MXPA99007396A - Plant pyruvate dehydrogenase kinase gene - Google Patents

Abstract

The present invention relates to the isolation, purification, characterization and use of a mitochondrial pyruvate dehydrogenase kinase (PDHK) gene [SEQ ID NO:1](pYA5;ATCC No 209562) from the Brassicaceae (specifically Arabidopsis thaliana). The invention includes isolated and purified DNA of the stated sequence and relates to methods of regulating fatty acid synthesis, seed oil content, seed size/weight, flowering time, vegetative growth, respiration rate and generation time using the gene and to tissues and plants transformed with the gene. The invention also relates to transgenic plants, plant tissues and plant seeds having a genome containing an introduced DNA sequence of SEQ ID NO:1;or a part of SEQ ID NO:1 characterized in that said sequence has been introduced in an antisense or sense orientation, and a method of producing such plants and plant seeds. The invention also relates to substantially homologous DNA sequences from plants encoding proteins with deduced amino acid sequences of 25%or greater identity, and 50%or greater similarity, isolated and/or characterized by known methods using the sequence information of SEQ ID NO:1, and to parts of reduced length that are still able to function as inibitors of gene expression by use in an antisense, co-suppression or other gene silencing technologies.

Description

PLANT GENE OF PIRUVATO-DEHYDROGENASE-CINASE TECHNICAL FIELD This invention relates to plant genes useful for the genetic manipulation of plant characteristics. More specifically, the invention relates to the identification, isolation and introduction of useful genes, for example, to alter the oil content of the seeds, seed size, flowering and / or generation time, or vegetative growth of commercial or crop plants.

BACKGROUND OF THE INVENTION Plants assimilate C02 in the formation of sugar through a coordination of the reactions of photosynthesis in light and dark. Through the catabolic and anabolic reactions of metabolism, these sugars are the base of the growth of the plant, and finally the productivity of the plant. In the process of plant growth, respiration, which comprises the consumption of 02 and the catabolism of sugar and other substrates to produce serums, plays a central role in the production of an energy source, which reduces the equivalents and an arrangement of intermediate compounds (carbon skeletons) as the building blocks for many essential biosynthetic processes. It is known that any two plants with identical photosynthetic speeds often differ both in the total production of the biomass and in the harvestable product. Therefore, the relationship between respiration velocity and crop productivity has been one of the most intensely studied topics in the physiology of the plant. In a biochemical sense, it can be understood that respiration is composed of glycolysis, the oxidative pathway of pentose phosphate, the Krebs cycle (tricarboxylic acid, TCA) and the mitochondrial electron transport system. The intermediate products of respiration are necessary for the growth in the meristematic tissues, the maintenance of the existing phytomass, the absorption of nutrients, and the intra- and inter-cellular transport of organic and inorganic materials. In soybeans, there is evidence that an increase in respiration rate through the pod can lead to an increase in seed growth (Sinclair et al., 1987), whereas decreased respiration can result in decreased reproductive growth (Gale, 1974). Therefore, respiration is important for both anabolic and catabolic metabolic phases. Although the pathways of carbon metabolism in plant cells are completely well understood, the control of carbon flux through these routes in vivo is poorly understood at present. The pyruvate-dehydrogenase mitochondrial complex (mtPDC), which catalyzes the oxidative decarboxylation of pyruvate to acetyl-CoA, is the main entry point for carbohydrates in the Krebs cycle, the mtPDC complex links the glycolytic carbon metabolism with the Krebs cycle, and due to the irreversible nature of this reaction, the pyruvate-dehydrogenase complex (PDC) is a particular site very important for regulation. The mitochondrial PDC has been studied intensively in mammalian systems, and the available knowledge about the molecular structure of the plant mtPDC is largely based on mammalian mtPDC studies. The mtPDC contains the enzymes El (EC 1.2.4.1), E2 (EC 2.3.1.12) and E3 (EC 1.8.1.4), and their associated prosthetic groups, thiamine PPi, lipoic acid, and FAD, respectively. The El and E3 components are arranged around an E2 core. The components of E2 and E3 are individual polypeptide chains. In contrast, the enzyme El consists of two subunits, Ela and Elß. Their precise roles remain unclear. Another subunit, the E3 binding protein, is thought to play a role in the binding of E3 to the E2 nucleus. El-kinase and phosphatase are associated regulatory subunits (Grof et al., '1995). Plants are unique in having PDH complexes in two isoforms, one located in the mitochondrial matrix as in other eukaryotic cells, and another located in the plastid chloroplast or stroma (Randall et al., 1989). Although the isoforms of the plastidial and mitochondrial PDH complex are very sensitive to feedback regulation of products, only the mitochondrial PDH complex is regulated by inactivation / reactivation by reversible phosphorylation / dephosphorylation (Miernyk and Randall, 1987).; Gemel and Randall, 1992; Grof et al., 1995). More specifically, mitochondrial PDC activity (mtPDC) is regulated through the inhibition of product feedback (NADH and acetyl-CoA) and the phosphorylation status of mtPDC is determined by the determined combination of reversible phosphorylation of the Ela subunit by PDC-kinase (PDCK) and its dephosphorylation by PDC-phosphatase. PDCK phosphorylates and inactivates PDC, P872 while the PDC-phosphatase dephosphorylates and reactivates the complex. The maximum activity of PDC also seems to vary according to the development, with the highest catalytic activity observed during germination of the seed and the early development of the germ (for example, in the post-germinative cotyledons, Hill et al., 1992; et al., 1995). Acetyl-CoA, the product of PDC, is also the primary substrate for the synthesis of fatty acids. While it is known that the biosynthesis of the fatty acids of the plant occurs in the plastids, the origin of the acetyl-CoA used for the synthesis of fatty acids in the plastids has been the subject of much speculation. This remains a major issue that has not been resolved. Due to the central role of acetyl-CoA in many metabolic pathways, it is likely that more than one route may contribute to maintaining the acetyl-CoA mixture (Ohlrogge and Browse, 1995). A philosophical school takes the perspective that the carbon for the synthesis of fatty acids derives directly from the products of photosynthesis. In this scenario, 3-phosphoglycerate (3-PGA) will give rise to pyruvate, which will be converted to acetyl-CoA by pyruvate-dehydrogenase in plastids (Liedvogel, 1986). This "hypothesis has many attractive aspects, P872 but also several issues -not faced: (1) the synthesis of fatty acids occurs in photosynthetic (chloroplasts) and non-photosynthetic plastids (in the root, embryonic cotyledons in development, endosperm leucoplastos); (2) some plastids may lack 3-phosphoglycerate-mutase (Kleining and Liedvogel, 1980), an essential enzyme for converting 3-PGA, the intermediate product of C02 fixation, to pyruvate; (3) acetate is the preferred substrate for the synthesis of fatty acids using isolated intact plastic, and there is evidence that a system of several enzymes that includes acetyl-CoA-synthetase and acetyl-CoA-carboxylase, exists in plastids, which channels acetate in lipids (Roughan and Ohlrogge, 1996). It is almost certain that at least some of the acetyl-CoA in plastids is formed by plastidial pyruvate dehydrogenase, using pyruvate imported from the cytosol or produced locally by plastid glycolysis. An additional possibility, especially in non-photosynthetic tissues (eg developing roots and embryos), is that acetyl-CoA, generated in the mitochondria, is an alternative means to provide portions of acetate for the synthesis of fatty acids (Ohlrogge and Bro se, 1995). The acetyl-CoA generated in mitochondrial form could be hydrolyzed to produce free acetate; that could move in plastid for conversion to acetyl-CoA via acetyl-CoA synthetase plastidial, an enzyme with 5 to 15 times greater activity than the in vivo speed of fatty acid synthesis (Roughan and Ohlrogge, 1994). Alternatively, mitochondrial acetyl-CoA could be converted to acetylcarnitine and transported directly into the plastid. Therefore, in theory, the mitochondrial pyruvate-dehydrogenase complex has an important role to play in the fatty acid biosynthesis (see Figure 1 of the accompanying drawings). The proof of this hypothesis has been stopped by the difficulties to directly measure the existence of acetate in the cytosol. The mitochondrial PDC (mtPDC) is a tightly regulated multiple subunit complex. As previously mentioned, one of the key regulatory components of this complex is PDH-kinase (PDHK). PDHK functions as a negative regulator by inactivating a PDH via phosphorylation. By modulating the PDCK, PDC activity can be engineered. Several attempts have been made to increase or channel the additional carbon towards fatty acid biosynthesis. The objectives have included the genetic modification of the expression of the acetyl-CoA-carboxylase and pyruvate kinase gene by over-expression and antisense mRNA techniques with limited success or without success. Nevertheless, there are many examples of successful modifications to the metabolism of the plant that has been achieved by genetic engineering, to transfer new genes or to alter the expression of existing genes, in plants. Now, it is possible to routinely introduce genes into many plant species of agronomic background to improve crop performance (eg, content / composition of seed oil or tuber starch; improvement of food; resistance to herbicides, disease or insects; tolerance to heavy metals, etc.) (Somerville, 1993, Kishore and Somerville, 1993, MacKenzie and Jain, 1997). For example, increases in the proportions of some strategic fatty acids and in the amounts of seed oil have been achieved by the introduction of various fatty acid biosynthesis and acyltransferase genes in oilseed crops. This includes the following demonstrations: The expression of an antisense construct to stearoyl-ACP? Desaturase in Brassi ca ceae led to an increase in stearic acid content (Knutzon et al., 1992). The expression of a medium chain fatty acyl-ACP-thioesterase from California Bay in Brassi ca ceae showed an increase in lauric acid (12: 0) (Voelker et al., 1992, 1996). The expression of jojoba ß-keto-acyl-CoA-synthase in Brassi caceae with low erucic acid content led to an increase in the level of erucic acid (22: 1); the effect after expression in cultures with high erucic acid content was not significant (Lassner et al., 1996). The increased proportions of oleic acid in Brassica napus and in soybeans have been achieved by absent the FAD2 (? 12) -microsomal desaturase (Hitz et al., 1995, Kinney, 1995, 1997). The transformation of Arabidopsis thaliana and turnip seed (B. napus) with a yeast sn-2-acyltransferase resulted in seed oils with increased proportions of 22: 1 and other very long chain fatty acids and significant increases in the content of seed oil (Zou et al., 1997). The starch deposit has also been altered by genetic engineering. By the expression of a glgCld gene of E. mutant coli that codes for an ADP-glucose-pyrophosphorylase in the tubers of the'papa, an increase in the accumulation of starch was achieved (Stark et al., 1992). However, due to the fact that a PDHK gene has not been cloned from any plant until now, even now, no genetic modification has faced the possibility of altering the carbon flow, increasing the synthesis of fatty acids, oil content or size of the seed, altering the time of flowering and / or generation, vegetative growth or respiration / productivity of the plant by modulating the activity of mitochondrial PDH of the plant.

DESCRIPTION OF THE INVENTION It is an object of the invention to identify, isolate and characterize a pyruvate-dehydrogenase-kinase (PDHK) sequence (gene and cDNA) from Arabidopsis and use this sequence in the genetic manipulation of plants. Another object of the invention is to provide a vector containing the full-length PDHK sequence or a significant portion of the PDHK sequence from Arabidopsis, in an antisense orientation under the control of either a constitutive or specific promoter of the seed, for reintroduction into Arabidopsis or for introduction into other plants. Another object of the invention is to provide a method for constructing the vector containing the PDHK sequence in full length or a significant portion of the PDHK sequence from Arabidopsis, in a homosense sequence under the control of either a constitutive promoter or specific to the seed, for reintroduction into the Arabidopsis or for introduction into other plants. Another object of the invention is to provide a method for modifying Arabidopsis and other plants to change their seed oil content. Another object of the invention is to provide a method for modifying Arabidopsis and other plants to change their weight or average seed size. Another object of the invention is to provide a method for modifying Arabidopsis and other plants to change their respiration rate during development. Another object of the invention is to provide a method for modifying Arabidopsis and other plants to change their vegetative growth characteristics. Another object of the invention is to provide a method for modifying Arabidopsis and other plants to change their flowering time or generative growth patterns. Still another object of the invention is to provide P872 a method to modify the Arabidopsis and other plants to change the period required to reach the maturity of the seed. In accordance with one aspect of the present invention, isolated and purified deoxyribonucleic acid (DNA) of SEQ ID No. 1 (pYA5; ATCC No. 209562) is provided. According to still another object of the invention, a vector containing SEQ ID No. 1 or a part thereof for the introduction of the gene is provided in an antisense orientation (eg, pAsYA5; ATCC No. 209561) in a cell-plant, and a method for preparing a vector containing SEQ ID No. 1 or a part thereof, for the introduction of the gene in a homosense orientation, in a plant cell. Also, the invention relates to transgenic plants and plant seeds having a genome containing an introduced DNA sequence of SEQ ID No. 1, and a method for reproducing these plants and plant seeds. The invention also relates to substantially homologous DNA sequences from plants with deduced amino acid sequences of 25% or greater identity, and 50% or greater similarity, isolated and / or characterized by known methods using the P872 sequence information of SEQ ID No. 1; as will be appreciated by those skilled in the art and to parts of reduced length that are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application (Transwitch, Jorgensen and Napoli 1994). It will be appreciated by those skilled in the art that small changes in the identities at the nucleotides in a gene-specific sequence can result in reduced or improved gene efficiency and that, in some applications (eg, antisense or co-deletion) ), frequently in partial sequences work as effectively as full-length versions. The ways in which the gene sequence can be varied or shortened are well known to a person skilled in the art, as are ways to test the effectiveness of altered genes. All of these variations of the genes are therefore claimed as part of the present invention. Stated in a more general manner, the present invention relates to the isolation, purification and characterization of a mitochondrial pyruvate-dehydrogenase-kinase (PDHK) gene from Brassi ca ceae (specifically Arabidopsis thaliana) and demonstrates its activity in regulating the synthesis of acids P872 fat, the content of seed oil, the size / weight of the seed, flowering time, vegetative growth, respiration rate and generation time. Until now, no specific data on the gene structure of the PDC regulatory subunits of the plant (PDCK and PDC-phosphatase) were available. The PDHK gene was cloned and characterized in the course of experiments designed to complement an E mutant. coli, JC201 (Coleman, 1990), with a plant cDNA library. { A. thaliana). By expressing the cDNA as a fusion protein in E. coli, its function was established as a PDHK as in a protein kinase assay, where the Ela / Elß subunits of mammalian PDH were specifically phosphorylated (substrates specific for PDHK). The structure of PDHK of A. thaliana is significantly homologous to its mammalian counterpart, particularly among the functional domains. The PDHK of the invention is useful in the manipulation of PDH activity, and the respiration rate in plants. For example, by transforming plants with a construct that has the partial PDHK gene in an antisense orientation or in a homosense orientation, under the control of either constitutive or tissue-specific promoters, mitochondrial PDHK expression may be absent somewhere. by the antisense or co-suppression phenomenon (Transwitch) (De Lange et al., 1995; Mol et al., 1990; Jorgensen and Napoli, 1994; Kinney, 1995), respectively. This may result in increased activity of mitochondrial PDH, and therefore increased production or increased availability of mitochondrially generated acetyl-CoA, or increased respiration rate. Alternatively, by selectively overexpressing the full-length PDHK gene in a tissue-specific manner, the activity of mitochondrial PDH can be negatively regulated, resulting in decreased respiratory rates in the tissues, such as leaves or tubers, for decrease the maintenance breathing and in this way increase the accumulation of the biomass. Some of the manipulations and distributions that are possible using the PDHK gene by a part of it, include, but are not limited to, the following: seeds with increased or decreased content of fatty acid and oil; plants that exhibit early or late flowering times (measured in terms of P872 days after planting or sowing of the seed); plants with increased or decreased vegetative growth (biomass); plants with root systems better adapted to resist low soil temperatures or frost; plants with tissues that exhibit higher or lower respiration rates; plants that exhibit an improved capacity to accumulate storage compounds in other storage organs (eg, tubers); plants that exhibit an improved ability to accumulate biopolymers that depend on the acetyl moieties, precursors, such as polyhydroxyalkanoic acids, or polyhydroxybutyric acids (Padgette et al., 1997).

