MXPA99005359A - Method for altering the nutritional content of plant seed - Google Patents

Abstract

The invention provides genetically engineered, preselected DNA sequences and methods of using them to alter the nutritional content of plant seed. Methods of the invention are directed to increasing the weight percent of at least one amino acid essential to the diet of animals, or increasing the starch content of a plant. One such method involves stably transforming a cell of a plant with a preselected DNA sequence encoding a RNA molecule substantially identical or complementary to a messenger RNA (mRNA) encoding a plant seed storage protein, preferably a seed storage protein which is deficient in at least one amino acid essential to the diet of animals. An alternative method employs stably transforming cells with at least two preselected DNA sequences, one of which encodes an RNA molecule substantially identical or complementary to a messenger RNA (mRNA) encoding a plant seed storage protein, and the other preselected DNA molecule which encodes a preselected polypeptide. The transformed cells are used to generate fertile transgenic plants and seeds. Transgenic seeds are characterized by expression of the preselected DNA sequence which results in a substantial inhibition of production of a seed storage protein deficient in at least one amino acid essential to the diet of animals and/or an increase in the weight percent of an amino acid essential to the diet of animals.

Description

METHOD FOR ALTERING THE NUTRITIONAL CONTENT OF PLANT SEEDS FIELD OF THE INVENTION The invention relates in general to the modification of the nutritional content of the de-maize seed using pre-selected DNA constructs. More specifically, the invention relates to the use of pre-selected DNA constructs to transform corn plants, to alter protein levels, such as protein storage proteins, for example, prolamines (zeins), in seeds of transgenic corn plants. In this way, the invention provides a mechanism for replacing nutritionally deficient proteins with nutritionally enhanced proteins and / or for increasing starch levels in the seeds of transgenic maize plants.

BACKGROUND OF THE INVENTION In agriculturally important seed crops, the expression of protein genes REF .: 30558 storage directly affects the nutritional quality of the seed protein. In corn, the prolamin (zein) fraction of the storage proteins comprises more than 50% of the total protein in the mature seed. The seeds designated a-zein are especially abundant. The a-zein polypeptides contain extremely low levels of the essential amino acids lysine and tryptophan. Thus, the corn seed protein is deficient in these amino acids because such a large proportion of the storage protein in total seed is contributed by the a-zeins (Mertz et al., 1964). The development of the development or breeding steps to improve the corn based on the manipulation of the zein profile, is harbored by the complexity of the zein proteins. The term "zeins" encompasses a family of about 100 related proteins. Zeins can be divided into four structurally distinct types: a-zeins include proteins with molecular weights of 19,000 and 22,000 daltons; the ß-zeins include proteins with a molecular weight of 14,000; The? -zeins include proteins with molecular weights of 27,000 and 26,000 daltons; and the d-zeins include proteins having a molecular weight of 10,000 daltons. A-zeins are the major zein proteins found in the endosperm of corn grains. However, the complexity of the zein proteins goes beyond these size classes. The analysis of the protein sequence indicates that there is microheterogenicity in the amino acid sequences of zein. This is in agreement with isoelectric focusing analyzes that show charge differences in zein proteins. More than 70 genes coding for zein proteins have been identified (Rubenstein, 1982), and zein genes appear to be located on at least three chromosomes. In this way, zein proteins are encoded by a family of multiple genes. Based on sequential and hybridization data, the multigenic family of zein is divided into several subfamilies. Each subfamily is defined by the sequence homology to a cDNA clone: A20, A30, B49, B59, or B36. The selection studies of hybrids employing the selection mRNAs of B49 and B36 that code for a-zein proteins of the predominantly heavy class (23 kD), while the selection of A20, A30 and B59 predominantly for proteins a-zein of light class (19 kD) (Heidecker and Messing, 1986). A comparison of the sequences of the zein in each of the subfamilies A20, A30 and B49 have identified four distinct functional domains (Messing et al., 1983). Region I corresponds to the signal peptide present in most, if not all, zeins. Regions II "and IV correspond to the amino and carboxyl termini, respectively, of the mature protein zein Region III corresponds to the coding region between Regions II and IV, including a region having tandem repeats of a sequence of 20 amino acids There are several known mutations that cause reductions in the synthesis of zein, which lead to alterations in the amino acid content of the seed. For example, in homozygous plant seeds for the recessive opaque -2 mutation, the content of zein is reduced by approximately 50% (Tsai et al., 1978): the opaque -2 mutation mainly affects the synthesis of a-zein proteins of 19 and 22 kD, causing a significant decrease in the level of the 19 kD zein fraction and reducing the accumulation of the 22 kD zein fraction at barely detectable levels (Jones et al., 1977). In this mutant, there is a concomitant increase in the proportion of nutritionally more balanced proteins, for example, albumins, globulins and glutelins, deposited in the seed. The net result of altered storage protein patterns is an increase in the essential amino acids lysine and tryptophan in the mutant seed (Misra et al., 1972). Two other recessive mutations, fl oury-2 and s ugary-1, result in increased levels of methionine in the seed. The increased methionine content in the seeds of the fl oury-2 mutants is the result of a decrease in the zein / glutein ratio, due to reductions in the a-zein fractions levels of 19 and 22 kD, and an apparent increase in the methionine content of the glutelin fraction (Hansel et al., 1973; Jones, 1978). In the sugary-1 mutants, there is a decrease in the synthesis of zein, coupled with an increase in the methionine content of the zein and glutelin fractions (Paulis et al., 1978).

