MXPA99005596A - Oil bodies and associated proteins as affinity matrices - Google Patents

Abstract

A method for the separation of a target molecule from a mixture is described. The method employs oil bodies and their associated proteins as affinity matrices for the selective, non-covalent binding of desired target molecules. The oil body proteins may be genetically fused to a ligand having specificity for the desired target molecule. Native oil body proteins can also be used in conjunction with an oil body protein specific ligand such as an antibody or an oil body binding protein. The method allows the separation and recovery of the desired target molecules due to the difference in densities between oil bodies and aqueous solutions.

Description

OLEOUS BODIES AND PROTEINS ASSOCIATED AS MATRICES OF AFFINITY FIELD OF THE INVENTION This invention relates to the use of oil bodies and their associated proteins as affinity matrices for the separation and purification of white molecules from samples. BACKGROUND OF THE INVENTION Within the general field of biotechnology, the ability to effectively separate and purify molecules from complex sources, such as living cells, blood serum or fermentation broth, is of critical importance. There are numerous applications in industry and research laboratories (where, for example, purified or partially purified proteins are used) and are well documented in the previous literature. See, for example, R. Meadon and G Walsh in Biotechnological Advances 1994, 12: p. 635-646. Most of the techniques currently used for the separation of molecules are capitalized on the innate physical and chemical properties of the molecule of interest. The affinity-based purification technology is unique in that they exploit the highly specific biological recognition between two molecular species that form an affinity pair. The union of two affinity pair entities occurs in almost all cases as a result of relatively weak chemical interactions known as non-covalent bonds. Some commonly recognized and commonly used affinity pairs include antibodies and their antigenic binding substances, nucleic acid binding proteins and binding proteins and nucleic acid and lipid binding proteins, as well as lipids, lectins and carbohydrates, complexes of streptavidin / biotin, protein A / immunoglobulin G complexes and receptors and their binding molecules. In general, affinity-based purification processes require that one member of the affinity pair be immobilized on a solid substrate or matrix that is insoluble in the fluid in which the other member of the pair resides. The molecular species of the affinity pair bound to the matrix is generally referred to as the ligand, while the soluble member is usually referred to as a white member. However, it is important to note that these definitions do not impose any restrictions in a strict chemical sense. The vast majority of current ligand immobilization techniques are based on physical or chemical approaches. The immobilization of physical ligands involves the adsorption or entrapment of the ligand with a suitable support, while the chemical mode of immobilization is characterized by the formation of strong bonds or covalent bonds between the ligand and the matrix. It is a requirement that the immobilization be achieved in such a way that the ability of the members of the affinity pair to recognize each other is not adversely affected by the immobilization procedure.

It is a disadvantage of the physical and chemical techniques available to immobilize ligands, that frequently the production processes are slow and expensive. This is mainly due to the fact that the immobilization techniques require the separate production of the matrix material and ligands, which must be coupled in a subsequent step. An alternative way to immobilize proteins is described in the U.S. Patent. No. 5,474, 925 documenting a biological production system for the immobilization of enzymes in the fiber of cotton plants. This patent describes what is thought to be the first immobilization system of biologically produced enzyme and allows production in a matrix and ligand passage. After immobilization of the ligand on the matrix, a variety of affinity-based purification techniques can be employed to achieve selective binding between the affinity-immobilized ligand and the target member. Affinity-based purification techniques, known in the prior art, include perfusion affinity chromatography, affinity repulsion chromatography, hyperdiffusion affinity chromatography, affinity precipitation, affinity division of membranes, affinity cross-flow ultrafiltration and affinity precipitation. In the widely used affinity-based purification technique, affinity chromatography, a matrix containing a ligand is coated, or packed, into a chromatographic column. A complex mixture containing the white member is then applied to. the chromatographic column. Ideally, only the target molecules that specifically recognize the ligand bind in a non-covalent form to the chromatographic column, while the other molecular species present in the sample pass through the column. In the affinity division, two solutions of substantially different densities are employed. The solution of complexes containing the white member is mixed with a solution of a different density containing an affinity ligand. After mixing, the solutions are allowed to be established in order to allow the formation of two separate phases. The molecules tend to divide differentially between the phases depending on their size, charge and specific interactions with the phase formation solutions. The white protein bound to the ligand selectively divides the phase containing the affinity ligand. For example, Caughlin and Baclaski in Biotechnology Progress, 1990 6: 307-309 reported the use of isooctane in organic solution containing biotin to transfer avidin from an aqueous solution to the isooctane solution. However, affinity division applications have been largely limited primarily due to the current lack of availability of suitable affinity matrix substances that can be employed in the specific division into two phase systems. An important factor for the commercial development of biotechnology is the purification of bioproducts, which are usually 50% or more of the total cost (Labrou, N. and Clonis, YD in the Journal of Biotechnology 36: 95-1 19 (1994)). ). Many protein purification steps are based on separation procedures of the column type. In particular, large scale separation techniques such as protein purification techniques based on column chromatography or batch type are expensive. In addition, the raw material is less suitable for column chromatography or batch separations, since contaminants can pass the sedimented resins and plug the columns. Therefore, affinity matrices are often only used in the last stage of purification processes, where substantial purity is critical, where proteins are present in extremely dilute concentrations, or where high protein levels are required. value, for example in diagnostic proteins and therapy. These and other aspects related to the use of affinity technology in biotechnological processes have been reviewed by Labrou, N. and Clonis, Y. D. in the Journal of Biotechnology 36: 95-1 19 (1994). There is a need in the art to develop novel and inexpensive methods for separating and purifying biological products from complex mixtures. The inventors of the present have found that the storage structures of subcellular oil, known as oil bodies and their associated proteins, are useful in this aspect. COMPENDIUM OF THE INVENTION The present invention relates to a novel versatile biological system for the production of affinity matrices. The inventors of the present have found that oil bodies and their associated proteins can be used as affinity matrices for the separation of a wide variety of target molecules such as proteins, carbohydrates, lipids, organic molecules, nucleic acids, metals, cells and fractions of cells in a sample. According to the invention, a method is provided for the separation of a target molecule from a sample comprising: 1) contacting (i) oily bodies that can associate either directly or indirectly with the target molecule with (ii) a sample containing the molecule White; and 2) separating the oily bodies associated with the sample bank molecule. The oil bodies and the sample containing the target molecule are contacted in a manner sufficient to allow the oil bodies to associate with the bank. Preferably, the oil bodies are mixed with the target. If desired, the white molecule can be further separated from the oil bodies. In one aspect, the target molecule has affinity for, or binds directly to, the oil bodies or the body protein, examples of such targets include antibodies or other proteins that bind to the oil bodies. In another aspect, a ligand molecule can be used to associate the target molecule with the oil bodies.

In one embodiment, the ligand has natural affinity for oil bodies or oil body protein. In a specific embodiment, the ligand is an antibody that binds to the oily body protein. Said antibody can be used to separate targets that have affinity for the ligand antibody such as anti-IgG or protein A antibodies. A bivalent antibody can also be prepared having binding specificities for both the oil body and the target protein. The antibody to the oily body protein can also be fused to a second ligand that has an affinity for the target. In another embodiment, the ligand is covalently bound to the oil bodies or the oil body protein. In one embodiment, the ligand is a protein that is chemically conjugated or produced as a fusion protein with the oily body protein (as described in WO 96/21029). In the latter case, the fusion protein is directed to, and expressed over, the oily bodies. In one example, the ligand fused to the oily body protein can be hirudin and can be used to purify thrombin. In another example, the ligand fused to the oily body protein can be metallothionine and can be used to separate the cadmium from a sample. In a further example, the ligand fused to the oily body protein can be protein A and can be used to separate immunoglobulins. In yet another example, the ligand fused to the oily body protein can be cellulose binding protein and can be used to separate cellulose from the sample. In another embodiment, the ligand can be covalently bound to the oil bodies. For example, the ligand can be a small organic molecule such as biotin. The biotinylated oily bodies can be used to separate avidin from a sample. The present invention also includes modified oily bodies for use as an affinity matrix. Accordingly, the present invention includes a composition comprising oily bodies associated with the molecule, such as a ligand molecule or a target molecule. In one embodiment, the composition comprises oily bodies covalently bound to a ligand molecule, such as biotin. The present invention also includes an affinity matrix to be used for the purpose of separating a target molecule from a sample, comprising oil bodies that can be associated with the target molecule. The affinity matrix may additionally include a ligand molecule associated with the oil bodies, wherein the ligand molecule is capable of associating with the target molecule. Other objects, aspects and advantages of the present invention will be apparent from the following detailed description and accompanying drawings. However, it should be understood that the detailed description and associated examples are given by way of illustration only, and various changes and modifications thereof that are within the scope of the invention will be apparent to those skilled in the art. In addition, reference is made herein to various publications, patents and patent applications which are incorporated herein in their entirety by reference. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. The nucleotide and deduced amino acid sequence of the 18 KDa oleosin from Arabidopsis thaliana as shown in SEQ. ID. NO.1 and SEQ.ID.NO:2. Figure 2. Sequence of an oleosin-hirudin fusion of Arabidopsis. A portion of the genomic sequence of oleosins (base 1-1620 as reported in van Rooijen et al. 1992, Plant Mol. Biol. 18: 1177-1179), a separating sequence (base 1621-1635, underlined) and the synthetic DNA sequence encoding the isoform of mature hirudin variant-2 (base 1636-1833, in italic form). This gene fusion is regulated by the 5 'upstream region of the Arabidopsis oleosin (bases 1-861) and the nopaline synthase termination sequence (base 1855-2109). The sequence is also shown in SEQ.ID.NO:3 and SEQ.ID.NO:4. Figure 3. Describes the steps used in the construction of pCGOBHIRT, which contains the entire oleosin-hirudin construction.

Figure 4. Schematic diagram illustrating the configuration of the oleosin-hirudin fusion protein in the oily body and thrombin binding.

Figure 5. NaCl elution profiles of wild-type thrombin and matrices of the oil body 4A4 transformed with a construct expressing an oleosin-hirudin fusion. Figure 6. Purification of an anti-IgG antibody conjugated with horseradish peroxidase using an anti-oleosin antibody as a ligand. Schematic diagram illustrating the configuration of the oleosin / anti-oleosin / anti-IgG sandwich complex bound to an oily body. Figure 7. Illustrates the specific binding of anti-IgG antibodies to wild-type oily bodies complexed with anti-oleosin primary antibodies as a ligand (left) and the binding of anti-IgG antibodies from oil bodies that did not complex with the anti-IgG antibodies. primary antibodies before binding with secondary antibodies (right). Figure 8. Sequence of an oleosin fusion of metallothionine. The coding sequence of an oleosin cDNA from B. napus (bases 1092-1652, van Rooijen, 1993, Ph. D. Thesis, University of Calgary), a separating sequence (bases 1653-1670, underlined) and the mt-ll human metallothionine gene (bases 1671 -1876, Varshney and Gedamu, 1984, Gene, 31: 135-145)). The gene fusion is regulated by an Arabidopsis oleosin promoter (bases 1-1072) and ubiquite termination sequence (bases 1870-2361, ub3 '; Kewalleck et al., 1993, Plant Mol. Biol. 21: 673 -684). The sequence is also shown in SEQ. I D. NO: 6 and SEQ. I D. NO: 7.

Figure 9. Describes the steps used in the construction of pBIOOM3 'containing the entire oleosin-metalothionine construction. Figure 10. Schematic diagram illustrating the configuration of the oleosin-metalotionin fusion protein in the oily body and the binding of cadmium ions. Figure 11. Illustrates the binding (A) and the elution (B) of cadmium to an oily body matrix of wild type B. carinata seeds and seeds of B. carinata transformed with a construction expressing the fusion of the oleosin metallothionine gene . The percentage of the cadmium bound to the oil body fraction of an oil body fraction collected from the transgenic and non-transformed seeds is shown. The bars represent average values of 5 experiments per replicate (union) and 3 replicates (elusion). Figure 12. Illustrates the binding of S. aureus cells expressing protein A with oil bodies treated with varying amounts of anti-oleosin IgGs. The bars represent readings of OD6oo obtained following the procedures as described in Example 5 and using variable amounts of IgGs (0 μl, 3 μl, 30 μl, 100 μl of aggregated IgG). Figure 13. Oligonucleotide primers used to amplify the sequence of S. aureus protein A (The sequence is also shown in SEQ.ID.NO:8; The sequence of the protein is also shown in SEQ.ID.NO:9 ). The primer BK266, 5'C TCC ATG GAT CAA CGC AAT GGT TTA TC 3 '(SEQ ID NO: 0), indicates a Ncol site (in italics) and a sequence identical to a portion of a protein A gene content within the vector pRTIZ2T (Pharmacia) (underlined). The primer BK267 is indicated, 5 'GC AAG CTT CTA ATT TGT TAT CTG CAG GTC 3' (SEQ.ID.NO:11), a Hind site \\\ (in italics), a stop codon (bold) and a sequence complementary to a portion of the protein A gene contained within pRIT2T (Pharmacy) (underlined). The PCR product was digested with Ncol and Hind \\\ was ligated into pCGNOBPGUSA (Van Rooijen and Moioney 1995, Plant Physiol.109: 1353-2361) from which the? / Co / -GUS- fragment was removed H / A7dlll. Figure 14. Sequence of an oleosin-a protein fusion of Arabidopsis (The sequence is also shown in SEQ.ID.NO:12 and the protein sequence is also shown in SEQ.ID.NO:3 and 14). A portion of the oleosin genomic sequence (from base 1-1626) is indicated, as reported in van Rooijen and others 1992, Plant. Mol. Biol. 18: 1177-1179), a separating sequence encoding a thrombin separation site (base 1627-1647, underlined) and the presence of DNA encoding protein A (base 1648-2437, in italics). Expression was regulated by the upstream expression 5 'of Arabidopsis of the Arabidopsis oleosin (base 1-867) and the terminator region of nopaline synthase (base 2437-2700). Figure 15. Schematic diagram illustrating the configuration of the oleosin-protein A fusion protein in the oily body and the binding of the immunoglobulin.