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the central role played by acetyl-CoA in mitochondrial respiration and the plastidial biosynthesis of fatty acids. The pyruvate-dehydrogenase complex (PDC) decarboxylates pyruvate oxidatively to produce acetyl-CoA. The plants are unique in that they have both mitochondrial and PDC plastidial isoforms. The mitochondrial pyruvate-dehydrogenase complex plays a key role in regulating the generation and availability of acetyl-CoA from the P872 portions of acetyl for various catabolic and anabolic reactions in plant cells. The mitochondrial PDC is downregulated by phosphorylation of the Ela subunit by pyruvate dehydrogenase kinase (PDCK = PDHK), and is positively regulated by the dephosphorylation of PDC by pyruvate dehydrogenase phosphatase (PDCP). Mitochondrially generating acetyl moieties can find their way into the tricarboxylic acid (TCA) respiratory cycle, but also in the plastid behavior where finally, the acetate units are used by the enzymes of the fatty acid synthesis route (FAS) to synthesize the fatty acids. They exist eventually incorporated in the membrane and also store glycerolipids. Other abbreviations: PDC, pyruvate-dehydrogenase complex; OAA, oxaloacetate; ACS, acetyl-CoA synthetase; ACH; acetyl-CoA-hydrolase; DHAP, dihydroxyacetone phosphate. "Figure 2 shows a nucleotide sequence [SEQ ID No. 1] and the deduced amino acid sequence [SEQ ID No. 2] of the cDNA (clone YA5) of PDH-kinase (PDHK) from Arabidopsis thaliana." Figure 3 shows the alignment of the amino acid sequence of the Arabidopsis PDH-kinase (Ya5p) [SEQ ID No. 2] with other keto-acid- P87 dehydrogenase-mitochondrial kinases in mammal: Pdhk I, subunit I of porcine PDH-kinase [SEQ ID No. 3]; Pdhk II, and the subunit II of the porcine PDH-kinase [SEQ ID No. 4]; Bckdhk, is a branched-chain a-ketoacid-dehydrogenase kinase from porcine [SEQ ID No. 5]. The points indicate separations. Identical amino acid residues are highlighted in a bold typeface. Figure 4 shows the predicted helical wheel structure (angle = 100 °) of the 24 amino acid residues in the N-terminus of the YA5 leader sequence (pyruvate-dehydrogenase-kinase, PDHK). The N-terminal leader sequence of the YA5 protein corresponds well to most of the target, mitochondrial sequences (Rosie _ and Schatz, 1988), which consists of a stretch of amino acids enriched in hydrophobic residues and charged residues in a positively opposite manner . The key hydrophobic residues (V3, F10, L14, V18 and W21) and positively charged (K5, K12 and H19) are found on opposite sides of the helical wheel portion in this mitochondrial target sequence, and are highlighted by " • "in the waste itself, and by"? " next to the residue number. Figure 5 shows the results of DNA gel transfer analysis (Southern, 1975) of the gene P872 YA5 (PDHK) of Arabidopsis thaliana, the genomic DNA was digested with PstI + Xabl (lane 1), Xbal (lane 2), PstI (lane 3), Pvull + Spel (lane 4), Spel (lane 5) and Pvull (path 6). It is noted that these enzymes have an internal restriction site in the cDNA (PDHK) of YA5. The digested DNA was hybridized with YA5 cDNA labeled with 32 P (approximately ~ 1.5 kb) ba or high severity conditions. All digestions showed only one fragment of hybridization, suggesting that the PDHK gene most likely represents a single copy gene in Arabidopsis thaliana. Figure 6 depicts a Northern blot analysis of the tissue distribution / abundance of mRNA (PDHK) of YA5 in A. thaliana. RNA was extracted from flowers (F), vegetative tissue (germ leaves (L)), young siliques in development (YS) and maturing siliques (MS). The analysis shows that in all tissues, an RNA hybridization band of approximately 1.5 Kb was observed, but in abundance the YA5 mRNA varied considerably from tissue to tissue. Germ leaves (L) showed the highest expression level of YA5, while significant but low levels of expression were observed in developing siliques (seed). Figures 7a, 7b, 7c and 7d show the results of the experiments in which the PDHK cDNA YA5 was expressed as a fusion protein in E. coli and the tests carried out to confirm its function as a PDH-kinase. The YA5 cDNA was expressed as a fusion protein in E. coli as shown in Figure 7a. Analysis by SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) revealed that the E lysate. coli transformed with the PDHK (YA5) of A. thaliana has a very strongly induced fusion protein of Mt ~ 45 kDa (?), which is the predicted mass of the PDHK gene fusion product of A. thaliana (42 kD + 3 kD His TAG). Figure 7b shows the PDH Ela / Elß subunit complex (obtained courtesy of Dr. M. Patel at the University of Buffalo). The proteins have been co-expressed in E. coli, to provide a substrate to test PDH's ability to phosphorylate the PDH subunit. Figures 7c and 7c are autoradiograms of the radioactive incorporation of P (from? - P-ATP) in the El subunit of the Ela / Elß PDH complex. The panels to the left of Figures 7c and 7d show the time-dependent in vitro phosphorylation (incubation times of 2, 5, 10, 15 or 20 minutes) of the PDH complex of Ela / Elß by the action of the PDHK of plant (product of clone YA5 expressed in E. coli), confirming its function as a pyruvate-dehydrogenase-kinase, the first cloned plant. In Figure 7c the control reaction (panel on the right side) contains the lysate of YA5 plus the lysate of E. Control coli without Ela / Elß substrate. "There is no evidence of phosphorylation of the Ela / Elß complex." In Figure 7d, the control reaction (right panel) contains the control E. coli lysate (without the YA5 insert) + the Ela / Elß substrate. Again, there is no evidence of the phosphorylation of the Ela / Elß complex - Figure 8 shows mitochondrial pyruvate dehydrogenase (PDC) activity in the leaves of A. thaliana from non-transformed wild-type plants of (n-WT) from A Thaliana and the T2 transgenic plants containing the constitutively expressed pyruvate dehydrogenase kinase (PDHK) designated as YA5 lines The mitochondria isolated from the leaves of the A. thaliana transgenic lines containing an expressed antisense PDHK construct constitutively, they have high PDC activity in comparison to the mitochondria isolated from leaves of non-transformed control plants Figure 9 shows the activity of mitochondrial citrate synthase in leaves of wild-type plants estre (n-WT) untransformed from A. thaliana and plants P872 Transgenic T2 containing the pyruvate-dehydrogenase-kinase (PDHK), antisense, constitutively expressed, designated as YA5 lines. The mitochondria isolated from the leaves of the "transgenic lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct also have elevated citrate synthase activities, in addition to a high concentration of PDC, in comparison with the mitochondria isolated from the leaves. of non-transformed control plants Figure 10 shows the oil content (expressed as μg of total fatty acids per 100 seeds) in seeds isolated from untransformed controls of A. thaliana (With nt-WT), and T2 seeds of transgenic of control only of plasmid pBI121 (With pBI121), and antisense pyruvate-dehydrogenase-kinase (PDHK) transgenic, designated as YA5 lines. YA5 seed lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct have a content elevated of fatty acid and oil compared to non-transformed control plant seeds or transformants that they contain only _ the selectable marker gene (transformed with pBI121), but without PDHK antisense. Figure 11 shows the time (expressed in P872 days after planting) to reach the flower initiation phase (generative) in untransformed controls of A. thaliana (nt-WT), and the T2 generation of transgenic control sera from plasmid pBI121 (pBI121) and transgenic pyruvate-dehydrogenase-kinase (PDHK) antisense, designated as YA5 lines. The time to reach the generative stage (floral onset) is reduced in the YA5 lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct, compared to non-transformed decontrol or transformants containing only the selectable marker gene (transformed with pBI121 ), but without PDHK antisense. Figure 12 shows the dry weights of shoot tissues, vegetative at 31 days after planting in untransformed controls of A. thaliana (WT), and the T2 generation of transgenic single-control plasmid pBI121 (pBI121), and the antisense pyruvate-dehydrogenase-kinase (PDHK) transgene, designated as YA5 lines. The growth of shoot tissue in YA5 lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct is reduced as compared to untransformed controls or transformants containing only the selectable matador gene P87 (transformed with pBI121), but without antisense PDHK. Figure 13 shows the average number of rosette leaves present upon entering the generative phase, in untransformed control plants of A. thaliana (WT), and the T2 generation of transgenic single-control plasmid of pBI121 (pBI121), and antisense pyruvate dehydrogenase kinase (PDHK) transgenics, designated as YA5 lines. The average number of rosette leaves per plant is reduced in YA5 lines of A. thaliana transformed with a constitutively expressed PDHK, antisense construct, compared to untransformed controls or transformants containing only the selectable marker gene (transformed with (pBI121), but without antisense.The disturbed vegetative growth class in antisense PDHK transgenics (see also Figure 12) is well related to the early flowering phenotype (see also Figure 11).

BEST WAY TO CARRY OUT THE INVENTION The best way to carry out the invention will be evident from the following description of the results of tests and experiments that have been carried out by the inventors.

The inventors chose the use of the well-accepted model plant system, the Arabidopsis thaliana for the cloning of PDHK, had a host system for genetic manipulation to alter the expression of PDHK, and to study the effects of PDHK expression on various metabolic processes and the development of the plant. This is because in recent years, Arabidopsis thaliana, a typical flowering plant, has gained increasing popularity as a model system for the study of plant biology. As a result of the ease with which this plant lends itself to work in classical and molecular genetics, Arabidopsis has come to be widely used as a model organism in the molecular genetics of plants, development, physiology and biochemistry ( Meyerowitz and Chang, 1985; Meyerowitz, 1987; Goodman et al., 1995). This dicotyledonous plant model is also closely related to Brassica's crop species and it is increasingly evident that information regarding the genetic control of basic biological processes in Arabidopsis will be transferable to other species (Lagercrantz et al., 1996). Actually, there are numerous examples in P872 where studies of the molecular biology and biochemistry of a particular metabolic pathway or particular developmental process, the possibility of genetically managing a plant to cause changes to the metabolic pathway or process, has been tested first on the model plant Arabidopsis, and it is then shown to produce similar phenotypes in other plants, particularly crop plants. For example, the oleate (18: 1) -? 12- (? -6) - desaturase gene associated with the extra-plastidial membrane, FAD2, was originally studied and eventually cloned in Arabidopsis thaliana, by identifying the lesion found in a mutant of A. thaliana defective in the desaturation of oleate to produce linoleate (18: 2) in the phosphatidylcholine skeleton. This resulted in a phenotype with high oleic acid content in A. thaliana seed oil (Okuley et al., 1994). The genetic manipulation of both soybean (Glycine max.) And cannabis B. napus to make the indigenous FAD2 gene (s) imperceptible in a specific way to the seed, by antisense approaches of co- "suppression, gave as Result similar phenotypes of seed oil with high oleic acid content (Kinney, 1995, 1997). "The transgenic expression of a sn-2 gene P872 yeast acyltransferase (SLC1-1) to achieve improved seed oil content and improved content of very long chain fatty acid was first developed in Arabidopsis and was subsequently shown to produce similar phenotypes in transgenic naba seed experiments ( B. napus) (Zou et al., 1997). Arabidopsis thaliana has repeatedly shown itself to be a useful model system for the metabolic manipulation of metabolic pathways (eg, fluid biosynthesis, photosynthesis) or processes (organogenesis, productive development, etc.) common to all higher plants. In the area of secondary metabolism transduction / signal transduction, a specific transcriptional activator of the anthocyanin pathway from monocotyledonous corn designated as R (the myc transcription factor comprised in the activation of biosynthetic genes for the production of anthocyanin in the aleurone cells of corn kernels), was expressed in Arabidopsis thaliana, causing an increased anthocyanin pigmentation in the blooms. Subsequent expression in another dicotyledonous tobacco (Nicotiana tabacum) resulted in similar flower pigment changes (Lloyd et al., 1992). These experiments show that the routes P872 complete common to all flowering plants can be controlled in a coordinated way by the introduction of transcriptional regulators, and that the mechanisms are common for various plant species. In the context of the present invention, all plant cells are subjected to mitochondrial respiration and this omnipresent process is affected by the activity of PDC and its PDCK and PDCP regulators as previously explained. Thus, many of the effects observed after genetic manipulation to modulate the expression of PDCK in Arabidopsis can be expected to result in similar phenotypes when carried out in all other plants. There are a number of ways in which genes and gene constructs can be introduced into plants, "a combination of plant transformation and tissue culture techniques has been successfully integrated into effective strategies for creating transgenic crop plants. which can be used in the present invention, have been extensively reviewed elsewhere (Potrykus, 1991, Vasil, 1994, Walden and Wingender, 1995, Songstad et al., 1995), and are well known to a person skilled in the art. For example, a person skilled in the art will certainly be aware that, in addition to the transformation P872 mediated by Agrobacterium of Arabidopsis by vacuum infiltration (Bechtold et al., 1993), or wound inoculation (Katavic et al., 1994), it is equally possible to transform other plant or crop species, using the Ti-mediated transformation. Agrobacterium plasmid (for example wound infection of hypocotyledonous petiole (DeBlock et al., 1989) or cotyledonary (Moloney et al., 1989)), particle / biobalistic bombardment methods (Sanford et al., 1987); Nehra et al., 1994; Becker et al., 1994) or the protoplast transformation methods assisted by polyethylene glycol (Rhodes et al., 1988; Shimamoto et al., 1989). As will also be apparent to those skilled in the art, and as widely reviewed elsewhere (Meyer, 1995; Datla et al., 1997), it is possible to use plant promoters to direct_ any accelerating and opposing decelerating regulation of the expression transgenic using constitutive promoters (eg, those based on CaMV35S), or by using promoters that can direct - gene expression to particular cells, tissues (e.g., napin promoter for the expression of transgenes in the cotyledons of developing seeds) , organs, for example, roots), or to a P872 particular stage of development, or in response to an external, particular stimulus (for example, thermal shock). Particularly preferred plants for modification according to the present invention include borage (Borago spp.), Cañola, castor (Ricinus communis), cacao bean (Theobroma cacao), maize (Zea mays), cotton (Gossypium spp.), Crambe spp., Cuphea spp., flax (Linum spp.), Lesquerella and Limnanthes spp., Linola, nasturcio (Tropaeolum spp.), Oenothera spp., olive (Olea spp.), palm (Elaeis spp.), peanut (Arachis spp.), Naba seed, safflower (Carthamus spp.), Soybean (Glycine and Soja, spp.), Sunflower (Helianthus spp.), Tobacco (Nicotiana spp.), Vermonia spp., Wheat (Triticum spp.), Barley (Hordeum spp.), Rice (Oryza spp.), Oats (Avena spp.), Sip (Sorghum spp.); rye (Sécale spp.), Or other members of the Gramineae family.