As demonstrated by the opaque-2, fl oury-2 and sugary-1 mutations, reductions in zein synthesis and / or changes in the relative proportions of storage protein fractions can affect the complete amino acid composition of the seed. Unfortunately, the poor agronomic characteristics (grain softness, reduced yield, reduced resistance to disease) are associated with opaque and floury mutations, preventing its easy application in commercial breeding. Another way in which genes can be down-regulated in animals and plants, involves the expression of antisense genes. A review of the use of antisense genes in the manipulation of gene expression in plants can be found in van der Krol et al. (1988a; 1988b). Inhibition of the expression of several endogenous plant genes has also been reported. For example, U.S. Patent No. 5,107,065 describes the down regulation of polygalacturonase activity by the expression of an antisense gene. Other plant genes sub-regulated using antisense genes include the genes encoding chalcone synthase and the small subunit of ribulose-1,5-biphosphate carboxylase (van der Krol et al., 1988c, Rodermel et al., 1988). However, to date there is no description of the attempts to use antisense technology to alter the nutritional content of the seeds. The down regulation of gene expression in a plant can also occur through the expression of a particular transgene. This type of underregulation is called cosuppression and involves the coordinated silencing of a transgene and a second transgene or an endogenous gene homolog (Matzke and Matzke, 1995). For example, the co-suppression of a herbicide resistance gene in tobacco (Brandle et al., 1995), polygalacturonidase in tomato (Flavell, 1994) and chalcone synthase in petunia (US Patent No. 5,034,323) have been demonstrated. Flavell (1994) suggested that genes from multiple copies, or families of genes, must have evolved to avoid cosuppression, so that multiple copies of the related genes are expressed in a plant. Thus, there is a need for a method to alter the nutritional content of the seeds and produce grains with good agronomic characteristics, including maintenance of grain hardness, yield, and disease resistance of the parent genotype. In addition, there is a need for a method for decreasing the expression of storage proteins in seeds of poor nutritional quality, while increasing proteins with higher contents of nutritionally advantageous amino acids, such as methionine and lysine, and / or while also increasing the starch content of the seeds.