Figure 16. A Western analysis illustrating the binding of anti-mouse antibodies from HRP-conjugated mice to protein extracts from oil bodies obtained from the transgenic B. napus lines expressing the oleosin-protein A fusion proteins. sample in a Western analysis probed with an antibody conjugated with HRP protein extracts of oily bodies of the transgenic lines, opa 30 (line 31), opa 31 (line 4), opa 34 (line 5), opa 36 (line 6) ), opa 47 (line 7), opa 93 (line 8), all expressing an oleosin-protein A fusion protein and a non-transformed control line of B. napus (line 9), as well as lysates of E. coli of DH5a transformed with expression protein A pRIT2T (line 2) and transformed E. coli DH5a MP (line 1). Figure 17. Illustrates the binding and elution of IgGs to isolated oil bodies of B. napus wild type (in weight basis) and a line of transgenic B. napus, expressing oleosin-protein A fusions. The error bars represent the results of 4 independent experiments. DETAILED DESCRIPTION OF THE INVENTION As mentioned above, the present invention relates to a novel biological affinity matrix system employing oil bodies and proteins associated therewith. The affinity matrix is suitable for the highly efficient separation of specific targets, including proteins, carbohydrates, lipids, nucleic acids, cells and subcellular organelles, metals and ions, from a sample. The present invention provides a method for separating a target molecule from a sample comprising: 1) contacting (i) oil bodies which may be associated either directly or indirectly with the target molecule with (ii) a sample containing the white molecule; and 2) separating the oily bodies associated with a white molecule from the sample. The oil bodies and the sample containing the target molecule were contacted in a manner sufficient to allow the oil bodies to associate with the target. Preferably, the oily bodies are mixed with the white. Preferably, the oil bodies are mixed with the target. The indirect association of oil bodies with the target can be effected by using a ligand molecule that can be associated with oil bodies without the target molecule. Therefore, the ligand serves to bridge or bind the oil bodies with the target molecule. If desired, the white molecule can be further separated from the oil bodies and the ligand if present. Each of the components of the affinity matrix is treated in turn later. Targets The term "blanks", as used herein, denotes a desired molecule that one wants to purify, isolate or separate from a sample such as a biological mixture. This technology is receptive for use with virtually any target for which a ligand or any target can be obtained that can be directly associated with, or linked to, an oily body or an oil body protein. Possible ligand-target pairs include but are not limited to: subunit of proteins / subunit associations, antibodies / antigens, receptor protein / signal molecules, nucleic acid / nucleic acid binding proteins, lectins / carbohydrates; lipid / lipid binding proteins; ion / ion binding proteins; and ligands for the surface of epitopes / cells or subcellular organelles. The white can be obtained from any natural source or can be synthesized chemically. If the target is a macromolecule such as a protein or nucleic acid, it can also be produced recombinantly using any suitable expression system such as bacteria, yeast, plant, insect or mammal. Ligands The term "ligand" used herein, denotes a molecule that is capable of associating with the target molecule and with oil bodies or oil body protein (discussed below). The term "that is associated with", as used herein, includes covalent or non-covalent attachment of the ligand to the oil bodies or to the target molecule. For example, the ligand molecule can be covalently bound to the oil bodies and non-covalently associated with the target (and vice versa), or the ligand can associate non-covalently with both the oil bodies and the target molecule. The ligand can be any molecule that can bind the oil bodies or protein of the oil body and the target molecule and can include a protein, nucleic acid, carbohydrate or small organic molecule. The ligand may be comprised of two molecules, a first molecule that associates with the oily bodies and a second molecule that associates with the target, wherein the first molecule and the second molecule associate with each other. The affinity ligand proteins used for this methodology may be derived from known pairs of ligands, present in nature, such as those listed above. Alternatively, the ligand can be obtained by screening proteins extracted from cells or organisms, synthesized chemically or produced in libraries comprised of combinatorial peptide sequences, antibodies or expressed DNA sequences. In one embodiment, the ligand has a natural affinity for oil bodies or for oil body proteins. For example, the ligand can be a protein such as an antibody, which has an affinity for the oil body protein. The ligand can also be a molecule other than a protein that has a natural affinity for the oily body or for the oily body protein. Said ligands, capable of binding to the oily bodies or to the protein of oily bodies, can be associated with a second molecule that can bind the target molecule. For example, the ligand molecule can be an antibody conjugated to avidin and can be used to purify biotin from a sample. In another embodiment, the ligand is covalently bound to the oil bodies or protein of oil bodies by chemical or recombinant means. Chemical means for preparing fusions or conjugates is known in the art and can be used to prepare a ligand-protein fusion of oil bodies. The method used to conjugate the ligand and the oily body must be able to bind the ligand with the oily body protein without interfering with the ability of the ligand to bind to the target molecule. In one example, the ligand can be a small organic molecule such as biotin which is covalently bound to the oil bodies. The biotinylated oily bodies can be used to separate avidin from a sample. The present invention also includes modified oily bodies such as biotinylated oily bodies to be used as an affinity matrix. Accordingly, the present invention includes a composition comprising, oily bodies attached to a molecule, such as a ligand or a target molecule. In a preferred embodiment, the ligand is a protein and can be conjugated to the oil body protein using techniques well known in the art. There are several hundred interleavers available that can conjugate two proteins. (See for example "Chemistry of Protein Conjugation and Crosslinking." 1991, Shans Wong, CRC Press, Ann Arbor). The interleaver is generally chosen based on reactive functional groups available or inserted into the ligand. In addition, if there are no reactive groups, a photoactivable interleaver can be used. In certain cases, it may be convenient to include a separator between the ligand and the oil body protein. Interlacing agents known in the art include the homobifunctional agents: glutaraldehyde, dimethyladipiidate and Bis (diazobenzidine) and the heterobifunctional agents: -maleimidobenzoyl-? / -hydroxysuccinimide and sulfo- / 7? -maleimidobenzoyl-? / -hydroxysuccinimide. Fusion of protein-ligand protein from oil bodies can also be prepared using recombinant DNA techniques. In that case, a DNA sequence encoding the ligand is fused to a DNA sequence encoding the protein of oil bodies, resulting in a chimeric DNA molecule that expresses a protein-ligand fusion protein of oil bodies (described in greater detail later). In order to prepare a recombinant fusion protein, the DNA sequence encoding the ligand must be known or obtainable. As can be obtained, it is understood that a sufficient DNA sequence can be deduced to encode the protein ligand from the known amino acid sequence. It is not necessary that the entire sequence of the ligand gene be used, as long as the purification of the ligand binding domain sequence of the protein is known. Therefore, the ligand can include the entire sequence, or the binding domain, of the specific ligand protein in question.

If the DNA sequence of the desired ligand is known, the gene can be synthesized chemically using an oligonucleotide synthesizer. Alternatively, the clone carrying the ligand gene can be obtained from the cDNA or from genomic libraries containing the gene by probing with a labeled complementary DNA sequence. The gene can also be amplified specifically from the library using oligonucleotide primers specific for the gene and PCR. If the DNA sequence of the desired ligand is not known, then a partial amino acid sequence can be obtained through the N-terminal sequencing of the protein (Matsudaira 1987; J. Biol. Chem. 262: 10035-10038). The labeled probes can be synthesized based on the DNA sequences deduced from these amino acid sequences and used to screen cDNA or genomic libraries as described above. The clone carrying the gene can also be identified from a cDNA expression bank by probing with antibodies raised against the protein ligand or the target protein. Ligands can also be discovered by probing mixtures of proteins with the target. The blank can be immobilized on a support matrix and used to screen proteins extracted from cells and tissues or chemically synthesized. After binding between the ligand protein and the immobilized target, the matrix is separated from the solution and washed. The protein ligand is subsequently eluted from the matrix and the sequence determined as described above. Alternatively, recombinant protein libraries produced by phage display, such as those comprised of combinatorial peptide sequences (Smith, 1985, Science 228: 1315-1317) or antibody repertoires (Griffiths et al., 1994, EMBO J. 13: 3245-3260; N issim et al., 1994; EMBO J. 13: 692-698) can be sieved with the immobilized target. In this case, the binding between the protein ligand and the target could allow the separation and recovery of the phage expressing the ligand of the large complex population of the phage encoding non-binding proteins. A two-hybrid system such as in yeast (Fields and Sternglanz, 1994; Trends Genet, 10: 286-292) can also be used to identify a ligand from an expressed cDNA library. In the present, a gene fusion is constructed between the sequence encoding the target protein and that of the DNA binding protein. Cells containing this construct are transformed with constructs from a cDNA library where the sequences have been fused to that of a transcriptional activator. Ligand binding derived from the cDNA library with the target protein allows transcription of a reporter gene to occur. The clones expressing the ligand are then recovered. To specifically discover a ligand to oil bodies, a complete or partial oleosin protein can be used as a target in any of the above methods. Alternatively, it may be possible to employ intact oil bodies to screen protein extracts, synthetic peptides or banks that display the phage. In this case, the oily body could serve as a target as well as an immobilization matrix. Using this approach, a wider variety of ligands can be discovered, which exhibit affinity not only for oleosins, but for other epitopes present in the oil bodies. Oily Bodies and Oily Bodies Proteins Oily bodies are small, spherical, subcellular organelles that encapsulate stored triacylglycerols, a reservoir of energy used by many plants. Although they are found in most plants and in different tissues, they are particularly abundant in oily seed seeds where they can vary in size from less than one to a few microns in diameter. The oily bodies are comprised of triacylglycerides surrounded by a membrane unitary to half of the phospholipids and are embedded with a unique type of protein known as an oil body protein. The term "oily body" or "oily bodies", as used herein, includes any or all of the triacylglyceride, phospholipid or protein components present in the complete structure. The term "oil body protein" as used herein means a protein that is present in nature in an oily body. In plants, the predominant oil body proteins are called "oleosins". Oleosins have been cloned and sequenced from many plant sources including corn, rapeseed, carrot and cotton. The oleosin protein seems to be comprised of three domains; the two ends of the protein, terminations N and C, are highly hydrophilic and reside on the surface of the oily body exposed to the cytosol while the highly hydrophobic central matrix of the oleosin is firmly anchored within the membrane and triacylglycerides. Oleosins from different species represent a small family of proteins that show conservation of considerable amino acid sequences, particularly in the central region of the protein. Within an individual species, there may be a small number of different isoforms. Oily bodies of individual species exhibit an almost uniform size and density that depends in part on the precise protein / phospholipid / triacylglyceride composition. They can be separated simply and quickly from liquids with different densities in which they are suspended. For example, in aqueous media where the density is greater than that of oil bodies, they will float under the influence of gravity or applied centrifugal force. In 95% of the ethanol where the density is lower than that of the oily bodies, they will settle under the same conditions. Oily bodies can also be separated from liquids and other solids present in solutions or suspensions by methods that are fractionated on a size basis. For example, the oil bodies of B. napus are minimal, approximately 0.5 μm in diameter and, therefore, can be separated from the smaller components using a membrane filter with a pore size smaller than this diameter.

The oil bodies of the present invention are preferably obtained from a seed plant and more preferably from the group of plant species comprising: watercress (Arabidopsis thaliana), rapeseed oil (Brassica spp.), Soybean (Glycine max), sunflower (Helianthus annuus), palm oil (Elaeis winkle), cottonseed (Cocus nucifera), peanut (Arachis hypogaea), coconut (Cocus, nucifera), castor (Recinus communis), safflower (Cathamus tinctorius), mustard (Brassica spp. and Sinapis alba), cilantro (Coriandrum sativum), linseed (Linum usitatissimum) and corn (Zea mays). The plants are developed and the seed is allowed to be established using agricultural farming practices well known to someone skilled in the art. After harvesting the seed and removing the foreign material such as stones or seed husks, for example by sifting, preferably the seeds are dried and subsequently processed by pressing, grinding or mechanically grinding. The fraction of the oil body can be obtained from the crushed seed fraction by capitalization in separation techniques that exploit differences in density between the oil body fraction and the oil fraction such as centrifugation or using separation techniques based on size exclusion, such As membrane filtration, or a combination of both, the seeds are usually milled uniformly and five volumes of a cold aqueous buffer solution. A wide variety of regulatory compositions can be employed, as long as they do not contain high concentrations of strong organic solvents such as acetone or diethyl ether, since these solvents can alter the oil bodies. The solution density of the milling buffer can be increased with the addition of 0.4-0.6 M sucrose, in order to facilitate washing as described below. The milling buffer will also normally contain 0.5 M NaCl to help remove soluble proteins that are not integrally bound to the surface of the oily body. After grinding, the homogenate is centrifuged resulting in a pellet of particulate and insoluble matter, an aqueous phase containing soluble components of the seeds and a surface layer comprised of oil bodies with their associated proteins. The oily body layer slides off the surface and is uniformly resuspended in a volume of fresh grinding buffer. It is important that the aggregates of oily bodies dissociate as uniformly as possible in order to ensure the efficient removal of contaminants in subsequent wash steps. The resuspended oil body preparation is layered under a lower density flotation solution (e.g., water, aqueous buffer) and centrifuged, again separating the oil body and aqueous phases. This washing procedure is normally repeated at least three times, after which the oil bodies are considered sufficiently free of contaminating soluble proteins as determined by gel electrophoresis. It is not necessary to remove all the aqueous phase and the final preparation water can be added or 50 mM of Tris-HCl pH 7.5 and if desired the pH can be lowered to pH 2 or raised to pH 10. The protocols for isolating oily bodies from Oily seeds are available in Murphy, D. J. and Cummins I. , 1989, Phytochemistry, 28: 2063-2069; and in Jacks, T. J. and others 1990, JAOCS, 67: 353-361. A preferred protocol is detailed in Example 1 of the present specification. Oil bodies other than those supplied by those derived from plants can also be used in the present invention. A system functionally equivalent to oil bodies of plants and oleosins has been described in bacteria (Pieper-Fürst et al., 1994; J. Bacterial 176: 4328), algae (Rossler, PG, 1988, J. Physiol. ), 24: 394-400) and mushrooms (Ting, J .T. and others, 1997, J. Biol. Chem. 272: 3699-3706). The oily bodies of these organisms, as well as those that can be discovered in other living cells by one skilled in the art, can also be employed in accordance with the present invention. Affinity Matrices As mentioned above, the present invention provides a novel affinity matrix system for the purification of a target molecule from a sample. In one embodiment, the affinity matrix comprises oily bodies that can be attached to a target molecule in a sample. In such an embodiment, the target molecule can be an antibody that can bind to an oil body protein. In another embodiment, the affinity matrix comprises oil bodies or oil body proteins and a ligand that associates with the oil bodies or proteins of the oil body and has affinity for a target molecule. In such embodiment, the ligand can be attached non-covalently or covalently to the oil bodies or the oil body protein (as described above). It is an advantage of the present that the white substances can be purified or removed from the samples through the non-covalent association of the oily bodies followed by the separation of the oily body. A number of different body-ligand configurations are possible. Whites with inherent affinity for proteins of specific ligands such as hirudin or thrombin or heavy metals to metallothionin can be purified or separated with oil bodies containing the ligand fused to an oleosin. Alternatively, a white protein can also be purified from a target protein or separated with an oil body affinity matrix by fusing the target to a specific ligand for the oily body or the complementary ligand with that fused to an oleosin. If desired, a protease recognition site or a chemical separation site between the ligand and the target protein can be treated to allow proteolytic removal of the target protein ligand in the course of purification. A multivalent ligand can also be constructed, such as a bivalent single chain antibody, in which one ligand domain has an affinity for an oil body and the other domain exhibits affinity for the target. In this case, neither the oily body nor the white molecule needs to be covalently fused to the ligand. Also, ligand concatamers can be used to increase the affinity of a matrix for a target, or the sequence of a ligand can be mutated to modulate the affinity of a target when said conditions are convenient. In addition, mixtures of different ligands can be fused to recover / remove different types of targets simultaneously. Fusions between different ligands can also be constructed to form bridges between different types of targets or between targets and the affinity matrix of the oil body. Binding to the affinity matrix can also be achieved by bridging between ligand or ligand and target sequences, such as Zn + + ions bridging between the polyhistidine sequences. There are several advantages associated with the use of affinity matrices of oily bodies that make them attractive as purification tools. The flexibility in design that is possible through different configurations described above, allows a matrix to be built to better meet the requirements for a specific target. Also, the production of the matrix as part of a natural biological seed process is extremely cost-effective, since purification and immobilization of the ligand are not necessary. In the case of oleosin-ligand fusions, the ligand is immobilized in the oily body as a result of the oleosin being directed into the cell, wherein the ligands specific for the oily body naturally associate with the matrix while it is present. in complete mixtures. The natural immobilization of the ligand in the matrix can also be advantageous in that it eliminates the requirement for chemical entanglement that can compromise the affinity of the ligand for the target. Finally, the oily body affinity matrices offer a unique and attractive purification option particularly for large scale operations. The ability to separate the matrix through flotation as a loose suspension allows it to be used with the raw material that contains what could be prohibitive amounts of particulate pollutants. The presence of these contaminants often cover and block conventional solid matrices applied in columns or suspensions in lots limiting their use in the early stages of the purification process. As previously mentioned, in one embodiment of the invention, the ligand protein sequences are genetically fused to the oil body protein. In order to prepare such genetic fusions, a chimeric DNA sequence encoding an oil body protein / ligand fusion protein was prepared and consists of (a) a DNA sequence encoding a sufficient portion of an oil body protein to provide the direction of the fusion protein to the oil bodies and (b) a DNA sequence that encodes a sufficient portion of the ligand protein to provide binding to the target. The inventors have determined that, in general, the N-terminus and the hydrophobic center of an oil body protein are sufficient to provide the direction of the fusion protein of the oil bodies. In particular, oleosins derived from amino acids 2 to 123 of the Arabidopsis thaliana plant (as shown in SEQ.ID.NO.:1) are sufficient in this respect. The ligand can be fused to the terminal and / or C end of the oleosin. It may also be possible to construct an internal fusion between the ligand and the oleosin or to fuse the ligand between two oleosin proteins. The chimeric DNA sequence encoding an oil body protein fused to a ligand can be transfected into a suitable vector and used to transform a plant. Two types of vectors are routinely employed. The first type of vector is used for the genetic treatment and assembly of constructs and usually consists of a base structure such as is found in the pUC family of vectors, allowing replication in gram-negative bacteria easily manipulated and maintained such as coli. the second type of vector typified by the Ti and Ri plasmids, specify the functions of DNA transfer and are used where it is convenient that the constructions have been introduced into the plant and stably integrated into their genome via Agrobacterium-mediated transformation.