RESULTS Cloning of cDNA and sequence analysis of the clone YA5 (plant PDHK) A designated plant PDHK cDNA sequence YA5 was identified and cloned during the experiments designed to complement an E. coli mutant and JC201 (Coleman, 1990) with the cDNA library of P872 Arabidopsis thaliana. The mutant of E. coli JC201 has been reported to be a mutant deficient in the activity of acid-lysophosphatidic acyltransferase (LPAT, EC 2.3.1.51), and has a growth phenotype sensitive to "temperature (Cole an, 1990) The plasmids generated from the expression library "YES" of A. thaliana (Elledge et al., 1991) were used to transform the E. coli mutant, JC201. A restrictive temperature condition (44 ° C) was applied. ) to select for surviving colonies The cDNAs of the temperature insensitive transformants were isolated The clone YA5 was found to be able to complement or rescue the temperature sensitivity of JC201, but no elevated activity of LPAT was detected in the lysates of the In this way, the mechanism that supports the ability to complement the temperature sensitivity of JC201 remains unclear, however, several other complementation clones that rescue the phenotype have also been found. temperature sensitive of JC201, indicating that complementation to temperature can occur in the transformation with cDNAs having functions unrelated to LPAT (Taylor et al., 1992a; Zou and Taylor, 1994). The YA5 cDNA was sequenced from both strands in a Model 373A DNA sequencing system from Applied Biosystems using the Cycle Sequencing Kit Taq DyeDeoxi MR Terminator (Applied Biosystems, Inc.). The nucleotide sequence of the 1,457 kb YA5 cDNA (pYA5; ATCC 209562) [SEQ ID No. 1] and its deduced amino acid sequence [SEQ ID No. 2] are shown in Figure 2. A cDNA sample was deposited of YA5 (pYA5) on December 18, 1997 in the American Species Crop Collection (ATCC) of 12301 Parkiawn Drive, Rockville, Maryland 20852, USA., under accession number ATCC 209562. The sequence revealed an untranslated region at 5 'of 103 nucleotides and a 3' untranslated region of these 325 nucleotides followed by a poly A extension. YA5 has an open reading frame of 1098 base pairs encoding a 366 amino acid polypeptide, weighing calculated molecular weight of 41.37 kDa. The sequences around the AUG start codon are in agreement with the consensus sequences derived from other plant species (Lutcke et al., 1987) There is a stop codon in the box in the 5 'direction of the start codon, indicating that YA5 is a full length cDNA The calculated isoelectric point of the YA protein is 6.68 and its net charge at pH 7.0 is calculated to be -1.48.

P872 Alignment of the Amino Acid Sequence As shown in Figure 3, the comparisons of the deduced amino acid sequence [SEQ ID No. 2) of the YA5 protein (Ya5p) to the NCBI data bank revealed a high degree of homology with mammalian mitochondrial kinases responsible for the phosphorylation and inactivation of a-ketoacid-dehydrogenase complexes (Harris et al., 1992), including the pyruvate-dehydrogenase complex (PDC), the α-ketoglutarate dehydrogenase complex (KGDC) and the branched-chain α-ketoacid dehydrogenase complex (BCKDHK). These mammalian complexes are located in the mitochondrial matrix space (Damuni et al., 1984) and are similar in structure and function (Nobukuni et al., 1990). The cDNAs encoding the mammalian pyruvate-dehydrogenase-kinase (PDHK) and the branched-chain a-ketoacid-dehydrogenase-kinase (BCKDHK) have been cloned and the amino acid sequences of these protein-kinases are highly homologous. yes (Popov et al., 1992; 1993; 1994). The protein of YA5 (Ya5p) is 28.6% identical and 83.7% similar to PDKI (Popov et al., 1993), and 32.3% identical and 88.4% similar to PDKII (Popov et al., 1994), both subunits of PDH- porcine kinase. The Ya5p P872 is also 28.8% identical and 84.1% similar to BCKDHK (Popov et al., 1992). The sequence similarities extend over the entire sequence, but sequence differences and alignment separations occur throughout, particularly towards the amino and carboxyl terms. SEQ ID No. 1 of the present invention and mammalian PDHK and BCKDHK-do not exhibit significant homology with known serine / trionine-protein kinases. In contrast, a much higher degree of sequence homology was found with members of the prokaryotic protein-histidine kinase family. As shown in Figure 3, the most homologous regions fall in the conserved portions that define the functional domains of histidine kinase. Members of the protein-histidine kinase family have five regions that are highly conserved (Parkinson and Kofoid, 1992). The "five portions are easily identifiable in the deduced amino acid sequence of YA5, with the same order and separation conserved in the bacterial proteins, in the C-trrminal, the catalytic domain (Block VF) with a glycine-rich loop of Gly320- X-Gly322-X-Gly324 [SEQ ID No. 7] as well as the surrounding sequence, is the longest region of amino acids that exhibits a high identity.

P872 III with the consensus sequence of Asp -X-Gly -X-Gly252 [SEQ ID No. 8] characteristic of adenosine triphosphate (ATP) binding proteins, and Block IV with an invariant Phe 292, are localized in the positions defined as the central nucleus of the catalytic domain.

A highly conserved region defined as Block II (Glu238-Leu-X-Lys-Asn242-X-X-Arg-Ala246) [SEQ ID No. 9] of the catalytic domain is also found in the proper proximity to N-teyrmmo. The histidine residue (His121) conserved between YA5, PDKI and PDKII will probably represent Block I, which is proposed to be included in autophosphorylation. The N-terminal guide sequence of the YA5 protein corresponds well to most of the white mitochondrial sequences (Rosie and Schatz, 1988), which consists of an amino acid region enriched in hydrophobic and positively charged residues, with a structure of planned helical wheel (angle = 100 °) (Figure 4). The key hydrophobic residues (V3, F10, L14, V18 and W21) and positively charged (K5, K12 and H19) are on opposite sides of the helical wheel portion in this target mitochondrial sequence. The YA5 protein lacks obvious target portions typically found in peroxisome-targeting proteins (e.g., the peroxisomal target sequence portion Ser-Lys-Leu (SKL) not cleaved, C-trrminal, endpoint; et al., 1997).

Genomic Organization and Expression of the YA5 Gene in A. thaliana The genomic cDNA was digested with [Xal + PsII], Xbal, PsII, [PvuII + Spel], Spel, and PvuII (there were no internal restriction sites in the YA5 cDNA for these enzymes). The digested DNA was then subjected to a DNA gel blot (Southern, 1975) and hybridized with the P-labeled YA5 cDNA under high stringency hybridization conditions. As shown in Figure 5, all digestion reactions produced only one hybridization fragment (gel band), indicating that the YA5 gene is most likely present as an individual copy in the Arabidopsis genome. To determine the relative abundance of the tissue distribution of the YA5 gene transcript, an RNA gel hybridization analysis was carried out (Northern blot), shown in Figure 8, on the RNA extracted from the trees, flowering (flowers ), young siliques, and siliques in maturation of A. thaliana. In all tissues, P872 observed an RNA hybridization band of approximately 1.5 kb, but the abundance of YA5 mRNA varies considerably from tissue to tissue. Young saplings showed the highest level of expression of YA5, while significant but lower levels of expression were observed in the developing siliques (seed).

Expression of YA5 in E. coli Confirmation of its Function as a PDH-Kinase The full length cDNA of YA5 (YA5F) was cloned into pBluescript SK in a 5 'to 3' orientation of T7-T3. A primer spanning the putative transductional initiation site OMpdk (AGGAGAGACTCGAGGCTTATGGCAGTGAAG) [SEQ ID No. 6] was synthesized to include an XhoI restriction site. The Ompdk primer and the T3 primer were used in a PCR reaction to amplify the YA5 coding region of YA5F. The resulting PCR fragment was digested with HindIII (the HindIII site is present 3 'to the stop codon) and Xhol was cloned into the pTrcHisB vector (Clontech) to generate the pZTa5 construct. Analysis of SDS-PAGE with IPTG lysates of IPTG induced by IPTG containing pZTa5 and vector control ^ pTrcHisB (Figure 7a), lane 1 ("YA5") and 2 P872 ("Control"), respectively), aled that the transformer pZTa5 (Figure 7a, lane 1"YA5") exhibited a very strongly induced fusion protein of Mr ~ 45 kD, which is the predicted mass of the gene fusion product of PDHK from A. thaliana (~ 42kD + 3 kD His TAG). The protein kinase activity of the YA5 protein expressed from E. coli was assessed essentially as described by Liu et al., (1995). Protein phosphorylation substrates, human Ela and Elß co-expressed in, and purified from, M15"of E. coli, were obtained from Dr. MS Patel of the Department of Biochemistry, School of Medicine and Biomedical Sciences, State University of New York in Buffalo, Buffalo (Figure 7b) This co-expressed system of Ela and Elß has been extensively used in the study of PDC El phosphorylation regulation in mammalian systems (Korotchkina and Patel, 1995). phosphorylation experiments (shown in Figure 7c and 7d), 20-25 μg of Ela / Elß were combined with approximately 10 μg of cytosol protein from E. coli which accumulates YA5 in a final volume of 100 μl containing potassium phosphate 20 mm, pH 7.0, 1 mM magnesium chloride, 2 M dithiothreitol, 0.1 mM EDTA, and 200 μM cold ATP. The mixture was incubated at room temperature for 5 minutes, and then 32P -? - ATP5μCi was added to P872 start the trial. After 2, 5, 10, 15 and 20 minutes, aliquots of 20 μL were removed and the reaction was stopped with 20 μL of the denaturing mixture of SDS. Samples were separated on 10% SDS-PAGE and autoradiographed. Figures 7c and 7d are autoradiograms of the radioactive incorporation of 32P (of? -32P-ATP) into the El subunit of the Ela / Elß complex. The panels on the left side of 6 (c) and 6 (d) show in vitro phosphorylation dependent on time (incubation times of 2, 5, 10, 15 or 20 minutes) of the Ela / Elß complex substrate with the action of the fusion protein of plant PDHK (clone YA5), which confirms its function as a pyruvate-dehydrogenase-kinase, the first cloned plant. In Figure 7c, the control reaction (right side panel) contains the YA5 lysate plus the control E. coli lysate without the Ela / Elß substrate. There is no evidence of phosphorylation of the Ela / Elß substrate. In Figure 7d, the control reaction (right-hand panel) contains the control E. coli lysate (without the YA5 insert) plus the substrate of the PDH DE Ela / Elß complex. There is also no evidence of phosphorylation of the Ela / Elß complex in this control.

P872 Synthesis of Plant Transformation Constructs of YA5: "Construction of YA5 Antisense (PDHK Antisense) for Constitutive Expression: The YA5 cDNA contains the internal restriction sites BamHI (nt 628) and Ncol (nt 1176). _ and Ncol was free from YA5F and cloned into the respective sites in pBI524 (Datla et al., 1993), in an antisense orientation, and was located - between the 35S promoter of the cauliflower mosaic virus in "tandem and terminator" Jde napolina-synthase. The antisense cartridge of YA5 was then cut from pBGI524 by HindIII and EcoRI, and cloned into the respective sites of vector pRD400 (Datla et al., 1992). The final binary antisense vector pAsYA5 / pRD400 (a sample of which was deposited on December 18, 1997 under the terms of the Budapest Treaty in the American Species Cultivation Association (ATCC) of 12301 Parkiawn Drive, Rockville, Maryland 20852, USA, under accession number ATCC 209561) was introduced into the GV3101 strain of Agrobacterium tumefasciens (which has the auxiliary plasmid pMP90; Koncz and Schell, 1986) by electroporation. Constructions of YA5 (PDHK) ntisentido and Partial Homosentido for the Specific Expression of the P872 Seed: A 875 bp fragment of the YA5 cDNA was excised by digestion with BamHI (Pharmacia) and the fragment was ligated into the plasmid pDH1, which contains the seed-specific napin promoter (pDH1 was probably provided by DR. PS Cpvello, NCR / PBI). The cartridge and the insert (in either homosense or antisense orientation) were cleaved by a partial digestion with HindIII and EcoRI, and the DNA fragments were separated on agarose gels and purified using the Geneclean II kit (Bio 101 Inc. ). Then, the fragments were ligated into pRD400 digested with HindIII / EcoRI. The final binary vectors pNAsYA5 / pRD400 (antisense construct) or pNSYA5 / pRD400 (partial homosentide construct) were introduced into the strain GV3101 of Agrobacterium tumefasciens (which has the auxiliary plasmid pMP90; Koncz and Schell, 1986) by electroporation.

