MXPA99007477A - Leishmania - Google Patents

Abstract

Compositions and methods for preventing, treating and detecting leishmaniasis and stimulating immune responses in patients are disclosed. The compounds provided include polypeptides that contain at least an immunogenic portion of one or more Leishmania antigens, or a variant thereof. Vaccines and pharmaceutical compositions comprising such polypeptides, or DNA molecules encoding such polypeptides, are also provided and may be used, for example, for the prevention and therapy of leishmaniasis, as well as for the detection of Leishmania infection.

Claims (7)

1. PCT WORLD INTELLECTUAL PROPERTY ORGANIZATION Intematíonal Bureau INTERNAL? ONAL APPLIED? PUBLISHED UNDER THE PATENT COOPERA? ON TREATY (PCT) (51) International Patent Class? Fication 6: (11) International Publication Number: WO 98/35045 C12N 15/30, C07K 14/44, C12N 15/63, A2 5 10, A61K 39/008, 48/00 (43) International Publication Date: 13 August 1998 (13.08.98) (21) International Application Number: PCT / US98 / 03O02 (81) Designated States: BR, MX, European patent (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, BE, IT, LU , MC, NL, PT, (22) International Filing Date: 12 February 1998 (12.02.98) SE). (30) Priority Data: Published 08 / 798,841 12 February 1997 (12.02.97) US Without international search report and to be republished 08 / 920,609 27 August 1997 (27.08.97) US upon receipt of that report. (71) Applicant: CORIXA CORPORATION [US / US]; Suite 200, 1124 Columbia Street, Seattle, WA 98104 (US). (72) Inventors: REED, Steven, G .; 2843 122n Place N.E., Bellevue, WA 98005 (US). CAMPOS-NETO, Antonio; 9308 Midship Court NJE., Bainbridge Island, WA 98110 (US). WEBB, John, R .; 15314 Silverfirs Drive, Everett, WA 98208 (US). DILLON, Davin, C; 21607 N.E. 24th Street, Redmond, WA 98053 (US). SKEIKY, Yasir, A .; 8327 - 25th Avenue N.W., Seattle, WA 98107 (US). (74) Agents: MA I, David, J. et al .; Seed and Berry LLP, 6300 Columbia Center, 701 Fifth Avenue, Seattle, WA 98104-7092 (US). (54) Title: LEISHMANIA ANTTGENS FOR USE IN THE THERAPY AND DIAGNOSIS OF LEISHMANIASIS (57) Abstract Protection agaput inftctioi. witíi L. better _? BAl_l c mk___tpm_zed Compositions and methods for prevent- l__h__u_ 1 _ ~ - Iga -. ing, treating and detecting leishmaniasis and stimulating immune responses in patients are disclosed. The compounds provided include polypeptides that contain at least one immuno-genic portion of one or more Leishmania anti-geps, or a variant thereof. Vaccines and pharmaceutical compositions including such Ula. polypeptides, or DNA molecules encoding such polypeptides, are also provided and may be used, for example, for the prevention and therapy of leishmaniasis, as well as for the case of Ldp 23 -_-_: + MI J / G p tection of Leishmania infection. ftwaaja | ot < IBGTTITÍ ptottic? / Cp? Fffl-p W «t s after In / ectlop ANTIGENS OF LEISHMANIA TO BE USED IN THERAPY AND DIAGNOSIS OF LEISHMANIASIS REFERENCE TO RELATED REQUESTS TECHNICAL FIELD The present invention relates generally to compositions and methods for preventing, treating and detecting leishmaniasis and for stimulating patient immune responses. The invention relates more particularly to polypeptides comprising an immunogenic portion of a Leishmania antigen or a variant thereof and to vaccines and pharmaceutical compositions comprising one or more of said polypeptides. Vaccines and pharmaceutical compositions can be used, for example, for the prevention and therapy of leishmaniasis, as well as for the detection of Leishmania infection. BACKGROUND OF THE INVENTION Leishmania organisms are intracellular protozoan parasites of macrophages that cause a wide range of clinical diseases in humans and domestic animals, mainly dogs. In some infections, the parasite may be inactive for many years. In other cases, the host may develop one of a variety of forms of leishmaniasis. For example, the disease may be asymptomatic or may manifest as subclinical visceral leishmaniasis, which is characterized by moderate symptoms of malaise, diarrhea and intermittent hepatomegaly. Patients with subclinical or asymptomatic disease usually have low antibody titers, making it difficult to detect the disease with normal techniques. Alternatively, leishmaniasis can manifest itself as a skin disease, which is a severe medical problem, but which is usually self-limiting, or as a highly destructive mucosal disease, which is not self-limiting. Finally and more seriously, the disease may manifest as an acute visceral infection involving the baso, liver and lymph nodes, which, if left untreated, is usually a fatal disease. Symptoms of watery visceral leishmaniasis include hepatosplenomegaly, fever, leukopenia, anemia, and hypergammaglobulinemia. Leishmaniasis is a serious problem in most of the world, including Brazil, China, East Africa, India and in areas of the Middle East. The disease is also endemic in the Mediterranean region, including southern France, Italy, Greece, Spain, Portugal and North Africa. The number of cases of leishmaniasis has increased dramatically in the last 20 years and millions of cases of this disease now exist throughout the world. About 2 children of new cases are diagnosed each year, 25% of which are visceral leishmaniasis. However, there is no vaccine or effective treatment currently available. The precise diagnosis of leishmaniasis is often difficult to achieve. There are 20 species of Leishmania infecting humans, including L. donovani, L. chagasi, L. infantum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. mexicana, L. tropica, and L. guyanensis. and there are no distinctive signs or symptoms that indicate unambiguously the presence of the Leishmania infection. Parasite detection methods have also been used, but these methods are neither sensitive nor clinically practical. Current skin tests usually use complete or used parasites. These tests are generally insensitive, irreproducible and have a propensity to cross-react with a variety of other diseases. In addition, the preparations used in such tests are often unstable. Therefore, there is a need for improved methods for the detection of Leishmania infection. It has not been proven that current experimental vaccines consisting of complete organisms are effective for humans. Consequently, there remains a need in the art for vaccines to prevent leishmaniasis in humans and dogs and for improved therapeutic compositions for the treatment of leishmaniasis. COMMENTARY OF THE I NVENTION In summary, the present invention provides compositions and methods for preventing, treating, and detecting leishmaniasis, as well as for stimulating immune responses in patients. In one aspect, polypeptides are provided which comprise, at least, an immunogenic portion of a Leishmania antigen or a variant of said antigen that differs only in substitutions and / or conservative modifications. In specific embodiments of the invention, the Leishmania antigen comprises an amino acid sequence selected from the group consisting of SEQ ID Nos: 2, 4, 20, 22, 24, 26, 36-38, 41, 50-53 and 82. The DNA sequences encoding the above polypeptides, the recombinant expression vectors comprising these DNA sequences and host cells transformed or transfected with said expression vectors are also provided. In related aspects, the present invention provides pharmaceutical compositions comprising one or more of the polypeptides described herein, or a DNA molecule encoding said polypeptides and a physiologically acceptable carrier. Vaccines comprising one or more of said polypeptides or DNA molecules are also provided, along with a non-specific immune response enhancer. In specific embodiments of these aspects, the Leishmania antigen has an amino acid sequence selected from the group consisting of SEQ ID Nos: 2, 4, 20, 22, 24, 26, 36-38, 41, 50-53 and 82. In still further related embodiments, the pharmaceutical compositions and vaccines comprise at least two different polypeptides, each polypeptide comprising an immunogenic portion of a Leishmania antigen having an amino acid sequence selected from the group consisting of sequences recited in SEQ ID NOS: 2, 4, 6. 8, 10, 20, 22, 24, 26, 36-38, 41, 50-53, 82 and variants thereof differing only from substitutions and / or conservative modifications. In other embodiments, the pharmaceutical compositions of the invention comprise one or more of the polypeptides of the invention in combination with a known Leishmania antigen. In still other related embodiments, the pharmaceutical compositions and vaccines comprise Leishmania sol ubles antigens. In another aspect, the present invention provides methods for inducing protective immunity against leishmaniasis in a patient, comprising, administering to a patient a pharmaceutical composition or a vaccine as described above. In additional aspects, diagnostic methods and equipment are provided to detect Leishmania infection in a patient. The methods comprise: (a) contacting dermal cells of a patient with a pharmaceutical composition as described above; and (b) detecting an immune response on a patient's skin, thereby detecting Leishmania infection in the patient. The diagnostic kits comprise: (a) a pharmaceutical composition as described above; and (b) an apparatus sufficient to contact the pharmaceutical composition with the skin cells of a patient. In additional aspects, the present invention provides methods for stimulating a cellular and / or humoral immune response in a patient, which comprises administering to a patient a pharmaceutical composition or vaccine as described above. In a related aspect, methods are provided for treating a patient suffering from a disease responsive to the stimulation of I L-2, which comprises administering to a patient a pharmaceutical composition or vaccine as described above. These and other aspects of the present invention will be apparent by reference to the following detailed description and accompanying drawings. All references described herein are incorporated herein by reference in their entirety as if each were incorporated individually. BRIEF DESCRIPTION OF THE DICHES Figure 1 shows the stimulation of cell proliferation T obtained from BALB / c mice immunized with L. donovani (represented by the stimulation index) by macrophages infected with L. donovani after incubation for 24, 48 and 72 hours. Figure 2 illustrates representative CLAR profiles of peptides isolated from class I I MHC molecules of macrophages of P388D 1. Panel A shows peptides isolated from uninfected macrophages and panel B shows peptides isolated from macrophages infected with L. donovani. The arrows in panel B indicate peaks of peptides present only in the preparation of infected macrophages. Figure 3 illustrates the expression and purification of the Leishmania antigen Ldp23 as a recombinant fusion protein. Panel a shows an SDS-PAGE gel E stained with Coomassie blue of E. coli lysate without (line 1) and with (line 2) induction of IPTG of expression of Ldp23. The arrow indicates the recombinant fusion protein. Panel B shows the fusion protein after excision of the cut of a preparative SDS-PAGE gel, electroelution, dialysis against PBS and analytical SDS-PAGE. Figure 4 presents a Northern blot analysis of total RNA prepared from L. donovani, L. major, L. amazonensis and L. pifanoi with a 32 P-labeled Ldp23 gene. 1, 2 and 3 refer to RNA obtained from promastigotes in the logarithmic growth phase, promastigotes in the stationary growth phase and amastigote forms, respectively. Figure 5 shows a Westhern spot analysis of L. donovani promastigote antigens incubated with pre-immune rabbit serum (line A) or with rabbit anti-Ldp23 antiserum (line B). Figure 6 illustrates the surface expression of Ldp23 in live promastigotes of L. donovani. The dotted line shows the indirect immunofluorescence performed using pre-immune mouse serum and the solid line shows the result obtained with anti-GST-Ldp23 antiserum from mice. The fluorescence intensity was analyzed by FACScan. Figure 7 shows the proliferation stimulation of T cells specific for Leishmania by Ldp23. The results are presented as a relative number of cells as a function of fluorescence intensity. T cells (10s / well) were purified from lymph nodes of BALB / c mice immunized in the footpad with promastigotes of L. donovani in AFC and cultured with various concentrations of purified recombinant Ldp23 in the presence of basal mononuclear cells. of normal BALB / c treated with 2 x 105 Mitomycin C. Proliferation of T cells was measured at 27 hours of culture. The values were expressed as cpm and represents the average of the [3H] TdR incorporation of cultures in triplicate. Figure 8 illustrates the cytokine production induced by Ldp23 by cells of the lymphatic node of BALB / c mice. The cultures were incubated with varying amounts of Ldp23 or Leishmania lysate, presented as μg / mL and analyzed by ELISA for the production of interferon-? (panel A) or interleukin-4 (panel B), both of which are shown as ng / mL. Figure 9 shows PCR amplification of cytokine mRNA isolated from PBMC from patients with mucosal leishmaniasis (Panel A) and cutaneous leishmaniasis (panel B) before and after stimulation with representative polypeptides of the present invention. The lines O and - indicate the level of PCR products and the start of the culture and after 72 hours of culture, respectively, in the absence of the added polypeptide; lines Lb, 83a and 83b indicate the level of CPR products after culturing CMS P with L. braziliensis lysate and the Leishmania antigens Lbhsp83a and Lbhas83b, respectively. Figure 10 represents a comparison of the levels of interferon-? (panel A) and TN F-a (panel B) in the culture supernatants of 72-hour PBMC from infected individuals. Leishmania and control in response to stimulation with the parasite lysate or the indicated polypeptides. Figure 11 illustrates the levels of I L-10 p40 (in pg / mL) in the supernatant of PBMC cultures of individuals infected with L. braziliensis and uninfected controls 72 hours after stimulation with the promastigote lysate. parasites (Lb), Lbhsp83a or Lbhsp83b. Figure 12 shows the serum reactivities of patients infected with L. braziliensis with representative polypeptides of the present invention and a normal ELISA. The values are expressed as absorbance at 405 nm. Figures 13A and 13B illustrate the level of I L-4 and I FN-? secreted (in pg / m L) stimulated in lymph node cultures of mice by the addition of representative polypeptides of the present invention. Figure 14 shows the level of I FN-? (in pg / mL) secreted by CMS P of humans infected with Leishmania and uninfected stimulated by the Leishmania antigen M 15, compared to the levels stimulated by the L. major lysate of L-Rack, an antigen not It seems to be recognized by humans infected by Leishmania. Figure 15 shows the level of IFN-? (in pg / mL) secreted by infected and uninfected human PBMCs stimulated by soluble Leishmania antigens (S antigens), compared to the levels stimulated by L. major and L-Rack lysate. Figure 16 illustrates the proliferation of murine lymph node cultures stimulated by the addition of the representative polypeptides of the present invention. The values are expressed as cpm. Figure 17 shows the proliferation of human PBMC, prepared from individuals immune to Leishmania and uninfected, stimulated by M15 purchased with the proliferation stimulated by lysate from L. major and L-Rack. The values are expressed as cpm. Figure 18 shows the proliferation of human PBMC, prepared from individuals immune to Leishmania and uninfected, stimulated by soluble Leishmania antigens compared to the proliferation stimulated by the culture medium, lysate of L. major and L-Rack. The values are expressed as cpm. Figure 19 presents a comparison of a sequence of Lbhsp83 (SEQ ID NO: 6) with homologous sequences of L. amazonensis (Lahsp83) (SEQ ID NO: 16), T. cruzi (Tchs83) (SEQ ID NO: 17) and humans (Huhsp89) SEQ ID NO: 18 ). Figure 20 illustrates the reactivity of rabbit serum raised against soluble Leishmania antigens with Leishmania promastigote lysate (line 1) and soluble Leishmania antigens (line 2). Figure 21 shows the cDNA and amino acid sequences predicted for the Leishmania antigen Lmspla. Figure 22 shows a Southern analysis of DNA of L. major digested with a panel of restriction enzymes (lines 1 to 7) and another six species of Leishmania digested with Pstl (lines 8 to 13) tested with the cDNA insert full length of Lmspla. Figure 23 shows a Southern analysis of genomic DNA of L. major digested with a panel of restriction enzymes, another six species of Leishmania digested with Pstl and the infectious pathogens T. cruzi and T. brucei, tested with the cDNA insert full-length Leishmania MAPS-1A antigen. Figure 24 illustrates the proliferation of PBMC isolated from uninfected individuals, patients with active mucosal leishmaniasis and patients with posterior kala-azar infection, stimulated by MAPS-1A. Figure 25 illustrates the proliferation of cultures of murine lymph nodes stimulated by MAPS-1A. Figure 26 illustrates the reactivity of MAPS-1A with serum from patients with human leishmaniasis. Figure 27 illustrates the reactivity of MAPS-1A with serum from mice immunized against and / or infected with leishmaniasis. Figure 28 illustrates the effectiveness of immunization with soluble Leishmania antigens or a mixture of Ldp23, LbeiF4A and M15 plus the adjuvant to confer protection against infection (as measured by swelling of the foot pads) in a model system. Murine leishmaniasis, compared to the administration of adjuvant alone. Figure 29 illustrates the immunization effectiveness of MAPS-1A plus adjuvant to confer protection against infection (measured by swelling of pads of the legs in a model system of murine leishmaniasis, compared with the administration of adjuvant alone. Figures 30A and B illustrate the proliferation of murine lymph node cultures stimulated with LcgSP8, LcgSPIO or LcgSP3. DETAILED DESCRIPTION OF THE INVENTION As noted above, the present invention is generally directed to compositions and methods for preventing, treating and detecting leishmaniasis, as well as for stimulating immune responses in patients. The compositions of the present invention include polypeptides comprising at least an immunogenic portion of a Leishmania antigen or a variant of said antigen that differs only in substitutions and / or conservative modifications. In a preferred embodiment, the compositions of the present invention include multiple polypeptides selected so as to provide increased protection against a variety of Leishmania species. Polypeptides within the scope of the present invention include, but are not limited to, polypeptides comprising immunogenic portions of Leishmania antigens comprising the sequences recited in SEQ ID NO: 2 (referred to herein as M 15); SEQ ID NO: 4 (hereinafter referred to as Ldp23), SEQ ID NO: 6 (referred to herein as Lbhsp83), SEQ ID NO: 8) (hereinafter referred to as Lt-210), SEQ ID NO: 22 (herein referred to as Lmsp la), SEQ ID NOS: 24 and 26 (referred to herein as MAPS-1 A) and SEQ ID NO: 36-42, 49-53 and 55. As used herein, the term "polypeptide" encompasses chains of amino acids of any length, including full length proteins (ie, antigens), wherein the amino acid residues are linked by covalent linkages. Therefore, a polypeptide comprising an immunogenic portion of one of the above antigens may consist entirely of the immunogenic portion or may contain additional sequences. Additional sequences may be derived from the native Leishmania antigen or may be heterologous and said sequences may (but need not) be immunogenic. An antigen "having" a particular sequence is an antigen that contains, within its full-length sequence, the sequence recited. The native antigen may or may not contain an additional amino acid sequence. An immunogenic portion of a Leishmania antigen is a portion that is capable of producing an immune response (i.e., cellular and / or humoral) in a current or previously infected Leishmania patient (such as a human or a dog) and / or in cultures of lymph node cells or peripheral blood mononuclear cells (PBMC) isolated from individuals currently or previously infected with Leishmania. Cells in which a response is produced may comprise a mixture of cell types or may contain cells from isolated components (including, but not limited to, T cells, NK cells, macrophages, monocytes and / or B cells). In particular, the immunoglogenic portions are capable of inducing the proliferation of T cells and / or a dominant Th1-like cytokine response (e.g., IL-2, IFN-α and / or production of TNF-α by T cells). and / or NK cells, and / or production of IL-12 by monocytes and / or B cells). Immunogenic portions of the antigens described herein may generally be used by techniques known to those of ordinary skill in the art, including representative methods provided herein. The compositions and methods of the present invention also encompass variants of the above polypeptides. A "variant" of polypeptides, as used herein, is a polypeptide that differs from the native antigen only in conservative substitutions and / or modifications, so that the ability of the polypeptide to include an immune response is retained. The polypeptide variants preferably exhibit at least about 70%, more preferably at least about 90% and even more preferably at least about 95% identity to the identified polypeptides. Alternatively, said variants can be identified by modifying one of the above polypeptide sequences and evaluating the immunogenic properties of the modified polypeptide using, for example, the representative methods described herein. A "conservative substitution" is one in which an amino acid is substituted by another amino acid that has similar properties, so that someone skilled in the matter of peptide chemistry could expect that the secondary structure and hydropathic nature of the polypeptide is substantially not changed. . In general, the following amino acid groups represent conservative changes: (1) ala, pro, gly, glu, asp, gln, asn, ser, thr; (2) cys, ser, tyr, thr; (3) val, ile, leu, met, ala, phe; (4) lys, arg, his; and (5) phe, tyr, trp, his. The variants also (or alternatively) can be modified, for example, by the deletion or addition of amino acids that have minimal influence on the immunogenic properties, secondary structure and hydropathic nature of the polypeptide. For example, a polypeptide or a signal sequence (or leader) can be conjugated at the N-terminus of the protein which co-translationally or post-translationally directs the transfer of the protein. The polypeptide can also be conjugated to a linker or other sequence for ease of synthesis, purification or identification of the polypeptide (v. G r., Poly-His), or to increase the one ion of the polypeptide to a solid support. For example, a polypeptide can be conjugated to a region of Fe. A "variant" of nucleotide in a sequence that differs from the nucleotide sequence recited by having one or more deletions, substitutions or additions of nucleotides. Such modifications can be easily introduced using normal mutagenesis techniques, such as site-specific mutagenesis directed by oligonucleotides as taught, for example, by Adelman et al. (DNA, 2: 183, 1983). The nucleotide variants may be allelic variants present in nature, or variants not present in nature. In the variant nucleotide sequences they preferably exhibit at least about 70%, more preferably at least about 80% and more preferably at least about 90% identity for the sequence recited. Said variant nucleotide sequences will generally hybridize to the nucleotide sequence recited under stringent conditions. As used herein, "stringent conditions" refers to prewash in a solution of 6x SSC, 0.2% SDS; Hybridization at 65 ° C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in 1 X SSC, 0.1% or SDS at 65 ° C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65 ° C. The "polypeptides" as described herein, also include polypeptide combination. A "polypeptide combination" is a polypeptide comprising at least one of the above immunogenic portions and one or more additional immunogenic Leishmania sequences, which are linked via a peptide ligation in a single chain of amino acids. The sequences can be linked directly (ie, without amino acid intervention) or can be linked in the manner of a linker sequence (eg, Gly-Cys-Gly) that does not significantly decrease the immunogenic properties of the component polypeptides. In general, Leishmania antigens having immunogenic properties and DNA sequences encoding said antigens, can be prepared using any variety of methods of one or more Leishmania species including, but not limited to, L. donovani, L. chagasi , L. infantum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. mexicana, L. tropic and L. guyanensis. Such species are available, for example, from the American Type Culture Collection (ATCC), Rockville, MD. For example, peptides isolated from MHC class I I molecules from macrophages infected with Leishmania species can be used to rescue the corresponding donor antigens from Leishmania. The class I I molecules of M HC are mainly expressed by cells of the immune system, including macrophages. These molecules present peptides, which are usually 13-17 amino acids long, derived from foreign antigens and are degraded into cellular vesicles. The antigens of a peptide are then recognized by T cells of CD4. Consequently, foreign peptides isolated from class I I molecules of M HC from, for example, murine macrophages infected by Leishmania can be used to identify immunogenic Leishmania proteins. In summary, the peptides derived from Leishmania antigens can be isolated by comparing the reverse phase HPLC profile of peptides extracted from infected macrophages with the profile of peptides extracted from uninfected cells. Peptides that give rise to different spikes of unique HPLCs for infected macrophages can then be sequenced using, for example, Edman chemistry as described in Edman and Berg, Eur J. Biochem, 80: 1 16-132 (1967). A DNA fragment corresponding to a Leishmania gene encoding the peptide can then be applied to a Leishmania cDNA library using an oligonucleotide sense primer derived from the peptide sequence and an oligo dT antisense primer. The resulting DNA fragment can then be used as a probe to screen a Leishmania bank for a full length of cDNA or genomic clone encoding the Leishmania antigen. Such screens can generally be made using techniques well known to those of ordinary skill in the art, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1989). This approach can be used to identify a 23 kD antigen of Leishmania donovani (referred to herein as Ldp23). The sequence of a DNA molecule encoding Ldp23 is provided in SEQ ID NO: 3 and the amino acid sequence of Ldp23 is provided in SEQ ID NO: 4. Using the methods described herein, it has been shown that Ldp23 induces a Th1 immune response in T cells prepared from mice infected with Leishmania. Alternatively, a Leishmania cDNA or genomic expression bank, can be screened with serum from an individual infected with Leishmania, using techniques well known to those skilled in the art, DNA molecules encoding reactive antigens can be used to express the antigen. recombinant for purification. The immunogenic properties of the purified Leishmania antigens can be evaluated, using, for example, the representative methods described herein. For example, serum from mice infected with Leishmania can be used to screen a cDNA library prepared from Leishmania amastigotes. The reactive clones can then be expressed and the recombinant proteins can be analyzed for the ability to stimulate T cells or NK cells derived from individuals immune to Leishmania (i.e., individuals who have evidence of infection, as documented by positive serological reactivity with antibodies. specific for Leishmania and / or HTR response specific for Leishmania, without clinical symptoms of leishmaniasis). This method can be used to obtain a recombinant DNA molecule encoding the Leishmania antigen designated M15. The sequence of said DNA molecule is provided in SEQ I D NO: 1 and the amino acid sequence of the encoded protein is provided in SEQ I D NO: 2. A similar approach can be used to isolate a genomic DNA molecule encoding an immunogenic antigen from Leishmania braziliensis, herein referred to as Lbhsp83. More specifically, a genomic clone encoding Lbhsp83 can be isolated by screening an expression bank of L. braziliensis with serum from an individual infected with Leishmania. The DNA encoding Lbhsp83 is homologous to the gene encoding the eukaryotic protein of 83 KD heat shock. The sequence of a DNA molecule encoding almost all Lbhsp83 is presented in SEQ I D NO: 5, and the encoded amino acid sequence is provided in SEQ I D NO: 6. Using the methods described below, it has been found that Lbhsp83 stimulates proliferation, and a cytokine profile of Th 1 and Th 2 mixed, in PBMC isolated from patients infected with L. braziliensis. Consequently, Lbhsp83 is an immunogenic Leishmania antigen. The Lbhsp83 regions that are not conserved with the mammalian gene have been found to be particularly potent for T cell stimulation and antibody binding. Said regions can be identified, for example, by visual inspection of the sequence comparison provided in Figure 1. This approach can also be used to isolate a DNA molecule encoding an inorganic tropic L.sub.10 antigen of 210 kD, termed the present as Lt-210. The preparation and characterization of Lt-21 0 and the immunogenic portions thereof (such as Lt-1 and repeated immunogenic sequences and sequences without repetition), was described in detail in the patent application of E. U.A. , Series No. 08/51 1, 872, filed on August 4, 1995. The sequence of a DNA molecule encoding Lt-1 is provided in SEQ ID NO: 7 and the encoded amino acid sequence is presented in SEQ ID. NO: 8 The above approach can also be used to isolate a DNA molecule encoding an antigen of L. braziliensis referred to herein as Lbel F4A. In summary, said clone can be isolated by screening an expression bank of L. braziliensis with serum obtained from a patient suffering from mucosal leishmaniasis, and analyzing the reactive antigens for the ability to stimulate proliferative responses and the preferential Th 1 cytokine production. in CMSP isolated from patients infected with Leishmania, as described below. The preparation and characterization of Lbel F4A was described in detail in the U.S. Patent Application. Series Nos. 08/454, 036 and 08/488, 386, which are continuations in part of the Patent Application of E. U.A. Series No. 08/232, 534, filed on April 22, 1994. The sequence of a DNA molecule encoding Lbel F4A is provided in SEQ ID NO: 9 and the encoded amino acid sequence is presented in SEQ ID NO: 1 0. Lbel F4A homologs, such as those found in L. major, can also be isolated using this approach and are within the scope of the present invention. The compositions of the present invention may also, or alternatively, contain soluble Leishmania antigens. As used herein, "soluble Leishmania antigens" refers to a mixture of at least 8 different Leishmania antigens that can be isolated from the supernatant of Leishmania promastigotes of any species developed for 8-12 hours in free medium. protein. In summary, organisms develop to the late log phase in complex medium with serum until they reach a density of 2-3 x 107 viable organisms per mL of medium. Organisms are washed uniformly to remove media components and resuspended in 2-3 x 107 viable organisms per m L of defined serum-free medium consisting of equal parts of RPMl 1640 and medium 199, both from Gibco BRL Gaithersburg, M D. After 8-12 hours, the supernatant containing soluble Leishmania antigens is removed, concentrated 10 times and dialyzed against phosphate-buffered saline for 24 hours. The presence of at least eight different antigens within the mixture of Leishmania antigens can be confirmed using SDS-PAG E (ie, by observing at least 8 different bands). The immunogenic properties of soluble Leishmania antigens can be confirmed by evaluating the ability of the preparation to give an immune response in cultures of lymph node cells and / or mononuclear cells of peripheral blood (PBMC) isolated from current or previously infected individuals. Leishmania An evaluation can be carried out as described below. The individual antigens present within the mixture of soluble Leishmania antigens can be isolated by immunizing mice or rabbits with Leishmania culture supernatant, containing soluble antigens and using the resulting serum to screen a Leishmania cDNA expression library as described in detail. later. This method can be used to isolate recombinant DNA molecules encoding the L. major antigens referred to herein as Lmspl a, Lmsp9a and MAPS-1 A. The DNA sequences encoding Lmsp la, Lmsp9a and MAPS-l are provided in SEQ ID NO: 19, 21 and 23, respectively, with the corresponding predicted amino acid sequences being presented in SEQ ID NO: 20, 22 and 24, respectively. Similarly, serum from mice or rabbits immunized with the L. major culture supernatant can be used to screen a bank of L. major genomic DNA. As detailed below this method can be used to isolate DNA molecules encoding the L. major antigens referred to herein as LmgSPI, LmgSPd, LmgSPd, LmgS P9, LmgSP 13, LmgSP 1 9 and DNA molecules encoding antigens. of L. chagasi LcgS PI LcgSP3, LcgSP4, LcgSPd and LcgS PIO. The AD N sequences encoding these antigens are provided in S EQ I D NO: 29-35 and 44-48, respectively, with the amino acid sequences being