A typical construction, in the 5 'to 3' direction consists of a complete regulatory region with a promoter capable of directing expression in plants (preferably seed-specific expression), a protein coding region and a sequence containing a signal from Functional transcriptional termination in plants. The sequences comprising the construction can be either natural or synthetic or any combination thereof. Both seed-specific promoters can be used, such as the CaMV 35-S promoter (Rothstein et al., 1987; Gene 53. 153-161) and seed-specific promoters such as the phaseolin promoter (Sengupta-Gopalan et al., 1985; PNAS USA 82: 3320-3324) or the 18 kDa oleosin promoters of Arabidopsis (Van Rooijen et al., 1992; Plant Mol. Biol. 18: 1177-1179). In addition to the promoter, the regulatory region contains a ribosome binding site that allows translation of the transcripts in plants and may also contain one or more enhancer sequences such as an AMV leader (Jobling and Gehrke 1987; Nature 325. 622-625 ), to increase the expression of the product. The coding region of the construct will normally be comprised of sequences encoding a ligand fused in frame to an oleosin and terminating with a translational stop codon. The sequence for the oleosin may be comprised of a DNA sequence, or part thereof, natural or synthetic, sufficient to encode a protein that can be correctly directed, and expressed smoothly on an oily body. A detailed description of the characteristics of said has been previously reported in Moloney, 1993; PCT Patent Application. WO 93/21320 which is incorporated herein by reference. The sequence may also include introns. The ligand coding region in turn may be comprised of a single or combination ligand sequence identified as described above. If desired, a protease or chemical recognition site can be treated between the ligand and the target protein to allow proteolytic removal of the target protein ligand in the course of purification. The region containing the transcriptional termination signal can comprise any of said functional sequence in plants such as the nopaline synthase termination sequence and can additionally include the enhancer sequences to increase the expression of the product. The different components of the construct are ligated together using conventional methods, usually in a vector based on pUC. This construct can then be introduced into an Agrobacterium vector and subsequently into host plants, using one of the transformation procedures described below. A variety of techniques are available for the introduction of DNA into host cells. For example, the construction of chimeric DNA can be introduced into host cells obtained from dicotyledonous plants, such as tobacco and oleaginous species such as B. napus using normal Agrobacterium vectors; by a transformation protocol such as that described by Moloney et al., 1989 (Plant Cell Rep., 8; 238-242) or Hinchee et al., 1988 (Bio / Technol, 6: 915-922); or other techniques known to those skilled in the art. For example, the use of T-DNA for the transformation of plant cells has received extensive study and is widely described in EPA Series NO. 120, 516; Hoekema et al., 1985, (Chapter V, In: The Binary Plant Vector System Offset-drukkerij Kanters B.V., Alblasserdam); Knauf, et al. 1983, (Genetic Analysis of Host Range Expression by Agrobacterium, page 245. In Molecular Genetics of the Bacteria-Plant Interaction, Puhler, A. Springer-Verlag, NY); and An et al., 1985, (EMBO J., 4: 277-284). Conveniently, explants can be cultured with A. tumefaciens or A. rhizogenes to allow the transfer of the transcription construct to the cells of the plant. After transformation using Agrobacterium the plant cells are dispersed in an appropriate medium for selection, subsequently the calluses, buds and eventually the seedlings are recovered. The Agrobacterium host will host a plasmid that purchases the vir genes needed to transfer the T-DNA to the plants. For injection and electroporation, (see below) unarmed Ti plasmids (lacking tumor genes, particularly in the T-DNA region) can be introduced into the plant cell.

The use of techniques that are for us for Agrobacterium allows the use of the constructions described herein to obtain the transformation and expression in a wide variety of monocotyledonous and dicotyledonous plants and other organisms. These techniques are especially useful for species that are retractable in an Agrobacterium transformation system. Other techniques for gene transfer include biolistics (Sanford, 1988, Trends in Biotech, 6: 299-302), electroporation (Fromm et al., 1985, Proc. Nati, Acad. USA 83: 5602-5606) or mediated DNA adsorption. by PEG (Potrykus et al., 1985, Mol. Gen. Gente., 199: 169-177). In a specific application such as B. napus, host cells targeted to receive the recombinant DNA constructs will normally be derived from cotyledonary petioles as described by Moloney et al. (1989, Plant Cell Rep., 8: 238-242). Other examples that use commercial oil seeds include transformation of cotyledons into soybean explants (Hinchee et al., 1988. Bio / Technology, 6: 915-922) and cotton stalk transformation (Umbeck et al., 1981, Bio / Technology, 5 : 263-266). After transformation, the cells, for example as leaf discs, develop on selective medium. Once the buds begin to emerge, they are removed and placed in a medium to form roots. After enough roots have been formed, the plants are transferred to the ground. Putative transformed plants are then tested for the presence of a marker. Southern analysis carrying the genomic DNA using an appropriate probe, for example an oleosin gene of A. thaliana, to show that integration of the desired sequences into the host cell genome has been presented. The expression roll will normally bind to a marker for selection in plant cells. Conveniently, the marker can be resistance to a herbicide, e.g. , phosphinothricin or glyphosate, or more particularly an antibiotic, such as kanamycin, G41 8, bleomycin, hygromycin, chloramphenicol or the like. The particular marker employed will be one that will allow the selection of transformed cells compared to cells lacking introduced recombinant DNA. The fusion peptide in the expression roll constructed as described above is expressed at least preferentially in developing seeds. Consequently, transformed plants developed in accordance with conventional forms, will be allowed to establish themselves. See, for example, McCormick et al. (1986, Plant Cell Reports, 5: 81-84). Northern analysis can be carried out using an appropriate gene probe with RNA isolated from the tissue in which the transcript is expected to be present such as seed embryo. The size of the transcript can be compared to the size predicted for the fusion protein transcript. The oil body proteins are then isolated from the seed and analyzes are carried out to determine that the fusion peptide has been expressed. The analyzes, for example, can be by means of SDS-PAGE. The fusion peptide can be detected using an antibody to the oleosin portion of the fusion peptide. The size of the fusion peptide obtained can be compared to the predicted size of the fusion protein. Two or more generations of transgenic plants can be grown and crossed or left alone to allow the identification of plants and strains with desired phenotypic characteristics including the production of recombinant proteins. It may be convenient to ensure the homozygosity of the plants, strains or lines that produce the recombinant proteins to ensure the continuous inheritance of the recombinant characteristic. Methods for selecting homozygous planks are well known to those skilled in the art of plant cultures and include the autonomy and recurrent selection and cultivation of anthers and microspores. Homozygous plants can also be obtained by transformation of haploid cells or tissues followed by regeneration of haploid seedlings subsequently converted to diploid plants by any number of known means (see fig.,: treatment with colchicine or other microtubule alteration agents). Method for Separating White Molecules Using the Affinity Matrices As mentioned above, the present invention relates to a method for separating a target molecule from a sample using the oily body proteins described above and in some cases, ligands. In the method of the invention, the oil bodies are mixed with a mixture containing the desired target and the interaction between the results of ligand and target in the non-covalent association of the blank with the oily body. After centrifugation, the oil bodies and the affinity-bound target are separated from the aqueous phase, effectively purifying the target of any contaminant present in the original sample. Repeating the washing step ensures that they are removed from any contaminants. After their binding to the oil bodies, the targets can be eluted under conditions empirically stopped for each pair of ligand-target. The treatment of the bound matrix with the appropriate eluent and the centrifugation allows the recovery of the purified target in the aqueous phase. If the target is a ligand-protein fusion that contains a protease recognition site, this can be treated with the appropriate protease to remove the ligand. The free ligand can then be separated from the target protein by the replication of the affinity matrix of the oil body or by protein purification methods. The chemical and physical properties of the affinity matrix can vary in at least two ways. The first, the different species of plants contain oily bodies with different oily compositions. For example, coconut is rich in lauric oils (C12), while erucic acid oils (C22) are abundantly present in some Brassica spp. In addition, the proteins associated with oil bodies will vary between species. Secondly, the relative amounts of oils can be modified within a particular plant species and applied to the crop and genetic engineering techniques or a combination of these known to the experts. These techniques help to alter the relative activities of enzymes that control the metabolic pathways involved in oil synthesis. By applying these techniques, seeds with a sophisticated group of different oils can be obtained. For example, the efforts of the crop have resulted in the development of rapeseed with a low erusic acid content (Cañóla) (Bestor, T. H., 1994, Dev. Genet. 15: 458) and lines of plants with oils that they have alterations in the position and number of double ligatures, variation in the chain length of fatty acids and the introduction of convenient functional groups have also been generated by genetic engineering (Topfer and Bulls, 1995, Science, 268: 681-685). Using similar approaches, someone skilled in the art could be able to expand on the sources currently available on oil bodies. The variant oily compositions will result in physical and chemical properties of the oily body fraction variants. Therefore we select oil seeds or mixtures thereof of different species or plant lines as a source of oily bodies, we will acquire a wide repertoire of oily body matrices with different textures and viscosities. Applications of affinity matrices of oily bodies Since it is possible to treat the affinity matrices of oily bodies for different kinds of proteins, multiple uses are provided for affinity matrices based on oily bodies. Bacteria, fungi, plants and animals contain proteins that are capable of interacting specifically with agents such as ions, metals, nucleic acids, sugars, lipids and other proteins. These agents can be immobilized using oily body technology. Protein affinity matrices of oily bodies can be used to isolate any white molecules that can bind protein from oil bodies, either directly or indirectly through a ligand molecule. Examples of the target molecules can be isolated from a sample using the methodology of the present invention include proteins, peptides, organic molecules, lipids, carbohydrates, nucleic acids, cells, cell fragments, viruses and metals. In particular, the inventors have shown that the affinity matrix of the present invention can be used to separate therapeutic proteins (such as thrombin), antibodies, metals (such as cadmium), carbohydrates (such as cellulose), organic molecules (such as biotin) and cells (such as bacterial cells).

The affinity matrices of oil bodies can also be used to separate cells of industrial or medical interest from a mixed population of cells. For example, hematopoietic stem cells, which are a subpopulation of blood cells and that are used in bone marrow transplants and support cell gene therapies, can be separated from other blood cells using affinity technology based on oil bodies. . In recombinant DNA technology it is often required that the cells in which the recombinant DNA has been successfully introduced, known as transformed cells, are distinguished and separated from the cells that do not acquire the recombinant DNA. Provided that the part of the recombinant DNA expresses a protein of cell surfaces that is complementary to an affinity ligand based on oil bodies, it is possible to use the oil bodies to separate the transformed cells from the non-transformed cells. Affinity technology of oil bodies can also be used to separate cellular organelles such as chloroplasts and mitochondria from other cellular material. The viral particles can also be separated from complex mixtures. It is also possible to immobilize a class of proteins known as metalloproteins, which contain phthaletic groups that specifically bind to ions. Examples of metalloproteins are hemoglobin, which binds to iron, parvalbumin that binds to calcium and metallothionine, a protein that binds to zinc and other metal ions. It is envisioned that oily bodies could be used to remove metals from streams in the flow material, which can be waters contaminated with waste from laboratory metals and industrial processes. Example 4 given below further illustrates this application. Other examples where the proteins can be bio-immobilized and used in a bioremediation strategy, include the removal of phosphates, nitrates and phenols from waste streams. In part this approach can overcome the real or perceived limitations of bacterial bioremediates. In some cases it may not be necessary to rely on the affinity division technology to separate the matrix from the oily bodies of the target compound. In these cases, it is envisaged that the oil bodies can be immobilized on an inert surface on what could be a flat surface or the surface of a column. A solution containing the affinity ligand can then be passed over the coated surface onto immobilized oil bodies whereby selective affinity binding occurs. It is envisaged that the immobilized oil bodies can be used in pipes and puddles to help the bioremediation. The following examples illustrate various systems in which oil bodies can be used as affinity matrices. It is understood that the examples given below are intended to be illustrative rather than limiting. EXAMPLES EXAMPLE 1 Thrombin Purification The following example demonstrates the utility of an oil body affinity matrix for the purification of thrombin. Thrombin is a serine protease that plays a central role in the coagulation of blood. It separates the fibrinogen to produce fibrin monomers that polymerize to form the base of a blood clot (Fenton 1981; Ann. N.Y. Acad. Sci. 370: 468-495). Alpha-thrombin consists of two polypeptide chains of 36 (A chain) and 259 (B chain) ligand residues by a disulfide bridge. Degen and others 1983; Biochemistry 22: 2087-2097). Hirudin, which is found in the salivary glands of the drug Hirudo medicinalis, is a very specific and potent inhibitor of thrombin. This inhibition is a result of the non-covalent binding of hirudin to specific parts of the alpha-thrombin chain. (Stone and Hofsteenge 1986; Biochemistry 25: 4622-4628).