BRIEF DESCRIPTION OF THE INVENTION The invention provides methods that employ pre-selected DNA sequences or segments, engineered by genetic engineering, to alter the nutritional content of plant seeds. Expression of the preselected DNA sequence results in an altered protein and / or amino acid composition in the plant, plant tissue, plant part or transgenic plant cell, relative to the plant, plant tissue, plant part or non-transformed plant cell. , for example, non-transgenic, corresponding. Preferably, the seeds of the transgenic plant have an increased amount, for example, weight percent, of at least one amino acid essential for the diet of the animals, relative to non-transformed seeds, for example, non-transgenic. An increase in the weight percent of at least one amino acid essential for the diet of animals, for example, lysine, methionine, isoleucine, tryptophan, or threonine in seeds, increases the nutritional value of those seeds for animals, for example, food for poultry and pigs, or for human consumption. Thus, the invention provides a method comprising the stable transformation of the cells of a plant with an expression cassette. The expression cassette comprises a preselected DNA sequence which codes for an RNA molecule that is substantially identical (sense), or complementary (antisense), to all or a portion of a messenger RNA ("target" mRNA), for example , an endogenous or "native" mRNA which is present in an untransformed plant cell. The target RNA encodes a storage protein of the seed of the plant, preferably a protein that is deficient in at least one amino acid, and more preferably deficient in an amino acid that is essential for the diet of the animals. The resulting transformed cells are used to regenerate fertile transgenic plants which in turn produce transgenic seeds, wherein the preselected DNA sequence is expressed in transgenic seeds in an amount effective to reduce or substantially decrease the amount, weight percentage or level of a seed storage protein relative to the amount, percent by weight or level of the seed storage protein present in the corresponding non-transgenic seeds, for example, seeds from an untransformed RO control plant or non-transformed seeds corresponding isolated from the transgenic plant. The seed storage protein is one that is deficient in at least one amino acid essential for an animal's diet. Preferably, the decrease in the amount of the storage protein in the seed results in an increase in the weight percent of the storage proteins of the seed, which comprise higher percentages of amino acid nutritionally advantageous. The preselected DNA sequence preferably codes for an RNA molecule substantially complementary to all or a portion of an mRNA encoding a 19 kD or 22 kD a-zein protein. A reduction in seed storage proteins, for example, a-zeins, may be accompanied by a decrease in the degree of grain hardness. Grain hardness can be increased in these cases by modification of the grain phenotype as described for the opaque -2 mutation (Lopes and Larkins, 1991) or by genetically modifying the plants to increase the levels of certain endosperm proteins, such as the? -zein of 27 kD. The genetically engineered DNA sequences of the invention are "preselected" since the coding regions contained therein have been isolated in vi tro, and identified at least functionally. Thus, a "preselected" DNA sequence is a sequence or segment of DNA that has been isolated from a cell, purified and amplified. The choice of the preselected DNA sequence will be based on the amino acid composition of the polypeptide encoded by the strand in the sense of a preselected DNA sequence, and preferably, the ability of the polypeptide to accumulate in the seeds. Preferably, the number of coding regions has also been evaluated. Also, preferably, the isolated DNA molecule is "recombinant" since it contains preselected DNA sequences from different sources, which, preferably, have been linked to produce chimeric expression cassettes. The preselected DNA sequences are preferably about 2 to 3 kb. The invention further provides a method for increasing the starch content of a plant, the part of a plant, the plant tissue or the plant cell. The method comprises the stably transforming cells of a plant with an expression cassette. The expression cassette comprises a preselected DNA sequence encoding a substantially identical RNA molecule, or complementary, to all or a portion of at least one mRNA that codes for a storage protein in plant seed. Preferably, the preselected DNA sequence is operably linked to a functional promoter in a plant and / or a seed. The transformed cells are used to regenerate transgenic, fertile plants and seeds. The preselected DNA sequence is preferably expressed in the transgenic seeds in an amount effective to decrease the percentage of the storage protein in the seeds, in the transgenic seed, on the percentage by weight of the seed storage protein present in the seed non-transgenic corresponding. The preselected DNA sequence is also preferably expressed in the transgenic seeds in an amount effective to increase the weight percentage of the starch in the transgenic seed, on the percentage by weight of the starch present in the corresponding non-transgenic seed. An increase in the weight percent of the starch in the seeds improves the nutritional value of the seed, or its value as a source of starch for use in processed food products or in various industrial applications. In addition, an increase in the starch content in transgenic seeds can result in an increase in the starch recovered from those seeds. A method for inhibiting a family or subfamily of seed storage proteins is also provided. Seed storage proteins such as corn zein proteins are encoded in a multi-gene family. The portions of the amino acid sequence, and the DNA sequences they encode, for the seed storage proteins in a given family share sequential amino acid and DNA homology, respectively (termed "family" specific sequences). Other portions of the amino acid sequence of, and the DNA sequences encoding, a seed storage protein, zein type, in one subfamily, share sequential amino acid and DNA homology, respectively, with another one (so-called specific sequences). "subfamily"). A preselected DNA sequence corresponding to the family or subfamily-specific sequences can be used to inhibit the production of a family or subfamily of zein proteins. An expression cassette is provided which comprises a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary, to all or a portion of an mRNA that is substantially homologous in sequence between members of a family or subfamily. of proteins zeins. The expression cassette comprising the preselected DNA sequence is then introduced into the plant cells, which are regenerated to produce transgenic plants and seeds. Transgenic seeds are characterized by substantial inhibition of a preselected family or subfamily of storage protein. In a preferred embodiment, the preselected DNA sequence encodes an RNA molecule that is substantially complementary to all or a portion of an mRNA that encodes a 20 amino acid sequence that is present in multiple copies in tandem, in subfamily A20 of a-zein proteins. Still another embodiment of the invention comprises plant cells, plant tissues, plant parts or plants stably transformed with at least two preselected DNA sequences. The first preselected DNA sequence encodes for an RNA molecule substantially identical, or complementary, to all or a portion of an mRNA that encodes a seed storage protein, eg, an endogenous seed storage protein, preferably one that is relatively deficient in at least one amino acid essential for the diet of animals, compared to other storage proteins in seeds. The second preselected DNA sequence encodes a polypeptide of desired amino acid composition, for example, a polypeptide comprising al. less an essential amino acid for the diet of animals. The polypeptide, preferably, has physical properties that minimize the disorganization of the cell structure of the seed and therefore the quality of the grain. It is preferred that each preselected DNA sequence be operably linked to a functional promoter in a plant and / or in a seed. After transformation, the transformed plant cells having the first and second stably pre-selected DNA sequences, eg, chromosomally integrated within their genome, are selected and used to regenerate fertile transgenic plants and seeds. Transgenic seeds are characterized by the expression of the first DNA sequence in an amount effective to substantially reduce or decrease the amount, percentage by weight, or level of storage protein in undesirable seed, or an amino acid present in said protein. , on the amount, weight percentage, or level, of that seed storage protein, or the amino acid present in that protein, which is present in the non-transgenic seeds. The transgenic seeds are also preferably characterized by the expression of the second DNA sequence as a vegetable protein in an amount effective to produce an increase in the amount, percentage by weight or level of at least one amino acid essential for the diet. of the animals on the amount, the weight percentage or level of that amino acid present in the non-transgenic seeds. In a preferred embodiment, the expression of the first preselected DNA sequence in the transgenic maize seed inhibits the weight percent of the a-zein of 19 kD or of 22 kD. In another preferred embodiment, the expression of the second DNA sequence preselected in the transgenic seed results in an increase in the weight percentage of a 10 kD d-zein protein.

