MXPA99007104A - A method for the production of dicarboxylic acids - Google Patents

Abstract

The present invention is an economical fermentation method for the production of carboxylic acids comprising the steps of:a) inoculating a medium having a carbon source with a carboxylic acid-producing organism;b) incubating the carboxylic acid-producing organism in an aerobic atmosphere to promote rapid growth of the organism thereby increasing the biomass of the organism;c) controllably releasing oxygen to maintain the aerobic atmosphere;d) controllably feeding the organism having increased biomass with a solution containing the carbon source to maintain the concentration of the carbon source within the medium of about 0.5 g/L up to about 1 g/L;e) depriving the aerobic atmosphere of oxygen to produce an anaerobic atmosphere to cause the organism to undergo anaerobic metabolism;f) controllably feeding the organism having increased biomass a solution containing the carbon source to maintain the concentration of the carbon source within the medium=1 g/L;and g) converting the carbon source to carboxylic acids using the anaerobic metabolism of the organism.

Description

A METHOD FOR THE PRODUCTION OF DICARBOXYLLIC ACIDS FIELD OF THE INVENTION The present invention relates to a method for the production of dicarboxylic acids, particularly to a fermentation method using a strain of Escherichia coli to produce high amounts of dicarboxylic acids such as malic acid, fumaric acid and acid. succinic f BACKGROUND OF THE INVENTION The carboxylic acids and derivatives thereof are widely used as "chemicals especially for applications in polymers, foods, pharmaceuticals and cosmetics." For example, succinic acid is useful in the production of said acids.

^ JL plastic precursors such as 1,4-butanediol (BDO), tetrahydrofuran and gma'-butyrolactone. New products derived from succinic acid are under continuous development, including the development of ^ JL polyester. The polyester is formed by the union of succinic acid and BDO. Generally, succinic acid esters have the potential to be the new "green" solvents that can supplant the most harmful solvents and can serve as precursors for millions of pounds of chemicals annually at a total market value of one billion dollars. Dollars. : - ~ The production of carboxylic acids, such as malic acid, succinic acid and fumaric acid, of food products Renewables (in this case through the fermentation process) is a route to supplant the higher energy intensive methods of * = faith? -the derivation of said acids from non-renewable sources. SuccTr? Ato is an intermediary of anaerobic termentations by the bacteria that produce propionate, but these processes yield low yields and concentrations. Many organisms that produce succinic acid have been isolated, such as the anaerobic rumen bacterium, Bacteroides rumibola. Bacteroides amylophilus. However, rume organisms are characteristically unstable in fermentation processes.Another organism that produces succinic acid, is Anaérobiospirillum succiniciproducens (A succiniciproducens) Several patents have been submitted on the use of this organism to produce succinic acid in a process of anaerobic fermentation Use said patents of Glassner et al., US Patent No. 5,143,834, describes the use of this organism in fermentation processes using A. succiniciproducens that has several probremas.A problem is that "the organism is a strict anaerobic, its Cultivation must be done in an absolutely oxygen-free environment. The propagation of this organism is a commercial fermentation plant that is difficult and requires highly heavy work. A. succiniciproducens is also difficult to handle even in lab scale practices and tends to degenerate under unfavorable conditions. Its degeneration can not be reversed. The organism had never been used in processes of commercial fermentation. In other words, the fermentation experience at production scale with this particular organism does not exist. In addition, the body requires an external supply of carbon dioxide to achieve high succinic acid yield. In a fermentation process, a stream of pure carbon dioxide must be sprayed into the fermentation broth. A. succiniciproducens produces a mixture of succinic and acetic acids at a molar ratio of succinatojacetate of about 2. The presence of acetic acid at high concentrations in the fermentation broth increases the cost of purification of succinic acid. The production of the acetate coproduct illustrates that a third of the expensive glucose is not converted to succinate. Furthermore, it has been shown that the host strain of A. succiniciproducens is not highly osmotolerant since it does not tolerate high concentrations of salts and is also inhibited by moderate concentrations of the product. Another problem with the use of A. succiniciproducens is that the preparation medium for the inoculum requires the addition of tryptophan and also requires the mixing of four different solutions, one of which contains H2S corrosive and toxic. It has been known for a long time that a mixture of acids is produced from the fermentation of E. coii, as elaborated by J. L. Stokes in 1949"Fermentation of glucose by suspensions of Escherichia coli," J. Bacteriol. , 57: 147-158. However, for each mole of fermented glucose, only 1.2 milliliters of glucose are produced. formic acid, 0.1 -0.2 moles of lactic acid and 0.3-0.4 moles of succinic acid. As such, the effort to produce carboxylic acids fermentatively results in relatively large amounts of growth substrates, such as glucose, without being converted to the desired product. ,, Fairoz Mat-Jan and others describe in J. Bacteriol .. v. 171 (1989), pgs. 342-348, a study carried out on Escherichia coli mutants cient in NAD-linked lactate dehydrogenase (Idh) that can be isolated shows cts without growth under anaerobic conditions unless they are present together with a ct in pyruvate lyase format. (pfl) The double mutants (pfl idh) were not able to develop anaerobically on the gfucosa or other sugars even when they were supplemented with acetate, whereas they can be made by the pfl mutants. The study did not treat or investigate the production of succinic acid or dicarboxylic acids. Although the succinate ion is a common intermediate in the metabolic pathway of several anaerobic microorganisms, there is a need in the art for a fermentation process to economically produce succinic acid, as well as other carboxylic acids such as malic acid and fumaric acid, in large quantities or with high yields. The process could use nutrients and substrates of low cost, the fermentation regime must be high for high productivity and the concentration of the product in the fermentation broth must be high.