The immobilized ligand is comprised of an isoform of hirudin fused to the Arabidopsis oleosin of 18 kDa (oil body protein) (Van Rooijen et al., 1992, Plant Mol. Biol. 18: 1177-1179). The expression of the construct is regulated by the 18 kDa oleoresin promoter from Arabidopsis (Van Rooijen et al., 1994, Plant Mol. Biol. 18: 1177-1179). The sequence of the oleosin-hirudin fusion is shown in Figure 2 and in SEQ.ID.NO:3. Oleosin construction -Hirudin Oligonucleotide primers were designed based on the sequence reported for an oleosin gene from Brassica napus (Murphy et al., 1991, Biochim, Biophys, Acta 1088: 86-94) and used to amplify a DNA fragment. genome of B. napus through CPR. Using this fragment as a probe, a clone having a 15 kbp insert is identified and isolated from an Arabidopsis genomic bank of EMBL3. Oligonucleotide primers were used to amplify a fragment of this insert containing all the oleosin encoding the sequence and intron together with 840 base pairs from the 5 'upstream region. The primers were designed so as to eliminate the transnational challenge codon and introduce a PstI restriction endonuclease recognition site at the 5 'end and Sali followed by a Pvul site at the 3' end of the fragment. The fragment was filled at one end and ligated into the Smal site of the plasmid vector pUC 19. A SalI-EcoRI fragment of plasmid pBI 121 (Clontech) comprising the nopaline synthase terminator sequence was then inserted to generate pOBI LT . A sequence of synthetic hirudin variant (HV2) 2 was synthesized based on the reported sequence information (Harvery et al., 1986, Proc. Nati, Acad. Sci. USA 83: 1084-1088) but using the codon of B use. napus and Arabidopsis. The sequence was amplified using four overlapping oligonucleotide primers designed so that the resulting fragment had the Pvul and Sali sites and the 5 'and 3' ends, respectively. This fragment was ligated into the Small site of the plasmid vector pUC 19 to generate pH I R. The Pvul-Sali fragment of pH IR was then inserted into pUCOBILT between the oleosin and the terminator sequences to form a fusion in frame with the region of coding for oleosin giving pUCOBH I RT. The entire construct was subcloned into pBluescript KS + (pBlOBH I RT) and then into the Pstl site of plasmid pCG N 1559 (McBride and Summerfelt, 1990, Plant Mol. Biol. 14: 269-276) carrying a low neomycin phosphotransferase gene the control of the 35-S promoter of CaMV (pCGOBH I RT). This plasmid was introduced into Agrobacterium tumefaciens. The preparation of this plasmid is shown in Figure 3. Transformation and Regeneration The procedures for transformation of Agrobacterium and plants have been previously described. Agrobacterium tumefaciens was transformed with the previous construct through electroporation (Dower et al 1988; Nucí Acids Res. 16: 6127-6145). The transformed bacteria were then used to transform cotyledonary explants of Brassica napus, followed by regeneration of plants according to the methods of Moloney et al. 1989; Plant Cell Reports 8: 238-242). The transgenic plant was initially identified using a neomycin phosphotransferase assay and subsequently confirmed by the expression of the oleosin-hirudin fusion as determined by Northern analysis and immunoblot analysis. Preparation of Oily Bodies The seeds of the control plants (non-transgenic) or the transgenic plants expressing the oleosin-hirudin fusion were homogenized in five volumes of cold trituration buffer (50 mM Tris-HCl, pH 7.5, 0.4 m sucrose and 0.5 M NaCl) using a polytron that operates at high speed. The homogenate was centrifuged at approximately 10 x g for 30 minutes, to remove the particulate matter and to separate the oily bodies from the aqueous phase containing the volume of the soluble seed protein. The oil bodies were slipped from the surface of the supernatant with a metal spatula and placed in a volume of fresh grinding buffer. To achieve efficient washing in subsequent steps it was important to ensure that the oil bodies will redisperse uniformly. This was achieved by gently re-homogenising the oily bodies in the trituration buffer with the polytron operating at low speed. Using a syringe, the resuspended oil bodies were carefully layered to 5 volume low volumes of 50 mM cold Tris-HCl, pH 7.5 and centrifuged as before. After centrifugation, the oil bodies were again removed and the washing procedure was repeated three times to remove residual soluble contaminant seed proteins. The final wash oil body preparation was resuspended in a volume of 50 mM cold Tris-HCl pH 7.5, redispersed with the polytron and then ready to be used as an affinity matrix. Purification of Thrombin Affinity The purification of thrombin using the oleosin-hirudin fusion protein is schematically shown in Figure 4. In order to evaluate thrombin binding, affinity matrices of the transgenic Brassica napus seeds were prepared by expressing the oleosin-hirudin fusion protein (seeds 4A4) (Parmenter et al., Plant Molecular Biology (1995) 29: 1 167-180) and seeds of Brassica napus cv Westar wild type. The binding of thrombin to both matrices was evaluated. The procedures for the preparation of washed seed oil bodies were also the same as those described above. The solutions containing a scale of thrombin activities between 0 and 1 units were mixed with 10 μl of a fixed amount of affinity matrix (prepared from a total of 10 mg of dried seeds); corresponding to approximately 100 μg of total oil body protein) in 500 μl of binding buffer (50 mM Tris-HCl (pH 7.5), 0.1% (w / v) BSA). The oily body suspension was then incubated for 30 minutes on ice and centrifuged at 14,000 rpm for 15 minutes at 4 ° C. The buffer solution under oily bodies (called "subnatant") containing free, unbound thrombin was recovered using a hypodermic needle and analyzed by thrombin activity in the following manner. A total of 250 μl of the subnatant was added to 700 μl of binding buffer and preheated to 37 ° C. After the addition of 50 μl of 1 mM of thrombin substrate N-p-tosyl-gly-pro-arg-p-nitroanilide (Sigma) to the subnatant, the change in optical density was monitored at 405 nonometros spectrophotometrically for 3 minutes. The concentration of thrombin in the assay mixture was determined using a normal curve that was constructed using a group of thrombin samples containing known concentrations of thrombin. The values obtained from these analyzes were used to calculate the bound thrombin concentration by proposing: [bound thrombin] = [total thrombin] = [free thrombin] The ratio of the binding concentration to the concentration of free thrombin was plotted as a function of the concentration of bound thrombin (frost graph). From these graphs the dissociation constants of the affinity matrix were calculated following normal procedures (Scatchard, G. Ann. N. Y. Acad. Sci. (1994) 57: 660-672) and assuming that: K? = 1 / Kd. The dissociation constants of the affinity matrices were 3.22 x 10"7 m for wild type and 2.60 x 10" 8 for oil bodies 4A4. In order to evaluate the recovery of bound thrombin from the matrices, a NaCl gradient is used. The thrombin elution profile bound to oleosin-hirudin oil body matrices was compared to the profile of thrombin bound to arrays of wild-type oil bodies. The methods for preparing wild-type oily bodies of wild-type Brassica napus cv Westar seeds and for the preparation of oleosin-hirudin oily bodies of seeds 4A4 of Brassica napus (Parmenter et al., Plant Molecular Biology (1995) 29: 1 167 -1 180) was identical to that described above. The procedures for attaching thrombin to the matrices were as described above, except that 100 μl aliquots of oil bodies were used to bind 0.5 units of thrombin. The suspensions of oily bodies were left on ice for 30 minutes before centrifugation for 15 minutes at 4 ° C and 14,000 rpm. The subnatant was analyzed for thrombin activity (unbound). The oily body matrix was resuspended in binding buffer solution to which NaCl was added to a final concentration of 0.05 M. Starting with the 30 minute incubation of the oily body suspension on ice, the procedure was repeated five times, Increased the NaCl concentration in one way by steps. The final concentrations of NaCl used were 0.05 M, 0.1 M, 0.2 M, 0.3 M, 0.4 M, and 0.6 M. NaCl concentrations in the thrombin analysis were kept constant at 150 mM. Figure 5 shows the elution profiles obtained when oily bodies of wild type and oil body 4A4 were used. EXAMPLE 2 Use of Antibodies as Bivalent Ligands Antibodies can be used as bivalent ligands by virtue of their affinity for both specific epitopes and other protein antibodies (eg, protein A from Staphylococcus aureus) that have affinity for immunoglobulins (IgGs). In this example, polyclonal anti-oleosin antibodies serve as a bivalent ligand and antibodies raised in rabbits against anti-oleosin antibodies serve as the target. This example is illustrated schematically in Figure 6. Oily bodies were prepared from 5 g of wild-type Brassica napus cv Westar seeds following the procedure described in Example 1. Subsequently, the oil bodies were washed twice with 100 mM glycine (pH 2.5), neutralized through two washes in binding buffer (50 mM Tris-HCl, pH 7.5) and resuspended in 5 ml of buffer of Union. A 150 μl aliquot of the washed oil body preparation was combined with 500 μl of rabbit serum containing anti-oleosin antibodies (ligand antibodies), diluted 1: 10 with binding buffer. The suspension of the oil body was mixed uniformly and incubated for 1 hour at 4 ° C with agitation. After incubation, unbound ligand antibodies were removed from the oil body suspension through three washes with 1 ml of binding buffer. The oily bodies were then combined with 500 μl of serum diluted 1: 500 in binding buffer and containing anti-rabbit IgG antibodies (the white antibodies) conjugated with horseradish peroxidase (H RP) as a Detection label (Sigma). This suspension was mixed and incubated under conditions identical to those used for the binding of anti-oleosin antibody. As a control, the white antibodies were incubated with oily bodies that had not previously bound to the ligand antibodies. Both samples were subsequently washed four times with 1 ml of binding buffer to remove unbound antibodies. Using the binding buffer, the samples were equalized with respect to the concentration of the oil bodies as determined by spectrophotometrically measuring the turbidity of the sample at 600 nm. To analyze both bound white antibody and samples containing 5 μl of oil bodies, tetramethylbenzidine was mixed with 1 μL of the H RP calorimetric substrate in 0.1% hydrogen peroxide and reacted for 10 minutes at room temperature. The reaction was stopped by the addition of 500 μl of 1 M H2SO4 and the absorbance at 450 nm was determined. Corrections for the presence of residual unbound white antibody remaining after washing were made by analyzing 5μl of the final wash fraction. The results obtained for control and preparation of the oily body bound to the ligand are shown in Figure 7. EXAMPLE 3 Use of Specific Ligands for Oils. The use of a specific ligand for oleosin represents an alternative for the use of an antibody or oleosin fusion proteins for the purification of recombinant white proteins. In this case, the white protein was fused to the specific ligand for oleosin and endogenous oleosins present in the oil bodies of the non-transgenic seeds serves as the complementary ligand affinity matrix. In addition to eliminating the requirement for a transgenic line expressing an oleosin fusion, this approach increases the overall capacity of the affinity matrix, because all endogenous oleosins can participate in the binding. Specific ligands for oleosins can be identified and isolated from a library that displays peptide phages screened with oleosin protein. Because the extreme hydrophobicity of the oleosin central domain can result in the aggregation and precipitation of the protein when it is removed from the oil bodies, a mutant protein lacking this domain can be used to screen it. There was little effect on the efficiency of the ligand, since only portions of the oleosin were expressed to the cytoplasm (ie, the N and C termini). Therefore, these are not the only regions available to join a ligand. Once isolated, the ligand can be fused to a common reporter protein, green fluorescent protein (PFV) (Prasher, 1995, Trends Genet, 11: 320-323), to demonstrate purification. Removal of the Oleosin Core Domain Oligonucleotide primers specific for the Arabidopsis oleosin gene described above can be used to amplify an oleosin gene from a B. napus cDNA library (van Rooijen 1993, Ph.D. Thesis, University of Calgary). The primers flanking sequences encoding 52 N-terminal and 55 C-terminal amino acids can be used to amplify sequences for the oleosin domains of the respective N and C termini in separate reactions. Additionally, the primer for the 5 'end of the N-terminal domain that contains a sequence for a thrombin recognition site to allow separation of the fusion protein as described below. The resulting fragment was ligated into the Smal site of the bacterial expression vector pEZZ 18 (Pharmacia). This vector contains sequences encoding a signal peptide for the secretion of proteins in the periplasm and the synthetic IgG binding domains derived from protein A to facilitate purification of protein downstream of the multiple cloning site. Expression and Purification of the Oleosin Removal Construction The vector having the deletion mutant construct is introduced into E. coli using normal methods and selected transformants. A culture of the transformed bacteria can be induced to express the oleosin fusion protein of synthetic protein A mutant by the addition of 1 mM of I PTG. Induced cells can be pelleted and resuspended in 5 mM MgSO4 causing lysis of the periplasmic membrane through osmotic shock. The cells used were centrifuged and the supernatant containing the secreted protein was loaded onto a column containing sepharose coupled with IgG. After washing to remove the unbound protein, the column was loaded with a buffer solution containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl and 1.0 U / ml purified Bovine thrombin (Sigma) for Separating the oleosin from mutants of the synthetic protein A. After incubation at 37 ° C for 4 hours, the column was drained and the eluate passed through a sepharose column coupled with heparin to remove the thrombin. The eluate from this column, containing the mutant oleosin protein, was recovered and purified from the examined protein through gel electrophoresis followed by tinsion with Coomassie blue R250. Generation of a Combinatorial Bank of Peptides A combinatorial bank of random peptides can be generated according to the methods of Scott and Smith (1990).; Science 249: 386-390). In summary, the PCR was used to amplify a DNA fragment containing the degenerative sequence (N N K) 6; wherein "N" represents an equal mixture of deoxynucleotides G, A, T, and C and K represent an equal mixture of deoxynucleotides of G and T. The degeneracy sequence encoded for hexameric peptides between which each possible combination of the 20 amino acids and another stop codon. The PCR product was ligated into the filament bacteriophage fUSE gene sequence, and the resulting phagemid introduced into E. coli by electroporation. Identification and Isolation of Oleosin Specific Liqes Banks that display peptide phages are amplified, concentrated and stored in aliquots of 1012 tdu / ml. The purified mutant oleosin protein is biotinylated using a thiol separable interlayer (biotin S-S Pierce) and purified by size exclusion chromatography. The aliquots of the bank displaying peptide phage containing 5x101 1 tdu in two ml are screened with the biotinylated protein at a concentration of 50 nM. The oleosin phage binding of mutants was recovered using paramagnetic beads coated with streptavidin. After washing, the phage was eluted by the addition of 5 mM of dithiothreitol which separates the disulfide bond. Eluted phage are then incubated with an excess of E. coli F + in the log phase. The aliquots of the infected cells are plated to determine the phage titration and the remaining cells are used in successive amplification and sieving cycles. After enrichment of the phage eluted by 3-4 orders of magnitude, the individual phage was selected and tested for binding to a mutant oleosin by direct ELISA. Phage binding was detected using anti-phage antibodies (Crosby and Schorr, 1995, in Annual Review of Cell Biology). Single-stranded DNA was isolated from a single phage exhibiting binding and the peptide coding sequence was determined. Affinity Purification with Specific Ligands for Oleosin The sequence for an oleosin ligand isolated as described above is fused upstream in the frame of the sequence for gfp 10 (Prasher et al., 1992, Gene 1 1 1: 229-233) which encodes GFP and the ligated construct in the bacterial expression vector pKK233 (Pharmacia). The soluble protein was extracted through the treatment with cell-induced sound to express the G-ligand-FP fusion, and was adjusted to a concentration of 10 mg / ml in 50 mM Tris HCl, pH 7.5. Twenty ml of the protein solution was mixed with 2 ml of oil bodies prepared as described above from seeds of non-transgenic plants. The mixture was incubated at 4 ° C for 30 minutes with agitation to allow binding and then centrifuged to separate the oil bodies and the soluble fraction. The amount of GFP remaining in the soluble fraction after removal of the oily bodies was determined by fluorescence spectrofluorometry at a length of 508 nm and compared with that of the original bacterial extract. The amount of bound FPG was calculated to determine the capacity of the matrix. The oily bodies were washed twice in 20 ml of 50 mM Tris-HCl, pH 7.5, resuspended in 2 ml of the same buffer and divided into 20 aliquots of 100 μl. The conditions for elution of the FP-ligand fusion protein were determined by adding 1 ml of solutions varying in pH of 2-10 and in a NaCl concentration of 0-1 M at different aliquots. After mixing and incubation at 4 ° C for 30 minutes, the oil bodies were removed and the soluble fractions recovered. The amount of FP-ligand fusion protein FP in the soluble fraction was determined by fluorescence spectrophotometry. EXAMPLE 4 Heavy Metal Ion Removal The following example demonstrates the utility of affinity matrices of oil bodies for the recovery / removal of protein-free targets from complex solutions. For the purpose of this example, the pair of metallothionine ligand / Cd ++ was used. However, other binding proteins such as phytochelatins can also be used (Rauser, 1990; Ann, Rev. Biochem; 59: 61-86) and metal ions that include Cu ++ and Zn ++. Oleosin-Metalothionine Fusion An oleosin gene from a B. napus cDNA library (van Rooijen 1993, Ph.D. Thesis, University of Calgary) was amplified via PCR with oligonucleotide primers designed in a way that they create sites of Notl and Ncol and the 5 'and 3' ends of the gene respectively. The resulting fragment was digested and placed in the Notl / Nocl sites of pGN to give the poloGN plasmid. The metallothionine gene, mt-ll (Varshney and Gedamu, 1984, Gene, 31: 135-145) was amplified using oligonucleotide primers designed to create a NotI site at the 3 'end of the gene. The resulting PCR product was subcloned into the EcoRV site with blunt end of pBluescript KS + to form pBSMTC. The mt-// gene was then excised from this plasmid and subcloned into the Nocl / Kpnl sites of poleGN replacing the GUS-NOS region to generate pOLEMTC. The 773 base-MT oleosin fusion of pOLEMTC was excised with Notl digestion and inserted into the unique NotP site of polePN3 'between the oleosin promoter (oleP; Van Rooijen et al., 1992, Plant Mol. Biol. : 1177-1179) and the ubi-12 gene terminator of P.crispum (ubi3 '; Kawqlleck et al., 1993, Plant Mol. Biol. 21: 673-684) to generate pOOM3'. After it was determined that the fusion was in the correct orientation, pOOM3 'was directed from Kpnl to release the oleP-oleMT-ub3 insert. This expression roll was inserted into the Kpnl site of the binary vector pCG N 1559 to give the final construct pBIOOM3 '. The sequence of the oleosin-metalothionine fusion is shown in Figure 8 and SEQ. I D. NO.6. The construction of plasmid pB 100M3 'is shown in Figure 9. Transformation and Regeneration Transgenic plants of B. carinata expressing the oleosin-metalothionin fusion were created using transformation and regeneration protocols as described in Example 1. Oily Body Preparation The washed oily bodies were prepared from B. carinata seeds of transgenic and control plants as described in Example 1. Removal of Cd + + from the Solution Using an Oil Body Affinity Matrix The use of the oleosin-metalothionine fusion to bind cadmium ions in solution is shown schematically in Figure 10.

A solution of 10 μM CdCI2 in 10 mM Tris-HCl, pH 7.2 containing 0.01 μCi / ml 109Cd was prepared. An aliquot of 1 ml of this CdCI2 solution was uniformly mixed with 100 μl of washed oily bodies (1.6 mg of oil body protein) prepared from seeds expressing the oleosin-metallothionine fusion protein and incubated at 22 ° C during 1 hour. After centrifugation for 5 minutes at 10,000 xg to separate the oil bodies from the aqueous phase and 2 washes of 1 ml of 10 mM Tris-CI, pH 7.2, an amount of 109Cd ++ remaining bound to the oil body fraction was determined using the gamma counter (Cobra auto-gamma, Canberra Packard, Canada). An identical experiment was carried out with oil bodies of non-transgenic seeds to detect and correct the non-specific binding of Cd ions to the matrix. The Cd ++ ions were eluted from the metalotionin affinity matrix of the oil body by mixing the oil body fraction with 1 m of 100 mM glycine buffer (pH = 3.0) (Pazirandeh et al., 1995; Appl. Microbio. Biotechn. 43: 1 1 12-1 1 17). After centrifugation for 5 minutes. At 10,000 xg the oil body fraction was removed and analyzed for bound Cd ++ ions as before. Figure 11 shows Cd binding and elution of the affinity matrix. EXAMPLE 5 Complete Cell Separation The following example illustrates the ability of oil bodies to immobilize whole cells. A potential for the use of bacterial cell separation lies in the diagnostic utility. It is also convenient to separate unique eukaryotic cells such as lymphocytes and support cells and whole cell mixtures wherein the type of cells of interest is present in relatively low numbers. Staphylococcus aureus binding to oil bodies via protein A For the purpose of this example, S. aureus cells, which express protein a as a surface antigen with oil bodies with varying amounts of polyclonal anti-oleosin antibodies, were mixed. Preparation of oil bodies The seeds of B. napus cv Westar were superficially sterilized in bleach, rinsed and ground in a mortar in milling buffer (50 mM Tris pH 7.5, 0.4 M sucrose and 100 mM glycine). The homogenate was filtered through Miracloth in sterile 15 ml Corex tubes. The filtered homogenate was then centrifuged at 4 ° C for 10 minutes at 10,000 xg. The oil body fraction was removed and resuspended in 50 mM Tris, pH 7.5 and 0.4 M sucrose and washed twice using the same buffer. 1 ml aliquots of the oil bodies were transferred to 1.5 ml Eppendorf tubes and centrifuged at room temperature for 10 minutes at 16,000 xg. Oily bodies were washed in 50 mM Tris pH 7.5 and 0.4 M sucrose 5-6 or more times until no visible pellets were observed. Binding of S. aureus cells to oil bodies coated with anti-oleosin The S. aureus cells fixed with formalin (Sigma, P-7155) were washed 3-4 times in 50 mM Tris-CL pH 7.5 and resuspended. The washed oily bodies (300 μl) and S. aureus cells (mixed with varying amounts of anti-oleosin IgGs (50 μl) After mixing and incubated at room temperature for 2 hours, the mixtures are centrifuged at room temperature. 16,000 xg for 5 minutes The fraction of the oil body and the subnatant were carefully removed and the cell pellet was washed twice in 1 ml 50 mM Tris-CI pH 7.5 The walls of the tube were cleaned with a tissue to remove traces Subsequently, the pellets of drained cells were resuspended in 1 ml of water and the OD600 was determined - Figure 12 is a representative experiment showing the decrease in the amount of cells present in the cell pellet as it increases the concentration of anti-IgG present in the mixture of S. aureus of the oily body.Differential binding of two strains of Staphylococcus aureus.In this experiment, an affinity matrix of the oily body is used to demonstrate the differential binding of two strains of Staphylococcus aureus. The S. aureus strains fixed with formalin, one expressing protein A of the IgG binding surface antigen and the other lacking protein A, are commercially available from Sigma. Diluted aliquots of S. aureus OD55o strains could be prepared the same. For each of these aliquots, one could add the control of the oily bodies of the untransformed plants or the oily bodies mixed with anti-oleosin antibodies. After incubation for an appropriate time at an appropriate temperature, the samples could be centrifuged for the bacterial cells not bound to the pellets and for separating the fraction from the oil body. Oily bodies could be decanted, stirred and the OD55o could be determined. The pellets could be resuspended and the OD550 of the subnatant could be determined. It is anticipated that only in the sample containing the strain of S. aureus expressing protein A and the oil body complexed with anti-oleosin antibodies, fractionation of these cells to the oily body fraction will be observed. The binding of the cells to the oily body could also be demonstrated by lowering the pH of the oily body fraction. After centrifugation to release the cells from the oily bodies, the presence of a pellet and / or an increase in OD550 could be evidenced by resuspension of the pellet. Separation of Staphylococcus aureus from E. coli A viable S. aureus strain could be mixed with varying amounts of cells from an E. coli strain having a specific antibiotic resistance. The mixed bacterial sample could be stirred with the control antibodies and oil bodies that have been complexed with anti-oleosin antibodies. After incubation for an appropriate time and at an appropriate temperature, the oil bodies could be washed and the subnatant and oil bodies could be directly titrated and seeded selectively on blood agar for growth of S. aureus and on LB plates for growth of E. coli. The actual enrichment or separation obtained could be determined by a calculation of colony formation units. Identification of Pathogens Present in Low Concentrations as a Mix of Complexes For diagnostic purposes, it is often convenient to concentrate bacterial or viral pathogens that invade human or animal tissues in low numbers. An affinity matrix of the oily body could be used to enrich these pathogens, so that they could be subsequently identified and characterized.