provided in SEQ I D N O: 36-42 and 49-53. The L. major antigens referred to herein as 1G6-34, 1E6-44, 4A5-63, 1B11-39, 2A10-37, 4G2-83, 4H6-41 and 8G3-100 can be isolated by the means of expression of CD4 + T cells cloned as described below. The DNA sequences encoding these antigen are provided in SEQ ID NO: 72-79, respectively, with the corresponding predicted amino acid sequences provided in SEQ ID NO: 80-87. The immunogenic properties of the isolated Leishmania antigens can be evaluated using, for example, the representative methods described herein. Regardless of the method of preparation, the antigens described herein are immunogenic. In other words, the antigens (and immunogenic portions thereof) are capable of eliciting an immune response in cultures of lymph node cells and / or peripheral blood mononuclear cells (PBMC) isolated from individuals recently or previously infected with Leishmania. More specifically, the antigens and immunogenic portions thereof, have the ability to induce T cell proliferation and / or to produce a Th1 type cytokine response dominantly (e.g., IL-2, IFN-α and / or production of TNF-a by T cells and / or NK cells; and / or production of IL-12 by monocytes, macrophages, and / or B cells) in cells isolated from individuals currently or previously infected with Leishmania. An individual infected with Leishmania may suffer from a form of leishmaniasis (such as subclinical, cutaneous, mucosal or active visceral), or may be asymptomatic. Such individuals can be identified using methods well known to those of ordinary skill in the art. Individuals with Leishmania can be identified based on clinical findings associated with at least one of the following: isolation of parasites from lesions, a positive skin test with Leishmania lysate or a positive serological test. Asymptomatic individuals are infected individuals who have no signs or symptoms of disease. Said individuals can be identified based on a serological test and / or a skin test with Leishmania lysate. The term "PBMC", which refers to a preparation of nucleated cells consisting mainly of lymphocytes and monocytes that are present in the peripheral blood, encompasses both cell mixture and preparation of one or more types of purified cells. PBMC can be isolated by methods known to those skilled in the art. For example, CMSP can be isolated by density centrifugation through, for example, Ficol ™ (Winthrop Laboratories, New York). Cultures of the lymphatic node can generally be prepared by immunizing BALB / c mice (e.g., in the pad of the hind paw) with Leishmania promastigotes emulsified in complete Freund's adjuvant. The draining lymph nodes can be removed after immunization. T cells can be purified on an anti-mouse Ig column to remove B cells, followed by a passage through a Sephadex G10 column to remove macrophages. Similarly, lymph node cells can be isolated from a human being after biopsy or surgical removal of a lymph node. The ability of a polypeptide (e.g., Leishmania antigen or a portion or other variant thereof) to induce a response in PBMC or cultures of lymph node cells can be assessed by contacting the cells with the polypeptide and measuring a proper response. In general, the amount of the polypeptide that is sufficient for the evaluation of about 2 x 10 cells ranges from about 10 ng to about 100 μg, and preferably is about 1-3 days. Incubation with cells is usually carried out at 37 ° C for about 1-3 days. After incubation with polypeptide, the cells were analyzed for an appropriate response. If the response is a proliferative response, any of a variety of techniques well known to those of ordinary skill in the art can be employed. For example, cells may be exposed to a radioactive thymidine pulse and the incorporation of measured cellular DNA label. In general, a polypeptide that results in at least a threefold increase in the preceding background of proliferation (i.e., the proliferation observed for cells grown without polypeptide) is considered to be capable of inducing proliferation. Alternatively, the response to be measured may be the secretion of one or more cytokines (such as interferon-α (IFN-y), interleukin-4 (IL-4), interleukin-12 (p70 and / or p40), interleukin -2 (IL-2) and / or tumor necrosis factor-a (TNF-a)) or the change in the level of mRNA encoding one or more specific cytokines. In particular, the secretion of interferon- ?, interleukin-2, tumor necrosis factor-a and / or interleukin-12 are indicative of a Th1 response, which is responsible for the protective effect against Leishmania. Analyzes for any of the above cytokines can generally be performed using methods known to those of ordinary skill in the art, such as by enzyme-linked immunosorbent assay (ELISA). Suitable antibodies for use in such analyzes can be obtained from a variety of sources such as Chemicon, Temucula, CA and PharMingen, San Diego, CA, can generally be used according to the manufacturer's instructions. The level of mRNA encoding one or more specific cytokines can be evaluated, for example, by polymerase chain reaction (PCR) amplifications. In general, a polypeptide that can induce, in a preparation of about 1-3 x 10 5 cells, the production of 30 pg / mL of IL-12, IL-4, IFN- ?, TNF-a or IL-12 p40, or 10 pg / mL of IL-12 p70, are considered capable of stimulating the production of a cytokine. Immunogenic portions of the antigens described herein can be prepared and identified using well known techniques, such as those summarized in Fundamental Immunology, 3rd ed. 243-247 (Raven Press 1993) and references cited therein. Such techniques include screening polypeptides derived from the native antigen for immunogenic properties using, for example, the representative techniques described herein. An immunogenic portion of polypeptide is a portion that, within such representative assays, generates an immune response (eg, proliferation and / or cytokine production) that is substantially similar to that generated by the full-length antigen. In other words, an immunogenic portion of an antigen can generate at least about 25% and preferably at least about 50% of the response generated over the entire length of the antigen in the model assays described herein. Portions and other variants of immunogenic Leishmania antigens can be generated by synthetic or recombinant means. Synthetic polypeptides having less than about 100 amino acids and generally less than about 50 amino acids, can be generated using techniques well known to those of ordinary skill in the art. For example, such polypeptides can be synthesized using any of the commercially available solid phase techniques, such as the Merrifield solid phase synthesis method, wherein the amino acids are sequentially added to a growing chain of amino acids. See Merrifield, J. Am. Chem. Soc. 85: 2149-2146, 1963. The equipment for the automatic synthesis of polypeptides is commercially available from suppliers such as Perkin Elmer / Applied BioSystems Division, Foster City, CA, and can be operated from according to the manufacturer's instructions. Recombinant polypeptides containing portions and / or variants of a native antigen can be readily prepared from a DNA sequence encoding the antigen. For example, the supernatant of suitable host / vector systems that secrete recombinant protein in culture medium can be first concentrated using a commercially available filter. After concentration, the concentrate can be applied to a suitable purification matrix such as an affinity matrix or an ion exchange resin. Finally, one or more reverse phase HPLC steps can be used for additional purity of a recombinant protein. In general, any of a variety of expression vectors known to those of ordinary skill in the art can be used to express recombinant polypeptides of this invention. The expression can be activated in any appropriate host cell that has been transformed or transfected with an expression vector containing a DNA molecule encoding a recombinant polypeptide. Suitable host cells include prokaryotes, yeast and superior ecuariotic cells. Preferably, the host cells employed are E. coli, yeast or a mammalian cell line such as COS or CHO. The DNA sequences expressed in this form can encode antigens present in nature, portions of antigens present in nature or other variants thereof. For example, variants of a native antigen can generally be prepared using normal mutagenesis techniques, such as oligonucleotide-directed site-specific mutagenesis and sections of the DNA sequence can be removed to allow the preparation of truncated polypeptides. In another aspect, the present invention provides repeat sequences of epitopes or antigenic epitopes of a Leishmania antigen, together with polypeptides comprising at least two of said contiguous antigenic epitopes. As used herein an "epitope" is a portion of an antigen that reacts with serum from individuals infected with Leishmania (i.e., an epitope is specifically bound by one or more antibodies present in said serum). As discussed above, the epitopes of the antigens described in the present application can generally be identified using techniques well known to those of ordinary skill in the art. In one embodiment, the antigenic epitopes of the present invention comprise the amino acid sequences provided in SEQ ID NO: 43, 56, 57 or 58. As discussed in more detail below, the antigenic epitopes provided herein may be employed in the diagnosis and treatment of Leishmania infection, either alone or in combination with other Leishmania antigens or antigenic epitopes. The antigenic epitopes and polypeptides comprising said epitopes can be prepared by synthetic means, as described generally above and in detail in Example 15. In certain aspects of the present invention, polypeptides, antigenic epitopes and / are described in detail below. or soluble Leishmania antigens can be incorporated into pharmaceutical compositions or vaccines. For clarity, the term "polypeptide" will be used when describing specific embodiments of the therapeutic compositions of the invention and diagnostic methods. However, it will be clear to one skilled in the art that the antigenic epitopes of the present invention can also be employed in the compositions and methods. The pharmaceutical compositions comprise one or more polypeptides, each of which may contain one or more of the above sequences (or variants thereof) and a physiologically acceptable carrier. The vaccines comprise one or more of the above polypeptides and one or more non-specific immune response enhancers, such as an adjuvant (eg, Lbel F4A, interleukin-12 or other cytokines) or a liposome (in which it is incorporated the polypeptide). The vaccines may additionally contain a delivery vehicle, such as a biodegradable microsphere (described, for example, in U.S. Patent Nos. 4,897,268 and 5,075, 109). Pharmaceutical compositions and vaccines within the scope of the present invention may also contain other Leishmania antigens, either in-corporation in a polypeptide combination or present within one or more separate polypeptides. Alternatively, a pharmaceutical composition or vaccine may contain a DNA encoding one or more of the polypeptides as described above, so that the polypeptide is generated in situ. In such pharmaceutical compositions and vaccines the DNA may be present within any of a variety of delivery systems known to those skilled in the art, including expression systems of nucleic acids, bacteria and viral expression systems. Suitable nucleic acid expression systems contain the DNA sequences necessary for expression in the patient (such as a suitable promoter and a termination signal). Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette-Guerrin) that expresses an immunogenic portion of polypeptide on its cell surface. In a preferred embodiment, the DNA can be introduced using a viral expression system (eg, vaccinia or other pox virus, retrovirus or adenovirus) that may involve the use of a competent non-pathogenic (defective) replication virus. The techniques for incorporating DNA into such expression systems are well known to those skilled in the art. DNA can also "peel", as is written, for example, in Ulmer et al., Science 259: 1745-1749 (1993) and reviewed by Cohen, Science 259: 1691-1692 (1993). The absorption of stripped DNA can be increased by the coating of DNA into biodegradable beads, which are transported efficiently in the cells. While any known vehicles suitable for those of ordinary skill in the art can be employed in the pharmaceutical compositions of this invention, the type of vehicle will vary depending on the mode of administration. For parenteral administration, such as subcutaneous injection, the vehicle preferably comprises water, saline, alcohol, a fat, a wax or a buffer solution. For oral administration, any of the above vehicles or a solid carrier such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose and magnesium carbonate can be used. Biodegradable microspheres (e.g., polylactic galactide) can also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres are described, for example, in U.S. Pat. 4,897,268 and 5,075,109. Any of a variety of adjuvant can be employed in the vaccines of this invention to nonspecifically improve the immune response. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil and a non-specific stimulation of immune responses, such as lipid A, Bordella pertussis or Mycobacterium tuberculosis. Suitable adjuvants are commercially available as, for example Freund's Complete Adjuvant I and Freund's Complete Adjuvant (Difco Laboratories, Detroit; Ml), Merck Adjuvant 65 (Merck and Company, Inc., Rahway, NJ), alum, biodegradable microspheres, lipid A and quil A of monosphosphoryl. Preferred adjuvants include fiber F4A, I L-12 and other cytokines such as I FN-? or granulocyte-macrophage colony factor (GM-CSF for its acronym in English). By virtue of its ability to induce an exclusive Th 1 immune response, the use of Lbel F4A and variants thereof, as an adjuvant in the vaccines of the present invention is particularly preferred. In a preferred embodiment, the compositions of the present invention include multiple polypeptides selected so as to provide enhanced protection against a variety of Leishmania species. Said polypeptides can be selected based on the native antigen origin species or based on a high degree of conservation of amino acid sequences between different species of Leishmania. A combination of individual polypeptides may be particularly effective as a prophylactic and / or therapeutic vaccine, because a (1) stimulation of proration and / or cytokine production by individual polypeptides may be additive, (2) stimulation of proration and / or cytokine production by individual polypeptides can be synergistic, (3) the individual polypeptides can stimulate cytoq or in profiles in such a way that they are complementary to each other and / or (4) the individual polypeptides can be complementary to each other. with others when certain of them are expressed more abundantly on the individual species or strain of Leishmania responsible for the infection. A preferred combination contains polypeptides comprising immunogenic portions of M 15, Ldp23, Lbhsp83, Lt-1 and Lbel F4A. Alternatively, or in addition, the combination may include one or more polypeptides comprising immunogenic portions or other Leishmania antigens described herein and / or soluble Leishmania antigens. The above pharmaceutical compositions and vaccines can be used, for example, to induce protective immunity against Leishmania in a patient, such as a human being or a dog, to prevent leishmaniasis. The appropriate doses and methods of administration are described in detail below. The pharmaceutical compositions and vaccines described herein may also be used to stimulate an immune response, which may be cellular and / or humoral, in a patient. For patients infected with Leishmania, the immune responses that can be generated include a preferential Th 1 immune response (ie, a response characterized by cytokine production interleukin-1, interleukin-2, interleukin-12 and / or interferon-? , as well as the tumor necrosis factor-a). For non-infected patients, the immune response may be the production of interleukin-12 and / or interleukin-2, or the stimulation of delta-gamma T cells. In this category of patient, the stimulated response may include the production of I L-12. Said responses may also occur in biological samples of PBMC or components thereof derived from individuals infected or not infected by Leishmania. As noted above, analyzes for any of the above cytokines can generally be carried out using methods known to those skilled in the art, such as an enzyme-linked immunosorbent assay (ELI SA). Suitable pharmaceutical compositions and vaccines for use in this aspect of the present invention are those that contain at least one polypeptide that contains an immunogenic portion of Leishmania antigen described herein (or a variant thereof). Preferably, the polypeptides used in the pharmaceutical compositions and vaccines are complementary, as described above. Soluble Leishmania antigens, with or without additional polypeptides, can also be employed. The pharmaceutical compositions and vaccines described herein, they can also be used to treat a patient suffering from a disease that responds to the stimulation of I L-12. The patient can be any warm-blooded animal, such as a human being or a dog. Such diseases include infections (which may be, for example, bacterial, viral or protozoa) or diseases such as cancer. In one modality, the leishmaniasis diseases and the patient may exhibit clinical symptoms or may be asymptomatic. In general, the responsibility of a particular disease to the stimulation of IL-12 can be determined by evaluating the effect of treatment with a pharmaceutical composition or vaccine of the present invention in the clinic correlates with immunity. For example, if the treatment results in an increased Th1 response or the conversion of a Th2 profile to a Th1 profile, with the clinical improvement appended to the treated patient, the disease responds to the stimulation of IL-12. The administration of polypeptides may be as described above or may be extended for a long period of time, depending on the indication. Preferably, the polypeptides used in the pharmaceutical compositions and vaccines are complementary, as described above. A particularly preferred combination contains polypeptides comprising immunogenic portions of M15, Ldp23, Lbhsp83, Lt-I and LbelF4A, Lmspla, Lmsp9a, and MAPS-1A. Soluble Leishmania antigens, with or without additional polypeptides, can also be employed. The routes and frequency of administration, as well as doses, for the above aspects of the present invention will vary from individual to individual and may be parallel to those currently used in immunization against other infections, including protozoal, viral and bacterial infections. In general, the pharmaceutical compositions and vaccines can be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration) or orally. Between 1 and 12 doses can be administered for 1 year period. For therapeutic vaccine (i.e., treatment of an infected individual), preferably 12 doses are administered at one month intervals. For prophylactic use, preferably 3 doses are administered at 3-month intervals. In any case, booster shots can be given periodically. Alternate protocols may be appropriate for individual patients. A suitable dose is an amount of polypeptide or DNA which, when administered as described above, can elicit an immune response in an immunized patient sufficient to protect the patient from leishmaniasis for at least 1-2 years. In general, the amount of polypeptide present in a dose (or produced in situ by the DNA in a dose) ranges from about 100 ng to about 1 mg per kg of the host, typically from about 10 μg to about 100 μg. The appropriate dose sizes will vary with the size of the patient, but will normally be on the scale of about 0.1 mL to about 5 mL. In another aspect, this invention provides methods for using one or more of the polypeptides described above for diagnosing Leishmania infection in a patient using a skin test. As used herein, a "skin test" is any analysis performed directly on a patient in which a delayed-type hypersepability reaction (HTR) (such as induration and ancillary flushing) is measured was measured following injection, intradermal one more polypeptides described above. Such injection can be accomplished using any suitable device sufficient to contact the polypeptide or polypeptides with the patient's skin cells, such as a tuberculin syringe or a 1 mL syringe. Preferably, the reaction is measured at least 48 hours after injection, more preferably 72 hours after injection. The HTR reaction is a cell-mediated immune response, which is higher in patients who have previously been exposed to a test antigen (i.e., an immunogenic portion of a polypeptide employed, or a variant thereof). The answer can be measured visually, using a rule. In general, induration that is greater than about 0.5 cm in diameter, preferably greater than about 1.0 cm in diameter, is a positive response, indicating infection by Leishmania, which may or may not manifest itself as an active disease. The polypeptides of this invention are preferably formulated, for use in a skin test, such as pharmaceutical compositions containing at least one polypeptide and a physiologically acceptable carrier, as described above. Such compositions typically contain one or more of the above polypeptides in an amount ranging from about 1 μg to about 100 μg, preferably from about 10 μg to 50 μg in a volume of 0.1 mL. Preferably the vehicle employed in said pharmaceutical compositions is a saline solution with appropriate preservatives, such as phenol and / or Tween 80 ™. The polypeptides of the invention can also be used in combination with one or more Leishmania antigens known in the diagnosis of leishmaniasis, using, for example, the skin test described above. Preferably, the individual polypeptides are chosen such that they are complementary to one another. Examples of known Leishmania antigens that can be usefully employed in conjunction with the polypeptides of the invention include K39 (Burns et al., Proc Nati, Acad, Sci USA, 1993 90: 775-779). The following Examples are offered by way of illustration and not by way of limitation. EXAMPLES EXAMPLE 1 PREPARATION OF M15 This Example illustrates the preparation of a Leishmania antigen M15, having the sequence provided in SEQ ID NO: 2. An expression bank of amastigote cDNA of L. major (Friedlan tinsion) prepared in the vector? ZAP II (Stratagene, La Jolla, CA) was screened according to the manufacturer's instructions using sera obtained from BALB / c mice infected with L. major (8 weeks after inoculum). Approximately 40,000 plates were screened and four clones expressing reactive antigens were purified for homogeneity by two subsequent rounds of low density screening. Bluescript phagemid inserts were excised from positive clones for further analysis. An EcoRI / SsflI restriction fragment from the 5 'end of a partial cDNA insert isolated during the first round of screening (pLmal-1) was subsequently used as a probe to rescreen clones containing the full-length cDNA inserts . The probe was labeled at a high specific activity (109 cpm / μg) with [_32P] using the random primer method and used to screen 10,000 plates of the L. major expression library described above. Positive clones were purchased for digestion of the restriction enzyme and the clone with the largest insert (pf 1 - 1) was chosen for subsequent analysis. DNA sequence analyzes were carried out in an Applied Biosystems automatic sequencer using Taq polymerase and ddNTP terminators coupled to the dye or dye-labeled sequencing primers. The complete sequence of the 2685 bp insert was determined using a combination of primer directed sequencing and by sequencing a series of overlapping Exonuclease subclones III overlays generated using the Erase-a-base system (Promega, Madison, Wl) . The sequence of this insert was provided in SEQ ID NO: 1, and the deduced amino acid sequence was provided in SEQ ID NO: 2. The complete insert of clone pf 1 -1 was excised by digestion with. BamH \ / Kpn \ and subcloned into the frame in pQE31 digested with Bam \ / kpn \ (QUIAGEN) for general construction pM151A. The E. coli containing this construct inducibly expressed high levels of the L. major antigen encoded by mp 1 -1 (designated M15) with the addition of a 6-histidine tag at the amino terminus. Large volume cultures (500 mL) of E. coli host cells containing the construct pM151A were induced to express the recombinant protein by the addition of 2 mM IPTG to a medium-log growth phase. Growth continued for 4 to 5 hours and the bacteria were then pelleted and washed once with cold PBS. The bacteria were resuspended in 20 ml of lysis buffer (50 mM Na2HPO, pH 8.0, 300 mM NaCl, 10 mM β-mercaptoethanol) containing 20 mg of lysozyme and used for 1 hour of incubation at 4 ° C. after treatment by brief sound. The insoluble material was removed by centrifugation at 10,000xg for 10 minutes and although the recombinant protein was found to be evenly distributed between the insoluble and soluble fractions, the insoluble material was discarded at this point. The recombinant protein containing the amino terminal histidine tag was affinity purified using the Ni-NTA resin (QIAGEN) according to the manufacturer's recommendations. In summary, 8 ml of the Ni-NTA resin resuspended in lysis buffer was added to the soluble lisate fraction and binding was carried out with constant mixing for 1 hour 79 studies were prepared from infected BALB / c mice with L. major 10 days later, of infection as described in Example 2. PBMC were prepared using peripheral blood obtained from individuals with cured L. donovani infections who responded immunologically to Leishmania. The diagnosis of the patients was made in clinical findings associated with at least one of the following. Isolation of parasites from injuries, a positive skin test with Leishmania lysate or a positive serological test. Uninfected individuals were identified based on a lack of clinical signs or symptoms, or a lack of history of exposure or travel to endemic areas, and absence of a serological or cellular response to Leishmania antigens. Peripheral blood was collected and PBMC were isolated by density centrifugation through Ficoll ™ (Winthrop Laboratories, New York). The culture supernatants were analyzed for the levels of IL-4 and IFN-α. secreted. IFN-? were quantified by a double walled ELISA using IFN-? Anti-human mouse mAb (Chemicon, Temucula, CA) and IFN-γ serum anti-human polyclonal rabbit. rIFN-? Human (Genentech, Inc., San Francisco, CA) was used to generate a normal curve. IL-4 was quantified in supernatants by a double walled ELISA using a mouse anti-human IL-4 mAb (M1) and a polyclonal rabbit anti-human IL-4 serum (P3). Human IL-4 was used (Immunex Corp. To ensure that the in vitro infection of the macrophages could load their MHC class II molecules with parasite peptides, initial experiments were carried out for the cell capacity test of the cell line of macrophages infected with L. donovani P388D 1 for parasite antigens present for T cells specific for L. donovani. This macrophage cell line was chosen because it has the same H-2 haplotype as the BALB / c mouse, which is a mouse strain moderately susceptible to L. donovani infection and is selected to carry out the in vitro experiments. Using a ratio of 3-5 parasites per cell and an initial incubation at room temperature for 4-6 hours later at 37 ° C for 24-48 hours, about 90% of the macrophages were infected. The level of expression of M HC class I I molecules, as determined by FACS analysis, indicated that the infection caused an effect on M HC class I I expression levels when compared to uninfected control cells. To test the capacity of P388D1 cells infected by L. donovani with the parasite antigens present, the macrophages were infected as indicated above and incubated at 26 ° C for 6 hours and then at 37 ° C for 24, 48 or 72 hours. At each of these points in time the non-adherent cells and the free parasites were washed and the adherent cells were mechanically unloaded, washed and fixed with paraformaldehyde. These cells were then used as antigen presenting cells (APCs) for the T cells of the lymph node of BALB / c mice immunized with promastigotes of L. donovani. To generate these T cells specific for anti-L. donovani, the BALB / c (H-2d) mice of both sexes (The Jackson Laboratory, Bar Harbor, ME) were immunized at 8 to 14 weeks of age in the hind paw pad with 5-10 x 106 of promastigotes of L. donovani emulsified in complete Freünd's adjuvant (A FC) (Difco Laboratories, Madison, M l) as described in Rodrigues et al., Parasite Immunol. 14:49 (1992). The draining lymph nodes were excised 8 days after immunization and the T cells were purified on an anti-mouse Ig column to remove the B cells, as described in Bunn-Moreno and Campos-Neto, J. Immunol. 127: 427 (1981), followed by a passage through a Sephadex G 10 column to remove the macrophages. The stimulation index was calculated by dividing the cpm obtained for the cells cultured in the presence of infected macrophages of P388D 1 by the cpm obtained for the cells cultured in the presence of non-infected macrophages, but they were subjected to the same conditions as the infected macrophages. The results shown in Figure 1 indicate that the macrophage P388D 1 infected with L. donovani processes parasite antigens and that optimal presentation occurs after 48 hours of infection. No stimulation of the T cells was observed by the non-infected macrophages. To isolate the L. donovani peptides associated with class I! of MHC, macrophages were infected with promastigotes of L. donovani during an initial incubation of 6 hours at room temperature. The cultures were then transferred at 37 ° C for the remainder of the 48-hour incubation period. At a ratio of 3-5 parasites per macrophage, almost 90% of the macrophages were infected after 24 hours of incubation at 37 ° C. The MHC class II molecules were then purified by affinity. Approximately 1.5 x 1010 cells infected with L. donovani or an equal number of uninfected P388D1 macrophages were used for each purification. The cells were recovered, washed with PBS and incubated with 30 min in cold lysis buffer (PBS, 1% Nonidet P40, 25 mM iodoacetamide, 0.04% sodium azide, 1 mM aprotinin and 1 mM PMSF). The insoluble material was removed by centrifugation at 40,000 g for 1 hour and the supernatant was recycled overnight at 4 ° C on a Sepharose column of 5 ml anti-MHC class II molecules (H-2d) (Sepharose Protein column G for which the monoclonal antibody MK-D6 has been attached). Culture supernatants of hybridoma cells of MK-D6 (American Type Culture Collection, Rockville, MD) were used as a source of anti-MHC class II monoclonal antibody (H-2d). The column was washed with 50 ml of lysis buffer and then with 50 ml of PBS containing 0.5% octyl glucopyranoside detergent. The bound molecules were eluted from the column with 1 M acetic acid in 0.2% NaCl. The MHC / peptide molecules were separated from the IgG (monoclonal antibody MK-D6) using a Centricon 100 filter unit (Amicon Division, W. R. Grace &; Co., Beverly, MA). The peptides were then dissociated from the class II molecules by the addition of acetic acid at 2.5 M, followed by separation using a Centricon 10 filter unit. The resulting peptide preparation, present in the low molecular weight sample, was then dried using a high speed vacuum concentrator (Savat instrument I nc., Farmingdale, NY). The peptides were redissolved in 200 μl of 0.05% TFA and separated by reverse phase high performance liquid chromatography (HPLC-FI) using a Vydac C-18 2.1 mm x 25 cm column at a flow rate of 0.15. ml / min using an acetonitrile gradient of 1 to 30% (60 min) followed by a gradient of 30 to 60% or (30 min) and then a gradient of 60 to 80% (90-1 1 0 min). Uninfected P388D 1 cells were processed similarly to serve as a background control for peptides associated with endogenous MHC. Figure 2 shows a representative experiment; four different peaks that are present only in the material in the material isolated from infected macrophages (panel B) and not in the material isolated from uninfected macrophages (panel A) were indicated. Of three independent peptide extractions, twenty-five different HPLC peptide peaks were isolated from macrophages infected with L. donovani and subjected to protein sequence analysis using an automatic Edman degradation in a Biosystems 477 gas phase protein sequencer. Protein sequence and amino acid analysis was carried out by W. M. Keck Foundation, Biotechnology Resource Laboratory, Yale University, New Haven, CT. Virtually all determinations could not be made for the first position. Also, in most cases, the definition of the amino acid residues at positions 10-15 was based on the quantitative dominance of one residue over another. Using this approach, the sequences obtained for several peptides showed the presence of 3-6 different residues in many of the 10-15 sequence cycles analyzed for each determination, reflecting a mixture of peptides. In addition, the sequences can not be obtained for some peaks because the peptides were blocked. Regardless of this, three peptide sequences were determined. The amino acid sequences were searched for identity with proteins in the Gen Bank database using the G EN PETP, PI R and SWISSPROT programs. The sequence of the database analysis revealed that one of the peptides was highly homologous to glyceraldehyde-3-phosphate dehydrogenase for several species. Another peptide had homology to the elongation factor of several species, including Leishmania. The third consequence was not clearly related in any of the known proteins and is shown below: XQXPQ (L / K) VFDEXX (S EQ I D NO: 1 1). B. Cloning and Sequencing of the Ldp23 Gene In order to recover the L. donovani protein that was processed into a peptide associated with the MHC class II molecules of infected macrophages, the sequence of peptides of uncertain origin was chosen to guide the strategy to clone the corresponding parasite gene. A DNA fragment was initially amplified from L. donovani promastigote cDNAs by PCR. The sense primer was a peptide derived from oligonucleotide (5 '> GGAATTCCCCInCAGCTInGTInTTCGAC < 3') (SEQ ID NO: 12) containing an EcoRI restriction endonuclease site (underlined). The bases were selected following the use of the preferential codon of L. donovani, as described in Langford et al., Exp. Parasite !, 74: 360 (1992). Inosine was used for the residues at positions 4, 6 and 7 because the low codon usage ensures the corresponding amino acids. In addition, L-glutamic acid with terminal carboxyl was not included for the design of the initiator. The counter-sense initiator was a poly-thymidine oligonucleotide (oligo dT downstream primer) containing a restriction endonuclease site Xho. The gene fragment was amplified from L. donovani promastigote cDNA preparation using the following reaction conditions: a 3 minute cycle at 94 ° C immediately followed by 45 ° C and 1 minute at 72 ° C. The cDNA of L. donovani was prepared from 5 x 10 'forms of washed promastigotes recovered in the log growth phase (3 days of culture). The cDNA was obtained using an Invitrogen ™ cDNA cycle kit (Invitrogen Co., San Diego, CA). The oligonucleotide primers were synthesized by DNA Synthesis Laboratory, Department of Pathology, Yale, University School of Medicine. The PCR products were analyzed by gel electrophoresis. Only one band of approximately 300 bp was obtained. This fragment was cloned and its sequence confirmed the initiator sequence based on the peptide including the glutamic acid codon, deliberately not included in the sequence of the primer. The amplified PCR fragment was ligated into the pCR ™ vector using the TA cloning system (Invitrogen Co., San Diego, CA). Transformants were selected in the Lb medium containing 100 μg / ml of ampicillin and the plasmid DNA was isolated using the DNA purification equipment of Wizard ™ Munipreps (Promega Co., Madison, SI). The DNA insert was released with restriction enzymes EcoRI and Xho \ (New England Biolabs, Beverly, MA), purified from an agarose gel electrophoresis and labeled with 32P using a random initiation method (Megaprime Labeling Kit, Amersham Life Science, Buckinghamshire, England). This DNA fragment was used as a probe to screen a promastigote cDNA library of L. donovani as described in Skeiky et al., Infect. Immun. 