F OBJECTIVES OF THE INVENTION • Accordingly, it is an objective of the present invention to provide an improved, practical and economical method for the production of dicarboxylic acids which overcome the disadvantages and problems presented by the prior art. It is another object of the present invention to provide an improved, practical and economical method for the production of succinic acid, malic acid and fumaric acid with high yields. It is still another object of the present invention to provide a fermentation method using an Escherichia coli mutant for production of succinic acid, malic acid and fumaric acid in high yields. It is yet another object of the present invention to provide a method of Improved, practical and economical fermentation using an Escherichia cji mutant for the production of succinic acid, malic acid and fumaric acid with high yields where the fermentation method is carried out in a single vessel, allowing the precise control of oxygenation, glucose levels, pH and nutrient addition regimes _Other and additional objects of the present invention will be apparent from the description contained herein: f COMPENDIUM r In accordance with one aspect of the present invention, the above and other objectives are achieved by a method to produce carboxylic acids that comprise the you are from a) inoculate in a I have a source of carbon with an organism that produces carboxylic acid; b) incubate the organism that produces acid -fe,, carb xi hco in an aerobic atmosphere that promotes the rapid growth of the organism thus increased the biomass of the organism, c) controlled release of oxygen to maintain the atmosphere aerob * B? ca; d) feeding in a controlled manner the feed of the organism having increased biomass with a solution containing the carbon source to maintain the concentration of the carbon source within the medium of about 0 5 g / L to about 1 g / L; e) deprive the aerobic atmosphere of oxygen • to_ "produce an anaerobic atmosphere to cause the organism to undergo an anaerobic metabolism; f) to feed the organism in a controlled manner" that has increased biomass, a solution containing the source of carbon to maintain the concentration of the source of carbon within the middle of > _ 1 g / L; and g) convert carboxylic acids to the carbon source using the anaerobic metabolism of the organism. According to another aspect of the present invention, other objects are achieved by a method for producing carboxylic acids comprising the steps of a) inoculating a medium having a carbon source with an organism that produces carboxylic acid; b) incubating the organism in an environment having a maintained p H value and having an aerobic atmosphere to promote the rapid growth of the organism thus increasing the biomass of the organism; c) release in a controlled manner oxygen to maintain the aerobic atmosphere; d) feeding the organism in a controlled manner with a solution containing the carbon source to maintain a carbon source concentration with the medium from about 0.5 g / L to about 1 g / L; e) transferring the organism having increased biomass to a production fermentor having an anaerobic atmosphere to cause the organism to undergo an anaerobic metabolism; f) feeding in a controlled manner to the organism, a solution containing the source of carbon to maintain a concentration of carbon source within the fermentor of production of > _ 1 g / L; and g) convert the carbon source to carboxylic acids using the metabolism - n? Anaerobic organism. BRIEF DESCRIPTION OF THE DRAWINGS For a better understanding of the present invention, together with other additional objectives, advantages and capabilities thereof, reference is made to the following description and appended claims when read in conjunction with the appended drawings, where: Figure 1 shows the results of the experiment described in EXAMPLE 1 .. Figure 2 shows the results of the experiment described in EXAMPLE 2. Figure 3 shows the results of the experiment described in EXAMPLE 3 .

-Figure 4 shows the results of the experiment described in EXAMPLE 4. Figure 5 shows the results of the experiment described in EXAMPLE 5. Figure 6 shows the results of the experiment described in EXAMPLE 6. Figure 7 shows the results of the experiment described in EXAMPLE 7.? DETAILED DESCRIPTION OF THE INVENTION The present invention is a novel, yet practical, economic means for producing high amounts of succinic acid, fumaric acid and malic acid in a controlled fermentation process. A strain of Escherichia coli (E. coli), referred to as AFP-1 1 1, has been used in the fermentation process of the present invention to overcome the problems presented by the art. AFP-1 1 1, an E. coli mutant of NZN-1 1 1, is an facultative organism. E. coli is very easy to "handle." Its biology and molecular physiology are well known in greater detail, therefore, an improved process can easily be achieved by molecular biology or modification of process parameters or both. Coli can be used extensively in fermentation processes for the manufacture of biopharmaceutical and chemical products, and there is considerable experience in the production scale with this organism.

E. coli also produces a mixture of succinic and acetic acids, however, the molar ratio of succinate: acetate under non-optimal conditions is around 3 or higher.This ratio can be substantially increased. in the broth of "fermentation will significantly reduce the cost of purification of succinic acid. In addition, E. coli may not necessarily need an external supply of carbon dioxide to achieve a high succinic acid yield. Without spreading carbon dioxide, the yield of succinic acid during the peak production period is compared to that obtained with A. Succiniproducens with the diffusion of carbon dioxide. ^ Normally under anaerobic conditions, wild type E. coli produces a mixture of fermentation products, of which succinic acid is a minor component. However, when AFP-III is developed under anaerobic conditions, the main metabolic product is succinic acid. AFP-III contains a unique spontaneous chromosomal imitation that produces a mixture of succinic acid, acetic acid and ethanol, succinic acid being the main product. A maximum yield of 99 percent by weight of succinic acid by the weight of glucose is produced with AFP-III. E [use of AFP-III could significantly reduce the cost of succinic acid production by fermentation processes. -The fermentation process of E. coli, consists of two stages. In the first, the AFP-JII strain was developed under conditions aerobic, in a low glucose environment, at high cell density in the fermentor. In the present invention, glucose was used as a carbon source for the growth of the body's biomass and for the production of dicarboxylic acids. When the desired density of the cell was achieved, the air supply was interrupted to force the organism to switch to its anaerobic metabolism, which resulted in the production of dicarboxylic acids, including malic, fumaric and succinic acid as the final product. In one embodiment of the present invention, the two-stage fermentation process is presented in a single container. The biochemical pathway of succinic acid production in E. coli involves a series of conversion steps. The pyruvic acid was first converted to oxaloacetic acid, then to malic acid, fumaric acid and finally to succinic acid. Of these acids, malic acid, fumaric acid and succinic acid are industrially important. AFP-III accumulates succinic acid as the final product. If fumaric acid is the desired product, the gene encoding the enzyme responsible for the conversion of fumaric acid to succinic acid are suppressed and the resulting organism will accumulate fumaric acid instead of succinic acid. Similarly, if malic acid is the desired product, the gene encoding the enzyme responsible for the conversion of malic acid to fumaric acid are deleted to form an organism that produces malic acid. With the current state of the art, the molecular biology techniques and the based on the analysis of gas evolution or an online glucose analysis. This has become a very common industrial practice. Anaerobic fermentation is the oldest route to obtain fuel energy such as glucose. In anaerobic cells, it is the only process to produce energy. In most facultative cells, there is a mandatory first step in glucose catabolism, which is folloby aerobic oxidation of the fermentation products via the tricarboxylic acid cycle. The most widely used type of fermentation is glycolysis with pyruvate produced as a penultimate product. The disposition of pjruvato depends on which genes are present in the organism. In the presence of the enzyme lactate dehydrogenase, glycolysis ends when pyruvate is reduced via NADH and H + to lactam. In the presence of pyruvate decarboxylase and alcohol dehydrogenase, ethanol is formed. In the presence of pyruvate lyase (pfl), the fermentation ends with the production of acetate, ethanol and format, or hydrogen plus carbon dioxide. If a mutation or a plurality of mutations in a bacterial genome removes the genes in the body responsible for the catabolism of pyruvate, then pyruvate will accumulate. To develop anaerobically E. coli, the genes are pyruvate lyase / pfl) and lactate dehydrogenase (Idh). The NZN 111 strain of E. coli, widely available to researchers of Dr. David Clark, Southern, Illinois University, Carbondale, III. 62901, contains mutations in both genes so that both pH and Idh have been inactivated due to changes in the chromosomal DNA sequence of E. coli. As such, NZN III can not develop fermentatively. AFP-III, which has been derived from NZN-III by applying additional genetic changes, produces a mixture of succinic acid, acetic acid and ethanol under anaerobic conditions, succinic acid being the main product. It has been found that additional changes to NZN 111, which occur either spontaneously during selective cultivation or via plasmid transformation, ultimately result in the emergence of AFP-111 which produces succinic acid as a major product. Spontaneous chromosome mutations to NZN 111, which lead to AFP-111 type characteristics, occur when selective environments are used in serial culture techniques. In a first step, the biomass of NZN 111 was increased aerobically in a rich medium, such as Luria Bertaini (LB) broth (0.5 percent yeast extract, 1 percent tryptone and 1 percent NaCf, pH 7.5). Yields between about 109 to 10 ° cells per milliliter are desired. While the incubation periods may vary, the durations of the growth phase of 5-7 hours at 37 ° C and at normal pressure produce the concentrations mentioned above.