Pathogens often bind specifically to human or animal cells through interaction with a receptor or surface protein. The oleosin could be fused to the human or animal protein ligand and the recombinant oily bodies can be used to immobilize the pathogens. Examples of the formation of protein complexes formed between proteins of human and pathogenic origins known from the prior art include: human fibrinogen or specific fibrin domains that bind to the protein cluster factor of S. aureus A (clf-A) ( McDevitt et al., 1995; Mol Microbiol., 16; 895-907); human deterioration acceleration factor (FAD) which binds the pathogenic E. coli of the urinary and intestinal tract (Nowicki et al., 1993; J. Of Experim.Med.178: 21-15-2121); a ligand of human cells that are expressed in the carcinoma in the Caco-2 carcinoma cell line and that bind only to the 28 KD KPF-28 Klebsiella pneumoniae fiber protein (Di Maretino et al., 1996; Infecí, and I mmun., 64: 2263-2266) and fibronectin specific domains of extracellular matrix of human cells that are specifically complexed with Streptococcus pyrogenes adhesin (F protein) (Ozeri et al., 1996; EMBO J. 15: 989-998). . EXAMPLE 6 Separation of Small Organic Molecules This example describes how an affinity matrix of the oily body can be used to recover / remove small organic molecules from the solution. By way of example, the small organic molecule, biotin, is purified using avidin as a ligand. Construction of Avidin Ligands Avidin is a protein synthesized by bird species and exhibits an extremely high affinity for biotin, a natural co-factor for many carboxylases. Purified avidin preparations (commercially available from Sigma) can be chemically conjugated to anti-oleosin antibodies using standard procedures known to those skilled in the art. This approach could produce a bivalent avidin ligand to demonstrate the affinity-based removal of biotin. Alternatively, a fusion of the oleosin-avidin gene can be used. The gene encoding avidin in chickens (Gallus gallus) has been identified and its sequences determined (Beattie et al., 1987, Nucí Acids Res. 15: 3595-3606). Based on the sequence the gene for avidin could be synthesized chemically or through PCR and fused to the oleosin of B napus (van Rooijen, 1993, Ph.D. Thesls, University of Calgary) as described in example 4. It could also be use streptavidin, an analogous bacterial biotin binding protein. Oil Body Preparation The washed oily bodies could be prepared from seeds of transgenic plants and / or control plants as described in Example 1. Bivalent Avidin-Oleosin Ligand Binding The binding of anti-oleosin antibodies and removal of the ligand as detailed in example 3. Removal of Biotin from the Solution Solutions containing known concentrations of biotin could be combined with a fixed amount of oil bodies complexed with anti-oleosin antibodies conjugated with avidin. After binding, the mixture could be centrifuged to separate the oily body and the oil fraction. The amount of biotin remaining in the aqueous fraction was determined by competitive ELISA using anti-biotin antibodies conjugated to horseradish peroxidase (HRP). The amount of bound biotin can be calculated assuming that: [bound biotin] = [total biotin] = [free biotin] From the values obtained, the dissociation constants can be determined as described in example 2. As a control, it could be carry out an identical experiment with oily bodies bound to anti-oleosin antibodies that have not been conjugated with avidin. If desired, biotin could be released from the oily-avidin body matrix through competitive elution using an excess of 2- (4-hydroxybenzene) benzoic acid (HABA). Elusion could also be aided by employing a mutant genetically treated with avidin that exhibits a lower affinity for biotin. Said mutants have been described for analogous biotin-binding protein of streptavidin bacteria (Chilkoti et al., 2995; Bio / Technol. 13: 1 198-1204). EXAMPLE 7 Separation of Carbohydrates The following example describes the usefulness of oil body matrices for the recovery of carbohydrates from complex biological mixtures. In this example, the inventors demonstrated that an immobilized cell of the oily body is capable of binding cellulose. Fusion of Oleosin-Cellulose Binding Domain Several of the celluloses produced by the Cellulomonas fimi bacteria contain discrete cellulose binding domains (DUC). These DUC bind independently to cellulose even when separated by proteolytic separation or genetic manipulation of the catalytic domain of the enzyme. Plasmid pU C 18-CBDPT contains a fragment encoding DUC of beta-1,4-glucanase (Gilkes et al., 1992 Journal of Biol. Chem. 267: 6743-6749) and could be used to construct an oleosin gene fusion -Dr. A DNA fragment encoding the DUC domain could be isolated from pUC 18-CBDPT using appropriate restriction enzymes or using PCR. "Alternatively, the DUCs of other C. fimi celluloses could be used from other sources. B. napus oleosin isolated from a cDNA library (van Rooijen, 1993, Ph.D. Thesis, University of Calgary) was cloned into pGN using PCR and yielding the pOLEGN plasmid as described in example 4. A fusion of gene within the framework between the oleosin gene and the DUC gene could be generated using standard techniques known to those skilled in the art.The final construct could comprise the translationally fused DUC domain immediately downstream of the oleosin. In order to introduce the construction of the fusion gene in plants, it could be subcloned into a binary vector, such as pCG N 1559. Transgenic plants expressing the oleosin-DUC fusion could gene work as described in example 1. Oil Body Preparation The washed oily bodies could be prepared from the seeds of transgenic or wild-type control type as described in Example 1.

Solution Cellulose Removal Using Oil Bodies Affinity Matrix In order to evaluate the binding of cellulose to the affinity matrix of the oil body, the capacity of the oil bodies of wild-type and transgenic plants was compared. Oily bodies could be mixed with appropriately regulated solutions containing a scale of cellulose concentrations. The concentrations of bound cellulose and free cellulose could be calculated assuming that: [bound cellulose] = [total cellulose] = [free cellulose] The ratio of the binding concentration to the free cellulose concentration was plotted as a function of the cellulose concentration united (Scatchard graph). From these graphs, the dissociation constants of the affinity matrix were calculated following normal procedures (Scatchard, G. Ann. NY Acad. Sci. (1994) 57: 660-672) and are detailed in example 2. EXAMPLE 8 Separation of Nucleic Acids The following example describes a method in which oil bodies were used to bind single-stranded nucleic acids (SH). Isolation of Single-Thread Nucleic Acids A method for capturing SH nucleic acids could be used in diagnosis, such as plant viral disease or in research applications where the non-annealed SH nucleic acid did not need to be removed selectively from the solutions , such as in the hybridization reactions for differential screening reactions of expressed genes. The oleosins could be fused with SH DNA or RNA binding proteins or specific domains thereof and could be used to trap SH nucleic acids for further identification or amplification. The nucleic acid binding proteins of SH are well characterized and include: Vir E2 protein from Agrobacterial Ti plasmid (Zupan et al., 1995, Plant, Physiol. 107: 1041-1047); Tobacco Mosaic Virus (VMT) virus movement P30 protein (Citovsky et al., 1990; Cell 60: 637-647; Waigmann et al., 1994 Proc. Nati. Acad. Sci (USA) 91: 1433- 1437); Cauliflower Mosaic Virus coating protein (Thompson et al., 1993; J. Gen. Virol 74: 1 141-1 148) and single-stranded binding proteins (USH) (Radding, 1991 J. Biol. Chem. 266: 5355-5358). EXAMPLE 9 Separation of Recombinant Proteins The following example further demonstrates the utility of an affinity matrix of oil bodies for the purification of recombinant white proteins. For the purpose of this example, the IgG / protein A ligand pair has been chosen. The construct employed consists of a protein A domain that is fused to the 18 kDa Arabidopsis oleosin (Van Rooijen et al., 1992; Mol. Biol. 18: 1 177-1 179). Oily bodies containing oleosin-protein A fusion proteins were isolated and used to demonstrate specific binding of rabbit anti-mouse IgG conjugated to Radish Peroxidase (HRP). The configuration of the oleosin-protein A fusion on the oil body and the IgG binding of the fusion is shown in Figure 15. Oleosin-Protein A Fusion A synthetic protein A sequence encoding a protein capable of binding to the protein. IgG was synthesized based on the reporter sequence information (pRIT2T, protein A gene fusion vector, Pharmacy) and amplified via PCR. Each primer used in PCR contained restriction sites 50 for the specific sequence for protein A in order to facilitate cloning. The reverse primer (i.e., the primer in the sense direction) also contained a transnational tag codon following the coding sequence. Figure 13 shows the position of the relative PCR primers of the protein A sequence. (The protein A sequence and the primer sequences were also shown separately in SEQ.ID.NO:8, SEQ.ID.NO : 10 and SEQ.ID.NO:11 respectively). The resulting fragment was ligated into a pUC19 plasmid containing the oleosin gene of Arabidopsis comprised of a promoter region of 867 bp upstream followed by the coding region (with its associated intron) from which the transnational catch codon was removed. The 3 'end of the construct contains the nopaline synthase transcriptional terminator. A separator sequence encoding a recognition sequence for endoprotease thrombin was incorporated immediately downstream of the oleosin coding sequence. The sequence of the protein A gene was introduced between this separating sequence and the terminator sequence. In the final expression construct the protein A coding regions were fused in the same reading frame. The entire construct (Figure 14 and SEQ.ID.:NO:13) was excised from plasmid pUC 19 and subcloned into the plant transformation vector pCGN 1559 (McBride and Summerfelt, 1990, Plant Mol. Biol. 14: 269-276) carrying a neomycin phosphotransferase gene under the control of the 35S CaMV promoter. The resulting plasmid was introduced into Agrobacterium (strain EHA 101). Transformation and Regeneration The plants were transformed and regenerated as described in Example 1. The transgenic plants were initially identified using an analysis of neomycin phosphotransferase and subsequently confirmed by the expression of protein A fusions through immunoblot analysis. Oil Body Preparation The oil bodies of the transgenic B. napus and B. carinata lines expressing the oleosin-protein A fusion were prepared after the procedure described in example 1. Union of Oleosin-Protein A-IgG Fusions Protein extracts of oil bodies (20 μl / aliquot) of several transgenic B. napus lines expressing oleosin-protein A fusion proteins were subjected to polyacrylamide gel electrophoresis and subsequently they were transferred to a PVDF membrane followed by normal procedures. The membrane was then probed with a rabbit anti-mouse antibody conjugated to H RP and visualized after the procedure, as described in a laboratory manual "Antibodies" (Harlow and Lane, 1988, Cold Spring Harbor). In Figure 16, the PVDF membrane of the strain is shown. A protein of 50 kDa (predicted molecular mass of the oleosin-protein fusion protein: 48.801 Da) was detected specifically in the extracts of the protein of the six lines of ß. transgenic napus tested. The untransformed control plants do not exhibit H RP activity, while the 30 kDa protein (predicted molecular mass 29,652 Da) was present in a bacterial lysate transformed with the protein coding pR IT2T and was not detected in the lysate not turned. IgG Elution Union for Oily Bodies containing Oleosin-Protein A fusion proteins. The washed oily bodies (10 mg / ml protein) were prepared from B. napus wild type and a line from B. transgenic napus with a construction expressing an oleosin-protein A fusion protein as described in Example 1 and suspended in 10 mM Tris-CI pH 8.8. A volume of 2 μl (± 34 μg) of rabbit anti-mouse antibodies conjugated with H RP (Sigma, cat # 09044) was added to 500 μl of the washed oil body preparation and the suspension was incubated for 1 hour at room temperature overnight at 4 ° C. The samples were then centrifuged for 15 minutes at 16,000 xg and the subnatant was removed. Subsequently, the oily bodies were uniformly resuspended in 500 μl 10 mM Tris-Cl pH 8.0 using a pot. This wash step in Tris-Cl was repeated 4 times (hereinafter called oil body wash preparation). An aliquot of 5μl of the washed oil body preparation was washed five times and then analyzed for H RP activity. H RP analysis was carried out by adding 1 μl of the oily body preparation to 1 ml of H RP analysis mixture (9.8 ml of 0.1 M NaOAc, 0.2 ml of 2.5 mg / ml Trimethylbenzidine in DMSO, 4 μl of H2O2) and the mixture was incubated for 5 minutes at room temperature. The reaction was then stopped by adding 0.5 ml of 1 M H2SO. The samples were filtered through a 0.22 μm filter and subsequently the OD4S0 were determined spectrometrically. In order to bypass the IgG from the oil bodies, the washed oil body preparation was resuspended in 10 mM glycine, pH 3.0 and centrifuged for 15 minutes at 16,000 xg and incubated for 30 seconds at room temperature. After neutralization in 500 μl, mM Tris-Cl pH 8.0, both the oil body fraction and the eluate were analyzed for H RP activity as before. The binding and elution of IgG to oily bodies of B. wild type napus and transgenic B. napus that expressed an oleosin-protein A fusion as illustrated in Figure 17. All publications, patents and patent applications are hereby incorporated by reference in their entirety to the same extent as indicated each individual publication, patent or patent application individually and individually to be incorporated by reference in its entirety.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANTS: (A) NAME: SemBioSys Genetics Inc.

(B) STREET: 609-14 Street, N.W. (C) CITY: Calgary (D) STATE: Alberta (E) COUNTRY: Canada (F) POSTAL CODE: T2N 2A1 (G) TELEPHONE NO .: (403) 220-5161 (H) TELEFAX NO .: (403) 220 -0704 (A) NAME: Moloney, Maurice (B) STREET: 34 Edgebrook Cove N.W. (C) CITY: Calgary (D) STATE: Alberta (E) COUNTRY: Canada (F) POSTAL CODE: T3A 5N5 (A) NAME: Boothe, Joseph (B) STREET: # 302, 3326th Avenue N.W.