62: 1643 (1994). A cDNA of approximately 650 bp (Ldp23) of the phagemid was excised by extirpation in vivo using the Stratagene protocol. DNA sequencing was carried out using the version 2 sequence system (DNA sequencing kit) in the presence or absence of 7-deaza-GTP (United States Biochemical, Cleveland, OH). The sequences were provided as SEQ ID NO: 3 and shows complete homology with the original 300 bp PCR fragment. An open 525 bp reading frame containing an ATG codon that tracks the last four bases of the leader sequence and 3 stop codons adjacent to the poly A tail was identified. This frame also encodes the carboxyl terminal sequence (KVFDE) (SEQ ID NO: 13) of the peptide associated with purified MHC class II. The deduced protein sequence revealed a potential glycosylation site (Asn-Cys-Ser) at positions 68-70. Sequence analysis was carried out using the University of Wisconsin Genetics Computer Group Programs and the GenBank and EMBL databases of protein and DNA sequences. Research for homology of the Ldp23 gene with known sequences did not reveal significant homology. C. Bacterial Expression and Recombinant Protein Purification The recombinant L. donovani peptide donor protein was produced in E. coli transformed with the expression vector pGEX 2T in which the Ldp23 gene was subcloned in frame. PCR was used to clone the gene cloned in the frame into the expression vector pGEX 2T. The primers containing the appropriate restriction site enzymes, the initiation and termination codons were: 5 '>; GGATCCATGGTCAAGTCCCACTACATCTGC < 3 * (SEQ ID NO: 14) for the upstream initiator and 5 '> GAATTCAGACCGGATAGAAATAAGCCAATGAAA < 30 (SEQ ID NO: 15) for the downstream primer (restriction sites of Bam \ and EcoRI are respectively underlined). The PCR conditions were as indicated above for the amplification of the DNA fragment related to the original peptide. The pattern used was the pBluescript plasmid containing the gene cloned from the cDNA library. Overexpression of the recombinant fusion protein was achieved by the growth of transformed E. coli (DH5a) and inducing the tac promoter with 1 mM isopropyl-β-thiogalactopyranoside (IPTG) (Stratagene, La Jolla, CA). The cells were collected, centrifuged and analyzed for the presence of the fusion protein by SDS-PAGE. A glutathione-S-transferase fusion protein of 43-44 kD was produced, which indicates a leishmania protein of approximately 28 kD, since glutathione-S-transferase (GST) has a MW of 36 kD. However, the fusion protein was very insoluble and therefore can not be purified by affinity chromatography using a glutathione column. The use of low concentrations of similar SDS detergents. Sarcosyl, deoxycholate and octyl-glucopyranoside during the extraction steps was efficient to solubilize the protein but unfortunately it avoided its union with the glutathione column. Other maneuvers, such as the growth of E. coli and the incubation and induction of the tac promoter with IPTG at 33 ° C, did not improve the solubility of the protein. However, purification was achieved by preparative SDS-PAGE. The band was visualized 0.1M KCl, cut and electroeluted from the gel followed by extensive dialysis against PBS and the Centricon 10 filter concentration. Approximately 500 μg of purified protein were obtained. The purified protein is shown in Figure 3. In panel A, E. coli (DH5a) transformed with the expression vector pGEX 2T containing the Ldp23 gene was grown in LB medium and the taq promoter was induced with IPTG for 3 hours . The cells were pelleted, resuspended to load the buffer and subjected to SDS-PAGE (10%) under reducing conditions. The gel was stained with Coomassie blue. Line 1 shows uninduced E. coli and land 2 shows E. coli induced. The arrow indicates the recombinant protein. Panel B shows the protein prepared as in panel A and subjected to preparative SDS-PAGE. The band corresponding to the overexpressed recombinant fusion protein was identified by KCl, cut and electroeluted from the gel separation, dialysed against PBS and subjected to analytical SDS-PAGE (12%). The numbers on the left side indicate the molecular weights of the markers. They were not successful in further purifying the leishmania protein by separating it from the GST fusion protein with thrombin. D. Expression of Ldp23 To ensure that the peptide Ldp23 was expressed in Leishmania organisms, a Northern blot analysis was carried out using RNA prepared from different growth phases of promastigotes (logarithmic and stationary) and the amastigote form of these parasites The RNA was prepared from 2 x 10 7 parasite cells using the Micro RNA isolation kit (Stratagene, La Jolla, CA) according to the instructions recommended by the protein. RNA was prepared from promastigotes of L. donovani (logarithmic growth phase); of L. major promastigotes (logarithmic and stationary growth phases); of L. amazonensis, both promastigotes (logarithmic and stationary growth phases) and purified amastigotes of mice infected by CBA / J; and L. pifanoi, both promastigotes (logarithmic and stationary growth phases) and amastigotes (axenic culture medium). The promastigotes of L. donovani (strain 2S), L. amazonensis (M HOM / BR / 77 / LTB0016), L. major (MHOM / IR / 79 / LRC-L251) and L. pifanoi (M HOM / VE / 60 / Ltrod) were developed and maintained at 26 ° C in Schneider medium containing 20% FCS and 50 μg / ml gentamicin. The amastigote forms of L. amazonensis were obtained by differential centrifugation of a "pus-like" leg pad lesion of mice infected for six months with this parasite. The amastigotes of L. pifanoi were obtained from axenic culture as previously reported by Pan and others, J. Euk. Microbiol 40: 213 (1993). Hybridization was carried out at 45 ° C in the presence of 50% formam ida, 5x Denhardt's solution, 0. 1% SDS, 100 μg / ml of an AD N of perma of single-h salmon. and 5x SS PE using 0.45 μm Nytran membrane filters Schleicher &; Schuell Keene, N H); The probe was the Ldp23 gene labeled with 32P. Figure 4 shows that a single band of 680 bp RNA was observed for all growth phases and forms of all Leishmanias tests. Within Figure 4, numbers 1, 2 and 3 refer to RNA obtained from promastigotes in the logarithmic growth phase, promastigotes in the stationary growth phase and amastigote forms, respectively and the numbers on the left side indicate that the Molecular weights of the markers in the base pairs. This result agrees with the corresponding gene size (525 bp) and with the molecular weight of the expressed protein and points of the ubiquitous distribution and expression of this gene within the Leishmania genus. E. Anti-L Antibody Response Induction. donovani in Mice and Rabbits by Purified Recombinant Protein. In order to evaluate the immunogenicity of the recombinant leishmania protein and to investigate its expression in the parasites, mice and rabbits were immunized with the GST fusion protein in A FC. BALB / c mice were immunized in the pad of the hind paw with 5-10 μg of protein emulsified in AFC. The concentration of the protein was determined using the Bio-Rad Protein Analysis reagent (Bio-Rad Laboratories, Richmond, CA). The mice were boosted 7 days later with 5-10 μg of protein emulsified in incomplete Freünd's adjuvant (AFI) i oculate in the peritonal cavity. The mice were bled 7 days after the second immunization. The New Zealand white rabbits (Millbrook Farm, Amherst, MA) were immunized according to the following protocol: an intramuscular (IM) injection of 25-30 μg of purified recombinant protein emulsified in AFC in each thigh in one day; an IM injection of 25-30 μg of purified protein emulsified in AFI in each shoulder on day 7; on day 15, 25-30 μg of the purified protein in PBS was injected into the subcutaneous tissue. The rabbits were bled 7 days after the last immunization. Sera were prepared and the anti-Leishmania antibody response was measured by Western blot analysis and by FACScan. In both cases promastigotes of L. donovani were used as antigen. Approximately 2 x 106 promastigotes of L. donovani were grown in Schneider's medium for 3 days (log phase), washed with PBS, used with SDS-PAGE charge buffer and subjected to electrophoresis under gel conditions. 15% polyacrylamide. Proteins were transferred into 0.45 μm Immobilon-P transfer membrane (Millipore Co., Bedford, MA) using a wet-type electrograft (Mini Trans-Blot Electrophoretic Transfer Cell, Bio Rad Life Science Division, Richmond, CA) during 2 hours at 50 V. The membranes were blocked overnight at room temperature with PBS containing 3% normal goat serum (SCN), 0.2% Tween-20 and 0.05% sodium azide, followed by 3 washes with PBS. . The spots were incubated for 3-4 hours at 4 ° C with a 1/200 dilution of pre-immune rabbit serum (line a, figure 5) or with the same dilution of antiserum protein rabbit antiserum (line B, Figure 5). The sera were previously absorbed 2 times with Mycobacterium tuberculosis H-37 RA of non-viable drying (Difco Laboratories, Detroit, Ml) and were diluted in PBS containing 1% SCN and 5% bovine milk without fat powder (Carnation, Nestlé Food Company, G lendale, CA). The membranes were then washed with PBS, incubated for 1 hour at room temperature with goat anti-rabbit IgG antibody conjugated with alkaline phosphatase (Promega, Madison, SI), washed once with PBS and 2 times with buffer solution of Veronal pH at pH 9.4. the reaction was visualized using the substrate mixture 5-bromo-4-chloro-3-indoyl-phosphate and nitroblue tetrazolium (Kirkegaard &Perry Laboratories I nc., Gaithersburg, M D) according to the manufacturer's instructions. Figure 5 shows that the antiserum of rabbit anti-recombinant protein detects a single 23 kDa protein (Ldp23) in the antigen preparation of Leishmania crude extract. No bands were observed when used in the anti-GST antiserum (not shown). further, the FACScan analysis (Figure 6) shows that the antibody induced by recombinant Lpd23 reacts with the live intact L. donovani promastigotes, thus signaling a cell surface expression of this molecule in these organisms. The dotted line of Figure 6 shows the indirect fluorescence fluorescence performed using serum from pre-immune mice and the solid line in Figure 6 shows the result obtained with anti-GST-Ldp23 antiserum from mice. Both sera were diluted 1/100. The parasites were washed with a tinsion buffer and incubated with goat anti-mouse immunoglobulin antibody conjugated with FITC. The intensity of the fluorescence was analyzed by FACScan. F. Recognition of Recombinant LDP23 by Lymph Node T Cells Specific for Leishmania To test the response of T cells to the Ldp23 protein, two groups of experiments were carried out. In the first experiment, lymph node T cells (105 / well) of BALB / c mice immunized with promastigotes of L. donovani (as described above) were stimulated to proliferate with 2 x 10 5 normal mononuclear basal cells treated with Mitomycin. C (CPA) e driven with the purified recombinant fusion protein. The proliferation of T cells was measured at 72 hours of culture. The values are expressed in Figure 7 as cpm and represent the average of a [3H] TdR incorporation of cultures in triplicate. The above cpm of the cells (T cells + CPA) grown in the presence of medium alone was 1291. Figure 7 shows that Leishmania-specific T cells proliferate well and in a dose-responsive form to recombinant Ldp23. No response was observed when purified GST was added in place of the recombinant fusion protein or when the lymph node T cells of the mice were immunized with AFC alone when stimulated to proliferate in the presence of the Leishmania fusion protein (not shown) ). Recognition of recombinant Ldp23 protein by Leishmania-specific T cells was also tested using two models of murine leishmaniasis, BALB / c mice highly susceptible to L. major and CBA / J mice susceptible to L. amazonensis as described in Champsi and McMahon-Pratt, Infecí. Immun. 56: 3272 (1988). These models were selected to investigate the cytokine pattern induced by Ldp23. In the mouse model of leishmaniasis, resistance was associated with Th1 cytokines while susceptibility was linked to Th2 responses. The cells of the lymphatic node were obtained 3 weeks after the initiation of infection of BALB / c mice with L. major and the ability of these cells to recognize recombinant Ldp23 was measured by proliferation and by the production of the IFN-α cytokines. and IL-4. 2 x 10 6 cells obtained from the popliteal lymph node drainage of infected mice was cultured for 72 hours in the presence of Ldp23 or recombinant Leishmania lysate. The levels of IFN-? and IL-4 in the culture supernatants were measured by ELISA as previously described (Chatelain et al., J. Immunol., 748: 1172 (1992), Curry et al., J. Immunol.Meth.104: 137 (1987) and Mossman and Fong, J. Immunol., Meth. 778: 151 (1989)) using monoclonal anti-IFN-α antibodies. and IL-4 (PharMingen, San Diego, CA). Ldp23 stimulated these cells to proliferate (not shown) and induced a normal Th1 type of cytokine response as indicated by the production of high levels of IFN-α. (panel A of Figure 8) and not IL-4 (panel B of Figure 8). Stimulation of these cells with a crude Leishmania lysate gave a mixed Th cytokine profile. Exactly the same pattern of cytokine production was obtained from CBA / J mice infected with L. amazonensis (not shown). These results clearly indicate that Ldp23 3s is a powerful and selective activator of the Th1 cytokines by the cells of mice. EXAMPLE 3 Preparation of Hsp83 This Example illustrates the antigen preparation of Leishmania Hsp83, having the sequence provided in SEQ ID NO: 6. A genomic expression bank with normal DNA of L. braziliensis (MHOM / BR / 75 / M2903) was constructed in the bacteriophage? ZAP II (Stratagene, La Jolla, CA). The expression bank was screened with pre-absorbed Escherichia coli serum from an individual infected with L. braziliensis with LM. The immunoreactive plates were purified and the phagemid pBSK (-) was excised by the protocols suggested by the manufacturer. Nested deletions were performed with exonuclease III to generate overlapping deletions for single-strand pattern preparations and sequencing. Single-strand patterns were isolated after infection with auxiliary phage VCSM13 as recommended by the manufacturer (Stratagene, La Jolla , CA) and sequenced by the dideoxy chain termination method or by the Tag dye terminator system using the Applied Biosystems model 373A automatic sequencer model. The recombinant antigens produced by these clones were purified from 500 ml of cultures induced by isopropyl-β-D-thiogalactopyranoside (IPTG) as described in Skeiky et al., J. Exp. Med. 778: 201-211 (1992). These antigens were then analyzed for the ability to stimulate PBMCs of individuals infected with Leishmania to proliferate and secrete cytokine. Peripheral blood was obtained from individuals living in an area (Corte de Pedra, Bahia, Brazil) where L. braziliensis is endemic and where spidemiological, clinical and immunological studies have been carried out for a decade and CMSP were isolated from whole blood by density centrifugation through Ficoll (Winthrop Laboratories, New York, NY). For in vitro proliferation analysis, 2 X 105 were cultured at 4 X 10 5 cells per well in complete medium (RPMl 1640 supplemented with gentamicin, 2-mercaptoethanol, L-glutamine and 10% human serum A + combined sifted, Trimar, Hollywood, Calif) in 96-well flat bottom plates with or without 10 μg of the indicated antigens per ml or 5 μg of phytohaemagglutinin per ml (Sigma Immunochemicals, St. Louis, Mo.) For 5 days. The cells were then pulsed with 1 μCu of [3 H] thymidine during the final 18 hours of the culture. For the determination of cytokine production, 0.5 to 1 ml of PBMC were grown at 1 X 106 to 2 x 10 6 cells per ml with or without the Leishmania antigens for 48 and 72 hours. Supernatants and cells were cultured and analyzed for sifted cytokine or cytokine mRNA. The aliquots of the supernatants were analyzed for interferon gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin-4 (IL-4) and IL-10 as described in Skeiky and others J. Exp. Med. 787: 1527-1537 (1995). For PCR analysis of cytokine mRNA, total RNA was isolated from PBMC and the cDNA was synthesized using poly (dT) (Pharmacia, Piscataway, NJ) and reverse transcriptase from bird mycotoblast virus. After normalization for β-actin, the cDNA diluted by PCR using Taq polymerase (Perkin-Elmer Cetus, Fsoter City, CA) with concentrations of 0.2 μM of the respective 5 'and 3' external primers in a reaction volume of 50 μl. The nucleotide sequences of the primary pairs and the PCR conditions used were as described in Skeiky and others, J. Exp. Med. 787: 1527-1537 (1995). We verify that our PCR conditions are within the semi-quantitative scale by initially carrying out serial dilutions of cDNA and varying the number of cycles used for CPR. Plasmids containing the human sequences for IL-2, IFN- ?, IL-4, IL-10 and β-actin were digested and the DNA inserts were purified after separation on 1% agarose gels. Radiolabelled 32P probes were prepared by the random initiation method. The PCR products were analyzed by electrophoresis on 1.5% agarose gels, transferred to nylon membranes and tested with the appropriate 32 P-labeled DNA insert. A recombinant clone was identified in the previous analysis which, after comparison of sequences of its predicted amino acid sequence with the sequences of other proteins, was identified as a Leishmania homologue braziliensis of the 83 kD heat shock protein. aukaryotics The sequence of the clone was provided in S EQ I D NO: 5 and the deduced protein sequence was provided in SEQ I D NO: 6. On the basis of homology, this clone, designated Lbhsp83a, appears to lack the first 47 residues of the 703 full-length amino acid residues. Lbhsp83 has a global homology of 94% (91% identity and 3% conservative substitution), 91% (84% identity and 7% conservative substitution) and 77% (61% identity and 16% conservative substitution). with hsp83 of L. amazonensis. hsp83 of T. cruzi and hsp89 of humans, respectively. A second clone (designated Lbhsp83b), which contained the C-terminal portion of 43 kD of hsp83 (residues 331 to 703) was also isolated. Figure 19 presents a comparison of the sequence of Lbhsp83 with hsp83 of L. amazonensis (Lahsp83). Hsp83 of T. cruzi (Tchsp83) and hsp89 of humans (Huhsp89). The results of the prolification analyzes using Lbhs83a are shown in Table 1. The cells of all patients with mucosal leishmaniasis (ML) proliferated strongly in response to Lbhsp83a, with indications of stimulation (Sis) ranging from 19 to 558 (compared with 20 to 1,634 for parasite lysate). Proliferation of PBMC of patients with cutaneous leishmaniasis (LC) was variable and except for the levels in two patients (IV and VII), the levels were significantly lower than those of patients with LM. For comparison, the proliferative responses of individuals with LC of self-healing to Lbhsp83a were similar to those of individuals with LM. However, the responses of the six self-healing individuals for Lbhsp83 were consistently superior to those of Lbhsp83b. This suggests that CMSP of patients with self-healing LCs preferentially recognize one or more epitopes of T cells located within the amino portion of Lbhsp83. Table 1 In vitro Proliferation of PBMCs of Individuals Infected with L. braziliensis in Response to Lbhsp83 [3 H] Thymidine Incorporation [103 cpm (SD)], IS with: Group and Patient Lisato Lbhsp83a Lbhsp83b LM I 41.3, (1.3), 294 32.5, (6.6), 221 46.7, (1.4), 318 II 44.2, (0.5), 104 20, (3.7), 47 36.7, (076), 86 III 27.4, (1.5), 150 8.1, (1.7), 44 9.9, (0.32), 54 IV 52.7, (3.3), 138 54.1, (6.2), 142 32.0, (1.3), 84 V 140.6, (7.6) , 308 151.8, (57), 333 150.4, (7.9), 331 VI 15.8, (1.8), 20 21.3, (4.4), 28 14.4, (1.3), 19 VIL 300.1, (9.4), 1634 102.1, (706), 558 41.7, (4.9), 228 Incorporation of [3 H] thymidine media [103 cpm (SD)], IS with: Group and Patient Lisato Lbhsp83a Lbhsp83b LC I 0.26, (0.0), 1.5 0.57, (0.3), 3.3 0.43, (0.17), 3.3 II 55.63, (8.6), 218 0.42, (0.0), 1.6 0.8, (0.14), 3.2 III 0.39, (0.5), 4.0 3.4, (0.5), 9 2.6, (0.9), 6.6 IV 19.14, (1.3), 87 7.17, (0.6), 32 5.9, (0.9), 27 V 0.32, (0.2), 3.0 1.47, (0.5), 14 0.3, (0.1), 3.0 VI 0.77, (0.1), 4.7 1.44, (0.2), 9 1.3, (0.6), 8.0 Vil 4.01, (1.0), 2.0) 60.3, (8.5), 15 66.7, (3.9), 16.6 Self-healing LC i 19.7, (4.4), 94 61.3, (4.6), 293 5.0, (2.0), 24 II 0.6, (0.1), 6.5 7.0, (2.0), 79 1.3, (0.8), 13 III 59.6, (7.1), 519 49.4, (3.1), 429 21.4, (3.7), 186 IV 0.2, (0.1), 1.6 13.1, (1.7), 108 0.6, (0.1), 5 V 27.1, (2.0), 225 6.3, (2.6), 52 3.0, (1.5), 25 VI 130.3, (14), 340 28.2, (2.9), 74 7.7, (3.8), 20 Control (not infected) I 0.19, (0.0), 1.4 0.18, (0.0), 1.3 0.40, (0.16), 2.8 II 0.31, (0.1), 1.7 0.19, (0.0), 1.0 0.27, (0.0), 1.5 III 0.44, (0.2), 4.1 0.48, (0.1), 5.0 0.51, (0.2), 5.2 IV 0.4. (0.1), 3.2 0.52, (0.2), 5.1 0.50, (0.1), 5.0 An analysis in greater detail in CMSP cytokine patterns of patients with LM was carried out by reverse phase transcriptase PCR. Cytokine mRNAs were evaluated in cells before culture (Figure 9, line O) or after culture in the absence (lines -) or presence of the indicated antigen for 48 and 72 hours. Figure 4A shows the results for five of the six patients with SCI whose PBMCs were analyzed. In about half of the patients with SCI, the uncultivated (remaining) PBMCs had detectable levels of mRNA for IFN- ?, IL-2 and IL-4 but not IL-10. However, the PBMCs of patients with LC had IL-10 mRNA in the resting state in addition to mRNA for the other cytokines tested (Figure 4B). After in vitro culture without antigen, mRNA levels for IFN-α, IL-2 and IL-4 in the resting cells of patients with LM decreased to background levels while IL-10 mRNA levels were increased. In contrast, CMSP of most patients with LC had stable or increased I L-10 mRNA, whereas mRNAs for IL-2, IFN-α and IL-4 were reduced to almost detectable levels in the absence of antigen stimulation. In CMSP of three patients with LM. Stimulation with lysate resulted in increased expression of mRNA for IFN-? IL-2 and IL-4 but not for IL-10. For comparison, both polypeptides of Lbhsp83 gave the production of mRNA for IFN-α. and IL-2 of all the CMSP of patients with ML tested. In contrast, the mRNA profiles for IL-10 and IL-4 differ for the two hsp83 polypeptides. Lbhsp83a stimulated the production of 1L-10 bolt non-IL-4 mRNA (patients I, II, III and IV), while Lbhsp83b stimulated the production of IL-4 but not IL-10 mRNA in all six patients. All the patients with LC tested responded to the polypeptides of Lbhsp83 as well as to the lysate of parasites regulating the synthesis of mRNA for IL-2 and IFN-α. and in two out of four patients (I and IV), the level of IL-4 mRNA was also increased, indicating the stimulation of both Th1 and Th2 cytokines. Interestingly, and as it is in the case of uncultivated PBMC from patients with ML who do not have detectable levels of IL-10 mRNA, Lbhsp83a and Lbhsp83b stimulated PBMC from a patient with LC (IV) to synthesize IL-0 mRNA. However, in the other three patients (I, ll, and III) with remaining levels of I L-10 mRNA, both polypeptides of rLbhsp83 as well as the parasite lysate down-regulated the expression of IL-10 mRNA. PBMC supernatants were also analyzed for the presence of secreted IFN-α, TNF-α, IL-4 and IL-10. The cells of all patients with ML and self-healing LC (seven and six patients, respectively) and four to seven patients with LC were analyzed for IFN-? secreted after stimulation with the polypeptides of rLbhsp83, parasite lysate and Lbhsp70, a protein of L. braziliensis homologous to the 70 kD eukaryotic heat shock protein (Figure 10A). In general, rLbhsp83 stimulated patient PBMCs to secrete higher levels of IFN-? of what rLbhsp83b (0.2 to 36 and 0.13 to 28ng / ml, respectively). The presence of I FN-? secreted correlated well with the corresponding AR N m detected by PCR. PBMC of four to five patients with LM (I, II, V and Vi l) had TNF levels in the supernatant (0.8 to 2.2 ng / ml) higher than those detected in PBMC cultures from uninfected controls after stimulation with parasite lysate (Figure 10B). Similarly, the same PBMCs were stimulated by rLbhsp83 to produce TNF-a levels in the supernatant ranging from 0.61 to 2.9 ng / ml. Compared with those uninfected controls, CMSP of three (I, V, and VI), five (I, II, IV, V and VI) and two (II and V) of six individuals analyzed produced higher levels of TNF-a in response to parasite lysate, rLbhsp83 and rLbhsp83b, respectively. TNF-a levels produced by PBMC from patients with LC in response to parasite lysate were comparable to those produced by uninfected controls. However, rLbhsp83 stimulated TNF-a production in the PBMC of two of these patients. rLbhsp83 stimulated higher levels of TNF-a production than rLbhsp83b. In the absence of antigen stimulation, only the PBMCs of patients with SCI (five of six) produced detectable levels of TNF-a supernatant (60 to 190 pg / ml). According to RNA m of I L-10, I L-10 was detected by ELISA in culture supernatants of stimulated CMSP with antigens from patients with LM and LC. Levels (49 to 190 pg) were significantly higher (up to 10 times) after stimulation with rLbhsp83a compared with those after parallel stimulation of the same cells with rLbhsp83b (Figure 11). Parasite lysate also stimulated CMSP of some of these patients to produce IL-10. Although rLbhsp83 stimulated PBMC from uninfected individuals to produce I L-10, with one exception, the levels were lower than those observed with patients' PBMC. IL-4 was not detected in any of the supernatants analyzed. Therefore, the level of secreted IL-4 was lower than the detection limit of the ELISA used (50 pg / ml). Taken together, the results demonstrate that a predominant Th1 type cytokine profile was associated with PBMC from individuals infected with L. braziliensis after stimulation of rLbhsp83 polypeptides. To determine the correlation between cell responsesT observed and the production of antibodies for Lbhsp83, we compared the reactivities of antibodies (immunoglobulin G) with Lbhsp83 in the serum of three groups of patients (Figure 12). The ELISA reactivities of sera from patients with LM with rLbhsp83a were comparable with those observed with parasite lysate and in general, there was a direct correlation between the titration of anti-Lbhsp83 antibody from patients with LM and the proliferation of T cells. 