated.

71.- The method according to claim 69 or 70, wherein said gene is selected from the group consisting of MA, ORF (2) and ENV.

72.- A host cell transfected with the nucleic acid molecule according to claim 71.

73.-The descendant lentivirus produced by the host cell according to claim 72.

74.- A method of inducing the production of antibodies against the host cell. to at least one lentivirus strain, comprising injecting said animal with the nucleic acid molecule according to claim 68.

75.- An antibody produced by the method according to claim 74.

76. - A vaccine comprising the nucleic acid molecule according to claim 69 at a concentration sufficient to induce immunity when administered to a mammal.

77. A method of inducing an immune response in a mammal, comprising administering the vaccine according to claim 76 to said mammal at a dosage sufficient to induce protective immunity against subsequent infection by said lentivirus.

78. A vaccine comprising the nucleic acid molecule according to claim 70 at a concentration sufficient to induce immunity when administered to a cat.

79. A method of inducing an immune response in a cat, comprising administering the vaccine according to claim 78 to said cat at a dosage sufficient to induce protective immunity against a subsequent infection by at least one FIV strain.

80.- A vaccine comprising the host cell according to claim 72.

81.- A method of inducing an immune response in a mammal, comprising administering the vaccine according to claim 80 to said mammal at a sufficient dose. to induce protective immunity against a subsequent infection by said lentivirus.

82. The method according to claim 81, wherein said mammal is a cat, said lentivirus is a strain of the IVF and the said vaccine is administered at a sufficient dose to induce protective immunity against subsequent re-ingestion by at least one FIV strain. 83.- A strain of the feline immunodeficiency virus having the registration number ATCC VR-2619 and the descendant viruses prepared therefrom. 84.- A plasmid designated pFIV-141-B1 and having the registration number ATCC 203001.