Constitutive Expression of YA5 Antisense Gene (PDHK Antisense) in Arabidopsis thaliana: Agrobacterium containing pAsYA5 / pRD400 was used to transform Arabidopsis by 'vacuum infiltration (Bechtold et al., 1993). Similarly, it should be apparent that an expert in the The P872 technique will certainly be aware that the transformation of other plant species is possible using the Ti-Agrobacterium-mediated transformation, (eg, hypocotyledonous petiole wound infection (DeBlock et al., 1989) or cotyledonary (Moloney et al. , 1989), particle / biolistic bombardment methods (Sanford et al., 1987, Nehra et al., 1994, Becker et al., 1994), or polyethylene glycol-assisted protoplast transformation methods (Rhodes et al., 1968: Shilmamoto et al., 1989). The constructions can be driven by constitutive or tissue-specific promoters (e.g., seed, root, etc.), as will also be apparent to those skilled in the art. "- As controls, the plants were either untransformed (nt), or transformed with the vector pBI121 only (Jefferson ~ et al., 1987; without the PDHK antisense insert, but containing the kanamycin selection marker and the ß-glucuronidase indicator gene.) The control and transgenic plants were grown at the same time under identical conditions in growth chambers as described by Katavic et al., 1995. The results of the DNA transfer analyzes in DNA (Southern, 1975) confirmed that all P872 antisense PDHK transgenic lines (designated as lines 23, 31, 32, 52, 95, 104 of YA5) have at least one insert for the - gene for the PDHK gene in an antisense orientation. As expected, the non-transformed wild type control and the transgenic control of pBI121 (plasmids only) only have one insert per genome, consistent with the original Southern analysis (see Figure 5).

Analysis of the activity of Pyruvate-Dehydrogenase (PDH) in Isolated Mitochondria of Transgenic Plants of PDHK Antisense of A. thaliana Sapling tissue was collected from A. thaliana transgenic plants containing the PDHK antisense construct, and from plants of control was not transformed, and intact mitochondria were isolated.

The activity of pyruvate dehydrogenase was determined (PDH) by the method of Raid et al., (1977). As shown in Figure 8, the activity of PDH in the mitochondria isolated from the leaves of transgenic plants of antisense PDHK was increased by 20 to 350%, in comparison to the activity of PDH in mitochondria isolated from non-transformed controls.

Analysis of the Enzymatic Activities of the Cycle of P872 Krebs in Isolated Mitochondria of Transgenic Plants of PDHK Antisense of A. thaliana The activities of the enzymes of the Krebs cycle, citrate-synthase, fumarase and succinate-dehydrogenase were significantly elevated in the mitochondria isolated from leaves of transgenic plants of PDHK antisense, in comparison to the respective activities in the mitochondria isolated from the non-transformed wild-type controls (n-WT). The citrate synthase activities were about 160-240% higher (Figure 9), whereas in the fumarase activities "they were approximately 65-120% higher, and the succinate-dehydrogenase activities were approximately 10-65% higher in the transgenics of antisense PDHK, in comparison to the corresponding n-WT activities established These results suggest that mitochondrial respiration is increased in antisense PDHK transgenics due to an increased availability of acetyl-CoA generated by enhanced PDC activity (due to the slow regulation of the expression of PDHK, a negative regulator of PDC).

Analysis of Fatty Acid Composition and Oil Content, and Average Seed Weights, in Seeds T2 of P872 Transgenic Control Plants of pBI121 and PDHK Antisense of A. thaliana Mature siliques and seeds of antisense PDHK transformants and controls were isolated, either untransformed transformants or transformants of pBI121 (without PDHK antisense, but with a resistance gene). kanamycin), and the respective oil contents, fatty acyl compositions, seed oils, average seed weights and the number of siliques per 15 cm segments of stem were determined. As shown in Figure 10, the total oil content, expressed as μg of total fatty acids / 100 seeds, was significantly elevated in the antisense PDHK transformants, by 8.5-26.5% and by -15.4-34.6%, in comparison the transformants of pBI121 and the non-transformed controls, respectively, indicated that the total flow of acetyl portions in the seed storage lipids was enhanced by a higher contribution of mitochondrially generated acetate. increased activity of mitochondrial PDH, due to the regulation of the negative regulator, PDHK, in antisense PDHK transformants.

Table 1 shows the oil content and the average weight of seeds isolated from A. thaliana lines transformed with a constitutively expressed antisense PDHK construct compared to the seeds of plasmid-only transformants (pBI121) and untransformed controls. Both the amount of oil and the average weight of seed were higher in the PDHK antisense transformants.

Table 1 Average seed oil content and average seed weight in untransformed controls and T2 seed of transgenic plants of YA5 antisense (PDHK A / S) and control of pBI121 The average number of siliques per 15 cm segment of the assured stem was not significantly affected in the lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct (designated as YA5 lines) compared to the plasmid-only transformants ( pBI121) and control plants not transformed. After the propagation of the T2 generation of the seed, transgenic A. thaliana plants of pBI121 and wild-type non-transformed control yielded 30 + 3 siliques and 31 ± 4 siliques, respectively, per segment of 15 cm of assured stem. Lines 31, 32, 52, 95 and 104 of YA5 transgenic PDHK antisense produced 26 ± 3, 27 + -3, 27 ± 3 and 26 + 3, 24 + 3 siliques per segment of 15 cm of assured stem, respectively. The average number of T3 seeds per silicone was also not affected in a significant way. For example, the control transformant of pBI121 produced 49.4 + 6.6 T3 seeds per silicone, and the line YA95"of PDHK antisense produced 50.1 + 8.5 T3 seeds per siliceous (n = 5-6 mature siliques of 4 individual transgenic plants of each line) This indicated that seed production (harvest index) was not adversely affected in the PDHK transformants P872 antisense. Table 2 shows the fatty acid composition of the seed oils isolated from the lines of A. thaliana transformed with a constitutively expressed antisense PDHK construct compared to the seed oil "of plasmid-only transformants (pBI121) and controls no The construction of antisense PDHK affects a very close point in the pathway of fatty acid biosynthesis / lipid biomontage, that is, it allows a greater availability of portions of acetyl for the plastidial biosynthesis of fatty acids. While the total flux of carbon through the lipid pathway in the storage lipids was improved in the seeds of the transgenic PDHK antisense plants, the fatty acid composition of the oils that accumulated was not changed in a marked manner. (Table 2).

P872 Table 2 Acyl composition of non-transformed control oils and seeds (Control n-WT) and T2 seed of transgenic control plants of pBI121 (Control pBI121) and of PDHK antisense (YA5 A / S) * í SD (n = 2) P872 Analysis of the Flowering Times of Transgenic Control Plants of pBI121 and PDHK Antisense of A. thaliana The transgenic plants of PDHK antisense exhibited a significantly early transition from the vegetative phase to the generative phase of growth, that is, early initiation of the generative phase (flower formation) (recorded at time inspection, such as days after planting: dap) compared to controls of plasmid only pBI121 and non-transformed wild type. As shown in Figure 11, 30-50% of the transgenics of PDHK antisense were blooming from day 31 a.p. compared to only 1-4% in controls. This phenotype of early flowering was even more dramatic at 34 a.D. when 50-75% of the PDHK antisense plants were in the generative phase compared to only 4-8% of the control plants. Most of the antisense PDHK plants were fully flowering (90% or more floral initiation) by 39 AD, but the untransformed control plants and control plants of a single pBI121 plasmid did not reach that stage until 46 AD. The time to reach maturity was also shorter in the A. thaliana transgenics of PDHK antisense. For example, at 68 days after planting, all transgenic PDHK antisense lines had completely developed siliques and more than half of them were golden and mature. The few flowers that remained were aging by then. In contrast, non-transformed wild-type control plants and pBI121 control transformants still had a significant flower development, mainly siliques and mature greens and only a few siliques that were golden and mature at this time. Under the growth conditions used by the inventors, the difference in maturity time was approximately 68-70 for the transgenic PDHK antisense lines, compared with approximately 75-77 days for the control plants. Since the generation time in the Arabidopsis control plants is approximately 75 days under the growth conditions used by the inventors, an early flowering of 5 to 8 days and an early maturing phenotype in the plants of PDHK antisense represents a shortening of the generation type of approximately 10%. The similar modification of the flowering time to extend the geographical range of culture is an important objective for Brassi ca crops (Lagercrantz et al., 1996). In related Brassicaceae (for example, Cañóla), this would allow the advantage of an early harvest (for example, the Canadian prairies) and would allow a more northern crop (Murphy and Scarth, 1994). Frost damage in late season and temperate climates could be prevented by early maturation, and this could also significantly solve the problems associated with chlorophyll cleanup in the late season of maturing seeds (which can lead to "green oil" during processing and needs expensive bleaching steps). Our data show that increased respiration can accelerate the transition from the vegetative phase to the generative phase of plant growth. It is of interest to note that the opposite effect, that is, a delay in flowering time, was observed in transgenic plants in which citrate synthase was regulated in a lentifying manner by antisense technology, which resulted in a decreased rate of respiration in vegetative tissues (Landschütze et al., 1995). This 'way, you can accelerate the flowering time by increased respiration and decrease by reduced respiration.

P872 Vegetative Growth Analysis of PDHK Antisense and Control Plants of pBI121 of A. thaliana The early flowering phenotype of the antisense PDHK transgenics was correlated with an altered pattern of vegetative growth. There was a reduced accumulation of vegetative shoot tissue mass (Figure 12) correlated with a reduced number of rosette leaves produced in the transgenic PDHK antisense by the time plants changed to the generative (flower initiation) growth phase (Figure 13). ). To summarize, A. thaliana lines transformed with a constitutively expressed antisense PDHK construct (designated as YA5 lines) exhibit both altered vegetative growth and early flowering phenotypes, compared to controls or transformants or transformants containing only the marker gene selectable (transformed with pBI121), but without PDHK antisense. The difference with respect to the altered vegetative growth pattern phenotype of the antisense PDHK transgenic (YA5) (small plants with few rosette leaves "compared to n-WT and pBI121 controls) were clearly visible at approximately 3.5 weeks P872 after planting, and even more obviously about one week later (30-31 days after planting). About 31 days after planting, the early flowering phenotype was also apparent in the transgenic PDHK lines antisense of YA5. Many of the plants that began to drop or show initiation of visible floral myristeme (flower bud), while there was no evidence of development in the controls of n-WT and pBI121. At 40 to 42 days after planting, the early flowering phenotype of the YH5 antisense PDHK transgenic lines was very apparent, with most or all of the transgenics showing completely open flowers, while the n-WT and pBI121 controls They showed a much lower frequency of bud buds. While the flowering time and generation time were shortened in the lines of YA5, the average number of siliques, weight of the seeds contained in oil, was not adversely affected. In contrast, as shown in Table 1 and Figure 10, both the weight and average of the seed and the content of fatty acid / oil with seed were improved in the YA5 lines.

EXPERIMENTAL PROCEDURES General General Biology Techniques: Isolation of plasmid DNA, restriction digests, DNA modification and ligation, PCR, agarose and polyacrylamide gel electrophoresis, culture transformation of E. coli strains, gel transfer analysis DNA (Southern, 1975) and DNA gel transfer analysis, were carried out according to normal procedures as summarized by Sambrook et al., (1989).

Cloning of YA5: The cDNA expression library of Arabidopsis thaliana-YES (ecotype Columbia) (Elledge et al., 1991) was obtained from Dr. Ronald Davis (Dept. of Biochemistry, Stanford University School of Medicine, Stanford CA 94305). Plasmids were generated by automatic subcloning procedures as described by Elledge et al., (1991). A mutant of putative Escherichia coli smooth-phosphatidic acid-acyltransferase (LPAT, EC 2.3.1.51) JC201 (Coleman 1990) was obtained from Dr. Jack Coleman (Dept. of Biochemistry and Molecular Biology, Louisiana State University Medical Center, New Orleans, LA 70112). JC201 was transformed with the plasmids generated from the library P872 from? YES, and was selected at the non-mandatory temperature of 44 ° C (Coleman, 1992). The YA5 cDNA of the temperature-insensitive transformants was sequenced in a model 373A DNA sequencing system from Applied Biosystems using the Cycle sequencing kit of Taq DyeDeoxy Terminator (Applied Biosystems, Inc.). The nucleotide and deduced amino acid sequences of clone YA5 were compared with sequences available in the data banks using the FASTA program (Pearson Lipman, 1988).

Protein Expression of YA5 in E. coli The full length cDNA of YA5 (YA5F) was cloned into pBluescript SK (+/-) in a 5 'to 3' orientation of T7-T3. A primer spanning the putative Ompdk transduction initiation site (AGGAGAGACTCGAGGCTTATGGCAGTGAAG) [SEQ ID No. 6] was synthesized to include an XhoI restriction site. The Ompdk primer and a T3 primer were used in a PCR reaction to amplify the coding region of YA5F The resulting PCR fragment was digested with HindIII (HindIII site is present in 3 'at the terminator codon) and Xhol, and cloned into the vector pTrcHisB (Clontech) to generate the construction pZTa5. Analysis by SDS-PAGE with lysates of E. coli induced P872 with IPTG containing pZTa5 and the control vector pTrcHisB confirmed that a new protein of approximately 45 kDA was synthesized.

Protein-Kinase Assay with the E. coli Lysate Express YA5: The protein kinase activity of the YA5 protein expressed by E. coli was evaluated in essentially the same way as described (Liu et al., 1995). Protein phosphorylation substrates, subunits of human PDC Ela and Elß, co-expressed and purified from E. coli M15, were obtained from Dr. Mulchand, S. Patel from the Department of Biochemistry, School of Medicine and Biomedical Sciences, State University of New York in Buffalo, Buffalo, New York.

This system of Ela and Elß co-expressed has been used extensively in the study of the regulation of the phosphorylation of one of PDC E in mammalian systems (Korotchkina and Patel, 1995). For the phosphorylation experiments, 20-25 μg of Exa / ß were combined with approximately 10 μg of cytosol protein from E. coli accumulating YA5, in a final volume of 100 μl containing potassium phosphate 20 in mM, pH 7.0 , chloride P872 1 mM magnesium, 2 mM dithiothreitol, 0. mM EDTA and 200 μM cold ATP. The mixture was pre-incubated at room temperature for 5 minutes, and then 5 μCi .32P-7-ATP was added to start the assay. At 2, 5, 10, 15 and 20 minutes after the start of the assay, 20 μl of aliquots of the denaturation mixture of the reaction. The samples were then separated on 10% SDS-PAGE and radiographed to reveal the labeled proteins.

Construction of the YA5 Antisense Plant Transformation Vector for Constitutive Expression: The YA5 cDNA contains the internal restriction sites BamHI (nt 628) and Ncol (ntll76). The BamHI and Ncol fragment was free of YA5F and cloned into the respective sites in pBI524 (Datla et al., 1993), in an antisense orientation, under the control of a tandem 35S promoter. The antisense cartridge of YA5 was then excised from pBI524 by _HindIII and EcoRI, and plant transformation vector pRD400 was cloned into it (Datla et al., 1992).