-As a second step, the accumulated biomass was now subjected to anaerobic conditions rich in glucose to facilitate the growth only of those cells (mutants) capable of catabolizing pyruvate. For example, the cells are disseminated on 1.5% agar plates containing approximately 1 to 30 grams per liter (g / l) of glucose, preferably 10 g / l glucose and 30 micrograms (μg) / ml. of Kanajriicina. The gene for kanamycin resistance is inserted into the gene for lactate dehydrogenase in NZN 1 1 1. The cultures were grown for 24 hours at 37 ° C, in a controlled anaerobic atmosphere. An anaerobic atmosphere that produces good results was a mixture of carbon dioxide and hydrogen, which was provided through the use of a commercially available atmosphere control device from Becton-Dickinson, Cockeysville, Maryland as GASPÁK ™. The incubation period produced many colonies of AFP 1 1 1 (approximately 2 per 107 cells) and about half of those were able to grow in liquid medium to produce the desired mixture of products. In the case of plasmid transformation, when NZN 1 1 1 was translocated with plasmid pM DH 13 containing the mdh gene for a mutant "" malate dehydrogenase enzyme, the catabolism of pyruvate is summarized to produce lactate. Serial culture of this transformant (MZN l l l (pMDH 13)) results in AFP 1 1 1 which contains a spontaneous chromosomal mutation. AFP 1 1 1 produces one. mixture of succinic acid, acetic acid and ethanol as fermentation products, the succinic acid producing up to 99 weight percent compared to the weight of the glucose used in the growth medium. The protocol for the development and transformation of pMDH 13 is similar to that described in W. E. Boernke, et al. (September 10, 1995) Archives of Biochemistry and Biophysics 322, No. 1 p. 43-52, incorporated herein by reference. For the experimental evaluation of the strains described herein, the cells are aerobically cultured in glucose free growth medium (Luria Broth) until cell densities of between 0.5 and 10 OD600- _ are reached. Once this is achieved appropriate biomass of AFP 1 1 1, then the cells are injected, or in some way transferred, to a sealed reaction chamber to be contained therein. The broth was mixed with glucose or some other suitable carbohydrate, such as xylose , galactose or arabinose at concentrations ranging from approximately 10 to 30 g / l. The mixture now contained was subjected to an atmospheric change by which anaerobic conditions were achieved. A means to achieve atmospheric change is through a gasification station through which the ambient air is exchanged for carbon dioxide. Before introducing the mixture into the fermentation reaction chamber, the chamber was supplied with an appropriate amount of buffer medium such as MgCO3, CaCO3 or CaMg (CO3) 2 so as to maintain almost neutral pH. Between about 4 and 8 weight percent of the pH regulating medium It is normally used for the appropriate regulatory capacity. Especially good results are obtained when the pH regulating medium is present as a solid so as to confer a time-regulating pH-regulating capacity to the fermentation liquor. The above procedure results in high yields of succinic acid. For example, a ratio of 6: 1 of succinic acid to acetic acid was obtained by weight, with a yield of 99 percent. The ratio of succinic acid to acetic acid further increases when the fermentation is carried out in the presence of hydrogen gas at H2 concentrations of between about 25 percent to 100 percent. These results indicate that unlike the organisms of the state of the art, the mutant AFP 111 uses exogenous hydrogen as a reducer. For example, when the Luria broth, glucose, pH regulating agent and a mixture of hydrogen gas and carbon dioxide (the CO2 being released from the pH regulating agent) are present, the ratios of acetic acid to succinic acid are obtained. to 9. This result reflects another advantage of changing the glucose catabolism to the desired product, without the undesirable acetate producing side reactions. a Table 1 below illustrates the product distribution of dicarboxylic acids for the original parent W1485 (also available from Southern Illinois University), NZN 111 and AFP 111. TABLE 1: Performance of the product in molar performance against initial glucose (mole percent) of AFP 1 1 1 and predecessors WO485 Mother NZN 1 1 1 Mother AFP 1 1 1 Original product Original Mutant Succinic acid 1 7 2 1 09 Lactic acid 24 0 0 Pyruvic acid 1 1 7 0 Formic acid 26 0 0 Acetic acid 51 49 Ethanol 80 1 5 47 Total product 1 93% 41% 206% 0? * * The molar yield values can theoretically be 200 percent because a glucose molecule can give two of all the products. When an atmosphere of 100 percent carbon dioxide is used, the production of succinic acid is increased with succinic acid concentrations reaching approximately 45 grams per liter, productivity reaching approximately 1.6 grams per liter per hour, yield per one hundred grams of succinic acid to grams of glucose reaching 99 percent and the weight ratio of succinic acid to acetic acid reaching about six.