In yet another preferred embodiment, expression of the second preselected DNA sequence in the transgenic seed results in an increase in the weight percentage of a 27 kD zein protein. In another preferred embodiment, the second preselected DNA encodes a synthetic polypeptide, such as MB1 (Beauregard et al., 1995). MB1 is a stable synthetic polypeptide highly enriched in essential amino acids for animal nutrition (eg, methionine, threonine, lysine, and leucine which also adopts an a-helical conformation.) Synthetic polypeptide MB1 shares some properties of corn zein proteins. , for example, MB1 is soluble in alcohol and contains multiple α-helical domains, however, other polypeptides, synthetic and of natural origin, with the desired, preselected amino acid compositions, and the genes encoding them, could be to be employed in the practice of the invention As used herein, the term "polypeptide" includes protein The invention also provides a method for increasing the amount, percentage by weight or level of a polypeptide in a plant. It comprises transforming stably plants, plant cells, plant tissue or parts of the plant with a first preselected DNA sequence, which codes for a seed storage protein, and a second preselected DNA sequence which codes for at least a portion of a desired, preselected polypeptide. The polypeptide can be encoded by the genome of the plant or untransformed plant cell ("endogenous" or "native"), or alternatively, it can be native to, for example, present in, the genome of the non-transformed plant or plant cell "wild type" (called "heterologous", "non-native" or "strange"). Preferably, the second preselected DNA sequence encodes a bacterial enzyme, eg, AK, DHDPS, EPSPS, a bacterial toxin, eg, the Bt crystal toxin, a seed storage protein, eg, Z27, or a storage protein in seed, not corn, such as storage proteins in walnut seed and legumes. See, for example, U.S. Patent Nos. 4,769,061; 4,971,908; PCT / US90 / 04462 applications; PCT / W089 / 11789; and Altenbach et al. (1989). Transformed plant cells having the first and second preselected DNA sequences stably, eg, chromosomally integrated into them, are selected and used to regenerate fertile transgenic plants and seeds. The transgenic seeds of the invention are characterized by substantial inhibition of the expression of at least one seed storage protein. The second preselected DNA sequence is expressed in said transgenic seeds in an amount effective to increase the weight percentage of at least one amino acid present in the polypeptide encoded by the second preselected DNA sequence, relative to the weight percentage of that amino acid in non-transgenic seeds Alternatively, the second preselected DNA sequence is expressed in the transgenic seed in an amount effective to increase the amount, weight percent or level of the polypeptide relative to the amount, weight percent or level of the polypeptide present in a seed transformed with the second preselected DNA sequence, alone. The invention also provides the preselected DNA sequences and expression cassettes useful in the methods described above, as well as fertile transgenic plants and / or seeds produced therefrom. The preferred fertile transgenic plants and seeds of the invention show an increase in the percentage by weight of at least one amino acid essential for the diet of the animals and / or an increase in the starch content. The fertile transgenic plants and the seeds are used to generate the plants for true breeding or cultivation, so that plant lines can be developed that transmit the increase in the content of amino acids or starch in a dominant way, while still maintaining the functional agronomic characteristics of the crossed lines among themselves, selected. Other embodiments of the invention include plant cells, plant parts, plant tissue and microorganisms transformed with the preselected DNA sequences.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 is a schematic representation describing the functional domains of the zein proteins. A consensus amino acid sequence is shown for each of the zein subfamilies. Domains I-IV are shown.