Construction of YA5 Antisense Plant Transformation Vectors and Partial Homosense for the P872 Seed-specific Expression The full length cDNA of YA5 (YA5F, 1.5 kb) was cloned into the plasmid of pBluescript SK (+/-) (Stratagene) in a 5 'to 3' orientation of T7-T3. A fragment of 857 bp was excised by an excision with BamHI (Pharmacia) and ligated into the pDH1 plasmid that has not been previously cut with BamHI and dephosphorylated (treated with 1/10 units of calf intestine alkaline phosphatase for 1 hour at 37 ° C). Plasmid pDH1 (provided by Dr P. Covello, PBI / NRC) is the PE35SNT plasmid which has been manipulated so that the constitutive tandem 35S promoter has been excised and replaced with the seed-specific napita promoter, obtained of the pUC19 plasmid. Ligations were performed at 4-12 ° C overnight in a water bath, following the instructions provided by the manufacturer. Competent E. coli cells (DH5a, Gibco BRL) were transformed by a heat shock method, with 50-100 g of transformation DNA, plated on a selective medium (LBG with 50 μg / ml ampicillin) and they were incubated overnight at 37 ° C. Plasmid pBluescript DNA (10 ng) was used with a positive control for transformation Single transformed cells (37 ° C, 225 rpm) in 5 ml of culture were grown overnight.

P872 LB with 50 μg / mL of ampicillin. DNA extraction and purification was performed with a Qiaprep Spin Miniprep (Qiagen) team. Restriction digestions were performed with HindIII to verify the presence and orientation of the inserts in the plasmid. In the case of the YA5 insert in an antisense orientation, two fragments of approximately 1.0 and 1.4 kb were obtained, while an insert of YA5 in a homosense orientation gave two fragments of approximately 1.8 and 0.6 Kb. The cartridge and the insert (in either homosense or antisense orientation) was excised by a partial double decision with HindIII and EcoRI (1 unit / 20 μL reaction for 10 minutes at 37 ° C). The DNA fragments corresponding to the cartridge with either the homosense or antisense insert were purified from the agarose gel using a Geneclean II kit (Blo 101, Inc.) and ligated to the plasmid pRD400 digested with HindIII / EcoRI. The best ligation results were obtained with a ratio of plasmid and insert 1:10 in a reaction volume of 10 μL, using 1 μL of T4-ligase and buffer (New England Biolabs) at 4 ° C overnight. The reaction mixture was heated at 45 ° C for 5 minutes and cooled with ice before the addition of the ligase. The next day, 1 μL of T4-ligase was added and the mixture was left to P872 room temperature for 3-4 additional hours. The identity of each construction was re-verified by digestion and DNA sequencing before the transformation of the plant.

Transformation of Arabidopsis thaliana: The transformation protocol was adapted from that described by Bechtold et al., (1993). The plants of Columbia ecotype of Arabidopsis thaliana were cultivated in humid soil at a density of 10-12 plants per pot, in 4 square inch pots, and covered with a nylon screen fixed in place with an elastic band. Once the bands reached the top on which the buttons began to emerge, the plants became wet, the buttons, and some of the leaves were cut off, and the plants were infiltrated into Agrobacterium suspension as summarized above. To culture the Agrobacterium, a suspension of 25 μL was grown in LB medium containing kanamycin at a concentration of 50 μg / mL, two to three days in advance. The day before the infiltration, this "seed culture" was added to 400 mL of the LB medium that contains 50 μg / mL of kanamycin. Once _absorbance at 600 nm was > 2.0, the cells are P872 collected by centrifugation (5,000 xg, 10 min in a GSA rotor at room temperature) and redispersed in volumes of the infiltration medium (1/2 x Murashige and Skoog salts, vitamins 1 x B5, 5% sucrose, benzylaminopurine 0.044 μM) at an optical density at 600 nm of 0.8. The Agrobacterium suspension was then poured into a beaker and the potted plants were placed in the beaker so that the buttons and the complete rosettes were submerged. The beaker was then placed in a large glass bell and a vacuum was created using a vacuum pump, until bubbles formed on the leaf and stem surfaces, and the solution began to bubble a little, and then it was freed. quickly emptiness. [Note: The necessary time and pressure will vary from one laboratory setting to the next, but good infiltration is apparently visible as tissue soaked with water, evenly moistened]. The pots were removed from the beaker, placed on their side in a plastic tray and covered with a plastic dome, to keep the unit. The next day, the plants escaped, stood and were allowed to grow for approximately four weeks in a culture chamber under continuous light conditions as described by Katavic et al., (1995). When the siliques were mature and dry, the seeds were collected and directed for the positive transformants.

Selection of Putative Transformants (Transgenic Plants) and Growth and Analysis of Transgenic Plants: Seeds collected from the vacuum infiltration transformation experiments were sterilized by treating for 1 minute in ethanol and then 5 minutes in 50% bleach / O .05 % Tween 20MR in distilled water, sterile. Then the seeds were rinsed several times with distilled, sterile water. The seeds were plaque redispersed in 0.1% agarose, sterile, at room temperature (approximately 1 mL of agarose per 500-1000 seeds), and then applying a volume equivalent to approximately 2,000-4,000 seeds in selection plates. 150 x 15 mm (1/2 for Murashige and Skoog salts, 0.8% agar, autoclave, cool and add 1 X vitamins B5 and kanamycin to a final concentration of 50 μg / mL). The plates were dried in a laminar flow hood until the seed did not bloom longer when the plates were tilted. The plates were then veneered for two nights at 4 ° C in the P872 dark, and then moved to a culture chamber (conditions as described by Katavic et al., 1995). After 7-10 days, the transformants were completely identifiable as dark green plants with green, healthy secondary leaves and roots that extended over and to the selective medium. The saplings were transplanted to the soil, the plants were grown to maturity and the mature seeds (generation T2 as defined in Katavic et al., 1994) were collected and analyzed. The seeds T2 were propagated. The vegetative growth patterns were inspected by measuring the dry weights of the root tissue, and / or by counting the number of rosette leaves present by the time plants beginning to enter the generative stage (flower initiation). The floral initiation (beginning of the generative phase of growth) was analyzed by recording, on a daily basis, the percentage of plants in which a flower bud appeared first and / or the percentage of plants that were with buds ( as described by Zhang et al., 1997). Data are reported in terms of the percentage of flowering plants / buds on a given day after planting (d.a.p.).

Preparation of Mitochondria of Antigenic Transgenic Plants P872 YA5 and Untransformed Control of A. thaliana All extractions were carried out at 4 ° C. A mitochondrial fraction enriched by a modified source from Ap Rees et al., (1993) was prepared. Approximately 30 g of freshly harvested shoots were homogenized using a Waring Bleder cooled in 4 volumes of extraction buffer (50 mM Tris-HCl, pH 8.0, containing 300 mM mannitol, 5 mM EDTA, 0.1% bovine serum albumin, 1% PVPP (polyvinylpolypyrrolidone) and 9 mM 2-mercaptoethanol The homogenate was filtered through four layers of cheesecloth and a Miracloth layer and centrifuged at 2,000 xg for 10 minutes.The pellet was discarded and the supernatant was centrifuged at 10,000 xg for 30 minutes.The pellet was redispersed in extraction buffer minus PVPP and used as an "enriched" mitochondrial preparation.For measurements of succinate dehydrogenase activity, this preparation was used directly For measurements of PDC, fumarase and "citrate-synthase, the newly prepared mitochondria were first smoothed in the presence of 0.1% Triton X-100 (v / v) to release the mitochondrial enzymes. tón was clarified by centrifugation at 27,000 x g and the supernatant, which contains the solubilized enzymes, was concentrated with a P872 Centricon-30 filter (Amicon). The concentrated result was used as the enzyme source in a PDC assay. Protein conditions were estimated by the method of Bradford (1976) using bovine serum albumin as a standard and normalized before testing.

Piruvate-Dehydrogenase Complex Assay: The method used to determine the activity of the pyruvate-dehydrogenase complex (PDH) present in the mitochondrial protein preparations was modified from the method of Reid et al., (1977). The assay mixture consisted of 0.1 mM TPP, 5 mM MgCl2, 1.5 mM NAD +, 0.1 mM, 3.0 mM, 3.0 mM Cysteine-HC, and 1.5 mM pyruvate in 100 mM Tricine, pH 8.0, in a final volume of 2 mL. The reactions were initiated by the addition of mitochondrial lysate concentrate. The control reactions contained all components except pyruvate. The reaction mixture was incubated at 30 ° C and the formation of NADH was inspected at a wavelength of 340 nm at 15 second intervals for 3 minutes, using a Beckman DU 74 spectrophotometer.

Citrate-Synthase Assay: The method used to measure the citrate synthase activity present in mitochondrial protein preparations was modified by the method of Srere (1969). The reaction mixture contained 0.2 mM 5 ', 5' -dithiobis-2-nitrobenzoic acid (DTNB), 0.1 mM acetyl-CoA, and mitochondrial lysate protein, in 50 mM Tris-HCl, pH 7.8, in a reaction volume end of 2 mL, incubated at 30 ° C. The absorption at 412 nm is followed for 3 minutes to measure possible activity of acetyl-CoA deacylase. The citrate synthase reaction was then initiated by the addition of 0.5 mM oxaloacetate (OAA), and the release of Coenzyme A (CoASH), the SH group from which it reacts with the DTNB (Ellman Reagent), was inspected at 412 nm. The resulting mercaptide ion had a strong absorption (E = 13,600) at 412 nm. Control reactions contained all components except OAA.

Fumarase Assay: The fumarase activity present in mitochondrial protein preparations was assessed by the method of Hill and Bradshaw (1969). The reaction mixture contained sodium malate at 25 mM and the mitochondrial lysate protein in 50 mM sodium buffer, pH 7.5, in a final reaction volume of 1 mL. The reactions were incubated at 28 ° C. the activity of fumarase, measured by P872 fumarate formation was determined spectrophotometrically by inspecting the increase in absorbance at 250 mM, at 15 second intervals for two minutes.

Succinate-Dehydrogenase Assay: The activity of mitochondrial succinate dehydrogenase was measured using the method of Veeger et al., (1969). The reaction mixture contained almost 1 mM, 40 mM succinate, 1 mM EDTA, 0.1% BSA, K3 Fe (CH) 6 3 Mm, 0.1% Triton X-100, and non-lysed mitochondria in sodium phosphate buffer in 100 mM at pH 7.5, in a final reaction volume of 1 MI. The reaction mixtures were incubated at 28 ° C. The reaction was initiated by the addition of the mitochondria of the oxygen-free phosphate buffer. The change in absorbance at 455 mM was inspected spectrophotometrically at 20 second intervals for 2 minutes. Control reactions contained all components except succinate.

Lipid Analysis of the Controls Seeds Transformations of A. thaliana and Transgenics of PDHK Antisense (AsYA5): Mature siliques and seeds were isolated P872 T2 or T3 of the antisense PDHK transformants (designated as YA5 lines) or the control transformants of pBI121 (without PDHK antisense, but with a kanamycin resistance gene) and the siliques and seeds were also isolated from the control plants non-transformed wild type and their respective contents of seed oil, fatty acyl compositions of the seed oils, average seed weights, number of siliques per 15 cm segment of stem with button and number of seeds per siliques were determined as described by Zou et al., (1997). All the plants were cultivated in the same culture chamber, at the same time and under identical light and temperature regimes, as previously described (Katavic et al., 1995; Zou et al., 1997). Due to the extremely small size and weight of the seeds, analyzes were performed on replicates of 100 to 400 seeds that were carefully counted under a dissecting microscope. Seed samples were seeded using a polytropron in chloroform: isopropanol (2: 1), [v / v] containing 0.2% v / v butylated hydroxytoluene and tripentadecanoin as the internal standard. The other conditions for isolation and analysis of the total fatty acid content of the seeds and the fatty acid composition (expressed as% by weight of fatty acids Total P872) by gas chromatography were performed as detailed previously (Taylor et al., 1992b, Taylor et al., 1995, Katavic et al., 1995, Zou et al., 1997). The oil content was dispersed either as μg of total fatty acids per sample size (see Figure 10), or as mg per sample size (see Table 1), calculated by assuming _ 3 moles of fatty acid per mole of triacylglycerol (oil), as described by Zou et al. , (1997).