I_E Succinic acid is also produced when the NAD-dependent mafic enzyme of E. co / f is produced in NZN 111 (by the addition and induction of the mazeA gene). In this case, the inductible plasmid pMEE2-1 was used to allow the expression of the malic enzyme gene in transforming NZN 111 (pMME2-1). The genomic DNA isolated from MC1061 E. coli was used as a standard to clone the malic enzyme by PCR. MC1061 was digested E. coli with restriction endonucleases Hind III and Pst I, with the resulting digested materal sized on 1 percent TAE agarose gel. The size of the genomic DNA fragment containing the malic enzyme gene was determined using analysis of Southern blots with the Nucleic Acid Detection System PhotoGene (Cat. 8192SA), as described above. -The primers were based on the published partial DNA sequence of the gene: TSentido:, CGAAGAACAAGCGGAACGAGCAT; "Contrasent: GGCAGCAGGTTCGGCATCTTGTC; These primers were combined in 1 microliter (μM) with approximately 20 nanograms (ng) of genomic DNA in a normal 100 microliter (μl) PCR reaction that produced the 0.8 kilobase (kb) internal fragment of the gene of the malic enzyme.

The PCR product was purified using an Extraction Equipment Qiaex Gel (Qiagen, Inc., Chatsworth, California) and biotinylated using a BioNick Marking System (GibcoBRL, Gaithersburg, Maryland).