(C) CITY: Calgary (D) STATE: Alberta (E) COUNTRY: Canada (F) POSTAL CODE: T2E OL9 (A) NAME: Rooijen. Gijs Van (B) STREET: 3223 Bearspaw Drive N.W. (C) CITY: Calgary (D) STATE: Alberta (E) COUNTRY: Canada (F) POSTAL CODE: T2N 1T1 (ii) TITLE OF THE INVENTION: Oil bodies and associated proteins as affinity matrices. (iii) SEQUENCE NUMBER: 14 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESS: BERESKIN & PARR (B) STREET: 40 King Street West (C) CITY: Toronto (D) STATE: Ontario (E) COUNTRY: Canada (F) POSTAL CODE: M5H 3Y2 (v) READABLE FORM BY COMPUTER (A) TYPE OF MEANS: Flexible Disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.30 (vi) CURRENT REQUEST DATA (A) REQUEST NUMBER : (B) DATE OF SUBMISSION: (C) CLASSIFICATION: (vii) PREVIOUS APPLICATION DATA: (A) NUMBER OF APPLICATION: US 08 / 767,026 (B) DATE OF SUBMISSION: DECEMBER 16, 1997 (viii) AUTHORITY INFORMATION / AGENT (A) NAME: Gravelle Micheline (B) REGISTRATION NUMBER: 40,261 (C) REFERENCE NUMBER / CASE: 9369-050 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (416) 364-7311 (B) TELEFAX: (416) 361-1398 (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 522 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE (A) ORGANISM: Oleosin from Arabidopsis Thaliana (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..522 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1: ATG GCG GAT ACA GCT AGA GGA ACC CAT CAC GAT ATC ATC GGC AGA GAC 4S M% t Wing Asp Tfex Wing Arg Gly Thr Hls His Asp lie He ßly Arsr Asp 1 5 10 15 CAG TAC CCG ATG ATG GGC CGA GAC CGA GAC CAG TAC CAG ATG TCC GGA 96 Without Tyr Pro Mee Mee Gly Arg Aßp Arg Asp Gln Tyr Gln Mee Ser Gly 20 25 30 CGA GGA TCT GAC TAC TCC AAG TCT AGG CAG ATT GCT AAA GCT GCA ACT 144 Arg Gly Ser Asp Tyr Ser Lys Ser Arg Gln ti- Ala Lys Ala Ala Thr 35 _0 45 GCT GTC GTC GGT GGT TCC CTC CTT GTT CTC TCC AGC CTT ACC CTT 19 _ Wing Val Thr Wing Gly Gly Ser Leu Lé-u Val Leu S_r Ser e Thr «u 50 55 60 GTT CGA ACT GTC ATA GCT TTG ACT GTT GCA AC CCT CTG CTC GTT ATC 240 to Gly Thr Val He Wing eu Thr Val Wing Thr Pro Leu Leu Val Il «65 70 75 80 TTC AGC CCA ATC CTT GTC CCG GCT CTC ATC AC GTT GCA CTC CTC ATC 28B Phe Ser Pro Ilß Leu Val? Ro Ala L «u He Thr V» l Ala Leu Leu lio 85 90 95 ACC GGT TTT CTT TCC TCT GGA GGG TTT GGC ATT GCC GCT ATA ACC GTT 336 Thr Gly Phe Lu Ser Ser Gly Gly £ > h «Gly Il_ Wing Wing He Thr Val 100 105 110 TTC TCT TGG ATT TAC AAG TAC GCA ACG GGA GAC CAC CCA CAG GGA TCA 384 Ph_Ser Trp Xle Tyr by * Tyt Wing Thr Gly Glu His Pro Glp Gly Ser 115 120 125 GAC AAG TTG GAC AGT GCA AGG AIG AAG TTG GGA AGC AAA GCT CAG GAT 432 Asp L, yst L «u A * p Ser Ala Arg Mt Lys Le Gly S_r Lys Ala Gln Asp 130 135 140 CTG AAA GAC AGA GCT CAS TAC TAC GGA CAS CAA CAT ACT GGT GGG GAA 480 Le Lys Aßp Ar_í Wing Gln Tyr Tyr Gly Gln G n His Thr Gly Gly Glu 145 3.50 155 160 CAT GAC CGT GAC CGT ACT CGT GGT GGC CAG CAC ACT ACT TAA 522 His Asp Arg Asp Arg Thr Arg Gly Gly Gil. His Thr Thr * 165 170 (2) IN FO RMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SECU ENC IA (A) LONG ITU D: 174 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLÉCU LA: protein (xi) DESCR I PC ION OF SECU ENC IA: SEQ ID NO: 2: Met Wing Asp Thr Wing Ara Gly Thr His His Asp He He Gly Arg Asp 1. S 10 15 Gln Tyr Pro Met Mee Gly Arg Asp Arg Asp Glri Tyr Gln M «= e Ser Gly 20 25 30 Arg Gly Ser Asp Tyr Stx Lys Ser Ar» Gli. 11e Wing Lys Wing Wing Thr 35 40 45 Wing Val Thr Wing Gly Gly Ser Leu Leu Val Leu Ser SQX Leu Thr Leu 50 55 60 Val Gly Thr Val He Wing Wing Leu Thr V &Wing Wing Thr Pro Leu Leu val He 65 70 5 80 P e Ser Pro HG Leu Val Pro Wing Leu He Thr Val Wing Leu Leu II- 85 90 95 Thr Gly ph_ Leu S * r Ser Gly Gly Phe Gly 13e Wing Wing * Thr Val 100 105 • 110 Ph_ Ser Trplia Tyr Lys Tyr Wing Thr Gly Glu Hís Pro Gln Gly S® 115 120 125 Asr Lys Leu Asp Set Wing Ar ? r Met Lys Leu Gly Ser Lys Wing Gln Asp 130 135 140 Leu Lys Asp Ara Wing Gln Tyr Tyr Gly (Without Gln His Thr Gly Gly Glu 145 150 155 160 His Asp Arg Asp Arg Thr Arg Gly Gly Gln His Thr Thr * 155 170 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 2115 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Fusion of Oleosin - Hirudin (ix) CHARACTERISTIC (A) NAME / KEY: CDS (B) LOCATION: 862..1215 (xi) D ESC RI PC I ND OF THE S EC U N IC: S EQ ID NO: 3: CTATACCCAA CCTCGGTCTT OOTCACACCA GGAACTCTCT GQTAAJ3CTAG CTCCACTCCC 60 CAGAAACAAC CGGCGCCA &A T «TGCCC ¥ AAT TGCTGACCTs AAGACGGAAC ATCATCGT G 120 GGTCCTT GG CGATTGCGGC GGAAGATGGG TCAGCTTGGG CTTGAGGACG AGACCCGAAT 180 CGAGTCTGTT GAAAGGTTGT TCATTGGGAT TTGTATACGG AGATTGGTCG TCOAGAGGTT 240 TGAGGGAAAG GACAAATGGG TTTGGCTCTG GAGAAAGAGA OTGCCGCTTT AGAGAGAGAA 300 TTGAGAGGTT TAGAGAGAGA TGCQGCGGCG ATGACGK5GAG GAGAGACGAC < 3AG < 3ACCTGC 360 ATTATCAAAG CAGTGACGTG GTGAAATTTa «AACTTTTAA GAOGCAGATA GATTTATTAT 420 TTGTATCCAT TTTCTTCATT GTTCTAGAAT GTCGOSGAAC AAATTTTAAA ACTAAATCCT 480 AAATTTTTCT AATTTTGTTG CCAATAGTGG ATATGTGGGC CGTA AOAAG GAATCTATTG 540 AAGGCCCAAA CCCATACTGA CGAGCCCÁAA GGTTCGTTTT GCGTT-TATG TTTCGGTTCG 600 ATGCCAACGC CACATTCTGA QCTAGGCAAA AAAC? A? C3T GTCTTTGAAT AGACTCCTCT 660 C3TTAACACA TGCAGCGGCT GCATGGTGAC GCCATTAACA CGTGGCCTAC AATTGCATGA 720 TGTCTCCATT GACACGTGAC TTCTCGTCTC CTTTCTTAAT ATATCTAACA AACACTCCTA 780 CCTCTTCCAA AATATATACA CATCTTTTTG ATCAATCTCT CATTCAAAAT CTCATTCTCT 840 CTAGTAAACA AGAACAAAAA ATG GCG GAT ACA GCT AGA GGA ACC CAT CAC 691 Met Wing A_p Thr Wing Arg Gly Thr His His 1 5 10 GAT ATC ATC GGC AGA GAC CAG TAC CCG ATG ATG GGC CGA GAC CGA GAC 939 Asp xle lie Gly Ar? r Aßp < 31n Tyr Prß 2- * e Mee Gly Arg As Arg Asp 15 20 25 CAG TAC CAG ATG TCC GGA COA GGA TCT GAC TAC TCC AAG TCT AGG CAG 987 Gl »Tyr Gli. Me- Ser Gly Arg Gly Ser Asp Tyr Ser Lyß Se Arg G n 30 35 40 ATT GCT AAA GCT GCA ACT GCT GTC ACA GCT GGT QGT TCC CTC CTT GTT 1035 He Ala Lys Ala Ala Thr Ala Val Thr Ala Gly Gly Ser Leu. Leu Val 45 50 55 CTC TCC AGC CTT ACC CTT GTT GGA ACT GTC ATA GCT TTG ACT GTT GCA 1083 Leu Ser Ser Leu Thr Leu Val Gly Thr Val lie Ala Leu Thr Val Wing 50 65 70 ACÁ CCT CTG CTC GTT ATC TTC AGC CCA ATC CTT GTC CCG GCT CTC ATC 1131 Thr Pro Leu Leu a He Phe Ser Pro He Leu Val Pro Ala Leu He 75 80. 85 _0 ACÁ GTT GCA CTC CTC ATC ACC GGT TTT CTT TCC TCT GGA GGG TTT GGC 1179 Thr Val Wing Leu Leu He Thr Gly Phe Leu Ser Ser Gly Gly Phe Gly 95 100 105 ATT GCC GCT ATA ACC GTT TTC TCT TGG ATT TAC AAG TAA < 3CACACA 1225 lie Ala Ala lie Th_r Val Phe Ser Trp He Tyr Lys 110 115 TTTATCATCT TACTTCATAA TTTTGTGCAA TATGTGCATG CATGTGTTGA GCCAGTAGCT 1285 TTGGATCAAT TTTTTTGGTC GAATAACAAA TGTAACAATA AGAAATTGCA AATTCTAGGG 1345 AACATTTGGT TAACTAAATA CGAAATTTGA CCTAGCTAGC TTGAATGTGT CTGTGTATAT 1405 CATCTATATA GGTAAAATGC TTGGTATGAT ACCTATTGAT TGTGAATAGG TAC GCA 1461 Tyr Wing 1 ACG GGA GAC CAC CCA CAG GGA TCA GAC AAG TTG GAC AGT GCA AGG ATG 1509 Thr Gly Glu His Pro Gln Gly Ser Asp Lys Leu Asp Ser Ala Arg Mee 5 10 1S AAG TTG GGA AGC AAA GCT CAG GAT CTG AAA GAC AGA GCT CAG TAC TAC 1557 Lys Leu Gly Ser Lys Wing Gln Asp Leu Lys Asp Arg Wing Gln Tyr Tyr • 20 25 30 GGA CAG CAA CAT ACT GGT TGG GAA CAT G7.C CGT GAC CGT ACT CGT GGT 1605 Gly Glr. Gln His Thr Gly Trp Glu His Asp Arar Asp Arg Thr Arg Gly 35 40 45 50 GGC CAG CAC ACT ACT GCG ATC GAA GGG AGA ATC ACT TAC ACT GAC TGT 1653 Gly Gln Hiß Thr Thr Wing He Glu Gly Arg He Thr Tyr Thr Asp Cys 55 60 6S ACT GAA TCT GGA CAG AAC CTC TGT CTC TGT GAA GGA TCT AAC GTT TGT 1701 Thr Glu er Gly Gln Asn Leu Cys Leu Cys Glu Gly Ser Asn Val Cys 70 75 80 GGA AAG GGA AAC AAG TGT ATC CTC GGA TCT AAC GGA AAG GGA AAC CAG 174S Gly Lys Gly Asn Lys Cya He Leu Gly Be Asn Gly Lys Gly Asn Gln 85 90 95 TGT GTT ACT GGA GAA GGA ACT CCA AAC CCA GAA TCT CAC AAC AAC GGA 1797 Cys Val Thr Gly Glu Gly Thr Pro Asn Pro Glu S &x His Asi- Asn Gly 100 105 110 GAC TTC GAA GAA ATC CCT GAA GAA TAC CTC CAO TAA GTCGACTCTA 1843 Asp Glu Glu Phe Glu Tyr He Glu Pro Leu Gln * 115 120 125 GACGGATCTC CCGATCGTTC AAACATTTGG CAATAAAGTT TCTTAAGATT GAATCCTGTT 1903 GCCGGTCTTG CGATGATTAT CATATAATTT CTGTTGAATT ACGTTAAGCA TGTAATAATT 1963 AACATGTAAT GCATGACGTT ATTTATGAGA TGGGTTTTTA TGATTAGAGT CCCGCAATTA 2023 TACATTTAAT ACGCGATAGA AAACAAAATA TAGCGCGCAA ACTAGGATAA ATTATCGCGC 2083 2115 TC CQGTGTCAT CTATGTTACT AGATCGGAAT (2) IN TRAINING FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SECU ENCIA (A) LONG ITU D: 1 18 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: Mee Wing Asp Thr Wing Argr Gly I? Go His His Aßp He He Gly Arg Asp 1 5 10 15 Gln Tyr Pro Mee Mee Gly Argr Asp Ar_y Asp 3lt. Tyr Glr. Met Ser Gly 20 25 30 Arg Gly Ser Asp Tyx Ser Lys Ser Arg G_ *? Xle Ala Lys Al »Ala. Thr 35 40 45 Wing Val Thr Wing Gly Gly Leu Leu a.1 Leu Ser Ser Le Thr Leu 50 55 £ 0 to 51y Thr al He Wing Wing Leu Thr Val AX * Thr Pro Leu e to He 65 70 75 30 Phe Ser Pro He Leu. Val Pro Ala Leu 11% Thr Val Ala Leu Leu He 85 90 95 Thr Gly Phe Leu Be Gly Gly Phe Gly He Wing Ala He Thr Val 100 105 110 Phe Ser Trp He Tyr Lys (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 126 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: Tyr Wing Thr Gly Glu His Pro Gln Gly Sex- Aap Lys Leu Asp Wing 1 5 10 1S Ars Mee Lys Leu Gly Ser Lys Wing Gln Asp Leu Lys Aap Arg Wing Gln 20 2S 30 Tyr Tvr Gly Gln ßln His Thr Gly Trp Glu His Asp Arg Asp Arg Thr 35 40 45 Arg Gly Gly Gln His Thr Thr Wing He Glu Gly Arg He Thr Tyr Thr 50 55 60 Asp Cys Thr Glu Ser Gly Gln Asn Leu Cys Leu Cys Glu Gly Ser Asn 65 70 75 80 Val Cys Gly Lys Gly Asn Lyß Cy_ He Leu Gly Ser Asn Gly Lys Gly 85 90 95 Asn Gln Cys Val Thr Gly Glu Gly Thr Pro Aßn. Pro Glu Ser His Asn 100 105 110 As »Gly Asp Phe Glu Glu He Pro Glu Glu Tyr Leu Gln * 115 120 125 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 2366 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Fusion of Oleosin - Metalothionine (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1092..1856 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: GAGCTCAAAT ACGATCTGA ACTGATAACG TCTAGATTTT AOGGTTAAA CAATCAATC 60 ACCTGACGAT TCA.AGGTCGT TGGATCATCA CGATTCCAG? ??? CATCAAG CAAGCTCTCA 120 AAGCTACACT Cl -TGG ATC ATACTGAACT CTAACAACCT CGTTATGTCC CGTAGTGCCA 180 GTACAGACAT CCTCGTAACT CGGATTATGC ACGATGCCAT GGCTATACCC AACCTCGGTC 2-0 TTGGTCACAC CACGAACTCT CTGGTAAGCT AGCTCCACTC CCCAGAAACA ACCOGCGCCA 300 AATTGCCGGA ATTGCTGACC TGAAGACGGA ACATCATCGT CGGGTCCTTG GGCGATTGCG 360 GCGGAAGATG GGTCAGCTTG GGCTTGAGGA CGAGACCCGA ATCGAGTCTG TT AAAOCTT 4-20 _TTCKTT < S < S_ ATTTGTA AC iGAGATTGGT CGTCGAGAGG TTTGAGGGAA AGGACAAATG 480 GGTTTGGCTC TGGAGAAAGA GAGTGCGGCT TTAGAGAGAG AATTGAGAGG TTTAGAGAGA 540 GATGCGGCGG CGATGACGGG AGGAGAGACG ACGAGGACCT GCATTATCAA AGCACTGACG 500 TOGTGA? ATT TGGAACTTTT AAGAGGCAGA TAGATTTATT ATTTGTATCC ATTTTCTTCA 66U TTGTTCTAGA ATGTCGCGGA ACAAATTTTA AAACTAAATC CTAAATTTTT CTAATTTTGT 720 TG-CAATA-T GGATATGTGG GCCGTATAGA AGGAATCTAT TGAAGGCCCA AACCCATACT 780 GACGAGCCCA AAGGTTCGTT TTGCGTTTTA TGTTTCGGTT CGATGCCAAC GCCACATTCT 840 GAGCTAGGCA AAAAACAAAC GTGTCTTTGA ATAGACTCCT CTCGTTAACA CATGCAOCGG 900 CTGCATGGTG ACGCCATTAA CACGTGGCCT ACAATTGCAT GATGTCTCCA TTGACACGTG 960 ACTTCTCGTC TCCTTTCTTA ATATATCTAA CAAAC? CTCC TACCTCTTCC AAAATATATA 102U CACATCTTTT TGATCAATCT CTCATTCAAA ATCTCATTCT CTCTAGTAAA CAGGATCCCC 1080C ATG GCG GAT ACA GCT AGA ACC CAT CAC G? T GTC ACA AGT 1130 Met Wing Asp Thr Wing Arg Thr His His Asp Val Thr S & Í: 1 5 10 CGA GAT CAG TAT CCC CGA GAC CGA GAC CAG TAT TCT ATG ATC GGT CGA 1178 Arg Asp Gln Tyr Pro Arg Asp Arg Asp Gln Tyr Ser Met He Gly Arg 15 20 25 GAC CGT _AC CAG TAC TCT ATG ATG GGC CGA GAC CGA GAC CAG TAC AAC 1226 Asp Arg Asp Gln Tyr Ser Mee Met Gly Arg Asp Arg Asp Gln Tyr As 30 35 40 ATG TAT GGT CGA GAC TAC TCC AAG TCT AGA CAG ATT GCT AAG GCT GTT 1274 Met Tyr Gly Arg Asp Tyz S_r Lys Ser Arg ßln He Ala Lys Ala Val 50 55 '60 ACC GCA GTC ACG GCG GGT TCC CTC CTT GTC CTC TCC AßT CTC ACC 1322 Thr Wing Val Thr Wing Gly Gly Ser Leu Leu Val Leu Ser Sex Leu Thr 65 70 75 CTT GTT GGT ACT GTC ATT GCT TTG ACT GT GCC ACT CCA CTC CTC OTT 1370 JiSV. Yal Gly hj; ? »L. t? e &jd L.eu Sv ,? H? I Al- SSX S? Í. & eit rtx U * ¿__xß lie Phe Ser Pro He Leu Val Pro Ala Leu He Thr Val Ala Leu Leu 95 100 105 ATC ACT GGC TTT CTC TCC TCT GGT < 3GG TT GCC ATT GCA GCT ATA ACC 1466 He Thr Gly Phe Leu Ser Ser Gly Gly Phe Wing He Wing Wing He Thr 1 0 115 120 1_5 GTC TTC TCC TGG ATC TAT AAG TAC GCA ACG < 3GA GAG CAC CCA CAG GGG 1514 Val Phe Ser Trp lie Tyr Lys Tyr Wing Thr sly Glu His Pro Gln Gly 130 135 140 TCA GAT AAG TTG GAC AGT GCA AGG ATG AAG CTG GGA ACC AAA GCT CAG 1562 Ser Asp Lys Leu Asp Ser Ala Arg Met Lyc Leu Cly Thr Lys Ala Gln 145 150 155 GAT ATT? A? GAC AGA GCT CAAC TAC TAC GGA CAG CAÁ CAT ACÁ GGT GGT 161? Asp He Lys Asp Arg Wing Gln Tyr Tyr Gly Gln Gli. His Thr Gly Gly 160 165 170 GAG CAT GAC CGT GAC CGT ACT CGT GGT GGC CAG CAC ACT ACT CTC GTT 1658 Glu His Asp Arsr Asp Arg Thr Arg Gly Gly Gln His Thr Thu Leu Val 175 180 185 CCA CGA GGA TCC ATG GAT CCC AAC TGC TCC TGT GCC GCC AGT GAC TCC 1706 Pro Arg Gly Ser Met Asp Pro Asn Cys Ser Cys Ala Wing Ser Asp Ser 190 195 200 205 TGC ACC TGC GCC GGC TCC TGC AAG TGC AAA GAG TGC AAA TGC ACC TCC 1754 Cys Thr Cys Wing Gly Ser Cys Lys Cys Lys Glu Cys Lys Cys Thr Ser 210 215 - 220 TGC AAG AAA AGC TGC TGC TCC TGC TGT CCG GTG GGC TGC GCC AAG TGT 1802 Cye Lys Lye Ser Cys Cys Ser Cye Cys Pro Val Gly Cys Ala Lys Cys 225 230 23S GCC CAG GGC TGC ATC TGC AAA GGG GCG TCG GAC AAG TGC AGC TGC TGT 1850 Wing Gln Gly Cys He Cys Lys Gly Wing Ser Asp Lys Cys Ser cys Cys 240 245 250 GCC TGA GCGGCCGCGA GGGCTGCAGA ATGAGTTCCA AGATGGTTTO TGACGAAGTT 1906 Wing * 255 AGTTGGTTGT TTTTATGGAA CTTTGTTTAA GCTTGTAATG TGGAAAGAAC GTGTGGCTTT 1966 GTGOTTTTTA AATGTTGGTG AATAAAGATG TTTCCTTTGG ATTAACTAGT ATTTTTTTA 2026 TTGGTTTCAT GGTTTTAGCA CACAACATTT TAAATATGCT GTTAGATGAT ATGCTGCCTG 2086 CTTTATTATT TACTTACCCC TCACCTTCAG TTTCAAAGTT GTTGCAATGA CTCTGTGTAG_2146_TTTAAGATCG AGTGAAAGTA GATTTTGTCT ATATTTATTA GGGGTATTTG ATATGCTAAT 2206 GGTAAACATG GTTTATGACA GCGTACTTTT • TGGTTATGG TGTTGACGTT TCCTTTTAAA 2266 CATTATAGTA GCGTCCTTGG TCTGTGTTCA TTGGTTGAAC AAAGGCACAC TCACTTGGAG 23 6 ATGCCGTCT CACTGATATT TGAACAAAGAATTCGGTACC 2366 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 255 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 7: Met Wing Asp Thr Wing Arg Thx His His Asp Val Thr Ser Arg Asp Gln 1 S 10 15 Tyr Pro Arg Asp Arg Aep Gln Tyr Ser Mee He Gly Arg Asp Arg Asp 20 25 30 Gln Tyr Ser Met Met Met Gly Ara Aßp Arg Asp Glp Tyr Asu Mee Tyr Gly 35 40 45 Arg Asp Tyr £ e_ Lys Ser Arg G n He Wing LyS Wing Val Thr Wing Val 50 55 60 Thr Wing Gly Gly Ser Leu Leu Val Leu S ^ x Ser Leu Thr Leu Val Gly 65 70 75 80 Thr Val He Wing Leu Thr Val Wing Thr Pro Leu Leu Val He Phe Ser 85 90 95 Pro He Leu Val Pro Wing Leu He Tbr Val Wing Leu Leu He Thr Gly 100 105 110 Phe Leu Ser Ser Gly Gly Phe Wing Wing Wing He Thr Val Phe S &r 115 120 _ 125 Trp He Tvr Lys Tyr Wing Thr Gly Glu His Pro Glr. Gly Ser Asp Lys 130 135 140 Leu Asp Be Wing Arg Met Lys Leu Gly Thr Lys Wing Gln Asp He LYS 145 150 155 160 Asp Arg Wing Gln Tyr Tyr Gly Gln Gln Hie Thr Gly Gly Glu His Asp 165 170 175 Arg Asp Arg Thr Arg Gly Gly Gln His Thr Thr Leu Val Pro Arg Gly 180 185 190 Ser Mee Asp Pro Asn Cys Ser Cys Ala Wing Ser Aep S & Cye Thr Cvs 195 200 205 Wing Gly Ser Cys Lys Cys Lys Glu Cys Lys Cys Thr Ser Cys Lys Lye 210 215 220 Ser Cys Cys S & Cys Cys Pro Val Gly Cys Ala Lys Cys Ala Gln Gly 2 -? "2.c. 2 • .3 • an0 2- > 3.