23 serum samples from patients with SCI analyzed, 22 were positive (-with absorbance values from 0.20 to> 3.0. Eleven of the serum samples from patients with SCI had optical density values that were> 1. In general, patients with LC had significantly lower anti-Lbhsp83 antibody titers (x = 0.74, normal error of the mean [SEM] = 0.1) compared to those of patients with LM.Therefore, titers of anti-rhsp83 antibody from patients with LM and LC were correlated with their respective T-cell proliferative responses.The titrations of anti-rLbhsp83 antibody were significantly higher in patients with LM (x = 1.5; M = 0.2) than in patients with self-healing LC (x = 0.35; SEM = 0.056), although their T cell proliferative responses were similar. In fact, titers of anti-Lbhsp83 antibodies in serum of patients with self-healing LC were comparable with that of uninfected controls (x = 0.24, SEM = 0.028). Using 2 normal deviations greater than the absorbance value of uninfected control medium (0.484) as a criterion for positive reactivity to Lbhsp83, eight of nine of the self-curable serum patient samples proved to be negative. EXAMPLE 4 PREPARATION OF CLONES CODING LT-210 This example illustrates the preparation of portions coding for the Leishmania antigen Lt-210, and having the sequence provided in SEQ ID NO: 8. An expression bank was constructed from L. tropic genomic DNA (MHOM / SA / 91 / WR1063C). The DNA was isolated by solubilizing L. tropic promastigotes in 10 mM Tris-HCl, pH 8.3, 50 mM EDTA, 1% SDS and treating it with 100 μg / ml RNaseA and 100 μg / ml proteinase K. The sample then it was extracted sequentially with an equal volume of phenol, phenol: chloroform (1: 1) and chloroform. The DNA was precipitated by adding 0.1 volume of 3M sodium acetate (pH 5.2) and 2.5 volume of 95% ethanol. The precipitate was resuspended in 10 μM Tris, 1 mM EDTA. The DNA was shared by passage through a 30 gauge needle at a scale of 2-6 kilobases in size, and repaired by incubation with DNA poly in the presence of 100 μM of each dATP, dCTP, dGTP and dTTP. The EcoRI adapters were ligated to the DNA fragments. After removal of adapters linked by passage over a G-25 Sephadex ™ column, the fragments were inserted into the EcoRI cut of Lambda Zap II (Stratagene, La Jolla, CA). Approximately 43,000 pfu were plated and sieved with serum isolated from patients with viscerotropic leishmaniasis (VLT). Serum from patients with VTL were received from Drs. M. Grogl and A. Magill. The group of patients with VTL included eight individuals from whom they isolated parasites and were cultured, seven of whom had an infection confirmed with L. tropic. Four other patients had negative cultures, but were considered infected based on PCR analysis or a positive monoclonal antibody mount (Dr. Max Grogl, personal communication). The serum samples from the 11 patients were infected and the anti-E reactivity was removed. coli by affinity chromatography (Sambrook et al., supra, pp. 12.27-12.28). The reactive proteins that express the lambda phage. they were detected after the binding of the antibody by protein A-horseradish peroxidase and the ABTS substrate. Three clones, Lt-1, Lt-2 and Lt-3, containing a portion of the Lt-210 gene were identified and purified. The clones ranged in size from 1.4 to 3.3 kb and the coveted 75 kD polypeptides, 70kD and 120kD, respectively. These three clones contain partial sequences of the Lt-210 gene. Lt-1 and Lt-2 are overlapping clones and were chosen for further study. The DNA sequences of Lt-1 and Lt-2 were determined. The digestion of exonuclease II was used to create overlapping deletions of the clones (Heinikoff, Gene 28: 351-359, 1984). The single-stranded pattern was prepared and the sequence determined with the Applied Biosystems Automatic Sequencer model 373A or by Sanger dideoxy sequencing. The sequence of both strands of the coding portion of the Lt-1 clone was determined. The partial sequence of one strand of the Lt-2 clone was determined. SEQ ID NO: 7 presents the DNA sequence of Lt-1 and SEQ ID NO: 8 provides the predicted amino acid sequence of the open reading frame. The DNA sequence of the coding portion of clone Lt-1 includes a sequence of nucleotides repeated in the 5 'portion of the clone containing eight copies of a 99 bp repeat, three copies of a 60 bp repeat unit, which it is part of the larger 99 bp repeat and 800 bp of sequence without repetition. The amino acid sequence deduced from the 99 bp repeat contains limited degenerations. The mass of the predicted recombinant protein is 67,060 Daltons. An investigation of the PIR database with the predicted amino acid sequence of the open reading frame was not produced significant homology to the previously presented sequences. The predicted secondary structure of the portion of the repeat portion of the clone is completely a-helical. The sequence analysis of Lt-2 revealed that the 3 'portion of the clone consisted of a mixture of 60 and 99 bp repeats that were identical except occasionally degenerations were observed, for the 60 and 99 bp repetitions in Lt-1. Collectively, the sequencing data suggest that Lt-1 and Lt-2 are different portions of the same gene, Lt-2 being upstream of Lt-1, with the possibility of a small overlap. Hybridization analysis confirmed that rLt-2 and rLt-2 contain overlapping sequences. The genomic NAs of several Leishmania species were restricted with a variety of enzymes, separated by agarose gel electrophoresis and analyzed by staining on a Nytran membrane filter (Schleicher &; Schuell, Keene, NH). The rLt-1 and rLt-2 inserts were labeled with 32 P-CTP by reverse transcriptase of oligonucleotide primers and used as probes after separation of nucleotides not incorporated in a Sephadex G-50 column. Hybridizations using the rLt-1 or the rLt-2 donated probe were carried out in NaH2P04 / 3.6M OAM of NaCI at 65 ° C, while hybridization using the rLt-1 r probe was carried out in 0.2 M NaH2P04 / 3.5 M NaCl / 0.2 M EDTA at 60 ° C overnight. The filters were washed in 0.075 M NaCl / 0.0075 M sodium citrate pH 7.0 (0.15 M NaCl / 0.0150 M sodium citrate for the Lt-1 probe), plus 0.5% SDS at the same temperature as hybridization . Genomic DNA from a number of Leishmania species including L. tropic were analyzed by Souther spot analysis as described above using Lt-1, Lt-2 and Lt-1 r inserts separately as probes. Collectively, several L. trópica DNA digestions indicate that this gene has a lower copy number, a similar overlapping pattern, was observed using either the Lt-1 or Lt-2 inserts as a probe, which agrees with the premise of that these two clones contain sequences that are closer or that overlap with others. In addition, the sequences that hybridize with these clones are present in other Leishmania species. Isolates of L. tropic have limited heterogeneity. Southern analyzes of digested genomic DNA from four strains of L. tropic parasites isolated from VTL patients and three strains of L. tropic parasites isolated from LC cases (two humans, one canine) were carried out. The Lt-1 r insert was labeled and used as a probe. The seven different isolates of L. tropic gave similar intensities and restriction patterns, with only a single restriction fragment length polymorphism among the isolates. These data, together with Southern analyzes with additional enzymes, indicate limited heterogeneity in this region among L.tropic isolates. The recombinant proteins of Lt-1 and Lt-2 were expressed and purified. The nested deletion set of Lt-1 formed for sequencing included a clone termed as Lt-1 r, which contains one and a third of repeats. This polypeptide was also expressed and purified. In vivo excision of phagemid SK 'from pBluescript of Lambda Zap I I was carried out according to the manufacturer's protocol. The phagemid virus particles were used to infect £. coli XL-1 Blue. Protein production was induced by the addition of I PTG. Protein was recovered by first lysing bacteria pellets induced from pH buffer (LB, 50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 10 mM EDTA) using a combination of lysozyme (750 μg / m L) and sound treatment. rLt-1, rLt-2 and rLt-1 r, were recovered from the inclusion bodies after solubilization in 8M of urea (rLt-1 and rLt-2) or 4M of urea (rLt-1 r). The rLt-1 and rLt-2 proteins were enriched and separated by precipitation with 25% -40% ammonium sulfate and rLt-1 r was enriched by precipitation with 10% -25% ammonium sulfate. The proteins were further purified by preparative gel electrophoresis in 10% S-DS-PAG E. Recombinant proteins were eluted from the gels and dialyzed in phosphate buffered saline (PBS). The concentration was measured by the Pierce BCA analysis (Rockfor, I L) and the purity was evaluated by Coomassie blue tinsion after S DS-PAG E. EJ EMP LO 5 PREPARATION OF Lbel F4A This example illustrates the molecular cloning of a DNA sequence encoding the ribosomal antigen of L. braziliensis Lbel F4A. A genomic expression library was constructed with shared DNA of L. braziliensis (MHOM / BR / 75 / M2903) in the bacteriophage? ZAPII (Stratagene, La Jolla, CA). The expression bank was screened with serum from a pre-absorbed E. coli patient from an individual infected with L. braziliensis with mucosal leishmaniasis. Plates containing immunoreactive recombinant antigens were purified and pBSK (-) phagemid excised using the manufacturer's protocols. Nested deletions were carried out with Exonuclease I 1 to generate overlapping deletions for single-strand normal pattern preparations and sequencing. The single-strand patterns were isolated after infection with the auxiliary phage VCSM 13 as recommended by the manufacturer (Stratagene La Jolla, CA) and sequenced by the dideoxy chain termination method or by the dye termination system. Taq using the Applied Biosystems Model 373A Automatic Sequencer. Immunoreactive recombinant antigens were then analyzed in T cell analyzes for their ability to stimulate proliferative cytokine production, as described in Examples 7 and 8 below. A recombinant clone was identified in the above analysis which, after comparison of the sequence of its predicted amino acid sequence with sequences of other proteins, was identified as a homolog of Leishmania braziliensis of eukaryotic initiation factor 4A (elF4A). The isolated clone (pLelF.1) lacked the first 48 amino acid residues (144 nucleotides) of the full-length protein sequence. The sequenced pLelF.1 insert was subsequently used to isolate the full length genomic sequence. SEQ ID NO: 9 shows the entire polypeptide sequence LbelF4A full length. The open reading frame (nucleotides 115-1323) encodes a protein of 403 amino acids with a predicted molecular weight of 45.3 kD. A comparison of the predicted protein sequence of LbelF4A with the homologous proteins for tobacco (TelF4A), mice (MelF4A) and yeast (YelF4A) shows extensive sequence homology, with the first 20-30 amino acids being more variable. The lengths (403, 413, 407 and 395 amino acids), molecular weights 845.3, 46.8, 46.4 and 44.7 kDa) and isoelectric points (5.9, 5.4, 5.5 and 4.9) of LbelF4A, TelF4A, MelF4A and YelF4A, respectively, were similar. LbelF4A shows a global homology of 75.5% (575 identity, 18.5% conservative substitution) with TelF4A, 68.6% (50% identity, 18.6% conservative substitution) with MelF4A and 67.2% (47.6% identity, 19.6% of conservative substitution) with YelF4A. EXAMPLE 6 PREPARATION OF SOLUBLE LEISHMANIA ANTIGENS This example illustrates the preparation of soluble Leishmania antigens from a supernatant of L. major culture. The promastigotes of L. major developed to the late log phase in complex medium with serum until they reached a density of 2-3 x 107 viable organisms per mL of medium. The organisms were washed uniformly to remove components from the medium and resuspended to 2-3 x 107 viable organisms per mL of defined serum free medium consisting of equal parts of RPMl 1640 and medium 199, both from Gibco BRL, Gaithersburg, MD. After 8-12 hours, the supernatant was removed, concentrated 10 times and dialysed against phosphate-buffered saline for 24 hours. The concentration of the protein was then determined and the presence of at least eight different antigens was confirmed by SDS-PAGE. This mixture is referred to herein as "soluble Leishmania antigens". EXAMPLE 7 COMPARISON OF PRODUCTION OF I NTERLEUCINE-4 AND INTERFERON-? STIMULATED BY ANTIGENS FROM LEISHMANIA This Example illustrates immunogenic properties of the antigens prepared according to Examples 1, 2, 5 and 6, as determined by its ability to stimulate IL-4 and IFN-? in lymph node cultures of infected mice and in human PBMC preparations. The lymph node cultures for use in these studies were prepared from BALB / c mice infected with L. major 10 days after infection as described in Example 2 PBMC were prepared using peripheral blood obtained from individuals with cured L. donovani infections who responded immunologically to Leishmania. The diagnosis of the patients was made in clinical findings associated with at least one of the following. Isolation of parasites from lesions, a positive skin test with Leishmania lysate or a positive serological test. Uninfected individuals were identified based on a lack of clinical signs or symptoms, or a lack of history of exposure or travel to endemic areas, and absence of a serological or cellular response to Leishmania antigens. Peripheral blood was collected and PBMC were isolated by density centrifugation through Ficoll ™ (Winthrop Laboratories, New York). The culture supernatants were analyzed for the levels of IL-4 and IFN-α. secreted. IFN-y were quantified by a double walled ELISA using IFN-? Anti-human mouse mAb (Chemicon, Temucula, CA) and IFN-γ serum anti-human polyclonal rabbit. rIFN-y human (Genentech, Inc., San Francisco, CA) was used to generate a normal curve. IL-4 was quantified in supernatants by a double walled ELISA using a mouse anti-human IL-4 mAb (M1) and a polyclonal rabbit anti-human IL-4 serum (P3). Human IL-4 was used (Immunex Corp. Seattle, WA) to generate a normal curve ranging from 50 pg / ml to 1 ng / ml. Figures 13A and 13B illustrate the average level of IL-4 and IFN-? secreted, respectively, 72 hours after the addition of 10 μg / mL of each of the following antigens to a culture of the lymph node prepared as described above: the soluble Leishmania antigen (ie, an extract prepared from broken promastigotes that they contain membrane and internal antigens (SLA), Ldp23, LbelF4A (LelF), Lbhsp83, M15 and LmelF (the L. major homolog of LbelF4A). The levels of IL-4 and IFN-? secreted in the middle only (that is, not stimulated) were also shown. While SLA produces a predominant Th2 response of lymph node cells from mice infected with Leishmania, Ldp23, LbelF4A, Lbhsp83 and M15 produced relatively little IL-4 and large amounts of IFN-α, which agrees with a response profile of Th1. Figure 14 shows the level of IFN-? secreted in the culture filtrate of infected and uninfected human PBMC preparations 72 hours after the addition of 10 μg / mL) of L. major lysate, M15 or L-Rack, an immunodominant leishmania antigen in murine leishmaniasis. Similarly Figure 15 illustrates the level of IFN-? secreted in the culture filtrate of infected and uninfected human PBMC preparations 72 hours after the addition of 10 μg / mL of L. major lysate, soluble Leishmania antigens (prepared as described in Example 6) or L- Rack These results indicate that M15 and soluble Leishmania antigens, but not L-Rack, are potent stimulators of IFN-α production. in CMSP of patients but not in CMSP obtained from non-infected individuals. Therefore M15 and soluble Leishmania antigens produce a dominant Th1 cytokine profile in both mice and humans infected with Leishmania. EXAMPLE 8 COMPARISON OF PROLIFERATION STIMULATED BY ANTIGENS FROM LEISHMANIA This example illustrates the immunogenic properties of the antigens prepared according to Examples 1, 2, 5 and 6, as determined by their ability to stimulate proliferation in lymph node cultures of infected mice and in human PBMC preparations. For in vitro proliferation assays, 2 - 4 x 10 cells / well were cultured in complete medium (RPMl 1640 supplemented with gentamicin, 2-ME, L-glutamine, and 10% human serum A + combined sieve, Trimar, Hollywood, CA) in 96-well bottom plates with or without 10 μg / ml of the indicated antigens or 5 μg / ml of PHA (Sigma Immunochemicals, St. Louis, MO) for five days. The cells were then pulsed with 1 μCi of [3 H] of thymidine for 18 final hours of culture. Figure 16 illustrates the proliferation observed after the addition of 10 μg / ml or 20 μg / ml of each of the following antigens to a lymph node culture prepared as described in Example 7: SLA, Ldp23, LbelF4A , Lbhsp83 and M15. The level of proliferation addition of antigen is also shown. The data is represented as average cpm. These results demonstrate that a variety of Leishmania antigens are capable of the proliferation of lymph node cells that stimulate mice infected with Leishmania. Figures 17 and 18 illustrate the proliferation observed in preparations of human PBMC from individuals immune to Leishmania and uninfected after the addition of 10 μg / mL of M15 and soluble Leishmania antigens, respectively. These values were compared with the proliferation observed after the addition of culture medium, L. major lysate or L-Rack. The results show that M15 and soluble Leishmania antigens stimulate proliferation in CMSP immune to Leishmania, but not in PBMCs obtained from non-infected individuals, demonstrated that M15 and soluble antigens (but not L-Rack) are recognized by PBMCs of immune individuals to Leishmania due to a previous infection. EXAMPLE 9 PREPARATION OF Lmspla and Lmsp9a This example illustrates the preparation of two soluble Leishmania antigens. Lmspla and Lmsp9a. A. Purification of Lmspla and Lmsp9a from a mixture of soluble L. maior antigens A high-titrated rabbit serum emerged against soluble L. major soluble antigens, prepared as described in Example 6. Specifically, a white rabbit was immunized of New Zealand subcutaneously to multiple sites with 180 μg of soluble L. major antigens in a suspension containing a suspension of 100 μg of muramyl dipeptide and 50% incomplete Freund's adjuvant. Six weeks later the rabbit was subjected to a subcutaneous reinforcement of 100 μg of the same soluble antigen preparation in incomplete Freund's adjuvant. This was followed by two intravenous boosts separated by two weeks, each with 100 μg of the soluble antigen preparation. The serum was recovered from the rabbit 11 days after the final boost. Antibody reactivities of E. coli were removed from rabbit serum pre-absorbing on nitrocellulose filters containing E. coli lysate. Absorbed serum was evaluated by Western blot analysis using 10 μg of Leishmania promastigote lysate (line 1) and 1 μg of soluble L. major antigen mixture (line 2). As shown in Figure 20, rabbit serum was found to be reactive with seven dominant antigens of the mixture of L. major soluble antigen with molecular weights ranging from 18 to > 200 kDa. A four-fold longer exposure of the same spot analysis revealed three additional immunoreactive species with molecular weights less than 18 kDa. The same sera reacted with approximately 10 antigens of the promastigote lysate, but with a pattern significantly different from that observed with the L. major antigens (Figure 20). This suggests post-translational modification of the same anterior antigen (intracellular localization) and after secretion / spreading. Such modifications may include the separation of a leader sequence and / or the addition of carbohydrate molecules to the secreted / scattered antigens. The rabbit sera described above were subsequently used to screen an L. major cDNA expression library prepared from L. major promastigote RNA using the unidirectional Lambda ZAP (uni-ZAP) kit (Stratagene) according to the protocol of maker. A total of 70,000 pfu of the amplified cDNA library was screened with rabbit serum at a dilution of 1: 250. Nineteen positive clones were screened in the tertiary screening. The phagemids were excised and the DNA from each of the 19 clones was sequenced using an automatic sequencer from Perkin Elmer / Applied Biosystems Division Model 373A. The 19 clones were found to represent different sequences, termed Lmspl a and Lmsp9a. The cDNA sequences determined for Lmspl a and Lmsp9a are provided in SEQ I D NO: 19 and 21, respectively, with the corresponding amino acid sequences being provided in SEQ I D NO: 20 and 22, respectively. B. Characterization of Lmsp l a and Lmsp9a Figure 21 shows the full-length cDNA (SEQ I D NO: 19) and the predicted amino acid sequence (SEQ I D NO: 20) for the Lmspl a antigen. The EcoRI / Xhol insert is 1019 bp long and contains the following characteristics: a) the last nt of the characteristic split leader sequence of all the AR Nm in the nucleated nucleus of the trypanosome; b) 39 nt of the 5 'untranslated sequence; c) an open reading frame of 453 nt long which encodes a deduced 151 amino acid sequence with a predicted molecular mass of 16,641 kDa; and d) 471 nt of the untranslated sequence ending with a poly A tail. The predicted amino acid sequence contains three potential phosphorylation sites at amino acid residues 3, 85 and 102. In addition, Lmspl a contains a sequence of RGD in the residue 104, a sequence that can play a role in the invasion of parasites. It has been shown that the RGD sequences mediate the union of various addition proteins to their cell surface receptors. There is no obvious leader sequence (secretory signal) in the amino terminal portion suggesting that the protein may be dispersed or excreted. Lmsp seems to be one of the most abundant antigens found in the supernatant of live promastigote cultures since clones 17 to 19 contain sequences of variable lengths identical to Lmsp l a. The comparison of the sequence of amino acids from Lmsp with sequences with ocs using the STAR DNA system (Version 87) revealed that Lmsp shares it between 65% to 70% of homology with the nucleoside diphosphate kinase protein. eukaryotic, also called in mice and humans as a tumor metastasis inhibitor gene. Southern blot analysis of L. major genomic DNA (Strain Friedlander) was digested with a panel of restriction enzymes (lines 1 to 7) and six other Leishmania species from different geographic locations digested with Pstl (lines 8 through 13) using the full length cDNA insert from Lmpsla, showed that Lmspla is present in all the species characterized with a high degree of conservation (Figure 22). This suggests the evolutionary significance for the maintenance of Lmspla and the existence of homologous species among Leishmania species. The other two remaining cDNA clones isolated from the mixture of L. major antigens represent identical sequences (designated as Lmsp9a; SEQ ID NO: 21), suggesting that the two copies result from the amplification of the primary bank. The cDNA sequencing of Lmsp9a revealed that the clone does not contain the full length 5 'sequence since it lacks the divided leader and the 5' untranslated sequences. The 3 'end of the cDNA contains an extension of poly A, as it could be expressed for Leishmania mRNA. Of the predicted translated sequence (SEQ ID NO: 22), 34 of the 201 amino acids (17%) represent the cysteine residues. Comparison of the predicted protein sequence with those known proteins as described above, revealed some homology with other cysteine-rich proteins such as the main surface tropozoite antigen of Giardia lamblia and furin proteases. EXAMPLE 10 PREPARATION AND CHARACTERIZATION OF MAPS-1A This example illustrates the preparation and characterization of Leishmania MAPS-1A antigen (SEQ ID NO: 24). A serum pool was obtained from 5 BALB / c mice which were given a primary immunization and two boosters with the crude L. major promastigote culture supernatant as described below in Example 12. Subsequently, it was shown that these mice were protected when confronted with a dose of live L. major promastigotes that are generally found to be lethal. Serum from mice thus obtained was used to screen a cDNA expression library of L. major amastigotes prepared as described in Example 1. Several severe seroreactive clones were isolated and sequenced using an automatic Perkin Elmer / Applied Biosystems sequencer. Model 373A Division (Foster City, CA). One of these clones, referred to herein as MAPS-1A, was found to be full length. Comparison of cDNA and deduced amino acid sequences for MPAS-1A (SEQ ID Nos: 23 and 24, respectively) with known sequences in the gene bank using the STAR DNA system did not reveal significant homologies for known Leishmania sequences, although found that some sequences have some similarity to a group of proteins to a group of thiol- specific antioxidants, found in other organisms. The recombinant MAPS-1A protein having an amino-terminal HIS-Tag was prepared using a high level of E. coli expression system and the recombinant protein was purified by affinity chromatography as described in Example 1. The analysis of Southern blots of L. major genomic DNA digested with a panel of restriction enzymes, seven other Leishmania spaces digested with Pstl, and two other pathogens of infectious disease (T. cruzi and T. brucei), using the full-length insert of MAPS-1A, demonstrated that MAPS-1A is present in the eight Leishmania species tested (Figure 23). In Northern blot analysis of promastigote and L. amastigote RNAs indicated that MAPS-1A is expressed constitutively. Using the oligonucleotide primers (SEQ ID NOS: 27 and 28) based on the cDNA sequence of MAPS-1A provided in SEQ ID NO: 23), the corresponding gene was isolated from L. tropic by means of PCR (using 30 cycles of the following sequence by temperature steps: 94 ° C , 1 minute, 50 ° C, 1 minute, 72 ° C, 1 minute). The cDNA sequence determined for MAPS-1A protein from L. tropic was provided in SEQ ID NO: 25. with the corresponding amino acid sequence being provided in SEQ ID NO: 26. The ability of recombinant MAPS-1A to stimulate cell proliferation was investigated as follows: PBMC from 3 patients infected with L. braziliensis who have active mucosal leishmaniasis of 4 patients after kala-azar infection (previously infected with L. chagasi and / or L. donovani) and 3 uninfected individuals were prepared as described above in Example 7. The ability of MPAS-1A to stimulate proliferation of these PBMCs was determined as described in Example 8 above . As shown in Figure 24, significant levels of CMSP proliferation specific for MAPS-1A were observed in 2 of the 7 patients for Leishmania. The ability of MAPS-1A to stimulate proliferation in lymph node cultures was determined as described in Example 8. Figure 25 shows the amount of proliferation stimulated by MAPS-1A (at 25 μg / ml, 5 μg / ml and 1 μg / ml) compared to that stimulated by the positive control Con A and the supernatant proteins of crude L. promastigote, 20 days after infection with L. major. Cells isolated 20 days after infection responded highly to MAPS-1A, while cells isolated 10 days after infection did not respond. EXAMPLE 11 IMMUNEACTIVITY OF LEISHMANIA ANTIGENS WITH SERUM OF PATIENTS INFECTED WITH LEISHMANIA The reactivity of MAPS-1A with serum from uninfected individuals, from patients with cutaneous infection of leishmaniasis, from human patients with acute visceral leishmaniasis, and from infected BALB / c mice with L. major was determined as follows. Analyzes were carried out in 96-well plates with 200 ng of antigen diluted with 50 μL in pH-adjusting buffer of carbonate, pH 9.6. The wells were coated overnight at 4 ° C (or 2 hours at 37 ° C). The content of the plate was removed and the wells were blocked for 2 hours with 200 μL of PBS / 1% BSA. After the blocking step, the steps were washed five times with PBS / 0.1% Tween 20 ™. 50 μL of serum, diluted 1: 100 in PBS / 0.1% Tween 20 ™ / 0.1% BSA, then added to each well and incubated for 30 minutes at room temperature. The plates were then washed again five times with PBS / 0.1% Tween 20 ™. The enzyme conjugate (horseradish peroxidase - Protein A, Zymed, San Francisco, CA) was then diluted to 1: 10,000 in PBS / 0.1% Tween 20 ™ / 0.1% BSA and 50 μL of the diluted conjugate was added to each well and incubated for 30 minutes at room temperature. After incubation, the wells were washed five times with PBS / 0.1% Tween 20 ™. 100 μL of the tetramethylbenzidine peroxidase substrate (TMB) (Kirkegaard and Perry Laboratories, Gaithersburg, MD) was added, not diluted and incubated for approximately 15 minutes. The reaction was stopped with the addition of 100 μL of 1N H2SO4 to each well, and the plates were read at 450 nm. As shown in Figure 26, approximately 50% of the samples from patients with human leishmaniasis showed reactivities with recombinant MAPS-1A substantially above the background. Figure 27 shows the reactivity of MAPS-1A with increasing dilutions of serum from BALB / c mice previously administered with (i) saline; (ii) the adjuvant of B. pertussis; (iii) soluble Leishmania antigens plus B. pertussis; (iv) live L. major promastigotes; or (v) soluble Leishmania antigens plus B. pertussis followed by live L. major promastigotes (as described later in Example 12). Significantly higher absorbances were observed with serum from mice infected with L. major promastigotes alive and with mice infected with L. major promastigotes alive after immunization with soluble Leishmania antigens plus B. pertussis, than with serum from the other three groups of mice, indicating that anti-MAPS-1A antibody titers are increased after infection by Leishmania. EXAMPLE 12 USES OF LEISHMANIA ANTIGENS FOR VACCINE AGAINST LEISHMANIA INFECTION This example illustrates the effectiveness of Leishmania antigens to confer protection against disease in the experimental murine leishmaniasis model system. For a discussion of the model system of murine leishmaniasis see, for example, Reiner and others Annu. Rev. Immunol., 73: 151-77, 1995. The effectiveness of (i) crude soluble Leishmania antigens, (ii) MPAS-1A, and (iii) a mixture of Ldp23, LbelF4A and M15. as vaccines against Leishmania infection, was determined as follows. BALB / c mice (5 per group) were immunized intraperitoneally three times at twice weekly intervals with (i) 30 μg of crude soluble Leishmania antigens, (ii) 20 μg of MAPS-1A or (iii) a mixture containing 10 μg each of LelF, Ldp23 and M15. Together with 100 μg of the adjuvant of C. parvum. Two control groups were immunized with saline or C. parvum alone. Two weeks after the last immunization, the mice were confronted with 2 x 105 promastigotes in late log phase of L. major, the infection was monitored weekly by measuring the swelling in the pads of the legs. The amount of swelling in the pads of the legs observed in mice immunized with crude soluble Leishmania antigens, a mixture of Ldp23, LbeiF4A and M15 (Figure 28), or MAPS-1A (Figure 29) was significantly lower than that observed in mice immunized with C. parvum alone. These results demonstrate that the Leishmania antigens of the present invention are effective in conferring infection against Leishmania. EXAMPLE 13 ISOLATION OF DNA CODING SOLUBLE ANTIGENS FROM A BANK OF GENOMIC DNA OF L. major This example illustrates the isolation of seven people from Leishmania antigens from a bank of L. major genomic DNA. An expression bank of L. major genomic DNA was prepared from L. major promastigotes using unidirectional Lambda ZAP (uni-ZAP) (Stratagene) according to the manufacturer's protocol. This bank was screened with a high titration rabbit serum raised against soluble L. major antigens, as described above in Example 9. Seven positive clones were identified. The excised phagemids and DNA from each of the seven clones were sequenced using an automatic sequencer from Perkin Elmer / Applied Biosystems Division Model 373A. The DNA sequences for these antigens, designated as LmgSPI, LmgSP3, LmgSP8, LmgSP9, LmgSP13, LmgSP19, are provided in SEQ ID NO: 29-35, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO: 36- 42, respectively. It was found that LmgSP13 contains a repeat sequence of 39 amino acids shown in SEQ ID NO: 43. Subsequent studies on the isolation of a full-length sequence for LmgSP9. The full-length DNA sequence is provided in SEQ ID NO: 54, with the corresponding predicted amino acid sequence being provided in SEQ ID NO: 55. The amino acid sequence was found to have six repeat units of 14 amino acids (SEQ ID NO: 56), each unit being further divided into two units of 7 amino acids, provided in SEQ ID NOs: 57 and 58. The comparison of DNA and the amino acid sequences for the isolated antigens as described above, did not reveal significant homologies for LmgSPI, LmgSP3 and LmgSP13. LmgSP5 was found to be related to the known PSA2 family. LmgSPd was found to have some homology to a sequence previously identified in E. coli (2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylic acid synthase). It was found that LmgSP9 and LmgSP19 are homologous to a hydrophilic surface protein of L. major named as Gen B (Flinn, H.M. and others Mol, Biochem, Parasit, 65: 259-270, 1994) and for ubiquitin, respectively. To the best of our knowledge, none of these antigens has previously been shown to produce T or B cell responses. The reactivity of recombinant LmgSP9 with serum from patients with visceral leishmaniasis, (from Sudan and Brazil) and from normal donors was evaluated by ELISA as described above. Absorbance values were compared with those obtained using the known Leishmania antigen K39 described, with L. chagasi lysate being used as a positive control. Representative results of these analyzes are provided below in Table 2, where all patients from Brazil and Sudan designated as "VL" suffered from visceral leishmaniasis. The results demonstrate that LmgSP9 specifically detects antibodies in most individuals with visceral leishmaniasis, regardless of geographic location. In many cases, the absorbance values of the antibody reactivity for LmgSP9 were comparable with that observed with K39. In addition, LmgSP9 detected several cases of leishmaniasis that were not detected using K39. These results indicate that LmgSP9 can be used to complement the reactivity of K39. Table 2 REACTIVITY OF LmgSP9 WITH SERUM OF PATIENTS WITH LEISHMANIA In order to obtain a higher specificity for the detection of serum antibodies from patients with visceral leishmaniasis, a homolog of LmgSP9 of L. chagasi, one of the causative agents of visceral leishmaniasis, was isolated. A total of 80,000 pfu of an amplified L. chagasi genomic bank was screened with the entire coding region of LmgSP9 (amplified from L. major genomic DNA). Seven hybridization clones were purified for homogeneity. The DNA sequences for two of these clones, designated as Lc Gene A and Lc Gen B, are provided in SEQ ID NO: 59 and 60, respectively, with the corresponding predicted amino acid sequences provided in SEQ ID NO: 61 and 62, respectively. The open reading frame for Lc gene A was found to show some homology with the A / C gene, previously isolated from L. major (McKIean et al., Mol. Bio. Parasite!., 85: 221-231, 1997 ). The open reading frame for the B gene of Lc showed some homology with the B gene of L. major, treated before and it was found to contain eleven repeats of a 14 amino acid repeat unit (SEQ ID NO: 63), with each repetition being further divided into two repeating units of 7 amino acids provided in SEQ ID NO: 64 and 65. The diagnostic potentials of Lc Gene A and Lc Gene B were evaluated by ELISA as described above using sera from patients with visceral leishmaniasis from Sudan and Brazil, and from uninfected controls. The absorbance values were compared with those obtained using LmgSP9. The much higher absorbance values were obtained with Lc Gene A and Lc Gene B with LmgSP9, with Lc Gene B appearing to be more effective than Lc Gene B for detecting antibodies in certain cases. These results indicate that Gene B of Lc is highly effective in the diagnosis of visceral leishmaniasis. In order to evaluate the diagnostic potential of the repeats found within Lc gene B, a series of six peptides was synthesized (SEQ ID NO: 66-71, referred to as Pep 1-6). Differing in a residue of R or H. An ELISA was carried out using a full length Lc Gen B protein and all six peptides. The absorbance values obtained with Pep 3 were higher than those obtained with the other 5 peptides, however, they are not as high as those obtained with the full-length protein. EXAMPLE 14 ISOLATION AND CHARACTERIZATION OF DNA CODIFYING SOLUBLE ANTIGENS FROM A BANK OF GENOMIC DNA OF L. CHAGASI This example illustrates the preparation of five soluble Leishmania antigen populations from a bank of L. chagasi genomic DNA. An expression bank of L. chagasi genomic DNA was prepared from L. chagasi promastigotes using unidirectional Lambda ZAP (uni-ZAP) (Stratagene) according to the manufacturer's protocol. This bank was screened with a high titration rabbit serum raised against soluble antigens of L. major, as described above in Example 9. Five positive clones were identified. The phagemid was excised and the DNA from each of the five clones was sequenced using an automatic sequencer from Perkin Elmer / Applied Biosystems Division Model 373A. The DNA sequences of these antigens, designated as LcgSPI, LcgSP4, LcgSPd and LcgSPIO are provided in SEQ ID NO: 44-48, respectively, with the corresponding amino acid sequences being provided in SEQ ID NO: 49-53, respectively. Comparison of these sequences with known sequences in the gene bank as described above, revealed no homologies for LcgSP3, LcgSP4, LcgSPd and LcgSPIO. It was found that LcgP1 is homologous to the known HSP70 antigen. Figures 30A and B illustrate the proliferative response of murine lymph nodes for recombinant LcgSPd, LcgSPIO and LcgSP3. Lymph nodes were taken from BALB / c mice 17 days after infection