The biotinylated PCR product was used as the probe in the analysis of Southern blots of £ genomic DNA. coli that separated with HindJIl and one of several other second endonucleases. The malic enzyme gene was determined to be located in the region containing fragments of 2.0-2 5 kb of DNA digested with Hind III and Pst I. One microgram of E coli DNA was digested with Hind III and PST I and sized in a 1 percent preparative TAE agarose gel. DNA fragments of E. coli in the 2.0-2.5 kb region were isolated and purified using the Qiaex Gel Extraction Kit. The purified DNA fragments were ligated into the polylinker region of pUC19 which was separated with Pst 1 and Hind III and treated with shrimp alkaline phosphatase. The ligated material was then used as a standard for a PCR reaction to amplify the entire malic enzyme gene. One microliter of the ligation mixture was used as a standard with 1 μM of the sense primer GATGCCCCATGGATATTCAAAAAAGAGTGAGT, which was directed to the malic enzyme gene, and 0.25 μM of the TTTTCCCAGTCACGACGTTG antisense primer, which was directed to the ligated pUC19 DNA. The amplification parameters were denaturation at 94 ° C, hybridization at 55 ° C for one minute and an exemption of 72 ° C for three minutes for a total of 35 cycles. The PCR product was analyzed in a percent of TAE-agarose gel and the 1.8 kb fragment was isolated and purified using the Qiaex Gel Extraction Kit. A portion of the PCR product was digested with Bel and Bgl to demonstrate that the product contained the ia gene • 2ß malic enzyme. The challenge of the PCR product was digested with Pst I and Neo I, gel isolated, repurified and then ligated into the polylinker region of the expression vector pTRC99a (Pharmacia, Píscataway, New ersey) which was separated with Neo I and Pst I The NZN III of the E. coli strain was transformed with the ligation mixture by normal methods and the resulting colonies (four colonies of the experimental and 2 colonies of the control) were screened for the gene of the malic enzyme by fragment analysis. restriction using Xmn (fragments of 0.7 kb, 1.4 kb and 3.9 kb are expected). The plasmid containing the gene of the cloned malic enzyme was named pMEE3. A 100 ml culture of NZN (pMEE3) was grown in a culture overnight and the plasmid was isolated using a Qiagen Plasmid Kit. The isolated plasmid was used as a standard for the PCR reaction. A new primer was designated to give an alternative N-terminus that had 81 base pairs downstream of the primer used in the first cloning of the malic enzyme. Twenty nanograms of plasmid were used as a standard with 1 μM of sense primer AGGATCCATGGAACCAAAAACAAAAAAC and a counter-sense primer CGCCAGGGTTTTCCCAGTCACGAC. The amplification parameters were the same as those observed before. A portion of the PCR product was again verified by restriction mapping with Bel I and Bgl I that verified that the product contained the malic enzyme gene. The rest of the PCR material was digested with Pst I and Neo I and gel isolated, repurified and then ligated into the polylinker region of the expression vector pTRC99a (Pharmacia, Inc. Piscataway, NJ) which was separated with Neo I and Pst I. The E. coli strain JM109 was transformed with the ligation mixture by normal methods and the resulting colonies (three experimental clones and one control clone) were screened for the desired insert by restriction fragment analysis. The plasmid containing this version of the malic enzyme gene was named pMEÉ2. Thirty milliliters of LB broth containing 100 μg / ml of ampicillin was inoculated with 1.5 ml of an overnight culture of pMEÉ2. After two hours of growth, the 30 ml culture was separated in 3-10 ml aliquots. The activity of the enzyme was induced 'with 0, 100 μM and 10 μM of isopropylthiogalactoside (IPTG). A 2 ml sample was removed from each culture at 0, 1, 2, 3, and 4 hours The protein was isolated according to normal methods and the activity was determined as previously observed. The production of enzyme, with time, was described in the following Table 2. Table 2 Production of malic enzyme induced by IPTG in batches of LB Time (hour Without IPTG IQOuM IPTG 10 uM of IPTG μg / min / mg protein 0 3.09 1 4.83 26.5 5.84 2 4.26 38.2 10.06 8. 46 75.3 32.7 9.92 88.2 38.95 The cultures in duplicate of NZN 111 (pMEE2) and, as a control, NZN 111 (pTRC99a) were aerobically developed in 2 ml of LB medium containing ampicrin. A culture of each was induced with 10 μM IPTG. After three hours, the OD60o from 0.6 to 4.8. One milliliter of the cultures were injected into 50 ml flasks containing 10 ml of LB medium containing glucose at 20 g / l, acetate at 1 g / l and 0.5 g of solid MgCO3. The atmosphere consisted of air: hydrogen; carbon dioxide in a ratio of 1: 1: 2 at a pressure of 1 atm above the ambient pressure. The crop was sampled immediately and at intervals -during incubation at 37 ° C with ~ agitation at 100 rpm. The following table 3 provides a comparison of product yields when NZN Ti 1 was transformed with the crude vector (pTRC99a) against pMEE2. Table 3 Effect of expression of malic enzyme in NZN 111 (pMEE2) against NZN 111 (pRTC99a) Product Vector maeA g / L - Succinic acid 0.3 6.5 Lactic acid 0.4 0.4 Acetic acid 0 0 ~ - Ethanol 0 0.2 The results described in Table 3 are the result of the incubation periods between approximately 19 and 42 hours. I malic acid, a precursor of succinic acid is in principle a better end product than succinic acid, in that its production requires a less reductive step. The theoretical stoichiometry for the production of malic acid is one mole of glucose and two moles of carbon dioxide converted to two moles of malic acid. As such, the production of malic acid could occur without wasting? glucose. It is also possible to form fumaric acid, which is the dehydration product of malic acid and the succinate precursor in the reduction route. Both malic acid and fumaric acid could be formed without the production of co-product, but the superior solubility of malic acid makes it preferable for large-scale production processes. The transformation of suitable bacteria with a gene responsible for the production of the malic enzyme (such as maeA) could result in an excess of malate. Generally, the ideal bacteria might lack lactate dehydrogenase activity and other enzymes that metabolize pyruvate, giving as resulting in an accumulation of pyruvate. Bacteria were transformed with maeA to directly produce malate. In order to maintain the high levels of malate produced, the bacteria should not be able to convert the malate back to lactate, or to fumarate or succinate. As for some strains of Lactgbacillus lacks the enzyme ^ malolactate, fumarase and fumarate reductase responsible for such conversions, these strains are particularly suitable candidates for the production of malate in fermentation processes. The suitability of Lactobacillus is increased more given its very high osmotolerant characteristics. Lactobacillus gasseri is an almost terminal host for such manipulation since it has been shown that it does not metabolize malate during glucose fermentation and is fairly well characterized genetically. Lactobacillus casei also has considerable potential in that it exhibits relatively superior osmotolerance than L. gasseri. In general, a malic enzyme gene (such as maeA) at a suitable lactobacillus expression vector, such as pTRK327 induced in a lactqbacillus host lacking a functional lactate dehydrogenase gene, could allow the formation of malic acid. This could be achieved by the insertion of the malic enzyme in the lactate dehydrogenase host gene. The chemicals used for the following examples for the production of carboxylic acids include: yeast extract and tryptone (Difco), glucose (AE Staley), light infusion water (MaTz AE Staley processing plant in Loudon, Tn.) , inorganic chemicals (E. Merck Science or J.T. Baker, reagent grade). The equipment used includes: fermenter-1 L (Virds), fermenter-5 L (New Brunswick, Bioflow 3000), pumps (Cole-Parmer, Master Flex), pH probes (Cole-Parmer), controllers pH (Cole-Parmer, Chem Cadet), dissolved oxygen meter (Cole-Parmer, 01971 -00), dissolved oxygen probes (Ingold), autoclave (Amsco, Eagle 3000), Agitator (New Brunswick), cryogenic bottles (Colé Parmer) The glucose analyzer came from Yellow Springs Instrument Company / YSI 2700 Select). In addition, the spectrophotometer for the measurement of OD is Milton Roy (SPEC 21 D) "The strain of E. coli AFP-1 1 was obtained from Argonne National Laboratory.The strain of AFPO-1 1 was derived from NZN-1 11. The concentrated culture was prepared by placing 1 g of magnesium carbonate (MgCO3) in a 250 ml flask, covering it with a foam sealant and * autoclaving at 121 ° C for 20 minutes. Then, a medium of 500 was prepared my containing tryptone 10 g / l, yeast extract 5 g / l, glucose 5 g / l, sodium chloride (NaCl) 10 g / l, potassium phosphate (K2H PO4) 7 g / l, potassium phosphate (KH2PO4 3 g / l The medium was then placed in an autoclave at 121 ° C for 20 minutes and allowed to cool to room temperature Fifty milliliters of the medium were transferred aseptically to the first flask containing the magnesium carbonate The flask was inoculated then with a complete inoculation cycle of AFP-1 1 1 of an inclined agar sent from Argonne National Laboratory. The inoculated flask was then incubated on a shaker at 250 rpm at 37 ° C. ^ Next, a one liter medium containing tryptone was prepared "10 g / T, yeast extract 5 g / l, glucose 5 g / l, NaCl 10 g / l, K2H PO4 3 g / l and magnesium sulfate (MgSO) 0.2 g / l The medium was placed in Autoclave at 121 ° C for 20 minutes and allow to cool. Then, 850 ml, were aseptically transferred to a 1 liter fermenter. -When the 250 ml flask was incubated for 16 hours, all its contents were transferred aseptically to the 1 liter fermentor. The fermenter was maintained at 37 ° C and at a pH of 7.0. Air was diffused into the bottom of the fermenter and the speed of the propellant was set at 500 rpm or more to ensure the transfer of sufficient oxygen to the fermentation broth to avoid oxygen limitation. The pH was maintained at 7 by a pH controller which activated a pump on demand to add a base solution to the fermenter. The base solution was prepared by placing 250 ml of deionized water in a graduated cylinder of 500 ml with a stirring rod. The graduated cylinder was covered with two layers of autoclave paper cover and autoclaved at 121 ° C for 20 minutes, then it was allowed to cool to room temperature. Then, 250 ml of 30% ammonium hydroxide (N H 4 OH) was added. Then, an upper layer of oil was added to prevent the escape of ammonia. The oil was autoclaved at 121 ° C for 20 minutes before it was added to the cylinder. The solution was mixed by stirring in a magnetic plate. The resulting base solution was a 15% solution of N H4Ofl. - '' To form a glycerol solution, 15 g of glycerol was placed in a small flask to which 15 ml of deionized water was added, a small stirring rod was added to the flask and then the flask was covered with a stopper. of foam and mixed in a magnetic plate to form a 50% glycerol solution. The glycerol solution was autoclaved at 121 ° C for 20 minutes, then allowed to cool to room temperature. When the glucose concentration in the fermentor was about 1 g / l, 30 ml was removed aseptically from the fermenter and added to the 50% glycerol flask. Then the mixture was stirred on a magnetic plate. The mixture was then transferred aseptically to cryogenic bottles (sterilized before packaging by the manufacturer), about 1.2 ml per bottle. The bottles were sealed and stored in a freezer at -70 ° C. These flasks served as a concentrated culture of AFP-111 for all of the following examples. EXAMPLE 1 The inoculum was developed in a shake flask. The medium contained tryptone at 10 g / l, yeast extract at 5 g / l, glucose at 5 g / l, NaCl at 10 g / l, K2HPO4 at 14 g / l, KH2PO6 at 6 g / l, (NH4) 2SO4 at 2 g / l and MgSO at 0.2 g / l. Fifty milliliters of medium was placed in a 250 ml flask. The flask was capped, autoclaved at 121 ° C for 20 minutes, cooled to room temperature and inoculated with 1 ml of a concentrated culture flask. It was then incubated at 37 ° C at 200 rpm for 16 hours. The fermentation medium contained tryptone at 10 g / l, yeast extract at 5 g / l, glucose at 5 g / l, NaCl at 10 g / l, K2HPO4 at 1.4 g / l, KH2PO4 at 0.6 g / l, (NH4) 2SO4 at 2 g / l and MgSO4 at 0.2 gl. One liter of the medium was prepared, autoclaved at 121 ° C for 20 minutes and allowed to cool to room temperature before 850 ml were transferred to the 1 I fermenter. The fermenter was inoculated with the entire contents of the flask, (the fermentation medium contains low * glucose concentrations of less than 10 g / l). The fermentation was carried out at 37 ° C and at a pH of 7.0 with aeration. The pH was maintained at 78.0 by adding a solution of 15% NHOH on demand through the action of a pH controller. When the initial glucose in the fermentation broth was exhausted, a feed pump was switched on to add a feed solution to the fermenter. J_a feed solution (solution 1) was formed by dissolving 250 g of glucose and 50 g of light infusion water in 400 ml of deionized water. This solution 1 was placed in an autoclave at 121 ° C for 20 minutes and cooled to room temperature. Then for solution 2, NaCl was dissolved at 5 g / l, K2HPO4 at 7 g / l, KH2PO4 at 3 g / l, (NH) 2SO4 at 22.5 g / l and MgSO at 1 g / l were dissolved in 100 ml of deionized water. The solution was then autoclaved at 121 ° C for 20 minutes, cooled to room temperature and added to solution 1. The resulting solution was used as the feed to the fermenter. The speed of the feed pump was manually controlled to maintain the residual glucose concentration in the fermenter at or below 1 g / l. When the glucose concentration was raised above 1 g / l, the pump speed was reduced. When the glucose concentration was very high, approximately 5 g / l or higher, the pump was turned off until the glucose concentration decreased below 1 g / l. During the first 24 hours, the fermenter was aerated to provide an aerobic environment which allowed the organism to grow to a high cell density. The optical density measured at 660 nm (OD6eo) was 24 at 24 hours. The air was then turned off to establish an anaephobic environment to force the organism into anaerobic metabolism for the production of succinic acid. The anaerobic condition was maintained until the end of the experiment. During the anaerobic stage, the glucose concentration was maintained at, or above, 1 g / l. The results of Example 1 were plotted in Fig. 1 and summarized in Table 4 below. TABLE 4 Concentration of final succinic acid (g / L) 40.5 Overall yield (succinic acid g / glucose 0.54) Performance during the production phase (g succinic acid / g glucose) 0.95 Global productivity (g / L-h) 0.21 Production phase during productivity (g / L-h) 0.24 Concentration of succinic acid at 47 hours (g / L) 17.9 Productivity at 47 hours (g / L-h) 0.38 Molar ratio of succinate / final acetate 1.35 ^ EXAMPLE 2 The experiment in this example was carried out in exactly the same way as Example 1, except that the air was turned off after six hours instead of after 24 hours. At the time the air was turned off, the OD66o was 6. The results are plotted in Fig. 2 and summarized in the "^ ¡R TABLE 5.