-5:" 23 _4P0 Cys He Cys Lys Gly A-la S &r Asp Lys Cye Ser Cye Cye Wing 245 250 255 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 804 base pairs (B) TYPE: nucleic acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ) ORIGINAL SOURCE: (A) ORGANISM: Protein A Initiators (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 5,796 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 8: CTCC ATO GAT CA CGC AAT GGT TTT ATC CAA AGC CTT AAA GAT GAT CCA 49 Met Asp Gln Arg AS? I Gly Phe He Gln S &r Leu Lys Asp Asp Pro 1 5 10 Ib AGC CAA AGT GCT AAC GTT TTA GGT GAA GCT CA AAA CTT AAT GAC TCT 97 Ser Gln Ser Wing Asn V_l Leu Gly Glu Wing Gln Lys Leu Asn Asp Ser 20 25 30 CA CCT CCA AAA GCT GAT GCG CAÁ CAÁ AAT AAC TTC AAC AAA GAT CAA 145 sn Ala Pro Lys Ala Asp A. ß Gln ßl «Asn Asn Phe? Sn Lys Asp Gln 35 40 45 CAA AGC GCC TTC T? T GAA ATC TTG AAC ATG CCT AAC TTA AAC GAA GCG 193 Gln Ser Wing Phe Tyr Glu He Leu Asn Met Pro Asn Leu Asn Glu Wing 50 55 60 CAÁ CGT AAC GGC TTC ATT CA AGT CTT AAA GAC GAC CCA AGC CAA AGC 2 1 Gln Arg Asn Gly he He Gln S% t Leu Lys Asp Asp Pro Ser Gln Ser 65 70 75 ACT AAC GTT TTA OGT GAA GCT AAA AAA TTA AAC GAA TCT CAA GCA CCG 289 Thr Asn Val Leu Gly slu Ala Lys Lys Leu Asn Glu Ser Gln Wing Pro 80 85 90 95 AAA GCT GAT AAC AAT TTC AAC AAA GAA CAA CAA AAT GCT TTC TAT GAA 337 Lys Wing Asp Asn Asn Phe Asn Lys Glu Gln Gln Asn Wing Phe Tyr Glu 100 105 110 ATC TTG AAT ATG CCT AAC TTA AAC GAA GAA CAA CGC AAT GGT TTC ATC 385 lie Leu Asn Mee Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly Phe He 115 120 125 CAA AGC TTA AAA GAT GAC CCA AGC CAA AGT GCT AAC CTA TTG TCA GAA 433 Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Wing Asn Leu Leu Ser Glu 130 135 140 GCT AAA AAG TTA AAT GAA TCT CACA GCA CCG AAA GCG GAT AAC AAA TTC 481 Wing Lys Lys Leu Asn Glu Ser Gln Wing Pro Lys Wing Asp Asn Lys Phe 145 150 155 AAC AAA GAA CA CAA AAT GCT TTC TAT GAA ATC TTA CAT TTA CCT AAC S29 Asn Lys Glu Gli. Gln Asn Wing Phe Tyr Gl He Leu His Leu Pro Asn 160 165 170 175 TTA AAC GAA GAA CA CGC AAT GGT TTC ATC CA AGC CTA AAA GAT GAC 577 Leu Asn Glu Glu Gln Arg Asn Gly Phe He Gln Ser Leu Lys Asp Asp 180 185 190 CCA AGC CA AGC GCT AAC CTT TTA GCA GAA GCT AAA AAG CTA AAT GAT 625 Pro Ser Gln Ser Wing Asn Leu Leu Wing Glu Wing Lys Lys Leu Aßn Asp 195 200 205 GCT CA GCA CCA AAA GCT GAC AAC AAA TTC AAA AAA GAA CA CAA AAT 673 Wing G n Wing Pro Lys Wing Asp Asn. Lys Ph < = Asn Lys Glu Gln Gln Asn 210 215 220 GCT TTC TAT GAA ATT TTA CAT TTA CCT AAC TTA ACT GAA GAA CAÁ CGT 721 Ala * Tyr Glu He Leu His Leu Pro Asn Leu Thr Glu Glu Gli- Arg 225 230 235 AAC GGC TC ATC CAA AGC CTT AAA GAC GAT CCG GGG AAT TCC CGG OGA 769 Asn Gly Phe He Gln Ser Leu ys ASp Asp Pro Gly Aen Ser Ara Gly 240 24S 250 255 TCC GTC GAC CTG CAG ATA AC AAT TAG AAGCTTGC 804 Ser Val Asp Leu Gln He Thr Asn * 260 (2) IN TRAINING FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SECU ENC IA (A) ITU D LENGTH: 264 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (i) TI PO FROM MOLÉCU LA: prote ína (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: Met Asp Gln Ara Asn Gly Ph_ lie Gln Ser- Leu Lys Asp Asp Pro Ser 1 5 10 15 Gln Ser Ala Asn Val Leu Gly Glu Ala Gln Lys Leu A? Asp be Gln 20 25 30 Wing Pro Lys Wing Asp Wing Gln Gln Asn Asn Phe Asn Lys Asp Glr. Gln 35 40 • 45 S & Ala Phe Tyr Glu He Leu Asn Mee Pro Asn Leu Asn Glu Ala Gln 50 55. 60 Arg Asn Gly Phe lie Gln Ser Leu Lys ASp Asp Pro Ser Gln Ser Thr 65 70 75 80 Aan Val Leu Gly Glu Wing Lys Lys Leu Asn Glu Ser Gln Wing Pro Lys 85 90 95 Wing Aep Asn Asn Phe Asn Lys Gln Gln Asn Alo Phe Tyr Glu He 100 105 110 Leu Asn Mee Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly Phe He Gln 115 120 125 Ser Leu Lys Asp Asp Pro Ser Gln Ser Wing Asn Leu Leu Ser Glu Wing 130 135 • 140 Lys Lys Leu Asn Glu Ser Gln Wing Pro Lys Wing Aßp Asn Lye Phe Asn 145 150 155 160 Lys Glu Gln Gln Asn Wing Phe Tyr < _lu He Leu Hie Leu Pro Asn Leu 16? 170 175 Aen Glu Glu Gln Arg Asn Gly Phe He Gln Ser Leu Lys Asp Asp Pro isp 185 190 Ser Gln Ser Wing Asn Leu Leu Al »Gl_ Ala Lye Lys Leu Asn Asp Wing 195 200 20S sln Wing Pro Lys Wing Asp Aßn Lys Phe Asn Lys Glu Gln G n Asn Wing 210 215 220 Phe Tyr Glu He Leu His Leu Pro Asn Leu Thr Glu Glu Gln Arg Asn 225 230 235 240Gln Ser Leu Lyß Aßp Asp Pro Gly Asn Ser Arg Gly Ser 245 250 255 val Aep Leu Gln He Thr Aßn * 260 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Initiator Bk 266 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 10: CTCCATGGAT CAACGCAATG GTTTATC 27 (2) INFORMATION FOR SEQ ID NO: 11: ( i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Initiator Bk 267 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 GCAAGCTTCT AATTTGTTAT CTGCAGGTC 29 (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 2709 base pairs (B) TYPE: nucleic acid (C) THREAD FORM: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTIC (A) NAME / KEY: CDS (B) LOCATION: 868..1220 (ix) CHARACTERISTIC (A) NAME / KEY: CDS (B) LOCATION: 1462 .. 2436 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 12: CCATGGCTAT ACCCAACCTC GGTCTTGGTC ACACCAGGAA CTCTCTGGTA AGCTAGCTCC 60 ACTCCCCAGA AACAACCGGC GCCAAATTGC CGGAATTGCT GACCTGAAGA CGGAACATCA 120 TCGTCGGGTC CTTGGGCGAT TGCGGCGGAA GATGGGTCTC CTTGGGCTTG AGGACGAGAC 180 CCGAATCGAG TCT TTGAAA GGTTsTTCAT T3GC? TTTGT ATACGQAGAT TOGTCGTCGA -? - U GAGGTTTGAG GGAAAGGACA AATGGGTTTG GCTCTGGAGA AAGAGAGTGC GGCTTTAGAG 300 AGAGAATTGA GAGGTTTAGA GAGAGATGCG GCGGCGATGA CGGGAGGAGA GACGACGAGG 360 ACC-GCATTA TCAAAGCAGT GACGTGGTGA AATTTGGAAC TTTTAAGAGG CAGATAGATT 420 TATTATTTGT ATCCATTTTC TTCATTGTTC TAGAATGTCG CGGAACAAAT TTT? AAACTA 480 AATCCTAA? T TTTTCTAATT TTGTTGCCAA TAGTGGATAT GTGGGCCGTA. TAGAAGGAAT 540 CTATTGAAGG CCCAAACCCA TACTGACGAG CCCAAAGGTT CGTTTTGCGT TTTATGTTTC 600 GGTTCGATGC CAACGCCACA TTCTGAGCTA sGCA? AAAAC AAACGTGTCT TTGAATAGAC 660 TCCTCTCGTT AACACATGCA GCGGCTGCAT GGTGACGCCA TTAACACGTG GCCTACAATT 720 GCATGATGTC TCCATTGACA CGTGACTTCT CGTCTCCTTT CTTAATATAT CTAACAAACA 780 CTCCTACCTC TTCCAAAATA TATACACATC TTTTTGATCA ATCTCTCATT CAAAATCTCA 840 TTCTCTCTAG TAAACAAGAA CAAAAAA ATG GCG GAT AC. GCT AGA GGA ACC 891 Mét Wing Asp Thr Wing Arg Gly Thr 1 5 CAT CAC OAT ATC ATC GGC AGA GAC CAG TAC CCG? TG ATG GGC CGA GAC 939 Hie His Asp He He G3y Arg Asp Gln Tyi Pro Mee Met Gly Arg Asp 10 15 20 CGA GAC CAG TAC CAG ATG TCC GGA CGA GGA TCT GAC TAC TCC AAG TCT 987 Arg Asp Gln Tyr Gln Met Ser Gly Arg Gly Ser Asp Tyr Ser Lys Ser 25 30 35 40 AGG CAG ATT GCT AAA GCT GCA ACT GCT GTC AC GCT GGT GGT TCC CTC 1035 Arg Gln He Ala Lys Ala Ala Thr Ala Val Thr Ala Gly Gly Ser Leu 45 50 55 CTT GTT CTC TCC AGC CTT ACC CTT GTT GGA ACT GTC ATA. GCT TTG ACT 1083 Leu Val? __ u Ser Ser Leu Thr Leu Val Gly Thr val He Wing Leu Thr 60 65 70 GTT GCA AC CCT CTG CTC GTT ATC TTC AGC CCA ATC CTT GTC CCG GOT 11 1 Val Wing Thr Pro Leu Leu Val He Phe Ser Pro He Leu Val Pro Al_ 75 80 85 CTC ATC ACÁ GTT GCA CTC CTC ATC ACC GGT TTT CTT TCC TCT GGA GOG 1179 Leu He Thr Val Ala Leu Leu lie Thr Gly Phe Leu Ser Ser Gly Gly 90 95 100 TTT GGC ATT GCC GCT ATA ACC GTT TTC TCT TGG ATT TAC AA 1220 Phe Gly T.le Ala Ala He _hr Val Phe be Trp He Tyr 105 110 115 GTAAGCACAC ATTTATCATC TTACTTCATA ATTTTGTGCA ATATGTGCAT OCATGTGTTC 1280 AGCCAGTAGC- TTTGGATCAA TTTTTTTGGT CGAATAACAA? TGTAACAAT AAGAAATTGC 1340 AAATTCTAGG GAA ATTTGG TTAACTAA? T AC-AAATTTG ACCTAGCTAG CTTGAATí? TG 1400 TCTGTGTATA TCATCTATAT AGGT? AAATG CTTGGTATG »TACCTATTG? TTGTGAATAG_1460_G TAC GCA ACG G3A GAG CAC CCA CAG GGA TCA GAC AAG TTG GAC AGT 1506 Tyr Ala Thr Gly Glu His Pro Gln Gly Ser Asp Lys Leu Asp S z 1 5 10 15 GCA AGG ATG AAG TTG GGA AGC AAA GCT CAG GAT CTG AAA GAC AGA GCT 1554 Ala Arg Met Lys Leu. Gly Ser Lyß Ala Gil. Asp Leu Lys Aßp Arg Wing 20 25 30 CAG .TAC TAC GGA CAG CAA CAT ACT GGT GGG GAA CAT GAC CGT GAC CGT 1602 Gln Tyr Tyr Gly Gln Gln His Thr Gly Gly Glu His Asp Arg Asp Arg 35 40 4S ACT CGT GGT GGC CAG CAC ACT ACT CTC GTT CCA CGA GGA TCC ATG GAT 1650 Thr Arg Gly Gly Gln His Thr Thr Leu Val Pro Arg Gly Ser Met Asp 50 55 60 CA CGC AAT GGT TTT ATC CAA AGC CTT AAA GAT GAT CCA AGC CAA AGT 1698 Gln Arg Aen Gly Phe He Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser 6S 70 75 GCT AAC GTT TTA GGT GAA GCT CA AAA CTT AAT GAC TCT CAÁ GCT CCA 1746 Wing Asn Val Leu Gly Glu Wing Gln Lys Leu Asn Asp Ser Gln Wing Pro 80 85 90 95 AAA GCT GAT GCG CAÁ CAÁ AAT AAC TTC AAC AAA GAT CA CA AGC GCC 1794 Lys Wing Asp Wing Gln Gln Asn Aen Phe Asn Lys Asp Gln Gln Ser Wing 100 105"110 TTC TAT GAA ATC TTG AAC ATG CCT AAC TTA AAC GAA GCG CAA CGT AAC 18 2 Phe Tyr Glu He Leu Asn Met Pro Asn Leu Asn Glu Wing Gln Arg Asn 115 120 125 GGC TTC ATT CAA AGT CTT AAA GAC GAC CCA AGC CAÁ AGC ACT AAC GTT 1890 Gly Phelia Gln. be Leu Lys Asp Asp Pro Ser G n Ser Thr Asn Val 130 135 140 TTA GGT GAA GCT AAA AAA TTA AAC GAA TCT CA GCA CCG AAA GCT GAT 1938 Leu Gly Glu Wing Lys Lyß Leu Asn Glu Ser Gln Wing Pro Lys Wing Asp 145 150 155 AAC AAT TTC AAC AAA GAA CA CA AAT GCT TTC TAT GAA ATC TTG AAT 1986 Asn Asn phe Asn Lys Glu Gln Gln Asn Wing Phe Tyr Glu He Leu Asn 160 165 17D 175 ATG CCT AAC TTA AAC GAA GAA CAA CGC AAT GGT TTC ATC CAA AGC TTA 2034 Met Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly Phe He Gln Ser Leu 180 185 190 AAA GAT GAC CCA AGC CAA AGT GCT AAC CTA TTG TCA GAA GCT AAA AAG 2082 Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ser Glu Wing Lys Lys 195 200 205 TTA AAT GAA TCT CA GCA CCG AAA GCG GAT AAC AAA TTC AAC AAA GAA 2130 Leu Asn Glu SGT Gln Ala Pro Lys Wing Asp Asn Lys Phe Asn Lys slu 210 215 220 CA CAA AAT GCT TTC TAT GAA ATC TTA CAT TTA CCT AAC TTA AAC GAA 2176 Gln Gln Aßn Wing Phe Tyr Glu He Leu His Leu Pro Asn Leu Asn Glu 225 230 235 GAA CAA CGC AAT GGT TTC ATC CA CA AGC CTA AAA GAT GAC CCA AGC CA 2226 Glu Gln Arg Asn Gly Phe He Gln Ser Leu Lys Asp Asp Pro Ser Gln 240 245 250 255 AGC GCT AAC CTT TTA GCA OAA GCT AAA AAG CTA AAT GAT GCT CA GCA 2274 Ser Ala Asn Leu Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala Gln Wing 260 265 270 CCA AAA GCT GAC AAC AAA TTC AAC AAA GAA CAA CAA AAT GCT TTC TAT 2322 Pro Lys Wing Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Wing Phe Tyr 275 280 285 GAA ATT TTA CAT TTA CCT AAC TTA ACT GAA OAA CAA CGT AAC GGC TTC 23 U Glu He Leu His Leu Pro Asn Leu Thr Glu Glu Gln Arg Asn Gly Phe 290 295 300 ATC CA AGC CTT AAA GAC GAT CCG GGG AAT TCC CGG GGA TCC GTC GAC 2418 He Gln S < 3: £ Leu Lys Asp Asp Pro Gly Aen Ser Arg Gly Ser Val Asp 305 310 315 TC cz¡_. ? __ ifl. ? an - 320 325 AACATTTGGC AATAAAGTTT CTTAAGATTG AATCCTGTTG CCGGTCTTGC GATGATTATC 2526 ATATAATTTC TGTTGAATTA CGTTAAGCAT GTAATAATTA ACATGTAATG CATGACGTTA 2536 TTTATGAGAT GGGTTTTTAT GATTAGAOTC CCGCAATTAT ACATTTAATA CGCGATAGAA 2646 AACAAAATAT AGCGCGCAAA CTAGGATAAA TTATCGCGCG CGGTGTCATC TATGTTACTA 270 GAT 2709 (2) IN TRAINING FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SECU ENCIA (A) LONG ITU D: 1 17 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (ii) TI PO DE MOLÉCU LA: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: Met Wing Asp Thr Wing Arg Gly Thr His His Asp He He Gly Arg Asj 1 5 10 15 Gln Tyr Pro Met Met Gly Arg App Arg Asp Gln Tyr Gln Met Ser Gl_. 20 25 30 Arg Gly Ser Asp Tyr Ser Lys Ser Arg Gln He Ala Lys Ala A.la Th- 35 40 45 Wing Val Thr Wing Gly Gly Ser Leu Leu Val Leu Ser Ser Leu Thr Lex) 50 55 60 Val Gly Thr Val He Ala Leu Thr Val Ala Thr Pro Leu Leu Val He 65 70 75 80 Phe Ser Pro He Leu Val Pro Ala Leu He Thr Val Ala Leu Leu He 85 90 95 Thr Gly Phe Leu Be Ser Gly Gly Phe Gly He Wing Wing He Thr Val 100 ios not Phe Ser Trp He Tyr 115 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 325 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (i) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: Tyr Ala Thr Gly Glu His Pro Gln Gly Ser Asp Lys Leu Asp Ser Ala 1 5 10 15 Arg Met Lys Leu Gly Ser Lys Al- Gln Asp Leu Lys Aep Arg Ala Gln 20 25 30 Tyr Tyr Gly Gln Gln His Thr Gly Gly Glu His Asp Arg Asp Arg Thr 35 40 45 Arg Gly Gly Gln His Tnr Thr Leu Val Pro Arg Gly Ser Mee Asp Gln 50 55 60 Arg Asn Gly Phe He Gln Ser Leu Lys Asp Asp Pro Ser Gln S € tx Ala 65 70 75 80 Asn Val Leu Gly Glu Wing Gln Lys Leu Asn Asp Ser Gln Ala Pro Lys 85 90. 95 Wing Asp Wing Gln Gln Asn Asn Ph * Asn Lys Asp Gln Gln Ser Wing Phe 100 105 110 Tyr Glu He Leu Asn Mee Pro Asn Leu Asn Glu Wing Gln Arg Asn Gly 115 120 125 Phe He Gln Ser Leu Lys Asp Asp Pro S ^ x Gln Ser Thr Asn al Leu 130 135 140 Gly Glu Wing Lys Lys Leu Ae Glu Ser Gln Wing Pro Lys Wing Asp Asn 145 150 155 160 Aen Phe Asn Lys Glu Gln Gln Asn Wing Phe Tyr slu He Leu Asn Mee 165 170 175 Pro Asn Leu Asn Glu Glu Gln Arg Asn Gly Phß He Gln Ser Leu Lys 180 185 190 Asp Aep Pro Ser Gln Ser Wing Asn Leu Leu Ser Glu Wing Lys Lys Leu 195 200 205 Asn Glu be Gln Ala Pro Lys Wing Asp Asn Lys Phe Aen Lys Glu Gln 210 215 220 Gln Asn Wing Phe Tyr Glu He Leu His Leu Pro Asn Leu Asn Glu Glu 225 230 235 240 Gln Arg Asn Gly Phe He sln Ser Leu Lys Asp Asp Pro Ser Gln Ser 245 250 255 Ala? Ert Leu Leu Ala Glu Ala Lys Lyß Leu Af Asp Ala G? N Ala Pro 2 * 0 265 270 Lys Ala Asp Asn Lys Phe Asn L s Glu Oln G n Asn Ala P e Tyr Glu 2 5 280 285 He Leu His Leu Pro Aßn Leu. Thr Glu Glu Gln Arg Asn Gly Phe He 290 295 300 Oln Ser Leu Lys Asp Asp Pro Gly Asn Ser Arg Gly Ser Val Asp Leu 305 310 315 320 G n tl < - Thr Aen 325