with L. major. Infection occurred by injection into the pads of the paws of 2 x 106 parasites / foot pads. The cells were stimulated with the recombinant antigen and the proliferation was measured at 72 hours when 3H-thymidine. Figure 30A shows CPM, an indirect measurement of mitotic activity to the antigens and Figure 30B shows the stimulation index, which measures the proliferative response in relation to the negative control. EXAMPLE 15 ISOLATION OF DNA CODING ANTIGENS OF L. MAJOR BY CLONING EXPRESSION OF CD4 + T-CELLS This example illustrates the isolation of antigens from L. major T cells using a T-cell screening approach. CD4 + specific for Leishmania are derived from CMSP of an individual who tested positive on a leishmania skin test but had no clinical history of disease. These T cell lines were used to screen an L. amastigote cDNA expression library prepared as described in Example 1. The immunoreactive clones were isolated and sequenced as described above. The cDNA sequences determined for the 8 isolated clones designated as 1G6-34, 1E6-44, 4A5-63, 1B11-39, 2A10-37, 4G2-33, 4H6-41, dG3-100 provided in SEQ ID NO: 72 -79, respectively, with the predicted amino acid sequences being provided in SEQ ID NO: dO-d7, respectively, the cDNA sequences provided for 1E6-44, 2A10-37, 4G2-33, 4H6-41 and 3G3-100 are think that they represent partial clones. It was shown that all these clones stimulate T cell proliferation. Comparison of these sequences with those in the gene bank as described above did not reveal known homologies with the 4A5-63 antigen. It was found that IG6-34 has some homology with histone H2B previously identified in L. enrietti. The antigens, 1 E6-44, 1 B1 1-39 and 3G3-100 showed some homology to the sequences previously identified in other eukaryotes, in particular Saccharomyces cerevisae. It was found that 2A10-37 and 4H6-41 are homologous to the previously identified alpha tubulin proteins of L. donovani and beta major tubulin of L. major, respectively, and found that 4G2-33 is homologous to the elongation initiation factor 2 identified previously in T. cruzi. EX EMPLO 15 SYNTHESIS OF PEPTIST POLYPERS The polypeptides can be synthesized on a Perkin Elmer / Applied Biosystems Division 430A peptide synthesizer using FMOC chemistry with H PTU activation (O-Benzotriazole-N, N, N ', N' hexafluorophosphate -tetramethyluronium). A Gly-Cys-Gly sequence can be attached to the amino terminus of the peptide to provide a conjugation method, attaching to an immobilized surface, or labeling the peptide. The separation of the solid support peptides can be carried out using the following separation mixture: trifluoroacetic acid: ethanedithiol: thioanisole: water: phenol (40: 1: 2: 2: 3). After separation for 2 hours, the peptides can be separated into cold ethyl ethyl t-butyl ether. The peptide pellets were then dissolved in water containing 0.1% trifluoroacetic acid (TFA) and lyophilized before purification by reverse phase CLAR of C1d. A gradient of 0% -60% acetonitrile (containing 0.1% TFA) in water (containing 0.1% TFA) can be used to elute the peptides. After lyophilization of the pure fractions, the peptides can be characterized using electroweak or other types of mass spectrometry and by amino acid analysis. From the foregoing, it will be appreciated that, although the specific embodiments of the invention have been described herein for purposes of illustration, various modifications may be made without departing from the spirit and scope of the invention. LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: Corixa Corporation (ii) TITLE OF THE INVENTION: ANTIGENS OF LEISHMANIA TO BE USED IN THERAPY AND DIAGNOSIS OF LEISHMANIASIS (iii) SEQUENCE NUMBER: 67 (iv) CORRESPONDENCE DIRECTION: ( A) ADDRESS: SEED and BERRY LLP (B) STREETS: 6300 Columbia Center, 701 Fifth Avenue (C) CITY: Seattle (D) STATE: Washington (E) COUNTRY: USA (F) POSTAL CODE: 96104-7092 (v) COMPUTER LEADABLE FORM: (A) MEDIA TYPE: Flexible disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS ( D) SOFTWARE: Patentln Reléase # 1.0, Version # 1.30 (vi) CURRENT REQUEST DATA: (A) NUMBER OF APPLICATION: US (B) DATE OF SUBMISSION: 12-FEB-1996 (C) CLASSIFICATION: (vii) INFORMATION OF AUTHORITY / AGENT: (A) NAME: Maki, David J. (B) REGISTRATION NUMBER: 31,392 (C) NUM. REFERENCE / NUM CASE: 210121.42001 PC (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (206) 622-4900 (B) TELERAS: (206) 682-6031 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS : (A) LENGTH: 3134 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear. (ix) ASPECT: (A) NAME / KEY: CDS (B) LOCATION: 421..2058 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CAAGTGTCGA AGGACAGTGT TCNCCGTGTG AGATCGCCGG CTGTGCGTGT GAAGGCGGTG 60 CCATCGGANA AACAACACCG GTGGA CCGC AGGAAACCAT CTTTCTCCGC AGGTCTCTTT 120 TTGTTGTCGA TTGAGAG GC NCCAAACCCT GCTGGTGCCC TTCTCACATA TCATGTTTTT 180 CGTTGTGCGC TCGCTTTGCC TTTCCTCTCC TTTCCCTCTC TTCCGTGGTG CCGTGTATAC 240 TTCTGGCACC CGCTACGTCA CTTCGCTGGT TTGAACAGAA CCACTGTGAA CACCCACGGG 300 CGATCGCACA CATACACATC CCTCACTCAC ACACACAGCT ACATCTATCC TACATAAAGC 360 TGAAAAAAAA GTCTACGAAC AATTTTGTTT TTACAGTGCG TTGCCGCACA TTTCTCCGTA 420 ATG GAC GCA ACT GAG CTG AAG AAC AAG GGG AAC GAA GAG TTC TCC GCC 468 Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 1 5 10 15 GGC CGC TAT GTG GAG GCG GTG AAC TAC TTC TCA AAG GCG ATC CAG TTG 516 Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala lie Gln Leu 20 25 30 GAT GAG CAG AAC AGT GTC CTC TAC AGC AAC CGC TCC GCC TGT TTT GCA 564 Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Be Wing Cys Phe Wing 35 40 45 GCC ATG CAG AAA TAC AAG GAC GCG CTG GAC GAC GCC GAC AAG TGC ATC 612 Wing Met Gln Lys Tyr Lys Asp Wing Leu Asp Asp Wing Asp Lys Cys lie 50 55 60 TCG ATC AAG CCG AAT TGG GCC AAG GGC TAC GTG CGC CGA GGA GCA GCT 660 Ser lie Lys Pro Asn Trp Wing Lys Gly Tyr Val Arg Arg Gly Wing Wing 65 70 75 80 CTC CAT GGC ATG CGC CGC TAC GAC GAT GCC ATT GCC GCG TAT GAA AAG 708 Leu His Gly Met Arg Arg Tyr Asp Asp Ala lie Ala Ala Tyr Glu Lys 85 90 95 GGG CTC AAG GTG GAC CCT TCC AAC AGC GGC TGG GCG CAG GGC GTG AAG 756 Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Ala Gln Gly Val Lys 1 00 105 110 GAC GTG CAG GTA GCC AAG GCC CGC GAA GCA CGT GAC CCC ATC GCT CGC 804 Asp Val Gln Val Ala Lys Ala Arg Glu Ala Arg Asp Pro lie Ala Arg 115 120 125 GTC TTC ACC CCG GAG GCG TTC CGC AAG ATC CAA GAG AAT CCC AAG CTG 852 Val Phe Thr Pro Glu Wing Phe Arg Lys lie Gln Glu Asn Pro Lys Leu 130 135 140 TCT CTA CTT ATG CTG CAG CCG GAC TAC GTG AAG ATG GTA GAC ACC GTC 900 Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val 145 150 155 160 ATC CGC GAC CCT TCG CAG GGC CGG CTG TAC ATG GAA GAC CAG CGC TTT 948 He Arg Asp Pro Ser Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 165 170 175 GCC CTG ACG CTC ATG TAC CTG AGC GGA ATG AAG ATT CCC AAC GAT GGT 996 Wing Leu Thr Leu Met Tyr Leu Ser Gly Met Lys He Pro Asn Asp Gly 180 185 190 5 GAT GGC GAG GAG GAA CGT CCG TCT GCG AAG GCG GAC GAG ACA GCG 1044 Asp Gly Glu Glu Glu Glu Glu Arg Pro Be Wing Lys Wing Wing Glu Thr Wing 195 200 205 AAG CCA AAA GAG GAG AAG CCT CTC ACC GAC AAC GAG AAG GAG GCC CTG 1092 Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Wing Leu 210 215 220 GCG CTC AAG GAG GGC AAC AAG CTG TAC CTC TCG AAG AAG TTT GAG 11 0 Ala Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu 'Ser Lys Lys Phe Glu -JO 225 230 235 240 GAG GCG CTG ACC AAG TAC CAA GAG GCG CAG GTG AAA GAC CCC AAC AAC 1188 Glu Wing Leu Thr Lys Tyr Gln Glu Wing Gln Val Lys Asp Pro Asn Asn 245 250 255 ACT TTA TAC ATT CTG AAC GTG TCG GCC GTG TAC TTC GAG CAG GGT GAC 1236 Thr Leu Tyr He Leu Asn Val Ser Wing Val Tyr Phe Glu Gln Gly Asp 260 265 '270 TAC GAC AAG TGC ATC GCC GAG TGC GAG CAC GGT ATC GAG CAC GGT CGC 1284 15 Tyr Asp Lys Cys lie Wing Glu Cys Glu His Gly He Glu His Gly Arg 275 280 285 GAG AAC CAC TGC GAC TAC ACA ATC ATT GCG AAG CTC ATG ACC CGG AAC 1332 Glu Asn His Cys Asp Tyr Thr He He Wing Lys Leu Met Thr Arg Asn 290 295 300 GCC TTG TGC CTC CAG AGG CAG AG G AAG TAC GAG GCT GCT ATC GAC CTT 1380 Wing Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Wing Wing He Asp Leu 305 310 315 320 20 TAC AAG CGC GCC CTT GTC TGG CGT AAC CCT GAC ACC CTC AAG AAG 1428 Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 325 330 335 CTG ACG GAG TGC GAG AAG GAG CAC CAA AAG GCG GTG GAG GAA GCC TAC 1476 Leu Thr Glu Cys Glu Lys Glu His Gln Lys Wing Val Glu Glu Ala Tyr 340 345 350 ATC GAT CCT GAG ATC GCG AAG CAG AAG AAA GAC GAA GGT AAC CAG TAC J "-24 He Asp Pro Glu He Ala Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 25 355 360 365 TTC AAG GAG GAT AAG TTC CCC GAG GCC GG GTG GCA GCG TAC ACG GAG GCC 1572 Phe Lys Glu Asp Lys Phe Pro Glu Wing Wing Wing Tyr Thr Glu Wing 370 375 380 ATC AAG CGC AAC CCT GCC GAC CAC ACC TCC TAC AGC AAT CGC GCG GCC 1620 He Lys Arg Asn Pro Wing Glu His Thr Ser Tyr Ser Asn Arg Wing Wing 385 390 395 400 GCG TAC ATC AAG CTT GGA GCC TTC AAC GAC GCC CTC AAG GAC GCG GAO 1668 Wing Tyr He Lys Leu Gly Wing Phe Asn Asp Wing Leu Lys Asp Wing Glu 405 410 415 AAG TGC ATT GAG CTG AAG CCC GAC TTT GTT AAG GGC TAC GCG CGC AAG 1716 Lys Cys He Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Wing Arg Lys 420 425 430 GGT CAT GCT TAC TTT TGG ACC AAG CAG TAC AAC CGC GCG CTG CAG GCG 1764 Gly His Wing Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Wing Leu Gln Wing 435 440 445 TAC GAT GAG GGC CTC AAG GTG GAC CCG AGC AAT GCG GAC TGC AAG GAT 1812 Tyr Asp Glu Gly Leu Lys Val Asp Pro Ser Asn Wing Asp Cys Lys Asp 450 455 460 GGG CGG TAT CGC ACA ATC ATG AAG ATT CAG GAG ATG GCA TCT GGC CAA 1860 Gly Arg Tyr Arg Thr He Met Lys He Gln Glu Met Wing Ser Gly Gln 465 470 475 480 TCC GCG GAT GGC GAC GG GCG GCG CGC GCC ATG GAC GAT CCT GAA 1908 Be Wing Asp Gly Asp Glu Wing Wing Arg Arg Wing Met Asp Asp Pro Glu 485 490 495 ATC GCG GCA ATC ATG CAA GAT AGC TAC ATG CAA CTA GTG TTG AAG GAG 1956 He Wing Wing He Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu 500 505 510 ATG CAG AAC GAT CCC ACG CGC ATT CAG GAG TAC ATG AAG GAC TCC GGG 2004 Met Gln Asn Asp Pro Thr Arg He Gln Glu Tyr Met Lys Asp Ser Gly 515 520 525 ATC TCA TCG AAG ATC AAC AAG CTG ATT TCA GCT AT GCT ATT ATT CGT TTT 2052 He Ser Ser Lys He Asn Lys Leu He Ser Wing Gly He He Arg Phe 530 535 540 GGT CAG TAGACTTCTA CGCTGCCTCA TCTTTTCCGT GTCTTTGCGT CGGCGGGTAT 108 Gly Gln 545 CGTAAAGCAC AATAAAGCAG CGATTCACAT GCACGAGTAA AGTGCTGCGC CTCTCAAACA 2168 CGACGTCGAG GCTGTGGTGC AGATGCOCGT CCTGCATGAA GGTAGTGAAG AGGAAAGTAA 2228 GGGATGTTGT TTGTGGGCCT TCGTGGCTGC GCACACACCT CTTATCTCCT TCGCTTGGTA 2288 CCTTCTCCCT TTTTCGTCTT CACCCCCCTT TCTCTTCTCA CGCTCTCCCT GGCGCGGTGG 2348 TGCAACGATT TCGTTTTATT TACGTCTGTG -AGCTCCTCT ATTCAACGGT GCGATGACGC 2408 TAACGAAGCT GGCCTGTATT CGGCTAAGGC GAAGGCAAAA GACTAG_AGG GGGGGGGGAA 2468 GGAGACGGCG TGACCATCAC TGCGAAGAAA CAAGCCGAAG AAAAGGCCCC GAACGCCTGC 2528 ATTTCCGCGC GCCCTCGCCC GCCTTCCTTC CTTCCTTCGC TCTCTCTCTC TCTCTCTCTC 2588 GCTATCTTCT CAACGGAGAC ATGAAAGGCG TTTGTTAGGA AAAGAGGGGG GGGGGAAGAG 2648 TGGGACGACG CGCTGCGTCT TTTGGGCACT GGTCACGTGC GTCACCCTCT TTT-TTATCT 2708 CTATTGGCAC TGTCTTßTTT CTTTTCCCTT TCCTATCATA CGCGTCTCGC AAACGACTCC 2768 GCGCTGAGCA GCCATGTGCT GCGGCGTGGA GGAAGTACAC AGACATCACG GATGCATATG 2828 TOCGCGTCCG TGTACGCGCT TGTATGGGGC TTCTAACAGC GCCTGTGTGT GTTTGTGTGT 2888 GTGTGTGTGT GTGTGTCTGT GTATTTCGAG CGTCTGTATG CTATTCTATT AAGCACCGAA 2948 GAAGAGACAC ACACGACAGC GAAGGAGATG GTGTCGGCTT TTCGGCTAAT CACTCCCTTC 3008 CATAGCTTCT CTGAAGGAGG CTCTCTTCCA GAGGAATAGA CTGCAGATGG GGTCCACGTT 3068 TATCTG GG GTCAACGGAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAAA 3128 CTCGAG 3134 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 546 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 2: Met Asp Ala Thr Glu Leu Lys Asn Lys Gly Asn Glu Glu Phe Ser Ala 1 5 10 15 Gly Arg Tyr Val Glu Ala Val Asn Tyr Phe Ser Lys Ala He Gln Leu 20 25 30 Asp Glu Gln Asn Ser Val Leu Tyr Ser Asn Arg Ser Ala Cys Phe Ala 35 40 45 Ala Met Gln Lys Tyr Lys Asp Ala Leu Asp Asp Ala Asp Lys Cys He 50 55 60 Ser He Lye Pro Asn Trp Wing Lys Gly Tyr Val Arg Arg Gly Wing Wing 65 70 75 80 Leu His Gly Met Arg Arg Tyr Asp Asp Wing He Wing Wing Tyr Glu Lys 85 90 95 Gly Leu Lys Val Asp Pro Ser Asn Ser Gly Cys Wing Gln Gly Val Lys 100 105 110 Asp Val Gln Val Wing Lys Wing Arg Glu Wing Arg Asp Pro Wing Wing Arg 115 120 125 Val Phe Thr Pro Glu Wing Phe Arg Lys He Gln Glu Asn Pro Lys Leu 130 135 140 Ser Leu Leu Met Leu Gln Pro Asp Tyr Val Lys Met Val Asp Thr Val 145 150 155 160 He Arg Asp Pro Be Gln Gly Arg Leu Tyr Met Glu Asp Gln Arg Phe 165 170 175 Wing Leu Thr Leu Met Tyr Leu Ser Gly Met Lys He Pro Asn Asp Gly 180 185 190 Asp Gly Glu Glu Glu Glu Arg Pro Be Wing Lys Wing Wing Glu Thr Wing 195 200 205 Lys Pro Lys Glu Glu Lys Pro Leu Thr Asp Asn Glu Lys Glu Ala Leu 210 215 220 Wing Leu Lys Glu Glu Gly Asn Lys Leu Tyr Leu Ser Lys Lys Phe Glu 225 230 '235 240 Glu Ala Leu Thr Lys Tyr Gln Glu Ala Gln Val Lys Asp Pro Asn Asn 245 250 255 Thr Leu Tyr He Leu Asn Val Ser Wing Val Tyr Phe Glu Gln Gly Asp 260 265 270 Tyr Asp Lys Cys He Wing Glu Cys Glu His Gly He Glu His Gly Arg 275 280 285 Glu Asn His Cys Asp Tyr Thr He He Wing Ala Lys Leu Met Thr Arg Asn 290 295 300 Wing Leu Cys Leu Gln Arg Gln Arg Lys Tyr Glu Wing Wing He Asp Leu 305 310 315 320 Tyr Lys Arg Ala Leu Val Glu Trp Arg Asn Pro Asp Thr Leu Lys Lys 325 330 335 Leu Thr Glu Cys Glu Lys Glu His Gln Lys Wing Val Glu Glu Wing Tyr 340 345 350 He Asp Pro Glu He Wing Lys Gln Lys Lys Asp Glu Gly Asn Gln Tyr 355 360 365 Phe Lys Glu Asp Lys Phe Pro Glu Wing Val Wing Ala Tyr Thr Glu Ala 370 375 380 He Lys Arg Asn Pro Wing Glu His Thr Ser Tyr Ser Asn Arg Ala Wing 385 390 395 400 Ala Tyr He Lys Leu Gly Ala Phe Asn Asp Ala Leu Lys Asp Ala Glu 405 410 415 Lys Cys He Glu Leu Lys Pro Asp Phe Val Lys Gly Tyr Wing Arg Lys 420 425 430 Gly His Wing Tyr Phe Trp Thr Lys Gln Tyr Asn Arg Wing Leu Gln Wing 435 440 445 Tyr Asp Glu Gly Leu Lys Val Asp Pro Ser Asn Wing Asp Cys Lys Asp 450 455 460 Gly Arg Tyr Arg Thr He Met Lys He Gln Glu Met Wing Ser Gly Gln 465 470 475 480 Wing Asp Gly Asp Glu Wing Wing Arg Arg Wing Met Asp Asp Pro Glu 485 490 495 Wing Wing He Met Gln Asp Ser Tyr Met Gln Leu Val Leu Lys Glu 500 505 510 Met Gln Asn Asp Pro Thr Arg He Gln Glu Tyr Met Lys Asp Ser Gly 515 520 525 He Ser Ser Lys He Asn Lys Leu He Ser Wing Gly He He Arg Phe 530 535 540 Gly Gln 545 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 676 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ix) ) ASPECT: (A) NAME / KEY: CDS (B) LOCATION: 26.550 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: AATTCGGCAC GAGGCATTGT GCATA ATG GTC AAG TCC CAC TAC ATC TGC GCG 52 Met Val Lys Ser His Tyr He Cys Wing 550 555 GGC CGC CTG GTG CGC ATC CTG CGT GGC CCC CGC CAG GAC CGC GTT GGT 100 Gly Arg Leu Val Arg He Leu Arg Gly Pro Arg Gln Asp Arg Val Gly 560 565 570 GTG ATC GTC GAC ATT GTC GAC GCG AAC CGC GTG CTG GTG GAG AAC CCG 148 Val He Val Asp He Val Asp Wing Asn Arg Val Leu Val Glu Asn Pro 575 580 585 GAG GAC GCG AAG ATG TGG CGC CAC GTG CAG AAC CTG AAG AAC GTG GAG 196 Glu Asp Ala Lys Met Trp Arg His Val Gln Asn Leu Lys Asn Val Glu 590 595 600 CCG CTG AAG TAC TGC GTG AGC GTC AGC CGC AAC TGC AGC GCG AAG GCG 244 Pro Leu Lys Tyr Cys Val Ser Val Ser Arg Asn Cys Ser Wing Lys Wing 605 610 615 CTG AAG GAT GCG CTG GCC TCG TCG AAG GCG CTG GAG AAG TAC GCG AAG 292 Leu Lys Asp Ala Leu Ala Ser Ser Lys Ala Leu Glu Lys Tyr Wing Lys 620 625 630 635 ACG CGC ACT GCT GCG CGC GTG GAG GCG AAG AAG GCG TGC GCC GCG TCG 340 Thr Arg Thr Wing Wing Arg Val Glu Wing Lys Lys Wing Cys Wing Wing Ser 640 645 650 ACG GAC TTC GAG CGC TAC CAG CTG CGC GTT GCG CGC CGT TCT CGC GCG 388 Thr Asp Phe Glu Arg Tyr Gln Leu Arg Val Wing Arg Arg Wing Arg Wing 655 660 665 CAC TGG GCG CGC AAG GTG TTC GAC GAG AAG GAC GCG AAG ACG CCC GTG 436 His Trp Wing Arg Lys Val Phe Asp Glu Lys Asp Ala Lys Thr Pro Val 670 675 680 TCG TGG CAC AAG GTT GCG CTG AAG AAG ATG CAG AAG AAG GCC GCA AAG 484 Ser Trp His Lys Val Ala Leu Lys Lys Met Gln Lys Lys Ala Ala Lys 685 690 695 ATG GAC TCG ACC GAG GGC GCT AAG AGG CGC ATG CAG AAG GCG ATC GCT 532 Met Asp Ser Thr Glu Gly Wing Lys Arg Arg Met Gln Lys Wing Wing 700 705 710 715 GCC CGC AAG GCG AAA AAG TAAGGCCATA CCCTCA CTTC GCTTGTTTCG 580 Wing Arg Lys Wing Lys Lys 720 TGATTTTTCG TGGGAGTCGG TGGCCCTACC AGCGGTCTTT CATTGGCTTA TTTCTATCCG 640 GTCTGAAAGA GGTACAAAAA AAAAAAAAAA AAAAAA 676 (3) IN TRAINING FOR SEQ ID NO: 4: (i) CAUSES OF S ECU TIES: (A) LONGITU D: 175 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear ( ii) TI PO OF MOLECULE: protein (xi) DESCRI PTION OF SEQUENCE: SEQ ID NO: 4: Met Val Lys Ser His Tyr He Cys Wing Gly Arg Leu Val Arg He Leu 1 5 10 15 Arg Gly Pro Arg Gln Asp Arg Val Gly Val He Val Asp He Val Asp 20 25 30 Wing Asn Arg Val Leu Val Glu Asn Pro Glu Asp Ala Lys Met Trp Arg 35 40 45 His Val Gln Asn Leu Lys Asn Val Glu Pro Leu Lys Tyr Cys Val Ser 50 55 60 Val Ser Arg Asn Cys Ser Wing Lys Wing Leu Lys Asp Wing Leu Wing Ser 65 70 75 80 Ser Lys Wing Leu Glu Lys Tyr Wing Lys Thr Arg Thr Wing Wing Arg Val 85 90 95 Glu Ala Lys Lys Ala Cys Ala Ala Ser Thr Asp Phe Glu Arg Tyr Gln 100 105 110 Leu Arg Val Ala Arg Arg Ser Arg Ala His Trp Ala Arg Lys Val Phe 115 120 125 Asp Glu Lys Asp Ala Lys Thr Pro Val Ser Trp His Lys Val Ala Leu 130 135 140 Lys Lys Met Gln Lys Lys Ala Ala Lys Met Asp Ser Thr Glu Gly Ala 145 150 155 160 Lys Arg Arg Met Gln Lys Wing He Wing Wing Arg Lys Wing Lys Lys 165 170 175 (2) INFORMATION FOR SEQ ID NO: 5 (i) SEQUENCE CHARACTERISTICS '(A) LENGTH: 2040 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ix) ASPECTS: (A) NAME / KEY: CDS (B) LOCATION: 62..2029 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: CGCGGTGGCG GCCGCTCTAG AACTAGTGGA TCCCCCGGGC TGCAGGAATT CGGCACGAGA 60 G AGC CTG ACG GAC CCG GCG GTG CTG GGC GAG GAG ACT CAC CTG CGC 106 Be Leu Thr Asp Pro Wing Val Leu Gly Glu Glu Thr His Leu Arg 180 185 190 GTC CGC GTG GTG CCG GAC AAG GCG AAC AAG ACG CTG ACG GTG GAG GAT 154 Val Arg Val Val Pro Asp Lys Ala Asn Lys Thr Leu Thr Val Glu Asp 195 200 205 AAC GGC ATC GGC ATG ACC AAG GCG GAC CTC GTG AAC AAT CTG GGC ACG 202 Asn Gly He Gly Met Thr Lys Wing Asp Leu Val Asn Asn Leu Gly Thr 210 215 220 ATC GCG CGC TCC GGC ACG AAG GCT TTC ATG GAG GCA CTG GAG GCC GGC 250 He Wing Arg Ser Gly Thr Lys Wing Phe Met Glu Wing Leu Glu Wing Gly 225 230 235 GGC GAC ATG AGC ATO ATC GGC CAG TTC GGT GTC GGC TTC TAC TCC GCG 298 Gly Asp Met Ser Met He Gly Gln Phe Gly Val Gly Phe Tyr Ser Wing 240 245 250 TAC CTT GTG GCG GAC CGC GTG ACG GTG GTG TCG AAG AAC AAC TCG GAC 346 Ty? "Leu Val Wing Asp Arg Val Thr Val Val Ser Lys Asn Asn Ser Asp 255 260 265 270 GAG GCG TAC TGG GAA TCG TCT GCG GGG GGC ACG TTC ACC ATC ACG AGC 394 Glu Wing Tyr Trp Glu Ser Ser Wing Gly Gly Thr Phe Thr He Thr Ser 275 280 285 GTG CAG GAG TCG GAC ATG AAG CGC GGC ACG AGT ACA CTG CAC CTA 442 Val Gln Glu Ser Asp Met Lys Arg Gly Thr Ser Thr Thr Leu His Leu 290 295 300 AAG GAG GAC CAG CAG GAG TAC CTG GAG GAG CGC GTG AAG GAG CTG 490 Lys Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg Val Lys Glu Leu 305 310 315 ATC AAG AAG CAC TCC GAG TTC ATC GGC TAC GAC ATC GAG CTG ATG GTG 538 He Lys Lys His Ser Glu Phe He Gly Tyr Asp He Glu Leu Met Val 320 325 330 GAG AAG ACG GCG GAG AAG GAG GTG ACG GAC GAG GAG GAG GAG GAC 586 Glu Lys Thr Wing Glu Lys Glu Val Thr Asp Glu Asp Glu Glu Glu Asp 335 340 345 350 GAG TCG AAG AAG AAG TCC TGC GGG GAC GAG GGC GAG CCG AAG GTG GAG 634 Glu Ser Lys Lys Lys Ser Cys Gly Asp Glu Glu Glu Pro Lys Val Glu 355 360 365 GAG GTG ACG GAG GGC GGC GAG GAG AAG AAG AAG AAG ACG AAG AAG GTG 682 Glu Val Thr Glu Gly Gly Glu Asp Lys Lys Lys Lys Thr Lys Lys Val 370 375 380 AAG GAG GTG AAG AAG ACG TAC GAG GTC AAG AAC AAG CAC AAG CCG CTC 730 Lys Glu Val Lys Lys Thr Tyr Glu Val Lys Asn Lys His Lys Pro Leu 385 390 395 TGG ACG CGC GAC ACG AAG GAC GTG ACG AAG GAG GAG TAC GCG GCC TTC 778 Trp Thr Arg Asp Thr Lys Asp Val Thr Lys Glu Glu Tyr Wing Wing Phe 400 405 410 TAC AAG GCC ATC TCC AAC GAC TGG GAG GAC ACG GCG GCG ACG AAG CAC 826 Tyr Lys Wing He As Asp Trp Glu Asp Thr Wing Wing Thr Lys His 415 420 425 430 TTC TCG GTG GAG GGC CAG CTG GAG TTC CGC GCG ATC GCG TTC GTG CCG 874 Phe Ser Val Glu Gly Gln Leu Glu Phe Arg Wing He Wing Phe Val Pro 435 440 445 AAG CGC GCG CCG TTC GAC ATG TTC GAG CCG AAC AAG AAG CGC AAC AAC 922 Lys Arg Wing Pro Phe Asp Met Phe Glu Pro Asn Lys Lys Arg Asn Asn 450 455 460 ATC AAG CTG TAC GTG CGC CGC GTG TTC ATC ATG GAC AAC TGC GAG GAC 970 He Lys Leu Tyr Val Arg Arg Val Phe He Met Asp Asn Cys Glu Asp 465 470 475 CTG TGC CCG GAC TGG CTC GGC TTC GTG AAG GGC GTC GTG GAC AGC GAG 1018 Leu Cys Pro Asp Trp Leu Gly Phe Val Lys Gly Val Val Asp Ser Glu 480 485 490 GAC CTG CCG CTG AAC ATC TCG CGC GAG AAC CTG CAG CAG AAC AAG ATC 10 C. Asp Leu Pro Leu Asn He Ser Arg Glu Asn Leu Gln Gln Asn Lys He 495 500 505 510 CTG AAG GTG ATC CGC AAG AAC ATC GTG AAG AAG TGC CTG GAG CTG TTC 1114 Leu Lys Val He Arg Lys Asn He Val Lys Lys Cys Leu Glu Leu Phe 515 520 525 GAA GAG ATA GCG GAG AAC AAG GAG GAC TAC AAG CAG TTC TAC GAG CAG 1162 Glu Glu He Wing Glu Asn Lys Glu Asp Tyr Lys Gln Phe Tyr Glu Gln 530 535 540 TTC GGC AAG AAC ATC AAG CTG GGC ATC CAC GAG GAC ACG GCG AAC CGC 1210 Phe Gly Lys Asn He Lys Leu Gly He His Glu Asp Thr Wing Asn Arg 545 550 555 AAG AAG CTG ATG GAG TTG CTG CGC TTC TAC AGC ACC GAG TCG GGG GAG 1258 Lys Lys Leu Met Glu Leu Leu Arg Phe Tyr Ser Thr Glu Ser Gly Glu 560 565 570 GAG ATG ACG ACA CTG AAG GAC TAC GTG ACG CGC ATG AAG CCG GAG CAG 1306 Glu Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met Lys Pro Glu Gln 575 580 585 590 AAG TCG ATC TAC TAC ATC ACT GGC GAC AGC AAG AAG AAG CTG GAG TCG 1354 Lys Ser He Tyr Tyr He Thr Gly Asp Ser Lys Lys Lys Leu Glu Ser 595 600 605 TCG CCG TTC ATC GAG AAG GCG AGA CGC TGC GGG CTC GAG GTG CTG TTC 1402 Ser Pro Phe He Glu Lys Wing Arg Arg Cys Gly Leu Glu Val Leu Phe 610 615 620 ATG ACG GAG CCG ATC GAC GAG TAC GTG ATG CAG CAG GTG AAG GAC TTC 1450 Met Thr Glu Pro He Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe 625 630 635 GAG GAC AAG AAG TTC GCG TGC CTG ACG AAG GAA GGC GTG CAC TTC GAG 1498 Glu Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu 640 645 650 GAG TCC GAG GAG GAG AAG AAG CAG CGC GAG GAG AAG AAG GCG GCG TGC 1546 Glu Ser Glu Glu Glu Lys Lys Gln Arg Glu Glu Lys Lys Wing Ala Cys 655 660 665 670 GAG AAG CTG TGC AAG ACG ATG AAG GAG GTG CTG GGC GAC AAG GTG GAG 1594 Glu Lys Leu Cys Lys Thys Met Lys Glu Val Leu Gly Asp Lys Val Glu 675 680 685 AAG GTG ACC GTG TCG GAG CGC CTG TTG ACG TCG CCG TGC ATC CTG GTG 1642 Lys Val Thr Val Ser Glu Arg Leu Leu Thr Ser Pro Cys He Leu Val 690 695 700 ACG TCG GAG TTT GGG TGG TCG GCG CAC ATG GAA CAG ATC ATG CGC AAC 1690 Thr Ser Glu Phe Gly Trp Ser Ala His Met Glu Gln He Met Arg Asn 705 710 715 CAG GCG CTG CGC GAC TCC AGC ATG GCG CAG TAC ATG GTG TCC AAG AAG 1738 Gln Ala Leu Arg Asp Ser Ser Met Wing Gln Tyr Met Val Ser Lys Lys 720 725 730 ACG ATG GAG GTG AAC CCC GAC CAC CCC ATC ATC AAG GAG CTG CGC CGC 1786 Thr Met Glu Val Asn Pro Asp His Pro He He Lys Glu Leu Arg Arg 735 740 745 750 CGC GTG GAG GCG GAC GAC AAC GAC AAG GCC GTG AAG GAC CTC GTC TTC 1834 Arg Val Glu Ala Asp Glu Asn Asp Lys Ala Val Lys Asp Leu Val Phe 755 760 765 CTG CTC TTC GAC ACG TCG CTG CTC ACG TCC GGC TTC CAG CTG GAT GAC 1882 Leu Leu Phe Asp Thr Ser Leu Leu Thr Ser Gly Phe Gln Leu Asp Asp 770 775 780 CCC ACC GGC TAC GCC GAG CGC ATC AAC CGC ATG ATC AAG CTC GGC CTG 1930 Pro Thr Gly Tyr Wing Glu Arg He Asn Arg Met He Lys Leu Gly Leu 785 790 795 TCG CTC GAG GAG GAG GAG GAG GTC GCC GCC GCG CCG CCG GCC GAG 1978 Ser Leu Asp Glu Glu Glu Glu Glu Val Wing Glu Wing Pro Pro Wing Glu 800 805 810 GCC GCC CCC GCG GAG GTC ACC GCC GGC ACC TCC AGC ATG GAG CAG GTG 2026 Ala Wing Pro Wing Glu Val Thr Wing Gly Thr Ser Ser Met Glu Gln Val 815 820 825 830 GAC TGAGCCGGTA TO 2040 Asp (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 656 amino acids (B) TYPE: amino acid (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: Ser Leu Thr Asp Pro Wing Val Leu Gly Glu Glu Thr His Leu Arg Val 1 5 10 15 Arg Val Val Pro Asp Lys Wing Asn Lys Thr Leu Thr Val Glu Asp Asn 20 25 30 Gly He Gly Met Thr Lys Wing Asp Leu Val Asn Asn Leu Gly Thr He 35 40 45 Wing Arg Ser Gly Thr Lys Wing Phe Met Glu Wing Leu Glu Wing Gly Gly 50 55 60 Asp Met Ser Met He Gly Gln Phe Gly Val Gly Phe Tyr Ser Wing Tyr 65 70 75 80 Leu Val Wing Asp Arg Val Thr Val Val Ser Lys Asn Asn Ser Asp Glu 85 90 95 Wing Tyr Trp Glu Be Ser Wing Gly Gly Thr Phe Thr He Thr Ser Val 100 105 110 Gln Glu Be Asp Met Lys Arg Gly Thr Ser Thr Thr Leu His Leu Lys 115 120 125 Glu Asp Gln Gln Glu Tyr Glu Glu Arlu Arg Arg Val Lys Glu Leu He 130 135 140 Lys Lys His Ser Glu Phe He Gly Tyr Asp He Glu Leu Met Val Glu 145 150 155 160 Lys Thr Ala Glu Lys Glu Val Thr Asp Glu Asp Glu Glu Glu Asp Glu 165 170 175 Ser Lys Lys Lys Ser Cys Gly Asp Glu Glu Glu Pro Lys Val Glu Glu 180 185 190 Val Thr Glu Gly Gly Glu Asp Lys Lys Lys Lys Thr Lys Lys Val Lys 195 200 205 Glu Val Lys Lys Thr Tyr Glu Val Lys Asn Lys His Lys Pro Leu Trp 210 215 220 Thr Arg Asp Thr Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr 225 230 235 240 Lys Ala He Ser Asn Asp Trp Glu Asp Thr Ala Wing Thr Lys His Phe 245 250 255 Ser Val Glu Gly Gln Leu Glu Phe Arg Wing He Wing Phe Val Pro Lys 260 265 270 Arg Wing Pro Phe Asp Met Phe Glu Pro Asn Lys Lys Arg Asn Asn He 275 280 285 Lys Leu Tyr Val Arg Arg Val Phe He Met Asp Asn Cys Glu Asp Leu 290 295 300 Cys Pro Asp Trp Leu Gly Phe Val Lys Gly Val Val Asp Ser Glu Asp 305 310 315 320 Leu Pro Leu Asn He Ser Arg Glu Asn Leu Gln Gln Asn Lys He Leu 325 330 335 Lys Val He Arg Lys Asn He Val Lys Lys Cys Leu Glu Leu Phe Glu 340 345 350 Glu He Wing Glu Asn Lys Glu Asp Tyr Lys Gln Phe Tyr Glu Gln Phe 355 360 365 Gly Lys Asn He Lys Leu Gly He His Glu Asp Thr Wing Asn Arg Lys 370 375 380 Lys Leu Met Glu Leu Leu Arg Phe Tyr Ser Thr Glu Ser Gly Glu Glu 385 390 395 400 Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met Lys Pro Glu Gln Lys 405 410 415 Ser He Tyr Tyr He Thr Gly Asp Ser Lys Lys Lys Leu Glu Ser Ser 420 425 430 Pro Phe He Glu Lys Wing Arg Arg Cys Gly Leu Glu Val Leu Phe Met 435 440 445 Thr Glu Pro He Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu 450 455 460 Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu 465 470 475 480 Ser Glu Glu Glu Lys Lys Gln Arg Glu Glu Lys Lys Wing Ala Cys Glu 485 490 495 Lys Leu Cys Lys Thr Met Lys Glu Val Leu Gly Asp Lys Val Glu Lys 500 505 510 Val Thr Val Ser Glu Arg Leu Leu Thr Ser Pro Cys He Leu Val Thr 515 520 525 Ser Glu Phe Gly Trp Ser Wing His Met Glu Gln He Met Arg Asn Gln 530 535 540 Wing Leu Arg Asp Ser Ser Met Wing Gln Tyr Met Val Ser Lys Lys Thr 545 550 555 560 Met Glu Val Asn Pro Asp His Pro He He Lys Glu Leu Arg Arg Arg 565 570 575 Val Glu Wing Asp Glu Asn Asp Lys Wing Val Lys Asp Leu Val Phe Leu 580 585 590 Leu Phe Asp Thr Ser Leu Leu Thr Ser Gly Phe Gln Leu Asp Asp Pro 595 600 605 Thr Gly Tyr Wing Glu Arg He Asn Arg Met He Lys Leu Gly Leu Ser 610 615 620 Leu Asp Glu Glu Glu Glu Glu Val Wing Glu Wing Pro Pro Wing Glu Wing 625 630 635 640 Wing Pro Wing Glu Val Thr Wing Gly Thr Ser Ser Met Glu Gln Val Asp 645 650 655 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1771 base pairs (B) TYPE: nucleic acid (C) TYPE OF THREAD: single (D) TOPOLOGY: linear (ix) ) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..1698 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: CAG GCC GCC CGC GTC CAG GCC CTC GAG GAG GG GCG CGT CTC GCG GCG GAG 40 Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg Leu Arg Ala Glu 1 5 10 15 CTG GAG GCG GCC GAG GAG GG GCG GCC CGC CTG GAT GTC ATG CAT GCG GCC 96 Leu Glu Wing Wing Glu Glu Wing Wing Arg Leu Asp Val Met His Wing Wing 2.0 25 30 GAG CAG GCC CGT GTC CAG GCC CTC GAG GAG GCA GCG CGT CTC CGC GCG 144 Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala Ala Arg Leu Arg Ala 35 40 45 GAG CTG GAG GAG GCC GAG GAG GCG GCC CGC CTG GAT GTC ATG CAT GCG 192 Glu Leu Glu Glu Ala Glu Glu Wing Wing Arg Leu Asp Val Met His Wing 50 55 60 GCC GAG CAG GCC CGC GTC CAG GCC CTC GAG GAG GG GCG CGT CTC CGC 240 Wing Glu Gln Wing Arg Val Gln Wing Leu Glu Glu Wing Wing Arg Leu Arg 65 70 75 80 GCG GAG CTG GAG GCT GCC GAG GAG GCG GCG CTG GAG GCC ATG CAC 288 Wing Glu Leu Glu Wing Wing Glu Glu Wing Wing Arg Leu Glu Wing Met His 85 90 95 GAG GCC GAG CAG GCC CGC TCC CAG GCC CTC GAG GAG GCA GCG CGT CTC 336 Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu 100 105 110 CGC GCG GAG CTG GAG GAA GCC GAG GAG GCG GCC CGC CTG GAT GTC ATG 384 Arg Ala slu Leu Glu Glu Ala Glu Glu Ala Ala Arg Leu Asp Val Met 115 120 125 CAT GCG GCC GAG CAG GCC CGC GTC CAG GCC CTC GAG GAG GCA GCG CGT 432 His Wing Wing Gln Gln Wing Arg Val Gln Wing Leu Glu Glu Wing Wing Arg 130 135 140 CTC CGC GCG GAG CTG GAG GAG GCC GAG GG GCG GCC CGC CTG GAG GCC 480 Leu Arg Wing Glu Leu Glu Glu Wing Glu Glu Wing Wing Arg Leu Glu Wing 145 150 155 160 ATG CAC GAG GCC GAG CAG GCC CGC TCC CAG GCC CTC GAG GAG GCG 528 Met His Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala 165 170 175 CGT CTC CGC GCG GAG CTG GAG GCG GCC GAG GAG GCG GCC CGC CTG GAT 576 Arg Leu Arg Ala Glu Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Asp 180 185 190 GTC ATG CAC GAG GCC GAG CAG GCC CGT GTC CAG GCC CTC GAG GAG GCG 624 Val Met His Glu Ala Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Ala 195 200 205 GCG CGC CTG GAT GTC ATG CAC GAG GCC GAG CAG GCC CGC GTC CAG GCC 672 Wing Arg Leu Asp Val Met His Glu Wing Glu Gln Wing Arg Val Gln Wing 210 215 220 CTC GAG GAG GCA GCG CGT CTC CGC GCG GAG CTG GAG GCG GCC GAG GAG 720 Leu Glu Glu Ala Wing Arg Leu Arg Ala Glu Leu Glu Wing Wing Glu Glu 225 230 235 240 GCG GCC CGC CTG GAT GTC ATG CAC GAG GCC GAG CAG GCC CGC GTC CAG 768 Wing Wing Arg Leu Asp Val Met His Glu Wing Glu Gln Wing Arg Val Gln 245 250 255 G CC CTC GAG GAG GCA GCG CGT CTC CGC GCG GAG CTG GAG GCG GCC GAG 816 Wing Leu Glu Glu Wing Wing Arg Leu Arg Wing Glu Leu Glu Wing Wing Glu 260 265 270 GAG GCG GCC CGC CTG GAT GTC ATG CAC GAG GGC GAG CAG GCC CGT GTC 864 Glu Wing Wing Arg Leu Asp Val Met His Glu Gly Glu Gln Wing Arg Val 275 280 285 CAG GCC CTC GAG GAG GCG GCC CGC CTG GAG GCC ATG CAC GAG GCC GAG 912 Gln Ala Leu Glu Glu Ala Ala Arg Leu Glu Ala Met His Glu Ala Glu 290 295 300 CAG GCC CGC TCC CAG GCC CTC GAG GAG GCA GCG CGT CTC TGC GCG GAG 960 Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu Cys Ala Glu 305 310 315 320 CTG GAG GCT GAG GAG GAG GAA AAA GAT GAG CGG CCG GCG ACG TCG AGC 1008 Leu Glu Wing Glu Glu Glu Glu Glu Lys Asp Glu Arg Pro Wing Thr Ser 325 325 335 TAC AGC GAG GAG TGC AAA GGG CGA CTG CTA TCG AGG GCG CGG CCG GAT 1056 Tyr Ser Glu Glu Cys Lys Gly Arg Leu Leu Ser Arg Wing Arg Pro Asp 340 345 350 CCG CGG AGG CCG CTG CCG CGG CCG TTC ATT GGG ATG TCA CTG TTG GAG 1104 Pro Arg Arg Pro Leu Pro Arg Pro Phe He Gly Met Ser Le u Leu Glu 355 360 '365 GAT GTG GAG AAG AGT ATT CTC ATT GTG GAC GGG CTC TAC AGG GAT GGG' 'c .