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: (A) NAME: National Research Council of Canada (B) STREET: 1200 Montreal Road (C) CITY: Ottawa (D) STATE: Ontario (E) COUNTRY: Canada "(F) POSTAL CODE (ZIP): KlA 0R6 (ii) TITLE OF THE INVENTION: Pyruvate-dehydrogenase-kinase plant gene (iii) NUMBER OF SEQUENCES: 9 (iv) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: compatible with IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: Patentln Reléase # 1.0, Version # 1.30 (EPO) (v) CURRENT APPLICATION INFORMATION: (A) APPLICATION NUMBER: WO PCT / CA98 / - (vi) DATA FROM THE PREVIOUS APPLICATION: (A) APPLICATION NUMBER: US 60 / 038,815 (B) DATE OF SUBMISSION: 10 -FEB-1997 2) INFORMATION FOR SEQ ID NO: l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1457 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Arabidopsis thaliana (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 1: TCCATCTGCO C? CTTCTTTC GTCCJWSTOGA TQA? FtATAAC GßTßßAGAAC GACGGAGGCG 60 GOCG? CGTTA QGQTTTCTAA. TCATTTCTCT CTCTTASA © CTTATßGCAS TGAftQAAAOC 120 CTßCGAAATG TTCC03AA3A GTTTGATCGA AGATOTTCAC AAATGßßGTT GCATGARSCA ISO AACCOaTOTT ftBCCTTABAT A < -MGATGGA GTTTGGTTCC AM-CCTACTO ATAQEftATCT 240 TTTGATTTCT GCTCAGTGTT TßCATAAOGA GCTTCCGATT CGCGTCGCCA, SGASafiCSAT 300 csAACTCCAß A8C? TCCTT ATGGTCTCTC TGATARACCT ßccß? TTGA ABGTGCGGGA seo TTGGTATTTG GAATCTTTCA GGGACATGAG AGCAT? TCCT GAGATTAAGG ATTCGGGTGA 420 CGAGftaAGAT TrcACTCAßA T6ATTAA13GC TGTCA? AGTA AGGCATAACA ATGTGfflrTCC 48o CATGATSGCT? TGGGTGTT? ATCASCTCAA ßftAABGRMG AATTCTGGAA A? CTTGRTGA 540 CATTCATCAG TTTCTTOATC GTTTCTACTT QTCGCGAATC OGGATCOGGA TGC? TATTGG «BO GCAGCA03TT GAGTTGCATA ATCCAAATCC ACCGCTTCAT ACftGTßGGTT AT2VTACACAC $ 60 AAAßATGTCT CCTATOOAGG TA3CAAGsAA TGCAAGTOW. GAMCT S3GT CAATTTQTTT 720 CCGAGASTAC GßTTCTGCAd CGGAAATAAA CATATATGßC GATOCCAGTT TCACCTTTCC 780 GTATGTTCCA A8CATTTGG ATCTTATÍJAT GTATGAG TA GTC * AOAACT CTCTACGTGC B40 TGTCCAAßAa CGATTtßTTß ACTCTGATAG AOTTOCACC ». CCftATCCßCA TTWTAßTTGC 900 T? ATQCuy: GAAtSAtO TA CTKXAAAQOT CTCRGATBW. OßTTß & QGTA TACSCAAGAAQ 9S0 CGGTCMCCC AGAATATTCA CCTATCTTTA CAGCACTGCA AaAAACCCGC TTGAtSßAGßA 1020 TGTCGMraTTA GßAATAflC? A ATGTTCCCGß GACTATGßßT GGATATGGTT ATGGTCrTCC 10B0 AATTAßTCGC TTGTAtraCTC G? TATTTCCG TGGAGATT C3 CAGATCATAT CCATGGMJGS 1140 ATA? CjKJGACT GATQCATACT TGCACTTQTC TOSCCTTBGA GATTCGCAA3 AßCCTTTAOC 1200 CTßAQAACAT CTCTATGTCA GßCAAAGTAft AGARABCTTI GACATQTATT TATGGTASAT 12 SO GAGGGATATC TACAATACTC AATTATTTAT GCTXTTCCAG WTCTGCTAA «3T? C3WSACT 1320 - ACAG CATTA TT? TCTCGTA TTACGCTTTC T «-ATTT? AG ACTCRSATAT ßSAGCTTTTT 1380 CCAAGTGAQT X &ATCTCCTA T IATTTGT TGGTTCC-WC CAMACCAOC? T? TA? OT? A 1440 AftAAAA? AAA AAAAAAA 1457 ) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 366 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Arabidopsis thaliana (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 2; Mac to val Ly * Lys Ala cya Gl * t Phe £ > ro Lys Sor Leu lia au 1 S 1 1S Asp Val His Lys Trp Gly Cys Met and s Gln Thr Gly Val Ser Leu Arg 20 ZS 30 Tyr H «t HBt Glu Ph * Gly Se L a Po r Glu g Aan Leu Leu Z tt 35 ßd 45 Ser Ala. Gln Phß Leu His Lya Glu Leu Pr © Ha Arg Val Wing Arg Arg SO 55 60 the He Glu Leu Gln Thr Leu Pro Tyr Gly Leu Ser Aap Lys pro Wing is 70? S ga Val Leu Lys Val Arg Aap Trp Tyr Leu ßlu Ser P? -ß Arg Asp Mee Arg 85 90 35 Wing Phe Prß ßlu tle Lys Aap Ser ßly Asp Glu Lya Aap Phe Thr Gln 100 105 110 Kst He Lya Wing Val Lyß Val Arg Hiß Aan Asn Val Val Pro Met Kst US 120 125 Wing. Leu Gly val Aßp eln IAU Lys Lya Gly Met Aan be Gly SA Leu 130 13S 140 Asp Glu X ß KÍB Gln Phe Leu Aßp Arg Phe Tyr Leu Ser Arg Xle ßly 14S 150 155 160 He Arg Mee Leu He ßly Gln Hiß Val Su Leu His Aan. P or Asn to 155 170 175 Pro Leu Hi »Mee ßlu Val Ala ñrg Asa Wing Se Glu Aap, Al * Arg Ser He Cy * Ph * Arg Glu 15 * 5 200 205 Tyr Gly Ser Ale Pro slu He Aßn He Tyr Gly Aep Pro Ser Phe Thr 210 SIS 220 Phe Pro Tyr Val Pro Thr HiS Leu Asp t < fcU Met HeC Tr ßlu Leu Val 225 230 Z3S Z10 Lys Asn be Leu Arg Wing Val Gla Glu Arg Phe val Asp be Asp Arg Z4S 250 255 Val Wing Pro Pro He Arg He He Val Wing Aap Gly He Glu Asp Val 260 2SS 270 Thr He Lya Val Ser Aep Glu Gly Gly Gly He Wing Arg Ser Gly Leu 275 260 285 Pro Arg He Phe Thr Tyr Leu Tyr Ser Thr Ala Arg Asn Pro Leu Glu 290 29S 300 Glu Asp al Aap Lew Gly He Ala Aap Val Pro Gly Thr Het ßly Gly 303 310 315 320 Tyr ßly and Tyr Sly Leu Pro? Le Ser Ara Leu Tyr Wing Arg Tyr Phe Gly 325 330 33S ßly Aap Leu Sin Ha? Le Ser Met ßlu Sly Tyr Gly Thr Aap Wing Tyr 340 34S 3S0 Leu His Leu Ser Arg Leu Gly Aap Ser Gln ßlu Pro MU Pro 355 360 36S ) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 405 amino acids (B) TYPE: amino acids 72 (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGINAL SOURCE: (A) ORGANISM: Subunit I of PDH Kinase Swine (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 3: P872 Met Arg rp Phe Arg Ala Leu Leu Lys Asn Ala Ser Leu Al * Gly Ala 1 5 10 15 Pro Lys Tyr He ßlu Kie Phe Ser Lyß Pha Ser Pro Ser Prß Leu Ser 20 25 30 Met Lys G n Phe Leu Aap Phe Gly Ser Ser Aan As Cyß Glu Lya Thr 35 40 45 Sor Phe Thr Phe Leu Arg Gln ßlu Leu Pro Val Arg Leu Wing Asn X to SQ 55 60 Met Lya Glu He Asn Leu Leu Pro sp Arg Val Leu Ser Thr Pro Ser SS 7 < TS SO Val Gln Leu Val Gln Ser Trp Tyr Val Gln Ser Leu Leu Asp He Met 95 90 95 Glu Phe Leu Asp Lys Aap Pro Glu Asp Hiß rg Thr Leu Ser Gn Ph * 100 IOS 110 Thr Aßp Ala Leu Val Thr He Arg Aap Arg Hiß Asn Asn Val Val Pro lis 120 12S Thr Het Wing Gln Gly Val Leu GYu Tyr and Aap Thr Tyr Gly Aap Asp 130 135 HO Pro Val Ser? Sn Without Asn He Gln Tyr Phe Leu Asp Arg Phe Tyr Leu 145 ISO 155 160 Ser Ag He S & t? Sp ßly be Thr Aßn Pro Wing Hiß Pro tya Hiß Gly Ser He Asp Pro Aßh líff 185 190 P o sn Cy »Sar val Ser Aap Val Val Lys Asp Wing Tyr Aap Met Wing US 200 205 Lyo Leu Leu Cya Aap byß Tyr Tyr Mat Ala Ser Pro Asp Leu Glu He 210 21S 220 Oln ßlu Val Aan Wing Thr Aan Wing Thr 01 »Pro X e Hiß Me Val Tyr 235 230 235 240 Val Pro Ser His Leu Tyr Hie Het Leu Phe ßlu Leu File Lyß Aso Wing 245 2S0 255 Met Arg Ala Thr Val Glu Ser Hiu ßlu Ser Ser L u Thr Leu Pro Pro 2S0 2C5 30 He Ly »He Met Val Ala Leu Oly Glu Glu Aßp Leu Ser He Lys Mae 27 $ 230 2_S Ser Aap Arg ßly and Gly Val Val Leu Arg Lys He ßlu Arg Leu Phe 290 Z? S 300 Ser Tyr Met Tyr Ser Thr Wing Pro Thr Pro Gln Pro Gly Thr Gly Gly 30 $ 3X0 31S 320 Thr Pro Leu Wing Oly Phe Gly Tyr ßly Leu Jiro TI * Ser? Rg Leu T 325 330 335 Wing Lys Tyr Phe Gn Gly Asp Leu Gn Leu Phe Ser Mee ßlu Gly Pha 340 34S 350 Gly Thr Aap Wing Wing Tyr Leu Lyß Wing Leu be Thr Aap Sar val 335 3S0 3C5 Glu Arg Leu Pro Val Tyr Asn Lya Ser Ala Tro Arg Bis Tyr ßln Thr 37 < 375 380 XI * Gln Glu Wing Gly Asp Trp Cys Val pro Ser Thr Slu Pro Lys Aßn 3ßS 390 39S 400 Thr Tyr Arg Val Ser 40S 2) INFORMATION FOR SEQ ID NO: 4: _ (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 434 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGINAL SOURCE: (A) ORGANIZATION: Subunit II of PDH Cinasa porcxna P872 (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 4 Mee rg Leu Wing Arg Leu Leu Arg Gly Gly Thr Ser Val Arg Pro Leu 1 S 10 1S Cy * Wing val Pro Cys Wing Ser Arg e Leu Wing Ser Aap Ser Wing Sex 20 2S 30 Gly Ser Gly Pro Wing Ser Glu Ser Gly Val Pro Gly Gln Val Asp Phe 35 40 4S Tyr Wing Arg Phe Ser Pro Pro Leu Ser Met Lyß Gl »Phe Leu Aap SO 55 60 Phe Gly Sex Val Asn Wing Cys Glu Lya Thr Ser Phe Met Phe Leu Arg is 70 75 80 Gln Glu Leu Po Val Arg Leu Wing Asa He Met Lys Glu He Sar Leu SS 90 SS Leu Pro Asp Even Leu eu Arg Thr Pro Ser Val Oln L * u Val Gla Ser 100 105 lio Trp Tyr He G n Ser Leu Gln Glu Leu Leu Aßp Phe Lyß Aap Lya Ser 115 120 125 Wing Glu Asp Wing Lys Thr He Tyr ßlu Phe Thr Aap Thr Val II * Arg 130 135 140 He Arg Asn Arg Bla Aan Asp Val He eo Thr Het Wing ßln Gly Val 145 150 155 160 Asp Glu Tyr Lyß Glu Be Phe ßly Ser Aap Pro Val Thr Ser Gn Handle 165 170 175 Val < 51n Tyr Phe Leu Asp Arg Phe Tyr Met Ser Arg He Ser He Arg 180 165 1S0 Mee Leu Leu Asn ßln His Ser Leu Leu Phe Gly Gl? Lys GLy Ser Pro 195 200 205 Ser Hia Arg Ly »Hia He ßly Ser He Aan Pro Aßn Cys Asp Val Val 210 215 220 Glu Val II * Lys Aßp Gly Tyr Glu Asn Wing Arg Arg Leu Oye Aßp Leu 223 230 235 240 Tyr Tyr Val Asn Sex Pro Glu Leu Glu L * tt ßlu Glu Leu Aan Wing Lys 245 250 255 Ser Pro Gly Ola Pro He Gln Val Val Tyr Val Pro Ser H ± s Leu Tyr 260 26S 270 is Met Val Phe Glu Leu Phß Lys Aan Ala Mat Arg -Ala Thr Met Glu 275 280 28 $ iB His Ala Asp Lyß ßly and Val Tyr Pro Pro Ha Gl «V» l Hi «Val Thr 290 295 300 Lsu Gly Glu alu Aßp eu Thr Val Lys Met Ser? Sp Arg? Ly and ßly ßly 305 310 315 320 val Pro Leu Arg Lys He Asp? Rg Lsu Phe Aen Tyr Met Tyr Ser Thr 325 330 33S Ala Pro Arg Pro Arg al Glu Thr Ser? Rg Ala Val Pro Leu Ala ßly '34 ú- '34S seo Phe ßly and Tyr Gly Leu Pro He S «r Arg Leu Tyr Ala Gln Tyr Pha ßln 3 £ = JS0 365 Gly Aßp Leu Lya Leu Tyr Ser Leu Glu Gly Tyr Gly Thr Asp Ala Val 370 375 350 He Tyr Ha Lys Ala Leu Ser Thr Glu Ser He Glu Arg Leu Pro Val 33S 3S0 395 400 Tyx- Asn U «Ala Ala Trp lya and Hia Tyr Arg Thr Asn Kis Glu Ala Asp 405 410 415 Aap Trp Cys Pro Pro Arg Glu Pro Lya Asp Met Thr Thr Phe Arg 42tf < S2S 450 Being ATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 412 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGINAL SOURCE: (A) ORGANISM: alpha-ketoacid dehydrogenase-branched-chain kinase, porcine (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 5: Met: He Leu Thr Ser Val Leu Gly Ser Gly Pro Arg Ser Gly 6 * r Ser 1 5 10 I = Leu Trp Pro Leu Leu Gly Ser Ser Leu Ser Leu Arg Val Arg Ser Thr 20 25 30 Ser Ala Thr Aep Thr Hia Hiß Val Glu Leu Wing Arg Glu Arg Ser Lyß 3 $ 40 45 Thr Val Thr Ser Phe Tyr Aßa Gla be Ala He Asp Val Val Ala Glu so 55 is Lys Pro Ser Val Arg Leu Tbr Sro Thr Mat M * t Leu Tyr Ser ßly Arg 6S 70 TS SO Ser ßln Asp Gly Ser Sis Leu Leu Lys Ser Gly Arg Tyr L * u ßla Ola as so ss ßlu Lau Pro goes Axg and Ala His Ar? He Lyß ßly Phe val Val Phe 100 105 110 Leu Ser S v Leu Val Wing Thr Leu Pro Tyr Cys Thr Val Hiß Glu Leu 115 120 12S Tyr He Arg Wing Phe ßln Lya Leu Thr A? P Phe Pro Pro He Ly? Aap 130 135 140 Gln Ala Asp ßlu Ala ßla Tyr Cys Gln Leu Val Arg Sn Leu Leu? Sp 145 SO 1SS £ 60 Asp Hia Lys A? P Val Val Thr Leu Leu Wing Glu Gly Leu Aeg Glu Ser 165 170 175 Arg Lys Hiß He ßlu Asp Glu Lya Leu Val Arg Tyr Phe Leu Asp Lya ISO 1SS 190 P872 Thr Leu Thr Ser Arg Leu Gly Xle Axg Met Leu Wing Thr- Hiß H ± ß Leu 195 200 205 Wing Leu Hiß Glu Asp Lys Pro Asp phe Val Gly Xle Has Ser Thr Arg 210- 215 220 Leu Ser Pro Lys Lys Xle He slu Lys Trp Val Asp Pha Wing Arg Arg 225 230 755 40 Leu Cya Glu His Lyß Tyr ßly Aan Ala Pro Arg Val Arg He Asn Gly 245 250 25? Kis Val Wing Wing Arg Phe Pro Phe He Pro Met Pro Leu Asp Tyr Ha 260 2SS 270 Leu Pro Glu Leu Lyu Aßn Al * Mae Arg Wing Thr Mee Glu Ser Hiß 275 280 2B5 Leu Asp Thr Pro Tyr Asn Val Pro Asp Val Val He Thr He Ala Asa 290 295 300 Handle Asp Val Aßp Leu le Xle Arg X * Ser Asp Arg ßly ßly and Gly Xl * 305 310 3 5 32 Wing Hia Lys Aap Leu A? P Arg Val Met Asp Tyr His Phe Thr Thr Wing 335 330 335 ßlu Wing Ser Thr Gla Asp Pro Arg He Ser Pro L * U Pha Asp Hia Leu 340 34S 350 Aßp Thr Sis S * r Gly Gly Gln Sar Gly Pro Mee Ki * ßly Phe Gly Phe SSS 3G0 -tßa Gly Leu Pro Thr Ser Arg Ala Tyr Ala Glu Tyr Leu Gly Gly Ser Leu 370 375 3B0 Gln Leu Ola Ser Leu Gln Gly H * Gly Thr Aßp Val Leu His Axg Be 36? 390 SSS 400 Arg His He Asp ßly Arg ßlu ßlu Ser Pha Arg He 405 410 ) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear 72 (ii) TYPE OF MOLECULE: DNA (genomic: (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) DESCRIPTION FOR SEQUENCE: SEQ ID No: 6: AGGAGAGACT CGAGGCTTAT GGCAlGTßAAß 30 NFORMATION FOR SEQ ID NO: 7 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 5 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Arabidopsis thaliana (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 7 ßly Xaa Gly xaa Gly J. s 2) INFORMATION FOR SEQ ID NO: 8: 10 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 5 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple 15 (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO 20 'iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Arabidopsis thaliana Aap Xaa ßly Xa * ßly 1 6 (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No:) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 9 amino acids (B) TYPE: amino acids (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: peptide (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: internal (vi) ORIGINAL SOURCE: (A) ORGANISM: Arabidopsis thaliana (xi) DESCRIPTION FOR THE SEQUENCE: SEQ. ID No: 9: 72 Glu Leu Xaa Lys Asn Xaa Xaa Arg Ala l 5 RELEVANT REFERENCES FOR THE PRESENT INVENTION Ap Rees, T., Bryce, J. H., Wilson, P.M. and Green, J.H. (1983) Role and location of NAD malignant enzyme in thermogenic tissue of Araceae. Arch., Biochem. Biophys. 127: 511-521.