TABLE 5 Fermentation time (h) 24 47 Succinic acid concentration (g / L) 16.0 29.20 Productivity (g / L-h) 0.67 0.62 -The results indicated a significant improvement by transition from aerobic to anaerobic conditions in the fermenter. EXAMPLE 3 The medium used in this example contained the following: yeast extract at 2 g / l, tryptone at 15 g / l, NaCl at 2 g / l, (NH 4) 2 SO 4 at 2 g / l, 'CaC at 0.6 g / l, MgSO4 at 0.5 g / l, KH2PO4 at 1.3 g / l, MnCl2 at 0.01 g / l.

Four fermentations were carried out in the five liter fermenter. The pH in these experiments was controlled to 6.2, 6.6, 7.0 and 7.4 by adding NaOH on demand. The inoculum originated in a shake flask using the same medium adjusted to pH 7.0. In the fermenters, the cells were developed aerobically with air diffusion and "propellant" velocity at 500 rpm until the ODβ reached 6 (approximately 5 to 6 hours) .Then the agitation was reduced to 250 rpm and effused gas changed to dioxide of pure carbon.

": The results for EXAMPLE 3 were plotted in Figure 3 and summarized in TABLE 6. TABLE 6 is a comparison of fermentation results at 100 hours at different pH values TABLE 6 6.2 6.6 7.0 7.4 Succinic acid (g / L) 23.3 35.7 30.1 27.5 Acetic acid (g / L) 3.3 5.3 6.3 6.0 Glucose used (g) 126 224 193 1.84 Fermentation in volume (L) 3.6 4.3 4.4 4.5 Yield (succinic acid g / glucose g) 0.67 0.68 0.69 0.67 Molar ratio of succinate: acetate 3.6 3.4 2.4 2.3 The results indicate that succinic acid could be produced on a wide pH scale, preferably at a pH of about 6.6 to 7.0. EXAMPLE 4 In this example, yeast extract and tryptone were replaced by light infusion water, which is a very low cost byproduct of the corn processing industry. The light infusion water was prepared by adjusting the pH of the infusion water to 7.0 with 50% NaOH. The suspended solids were removed by filtration through a Whatman No. 2 filter paper. The clear filtrate was used in the fermentation experiment.