-- Asp Val Glu Lys Ser He Leu He Val Asp Gly Leu Tyr Arg Asp Gly 370 375 380 CCG GCG TAC CAG ACG GGC ATC CGC CTC GGG GAT GTC CTC TTG CGT ATC 1 00 Pro Wing Tyr Gln Thr Gly He Arg Leu Gly Asp Val Leu Leu Arg He 385 390 395 400 GCG GGG GTT TAC GTG GAT TCA ATA GCG AAG GCG AGG CAG GTG GTC GAT 124f! Wing Gly Val Tyr Val Asp Ser Wing Wing Lys Wing Arg Gln Val Val Asp 405 410 415 GCG CGT TGC CGC TGC GGC TGC GTC GTT CCC GTG ACG CTG GCG ACG AAG 1296 Wing Arg Cys Arg Cys Gly Cys Val Val Pro Val Thr Leu Wing Thr Lys 420 425 430 ATG AAC CAG CAG TAC AGC GTG GCT CTG TAT ATC ATG ACG GTG GAT CCG 1344 Met Asn Gln Gln Tyr Ser Val Ala Leu Tyr He Met Met Thr Val Asp Pro 435 440 445 CAG CAC AAC GAC AAG CCC TTT TTT TTT GAT GTG CAC ATC CAC CAC CGC i '^ Gln His Asn Asp Lys Pro Phe Phe Phe Asp Val His lie His His Arg 450 455 460 ATC GAG AGC TCG CAC ATG GGG AAG AAG GCG CAG TGG ATG GAA GTT CTT: ..He Glu Ser Ser His Met Gly Lys Lys Wing Gln Trp Met Glu Val Leu 465 470 475 480 GAG AGC CCA TCC GTA TCT TCG GCT GCC ACC ACC CCT GTG CCG CTC 1488 Glu Ser Pro Ser Val Ser Be Ala Wing Thr Thr Pro Leu Val Pro Leu 485 490 495 TTG CGT GAG CCG ACG CCG CGT AGG GGC TCA GAG CTG CAG TCA AGT GCT 1536 Leu Arg Glu Pro Thr Pro Arg Arg Gly Ser Glu Leu Gln Ser Be Ala 500 505 510 CGT TCC GCC TTC GTT GCC ACG TCT TAC TTC TCG AGC GCG CGC AGG TCG 1584 Arg Ser Wing Phe Val Wing Thr Ser Tyr Phe Ser Wing Arg Arg Ser 515 520 525 GTC AGC TCA GAA AGT GAG CGA CCG CGC GGG TCC TCT AGC GTG GCT ATG 1632 Val Ser Ser Glu Ser Glu Arg Pro Arg Gly Ser Ser Ser Val Val Met Wing 530 535 540 GCG GAG GAG GCG ATC GCG CTG GCG CCG CAA GGG TAT ACC CCA CCC AAC 1680 Wing Glu Glu Wing Wing Wing Leu Wing Pro Gln Gly Tyr Thr Pro Pro Asn 545 550 555 560 CAA GTG CGC GGC CGT AGT TGACGTCTCT GTGTGAGTGT GTGTCGCTCC 1728 Gln Val Arg Gly Arg Ser 565 GTCTCCTTCC TTTTTCGTCA TGTGTTTTAT TCATTTCTTT TTC 1771 (2) INFORMATION FOR SEQ ID NO: d: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 566 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 6: Gln Ala Arg Val Gln Ala Leu Glu Glu Wing Wing Arg Leu Arg Wing Glu 1 5 10 15 Leu Glu Wing Wing Glu Wing Wing Wing Arg Leu Asp Val Met Wing Wing Wing 20 25 30 Glu Gln Wing Arg Val Gln Wing Leu Glu Wing Glu Wing Arg Leu Arg Wing 35 40 45 Glu Leu Glu Glu Wing Glu Glu Wing Wing Arg Leu Asp Val Met His Wing 50 55 60 Wing Glu Gln Wing Arg Val Gln Wing Leu Glu Glu Wing Wing Arg Leu Arg 65 70 75 80 Wing Glu Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Glu Ala Met His 85 90 95 Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu 100 105 110 Arg Ala Glu Leu Glu Glu Ala Glu Glu Ala Ala Arg Leu Asp Val Met 115 120 125? His Wing Wing Glu Gln Wing Arg Val Gln Wing Leu Glu Wing Ala Wing Arg 130 135 140 Leu Arg Wing Glu Leu Glu Glu Wing Glu Glu Wing Wing Arg Leu Glu Wing 145 150 155 160 Met His Glu Ala Glu Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala 165 170 175 Arg Leu Arg Ala Glu Leu Glu Ala Ala Glu Glu Ala Ala Arg Leu Asp - | 0 180 185 190 Val Met His Glu Ala Glu Gln Ala Arg Val Gln Ala Leu Glu Glu Wing 195 200 205 Wing Arg Leu Asp Val Met His Glu Wing Glu Gln Wing Arg Val Gln Wing 210 215 220 Leu Glu Glu Wing Wing Arg Leu Arg Wing Glu Leu Glu Wing Wing Glu Glu 225 230 235 240 15 Wing Wing Arg Leu Asp Val Met His Glu Wing Glu Gln Wing Arg Val Gln 245 250 255 Wing Leu Glu Glu Wing Wing Arg Leu Arg Wing Glu Leu Glu Wing Wing Glu 260 265 270 Glu Wing Wing Arg Leu Asp Val Met His Glu Gly Glu Gln Ala Arg Val 275 280 285 Gln Ala Leu Glu Glu Ala Ala Arg Leu Glu Ala Met His Glu Ala Glu 290 295 300 20 Gln Ala Arg Ser Gln Ala Leu Glu Glu Ala Ala Arg Leu Cys Ala Glu 305 310 315 320 Leu Glu Wing Glu Glu Glu Glu Lys Asp Glu Arg Pro Wing Thr Ser Ser 325 330 335 Tyr Ser Glu Glu Cys Lys Gly Arg Leu Leu Ser Arg Wing Arg Pro Asp 340 345 350 25 Pro Arg Arg Pro Leu Pro Arg Pro Phe He Gly Met Ser Leu Leu Glu 355 360 365 Asp Val Glu Lys Ser He Leu He Val Asp Gly Leu Tyr Arg Asp Gly 370 375 380 Pro Wing Tyr Gln Thr Gly He Arg Leu Gly Asp Val Leu Leu Arg He 385 390 395 400 Wing Gly Val Tyr Val Asp Ser Wing Wing Lys Wing Arg Gln Val Val Asp 405 410 415 Wing Arg Cye Arg Cys Gly Cys Val Val Pro Val Thr Leu Ala Thr Lys 420 425 430 Met Asn Gln Gln Tyr Ser Val Ala Leu Tyr He Met Thr Val Asp Pro 435 440 445 Gln His Asn Asp Lys Pro Phe Phe Phe Asp Val Hie He His His Arg 450 455 460 lie Glu Ser Ser His Met Gly Lys Lys Ala Gln Trp Met Glu Val Leu 465 470 475 480 Glu Ser Pro Ser Val Ser Be Wing Wing Thr Thr Pro Leu Val Pro Leu 485 490 495 Leu Arg Glu Pro Thr Pro Arg Arg Gly Ser Glu Leu Gln Ser Be Ala 500 505 510 Arg Be Wing Phe Val Wing Thr Ser Tyr Phe Ser Be Wing Arg Arg Ser 515 520"525 Val Ser Ser Glu Ser Glu Arg Pro Arg Gly Ser Be Ser Val Ala Met 530 535 540 Wing Glu Glu Wing He Wing Leu Wing Pro Gln Gly Tyr Thr Pro Pro Asn 545 550 555 560 Gln Val Arg Gly Arg Ser 565 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 161d base pairs (B) TYPE nucleic acid (C) TYPE OF THREAD, single (D) TOPOLOGY linear (ii) TYPE MOLECULES: cDNA (ix) CHARACTERISTICS (A) NAME / KEY: CDS (B) LOCATION: 115..1323 (ix) SEQUENCE DESCRIPTION: SEQ ID NO: 9: CCACTCTCTC GGTCGTCTGT CTCCCACGCG CGCACGCAGT TGATTTCCGC CTTCTTAAAC 60 GCTCTCTTTT TTTTTATTTT TCACCTGACC AACCGCACCA CGTCGGCCTC CATC ATG 117 Met 1 TCG CAG CAA GAC CGA GTT GCC CCA CAG GAC CAG GAC TCG TTC CTC GAC 165 Ser Gln Gln Asp Arg Val Ala Pro Gln Asp Gln Asp Ser Phe Leu Asp 5 10 15 GAC CAG CCC GGC GTC CGC CCG ATC CCG TCC TTC GAT GAC ATG CCG TTG 213 Asp Gln Pro Gly Val Arg Pro He Pro Ser phe Asp Asp Met Pro Leu 20 25 30 CAC CAG AAC CTT CTG CGC GGC ATC TAC TCG TAC GGC TTC GAG .AAA CCG 261 His Gln Asn Leu Leu Arg Gly He Tyr Ser Tyr sly Phe Glu Lys Pro 35 40 45 TCC AGC ATC CAG CAG CGC GCC ATC GCC CCC TTC ACG CGC GGC GGC GAC 309 Ser Ser He Gln Gln Arg Ala He Ala Pro Phe Thr Arg Gly Gly Asp 50 55 60 65 ATC ATC GCG CAG GCG CAG TCC GGT ACC GGC AAG ACG GGC GCC TTC TCC 357 He He Wing Gln Wing Gln Ser Gly Thr Gly Lys Thr Gly Wing Phe Ser 70 75 80 ATC GGC CTG CTG CAG CGC CTG GAC TTC CGC CAC AAC CTG ATC CAG GGC 405 He Gly Leu Leu Gln Arg Leu Asp Phe Arg His Asn Leu He Gln Gly 85 90 95 CTC GTG CTC TCC CCG ACC CGC GAG CTG GCC CTG CAG ACG GCG GAG GTG 453 Le u Val Leu Ser Pro Thr Arg Glu Leu Ala Leu Gln Thr Ala Glu Val 100 105 110 ATC AGC CGC ATC GGC GAG TTC CTG TCG AAC AGC GCG AAG TTC TGT GAG 501 He Ser Arg He Gly Glu Phe Leu Ser Asn Ser Ala Lys Phe Cys Glu 115 120 125 ACC TTT GTG GGT GGC ACG CGC GTG CAG GAT GAC CTG CGC AAG CTG CAG 549 Thr Phe Val Gly Gly Thr Arg Val Gln Asp Asp Leu Arg Lys Leu Gln 130 135 140 145 GCT CGC GTC GTC GTC GCC GTG GGs ACO CCG GGC CGC GTG TCC GAC GTG 597 Wing Gly Val Val Val Wing Val Gly Thr Pro Gly Arg Val Ser Asp Val 150 155 160 ATC AAG CGC GGC GCC CTC CGC ACC GAG TCC CTG CGC GTG CTG GTG CTC 645 He Lys Arg Gly Ala Leu Arg Thr Glu Ser Leu Arg Val Leu Val Leu 165 170 175 GAC GAG GCT GAT GAG ATG CTG TCT CAG GGC TTC GCG GAT CAG ATT TAC 693 Asp Glu Wing Asp Glu Met Leu Ser Gln Gly Phe Wing Asp Gln He Tyr 180 185 190 GAG ATC TTC CGC TTC CTG CCG AAG GAC ATC CAG GTC ATC CAG CTC TTC TCC 741 Glu He Phe Arg Phe Leu Pro Lys Asp He Gln Val Ala Leu Phe Ser 195 200 205 GCC ACG ATG CCG GAG GAG GTG CTG GAG CTG ACA AAG AAG TTC ATG CGC 789 Wing Thr Met Pro Glu Glu Val Leu Glu Leu Thr Lys Lys Phe Met Arg 210 215 220 225 GAC CCC GTA CGC ATT CTC GTG AAG CGC GAG AGC CTG ACG CTG GAG GGC 837 Asp Pro Val Arg He Leu Val Lys Arg Glu Ser Leu Thr Leu Glu Gly 230 235 240 ATC AAG CAG TTC TTC ATC GCC GTC GAG GAG GAG CAC AAG CTG GAC ACG 885 He Lys Gln Phe Phe He Wing Val Glu Glu Glu His Lys Leu Asp Thr 245 250 255 CTG ATG GAC CTG TAC GAG ACC GTG TCC ATC GCG CAG TCC GTC ATC TTC 933 Leu Met Asp Leu Tyr Glu Thr Val Ser He Wing SLN Ser Val He Phe 260 265 270 GCC AAC ACC CGC AAG GTG GAC TGG ATC GCC GAG AAG CTG AAT CAG 981 Wing Asn Thr Arg Arg Lys Val Asp Trp He Wing Glu Lys Leu Asn Gln 275 280 285 AGC AAC CAC ACC GTC AGC AGC ATG CAC GCC GAG ATG CCC AAG AGC GAC 1029 Ser Asn His Thr Val Ser Ser Met His Ala Glu Met Pro Lys Ser A sp 290 295 300 305 CGC GAG CGC GTC ATG AAC ACC TTC CGC AGC GGC AGC TCC CGC GTG CTC 1077 Arg Glu Arg Val Met Asn Thr Phe Arg Ser Gly Ser Ser Arg Val Leu 310 315 320 GTA ACG ACC GAC CTC GTG GCC CGC GGC ATC GAC GTG CAC CAC GTG AAC 1125 Val Thr Thr Asp Leu Val Wing Arg Gly He Asp Val His His Val Asn 325 330 335 ATC GTC ATC AAC TTC GAC CTG CCG ACG AAC AAO GAG AAC TAC CTG CAC 1173 He Val He Asn Phe Asp Leu Pro Thr Asn Lys Glu Asn Tyr Leu His 340 345 350 CGC ATT ssc csc ssc GGC CGC TAC GGC GTA AAG GGT CTT scc ATC AAC 1221 Arg He Gly Arg Gly Gly -Arg Tyr Gly Val Lys Gly Val Ala He Asn 355 360 365 TTC GTG ACG GAG AAA GAC GTG GAG CTG CTG CAC GAG ATC GAG GGG CAC 1269 Phe Val Thr Glu Lys Asp Val Glu Leu Leu His Glu He Glu Gly His 370 375 380 385 TAC CAC ACG CAG ATC GAT GAG CTC CCG GTG GAC TTT GCC GCC TAC CTC 1317 Tyr His Thr Gln He Asp Glu Leu Pro Val Asp Phe Wing Wing Tyr Leu 390 395 400 GGC GAG TGA GCGGGCCCCT GCCCCCCTTC CCTGCCCCCC TCTCGCGACG 1366 Gly Glu AGAGAACGCA CATCGTAACA CAGCCACGCG AACGATAGTA AGGGCGTGCG GCGGCGTTCC 1426 CCTCCTCCTG ccAGcssccc CCCTCCCCAC CGCTTCTCTT TTGAGAssss sscAGsssGA 1486 GGCGCTGCGC CTGGCTsGAT GTGTGCTTGA GCTTGCATTC CGTCAAGCAA GTGCTTTGTT 1546 TTAATTATOC GCGCCGTTTT GTTGCTCGTC CCTTTCGTTG GTGTTTTTTC GGCCGAAACG 1606 sCGTTTAAAG CA 1618 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 403 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 10: Met Ser Gln Gln Asp Arg Val Wing Pro Gln Asp Gln Asp Ser Phe Leu 1 5 10 15 Asp Asp Gln Pro Gly Val Arg Pro He Pro Ser Phe Asp Asp Met Pro 20 25 30 Leu His Gln Asn Leu Leu Arg Gly He Tyr Ser Tyr Gly Phe Glu Lys 35 40 45 Pro Ser Be lie Gln Gln Arg Ala He Ala Pro Phe Thr Arg Gly Gly 50 5S 60 Asp He He Wing Gln Wing Gln Ser Gly Thr Gly Lys Thr Gly Wing Phe 65 70 75 80 Be He Gly Leu Leu Gln Arg Leu Asp Phe Arg His Asn Leu He Gln 85 90 95 Gly Leu Val Leu Ser Pro Thr Arg Glu Leu Wing Leu Gln Thr Wing Glu 100 105 110 Val He Ser Arg He Gly Glu Phe Leu Ser Asn Be Wing Lys Phe Cys 115 120 125 Glu Thr Phe Val Gly Gly Thr Arg Val Gln Asp Asp Leu Arg Lys Leu 130 135 140 Gln Ala Gly Val Val Val Ala Val Gly Thr Pro Gly Arg Val Ser Asp 145 150 155 160 Val He Lys Arg Gly Ala Leu Arg Thr Glu Ser Leu Arg Val Leu Val 165 170 175 Leu Asp Glu Wing Asp Glu Met Leu Ser Gln Gly Phe Wing Asp Gln He 180 185 190 Tyr Glu He Phe Arg Phe Leu Pro Lys Asp He Gln Val Wing Leu Phe 195 200 05 Being Wing Thr Met Pro Glu Glu Val Leu Glu Leu Thr Lys Lys Phe Met 210 215 220 Arg Asp Pro Val Arg He Leu Val Lys Arg Glu Ser Leu Thr Leu Glu 25 230 235 240 Gly He Lys Gln Phe Phe He Wing Val Glu Glu Glu His Lys Leu Asp 245 250 255 Thr Leu Met Asp Leu Tyr slu Thr Val Ser He Wing Gln Ser Val He 260 265 270 Phe Wing Asn Thr Arg Arg Lys Val Asp Trp He Wing Glu Lys Leu Asn 275 280 285 Gln Ser Asn His Thr Val Ser Ser Met His Wing Glu Met Pro Lys Ser 290 295 300 Asp Arg Glu Arg Val Met Asn Thr Phe Arg Ser Gly Ser Ser Arg Val 305 310 315 320 Leu Val Thr Thr Asp Leu Val Wing Arg Gly He Asp Val His His Val 325 330 335 Asn He Val He Asn Phe Asp Leu Pro Thr Asn Lys Glu Asn Tyr Leu 340 345 350 His Arg He Gly Arg Gly Gly Arg Tyr Gly Val Lys Gly Val Wing 355 360 365 Asn Phe Val Thr Glu Lys Asp Val Glu Leu Leu His Glu He Glu Gly 370 375 380 His Tyr His Thr Gln He Asp Glu Leu Pro Val Asp Phe Ala Ala Tyr 385 390 395 400 Leu Gly Glu (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear: (ix) CHARACTERISTICS: (A) NAME / KEY: Sitido Modified (B) LOCATION: 6 (D) OTHER INFORMATION: / note = "where Xaa is a residue of Leu or Lys" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 11: Xaa Gln Xaa Pro Gln Xaa Val Phe Asp Glu Xaa Xaa 1 5 10 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 26 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ix) ) CHARACTERISTICS (A) NAME / KEY: - (B) LOCATION: 11 (D) OTHER INFORMATION: / note = "Where n is inosine" (ix) FEATURE (A) NAME / KEY: - (B) LOCATION: 17 (D) OTHER INFORMATION: / note = "Where n is inosine" (ix) CHARACTERISTICS (A) NAME / KEY: - (B) LOCATION: 20 (D) OTHER INFORMATION: / note = "Where n is inosine" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: GGAATTCCCC NCAGCTNGTN TTCGAC 26 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 13: Lys Val Phe Asp Glu 1 5 (2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 14: GGATCCATGG TCAAGTCCCA CTACATCTGC 30 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 15: GAATTCAGAC CGGATAGAAA TAAGCCAATG AAA 33 (2) INFORMATION FOR SEQ ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 701 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 16: Met Thr Glu Thr Phe Wing Phe Gln Wing Glu He Asn Gln Leu Met Being 1 5 10 15 Leu He lie Asn Thr Phe Tyr Being Asn Lys Glu He Phe Leu Arg Asp 20 25 30 Val He Ser Asn Wing Asp Wing Cys Asp Lys He Arg Tyr Gln Ser 35 40 45 Leu Thr Asp Pro Wing Val Leu Gly Asp Wing Thr Arg Leu Cys Val Arg 50, 55 60 Val Val Pro Asp Lys Glu Asn Lys Thr Leu Thr Val Glu Asp Asn Gly 65 70 75 80 He Gly Met Thr Lys Wing Asp Leu Val Asn Asn Leu Gly Thr He Wing 85 90 95 Arg Ser Gly Thr Lys Wing Phe Met Glu Wing Leu Glu Wing Gly Wing Asp 100 ios no Met Ser Met He Gly Gln Phe Gly Val Gly Phe Tyr Be Wing Tyr Leu 115 120 125 Val Wing Asp Arg Val Thr Val Thr Ser Lys Asn Asn Ser Asp Glu Val 130 135 140 Tyr Val Trp Glu Be Ser Wing Gly Gly Thr Phe Thr He Thr Ser Wing 145 150 155 160 Pro Glu Ser Asp Met Lys Leu Pro Wing Arg He Thr Leu His Leu Lys 165 170 175 Glu Asp Gln Leu Glu Tyr Leu Glu Wing Arg Arg Leu Lys Glu Leu He 180 185 190 Lys Lys His Ser Glu Phe He Gly Tyr Asp He Glu Leu Met Val Giu 195 200 205 Lys Thr Thr Glu Lys Glu Val Thr Asp Glu Asp Glu Glu Glu Wing Lys 210 215 220 Lys Wing Asp Glu Asp Gly Glu Glu Pro Lys Val Glu Glu Val Thr Glu 225 230 '235. *'. Gly Glu Glu Asp Lys Lys Lys Lys Thr Lys Lys Val Lys Glu Val Thr 245 250 255 Lys Glu Tyr Glu Val Gln Asn Lys His Lys Pro Leu Trp Thr Arg Asp 260 265 270 Pro Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr Lys Ala He 275 280 285 Ser As Asp Trp Glu Asp Pro Pro Ala Thr Lys His Phe Ser Val Gli- 290 295 300 Gly Gln Leu Glu Phe Arg Ala He Met Phe Val Pro Lys Arg Ala VK. 30S 310 315 3 f. Phe Asp Met Leu Glu Pro Asn Lys Lys Arg Asn Asn He Lys Leu Tyr 325 330 335 Val Arg Arg Val Phe He Met Asp Asn Cys Glu Asp Leu Cys Pro Asp 340 345 350 Trp Leu Gly Phe Val Lys Gly Val Val Asp Ser Glu Asp Leu Pro Leu 355 360 365 Asn He Ser Arg Glu Asn Leu Gln Gln Asn Lys He Leu Lys Val He 370 375 380 Arg Lys Asn He Val Lys Lys Cys Leu Glu Met Phe Glu Glu Val Wing 385 390 395 400 Glu Asn Lys Glu Asp Tyr Lys Gln Phe Tyr Glu Gln Phe Gly Lys Asn 405 410 415 He Lys Leu Gly He His Glu Asp Thr Wing Asn Arg Lys Lys Leu Met 420 425 430 Glu Leu Leu Arg Phe Tyr Ser Thr Glu Ser Gly Glu Val Met Thr Thr 435 440 445 Leu Lys Asp Tyr Val Thr Arg Met Lys Ala Glu Gln Asn Ser He Tyr 450 455 460 Tyr He Thr Gly Asp Ser Lys Lys Lys Leu Glu Ser Ser Pro Phe He 465 470 475 480 Glu Gln Ala Lys Arg Arg Gly Phe Glu Val Leu Phe Met Thr Glu Pro 485 490 495 Tyr Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu Asp Lys Lys 500 505 510 Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu Ser Glu Glu 515 520 525 Glu Lys Lys Gln Arg Glu Glu Glu Lys Wing Thr Cys Glu Lys Leu Cys 530 535 540 Lys Thr Met Lys Glu Val Leu Gly Asp Lys Val Glu Lys Val Thr Val 545 550 555 560 Ser Glu Arg Leu Ser Thr Ser Pro Cys He Leu Val Thr Ser Glu Phe 565 570 575 Gly Trp Ser Wing His Met Glu Gln Met Met Arg Asn Gln Wing Leu Arg 580 585 590 Asp Ser Met Met Wing Gln Tyr Met Met Ser Lys Lys Thr Met Glu Leu 595 600 605 Asn Pro Lys His Pro He He Lys Glu Leu Arg Arg Arg Val Glu Ala 610 615 620 Asp Glu Asn Asp Lys Ala Val Lys Asp Leu Val Phe Leu Leu Phe Asp 625 630 635 640 Thr Ser Leu Leu Thr Ser Gly Phe Gln Leu Glu Asp Pro Thr Tyr Wing 645 650 655 Glu Arg He Asn Arg Met He Lys Leu Gly Leu Ser Leu Asp slu Glu 660 665 670 Glu Glu Glu Glu Wing Val Glu Wing Wing Val Wing Glu Thr Ala Pro Wing 675 680 685 Glu Val Thr Wing Gly Thr Ser Ser Met Glu Leu Val Asp 690 695 700 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 704 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 17: Met Thr Glu Thr Phe Wing Phe Gln Wing Glu He Asn Gln Leu Met Ser 1 5 10 15 Leu He He Asn Thr Phe Tyr Ser Asn Lys Glu He Phe Leu Arg Glu 20 25 30 Leu He Ser Asn Wing Being Asp Wing Cys Asp Lys He Arg Tyr Gln Ser 35 40 45 Leu Thr Asn Gln Wing Val Leu Gly Asp Glu Ser His Leu Arg He Arg 50 55 60 Val Val Pro Asp Lys Wing Asn Lys Thr Leu Thr Val Glu Asp Thr Oly 65 70 75 80 He Gly Met Thr Lys Wing Glu Leu Val Asn Asn Leu Gly Thr He Wing 85 90 95 Arg Ser Gly Thr Lys Wing Phe Met Glu Wing Leu Glu Wing Gly Gly Asp 100 105 110 Met Ser Met He Gly Gln Phe Gly Val Gly Phe Tyr Ser Wing Tyr Leu 115 120 125 Val Wing Asp Arg Val Thr Val Val Ser Lys Asn Asn Asp Asp Glu Wing 130 135 140 Tyr Thr Trp Glu Be Ser Wing Gly Gly Thr Phe Thr Val Thr Pro Thr 145 150 155 160 Pro Asp Cys Asp Leu Lys Arg Gly Thr Arg He Val Leu His Leu Lys 165 170 175 Glu Asp Gln Gln Glu Tyr Leu Glu Glu Arg Arg Leu Lys Asp Leu He 180 185 190 Lys Lys His Ser Glu Phe He Gly Tyr Asp He Glu Leu Met Val Glu 195 200 205 Lys Ala Thr Glu Lys Glu Val Thr Asp Glu Asp Glu Asp Glu Wing Wing 210 215 220 Wing Thr Lys Asn Glu Glu Gly Glu Glu Pro Lys Val Glu Glu Val Lys 225 230 235 240 Asp Aep Wing Glu Glu Gly Glu Lys Lys Lys Lys Thr Lys Lys Val Lys 245 250 255 Glu Val Thr Gln Glu Phe Val Val Gln Asn Lys His Lys Pro Leu Trp 260 265 270 Thr Arg Asp Pro Lys Asp Val Thr Lys Glu Glu Tyr Ala Ala Phe Tyr 275 280 285 Lys Ala He Ser As Asp Trp Glu Glu Pro Leu Ser Thr Lys His Phe 290 295 300 Ser Val Glu Gly Gln Leu aiu Phe Arg Ala He Leu Phe Val Pro Lys 305 310 315 320 Arg Wing Pro Phe Asp Met Phe Glu Pro Ser Lys Lys Arg Asn Asn He 325 330 335 Lys Leu Tyr Val Arg Arg Val Phe He Met Asp Asn Cys Glu Asp Leu 340 345 350 Cys Pro Glu Trp Leu Wing Phe Val Arg Gly Val Val Asp Ser Glu Asp 355 360 365 Leu Pro Leu Asn He Ser Arg Glu Asn Leu Gln Gln Asn Lys He Leu 370 375 380 Lys Val He Arg Lys Asn He Val Lys Lys Ala Leu Glu Leu Phe Glu 385 390 395 400 Glu He Ala Glu Asn Lys Glu Asp Tyr Lys Lys Phe Tyr Glu Gln Phe 405 410 415 Gly Lys Asn Val Lys Leu Gly He His Glu Asp Ser Wing Asn Arg Lys 420 425 430 Lys Leu Met Glu Leu Leu Arg Phe His Ser Ser Glu Ser Gly Glu Asp 435 440 445 Met Thr Thr Leu Lys Asp Tyr Val Thr Arg Met Lys Glu Gly Gln Lys 450 455 460 Cys He Tyr Tyr Val Thr Gly Asp Ser Lys Lys Lys Leu Glu Thr Ser 465 470 475 480 Pro Phe He Glu Gln Wing Arg Arg Arg Gly Phe Glu Val Leu Phe Met 485 490 495 Thr Glu Pro He Asp Glu Tyr Val Met Gln Gln Val Lys Asp Phe Glu 500 505 510 Asp Lys Lys Phe Ala Cys Leu Thr Lys Glu Gly Val His Phe Glu Glu 515 520 525 Thr Glu Glu Glu Lys Lys Gln Arg Glu Glu Glu Lys Thr Ala Tyr Glu 530 535 540 Arg Leu Cys Lys Wing Met Lys Asp Val Leu Gly Asp Lys Val Glu Lys 545 550 555 560 Val Val Val Ser Glu Arg Leu Wing Thr Ser Pro Cys He Leu Val Thr 565 570 575 Ser Glu Phe Gly Trp Ser Wing His Met Glu Gln He Met Arg Asn Gln 580 585 590 Wing Leu Arg Asp Ser Ser Met Ser Wing Tyr Met Met Be Lys Lys Thr 595 600 605 Met Glu He Asn Pro Wing His Pro He Val Lys Glu Leu Lys Arg Arg 610 615 620 Val Glu Wing Asp Glu Asn Asp Lys Wing Val Lys Asp Leu Val Tyr} '. (> < 625 630 635 C4.0 Leu Phe Asp Thr Ala Leu Leu Thr Ser Gly Phe Thr Leu Asp Asp Pro 645 650 655 Thr Ser Tyr Wing Glu Arg He His Arg Met He Lys Leu Gly Leu Ser 660 665 670 Leu Asp Asp Glu Asp Asn Gly Asn slu Glu Wing Glu Pro Wing Ala?. • 675 680 685 Val Pro Ala Glu Pro Val Ala Gly Thr Ser Ser Met Glu Gln Val Asp 690 695 700 (2) INFORMATION FOR SEQ ID NO: 18: (i) CHARACTERISTICS. SEQUENCE: (A) LENGTH: 732 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1d: Met Pro Glu Glu Thr Gln Thr Gln Asp Gln Pro Met Glu Glu Glu Glu 1 5 10 15 Val Glu Thr Phe Wing Phe Gln Wing Glu He Wing Gln Leu Met Being Leu 20 25 30 He He Asn Thr Phe Tyr Being Asn Lys Glu He Phe Leu Arg Glu Leu 35 40 45 He Being Asn Being Being Asp Wing Leu Asp Lys He Arg Tyr Glu Ser Leu 50 55 60 Thr Asp Pro Ser Lys Leu Asp Ser Gly Lys Glu Leu His He Asn Leu 65 70 75 80 He Pro Asn Lys Gln Asp Arg Ala Leu Thr He Val Asp Thr Gly He 85 90 95 Gly Met Thr Lys Wing Asp Leu He Asn Asn Leu Gly Thr He Wing Lys 100 105 110 Ser Gly Thr Lys Wing Phe Met Glu Wing Leu Gln Wing Gly Wing Asp He 115 120 125 Ser Met He Gly Gln Phe sly Val Oly Phe Tyr Ser Wing Tyr Leu Val 130 135 140 Wing Glu Lys Val Thr Val He Thr Lys His Asn Asp Asp Glu Gln Tyr 145 150 155 160 Wing Trp Glu Be Ser Wing Gly Gly Ser Phe Thr Val Arg Thr Asp Thr 165 170 175 Gly Glu Pro Met Gly Arg Gly Thr Lys Val He Leu His Leu Lys Glu 180 185 190 Asp Gln Thr Glu Tyr Leu Glu Glu Arg Arg He Lys Glu He Val Lys 195 200 205 Lys His Ser Gln Phe He sly Tyr Pro He Thr Leu Phe Val slu Lys 210 215 220 Glu Arg Asp Lys Glu Val Ser Asp Asp Glu Wing Glu Glu Lys Glu Asp 225 230 235 240 Lys Glu Glu Glu Lys Olu Lys Glu Glu Lys Glu Ser Glu Asp Lys Pro 245 250 255 Glu He Glu Asp Val Gly Ser Asp Glu Glu Asp Glu Lys Asp Gly 260 265 270 Asp Lys Lys Lys Lys Lys He Lys Glu Lys Tyr He Asp Lys Glu 275 280 285 Glu Leu Asn Lys Thr Lys Pro He Trp Thr Arg Asn Pro Asp Asp He 290 295 300 Thr Asn Glu Glu Tyr Gly Glu Phe Tyr Lys Ser Leu Thr Asn Asp Trp 305 310 315 320 Glu Asp His Leu Wing Val Lys His Phe Ser Val Glu Gly Gln Leu Glu 325 330 335 Phe Arg Ala Leu Leu Phe Val Pro Arg Arg Ala Pro Phe Asp Leu Phe 340 345 350 Glu Asn Arg Lys Lys Asn Asn He Lys Leu Tyr Val Arg Arg Val 355 360 365 Phe He Met Asp Asn Cys Glu Glu Leu He Pro Glu Tyr Leu Asn Phe 370 375 380 He Arg Oly Val Val Asp Ser Glu Asp Leu Pro Leu Asn He Ser Arg 385 390 395 400 Glu Met Leu Gln Gln Ser Lys He Leu Lys Val He Arg Lys Asn Leu 405 410 415 Val Lys Lys Cys Leu Glu Leu Phe Thr Glu Leu Wing Glu Asp Lys Glu 420 425 430 Asn Tyr Lys Lys Phe Tyr Glu Oln Phe Ser Lys Asn He Lys Leu Gy 435 440 445 He His Olu Asp Ser Oln Asn Arg Lys Lys Leu Ser Glu Leu Leu Arg 450 455 460 Tyr Tyr Thr Ser Wing Ser Gly Asp Glu Met Val Ser Leu Lys Asp Tyr 465 470 475 480 Cys Thr Arg Met Lys Glu Asn Gln Lys His He Tyr Tyr He Thr Gly 485 490 495 Glu Thr Lys Asp Gln Val Wing Asn Ser Wing Phe Val Glu Arg Leu Ara 500 505 510 Lys His Gly Leu Glu Val He Tyr Met He Glu Pro He Asp Glu Tyr 515 520 525 Cys Val Gln Gln Leu Lys Glu Phe Glu Gly Lys Thr Leu Val Ser Val 530 535 540 Thr Lys Glu Gly Leu Glu Leu Pro slu Asp Glu Glu Glu Lys Lys Lys 545 550 555 560 Gln Glu Glu Lys Lys Thr Lys Phe Glu Asn Leu Cys Lys He Met Lys 565 570 575 Asp He Leu Glu Lys Lys Val Glu Lys Val Val Val Ser Asn Arg Leu 580 585 590 Val Thr Ser Pro Cys Cys Leu Val Thr Ser Thr Tyr Gly Trp Thr Wing 595 600 605 Asn Met Glu Arg He Met Lys Ala Gln Ala Leu Arg Asp Asn Ser Thr 610 615 620 Met Gly Tyr Met Ala Ala Lys Lys His Leu Glu He Asn Pro Asp His 625 630 635 640 Ser He He Glu Thr Leu Arg Gln Lys Wing Glu Wing Asp Lys Asn Asp 645 650 655 Lys Ser Val Lys Asp Leu Val He Leu Leu Tyr Glu Thr Wing Leu Leu 660 665 670 Ser Ser Gly Phe Ser Leu Glu Asp Pro Gln Thr His Wing Asn Arg He 675 680 685 Tyr Arg Met He Lys Leu Gly Leu Gly He Asp Glu Asp Asp Pro Thr 690 695 700 Wing Asp Asp Thr Ser Wing Wing Val Thr Glu Glu Met Pro Pro Leu Glu 705 710 715 720 Gly Asp Asp Asp Thr Ser Arg Met Glu Val Val Asp 725 730 (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1019 base pairs (B) TYPE nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (ix) ASPECT: (A) NAME / KEY: CDS (B) LOCATION: 71.523 (xi) SEQUENCE DESCRIPTION: SEQ ID NO : 19: GAATTCGGCA CGAGGTTTCT GTACTTTATT GCTTCCAGCC TTTATTCACT CTTCGATTTC 60 CTCTAACACC ATG TCC TCC GCC CGC ACC TTT ATT GCC GTC AAG CCG GAC 109 Met Ser Ser Glu Arg Thr Phe He Wing Val Lys Pro Asp 1 5 10 GOC OTG CAG CGC GGC CTC GTT GGC GAG ATC ATC GCC CGC TTC GAG CGC 15 Gly Val Gln Arg Gly Leu Val Gly Glu He He Wing Arg Phe Glu Arg 15 20 25 AAG GGC TAC AAG CTC GTC GCC TTG AAG ATA CTG CAG CCG ACG ACG GAG 205 Lys Gly Tyr Lys Leu Val Wing Leu Lys He Leu Gln Pro Thr Thr Glu 30 35 40 45 CAG GCC CAG GGT CAC TAT AAG GAC CTT TGC TCC AAG CCG TTT TTC CCG 253 Gln Wing Oln sly His Tyr Lys Asp Leu Cys Ser Lys Pro Phe Phe Pro 50 55 60 GCC CTT GTO AAG TAC TTC TCC TCT GGC CCG ATC GTG TGT ATG GTG TGG 301 Wing Leu Val Lys Tyr Phe Ser Ser Gly Pro He Val Cys Met Val Trp 65 70 75 GAG GGT AAG AAC GTG GTG AAG AGC GGC CGC GTO CTG CTC GOC GCG ACG '; '' • > Glu Gly Lys Asn Val Val Lys Ser Gly Arg Val Leu Leu Gly Wing Thr 80 85 90 AAC CCG GCC GAC TCA CAG CCC GGC ACG ATC CGT GGC GAC TTT GCC GTG 397 Asn Pro Wing Asp Ser Gln Pro Gly Thr He Arg Gly Asp Phe Wing Val 95 100 105 GAT GTG GGC CGC AAC GTG TGC CAC GGG TCC GAC TCT GTG GAG AGC GCG 445 Asp Val Gly Arg Asn Val Cys His Gly Ser Asp Ser Val Glu Ser Wing 110 115 120 125 GAG CGC GAG ATC GCC TTT TGG TTC AAG GCG GAT GAG ATC GCG AGC TGG 493 Glu Arg Glu He Ala Phe Trp Phe Lys Wing Asp Glu He Ala Ser Trp 130 135 140 ACG TCG CAC TCC GTG TCC CAG ATC TAT GAG TAACGGTGAT TGCGGACACG M ': Thr Ser His Ser Val Ser Gln He Tyr Glu 145 150' CTTTGAGGAC GTAGCTGTAC CCCCAATGAA TTCTTCTCTG AAAACCACAT CATAAGCCTC CO. '? TTAAGAGGTT ATTTTTCTTG ATCGATGCCC GGTGGTGACC AGCACCATTC CTTTATCGGA 663 TTCACTCACA CTCCTAGCGA ATCATGTAGT GCGGTGAGAG TGGGCTCTGG AGGAGACTGT '? > ' TGTGTAGCCA TGGCTTCAGG AGAGAAAACA AAATACAAGG AAAGGCAATA TGTAACTATG 783 GGGTTCCCTT TTTTACTATG CAAAGTTTTT ATAACTCCTG ATCGGCAAAA ACAACAACAA 843 CCGCCATACA CCAAGAGCAA ATGCTTTCTT CTGCGGACTG TGCTTCTGTT TTTTTTTATG 903 AAGGAGTGAC TCGCGCGATG AAAAGTGTOT GCOTGGGAGA TGTATTTCCT TTTTTTGTTC 963 ATAGTGGCGA CAGCTCACTG TTGACGATGA C-AAAAAAAAA AAAAAAAAAA CTCGAG 1019 (2) INFORMATION FOR SEQ ID NO: 20: SEQUENCE CHARACTERISTICS: (A) LENGTH: 151 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (i) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20: Met Ser Ser Glu Arg Thr Phe He Wing Val Lys Pro Asp Gly Val Gln 1 5 10 15 Arg Gly Leu Val Gly Glu He He Wing Arg Phe Glu Arg Lys Gly Tyr 20 25 30 Lys Leu Val Wing Leu Lys He Leu Gln Pro Thr Thr Glu Gln Wing Gln 35 40 45 Gly His Tyr Lys Asp Leu Cys Ser Lys Pro Phe Phe Pro Ala Leu Val 50 55 60 Lys Tyr Phe Ser Ser Gly Pro He Val Cys Met Val Trp Glu Gly Lys 65 70 75 80 Asn Val Val Lys Ser Gly Arg Val Leu Leu Gly Ala Thr Asn Pro Wing 85 90 95 Asp Ser Gln Pro Gly Thr He Arg Gly Asp Phe Wing Val Asp Val Gly 100 105 110 Arg Asn Val Cys His Gly Ser Asp Ser Val Glu Ser Wing Glu Arg Glu 115 120 125 He Wing Phe Trp Phe Lys Wing Asp Glu He Wing Trp Thr Ser His 130 135 140 Ser Val Ser Gln He Tyr Glu 145 150 (2) INFORMATION FOR SEQ ID NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1532 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (¡) i) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (ix) ASPECT: (A) NAME / KEY: CDS (B) LOCATION: 14..973 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: TGC CAG GAG CCC AAC TCC TTC AGC TOC GAC AGC GAC GCG AAT AAG TGC 385) Cys Gln Glu Pro Asn Cys Phe Ser Cys Asp Ser Asp Wing Asn Lys Cys 110 115 120 ACA CAA TGT GCG CCG AAC TAC TAC CTC ACC CCG CTC TTG ACC TOC TCC 4 '-i 3' Thr Gln Cys Wing Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser 125 130 135 140 CCG GTG GCC TGC AAC ATC GAG CAC TGC ATG CAG TGC GAC CCA CAG ACG. ! • > Thr Asp Cys Asn Asp Gly Tyr Gly Leu Thr Ser Ser Val Cys Val 30 35 '40 CGC TGC AGT GTA GCG GGC TGC AAG AGC TGC CCC GTC GAC GCT AAC GTC 1"? Arg Cys Ser Val Wing Gly Cys Lys Ser Cys Pro Val Asp Ala Asn Val 45 50 55 60 TGC AAA GTO TGT CTC OGC GGC AGC GAO CCC ATC AAC AAT ATG TGC CCC? " 1 Cys Lys Val Cys Leu Gly Gly Ser Glu Pro He Asn Asn Met Cys Pro 65 70 75 TGC ACC GAC CCC AAC TGC GCC AGC TGC CCC AGC GAC GCT GGC ACG TGC 289 Cys Thr Asp Pro Asn Cys Wing Ser Cys Pro Ser Asp Wing Gly Thr Cys 80 85 90 ACT CAG TGC GCG AAC GGC TAC GGT CTC GTG GAC GGC GCC TGT GTG AGA 337 Thr Gln Cys Wing Asn Gly Tyr Gly Leu Val Asp Gly Wing Cys Val Arg 95 100 105 TGC CAG GAG CCC AAC TGC TTC AGC TGC GAC AGC GAC GCG AAT AAG TGC 385 Cys Gln Glu Pro Asn Cys Phe Ser Cys Asp Ser Asp Wing Asn Lys Cys 110 115 120 ACA CAA TGT GCG CCG AAC TAC TAC TAC CTC ACC CCG CTC TTG ACC TGC TCC 4 O Thr Gln Cys Ala Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser 125 130 135 140 CCG GTG GCC TGC AAC ATC GAG CAC TGC ATG CAG TGC GAC CCA CAG ACG. ! 'Pro Val Ala Cys Asn He Glu His Cys Met Gln Cys Asp Pro Gln Thr 145 150 155 CCG TCG CGC TGC CAG GAG TGC GTG TCC CCC TAC GTG GTT GAC AGC TAC 529 Pro Ser Arg Cys Gln Glu Cys Val Ser Pro Tyr Val Val Asp Ser Tyr 160 165 170 GAC GGC CTC TGC AGG CTC TCC GAT GCC TGC TCC GTG CCC AAC TGC AAG 577 Asp Gly Leu Cys Arg Leu Ser Asp Ala Cys Ser Val Pro Asn Cys Lys 175 180 185 AAG TGC GAG ACC GGT ACC TCC AGG CTC TGC GCC GAG TGC GAC ACC GGC 625 Lys Cys Glu Thr Gly Thr Ser Arg Leu Cys Wing Glu Cys Asp Thr Gly 190 195 200 TAC AGT CTC TCC GCC GCG ACG AGC TGC AGC AGT CCA ACC ACG CAG 673 Tyr Ser Leu Ser Wing Asp Ala Thr Ser Cys Ser Ser Pro Thr Thr Thr Gln 205 210 215 220 CCG TGC GAG GTG GAG CAC TGC AAC ACA TGT AAC GGC GAT AGC ACC 721 Pro Cys Glu Val Glu His Cys Asn Thr Cys Val Asn Gly Asp Ser Thr 225 230 235 CGC TGT GCC TAC TGC AAC ACC GGC TAC TAC GTC TCC GAT GGC AAG TGC 769 Arg Cys Wing Tyr Cys Asn Thr Gly Tyr Tyr Val Ser Asp Gly Lys Cys 240 245 250 AAG GCC ATG CAG GGC TGC TAC GTG TCG -AAC TG C GCG CAG TGC ATG CTO 817 Lys Wing Met Gln Gly Cys Tyr Val Ser Asn Cys Wing Gln Cys Met Leu 255 260 265 CTT GAC AGC ACC AAG TGC TCC ACG TGC GTG AAA OGO TAC CTG CTC ACG 865 Leu Asp Ser Thr Lys Cys Ser Thr Cys Val Lys Gly Tyr Leu Leu Thr 270 275 280 TCG TCC TAC AGT TGC GTC TCG CAG AAA GTC ATC AAC AGT GCG GCC GCG 913 Ser Ser Tyr Ser Cys Val Ser Gln Lys Val He Asn Ser Ala Wing Wing 285 290 295 300 CCC TAC TCT CTG TGG GTG GCC GCC GCC GTG CTC CTC ACC TCT TTT GCC 961 Pro Tyr Ser Leu Trp Val Wing Wing Val Leu Leu Thr Ser Phe Wing 305 310 315 ATG CAC CTA GCA TAGTGCCCAG CGGCATGCGA ACAACCCCAC TCTCATTCTC 1013 Met His Leu Wing 320 CAACATGTGC ATACACACAC ACACAGACAG CGOGGCAGCA CCCCCTCCCC ACACACACAC 1073 ACGCACTTCC CCCTTGTCTT GTTCTTCTTT CCTCCTTCGC ATTTCTTTCT CTCGTGCGCT 1133 GGCGCCGGCC TCCTGCACGT CGCTCCCCTC CCCCTAACCT CTATTCTCTC TCTCTCTCTC 1193 TCTCGCCGGC ATCATTGCTT CTTACCCTTT TCTGATCCTT GCTCGCGTGG GCGGACACTG 1253 CCACAGTCCC ACAGCGCAGA CACACGTGTT TAAACGGCGC AGGCATCCCT CCCTATCACT 1313 TCATTTCTCC TAAAGCCACT CACCAAGTCG CACACCGCCC TCCCCCATCG GCCGCCCTTC 1373 CGGGCGCAGC TGTGCGGAAT GGGTGTGTGC TCGACCTCGT TCCTGGCAGC TCACTCGCAT 1433 GTGTACAGCC ACTCCAACCA CGAAAOCTCT CTTCTGCGCA CATAAAAAAA AAAAAAAAAAA 1493 AAAAACTCGA GGGGOGGCCC GGTACCCAAA 1523 (2) INFORMATION FOR SEQ ID NO: 22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 320 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 22: Val Leu Pro Asp Met Thr Cys Ser Leu Thr sly Leu Gln Cys Thr Asp 1 5 10 15 Pro Asn Cys Lys Thr Cys Thr Thr Tyr Gly Gln Cys Thr Asp Cys Asn 20 25 30 Asp Gly Tyr oly Leu Thr Ser Ser Ser Val Cys Val Arg Cys Ser Val 35 40 45 Wing Gly Cys Lys Ser Cys Pro Val Asp Wing Asn Val Cys Lys Val Cys 50 55 60 Leu Gly Gly Ser Glu Pro He Asn Asn Met Cys Pro Cys Thr Asp Pro 65 70 75 80 Asn Cys Ala Ser Cys Pro Ser Asp Wing Gly Thr Cys Thr Gln Cys Wing 85 90 95 Asn Gly Tyr Gly Leu Val Asp Gly Wing Cys Val Arg Cys Gln Glu Pro 100 105 pn Asn Cys Phe Ser Cys Asp Ser Asp Wing Asn Lys Cys Thr Gln Cys Wing 115 120 125 Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser Pro Val Wing Cys 130 135 140 Asn He Glu His Cys Met Gln Cys Asp Pro Gln Thr Pro Ser Arg Cys 1 5 150 155 160 Gln slu Cys Val Ser Pro Tyr Val Val Asp Ser Tyr Asp sly Leu Cys 165 170 175 Arg Leu Ser Asp Wing Cys Ser Val Pro Asn Cys Lys Lys Cys Glu Thr 180 185 190 Gly Thr Ser Arg Leu Cys Wing Glu Cys Asp Thr Gly Tyr Ser Leu Ser 195 200 205 Wing Asp Wing Thr Ser Cys Ser Ser Pro Thr Thr Gln Pro Cys Glu Val 210 215 220 Glu His Cys Asn Thr Cys Val Asn Gly Asp Ser Thr Arg Cys Ala Tyr 225 230 235 240 Cys Asn Thr Gly Tyr Tyr Val Ser Asp Gly Lys Cys Lys Wing Met Gln 245 250 255 Gly Cys Tyr Val Ser Asn Cys Wing Gln Cys Met Leu Leu Asp Ser Thr 260 265 270 Lys Cys Ser Thr Cys Val Lys Gly Tyr Leu Leu Thr Ser Ser Tyr Ser 275 280 285 Cys Val Ser Gln Lys Val He Asn Ser Ala Ala Ala Pro Tyr Ser Leu 290 295 300 Trp Val Ala Ala Ala Val Leu Leu Thr Ser Phe Ala Met His Leu Ala 305 310 315 320 (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 797 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (ix) ASPECT: (A) NAME / KEY: CDS (B) LOCATION: 27..623 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: CTGTACTTTA TTGCCACCAG CCAGCC ATG TCC TGC GGT AAC GCC AAG ATC AAC 53 Met Ser Cys Gly Asn Ala Lys He Asn 1 5 TCT CCC GCG CCG TCC TTC GAG GAG GTO GCG CTC ATG CCC AAC GGC AGC 101 Ser Pro Pro Ser Phe Glu Glu Val Wing Leu Met Pro Asn Gly Ser 10 15 20 25 TTC AAG AAG ATC AGC CTC TCC TCC TAC TAG AAG TFT GGC AAG TGG TTC GTG CTC 149 Phe Lys Lys Ser Ser Leu Ser Tyr Lys Gly Lys Trp Val Val Leu 30 35 40 TTC TTC TAC CCG CTC GAC TTT AGC TTC GTG TGC CCG ACA GAG GTC ATC 197 Phe Phe Tyr Pro Leu Asp Phe Ser Phe Val Cys Pro Thr Glu Val He 45 50 55 GCG TTC GCC AGC GTG AGT CGC TTC AAC GAO CTC AAC TGC GAG GTC 245 Wing Phe Ser Asp Ser Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val 60 65 70 CTC GCG TGC TCG ATA GAC AGC GAG TAC GCG CAC CTG CAG TGG ACG CTG 293 Leu Ala Cys Ser He Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 75 80 85 CAG GAC CGC AAG AAG GGC GGC CTC GGG ACC ATG GCG ATC CCA ATG CTA 3 1 Gln Asp Arg Lys Lys Gly Gly Leu Gly Thr Met Wing Pro Pro Met Leu 90 95 100 105 GCC GAC AAG ACC AAG AGC ATC GCT CGT TCC TAC GGC GTG CTG GAG GAG 389 Wing Asp Lys Thr Lys Ser Wing Arg Ser Tyr Gly Val Leu Glu Glu 110 115 120 AGC CAG GGC GTCC GCC TAC CGC GGT CTC TTC ATC ATC GAC CCC CAT GGC 437 Ser Gln Gly Val Ala Tyr Arg Gly Leu Phe He He Asp Pro His Gly 125 130. 135 ATG CTG CGT CAG ATC ACC GTC AAT GAC ATG CCG GTG GGC CGC AGC GTG 485 Met Leu Arg Gln He Thr Val Asn Asp Met Pro Val Gly Arg Ser Val 140 145 150 GAO GAG GTT CTA CGC CTG CTG GAG GCT TTT CAG TTC GTG GAG AAG CAC 533 Glu Glu Val Leu Arg Leu Leu Glu Wing Phe Gln Phe Val Glu Lys His 155 160 165 GGC GAG GTG TGC CCC GCG AAC TGG AAG AAG GGC GCC CCC ACG ATG AAG 581 Gly Glu Val Cys Pro Wing Asn Trp Lys Lys Gly Wing Pro Thr Met Lys 170 175 180 185 CCG GAA CCG AAT GCG TCT GTC GAG OGA TAC TTC AGC AAG CAG 623 Pro Glu Pro Asn Wing Ser Val Glu Gly Tyr Phe Ser Lys Gln 190 195 TAAACCTGTG AGCGTCGCAs GAGTCAGTOT OACCTCACCC CCCTCTGCCA GTGGGTGCGA fa'U? GAsGGCGTGA GGGATTGTGG sAAGsCTGTT GOATATOATE CAGACAGCGA TGAATGCAAC 7 ..