Claims (36)

1. REIV IN D ICAC ION ES 1. A method for separating a target molecule from a sample comprising 1) contacting (i) oil bodies with (ii) a sample containing the target molecule to allow the target molecule to associate with the oil bodies; and 2) separating the oily bodies associated with the sample bank molecule.
2. 2. A method according to claim 1, further comprising a ligand molecule that is associated with the oil bodies and the target molecule.
3. 3. A method according to claim 2, wherein the ligand molecule is covalently bound to the oil bodies.
4. 4. A method according to claim 3, wherein the ligand molecule is covalently bound to an oil body protein in the oil bodies.
5. 5. A method according to claim 2, wherein the ligand is comprised of two molecules, a first molecule that associates with the oil bodies and a second molecule that associates with the target, wherein the first molecule and the second molecule are associated with each other.
6. 6. A method according to claim 5, wherein the first and second molecules of the ligand are conjugated with one another.
7. 7. A method according to claim 4, wherein the ligand molecule is a protein.
8. 8. A method according to claim 7, wherein the protein ligand is a fusion protein with the oil body protein.
9. A method according to any of claims 1 to 8, wherein the target molecule is selected from the group consisting of proteins, peptides, organic molecules, lipids, carbohydrates, nucleic acids, cells, organelles of cells, cell components , viruses, metals, ions of metals and ions.
10. 10. A method according to claim 8, wherein the ligand molecule is hirudin and the target molecule is thrombin.
11. 11. A method according to claim 8, wherein the ligand molecule is protein A and the target molecule is immunoglobulin.
12. 12. A method according to claim 8, wherein the ligand molecule is metallothionine and the target molecule is cadmium.
13. 13. A method according to claim 8, wherein the ligand molecule is a cellulose binding protein and the target molecule is cellulose.
14. A method according to claim 8, wherein the ligand molecule is nucleic acid binding protein and the target molecule is nucleic acid.
15. 15. A method according to claim 14, wherein the ligand is a single-stranded DNA binding protein or an RNA binding protein and the target is a single nucleic acid molecule of a single strand.
16. 16. A method according to claim 2, wherein the ligand is an antibody that binds to the oily body or the oil body protein.
17. 17. A method according to claim 16, wherein the blank is a cell, cell organelle or cell component capable of binding to the ligand antibody.
18. 18. A method according to claim 16, wherein the cell is Staphylococcus aureus.
19. 19. A method according to claim 16, wherein the ligand is a bivalent antibody that binds both the oil body and the target.
20. 20. A method according to claim 6, wherein the ligand is an antibody conjugated to avidin and the target molecule is biotin.
21. 21. A method according to any of claims 4, 7, 8, 9, 10, 11, 12, 13, 14, 15, wherein the oil body protein is an oleosin.
22. 22. A method according to claim 21, wherein the oleosin is derived from a plant selected from the group consisting of watercress (Arabidopsis thaliana), rapeseed oil (Brassica spp.), Soybean (Glycine max), sunflower (Helianthus) annuus), palm oil (Elaeis winkle), cottonseed (Cocus nucifera), peanut (Arachis hypogaea), coconut (Cocus, nucifera), castor (Recinus communis), safflower (Cathamus tinctorius), mustard (Brassica spp. and Sinapis alba), coriander (Coriandrum sativum) linseed (Linum usitatissimum) and corn (Zea mays).
23. 23. A method according to any one of claims 1 to 22, wherein in step 1) the oil bodies and the sample are mixed and then incubated for about 1 minute to about 24 hours.
24. 24. A method according to claim 23, wherein the mixed oily bodies and the sample are incubated at a temperature range from about 4 ° C to about room temperature.
25. 25. A method according to any of claims 1 to 24, wherein the oily bodies associated with the target molecule are separated from the sample in step (2) by centrifugation, flotation or size exclusion.
26. 26. A method according to any of claims 1 to 25, further comprising 3) separating the target molecule from the oil bodies.
27. 27. A method according to claim 26, wherein the target molecule is eluted under appropriate conditions.
28. 28. A method according to any of claims 1 to 27, wherein the oil bodies are obtained from the group of plants consisting of watercress (Arabidopsis thaliana), rapeseed oil (Brassica spp.), Soybean (Glycine max) , sunflower (Helianthus annuus), palm oil (Elaeis winkle), cottonseed (Cocus nucifera), peanut (Arachis hypogaea), coconut (Cocus, nucifera), castor (Recinus communis), safflower (Cathamus tinctorius), mustard (Brassica spp. And Sinapis alba), coriander (Coriandrum sativum) linseed (Linum usítatissimum) and corn (Zea mays).
29. 29. A composition comprising oil bodies associated with the molecule.
30. 30. A composition according to claim 29, wherein the molecule is a white molecule selected from the group consisting of organic molecules, lipids, carbohydrates, nucleic acids, cells, cellular organelles, cellular components, viruses, metals, metal ions. and ions.
31. 31 A composition according to claim 30, further comprising a ligand molecule that is associated with the oil bodies and the target molecule.
32. 32. A composition according to claim 29, wherein the molecule is a ligand molecule.
33. 33. A composition according to claim 31 or 32, wherein the ligand molecule is covalently bound to the oil bodies.
34. 34. A composition according to claim 33, wherein the ligand is biotin.
35. 35. An affinity matrix for use in separating a target molecule from a sample comprising an oily body that can be associated with the target molecule.
36. 36. An affinity matrix to be used for the separation of a target molecule from a sample comprising (a) an oily body and (b) a ligand molecule associated with the oily body, wherein the ligand molecule is capable of associating with the white molecule. RESU M EN A method for separating a white molecule from a mixture is described. The method employs oily bodies and their associated proteins as affinity matrices for the selective non-covalent binding of the desired target molecules. The oily body proteins can be genetically fused to a ligand that has specificity for the desired target molecule. Native oil body proteins may also be used in conjunction with a specific ligand for oil body proteins such as an antibody or an oil body binding protein. The method allows the separation and recovery of the desired target molecules due to the difference in densities between the oil bodies and aqueous solutions.