Bechtold, N., Ellis, J. and Pelletier, G. (1993) In plant Agrobacterium mediated gene transfer by Infiltration of adult Arabidopsis thaliana Plants. C.R. Acad. Sci. Ser. III Sci. Vie, 316: 1194-1199.

Becker, D. Brettschneider, R. And Lórz. H. (1994) Fertile transgenic wheat from microprojectile bombardment of scutellar tissue. Plant J. 5: 299-307.

Bradford, M.M. (1976;) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72; 248-254.

Buddle R.J.A., Fang, T.K. and Randall, D D. (1988) Regulation of the phosphorylation of mitochondrial pyruvate dehydrogenase complex in situ. Plant Physiol, 88: 1031-1036.

Coleman, J. (1090) Characterization of Escherichia coli cells deficient in l-acyl-sn-glycerol-3-phosphate acyltransferase activity. J. Biol. Chem. 256: 17215-17221.

Coleman, J. (1992) Characterization of the Escherichia coli gene to l-acyl-sn-glycerol-3-phosphate - acyltransferase (pise). Mol. Gen. Genet. 232: 295-303.

Damuni, Z. Merry field, M.L., Humphreys J.S. and Reed, L.j. (1984) PuriFication and properties of branched-chain a-ketoacid dehydrogenase phosphatase from bovine kidney. Proc. Nati Acad. Sci. USA 81: 4335-4338.

Datla, R.S.S., Hammerlindl, J.K., Panchuk, B., Pelcher, L.E. and Keller W.A. (1992) Modified binary plant transformation vectors with the wild-type gene encoding NPTII. Gene 211: 383-384.

Datla, R.S.S., Bekkaoui, F., Hammerlindl, J., Pílate, G., Dunstan, D.I. and Crosby, W.L. (1993) Improved high-level constitutive foreign gene expression in plants using an AMV RNA4 unstranslatec leader sequence. Plant Sci. 94; 139-149.

P872 Datla, R., Anderson, J.W. and Selvaraj, G. (1997) Plant promoters for transgene expressions. Biotechnology Annual Review 3: 269-296.

DeBlock, M., DeBrouwer, D. and Tanning P. (1989) Transformation of Brassica napus and Brassica oleracea using Agrobacterium, tumefaciens and the expression of the bar and neo genes in the transgenic "plants." Plant Physiol. 91: 694-701 .

De Lange, P., Van Blokland, R., Kooter, J.M. and Mol. J.M.N. (1985) Suppression of flavenoid flower pigmentation genes in Petunia hydrida by the introduction of antisense and sense germs. ' In: Gene Silencing in Higher Plants and Related Phenomena in .other Eukaryotes. P. Meyer (Ed.), Springer-Verlag, Berlin, pp. 55-75.

Elledge, S.J., Mulligan, J.T., Ramer, S.W., Spottswood, M. and Davis, R.W. (1991) YES: A multifunctional cDNA expression vector for the isolation of genes by complementation of yéast and Escherichia coli mutations. Proc. Nati Acad. Sci. USA, 88: 1731-1735.

Gale, J. (1974) Oxygen control of reproductive growth: Possible mediation via dark respiration. J. Exp. Bot. 25: 987-989.

Gemel, J. and Randall, D.D. (1992) Light regulation of leaf mitochondrial pyruvate dehydrogenase complex; Role of photorespiratory charcoal metabolism. Plant Physiol. 100: 908-914.

Goodman, H.M., Ecker, J.R. and Dean, C. (1995) The genome of Arabidopsis thaliana. Proc. Nati Acad. Sci. USA 92: 10831-10835.

Grof, C.P.L., Winning, B.M., Scaysbrook, T.P., Hill ,. S.A. and Leaver, C.J. (1995) Mitochondrial pyruvate dehydrogenase: Molecular cloning the Ela subunit and expression analysis. Plán Physiol. 108: 1623-1629.

Harris, R.A., Popov, K.M., Shimomura, Y., Zhao, Y., Jaskiewicz, J., Nanaumi, N. and Suzuki, M. (1992) Purification, characterization, regulation and molecular cloning of mitochondrial protein kinase. Adv. Enzyme Regul. 32: 257-284.

Hill, R.L. and Bradshaw, RA. (1969) Fumarase. In: Methods In Enzymolbgy. Vol. XIII, J.M. Lowenstein (Ed.), Academic Press, Ne "York, pp. 91-99.

P872 Hill, S.A., Grof, C.P.L., Bryce, J.H. and Leaver, C.J. (1992) Regulation of mitochondrial function and biogenesis in cucumber (Cucu is sativus L.) cotyledons during early seedling grown Plant Physiol 99: 60-66.

Hitz, WD, Mauvis, CJ, Ripp, KG, Reiter, RJ, DeBonte, L. and Chen, Z. (1995) The use of cloned rapeseed genes for cytoplastic fatty acid desaturases and the plastic acyl-ACP thioesterases to alter relative levéis of polyunsaturated and saturated fatty acids in rapeseed oil. Proc. 9th International Cambronge Rapeseed Congress UK, pp. 470 472.

Jefferson, R.A. , Kavanaugh, T.A. and Bevan, M.W. (1987) GUS fusions: ß-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6: 3901-2907.

Jorgensen, R.A. and Napoli, C.A. (1994) Genetic engineering of novel plant phenotypes. INS Patent No. -5283184, Katavic, V., Haughn, G.W., Reed, D., Martin, M. and Kunst, L. (1994) IrT plants transformation of Arabidopsis thaliana. Mol. Gen. Garnet 246: 363-370.

P872 Katavic, V., Reed, D.W., Taylor, D.C., Giblin, E.M., Barton, D.L., Zou, J-T., MacKenzie, S.L., Covello, P.S. and Kunst, L. (1995) Alteration of fatty acid composition of an EMS-induced mutation in Arabidopsis thaliana affecting diacylglycerol acyltransferase activity. Plant Physiol. 108: 399-409.

Kinney, A.J. improving soybean seed quality. In: lnduced Mutations and Molecular Techniques for Crop Improvement. international Atomic Energy Agency. Vienna, Austia., Pp. 101-113.

Kinney, A.J. (1997) Genetic engineering of oilseeds for desired traits. In: Genetic Engineering, Vol. 19 (J.K. Setlow, ed.), Plenum press, NY., Pp. 149-166.

Kishore G.M. and Sornerville, C.R. (1993) Genetic engineering of "commercially useful biosynthetic pathways in transgenic plants." Current Opinion In Biotechnology 4: 152-158.

Kleinig, H. and Liedvogel, B. (1980) Fatty acid synthesis by isolated chromoplasts from the daffodil. Energy sources and distribution patterns of acids. Plant, 150: 166-169 Knutzon, INS., Thompson, G.A., Radke, S.E., Johnson. W.B, Chaff, J.C., and Kridl, J.C. ('892) Modification of Brassica seed oil by anti-sense expression of a stearoyl-acyl carrier protein desaturase gene. Proc Nati Acad. Sci. USA, 89: 2624-2628.

Koncz, C. and Schell, J. (1986) The promoter TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes by a novel type of Agrobacterium binary vector. Mol Gen. Genet. 204; 383-396.

Korotchkina, L.G. and Paul, M.S. (1995) Mutagenesis studies of the phosphorylation sites of recombinant human pyruvate dehydrogenase, J. Biol. Chem. 276: 14297-14304.

Lagercrantz, U., Putteril, J., Coupland, G. and Lydiate, D. (1996) Comparative mapping in Arabidopsis and Brassica, fine scale genome collinearity and congruence of genes controlling flowering. Plant. J. 9: 13-20.

Landschütze, V., Willmitzer, L. and Müller-Rdber, B. (1995) Inhibition of flower formation by antisense repression of mitochondrial citrate synthase in transgenic potato plans leads to a specific disintegration of the ovary tissues of flowers. EMBO J. 14 660-666.

P872 Lassner, "M.W., Lardizabal, K, and Metz, J.G. (1996) A jojoba ß-ketoacyl-CoA syntase cDNA complements the cañola fatty acid elongation mutation in transgenic plants, The Plant Cell, 8: 281-292.

Liedvogel, B. (1986) Acetyl Coenzyme A and isopentenyl diphosphate as lipid precursors in plant Cells-biosynthesis and compartmentation. J. Plant Physiol. 124: 211-222.

Liu, S., Baker, J.C. and Roche, T.E. (1995) Binding of the pyruvate dehydrogenase kinase to recombinant constsucts contdning the inner lipoyl domain of the dihydrolipoyl acetyltransferase component. J. Biol. .Chem. 270. 793-800 Lloyd, A.M., Walbot, V. and Davis, R.W. (1992) Arabidopsis and Nicotiana anthocyanin production activated by maize regulators R and Cl. Science 258: 1773-1775.

Lutcke, H.A., Chow, K.C., Mickel, F.C., Moss, K.A. , Kern, H.F. and Scheele, G.A. (1987) Selection of AUG; initiation codon differs in plants and encourage. EMBO J. 6: 43-48.

MacKenzie, S.L. and Jain. R.K. (1997) Improvement of oils crops via biotechnology. Recent Res. Dev. In Oil Chem. 1: 149-158.

P872 Meyer, P. (1995) Understanding and controlling transgene expression. Trends in Biotechnology, 13: 332-337.

Meyerowitz, E.M. (11387) Arabidopsis thaliana. Ann. Rev. Genet. 21: 93-111.

Meyerowitz, E.M. and Chang, C. (1985) Molecular biology of plant growth and development: Arabidopsis thaliana as an experimental system. In: Developmental Biology, Vol. 5, Plenum Press, NY., Pp. 353-366.

Miernyk, J.A. and Randall, D.D. (1987) Some kinetic and regulatory properties of the mitochondrial pea pyruvate dehydrogenase complex. Plant Physiol. 83: 306-310.

Mol, J.M.N., Van der Krol, A.R., Van Tunen, A.J., Van Blokland, R. ~ De Lange, P. and Stuitje, A.R. (1990) Regulation of plant gene expression by antisense RNA. FEBS Lett. 268: 427-430.

Moloney, M.M., Wader, J.M. and Sharma, K.K. (1989) High efficiency transformation of Brassica napus using; Agrobacterium vectors. Plant Cell Rep. 8: 238-242.

Mullen, R. T., Lee, M.S., Flynn, C.R. and Trelease, R.N.

P872 (1997) Diverse amino acid residues function within the type 1 peroxisomal targeting signal: Implications for the role of accessory "residues upstram of the type 1 peroxisomal targeting signal, Plant Physiol. 115: 881-889.

Murphy, L. and Scarth, R. (1994) Vernalization response in spring oilseed rape (Brassica napus L.) cultivars. Dog. J. Plant Sci. 74: 275-277.

Nehra, N.S., Chibbar, R.N. Leung, N., Caswell, K., Mallard, C, Steinhauer, L. Baga, M, and Kartha K.K. (1994) Self-fertile transgenic wheat plants regenerated from isolated scutellar tissues following microprojectile bombardment with halo distinct gene constructs. Plant J. 5: 265-297.

Nobukuni, Y., Mitsubushi, H., Endo, F., Asaka, J., Oyama, R., Titani, K. and Matsuda, I. (1990) Isolation and characterization of a complementary DNA clone coding for the E- | _ß subunit of the bovine branched chain a-ketoacid dehydrogenase complex: Complete amino acid sequence of the protein precursor and its proteolytic processing. Biochemistry 29: 1154-1160 Ohirogge, J. and Browse, J. (1995) Lipid biosynthesis The Plant Cell, 7: 957-970.

P872 Okuley, J. Lightner, J., Feldmann, K, Yadav, N., Lark, E. and Browse, J. (1994) Arabidopsis fad2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. The Pant Cell 6: 147-158.

Padgette, S.R., Gruys, K.J., Mitsky, T.A., Tran, M., Taylor, N.B., Slater, S.C., and Kishore, G.M. (1997) Strategies for production of polyhydroxyalkanoate polymers in plants. Plant Physiol. Suppl., 114: 3 (abstract 10003).

Parkinson, K.S. and Kofoid, E.C. (1992) Communication modules in bacterial signaling proteins. Annu. Rev. Genet 26: 71-112.