-. TCCCACACAC TGGCCCTCCT CAGCCCTCTC CACACAGACA CACGCACGCA TGTG '> - > • / (2) INFORMATION FOR SEQ ID NO: 24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 199 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 24: Met Ser Cys Gly Asn Wing Lys He Asn Ser Pro Wing Pro Ser Phe Glu 1 5 10 15 Glu Val Wing Leu Met Pro Asn Gly Ser Phe Lys Lys Ser Ser Leu Ser 20 25 30 Ser Tyr Lys Gly Lys Trp Val Val Leu Phe Phe Tyr Pro Leu Asp Phe 35 40 45 Be Phe Val Cys Pro Thr Glu Val He Ala Phe Ser Asp Ser Val Ser 50 55 60 Arg Phe Asn Glu Leu Asn Cys Glu Val Leu Ala Cys Ser He Asp Ser 65 70 75 80 Glu Tyr Ala His Leu Gln Trp Thr Leu sln Asp Arg Lye Lys Gly Gly 85 90 95 Leu Gly Thr Met Ala He Pro Met Leu Ala Asp Lys Thr Lys Ser He 100 105. no Wing Arg Ser Tyr Gly Val Leu Glu Glu Ser Gln Gly Val Wing Tyr Arg 115 120 125 Gly Leu Phe He He Asp Pro His Gly Met Leu Arg Gln He Thr Val 130 135 140 Asn Asp Met Pro Val Gly Arg Ser Val Glu Glu Val Leu Arg Leu Leu 145 150 155 160 Glu Ala Phe Gln Phe Val Glu Lys His Gly Glu Val Cys Pro Ala Asn 165 170 175 Trp Lys Lys Gly Wing Pro Thr Met Lys Pro Glu Pro Asn Wing Ser Val 180 185 190 Glu Gly Tyr Phe Ser Lys Gln 195 (2) INFORMATION FOR SEQ ID NO: 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 637 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Tropic Leishmania (ix) ASP ECTO: (A) NOM B RE / C LAVE: CDS (B) U BICTION: 7. .624 (xi) DESC RI PCIÓ NDE SEC UENC IA: S EQ ID NO: 25: CGT GGC ATG GTG CGT CAG ATC ACC GTC AAC GAC ATG CCG GTG GGC CGC * 8-'3 Arg Gly Met Val Arg Gln He Thr Val Asn Asp Met Pro Val Gly Arg 145 150 155 AAC GTG GAG GAG GCT CTG CGC CTG CTG GAG GCT TTG CAG TTC GTG GAG 5285 Asn Val Glu Glu Ala Leu Arg Leu Leu Glu Ala Leu sln Phe Val Glu 160 165 170 GGC AGC TTC AAG AAG ATC AGC CTC TCC GCC TAC AAG GGC AAG TGO GTC 1.4-Gly Ser Phe Lys Lys He Ser Leu Ser Wing Tyr Lys Gly Lys Trp Val 35 40 45 GTG CTC TTC TTC CCG CTC GAC TTC ACC TTC GTG TGC CCG ACA GAG 192 Val Leu Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu 50 55 60 ATC ATC GCG TTC TCC GAC AAC GTG AGT CGC 'TTC AAC GAG CTC AAC TGC 240 He He Wing Phe Ser Asp Asn Val Ser Arg Phe Asn Glu Leu Asn Cys 65 70 75 GAG GTC CTC GCG TGC TCG ATG GAC AGC GAG TAC GCG CAC CTG CAG TGG 288 Glu Val Leu Ala Cys Ser Met Asp Ser Glu Tyr Ala His Leu Gln Trp 80 85 90 ACG CTG CAG GAC CGC AAG AAG GGC GGC CTC GGO GCC ATG GCG ATC CCA 336 Thr Leu Gln Asp Arg Lys Lys Gly Gly Leu Gly Ala Met Ala He Pro 95 1 00 105 110 ATG CTG GCC GAC AAG ACT AAG AGC ATC GCT CGT TCC TAC GGC GTG CTG 384 Met Leu Wing Asp Lys Thr Lys Ser He Wing Arg Ser Tyr Gly Val Leu 115 120 125 GAG GAG AGC CAG GGC GTG GCC TAC CGC GGT CTC TTC ATC ATC GAC CCC 432 Olu Glu Ser Gln Gly Val Wing Tyr Arg Gly Leu Phe He He Asp Pro 130 135 140 CGT GGC ATG GTG CGT CAG ATC ACC GTC AAC GAC ATG CCG GTG GGC CGC '• &;; Arg Gly Met Val Arg Gln He Thr Val Asn Asp Met Pro Val Gly Arg 145 150 155 AAC GTG GAG GAG GCT CTG CGC CTG GG GCT TTG CAG TTC GTG GAG 528 Asn Val Glu Glu Ala Leu Arg Leu Leu Glu Ala Leu Gln Phe Val Glu 160 165 170 AAG CAC GGC GAG GTG TGC CCC GCG AAC TGG AAG AAG GGC GCC CCC ACG 576 Lys His Gly Glu Val Cys Pro Wing Asn Trp Lys Lys Qly Wing Pro Thr 175 180 185 190 ATO AAG CCG GAA CCG AAG GCG TCT GTC GAO GGA TAC TTC AGC AAG CAG 624 Met Lys Pro Glu Pro Lys Wing Ser Val Glu Gly Tyr Phe Ser Lys Gln 195 200 205 TAAGAATTCC ATG 637 (2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 206 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 26: Met His His His His His His His Met Ser Cys Gly Asn Ala Lys He Asn 1 5 10 15 Ser Pro Ala Pro Pro Phe Glu Glu Met Ala Leu Met Pro Asn Gly Ser 20 25 30 Phe Lys Lys He Ser Leu Ser Ala Tyr Lys Gly Lys Trp Val Val Leu 35 40 45 Phe Phe Tyr Pro Leu Asp Phe Thr Phe Val Cys Pro Thr Glu He He 50 55 60 Wing Phe Ser Asp Asn Val Ser Arg Phe Asn Glu Leu Asn Cys Glu Val 65 70 75 80 Leu Ala Cys Ser Met Asp Ser Glu Tyr Ala His Leu Gln Trp Thr Leu 85 90 95 Gln Asp Arg Lys Lys Gly Gly Leu Gly Wing Met Wing Pro Pro Met Leu 100 105 110 Wing Asp Lys Thr Lys Ser He Wing Arg Ser Tyr Gly Val Leu Glu Glu 115 120 125 Ser Gln Gly Val Wing Tyr Arg Gly Leu Phe He He Asp Pro Arg Gly 130 135 140 Met Val Arg Gln He Thr Val Asn Asp Met Pro Val Gly Arg Asn Val 145 150 155 160 Glu Glu Ala Leu Arg Leu Leu Glu Ala Leu Gln Phe Val Glu Lys His 165 170 175 Ily Glu Val Cys Pro Wing Asn Trp Lys Lys Gly Wing Pro Thr Met Lys 10 180 185 190 'ro Glu Pro Lys Ala Ser Val Glu Gly Tyr Phe Ser Lys sln 195 200 205 (2) INFORMATION FOR SEQ ID NO: 27: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: another nucleic acid 20 (A) DESCRIPTION: / desc = PCR initiator "50 (MAPs-1-5 ÓHis) to simultaneously amplify AMPS-1 cDNA for both L. major and L. tropic while 6 His residues are added to the amino terminus of the encoded protein ", (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 27: -c CAATTACATA TGCATCACCA TCACCATCAC ATGTCCTGCG GTAACGCCAA G 51 -.O (2) INFORMATION FOR SEQ ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "3" PCR primer (MAPS-1-3ÓR1) to simultaneously amplify AMPS-1 cDNA for both L. major and L. tropic " (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 26: CATGGAATTC TTACTGCTTG CTGAAGTATC C 31 (2) INFORMATION FOR SEQ ID NO: 29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 520 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: GGCACGAGCC CTTGCCTACA TTTGCTCGCC GATATTCGCG GGGAGTTCTT CAATTTGCGT 60 CGCCTAGAAC TGCTCAATGT CGCGCAACAA GCGCAGCTCG TCGTGGCGCA CGAAGGTGAT 120 GGCCAGTCCA GTGCGGCCCA TGCOGCCAGT GCGGCCGATG CGGTGAATGT ACTGCTCACG 180 CGCGAGCGGC AAATCGTAGC TGAGGACGAG CGAGACGCGC TCCACATCAA TGCCACGCGC 240 CCACAGGTCC GTTGTAATGA NCACGCGGCT GTGTCCATTA CGGAATGCCG CATAATCTCG 300 TCGCGCTCCG CCTGGGGCAT GTCGCCGTGC ATGGCGGACA CAGCGAAATT CTCGCGCGTC 360 ATCTTCTTGG CAAGCTGCTC CACCTTTTTG CGGGTGTTGC ANAAAACCAC NGcstsGscs 420 ATCGTTAAGC TGTCGTACAA ACTCCATCAA GAAATCGAAT TTGTTTTTCT CTTCGTCNAC 480 NGANACAAAN TACTGTTTAA CGCT TCCAC GOTGATCTCA 520 (2) INFORMATION FOR SEQ ID NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: GGCACAAGGT TTTCGGGTTA TCTTCACGCA TGGTGGAGCG CAGATGGGTG AAGTAAATAC 60 GCGGACCGAA CTCCTTsATC ATATCAACCA GATCGTTGTC AGCACGCACG CCGTANGAAC 120 CGGTOCACAT GGTAAAACCG TNTGCCATGC tsTTTACOGT ATCAACCATC CACTGCATAT 180 CTTCAATGGT GGAAACAATG CGCGGCAGGC CGAGGATCCG GCGCGGCTCA TCATNNAGNT 240 NATNAACCAN TCGCACGTCT ANTTCTGCAC TAAACTACAA NTATCGGTNA CATATNATAA 300 GGCCNATTTT CGGTCCAGGA NTATGTNCTN TCAAAATGCC NCGTTANNCA CTCTTAAATG 360 TCTCANGNGN AAANTNGTTC TAAAGGGTGT CCAAAANNTN NTTACCNTTC CCCNCTTACT 420 TCAANANCTC CTCNAATTCC CNGGCCCTTN GACNANNATT TNCTATTAAA ANATANAANN 480 TTCAAATGNA TTCCCNACCT NCCNTNNCCA AANNTANCNA ATAATCANNC CCCTNTCANN 540 ANNTCCCANC TTACCCTCCN NTNGNNGGGN NNNCCNATTN CCCCAANCCC NCNCTAAATA 600 (2) INFORMATION FOR SEQ ID NO: 31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31: GGCACGAGCC TCAGTGGAGC TCAATGAAGA TATTCCAOTA TCTTACTCTG GATOOCACTC 60 AGGTCTCCGG CACGCTGCCG CCCCAGTGGA GCGCGATGGC ATCGGTGCGA ATTCTTAACC 120 TGNAGGGTAC TGAGGTCTCT GGTACGCTGC COCCTsAGTG GATATCNATG TO CAGGCTGC 180 AAACTCTGAA TCTGCGGCGC ACGAAANTAT CCGGCACTCT GCCOCCCGAA TGGANTTCTA 1P TGAACAGCCT GGAGTACTTT CACCTTTATC TTACTCAGGT CTCCGGCACG CTGCCGCCCG • < • ••• AGTGGAGTGG GATGTCNAAG GCCGCATACT TCTGGCTGGA ATACTGCGAC CTGTCCGGCA 360 NTCTGCCGCC CNAGTGOTCG TCNATGCCAA AsCTGCGCGG TATCTCACTG ANCGGCAACA 4? 0 AATTCTTGCG NGTGTNTNCC NGACTCNTGG GATTCAGAAA GOTGGTCCTT GTTGTTGGGC 480 ATCNAAGGAN CAAACCCCAA NGGGCCCNCN AATTGCTTGG GCNTGCTTAA GGANTTGCAC 540 NAACCAACNC CNCCAAAAAC CCCCCCCACC NCNAAANNAC NANCCCCCAC TTAANNCCCN 600(2) INFORMATION FOR SEQ ID NO: 32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32: NGCACGAGAA GCGCAACTGO CGCATCCCAT CTOTGACTAT CTGCCTGAAC AGGGGCAATN 60 OTTTOTTGGT AACAGCCTGG TGGTACGTCT sATTGATNCG CTTNCGCAA TTCCGGCAGs 120 TTACCCGGTG TACANCAACC GTGGGGCCAN CGGTATCNAC NGGCTGCTTT CGACCGCCGC 180 CGONOTTCAN COOGCAANCG sCAAACCGAC GCTGsCGATT GTsGGCGATC TCTCCGCACT 240 TTACGATCTC AACGCNCTGs COTTATTOCG TCAGGTTTCT CCGCCGCTGG TATTAATTGT 300 GOTGAACAAC AACGGCNGGO CAAAATTTTC TCGCTGTTGC CAACGCCCCC AAAGCNAGCG 360 TGAAGCGTTT CTATCTGATG CCGCAAAACG TCCATTTTGA AACACGCCGC CNCCCATGTT 420 TCGANCTGAA AATATCATCO TCCGCAAAAC TGGCANGAAA CTTNGAAAAC CGCATTTTGC 480 CGACNCCCTG sCNCACGCCC AACCCACCCA CCGGTTGATT GAAAATGGTG GOTTAACGAA 540 NCCNNATGOG TGCCCCAAAN CNCNNCCANC CAAATTTCTG GGCCCAGGTT AAANCCCTTT 600 (2) INFORMATION FOR SEQ ID NO: 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 33: ACGATGACCA TGCCCCGAAO GAGOATGGCC ATGCGCCOAA GAACGATGAC CATGCCCCGA 60 AGGAGGATGG CCATGCGCCG AAGAACGATG ACCATGCCCC GAAsGAGGAT GGCCATGCGC 120 CCAAGAACGA CGGGGATGTs CAGAANAAOA GCGAAsATGs AOACAACGTG ssAGAGGGAG 180 GCAAGGGCAA TGAGGATGGT AACGATGATC AGCCGAAGOA GCACGCTGCC GOCAACTAGT 240 GGGCTGCGTC CGGGCTTGTG TGCGANCCGT GCTCTGCACC CCGCCGCTCG -TGCATCCTCG 300 CATGTOGACT GCGTGTGTCT CTCCCGCTTT GTCTCTCTCC CCCACACAOT GGCTGATGCC 360 TCCACGssGT TGCTGTGGCT CCACCTCCTG ACCACTGCCA GCTTTCTTss CTTGCCTCCC 420 CTCTGCGCCT CCGCTCGTGC CGCTCGTGCC GAATTCGATA TCAAGCTTAT CGATACCGTC 480 NACCTCGAAG GCGGGCCCGG TTACCCATTC GCCCTATANT GAGTCNTATT ACAATTCCTG 540 GCGTCGTTTT ACACGTCOTG ACTGGGAAAA ACCCTGGCGT TCCCCACTTA TCGCCTTGCA 600 (2) INFORMATION FOR SEQ ID NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 516 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: Genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 34: AGCTGCAGCA GCGCCTAGAC ACCGCCACGC AGCAGCGCGC CGAGCTGGAG GCACGGGTGG 60 CACGGCTGGC CGCGGACCGC GACGAGGCGC GCCAGCAGCT GGCCGCGAAC GCCGAGGAGC 1? 0 TGCAGCAGCG CCTAGACACC GCCACGCAGC AGCGCGCCGA GCTGGAGGCA CGGGTGGCAC '80 GsCTGGCCGC GGACGsCGAC OAGOCCCGCC AGCAGCTCGC CGCGAACGCC GAGsAsCTGC 240 AGCACCGCCT AGACACCGCC ACGCAGCAGC GCGCCGAGCT GGAGGCACAG GTGGCACGGC 300 TGGCCGCGAA CGCCGAGGAG CTGCAGCAGC GCCTAGACAC CGCCACGCAG CAGCGCGCCG 360 AGCTGGAGGC ACGGGTGGCA CGGCTGGCCG CGGACCGCGA CGAGGCGCGC CAGCAGCTGG "7n CCGCGAACGC CGAGsAGCTG CAGCAGCGCC TAOACACCGC CACGCACCAG CGCGCCOAGC TGsARGCACA GGTGGCACGG CTGGCCGCGA AMGCCG 516 (2) INFORMATION FOR SEQ ID NO: 35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 622 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: genomic DNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 35: GGCACGANAG ATCTTCGTGA AGACGCTGAC CGGCAANACG ATCGCGCTGG AGGTGGAGCC 60 GAsCGACACG ATCGAGAACG TGAAGGCCAA GATCCAGGAC AAGGAGGGCA TCCCGCCGGA 120 CCAGCAOCGC CTGATCTTCG CCGGCAAGCA GCTGOAOGAN GGCCGCACGC TCTCGGACTA 180 CAACATCCAO AAGGAGTCCA CGCTGCACCT GGTGCTGCGC CTGCGCGGCG GCATGCANAT 240 CTTCGTGAAA ACGCTNACCG GCAANACAAT CGCGCTGGAA GTGGAGCCGA ACGACCNATC 300 GAAAACGTGA AGGCCNANAT CCANGACAAG sAAGGCNTCC CGCCGGANCA GCACGCCTGA 360 TCTTCCNCCG GCAACCACTT GANGAAGGGC NCACGCTCTC NGACTACNAC ATCCANAAAG 420 GATTCCNCCC TGCACCTTGT TGCTTGCNCC TTGCTCGGGG GGCATGCCNA ATCTTCCTTN 480 AAAACCTCAA CCGGCAANAA CAATCCCCCN CNGAAOTTGG AACCCAACCA NCCCATTCNA 540 AAACTTTAAA GGCCNNNATT CCNGAACAAN GAAOGGCTTCENTOAC CNNCAANCNC 600 CCTGATTNTT CCCCCGGNNN NCANTTTGGA ANGAAGGGCC CCNCCCTCCN CCGAATTNCN 660 ACNTCCCNAA ANGGATTCCC CCCCTNCCCT TGNTTTTTGC GCOTNNNNNC GGCNNCNTNC 720 CNAAATTCCG NCCNAAGGNC CCCANTANAN CNACTTTCCC NTTCCCCCCC NNNNTTTTGC 780 NTAAANTTTT TNCCCCCNNA AANNTCCCNT TTNCNANTTN AN 822 AGCTGCAGCA GCGCCTAGAC ACCGCCACGC AGCAGCGCGC CGAGCTGGAG GCACGGGTGG 60 CACGGCTGGC CGCGGACCGC GACGAGGCGC GCCAGCAGCT GGCCGCGAAC GCCGAGGAGC 1 20 TGCAGCAGCG CCTAGACACC GCCACGCAGC AGCGCGCCGA GCTGGAGGCA CGGGTGGCAC '80 GGCTGGCCGC GGACGGCGAC GAGGCCCGCC AGCAGCTOGC CGCGAACGCC OAGGAGCTGC 240 AGCAGCGCCT AGACACCGCC ACGCAGCAGC GCGCCGAGCT GGAGGCACAG GTGOCACGsC 300 TGGCCGCGAA CGCCGAGGAG CTGCAGCAGC GCCTAGACAC CGCCACGCAG CAGCGCGCCG 360 AGCTGGAGGC ACGGGTGGCA CGGCTGGCCG CGOACCGCGA CGAGGCGCGC CAGCAGCTGG "? CCGCGAACGC CGAGGAGCTG CAGCAGCGCC TAGACACCGC CACGCAGCAG CGCGCCGAGC TGGARGCACA GGTGGCACGG CTGGCCGCGA AMGCCG 516 (2) IN FO R MAC I N O R N ID EQ: 36: (i) CA RA CTE R IC S TI C S D EC U S IN C IA: (A) LENGTH: 146 amino acid (B) TYPE: amino acid ( C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 36: Gly Thr Ser Pro Cys Leu His Leu Leu Wing Asp He Arg Gly Glu Phe 1 5 10 15 Phe Asn Leu Arg Arg Val Glu Leu Leu Asn Val Ala Gln Gln Ala Gln 20 25 30 Leu Val Val Wing His Glu Gly Asp Gly Gln Ser Wing Wing His Wing 35 40 • 45 Wing Wing Wing Wing Asp Wing Val Asn Val Leu Leu Thr Arg Glu Arg Gln 50 55 60 He Val Wing Glu Asp Glu Arg Asp Ala Leu His He Asn Ala Thr Arg 65 70 75 80 Pro Gln Val Arg Cys Asn Xaa His Wing Wing Val Ser He Thr Glu Cys 85 90 95 Arg He He Ser Ser Arg Ser Wing Trp Gly Met Ser Pro Cys Met Wing 100 105 110 Asp Thr Wing Lys Phe Ser Arg Val He Phe Leu Wing Ser Cys Ser Thr 115 120 125 Phe Leu Arg Val Leu Xaa Lys Thr Thr Wing Trp Wing He Val Lys I read. 130 135 140 Ser Tyr 145 (2) INFORMATION FOR SEQ ID NO: 37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 77 amino acids (B) TYPE: amino acids (C) THREAD FORM: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 37: Wing Gln Gly Phe Arg Val He Phe Thr His Gly Gly Wing Gln Met Gly 1 5 10 15 Glu Val Asn Thr Arg Thr Glu Leu Leu Asp His He Asn Gln He Val 20 25 30 Val Ser Thr His Wing Val Xaa Thr Gly Wing His Gly Lys Thr Val Cyr: 35 40 45 His Wing Val Tyr Gly He Asn His Pro Leu His He Phe Asn Gly Gly 50 55 60 Asn Asn Wing Arg Gln Wing Glu Asp Pro Wing Arg Leu He 65 70 75 (2) INFORMATION FOR SEQ ID NO: 38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 68 amino acids (B) TYPE: amino acids (C) THREAD FORM: single (D) TOPOLOGY: linear (i) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 38: Gln Gly Gln Xaa Phe Val Gly Asn Ser Leu Val Val Arg Leu He Asp 20 25 so Xaa Leu Xaa Gln Xaa Pro Wing Gly Tyr Pro Val Tyr Xaa Asn Arg Gly 35 40 45 Wing Xaa Gly He Xaa Xaa Leu Wing Thr Ala Wing Gly Val Xaa Arg 50 55 60 Wing 65 Arg Arg Thr Lys 65 (2) INFORMATION FOR SEQ ID NO: 39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 65 amino acids (B) TYPE: amino acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (x) SEQUENCE DESCRIPTION: SEQ ID NO: 39: Ala Arg slu Ala Gln Leu Ala His Arg He Cys Asp Tyr Leu Pro Glu 1 5 10 15 Gln Gly Gln Xaa Phe Val Gly Asp Ser Leu Val Val Arg Leu lie Asp 20 25 30 Xaa Leu Xaa Gln Xaa Pro Wing Gly Tyr Pro Val Tyr Xaa Asn Arg Gly 35 40 45 Wing Xaa Gly He Xaa Xaa Leu Leu Ser Thr Wing Wing Gly Val Xaa Arg 50 55 60 Wing 65 (2) INFORMATION FOR SEQ ID NO: 40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 78 amino acids (B) TYPE: amino acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (x) SEQUENCE DESCRIPTION: SEQ ID NO: 40: Asp Asp His Wing Pro Lys Glu Asp Gly His Wing Pro Lys Asn Asp Asp 1 5 10 15 His Wing Pro Lys Glu Asp Gly His Wing Pro Lys Asn Asp Asp His Wing 20 25 30 Pro Lys Glu Asp Gly His Wing Pro Lys Asn Asp Gly Asp Val Gln Xaa 35 40 45 Lys Ser Glu Asp Gly Asp Asn Val Gly Glu Gly Gly Lys Gly Asn Glu 50 55 60 Asp Gly Asn Asp Asp Gln Pro Lys Glu His Wing Ala Gly Asn 65 70 75 (2) INFORMATION FOR SEQ ID NO: 41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 169 amino acids (B) TYPE: amino acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (i) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 41 Leu Gln Gln Arg Leu Asp Thr Wing Thr Gln Gln Arg Wing Glu Leu Glu 1 5 10 15 Wing Arg Val Wing Arg Leu Wing Wing Asp Arg Asp Glu Wing Arg Gln Gln 20 25 30 Leu Wing Wing Asn Wing Glu Glu Leu Gln Gln Arg Leu Asp Thr Wing Thr 35 40 45 Gln Gln Arg Wing Glu Leu Glu Wing Arg Val Wing Arg Leu Ala Ala Asp 50 55 60 Gly Asp Glu Ala Arg Gln Gln Leu Ala Ala Asn Ala Glu Glu Leu Gln 65 70 75 80 Gln Arg Leu Asp Thr Wing Thr Gln Gln Arg Wing Glu Leu Glu Wing Gln 85 90 95 Val Ala Arg Leu Ala Ala Asn Ala Glu Glu Leu Gln Gln Arg Leu Asp 100 105 110 Thr Wing Thr Gln Gln Arg Wing Glu Leu Glu Wing Arg Val Wing Arg Leu 115 120 125 Wing Wing Asp Arg Asp Glu Wing Arg Gln Gln Leu Wing Wing Asn Wing Glu 130 135 140 Glu Leu Gln Gln Arg Leu Asp Thr Wing Thr Gln Gln Arg Wing Glu Leu 145 150 155 160 Glu Ala Gln Val Ala Arg Leu Ala Ala 165 (2) INFORMATION FOR SEQ ID NO: 42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 98 amino acids (B) TYPE: amino acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 42: Ala Arg Xaa He Phe Val Lys Thr Leu Thr Gly Xaa Thr He Ala Leu 1 5 lo 15 Glu Val Glu Pro Ser Asp Thr He Glu Asn Val Lys Wing Lys He Gln 20 25 30 Asp Lys Glu Gly Pro Pro Asp Gln Gln Arg Leu He Phe Wing Gly 35 40 45 Lys Gln Leu Glu Xaa Gly Arg Thr Leu Ser Asp Tyr Asn He Gln Lys 50 55 60 Glu Ser Thr Leu His Leu Val Leu Arg Leu Arg Gly Gly Met Xaa He 65 70 75 80 Phe Val Lys Thr Leu Thr Gly Xaa Thr He Ala Leu Glu Val Glu Pro 85 90 95 Asn Asp (2) INFORMATION FOR SEQ ID NO: 43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 amino acids (B) TYPE: amino acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania major (xi) DESCRIPTION OF SEQ ID NO: 43: Leu Gln Gln Arg Leu Asp Thr Wing Thr Gln Gln Arg Wing Glu Leu Glu 1 5 10 15 Wing Arg Wing Wing Arg Leu Wing Wing Asp Arg Asp Glu Wing Arg Gln Gln 20 25 30 Leu Wing Wing Asn Wing Glu Glu 35 (2) INFORMATION FOR SEQ ID NO: 44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 44: CGGCCGCCTC AGCGAGGAGG AGATCGAGCG CATGGTGCGC GAGGCTGCCC AGTTCGAGGA 60 TGAGGACCsC AAGGTGCGCG AACGTGTCGA AGCGAAGAAC TCGCTAGAGA GCATCGCGTA 120 CTCGCTTCGC AACCAGATCA ACGACAAGGA CAAGCTTGGT GACAAGCTCG CCGCGGACGA 180 CAAGAAGGCG ATCGAGGAGG CTGTGAAGGA TGCCCTCGAC TTTGTCCACG AGAACCCCAA 240 TGCAGACCGT GAGGAGTTCG AGGCTGCTCG CACGAAGCTG CAGAGTGTOA CGAACCCCAT 300 CATTCAAAAG GTGTACCAGG GCGCCGCCGG CTCTGGTGCA GAAGAGGCGG ACGCGATGGA 360 TGACTTGTTA GTCGGCCGCG TGAAAAGAAA AACAGsGAAA GCGGGAACAT NCCACAANAA 420 CCNAAGAAGA AAGGsssTNG CGACACCOCT COAACACCCA CGOCNCACAT NCNTCATGGG 480 CATGCTCAGC TTTCCTCTCC CCAACAAACC AGAAGGTTTT CTCCAAACNC CGTCTCNGCN 540 CCCAAAATAC GGAAANGTTA ANCGAAAAAN CCCCTTCCAC CAATTGNNGT TCTTTTGTTT 600 (2) INFORMATION FOR SEQ ID NO: 45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1748 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 45: CTAGTGGATC CCCCGGGCTG CAGGAATTCA CGGAATACGT ACCTCCTCCC CCTTCTTGOT 60CAACAACGTT CAAGACGACG CCGCGCCTTC TTGTACCOCA TTTGCTTCTG 120 AGCACGTTCA ATCCGTGCCT TGCAAACATG GAGGCGTACA AGAAGCTGGA AACGATCTTT 180 ACGAAGGTCT ACCGCCTGGA CCACTTCCTC GGTCTGGGCA ACTGGGACAT GAACACAAAC 240 ATGCCCCCCA AGGGCGAOGA ATCACOCGGT sAOGCsATGG CGATGCTCTC GGAOCTCCGC 300 TTTGGCTTCA TCACGGCACC GGAGGTGAAA AGCCTGATTG AGAGTGCCAC CAAGGOCAGC 360 GAGGAGCTGA ATGCGGTGCA GCGCGCTAAC TTGCGGGAGA TGAGGCGTGC GTGGAAGAGC 420 GCCACCGCCT TGCCGGCTGA GTTTGTGGGC CGCAAGATGC GCCTCACGAC ACACGCGCAC 480 AGCOTGTGGC OCGACAGCCG CAAAGCAAAT GACTTCGCCA AGTTCCTACC GGTGCTCAGG 540 GACCTCOTaG CGCTCGCCCs TGAGGAGGGC TCATACCTCC CCGCCGOCAC CTCCCTCTCC 600 CCGTATGAGG CGCTCATGAA CGAGTACsAG CCAGGAATCA CGACACAAAA GCTGGATGAG 660 GTGTACGCAA ATGTAAAGTC GTGGCTGCCG CAGCTGCTAA AGGACATTGT GCAGAAGCAG 720 TCCssCOAGT CGGTGATTsC GTTCTCsCAT AAGTTCCCsC AGGACAAsCA GsAAsCACTG 780 TGCAAGGAAT TCATGAAGAT CTGGCACTTC GACACCCATG CCGGTCGCCT CGACGTCAGC 840 CCCCACCCTT TCACGGGAAT GACGAACGAG GACTGCCGAC TCACAACAAA CTACATCGAA 900 OACACGTTTG TTCAGAGCTT GTATGGCGTC ATCCACGAGA GTGGGCATGO CAAGTACGAG 960 CAOAACTGTG GCCCACGCGA GCACATCACG CAGCCGGTGT GCAACOCCCG CTCTCTTGGC 1020 CTGCATGAGA GCCAGAGCCT CTTTOCGOAG TTTCAGATCG GCCACGCOAC GCCCTTCATC 10¡0 OACTACCTCA CAACTCGCCT TCCTGAGTTC TTCGAGGCGC AGCCAGCGTT CTCGCAGGAC _ '' • AACATGCGCA AGTCGCTGCA GCAGGTGAAG CCGGGCTACA TTCGCGTCGA TGCCGATGAG i • GTGTGCTACC CTCTGCACGT GATCCTGCGC TACGAGATCG AGCGCGACTT GATGGAsGGC 1260 AAAATGGAGG TGGAAGACGT GCCGCGCGCG TGGAACGCAA AGATGCAGGA GTACTTGGGT 1320 CTCTCAACGG AGGGCCGTGA CGACGTTGGG TGCCTGCAGG ACGTGCATTG GTCCATGGTG 1380 CGCTCGGCTA CTCTCCGACG TACTCGCTCG GCGCCATGTA TGCGGCGCAG ATCATGGCGA 1440 GCATCCGAAA GGAGCTGGGA GACGACAAGG TGOATGAGTG CCTGCGCACC GGTGAOCTCG 1500 GCCCCCTCCT GGAAAAGCAG CAGGAGAAGA TCTGGGATCA TGGGTGCCTG TACGAGACGG 1560 ACGACCTCAT GACGCGTGCG ACGGGCGAGA CGCTGAACCC CGAGTACCTG CGCCGCCACC J6? Í TGGAGGCGCG CTACATAAAC GCCTGAGTCG CGAGCGGTTG ACACACGCGC TCGCTAGCAC 1680 ATGACGCGTC TTTATTATTC TTTGTTGTGC ATTCGGAATT CCGCGGAATT CGATATCAAG V '' r < CTTATCGA 174. (2) INFORMATION FOR SEQ ID NO: 46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 560 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasí (xi) DESCRIPTION OF SEQ ID NO: 46: CGGAAGGAGG ATGGCCATAC ACAGAAAAAT sACGGCGATG CCCCTAAOOA sGACGGCCGT 60 ACACAGAAAA ACGACGACOO TGCCCCTAAG GAGGACGGCC ATACACAGAA AAATGACsGC 120 GATGGCCCTA AGGAGGACGG CCGTACACAG AAAAATAACG GCGATGGCCC TNAGGAGGAC 180 GGCCATACAC AGAAAAATGA CGGCGATGCC CCTNACGAGG ACGGCCGTAC ACANAAAAAT 240 sACGGCNATG GCCCTNACOA sGACsGCCGT ACACAGAAAA ATGACNGCCA TGGCCCTTAG_300_GANGACGCCG TACACAGAAA AATGACGCNA TGGCCCTNAG GGAGGACGGC CATACCCANA 360 AAAATTGACG GCNATNGCCC TTAGGANGAC GsCGOTNCCC ANAAANANTG ACNGCGsTNG 420 CCCTTAAOGA AOATGAAAAT CTGCCACCAA AACNATTGGG AATGCNCAGG AAAANAACNA 480 ANATNGACCC CACCTCGOGO ATGGANCTTA CNGCNATTAA NATTCTTACC ATTATCNACC 540 NAAGGACNNs TTGCCGNCAA 560 (2) INFORMATION FOR SEQ ID NO: 47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 600 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: double (D) TOPOLOGY: linear (¡) i) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 47: CGTCCGAGAA ACCCGTACAT GTATGCTGCT GGTAGAAsGC GCAGAGCTGG TCCCTCTGAT 60 sCACAAGCAT GAGGTCGTAC ATTGCCTGGT TCGTCATTTT CCAG-AGCACA ACGAGCAGCG 120 TCATCATACA GCATCCAATA GCCGCCAGAG TGAATGCGAT GCGCACACCA AGTCGAAAGT 180 GGTCGACCAG TAGGGGAATG TGACCCTGGC TGGCGTGCAA CATCATCGCC ACGCCAGCGG 240 TGGOCCACAC CACAACACAO GCGACGAAAG AGAACATGAA CTTGCTCACG AAGCTNACAA 300 TAAsssCCTC CCTNGTGATs CTAAGAACCA CGCCNAGGTA GACGGCGAAG ANCAAACTAA 360 ACACAAGCGT GACGATCCCG AAAAGAAGGA TCTCTCCCGA ATTTTCGTGA GATAGANAAT 420 GCCCGTACTG GAAAAANAAG CCGGCAGGCG CGCGATAACG CTGCAACTTG CCGCTCCTCO 480 CGGGCGCGTT TTCGCTCCTT CTCCGACTTG ATGGCGCNGT CNGNCTTGAC AAAACGGTTA 540 AGCTCCTCAT GCCCCAGCCG ATTCCCAGCT CACGOTCCAC TTCCGGCCAT GCCCACGGAC 600 (2) INFORMATION FOR SEQ ID NO: 48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1053 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 48: GGGAAAAAAG TGGAGCTCCA CCGCGGTGGC GGCCGCTCTA GAACTAGTGG ATCCCCCGGG 60 CTGCAGGAAT TCCOCGGAAT TCCGCGGAAT TCCGCGGAAT TCCGTCCGAC GCGGCACCCG 120 CACAGGGGTC GACAGTGACG CAACCTCCTC CACCACTGCG GCCTACGACG GCGCCGOCTC .1.00 CGCGCCAGTG ATGGTTGACG CCAATGTGAG CCACCCTCCG TACGCGGGGC ATGACCAAGT 240 GTACATGCAC GTCGGCAAGC CCATCGTGGG CAACACCCTC GACGGATACA ACGGGTGCGT 300 GTTCGCCTAC GGGCANACGG GCAGCGGCAA AACCTTCACG ATGCTCGGNT ACGCGCCGAG 360 CACGANCGAC ATCCGCGCTC GCAAAGGGTC CGTCCCCTGC GGGGCCAGCA GCATGGAGAA 420 CAGCACTCCT CTTGACAGCG CTGTGGAGCC GTTTGAGAGC GATGACGGCG ACGACGTGGT 480 GGACAAGACG GGGCTGGATC CGAACGAGCT GCAAGGCATC ATCCCGCGCG CGTGCACGGA 540 CCTGTTCGAT GGTCTCCGTG CGAAGCGCGC CAAGGACTCC GACTTCACGT ACCGCGTGO? 600 GGTGTCTTAC TACGAGATCT ACAACGAGAA sGTGTTCGAT CTCATCCGGC CGCAGCGCAA 660 CACGsACCTG AGGATACGTA ACTCGCCCAA CTCCGGTCCA TTTATCGAAG GCCTGACGTG 720 sAAGATsGTG TCCAAGGAGs AAsACGTCGC CCGCGTGATT CGCAAGGGCA TOCAC_AGCG 780 CCACACGGCT GCOACCAACT TCAACGACCC CAGCAGCCOC AGCCACGCCA TCCTCACCTT 840 CAACATTGTG CAGCTGTCGA TGGACGACTC CGACAACGCG TTCCAGATGC GCACCAAGCT 900 GAACCTGGTG GACCTTGCTG OOTCOOAGCG CACTGOTGCs GCCOGAOCCG AGOOCAATOA 960 GTTCCACGAC GGTGTGAAGA TCAACCACTC GCTGACGGTG CTGGGGCGCG TGATCGACCG 1020 TCTGOCGGAC CTCTCGCAGA ACAAGGGAGG GGG 1053 (2) INFORMATION FOR SEQ ID NO: 49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 136 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 49: Gly Arg Leu Ser Glu slu Olu He Glu Arg Met Val Arg Glu Ala Wing 1 5 10 15 Glu Phe Glu Asp Glu Asp Arg Lys Val Arg Glu Arg Val Glu Wing Lys 20 25 30 Asn Ser Leu Glu Ser He Wing Tyr Ser Leu Arg Asn Gln He Asn Asp 35 40 45 Lys Asp Lys Leu Gly Asp Lys Leu Wing Wing Asp Asp Lys Lys Wing He 50 55 60 Glu Glu Wing Val Lys Asp Ala Leu Asp Phe Val His Glu Asn Pro Asn 65 70 75 80 Wing Asp Arg Glu Glu Phe Glu Wing Wing Arg Thr Lys Leu Gln Ser Val 85 90 95 Thr Asn Pro He He Gln Lys Val Tyr Gln Gly Wing Wing Gly Ser Gly 100 105 110 Wing Glu Glu Wing Asp Wing Met Asp Asp Leu Leu Val Gly Arg Val Lys 115 120 125 Arg Lys Thr Gly Lys Wing Gly Thr 130 135 (2 ) INFORMATION FOR SEQ ID NO: 50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 510 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 50: Tyr Leu Leu Pro Leu Leu Gly Arg Ar Th Thr Thr Thr Phe Lys Thr 1 5 10 15 Thr Pro Arg Leu Leu Val Pro His Leu Leu Leu Ser Thr Phe Asn Pro 20 25 30 Cys Leu Wing Asn Met Glu Wing Tyr Lys Lys Leu Glu Thr He Phe Thr 35 40 45 Lys Vai Tyr Arg Leu Asp His Phe Leu Gly Leu Gly Asn Trp Asp Met 50 55 60 Asn Thr Asn Met Pro Pro Lys Gly Glu Glu Ser Arg Gly Glu Met Wing 65 70 75 80 Wing Met Leu Ser Glu Leu Arg Phe Gly Phe He Thr Wing Pro Glu Val 85 90 95 Lys Ser Leu He Glu Be Wing Thr Lys Gly Ser Glu Glu Leu Asn ñl-? 100 105 lio Val Gln Arg Wing Asn Leu Arg Glu Met Arg Arg Wing Trp Lys Ser Wing 115 120 125 Thr Wing Leu Pro Wing Glu Phe Val Gly Arg Lys Met Arg Leu Thr Th 130 135 140 His Wing His Ser Val Trp Arg Asp Ser Arg Lys Ala Asn Asp Phe Al a 145 150 155 160 Lys Phe Leu Pro Val Leu Arg Asp Leu Val Wing Leu Wing Arg Glu G3 or 165 170 175 Gly Ser Tyr Leu Wing Wing Gly Thr Ser Leu Ser Pro Tyr Glu Wing Leu 180 185 190 Met Asn Glu Tyr Glu Pro Gly He Thr Thr Gln Lys Leu Asp Glu Val 195 200 205 Tyr Wing Asn Val Lys Ser Trp Leu Pro Gln Leu Leu Lys Asp He Val 210 215 220 Gln Lys Gln Ser Gly Glu Ser Val He Ala Phe Ser His Lys Phe Pro 225 230 235 240 Gln Asp Lys Oln slu Ala Leu Cys Lys slu Phe Met Lys He Trp His 245 250 255 Phe Asp Thr Asp Wing Gly Arg Leu Asp Val Ser Pro His Pro Phe Thr 260 265 270 Gly Met Thr Lys Glu Asp Cys Arg Leu Thr Thr Asn Tyr He Glu Asp 275 280 285 Thr Phe Val Gln Ser Leu Tyr Gly Val He His Glu Ser Oly His sly 290 295 300 Lys Tyr Glu sln Asn Cys Cly Pro Arg Olu His He Thr Gln Pro Val 305 310 315 320 Cys Asn Ala Arg Ser Leu Gly Leu His Glu Ser Gln Ser Leu Phe Ala 325 330 335 Glu Phe Gln He Gly His Wing Thr Pro Phe He Asp Tyr Leu Thr Thr 340 345 350 Arg Leu Pro Glu Phe Phe Glu Wing Gln Pro Wing Phe Ser sln Asp Asn 355 360 365 Met Arg Lys Ser Leu Gln sln Val Lys Pro Gly Tyr He Arg Val Asp 370 375 380 Wing Asp Glu Val Cys Tyr Pro Leu His Val He Leu Arg Tyr Clu He 385 390 395 400 Glu Arg Asp Leu Met Glu Gly Lys Met Glu Val Glu Asp Val Pro Arg 405 410 415 Wing Trp Asn Wing Lys Met Gln Glu Tyr Leu Gly Leu Ser Thr Glu 420 425 430 Arg Asp Asp Val Gly Cys Leu Gln Asp Val His Trp Ser Met Val Arg 435 440 445 Ser Ala Thr Leu Arg Arg Thr Arg Ser Ala Pro Cys Met Arg Arg Arg 450 455 460 Ser Trp Arg Wing Ser Glu Arg Ser Trp Glu Thr Thr Arg Trp Met Ser 465 470 475 480 Wing Cys Wing Pro Val Ser Wing Pro Ser Trp Lys Ser Ser Arg Arg 485 490 495 Arg Ser Gly He Met Gly Wing Cys Thr Arg Arg Thr Thr Ser 500 505 510 (2) INFORMATION FOR SEQ ID NO: 51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 107 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 51: Gly Arg Arg Met Ala He His Arg Lys Met Thr Ala Met Ala Leu Arg 1 5 10 15 Arg Thr Wing Val His Arg Lys Thr Thr Thr Val Wing Leu Arg Arg r: • 20 25 30 Wing He His Arg Lys Met Thr Wing Met Wing Wing Leu Arg Arg Thr Wing at 35 40 45 His Arg Lys He Thr Wing Wing Ala Leu Arg Arg Thr Ala He His Ar 50 55 60 Lys Met Thr Ala Met Pro Leu Arg Arg Thr Ala Val His Xaa Lys Met 65 70 75 80 Thr Ala Met Ala Leu Arg Arg Thr Ala Val His Arg Lys Met Thr Al-- 85 90 95 Met Ala Leu Arg Xaa Thr Pro Tyr Thr Glu Lys 100 105 (2) INFORMATION FOR SEQ ID NO: 52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 63 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 52: Val Arg Glu Thr Arg Thr Cys Met Leu Leu Val Glu Gly Ala Glu Leu 1 5 10 15 Val Pro Leu Met His Lys His Glu Val Val His Cys Leu Val Arg His 20 25 30 Phe Pro Glu His Asn Glu Gln Arg His His Thr Ala Ser Asn Ser Arg 35 40 45 Gln Ser Glu Cys Asp Ala His Thr Lys Ser Lys Val Val Asp Gln 50 55 60 (2) INFORMATION FOR SEQ ID NO: 53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 324 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (vi) ORIGINAL SOURCE: (A) ORGANISM: Leishmania chagasi (xi) DESCRIPTION OF SEQ ID NO: 53: Phe Arg Gly He Pro Arg Asn Ser Val Arg Arg Gly Thr Arg Thr Gly 5 10 15 Val Asp Ser Asp Wing Thr Ser Ser Thr Thr Wing Wing Tyr Asp Gly Wing 20 25 30 Gly Ser Wing Pro Val Val Val Asp Wing Asn Val Ser Ser Pro Pro Tyr 35 40 45 Wing Gly His Asp Gln Val Tyr Met His Val Gly Lys Pro He Val Gly 50 55 60 Asn Thr Leu Asp Gly Tyr Asn Gly Cys Val Phe Wing Tyr Oly Xaa Thr 65 70 75 80 Gly Ser Gly Lys Thr Phe Thr Met Leu Gly Tyr Ala Pro Ser Thr Xaa 85 90 95 Ace? Ile Ar9 Wing Ar9 YYs GlY Se Val Pro Cys Gly Wing Being Met 100 105 110 Glu Asn Ser Thr Pro Leu Asp Ser Wing Val Glu Pro Phe Glu As Asp 115 120 125 Asp Gly Asp Asp Val Val Asp Lys Thr sly Leu Asp Pro Asn Olu Leu 130 135 140 Gln Gly He He Pro Arg Ala Cys Thr Asp Leu Phe Asp Gly Leu Arg 145 150 155 160 Ala Lys Arg Ala Lys Asp Ser Asp Phe Thr Tyr Arg Val Glu Val Ser 165 170 175 Tyr Tyr Glu He Tyr Asn Glu Lys Val Phe Asp Leu He Arg Pro Gln 180 185 190 Arg Asn Thr Asp Leu Arg He Arg Asn Ser Pro Asn Ser Gly Pro Phe 195 200 205 He Glu Gly Leu Thr Trp Lys Met Val Ser Lys Glu Glu Asp Val Wing 210 215 220 Arg Val He Arg Lys Gly Met Gln Glu Arg His Thr Wing Wing Thr Lys 225 230 235 240 Phe Asn Asp Arg Ser Ser Arg Ser His Wing He Leu Thr Phe Asn He 245 250 255 Val Gln Leu Ser Met Asp Asp Ser Asp Asn Wing Phe Gln Met Arg Ser 260 265 '270 Lys Leu Asn Leu Val Asp Leu Wing Gly Ser Glu Arg Thr Gly Wing Wing 275 280 285 Gly Wing Glu Gly Asn Glu Phe His Asp Gly Val Lys He Asn His Ser 290 295 300 Leu Thr Val Leu Gly Arg Val He Asp Arg Leu Wing Asp Leu Ser Gln 305 310 315 320 Asn Lys Oly Gly (2) INFORMATION FOR SEQ ID NO: 54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1585 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: double (D) TOPOLOGY: linear (ii) ) TI PO DEMO DECLARATION: DNA (g enemic) (xi) DESCR I PTION OF SEQ ID NO: 54: AAAsCTGsAG CTCCACCGCO GTOaCGsCCG CTCTAGAACT AGTGGATCCC CCGGGCTGCA 60 GOAATTCssC ACGAOTGCTs CCCGACATGA CATGCTCGCT GACCGGACTT CAGTGCACAG 120 ACCCGAACTG CAAGACCTGC ACAACTTACG GTCAGTGCAC AOACTGCAAC GACGGCTACG 180 GTCTCACCTC CTCCAGCGTT TGCGTGCGCT GCAGTGTAGC GGGCTGCAAG AGCTGCCCCG 240 TCGACGCTAA CGTCTGCAAA GTGTGTCTCG GCGGCAGCGA GCCGATCAAC AATATGTGCC 300 CCTGCACCGA CCCCAACTGC GCCAGCTGCC CCAGCGACGC TGGCACGTGC ACTCAGTGCG 360 CGAACGOCTA CGGTCTCGTG GACGGCGCCT GTOTsAsATG CCAGGAGCCC AACTGCTTCA 420 GCTCCGACAG CGACGCGAAT AAGTGCACAC AATGTGCGCC GAACTACTAC CTCACCCCGC 480 TCTTGACCTG CTCCCCGGTG GCCTGCAACA TCGAGCACTG CATGCAGTGC GACCCACAGA 540 CGCCGTCGCG CTGCCAGGAG TGCGTGTCCC CCTACGTGGT TGACAGCTAC GACGGCCTCT 600 GCAGGCTCTC CGATGCCTGC TCCGTGCCCA ACTGCAAGAA GTGCGAGACC GGTACCTCCA 660 GGCTCTGCGC CGAGTGCGAC ACCGGCTACA GTCTCTCCGC CGACGCGACG AGCTGCAGCA 720 GTCCAACCAC GCAGCCGTGC GAsGTGGAGC ACTOCAACAC ATCTGTOAAC GOCGATAGCA 780 CCCGCTGTGC CTACTGCAAC ACCGOCTACT ACGTCTCCGA TGGCAAGTGC AAGGCCATGC 840 AGGGCTGCTA CGTGTCGAAC TGCGCGCAGT GCATGCTGCT TGACAGCACC AAGTGCTCCA 900 CGTGCGTGAA AGGGTACCTG CTCACGTCGT CCTACAGTTG CGTCTCGCAG AAAGTCATCA 960 ACAGTGCGGC CGCGCCCTAC TCTCTGTGGO TGGCCGCCGC CGTGCTCCTC ACCTCTTTTG 1020 CCATGCACCT AGCATAGTGC GCAGCGGCAT GCGAACAACC CCACTCTCAT TCTCCAACAT 1080 GTGCATACAC ACACACACAG ACAGCGGGGC AGCACCCCCT CCCCACACAC ACACACGCAC 1140 TTCCCCCTTG TCTTGTTCTT CTTTCCTCGN TTCGCATTTC TTTCTCTCGT GCGCTGGCGC 1200 CGGCCTCCTG CACGTCsCTC CCCTCCCCCT AACCTCTATT CTCTCTCTCT CTCTCTCTCO 1260 CCGGCATCAT TGCTTCTTAC CCTTTTCTGA TCCTTGCTCG CGTGGOCGGA CACTGCCACA 1320 GTCCCACAGC GCAGACACAC GTGTTTAAAC GGCGCAGGCA TCCCTCCCTA TCACTTCATT 1380 TCTCCTAAAG CCACTCACCA AGTCGCACAC CGCCCTCCCC CATCGGCCGC CCTTCCGGGC 1440 GCAGCTGTGC GGAATGGGTG TGTGCTCGAC CTCGTTCCTG GCAGCTCACT CGCATGTGTA 1500 CAOCCACTCC AACCACGAAA GCTCTCTTCT GCGCACATAA AAAAAAAAAA AAAAAAAAAA • 1560 CTCGAGGGGG GGCCCGGTAC CCAAA 1585 (2) INFORMATION FOR SEQ ID NO: 55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 320 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (i) TYPE OF MOLECULE: protein (v) TYPE OF FRAGMENT: internal (x) MOLECULE DESCRIPTION: SEQ ID NO: 55: Val Leu Pro Asp Met Thr Cys Ser Leu Thr Gly Leu Gln Cys Thr Asp 5 10 15 Pro Asn Cys Lys Thr Cys Thr Thr Tyr sly Gln Cys Thr Asp Cys Asn 20 25 30 Asp Gly Tyr Gly Leu Thr Ser Ser Val Val Cys Val Arg Cys Ser Val 35 40 45 Wing sly Cys Lys Ser Cys Pro Val Asp Wing Asn Val Cys Lys Val Cys 50 55 60 Leu Oly Gly Ser Glu Pro He Asn Asn Met Cys Pro Cys Thr Asp Pro 65 70 75 80 Asn Cys Wing Cys Pro Ser Asp Wing Gly Thr Cys Thr Gln Cys Wing 85 90 95 Asn Gly Tyr Gly Leu Val Asp Gly Wing Cys Val Arg Cys Gln Glu Pro 100 105 110 Asn Cys Phe Ser Cys Asp Ser Asp Wing Asn Lys Cys Thr Gln Cys Wing 115 120 125 Pro Asn Tyr Tyr Leu Thr Pro Leu Leu Thr Cys Ser Pro Val Wing Cys 130 135 140 Asn He Glu His Cys Met Gln Cys Asp Pro Gln Thr Pro Ser Arg Cys 145 150 155 160 Gln Glu Cys Val Ser Pro Tyr Val Val Asp Ser Tyr Asp Gly Leu Cys 165 170 175 Arg Leu Ser Asp Wing Cys Ser Val Pro Asn Cys Lys Lys Cys Glu Thr 180 185 190 Gly Thr Ser Arg Leu Cys Wing Glu Cys Asp Thr Gly Tyr Ser Leu Ser 195 200 205 Wing Asp Wing Thr Ser Cys Ser Ser Pro Thr Thr Gln Pro Cys Glu Val 210 215 220 Glu His Cys Asn Thr Cys Val Asn Gly Asp Ser Thr Arg Cys Ala Tyr 225 230 235 240 Gly Tyr Tyr Val Ser Asp Gly Lys Cys Lys Wing Met Gln 245 250 255 Gly Cys Tyr Val Ser Asn Cys Wing Gln Cys Met Leu Leu Asp Ser Thr 260 265 270 Lys Cys Ser Thr Cys Val Lys Gly Tyr Leu Leu Thr Ser Ser Tyr Ser 275 280 285 Cys Val Ser Gln Lys Val He Asn Ser Ala Ala Ala Pro Tyr Ser Leu 290 295 300 Trp Val Ala Ala Ala Val Leu Leu Thr Ser Phe Ala Met His Leu Ala 305 310 315 320 (2) INFORMATION FOR SEQ ID NO: 56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE. amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (v) TYPE OF FRAGMENT: internal (xi) MOLECULE DESCRIPTION: SEQ ID NO: 56: Pro Lys Glu Asp Gly His Wing Pro Lys Asn Asp Asp His Wing 1 5 10 (2) INFORMATION FOR SEQ ID NO: 57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : peptide (v) TYPE OF FRAGMENT: internal (xi) DESCRIPTION OF MOLECULE: SEQ ID NO: 57: Pro Lys Glu Asp Gly His Wing 1 5 (2) INFORMATION FOR SEQ ID NO: 58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE : peptide (v) TYPE OF FRAGMENT: internal (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 58: Pro Lys Asn Asp Asp His Wing 1 5 (2) INFORMATION FOR SEQ ID NO: 59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 264 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: single (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 59: ATGCACCATC ATCACCATCA CATGGGAAGC TCCTGCACGA AGGACTCCGC AAAGGAGCCC C > < ) CAGAAGCGTG CTGATAACAT CGATACGACC ACTCGAAGCG ATGAGAAGGA CGGCATCCAT S? < - GTCCAGGAGA GCGCCGGTCC TGTGCAGGAG AACTTCGGGG ATOCGCAGGA GAAGAACGAA 180 GATGGACACA ACGTOOGGGA TGGAGCTAAC GACAATGAGG ATGGTAACGA TGATCAGCCG -Ju AAGGAGCAGG TTGCCGGCAA CTAG_264_(2) INFORMATION FOR SEQ ID NO: 60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 744 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 60: ATGGGAGCCT ACTGCACGAA GOACTCCGCA AAOGAGCCCC AsAAsCGTGC TGATAACATC 60 CATAAAACCA CTGAssCCAA TCACAsAGGC GCCGCCGGTO TGCCCCCGAA GCACGCCGOC 120 sGTscsATOA ACGACTCTCC CCCGAAGsAG GATGsCCATA CACAsAAAAA TGACGGCGAT 180 GGCCCTAAsG AsGACGGCCG TACACAGAAA AACGACG-ACO GTGGCCCTAA GGAsOACssC 240 CATACACACA AAAATOACOG COATOOCCCT AAGGAGGACG GCCCTACACA GAAAAATAAC 300 GOCGATGGCC CTAAGOAGGA CGGCCATACA CAGAAAAATs ACGOCGATGC CCCTAAssAG 360 GACOGCCGTA CACAGAAAAA TGACsGCGAT GGCCCTAAGG AGGACGGCCG TACACAGAAA 420 AATGACGGCG ATGOCCCTAA GOA-GACGOC CGTACACAsA AAAATsACOG CGATGsCCCT 480 AAGGAGGACG GCCGTACACA GAAAAATGAC GGCGATGGCC CTAAGOAOGA CGGCCATACA 540 CAGAAAAATG ACGOCGATsO CCCTAAGGAO GACGGCCGTA CACAGAAAAA TGACGGCGGT 600 GGCCCTAAGG AGGATGAGAA TCTGCAGCAA AACGATGGGA ATGCGCAGGA GAAGAACGAA 660 GATGGACACA ACGTGGGGGA TGGAGCTAAC GGCAATGAGG ATGGTAACGA TGATCAGCCG 720 AAGGAGCAGG TTGCCGGCAA CTAG_744_(2) INFORMATION FOR SEQ ID NO: 61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 80 amino acids (B) TYPE: amino acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (x) DESCRIPTION OF SEQUENCE: SEQ ID NO: 61 Met Oly Ser Ser Cys Thr Lys Asp Ser Ala Lys Glu Pro Gln Lys Arg 1 5 10 15 Wing Asp Asn He Asp Thr Thr Thr Arg Ser Asp slu Lys Asp Gly He 20 25 30 His Val Oln Glu Be Wing Gly Pro Val Gln Glu Asn Phe sly Asp Ala 35 40 45 Gln Glu Lys Asn Glu Asp Gly His Asn Val Gly Asp Gly Wing Asn Asp 50 55 60 Asn Glu Asp Gly Asn Asp Asp Gln Pro Lys Glu Gln Val Wing Gly Asn 65 70 75 80 (2) INFORMATION FOR SEQ ID NO: 62: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 247 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 62: Met Gly Ala Tyr Cys Thr Lys Asp Ser Ala Lys Glu Pro Gln Lys Arg 1 5 10 15 Wing Asp Asn He His Lys Thr Thr Glu Wing Asn His Arg Gly Wing Wing 20 25 30 Gly Val Pro Pro Lys His Wing Gly Gly Wing Met Asn Asp Ser Wing Pro 35 40 45 Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu 50 55 60 Asp Gly Arg Thr Gln Lys Asn Asp Asp Gly Gly Pro Lys Glu Asp Gly 65 70 75 80 His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu Asp Gly Arg Thr 85 90 95 Gln Lys Asn Asn Gly Asp Gly Pro Lys Glu Asp Gly His Thr Gln Lys 100 105 110 Asn Asp Gly Asp Ala Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp 115 120 125 Gly Asp Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 130 135 140 Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly Pro 145 150 155 160 Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp sly Asp Gly Pro Lys Glu 165 170 175 Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro Lys Glu Asp Gly 180 185 190 Arg Thr Gln Lys Asn Asp Gly Gly Gly Pro Lys Glu Asp Glu Asn Leu 95 200 205 Gln Gln Asn Asp Gly Asn Ala Gln Glu Lys Asn Glu Asp Gly His Asn 210 215 220 Val Gly Asp Gly Wing Asn Gly