The inoculum was developed in a shaking flask. A solution was prepared with the following: NaCl at 20 g / L, K2PO4 at 28 g / L, KH2PO4 at 12"g / L, (NH4) 2 SO4 at 4 g / L, MgSO at 0.4 g / L. it was placed in an autoclave at 121 ° C for 20 minutes, then 30 ml of the light infusion water filtrate was added to a 250 ml flask, the flask was capped, autoclaved at 121 ° C for 20 minutes and then The solution was allowed to cool to room temperature, then 30 ml of solution 1 (from Example 1) was added to the flask, therefore, this medium contained 50% filtration of light infusion water.The flask was inoculated with 0.1 ml of an concentrated glycerol culture flask (Example 1) and incubated at 35 ° C and 200 rpm for 16 hours rA solution 2 was prepared with the following: NaCl at 20 g / l, K2HPO4 at 2.8 g / l, KH2PO4 at 1.2 g / l, (NH4) 2SO4 at 4 g / l and MgSO4 at 0.4 g / l This solution was then placed in an autoclave at 121 ° C for 20 minutes and allowed to cool to room temperature.The one liter fermenter was they added 425 My light infusion water filtration. The fermenter was placed in an autoclave at 121 ° C for 20 minutes and allowed to cool to room temperature. Then, 425 ml of solution 2 was added to the one liter fermenter resulting in the fermentation medium to contain 50% of the light infusion water filtrate. The fermentor was inoculated with all the contents of the shake flask. The fermentation was carried out at 37 ° C and at a pH of 7.0. The pH was maintained at 7.0 by adding a 1.5 M sodium carbonate solution upon demand. This The solution was sterilized by autoclaving at 121 ° C. The cells initially developed aerobically by diffusing air in the thermenator for six hours. The dissolved oxygen was monitored during this period. Occasionally, the level of dissolved oxygen decreased to less than 5% saturation, but with the continuous diffusion of air, the condition inside the fermentor was still aerobic. At the end of that period, the air was turned off to begin the production of succinic acid by anaerobic metabolism of the organism. At the same time, a pump was started to feed • r -? -a solution containing approximately 500 g / l of glucose ai fermentor. The speed of the feed pump was adjusted manually to maintain the concentration of glucose in the fermentation broth greater than or equal to 1 g / l. - * The results of Example 4 were plotted in Figure 4 and summarized in Table 7. Table 7 shows the accumulation of succinic acid in 50% of the light infusion water fermentation medium. TABLE 7 Fermentation time (h) 24 48 99 Succinic acid concentration (g / L) 11.9 25.5 51.0 Productivity (g / L-h) 0.50 0.53 0.52 These results indicated that succinic acid could be produced in an expensive environment in which both the Yeast extract as the triptone expensive by the low-cost light infusion water. EXAMPLE 5 In this example, the concentration of light infusion water in the shake flask and the fermentation medium was reduced to 25%. Others, conditions were exactly the same as those described in TEACH 4. Water was added to form the volume deficit due to the lower amounts of light infused water used. The results were plotted in Figure 5, and summarized in Table 8. Table 8 shows the accumulation of succinic acid in '25% light infusion water fermentation medium.

'? "TABLE 8 Fermentation time (h) 24 48 97 Concentration of succinic acid (g / L) 20.9 35.7 46.3 Productivity (g / L-h) 0.87 0.74 0.48 - The results indicated that succinic acid could be produced in an even more economical medium in which the slight infusion was reduced to 25%. EXAMPLE 6 In this example, the concentration of light infusion water in the shake flask and the fermentation medium was 25% and the base was 1 .5M ammonium carbonate. Other conditions were the same as described in Example 4. The results were plotted in Figure 6 and summarized in Table 9 which shows the accumulation of succinic acid in 25% fermentation medium of light infusion water with sodium carbonate. ammonium for pH control.

TABLE 9 Fermentation time (h) 24 48 Succinic acid concentration (g / L) 14.8 24.9 Productivity (g / L-h) 0.62 0.52 The results indicated that carbonate salts other than sodium carbonate, such as ammonium carbonate, magnesium carbonate, etc. , could be used for pH control in a succinic acid fermentation process. EXAMPLE 7 In this example, four experiments were described. In two experiments, the concentration of light infusion water in the shake flask and the fermentation medium was 25% and the base was 2M NaOH. In the other two experiments, the concentration of light infusion water was 50% and the base was 15% N H OH. Within each group of two experiments that used the same base for pH control, the pure carbon dioxide diffused in the fermenter at approximately 100 ml per minute. in an experiment during the anaerobic phase for the production of succinic acid by anaerobic metabolism. The results were plotted in Figure 7 and summarized in Table 10. Table 10 shows the accumulation of succinic acid in fermentation medium of light infusion water with ammonium hydroxide and sodium hydroxide for pH control.

TABLE 10 Base ^ NaOH With CO? S i n CO? Fermentation time (h) 48 72 48 72 Concentration of succinic acid _ (g / L) 17.5 23.9 6.0 6.0 Productivity (g / L-h) 0.36 0.33 0. 1 3 0.08 Base = N H4OH With CO? Without CO? Fermentation time (h) 48 72 46 52 Concentration of succinic acid (g / L) 22.5 33.4 8.7 8.4 Productivity (g / L-h) 0.47 0.46 0.19 0.16 The results indicated that if a base other than a carbonate salt base was used for pH control, diffusing carbon dioxide gas in the fermenter during the anaerobic phase could be needed for the important production of succinic acid.

The present invention also provides a method for producing malic acid via fermentation. ~ Malic acid, a precursor of succinic acid, is in principle a better final product than succinic acid, in that its production requires a less reductive step. The theoretical stoichiometry for malic acid production is one mole of glucose and two moles of carbon dioxide converted to two moles of malic acid. As such, the production of malic acid can occur without glucose waste. Fumaric acid can also be formed, which is the dehydration product of malic acid and the succinate precursor in the reduction route. Both malic acid and fumaric acid can be formed without the production of co-product, but the superior solubility of malic acid makes it preferable for large-scale production processes. The present invention can also be a continuous fermentation process consisting of a fermentor and an establishment tank. Cells that settle to the bottom of the establishment tank are returned to the fermenter to increase cell concentration which in turn increases productivity. It has been observed that the cells flocculated and settled extremely well when mixing was stopped. The succinic acid was also produced through a continuous fermentation process consisting of a fermentor and an ultrafiltration unit. The cells recovered in this unit were returned to the fermenter to increase cell concentration which in turn increases productivity. The removal of fermentation products from the broth by the ultrafiltration unit alleviates product inhibition and increases yield. Succinic acid is also produced through a continuous fermentation process in which an adsorbent is added to, and removed from, the fermenter continuously. The removal of fermentation products from the broth relieves the inhibition of the product and increases the yield. Succinic acid is also produced through a batch process consisting of two series-based solvents. The organism was developed under aerobic conditions in the first fermentor (growth fermentor) at high cell density. The biomass was then transferred to the second fermentor (production fermentor) where the anaerobic conditions are applied to promote the production of succinic acid. The growth fermentor can be cleaned and used to form more biomass in order to transfer it to another production fermenter. Since the production time is much longer than the growth time, a growth fermentor can be used to provide biomass for a number of production plants. While it was shown and described what is currently considered the preferred embodiments of the invention, it will be obvious to those skilled in the art that various changes and modifications may be made herein, without departing from the scope of the invention defined by the claims. annexes. coli and Lactobacillus. which in turn increases productivity. The removal of fermentation products from the broth by the ultrafiltration unit alleviates product inhibition and increases yield. 'Succinic acid is also produced through a continuous fermentation process in which an adsorbent is added to, and removed from, the fermenter continuously. The removal of fermentation products from the broth relieves the inhibition of the product and increases the yield. i-Succinic acid is also produced through a batch process that consists of two series of solvents. The organism was developed under aerobic conditions in the first fermenter ^ (growth tester) at high cell density The biomass was then transferred to the second fermentor (production fermenter) where the anaerobic conditions are applied to promote the production of succinic acid.The growth fermenter can be cleaned and used to form more biomass in order to transfer it to another production fermenter Since the production time is much longer than the growth time, a growth fermenter can be used to provide biomass for a number of production fermenters. it was shown and described what is currently considered the preferred embodiments of the invention, it will be obvious to those skilled in the art that various changes and modifications may be made herein, without departing from the scope of the invention defined by the appended claims .