Pearson, W.R. and Lipman, D.J. (1988) Improved tools for biological sequence comparison. Proc. Nati acad. Sci. USA 85; 2444-2448.

Popov, K.M., Zhao, Y., Shimomura, Y., Kuntz, M.J. and Harris, R.A. (1992) Branched-chain a-ketoacid dehydrogenase kinase: Molecular cloning, expression and sequence similarity with histidine protein kinase. J. Biol. Chem. 267: 13127-13130.

Popov, K.M., Kedishvili, N.Y., Zhao, Y., Shimomura, Y., Crabb, D.W. and Harris, R.A. (1993) Primary structure of P872 pyruvate dehydrogenase kinase establishes a new family of eukaryotic protein kineses. J. Biol. Chem ,. 268: 26602-26606. "" Popov, K.M., Kedishvili, N.Y., Zhao, Y., Gudi, R. and Harris, R.A. (1994) Molecular cloning of the p45 subunit of pyruvate dehydrogenase kinase J. Biol. Chem. 269: 29720-29724 Potrykus, I. (1991) Gene transfer to plants: Assessment of published approaches and results. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42: 205-225.

Randall, D.D., Miernyk, J.A., Fang, T.K., Budde. R.J.A. and Schuller, K.A. (1989) Regulation of the pyruvate dehydrogenase complexes in plants. Ann. NY Acad. Sci. 573: 192-205.

Reid, E.E., Thompson, P., Lyttle, C.R. and Dennis, D.T. (1977) Pyruvate dehydrogenase complex from higher plant mitochondria and proplastids. Plant Phisiol. 59: 842-848.

Rhodes, C.A., Pierce, D.A., Mettler, I.J., Mascarenhas, D. and Detmer, J.J. (1988) Genetically transformed maize plants from protoplasts. Science 240: 204-207.

P872 Rosie, D. and Schatz, G. (19BB) Mitochondrial presequenses. J. Biol. Chem. 263: 4509-4511.

Roughan, P.G. and Ohlrogge, J.B. (1994) On the assay of acetyl-CoA synthestase in chloroplasts and leaf extracts. Anal. Biochem. 216: 77-82.

Roughan, P.G. and Ohlrogge, J.B. (1996) Evidence that isolated chloroplasts contain an integrated lipid-synthesizing assembly that channels actatate into long-chain fatty acids. Plant Physiol, 110: 1239-1247.

Sambrook, J., Fritsch, E.F., and Manitatis, T. (1989). Molecular Cloning, A Laboratory Manual, 2n. Edison, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sanford, J.C. Klein, T.M., Wolf, E.D. and Allen T, N. (1987) Delivery of substances into cells and tissues using a particle bombardment process. J. Part. Sci. Technol 5: 27-37.

Shimamoto, K., Terada, R., Izawa, T. and Fujimoto, H. (1989) Fertile transgenic rice plant regenerated from transformed protoplasts, Nature 338: 274-276.

P87 Sinclair, T.R., Ward, J.P. and Randall, C.A. (1987) Soybean seed growth in response to long-term exposures to different oxygen partial pressures. Plant Physiol. 83: 467-468.

Somerville, C.R. (1993) Future prospects for genetic medication of the composition of edible oils from higher plants. Am. J. Clin. Nutr. 56 (2 Suppl.): 270S-275S.

Songstad, D.D., Somers, D.A and Griesbach, R.J. (1995) Advances in alternative DNA delivery techniques. Plant Cell, Jesus and Organ Culture 40: 1-15.

Southern E.M. (1975) Detection of specific sequences among DNA fragments separated by gele electrophoresis. J. Mol. Biol. 93: 503-517.

Srere, P.A. (1969) Cúrate synthase. In: Methods in Enzymology. Vol. XIII, J.M. Lowenstein (Ed.), Academic Press, New York. pp. 3-11.

Stark, D.M., Timmerman, K.P., Barry, G.F, Preiss, J. and Kishore, G.M. (1992) Regulation of the amount of starch in plant "tissues by ADP glucose pyrophosphorylase, Science 258: 287-292.

P872 Taylor, D.C., Magus, J.R., Bhella, R., Zou, J-T., MacKenzie, S.L., Giblin, E.M., Pass, E.W. and Crosby, W.L. (1992a) Biosynthesis of triacylglycerols in Brassica napus L. cv Reston; Target: Trierucin. In: Seed Oils for the Future. S.L. MacKenzie and D.C. Taylor (Eds.), American Oil Chemists Society, Campaing, IL., Pp. 77-102.

Taylor, D.C., Barton, D.L., Rioux, K.P., Reed, D.W., Underhill, E.W., MacKenzie, S.L., Pomeroy, M.K. and weber, N. (1992b) Biosynthesis of acyl lipids contining very long-chain fatty acids in microspore-derived and zygotic embryos of Brassica napus L. cv Reston. Plant Physiol. 99: 1609-1618.

Taylor. D.C., Barton, D.L., Giblin, E.M., MacKenzie. S.L., Van den Berg, C.G.J. and McVetty, P.B.E. (1995) Developing seeds of a Brassica oleracea breeding line possess a lyso-phosphatidic acid acyltransferase capable of utilizing erucoyl-CoA and accumulating triacylglycerols containing erucic acid in the sn-position. Plant Physiol. 109: 409-420.

Vasil, I.K. (1994) Molecular Improvement of cereals. Plant Mol. Biol. 26: 925-937.

P872 Veeger, C, Der Vartanian, D.V. and Zeylemaker, W.P. (1969) Succinate dehydrogenase. In: Methods in Enzymology. Vol. XIII, J.M. Lowenstein (Ed.), Academic Press, New York. pp. 81-90.

Voelker, T.A., Worrell, A.C., Anderson, L., Bleibaum, J., Fan, C, Hawkins D.J., Radke. S.E., and Davies, H.M. (1992) Fatty acid biosynthesis redirected to medium chains in transgenic oilseed plants. Science 257: 72-74.

Voelker, T.A., Hayes, T.R., Cramner, A.M., Turner, J.C., and Davies, H.M. (1996) Genetic engineering of a quantitative trait: metabolic and genetic parameters influencing the accumulation of laurate in rapeseed. The Plant Journal 9: 229-241.

Walden, R. and Wingender, R. (1995) Gene-transfer and plant regeneration techniques. Trends in Biotechnology 13: 324-331.

Zhang, H. Goodman, H.M. and Jansson, S. (1997) Antisense inhibition of photosystem I antenna protein Lhca4 in Arabidopsis Thaliana. Plant Physiol. 115: 1525-1531.

Zou, J-T and Taylor, D.C. (1994) Isolation of an Arabidopsis P872 thliana cDNA homologous to parsley (Petroselinum crispum) S-adenosyl-L-methionine: trans-caffeoyl-Coenzy e A 3-0-methyltransferase, an enzyme involved in disease resistance. Plant Physiol Biochem. 32: 423-427.

Zou, J-T., Katavic, V., Giblin, E.M., Barton, D.L., MacKenzie, S.L., Keller, W.A. , Hu, X. and Taylor, D.C. (1997) Modification of seed oil content and acyl composition in the Brassicaceae by expression of -a yeast sn-2 acyltrañsferase gene. The Plant cell 9: 909-923.

The teachings of the references shown above are incorporated herein by reference

Claims (28)

1. CLAIMS: 1. Isolated and purified deoxyribonucleic acid (DNA), characterized in that the DNA includes a sequence according to SEQ ID No. 1 (ATCC 209562), or a DNA sequence coding for a protein with 50% or greater identity of amino acids to the protein encoded by SEQ ID No. 1, or to portions of reduced length of these sequences that are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application.
2. 2. A vector for the transformation of plant cells, characterized in that the vector contains a deoxyribonucleic acid sequence according to SEQ ID No. 1, or a DNA sequence coding for a protein with 50% or more identity of amino acids to the protein encoded by SEQ ID No. 1, or to parts of reduced length in the sequences that are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application.
3. 3. A vector according to claim 2, characterized in that the sequence is present in the vector in an antisense orientation.
4. 4. A vector according to claim 2, characterized in that the sequence is present in the P872 vector_ in a homosentido orientation.
5. 5. Plasmid pYA5 (ATCC 209562).
6. 6. Plasmid pAsYA5 (ATCC 209561).
7. 7. A plant having a genome, characterized in that the genome has a nucleotide sequence introduced in SEQ ID No. 1, or a DNA sequence encoding a protein with 50% more amino acid identity to the encoded protein SEQ ID No. 1, or parts of reduced length of the sequences that are still capable of functioning, individual gene expression by use in an antisense or co-suppression application.
8. 8. A plant seed having a genome, characterized in that the genome has an introduced nucleotide sequence of SEQ ID No. 1, or a DNA sequence encoding a protein with 50% or more amino acid identity at the protein encoded by SEQ ID No. 1, or parts of reduced length of the sequences that are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application.
9. 9. A genetically transformed plant, characterized in that the genome has been transformed by a vector according to claim 2.
10. 10. A genetically modified plant seed P872 transformed, characterized in that the seed has been transformed by a vector according to claim 2.
11. 11. A plant according to claim 9, characterized by exhibiting an altered respiration rate compared to a genomically-modified plant of the same genotype. .
12. 12. A plant seed according to claim 10, characterized by exhibiting an altered respiration rate compared to a genomically unmodified plant of the same genotype.
13. 13. A plant according to claim 9, characterized by exhibiting an altered seed oil content as compared to a genomically unmodified plant of the same genotype.
14. A plant seed according to claim 10, characterized by exhibiting an altered content of seed oil in comparison to a genomically unmodified plant of the same genotype.
15. 15. A plant according to claim 9, characterized by exhibiting an altered scan time in comparison to a genomically unmodified plant of the same genotype
16. 16. A plant seed according to claim 10, characterized in that it produces a P872 plant that exhibits an altered flowering time in comparison to a genomically unmodified plant of the same genotype.
17. 17. A plant according to claim 9, characterized by exhibiting improved resistance to cold temperatures compared to a genomically unmodified plant of the same genotype.
18. 18. A plant seed according to claim 10, characterized in that the seed produces a plant that exhibits an improved resistance to cold temperatures in comparison to a genomically unmodified plant of the same genotype.
19. 19. A plant according to claim 9, characterized by exhibg an improved biomass compared to a genomically unmodified plant of the same genotype.
20. 20. A plant seed according to claim 10, characterized in that the seed produces a plant that exhibits an improved biomass compared to a genomically unmodified plant of the same genotype.
21. 21. A plant according to claim 9, characterized by exhibg an improved capacity to accumulate biopolymers in comparison to a genomically unmodified plant of the same genotype. P872
22. 22. A plant seed according to claim 10, characterized in that the seed produces a plant that exhibits an improved capacity to accumulate biopolymers in comparison to a genomically unmodified plant of the same genotype.
23. 23. A method for producing transgenic plants by introducing a nucleotide sequence into a genome of the plant, characterized in that the nucleotide sequence introduced into the genome includes SEQ ID No. 1; or a DNA sequence encoding a protein with 50% or more of amino acid identity to the protein encoded by SEQ ID No. 1, or to reduced length portions of the sequences that are still capable of functioning as inhibitors of expression gene for use in an antisense or co-suppression application.
24. 24. A method according to claim 23, characterized in that the plant is a member of the Brassicaceae.
25. 25. A method according to claim 23, characterized in that the plant is a group member consisting of borage (Borago spp.), Canola, castor. (Ricinus communis), cocoa bean (Theobroma cacao), corn (Zea mays), cotton (Gossypium spp.), Crambe spp., Cuphea spp., Flax (Linum spp.), Lesquerella and Limnanthes P872 spp., Linola, nasturcio (Tropaeolum spp.), Oenothera spp., Olive (Olea spp.), Palma. { Elaeis spp.), Peanut (Arachis spp.), Naba seed, safflower (Carthamus spp.), Soybeans (Glycine and Soja spp.), Sunflower (Helianthus spp.), Tobacco (Nicotiana spp.), Vermonia spp., wheat (Triticum spp.), barley (Hordeum spp.), rice (Oryza spp.), oats (Avena spp.), sip (Sorghum spp.); rye (Sécale spp.), or other members of the Gramineae.
26. 26 ^ In the plant DNA sequence or part thereof, characterized in that the sequence codes for a protein with 50% more amino acid identity to the protein encoded by SEQ ID No. 1, or to parts of reduced length of the proteins. sequences which are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application and in which the sequence has been isolated or characterized using the sequence information of SEQ ID No. 1.
27. 27. A method for changing the oil content of plant seeds by introducing a homosense or antisense nucleic acid construct into the plant-transformation vector, using the vector to transform the genome of a plant or plant seed, and then cultivating the plant and plant seed and extract the oil from the plant seed, P872 characterized in that the nucleic acid sequence is SEQ ID No. 1, or a DNA sequence encoding a protein with 50% or greater amino acid identity to the protein encoded by SEQ ID No. 1, or to parts of reduced length of sequences that are capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application.
28. 28. A method for changing the content of the biopolymer of a plant or plant storage organ by introducing an antisense or homosentide construct into a plant transformation vector, using the vector to transform the genome of a plant or storage organ of a plant. plant, and then cultivate the plant or storage organ and extract the biopolymer from the plant or plant storage organ, characterized in that the construct contains SEQ ID No. 1, or a DNA sequence encoding a protein with 50% or more of the amino acid identity to the protein encoded by SEQ ID No. 1, or to parts of reduced length of the sequences that are still capable of functioning as inhibitors of gene expression by use in an antisense or co-suppression application . P872 SUY OF THE INVENTION The present invention relates to the isolation, purification, characterization and use of a mitochondrial pyruvate-dehydrogenase-kinase (PDHK) gene [SEQ ID No. 1] (pYA5; ATCC No. 209562) of the Brassicaceae (specifically Arabidopsis thaliana). The invention includes DNA isolated and purified from the sequences indicated and relates to methods for regulating the synthesis of fatty acids, seed oil content, seed weight / size, flowering time, vegetative growth, respiration rate and generation time using the gene and to tissues and plants transformed with the gene. The invention also relates to transgenic plants, plant tissues and plant seeds having a genome containing an introduced DNA sequence of SEQ ID No. 1, or a part of SEQ ID No. 1, characterized in that the sequence is has introduced in an antisense or homosense orientation, and a method to produce these plants and plant seeds. The invention also relates to substantially homologous DNA sequences of, plants encoding proteins with deduced amino acid sequences of 25% or greater identity, and 50% or greater similarity, isolated and / or characterized by known methods using the P872 sequence information of SEQ ID No. 1, and to portions of reduced length that are still capable of functioning as inhibitors of gene expression by use in an antisense, co-deletion or other gene in antisense gene identification technologies, of co-suppression or others.