Asn Glu Asp Gly Asn Asp Asp Gln Pro 225 230 235 240 Lys Glu Gln Val Wing Gly Asn 245 (2) INFORMATION FOR SEQ ID NO: 63: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ix) ASPECT: ( A) NAME / KEY: modified on site (B) LOCATION: 6 (D) OTHER INFORMATION: / note = "Xaa can be His or Arg" (ix) ASPECT: (A) NAME / KEY: modified on site (B) LOCATION: 12 (D) OTHER INFORMATION: / note = "Xaa can be Gly or Asp" (ix) ASPECT: (A) NAME / KEY: modified on site (B) LOCATION: 13 (D) OTHER INFORMATION: / note = "Xaa can be Asp or Gly" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 63: Pro Lys Glu Asp Gly Xaa Thr Gln Lys Asn Asp Xaa Xaa Gly 5 10 (2) INFORMATION FOR SEQ ID NO: 64: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ix) ASPECT: ( A) NAME / KEY: modified on site (B) LOCATION: 6 (D) OTHER INFORMATION: / note = "Xaa may be His or Arg" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 64: Pro Lys Glu Asp Gly Xaa Thr 1 5 (2) INFORMATION FOR SEQ ID NO: 65: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (ix) ASPECT: ( A) NAME / KEY: modified on site (B) LOCATION: 5 (D) OTHER INFORMATION: / note = "Xaa can be Gly or Asp" (ix) ASPECT: (A) NAME / KEY: modified on site (B) LOCATION: 6 (D) OTHER INFORMATION: / note = "Xaa can be Asp or Gly" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 65: Gln Lys Asn Asp Xaa Xaa Gly 1 5 (2) INFORMATION FOR SEQ ID NO: 66: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 66: Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15 Gly (2) INFORMATION FOR SEQ ID NO: 67: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 67: Gly Cys Gly Pro Lys Glu Asp Oly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15 Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly 20 25 30 (2) INFORMATION FOR SEQ ID NO: 68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 68: Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp 1 5 10 15 Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly Pro 20 25 30 Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly 35 40 45 Gly Cys Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp l 5 10 15 Gly Pro Lys Glu Asp Gly Arg Thr Gln Lys Asn Asp Gly Asp Gly 20 25 30 (2) INFORMATION FOR SEQ ID NO: 69: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 69: Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 1 5 10 15 Gly (2) INFORMATION FOR SEQ ID NO: 70: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 70: Gly Cye Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 5 10 5 Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly 20 25 30 (2) INFORMATION FOR SEQ ID NO: 71: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 amino acids (B) TYPE: amino acid (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 71: Gly Cys Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp 5 10 15 Gly Pro Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly Pro 20 25 30 Lys Glu Asp Gly His Thr Gln Lys Asn Asp Gly Asp Gly 35 40 45 (2) INFORMATION FOR SEQ ID NO: 72: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 664 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 72: GCTGCACGAA TTCGGCACGA GATTGCTTCC CAGCCCACCT TCGCTATCCA GCCACTCTCG 60 CTCTTCTACA TCTCCCACCC CCTCACACCG CCATGGCTTC TTCCCGCAAG GCTTCCAACC 120 CGCACAAGTC GCACCGCAAG CCGAAGCGCT CGTGGAACGT GTACGTGGGC CGCTCGCTGA 180 AGGCGATCAA CGCCCAGATG TCGATGTCGC ACCGCACGAT GAAGATCGTG AACTCGTACG 240 TGAACGACGT GATsGAGCGC ATCTGCACTs AGGCCGCCTC GATTGTTCGC GCGAACAAGA 300 AGCGCACGTT GGGTGCGCGC GAGGTGCAGA CGGCGGTGCG CATTGTGCTG CCGGCGGAGC 360 TCGCGAAGCA TGCCATGGCT GAGGGCACGA AGGCCGTGTC GAGCGCGTCC CGCTAAAGCG 420 GCTTGCCGGA TGCCGTGTsA GTAOGAGGsT GGCTTGCCGC AAACGCTGAC CTCGGCGATT 480 sCGsCGTOGC GCTCCCCGTC TCCTCCTTsT CCGGCGGTsT GTGTCATGCA TTTGCGTsAC 540 TCCTCCCTCT TATAGATGCA AGCTTTTTTT TTCTCTTGAC GTTTTATTTT CTCCTCCCCC 600 TCCCTTAACG TGAAGTGTAT ATGANAGCGT ACTGGACATG ANANAAAAAA AAAANAAACT 660 CGAG 664 (2) INFORMATION FOR SEQ ID NO: 73: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1432 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 73: sATGAAGAAO AGGAGGACAC CACCATCAAC AACTCCGACG TGGTGGTGCG CTACAAGAAG 60 GCCGCAACGT GGTGCAATGA AACGTTGCGC GTGCTTATCG ATGCCACAAA ACCTGGCGCC 120 AAGGTGTsCs ACCTOTGCCs CCTCGGTGAT GACACCATCA CCGCCNAsGT CAAGACAATO 180 TTCAAAGGCA CssAAAAAsO CATCGCTTTC CCGACCTGCA TCTCGGTCAA CAACTGCGTA 240 TGCCACAACA GCCCTCGCGT GTCssACsAO ACOACOCAGC AAGAGATCGC GATGGOTGAC 300 GTCGTGCACT ACGACCTGGG CATCCACGTG GACGGCTACT GCGCCGTCGT CGCGCACACC 360 ATTCAGGTGA CAGAGOACAA TGAsCTTGGC AAGGACGAsA AGOCasCGCG CGTCATTACA 420 sCGGCGTACA ACATCCTGAA CACGOCOCTG CCCCAGATOC GTCCCGGTAC GACCATCTAC 480 CAGGTGACAO ACGTAaTTGA OAAOGCTOCO GAGCACTACA AGsTGACTCC GGTAsACGGC 540 GTCCTCTCGC ATATGATGAA GCOCTACATC ATAOACNGAT ACCGCTGTAT CCCGCAGCGC 600 AGGGTCGCGO AGCACATGOT GCACGACTAC GATCTCCAGA AAGCOCAsGT GTOGACOCTA 660 GACATTGTCA TGACCTCCGG CAAGGsCAAs CTGAAsGAGC GCGATGCsCG GCCGTGCsTO 720 TTCAAGGTGG CTCTGGACTC CAACTACTCT GTGAAAATGG AAAGCGCGAA GGAGGTTCAG 780 AAsGAAATCG ACTCCNAGTA TGCCACCTTC CCCTTTGCCA TCCGCAACCT GOAGGCCAAG 840 AAGGCCCGCC TCGGTCTCAA CGAGATGGCG AAGCACGGTG CTGTCATCCC GTACCCTATT 900 CTCTTCGAAA AGGAAGGCGA GGTCGTCGCC CATTTCAAGA TTACGGTGCT CATCAGCAAC 960 AAGAAGATTG AGCCCATTAC CGsCCTGAAG CCGCAGAAOG CCCCGGCsCT CGAGCCATAC 1020 ACGGACGAGA TGCTGCTTCC GACGAACAAG CTCTTCGCTG TCGCTAGAGA AGAAGGCGGC 1080 GAAGTAGACG GCCGTGGCAT CCGTGACGCT GTACTGCGAG CTTTCGTAGG CGTACGCCTC 1140 TTGTGAGGCG TACACGTGTG CTGTTTGCGG ACGAGGAGGC ACCCATTCTG TTCCCCTTCT 1200 TCGCTAATCT TCGCGTTTCC TCTGACGCTG GCTTCTYTGC CGGAGTGTGG TGAGGCGCGT 1260 GGGGGGAGAAA CGGCCCACTY GCATGCCTGT GCATACGCGA GCACGGTAGG GAGCGCGGTG 1320 TGTGTGTGTG TGGGGGGOCs TOTTACGAOT ACAAAAGAsG CTCGATCTTT GCsATCTTTT 1380 CTTTCTGTAA ACAGGAACAT AAGTAACCAA AAAAAAAAAA AAAAAACTCG AO 1432 (2) INFORMATION FOR SEQ ID NO: 74: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: d73 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single ( D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 74: CTTTATTGTC ATCACTGTAA AGCACTGTTT TTTCTTTCAC TTTTTCTTGA GTGTTTTCTT 60 CTATTCACCA TOAOCATTAT CAAGCAaGAC OACGCCGTOG GCTCCTACAT GACGGTGACC 120 CTCGTGGACs ACACCAAGOT OOAsaGTACC ATCTTCACCT ACAATTCCAA sOAGGGCATC 180 ATAGTACTCC TGTCCCTCCs COACGATCAO ACGAACATOA AGCTAATCCG CACTCCGTAC 240 ATCAAAGACT TCAOCCTTTC ACACGCTOAG GAGGGAOCGC ACCTGCCCCC GGCACTGGAC 300 TCCTTCAACG AGCTTCCGTC CATGCACGCC GGCCOCGACA AGTCCATCTT CAACCACGCC 360 AGCACGCAGC TCAAGAACGC CGAGGCGAAC CGCGAAAAGC ACTTCAACTC TCTCACOACC 420 OACACACCCA TTGCCACACT TGATGCsTAC CTCAAGCTCC TGCGGCTATA CCCCTTAATT 480 GAGTOGAACA GCGACGAGsG TGTCATCCAG GTCTCCOACA CCOTCATTGT CGTAGGAGAC 540 CCCGACTGGC GGACOCCCAA GsCAATOCTG GTGGACGGCG CCCCTGAGAA GGACAGACCG 600 CTTGTAGATC GCCTGCAGGT TGCGCTCGGM AACGOCAAGA AGTGATTCAG TGTGTAGCGG 660 ACAGAACATC GTGTGCTTGT GTGTCTGTTT GANGTTTGTT TGTTTTCTCT TTGTGGTACT 720 GCGTACGACG GCGCCTTCTC CCGGTGGTGG OTGAOTCCAT AAsCACTTGA GTTCTYGGTT 780 GTAGNAAVGC CTYACYGCCC ACCATATGGG AGAGGGCGAA CAAATNTTTG ATAGAAGTTG 840 AAAATCCCAA AGTYAAAAGA AAAAAAAAAN AAA 873 (2) INFORMATION FOR SEQ ID NO: 75: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1236 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 75: TTTCTGTACT TTATTGAACA TCAGTAsAAC ACGTTCTTCC CCCAAAGATG GCCAAGAAGC 60 ACCTCAAGCG CTTGTATGCG CCCAAGGACT GGATGCTGAG CAAGCTGACC GGCGTGTTCG 120 CGCCGCGTCC GCGTCCGGGT CCGCACAAGC TGCGCGAGTG CCTGCCGCTN CTGGTGATCA 180 TCCGCAACCG sCTOAAGTAC OCCCTCAACC CGCCCGAGGG TGAaATGATC CTGCGCCAsG 240 GTCTGGTGCA CCTOGACAAC CACCCGCGCC GCGACGGCAA GTATCCCGCC GGTTTCATGG 300 ACGTGGTCGA OATCCCGAAG ACGGGCGACC GCTTCCGCCT GATGTACGAC GTCAAGGGCC 360 GCTTCGCGTT GGTGAACCTG TCCOAGGCGG AGGCGCACAT CAAOCTGATG AAGGTTGTGA 420 ACCTGTACAC GGCCACCGGC CsCCTOCCGG TCGCTCTGAC GCACGACGGC CACCGCATCC 400 sCTACCCGOA CCCGCACACC TCCATTOGTs ACACCATCGT GTACAACGTC AAGGAGAAGA 540 AOTGCGTsGA CCTGATCAAG AACCGCCAGG GCAAGGCCGT GATCGTGACC GGTGGCGCCA 600 ACCGCGGCCG CATCGGCGAG ATCGTGAAGG TGGAGTGCCA CCCCCGTGCG TTCAACATTG 660 COCACCTGAA GGACGCGTCC GGCGCCGAGT TCGCCACCCG CGCCGCGAAC ATCTTCGTGA 720 TCGGCAAGGA CCTGAACAAC CTCCAGGTAA CCOTOCCGAA GCAGCAGGGC CTGCGCATGA 780 ACGTGATCCA GOAGCGCGAs GAGCGCCTGA TCGCGGCGGA GOCCCGCAAG AACCCGCCOG 840 CTCGTGGTGC CCGCAGGGCC CGCAAGTGAG GAGGCGATTA CACGCATGCG TGTTTGTGGC 900 TCTGAAGCGA CTTGGCGGGT CGGCTGTGAG GGTTTGAGAG GAGGTGTGTG ATGCGTGTGA 960 AGTCCTTCTC CGTTCTCAGC TCTCTCTGTG CTGTAGCTGT GCCTTTCCCC AGATCGCTTT 1020 ACCOCATTTG CATACATCTG TGTAGTCGCA TGTGCGTGTT TCTGTCTCTC GGTGGGTCTC 1080 CCTCTCCCTC CCTTTCTGCC TCTCTCTTTG AGTGGGTGTG CATGCGTCGC GCGCGACGGG 1140 CTCCGCTTNA GTGATTCTCT CGTGTTTTAN GGCTGTTTTY TTTCTYAGTT NAGCGTTTTY 1200 GTTCATGATT TCCTCAGACC CAAAAAAAAA AAAAAAAA 1238 (2) INFORMATION FOR SEQ ID NO: 76: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 712 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 76: CTGACGGAGT TCCAGACGAA CCTTGTGCCG TACCCGCGCA TCCACTTCGT GCTGACAAGC 60 TACGCTCCGG TGGTGTCTGC CGAG-AAGGCG TACCACGAGC AGCTNTCCGT CGCGGACATC 120 ACGAACTCGO TNTTTGAGCC TCCTCOCATO CTNACAAAsT GCGATCCTCG CCACGGCAAG 180 TACATGTCGT GCTGCCTCAT GTACCOCGOT OATGTCGTGC CsAAGGATGT CAACGCCGCG 240 ATTGCGACGA TCAAGACGAA GCOCACAATT CAGTTCGTGG ACTGGTGCCC GACCOOCTTC 300 AAGTGCGGCA TCAACTACCA GCCGCCGACC GTTGTGCCCG GCGGTGACCT CGCsAAGGTs 360 CAGCGCGCCG TGTGCATGAT TGCCAACTCG ACCGCGATCs CTGAGGTGTT TGCCCGCATC 420 GACCACAAGT TCGACCTGAT GTACAGCAAG CGCGCGTTTG TsCACTGGTA CGTsssTGAs 480 GGCATGGAsG AGGGCGAGTT CTCCGAOOCO COCGAGsATC TCGCTGCGCT GOAGAAGGAC 540 TACGAOGAGG TTGGCOCCOA GTCCGCCGAC GACATGGOCG AGGAGGACGT CGAGGAGTAC 600 TAAGGTAGAC TCGTGCCGCG CGCTGATGAT GTAGGTGCAC GCGTGCGTGT GCTGCAGCGG 660 AGCCGCCGCC ACCGCGACTG TGTGTGTGTG CGCGCOTOAC GACCGGCTCG AG 712 (2) INFORMATION FOR SEQ ID NO: 77: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1066 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single ( D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 77: CAAGAAGTGG ATCAAGCAGG AGACGAACOC CCATsGCGAC CGCOTGCGCC GCGCGTTCTG 60 CCAGTTCTGC CTAGACCCCA TCTACCAGAT CTTCGACGCT GTOATGAACG AGAAGAAGOA 120 CAACGTGGAC AAGATGCTCA AGTOCCTCCA CGTGACGCTN ACCGCTGAGG AGCGCGAGCA 180 OGTsCCGAAN AAGCTTCTGA AGACGGTGAT GATGAANTTC CTGCCOGCTG CTGAGACGCT 240 GCTACAGATG ATCGTGGCGC ACCTGCCGTC GCCCAAGAAG GCGCAGGCGT ACCGTGCGOA 300 GATGCTGTAC TCTGGCGAGG CGTCGCCGGA GGACAAGTAC TTCATGGGTA TCAAGAACTG 360 CCACCCCOCT sCGCCOCTCA TGCTCTACAT CAGCAAGATG GTGCCsACGO CCGACCGCGO 420 CCGCTTCTTC GCCTTTGOCC GCATCTTCTC CGGTAAGGTG COCAGCCGCC AGAAGGTGCG 480 CATCATGGOT AACAACTACO TCTACGGCAA GAAGCAGOAC CTGTACGAGO ACAAGCCTGT 540 GCAGCGCTCC CTsCTG-ATGA TOGGCCGCTA CCAGOAOGCC GTGGAGOACA TGCCGTGCGG 600 TAAcstssto sGccttstoG GCOTOGACAA GTACATCOTO AAOTCCGCGA CGATCACGGA 660 CsATOGCGAO AGCCCCCACC csCTGCGCCA CATGAAGTAC TCTGTGTCGC CCGTCGTGCs 720 TGTGGCCGTG GAGGCGAAGA ACCCGTCCGA CCTGCCGAAG CTTGTGGAGG GCCTGAAGCG 780 CCTTGCCAAG TCCGACCCGC TGGTGGTGTG CACCATTGAG GAGTCTGGCG AGCACATTGT 840 TGCCGOCGCT GOCGAGCTTC ACCTTGAGAT TTOCCTGAAG GATCTCCACO AGGACTTCAT 900 GAACGGCGCG CCGCTNAAGA TCTCCGAGCC GsTGGTGTCG TTCCGCGAGA CGsTGACGGA 960 TGTOTCsTCG CAGCAOTOCC TsTCGAAGTC TGCGAACAAG CACAACCGTC TCTTCTGCCG 1020 cssTscsccs CTNACAGAOG ANCTGOCGCT GGCGATNGAN GAAGGCACCG CTGGTCCCGA íoßo NGCGGA 108 i. (2) INFORMATION FOR SEQ ID NO: 78: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 447 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 78: CGCATCAACG TCTACTTCGA TNAGTCGACG GGAGGCCGCT ACGTGCCGCG CGCCGTGCTG 60 ATGGACCTCG AGCCCGGCAC TATGGACTCC GTTCGCGCCG GCCCGTACGG CCAGCTGTTC 120 CGCCCGGACA ACTTCATCTT TGGTCAGTCC GGCGCTGGCA ACAACTGGGC CAAGGGCCAC 180 TACACTGAGG GCGCGGAGCT GATCGACTCC GTGCTTGATG TGTGCCGCAA GGAGGCGGAG 240 AGCTGCGACT GCCTGCAGGG CTTCCAGCTG TCTCACTCCC TCGGCGGCGG CACGGGCTCC 300 GGCATsGOCA CGCTGCTCAT TTCCAANCTG CGCGANGAOT ACCCGGACCG CATCATCATG - ,. C < \ ACCTTCTCCG TCATCCCOTC CCCCCOCOTO TCCOATACCG TTGTGGANCC GTACAACACG 420 ACCCTCTCTG TGCACCAGCT CGTGGAA 447 (2) INFORMATION FOR SEQ ID NO: 79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 375 base pairs (B) TYPE: nucleic acids (C) THREAD FORM: single (D) TOPOLOGY: linear (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 79: GTAACCCGCT GGTsTACGCA TATGTAOACA CAGACGGOCA GCACGACACG ACGTTCCTCG 60 CGATCCCTGT GGTGCTTGGC ATGAATGGAA TCGAGAAGCG CCTGCCGATT GGTCCGCTGC 120 ACTCGACGCA GsAAACGCTG CTGAAGGCGG CACTGCCGGT GATCAAGAAG AATATCGTG 180 AGOOCAGCCA GTTCGCGCGC TCACACCTGT AGCACCTCAG CTIT'TTTTT TtGCsTTAAA 240 CsGGCGTGGG AAGCACCTCG ATACTTCGCT TCGCGCTGAC GGACCCGCAC GACATCGTTC 300 GTCATCCCCC TCCCCCTCTT CGGCCCTATA CGCATGAAGG AGTOGAATTA TGCAACAGCA 360 TGTTNATATC AAGTG 375 (2) INFORMATION FOR SEQ ID NO: 60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 107 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: dO: Met Ala Ser Ser Arg Lys Ala Ser Asn Pro His Lys Ser His Arg Lys 5 10 15 Pro Lys Arg Ser Trp Asn Val Tyr Val Gly Arg Ser Leu Lys Ala He 20 25 30 Asn Ala Gln Met Ser Met Ser His Arg Thr Met Lys He Val Asn Ser 35 40 45 Tyr Val Asn Asp Val Met Glu Arg He Cys Thr Glu Wing Ala Ser He 50 55 60 Val Arg Wing Asn Lys Lys Arg Thr Leu Gly Wing Arg Glu Val Gln Thr 65 70 75 80 Wing Val Arg He Val Leu Pro Wing Glu Leu Wing Lys His Wing Met Wing 85 90 95 Glu Gly Thr Lys Wing Val Ser Ser Wing Ser Arg 100 105 (2) INFORMATION FOR SEQ ID NO: 81: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3d1 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 81: Asp Glu Glu Glu Glu Asp Thr Thr He Asn Asn Ser Asp Val Val Val 1 5 -10 15 Arg Tyr Lys Lys Wing Wing Thr Trp Cys Asn Glu Thr Leu Arg Val Leu 20 25 30 He Asp Wing Thr Lys Pro Gly Wing Lys Val Cys Asp Leu Cys Arg Leu 35 40 45 Gly Asp Asp Thr He Thr Ala Xaa Val Lys Thr Met Phe Lys Gly Thr 50 55 60 Glu Lys Gly He Ala Phe Pro Thr Cys He Ser Val Asn Asn Cys Val 65 70 75 80 Cys His Asn Ser Pro Gly Val Ser Asp Glu Thr Thr Gln Gln Glu He 85 90 95 Wing Met Gly Asp Val Val His Tyr Asp Leu Gly He His Val Asp Gly 100 105 110 Tyr Cys Ala Val Val Ala His Thr He Gln Val Thr Glu Asp Asn ü) "115 120 125 Leu Gly Lys Asp Glu Lys Ala Ala Arg Val He Thr Ala Ala Tyr A; 130 135 140 He Leu Asn Thr Ala Leu Arg Gln Met Arg Pro Gly Thr Thr He? Y. " 145 150 155 X < '- Gln Val Thr Asp Val Val Glu Lys Ala Wing Glu His Tyr Lys Val Thr 165 170 175 Pro Val Asp Gly Val Leu Ser Met Met Met Lys Arg Tyr He He Asp 180 185 190 Xaa Tyr Arg Cys He Pro Gln Arg Arg Val Ala Glu His Met Val His 195 200 205 Asp Tyr Asp Leu Glu Lys Ala Gln Val Trp Thr Leu Asp He Val Met 210 215 220 Thr Ser Gly Lys Gly Lys Leu Lys Glu Arg Asp Ala Arg Pro Cys Val 225 230 235 240 Phe Lys Val Ala Leu Asp Ser Asn Tyr Ser Val Lys Met Glu Ser Ala 245 250 255 Lys Glu Val Gln Lys Glu He Asp Ser Xaa Tyr Wing Thr Phe Pro Phe 260 265 270 Wing He Arg Asn Leu Glu Wing Lys Lys Wing Arg Leu Gly Leu Asn Glu 275 280 285 Met Wing Lys His Gly Wing Val He Pro Tyr Pro He Leu Phe Glu Lys 290 295 300 Olu Gly Val Val Wing His Phe Lys He Thr Val Leu He Ser Asn 305 310 315 320 Lys Lys He Glu Pro He Thr Gly Leu Lys Pro Gln Lys Ala Pro Wing 325 330 335 Leu Olu Pro Tyr Thr Asp Glu Met Leu Leu Wing Thr Asn Lys Leu Phe 340 345 350 Wing Val Wing Arg Glu Glu Gly Gly Glu Val Asp Gly Arg Gly He Arg 355 360 365 Asp Wing Val Leu Arg Wing Phe Val Gly Val Arg Leu Leu 370 375 380 (2) INFORMATION FOR SEQ ID NO: 82: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 191 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 82: Met Ser He He Lys Glu Asp Asp Wing Val Gly Cys Tyr Met Thr Val 1 5 10 15 Thr Leu Val Asp Asp Thr Lys Val Glu Gly Thr He Phe Thr Tyr Asn 20 25 30 Ser Lys Glu Gly He He Val Leu Leu Ser Leu Arg Asp Asp Gln Thr 35 40 45 Asn Met Lys Leu He Arg Thr Pro Tyr He Lys Asp Phe Ser Leu Ser 50 55 60 His Wing Glu Glu Gly Wing His Leu Pro Pro Wing Leu Asp Ser Phe Asn 65 70 75 80 Glu Leu Pro Ser Met His Wing Gly Arg Asp Lys Ser He Phe Lys His 85 90 95 Wing Being Thr Gln Leu Lys Asn Wing Glu Wing Asn Arg Glu Lys His Phe 100 105 110 Asn Being Val Thr Thr Asp Thr Pro He Wing Thr Leu Asp Wing Tyr Leu 115 120 125 Lys Leu Leu Arg Leu Tyr Pro Leu He Glu Trp Asn Ser Asp Glu Gly 130 135 140 Val He Gln Val Ser Asp Thr Val He Val Val Gly Asp Pro Asp Trp 145 150 155 160 Arg Thr Pro Lys Ala Met Leu Val Asp Gly Ala Pro Glu Lys Asp Arg 165 170 175 Pro Leu Val Asp Arg Leu Gln Val Wing Leu Gly Asn Gly Lys Lys 180 185 190 (2) INFORMATION FOR SEQ ID NO: d3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 273 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 63: Met Ala Lys Lys His Leu Lys Arg Leu Tyr Ala Pro Lys Asp Trp Met 1 5 10 15 Leu Ser Lys Leu Thr Gly Val Phe Ala Pro Arg Pro Arg Pro Gly Pro 20 25 30 His Lys Leu Arg Glu Cys Leu Pro Leu Leu Val He He Arg Asn Arg 35 40 45 Leu Lys Tyr Ala Leu Asn Ala Arg Glu Gly slu Met He Leu Arg Gln 50 55 60 Gly Leu Val His Val Asp Asn His Pro Arg Arg Aep Gly Lys Tyr Pro 65 70 75 80 Wing Gly Phe Met Asp Val Val slu He Pro Lys Thr Gly Asp Arg Phe 85 90 95 Arg Leu Met Tyr Asp Val Lys Gly Arg Phe Ala Leu Val Asn Leu Ser 100 105 110 Glu Wing Glu Wing Gln He Lys Leu Met Lys Val Val Asn Leu Tyr Thr 115 120 125 Wing Thr Gly Arg Val Pro Val Wing Val Thr His Asp Gly His Arg He 130 135 140 Arg Tyr Pro Asp Pro His Thr Ser He Gly Asp Thr He Val Tyr Asn 145 150 155 160 Val Lys Glu Lys Lys Cys Val Asp Leu He Lys Asn Arg Gln Gly Lys 165 170 175 Ala Val He Val Thr Gly Gly Ala Asn Arg Gly Arg He Oly Glu He 180 185 190 Val Lys Val Glu Cys His Pro Gly Ala Phe Asn He Ala His Leu Lys 195 200 205 Asp Wing Ser Gly Wing Glu Phe Wing Thr Arg Wing Wing Asn He Phe Val 210 215 220 He Gly Lys Asp Leu Asn Asn Leu Gln Val Thr Val Pro Lys Gln Gln 225 230 235 240 Gly Leu Arg Met Asn Val He Gln Glu Arg Glu Glu Arg Leu He Wing 245 250 255 Ala Glu Ala Arg Lys Asn Ala Pro Ala Arg Gly Ala Arg Arg Ala Arg 260 265 270 Lys (2) INFORMATION FOR SEQ ID NO: 84: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 200 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 84: Leu Thr Glu Phe Gln Thr Asn Leu Val Pro Tyr Pro Arg He His Phe 1 5 lo 15 Val Leu Thr Ser Tyr Ala Pro Val Val Ser Ala Olu Lys Ala Tyr His 20 25 30 Glu Gln Leu Ser Val Ala Asp He Thr Asn Ser Val Phe Glu Pro Ala 35 40 45 Gly Met Leu Thr Lys Cys Asp Pro Arg His Gly Lys Tyr Met Ser Cys 50 55 60 Cys Leu Met Tyr Arg Gly Asp Val Val Pro Lys Asp Val Asn Wing Wing 65 70 75 80 He Wing Thr He Lys Thr Lys Arg Thr He Gln Phe Val Asp Trp Cys 85 90 95 Pro Thr Gly Phe Lys Cys Gly He Asn Tyr Gln Pro Pro Thr Val Val 100 105 110 Pro Gly Gly Asp Leu Wing Lys Val Gln Arg Wing Val Cys Met He Wing 115 120 125 Asn Ser Thr Wing Wing Wing Glu Val Phe Wing Arg He Asp His Lys Phe 130 135 140 Asp Leu Met Tyr Ser Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu 145 150 155 160 Gly Met Glu Glu Gly Glu Phe Ser Glu Wing Arg Glu Asp Leu Ala Wing 165 170 175 Leu Glu Lys Asp Tyr Glu Glu Val Gly Wing Glu Ser Wing Asp Asp Met 180 185 190 Gly Glu Glu Asp Val Glu Glu Tyr 195 200 (2) INFORMATION FOR SEQ ID NO: d5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 365 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 65: Lys Lys Trp He Lys Gln Glu Thr Asn Wing Asp Gly Glu Arg Val Arg 1 5 10 15 Arg Wing Phe Cys Gln Phe Cys Leu Asp Pro He Tyr Gln He Phe Asp 20 25 30 Wing Val Met Asn Glu Lys Lys Asp Lys Val Asp Lys Met Leu Lys Ser 35 40 45 Leu His Val Thr Leu Thr Wing Glu Glu Arg Glu Gln Val Pro Xaa Lys 50 55 60 Leu Leu Lys Thr Val Met Met Xaa Phe Leu Pro Ala Wing Glu Thr Leu 65 70 75 80 Leu Gln Met He Val Wing His Leu Pro Pro Pro Lys Lys Wing Gln Wing 85 90 95 Tyr Arg Wing Glu Met Leu Tyr Ser Gly Glu Wing Pro Glu Asp Lys 100 105 110 Tyr Phe Met Gly He Lys Asn Cys Asp Pro Wing Wing Pro Leu Met Leu 115 120 125 Tyr He Ser Lys Met Val Pro Thr Wing Asp Arg Gly Arg Phe Phe Wing 130 135 140 Phe Gly Arg He Phe Ser Gly Lys Val Arg Ser Gly Gln Lys Val Arg 145 150 155 160 He Met Gly Asn Asn Tyr Val Tyr Gly Lys Lys Gln Asp Leu Tyr Glu 165 170 175 Asp Lys Pro Val Gln Arg Ser Val Leu Met Met Gly Arg Tyr Gln Glu 180 185 190 Wing Val Glu Asp Met Pro Cys Gly Asn Val Val Gly Leu Val Gly Val 195 200 205 Asp Lys Tyr He Val Lys Ser Wing Thr He Thr Asp Asp Gly Glu Ser 210 215 220 Pro His Pro Leu Arg Asp Met Lys Tyr Ser Val Ser Pro Val Val Arg 225 230 235 240 Val Ala Val Glu Ala Lys Asn Pro Ser Asp Leu Pro Lys Leu Val Glu 245 250 255 Gly Leu Lys Arg Leu Wing Lys Ser Asp Pro Leu Val Val Cys Ser He 260 265 270 Glu Glu Ser Gly Glu His He Val Wing Ala Gly Wing Gly Glu Leu His Leu 275 280 285 Glu lie Cys Leu Lys Asp Leu Gln Glu Asp Phe Met Asn sly Ala Pro 290 295 300 Leu Lys He Ser Glu Pro Val Val Ser Phe Arg Glu Thr Val Thr Asp 305 310 315 320 Val Ser Ser Gln Gln Cys Leu Ser Lys Ser Wing Asn Lys His Asn Arg 325 330 335 Leu Phe Cys Arg Gly Ala Pro Leu Thr Glu Xaa Leu Ala Leu Ala Xaa 340 345 350 Xaa Glu Gly Thr Ala Gly Pro Xaa Ala 355 360 (2) INFORMATION FOR SEQ ID NO: 86: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 149 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 86: Arg He Asn Val Tyr Phe Asp Xaa Ser Thr Gly Gly Arg Tyr Val Pro 1 5 10 15 Arg Ala Val Leu Met Asp Leu Glu Pro Gly Thr Met Asp Ser Val? Rg 20 25 30 Wing Gly Pro Tyr Gly Gln Leu Phe Arg Pro Asp Asn Phe He Phe Gly 35 40 45 Gln Ser Gly Wing Gly Asn Asn Trp Wing Lys Gly His Tyr Thr Glu GJy 50 55 60 Wing Glu Leu He Asp Ser Val Leu Asp Val Cys Arg Lys Glu Wing G.? 65 70 75 80 Ser Cys Asp Cys Leu Gln Gly Phe Gln Leu Ser His Ser Leu Gly Gly 85 90 95 Gly Thr Gly Ser Gly Met Gly Thr Leu Leu He Ser Xaa Leu Arg Xaa 100 105 no Glu Tyr Pro Asp Arg Met Met Met Thr Phe Ser Val He Pro Ser Pro 115 120 125 Arg Val Ser Asp Thr Val Val Xaa Pro Tyr Asn Thr Thr Leu Ser Val 130 135 140 His Gln Leu Val Glu 145 (2) INFORMATION FOR SEQ ID NO: 87: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 69 amino acids (B) TYPE: amino acids (C) THREAD FORM: (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEQ ID NO: 87: Asn Pro Leu Val Tyr Ala Tyr Val Asp Thr Asp Gly Gln His Glu Thr 1 5 10 15 Thr Phe Leu Wing Pro Val Val Leu Gly Met Asn Gly He Glu Lys 20 25 30 Arg Leu Pro He Gly Pro Leu His Ser Thr Glu Glu Thr Leu Leu Lys 35 40 45 Ala Ala Leu Pro Val He Lys Lys Asn He Val Lys Gly Ser Glu Phe 50 55 60 Wing Arg Ser His Leu 65 CLAIMS 1. A polypeptide comprising an immunogenic portion of a Leishmania antigen having an amino acid sequence recited in SEQ ID NO: 2, or a variant of said antigen that differs only in substitutions and / or conservative modifications.
2. 2. The polypeptide of claim 1, comprising the amino acids of 1-564 of SEQ ID NO: 2.
3. 3. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide according to claim 1.
4. 4. The DNA molecule of claim 3, wherein the nucleotide sequence is selected from the group consisting of: a) nucleotides 421 to 2056 of SEQ ID NO: 1; and (b) DNA sequences that hybridize to a nucleotide sequence complementary to nucleotides 421 to 205d of SEQ ID NO: 1 under moderately stringent conditions.
5. 5. A recombinant expression vector comprising the DNA molecule of claim 3.
6. 6. A host cell transformed or transfected with the expression vector of claim 5.
7. 7. A polypeptide comprising an immunogenic portion of a Leishmania antigen having an amino acid sequence recited in SEQ ID NO: 4, or a variant of said antigen that differs only in substitutions and / or conservative modifications. d. The polypeptide of claim 7, comprising amino acids 1-175 of SEQ ID NO: 4. 9. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide according to claim 7. The DNA molecule of claim 9, wherein the nucleotide sequence is selected from the group consisting of: a) nucleotides 25 to 549 of SEQ ID NO: 3; and (b) DNA sequences that hybridize to a nucleotide sequence complementary to nucleotides 25 to 549 of SEQ ID NO: 3 under moderately stringent conditions. 11. A recombinant expression vector comprising the DNA molecule of claim 9. 12. A host cell transformed or transfected with the expression vector of claim 11. 13. A polypeptide comprising an immunogenic portion of a Leishmania antigen. or a variant of said antigen that differs only in substitutions and / or conservative modifications, wherein the antigen comprises an amino acid sequence selected from the group consisting of the sequences recited in SEQ ID NO: 22, 24, 26, 36-36, 41, 49-53 and 82. 14. The antigenic epitope of a Leishmania antigen comprising an amino acid sequence recited in SEQ ID NO: 43. 15. A polypeptide comprising at least two contiguous antigenic epitopes according to claim 14. 16. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide according to claim 13 or 15. 17. The DNA molecule of claim 16, wherein the nucleotide sequence is selected from the group consisting of: (a) sequences recited in SEQ ID NO: 21, 23, 25, 29-31, 34, 45-48 and 74; And (b) DNA sequences that hybridize to a complementary nucleotide sequence for a sequence recited in SEQ ID NO: 21, 23, 25, 29-31, 34, 45-48 and 74 under strictly moderate conditions. 16. An expression vector comprising the DNA molecule of claim 16. 19. A host cell transformed or transfected with the expression vector of claim 16. 20. A polypeptide comprising an immunogenic portion of a Leishmania antigen or variant of said antigen that differs only in substitutions and / or conservative modifications, wherein the antigen comprises an amino acid sequence provided in SEQ ID NO: 20. 21. An isolated DNA molecule comprising a nucleotide sequence encoding a polypeptide according to claim 20. 216 22. The DNA molecule of claim 21, wherein the nucleotide sequence is selected from the group consisting of: (a) a sequence recited in SEQ ID NO: 19; and (b) the DNA sequences that hybridize to a nucleotide sequence complementary to the SEQ ID sequence. NO: 9 under strictly moderate conditions. 23. A recombinant expression vector comprising the DNA molecule of claim 21. 24. A host cell transformed or transfected with the expression vector of claim 23. 25. A pharmaceutical composition comprising a polypeptide according to any of claims 1, 7, 13 and 15, and a physiologically acceptable vehicle. 26. A pharmaceutical composition comprising a polypeptide according to claim 20 and a physiologically acceptable carrier. 27. A pharmaceutical composition comprising at least two different polypeptides selected from the group consisting of: (a) a polypeptide according to claim 1; (b) a polypeptide according to claim 7; (c) a polypeptide according to claim 13; (d) a polypeptide according to claim 15; (e) a polypeptide according to claim 20; (f) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 6; or a variant of said antigen that differs only from substitutions and / or conservative modifications; (g) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 8; or a variant of said antigen that differs only from substitutions and / or conservative modifications; (h) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 10; or a variant of said antigen that differs only from substitutions and / or conservative modifications; and a physiologically acceptable vehicle. 28. A pharmaceutical composition according to any of claims 25, 26 and 27, further comprising soluble Leishmania antigens. 29. A pharmaceutical composition according to any of claims 25, 26 and 27, further comprising a K39 antigen from Leishmania. 30. A pharmaceutical composition comprising soluble Leishmania antigens and a pharmaceutically acceptable carrier. 31. A vaccine comprising a polypeptide according to any of claims 1, 7, 13 and 15 and a non-specific immune response enhancer. 32. A vaccine comprising a polypeptide according to claim 20 and a non-specific immune response enhancer. 33. A vaccine comprising at least two different polypeptides selected from the group consisting of: (a) a polypeptide according to claim 1; (b) a polypeptide according to claim 7; (c) a polypeptide according to claim 13; (d) a polypeptide according to claim 15; (e) a polypeptide according to claim 21; (f) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 6; or a variant of said antigen that differs only from substitutions and / or conservative modifications; (g) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 8; or a variant of said antigen that differs only from substitutions and / or conservative modifications; (h) a polypeptide comprising an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 10; or a variant of said antigen that differs only from substitutions and / or conservative modifications; and a physiologically acceptable vehicle. 34. A vaccine comprising soluble Leishmania antigens and a non-specific response enhancer. 35. A vaccine according to any of claims 32, 32, 33 and 34 wherein the non-specific immune response enhancer is an immunogenic portion of a non-Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 10 or a variant of the antigen that differs only in substitutions and / or modifications. 36. A vaccine according to any of claims 31, 32 and 33, further comprising soluble Leishmania antigens. 37. A vaccine according to claim 36, wherein the non-specific immune response enhancer is an immunogenic portion of a Leishmania antigen having the amino acid sequence recited in SEQ ID NO: 10, or a variant of the antigen that differs only in substitutions and / or conservative modifications. 38. A vaccine according to any of claims 31, 32, 33 and 34, further comprising a delivery vehicle. 39. The vaccine of claim 38, wherein the delivery vehicle is a biodegradable microsphere. 40. A vaccine comprising a DNA molecule according to any of claims 3, 9 and 16. 41. A vaccine comprising a DNA molecule according to claim 21. 42. A pharmaceutical composition according to any of claims 25, 26, 27, 29 and 30, for use in the manufacture of a medicament for inducing protective immunity against leishmaniasis in a patient. 43. The composition of claim 42, wherein leishmaniasis is caused by Leishmania species selected from the group consisting of L. donovani, L. chagasi, L. infatum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. tropica and L. guyanensis. 44. A vaccine according to any of claims 31-34, 40 and 41, for use in a method for inducing protective immunity against leishmaniasis in a patient comprising administering. 45. The composition of claim 44, wherein the leishmaniasis caused by Leishmania species selected from the group consisting of L. donovani, L. chagasi, L. infatum, L. major, L. amazonensis, L. braziliensis, L. panamensis, L. tropica and L. guyanensis. 46. A pharmaceutical composition according to any of claims 35, 26, 27, 29 and 30, for use in a method for detecting Leishmania infection in a patient. 47. A diagnostic kit comprising: (a) a pharmaceutical composition according to any of claims 25, 26, 27, 29 and 39; and (b) an apparatus sufficient to contact the dermal cells of a patient with the pharmaceutical composition. 48. A pharmaceutical composition according to any of claims 25, 26, 27, 29 and 30, for use in the manufacture of a medicament for stimulating a cellular and / or humoral immune response in a patient. 49. The pharmaceutical composition of claim 43, wherein the response is an immune response of Th 1. 50. The composition of claim 4d, wherein the response is the production of I L-12. 51 A vaccine according to any of claims 31-34, 40 and 41, for use in the manufacture of a medicament for stimulating the cellular and / or humoral immune response in a patient. 52. The vaccine of claim 51, wherein the response is a Th 1 response. 53. The method of claim 51, wherein the response is the production of I L-12. 54. A pharmaceutical composition according to any of claims 2, 26, 27, 29 and 30, for use in the manufacture of a medicament for treating a patient suffering from a disease responsive to stimulation of IL-12. 55. A vaccine according to any of claims 31-34, 40 and 41, for use in the manufacture of a medicament for treating a patient suffering from a disease responsive to stimulation of IL-12. 56. A pharmaceutical composition comprising a polypeptide and a physiologically acceptable carrier, the polypeptide comprising an immunogenic portion of a Leishmania antigen or a variant of said antigen that differs only in substitutions and / or conservative modifications, wherein the antigen comprises a sequence of amino acids selected from the group consisting of SEQ ID NO: 39, 42, 55, 61, 62, 30, d1 and d3-d7. 57. A pharmaceutical composition according to claim 56, further comprising a K39 antigen from Leishmania. 53. A vaccine comprising a polypeptide and a non-specific immune response enhancer, the polypeptide comprising an immunogenic portion of a Leishmania antigen or a variant of the antigen that differs only in substitutions and / or conservative modifications, wherein the antigen comprises a sequence selected from the group consisting of SEQ ID NO; 39. 42, 55, 61, 62, 60, 81 and 83-67. 59. A pharmaceutical composition according to any of claims 56 and 57, for use in the manufacture of a medicament for inducing protective immunity against leishmaniasis in a patient. 60. A vaccine according to claim 5d, for use in the manufacture of a medicament for inducing protective immunity against leishmaniasis in a patient. 61. A pharmaceutical composition according to any of claims 56 or 57, for use in a method for detecting Leishmania infection in a patient. 62. A pharmaceutical composition according to claim 56, and a composition comprising a K39 antigen from Leishmania, for use in a method for detecting Leishmania infection in a patient. 63. A diagnostic kit comprising: (a) a pharmaceutical composition according to any of claims 56 and 57; and (b) an apparatus sufficient to contact skin cells of a patient with the pharmaceutical composition. RES U MEN Compositions and methods are described to prevent, treat and detect leishmaniasis and stimulate immune stimulatory responses in patients. Compounds provided include polypeptides that contain at least an immunogenic portion of one or more Leishmania antigens or a variant thereof. Also provided are vaccines and compositions comprising said polypeptides or DNA molecules that encode said polypeptides and can be used, for example, for the prevention and therapy of leish maniasis, as well as for the detection of Leishmania infection.