Claims (20)

1. t REVIVAL DICTION IS 1. A method for producing carboxylic acids comprising the steps of a) inoculating a medium having a carbon source with an organism producing carboxylic acid having a biomass; b) incubating said organism in an aerobic atmosphere to promote the rapid growth of said organism thus increasing the biomass of the organism, c) releasing in a controlled manner the oxygen to maintain the aerobic atmosphere; d) feeding in a controlled manner to said organism a solution containing said carbon source to maintain a concentration of the carbon source within said medium of approximately 0.5 g / l to approximately 1 g / l; e) depriving said aerobic atmosphere of said oxygen to produce an anaerobic atmosphere to cause said organism to undergo anaerobic metabolism; "f) feeding in a controlled manner to said organism said solution containing said carbon source to maintain a concentration of the carbon source within the medium of> 1 g / l; and g) converting said carbon source to carboxylic acids using the anaerobic metabolism of said organism 2. The method of claim 1, wherein the organism is selected from the group consisting of the bacteria Escherichia coli and Lactobacillus -3. The method of claim 1, wherein said organism is osmotolerant whereby said organism is capable of producing organic acids without any inhibition of the metabolism of said organism. 4. The method of claim 2, wherein said Escherichia coli is AFP-111. ^ 5. The method of claim 2, wherein said organism is an Escherichia coli bacterium derived from a parent organism that lacks genes for pyruvate forma lyase and lactate dehydrogenase. ^ 6. The method of claim 1, wherein the organism is genetically engineered to express an enzyme that allows said organism to be converted to dicarboxylic acid pyruvate. The method of claim 6, wherein said enzyme is malic enzyme. The method of claim 7, wherein the organism using said anaerobic metabolism produces succinic acid, acetic acid and ethanol, wherein succinic acid is the main product. .9. The method of claim 7, wherein said organism using said anaerobic metabolism produces malic acid, acetic acid and ethanol, wherein said malic acid is the main product. .10. The method of claim 7, wherein the organism using said anaerobic metabolism produces fumaric acid, acetic acid and ethanol, wherein fumaric acid is the main product. 11. A method for producing carboxylic acids comprising: a) inoculating a medium having a carbon source with an organism that produces carboxylic acid having a biomass; b) incubating said organism in an aerobic atmosphere to promote the rapid growth of said organism thus increasing said biomass of the organism; c) release in a controlled manner the oxygen to maintain the aerobic atmosphere; d) feeding in a controlled manner to said organism a solution containing said carbon source to maintain a concentration of the carbon source within said medium of approximately 0.5 g / l to approximately 1 g / l; - e) depriving said aerobic atmosphere of said oxygen to produce an anaerobic atmosphere to cause said organism to undergo anaerobic metabolism; "F) feeding in a controlled manner to said organism said solution containing said carbon source to maintain a concentration of the carbon source within the medium of > 1 g / l; and -g) converting said source "from carbon to carboxylic acids using the anaerobic metabolism of said organism. 12. The method of claim 1, wherein the organism is selected from the group consisting of the bacteria Escherichia coli and Lactobacillus. f13. The method of claim 1 1, wherein said organism is osmotolerant so that said organism is capable of producing organic acids without any inhibition of the metabolism of said organism. 14 The method of claim 12, wherein said Escherichia coli is AFP-1 1 1. 15. The method of claim 12, wherein said organism is an Escherichia coli bacterium derived from a parent organism that lacks genes for pyruvate forma lyase and lactate dehydrogenase. 16. The method of claim 1, wherein the organism is engineered to express an enzyme that allows said organism to be converted to dicarboxylic acid pyruvate.; 17. The method of claim 16, wherein said enzyme is malic enzyme. ** 18 The method of claim 17, wherein the organism using said anaerobic metabolism produces succinic acid, acetic acid and ethanol, wherein succinic acid is the main product. The method of claim 17, wherein said organism using said anaerobic metabolism produces acid malic, acetic acid and ethanol, wherein said malic acid is the main product. ,twenty. The method of claim 17, wherein the organism using said anaerobic metabolism produces fumaric acid, acetic acid and ethanol, wherein fumaric acid is the main product The present invention is an economical fermentation method for the production of carboxylic acids comprising the steps of: a) inoculating a medium having a carbon source with a carboxylic acid producing organism; b) incubate the carboxylic acid producing organism in an aerobic atmosphere to promote the rapid growth of the organism thus increasing the biomass of the organism; c) release in a controlled manner the oxygen to maintain the aerobic atmosphere; d) controlled feeding of the organism having increased biomass with a solution containing the carbon source to maintain the concentration of the carbon source within the medium of about 0.5 g / l to about 1 g / l; to the aerobic atmosphere of oxygen to produce an anaerobic atmosphere in order to cause the organism to undergo anaerobic metabolism, f) controllably feed the organism having increased biomass with a solution containing the carbon source to maintain the concentration of the source of.} carbon within the medium> g / l; and g) converting the carbon source to carboxylic acids using the anaerobic metabolism of the organism.