Shown in the Illb Region is a consensus of the repetitive portion of the zein proteins. The asterisks indicate a lack of consensus in that position. Dashed lines represent empty spaces inserted to align the sequences.

Figure 2 is the RNA sequence of A20 (SEQ ID No. 1).

Figure 3 is the DNA sequence of Z4 (SEQ ID No. 2).

Figure 4 shows the oligonucleotide primers that are directed to the cap or head site (A) (SEQ ID No. 9 and SEQ ID No. 10), domain IIIB (B) (SEQ ID No. 11) and SEQ ID No. 12), and the poly (A) region (C) (SEQ ID No. 13 and SEQ ID No. 15) of the Z4 gene.

Figure 5 shows the SDS-PAGE analysis of the zein extracts from individual grains of populations in segregation resulting from the Rl crosses of a hemicigote transformant (GW01) possessing pDPG340 and pDPG380 at internal or relative crossbreeding, transformed, and the self-pollinations R2. Bands 1-8 contain zein extracts from R2 grains crossed to CN in the Rl generation and self-pollinated in the second generation. Lane 9 contains the zein extract from untransformed CN. Bands 10-17 contain zein extracts from R2 grains crossed to AW in the first generation, and self-pollinated in the second generation. Band 18 contains zein extract from untransformed AW. Band 19 contains molecular weight markers.

Figure 6 shows the SDS-PAGE analysis of zein extracts of vitreous or opaque grains from segregating populations resulting from cross-transformations of hemicithous transformants pDPG530 to untransformed internal crosses AW and CV. KP014 x AW (bands 1-2); AW x KP014 (bands 3-4); KP015 x AW (bands 5-6); AW x KP015 (bands 7-8); CV x KP015 (bands 9-10); AW x KP015 (bands 11-12). The bands 13-19 are AW, CV, ILP, IHP, opaque AK835, normal AK835 and opaque W64A, respectively. Band 20 contains molecular weight markers.

Figure 7 shows the SDS-PAGE analysis of zein extracts of proteins from individual grains of populations in segregation, which result from crosses of hemicigote transformants and non-transformed inbred individuals. The transformant KP015 of pDPG530 (AW x KP015, bands 1-2, CV x KP015, bands 3-4, KP015 x AW, bands 5-6, and KP016 (CV x KP016, bands 7-8, KP016 x AW, bands 9-10) and the transformant KQ018 of pDPG531 (KQ018 x AW, bands 11-12) The bands 13-18 are the untransformed controls CW, AR, CV, AW, W64A, 02 and W64A, respectively. 19-20 contain molecular weight markers.

Figure 8 shows the levels of a-zein mRNA in developing grains from a population in segregation resulting from crosses of the pDPG530 transformants and pDPG531 hemicigotes to untransformed inbred AW and CV individuals. AW x KP015 (transformant pDPG530, bands 1-10, top panel); KP015 x AW (transformant pDPG530; bands 11-20; top panel); CV x KP015 (transformant pDPG530, bands 1-10, lower panel); and KQ012 x AW (transformant pDPG531, bands 11-20, bottom panel). The grains were isolated 21 days after pollination.

Figure 9 shows the ultrastructure of the transformed (right) and untransformed (left) grains, with pDPG530.

Figure 10 shows the SDS-PAGE analysis of the zein extracts from populations in segregation resulting from crosses of the transformants pDPG531 to non-transformed inbred individuals AW and CV. CV x KQ012 (bands 1-4); KQ012 x AW (bands 5-8); KQ020 x AW (bands 13-15); KQ020 x CV (bands 16-19). The CW, AR, CV and AW controls (bands 9-12, respectively). The band 20 contains a molecular weight marker.

DETAILED DESCRIPTION OF THE INVENTION Definitions As used in this "substantially identical" or "substantially homologous" in sequence, means that two nucleic acid or amino acid sequences have at least about 65%, preferably about 70%, more preferably about 90%, and even more preferably about 98%, of identity or homology sequential to each other. An RNA molecule encoded by a first preselected DNA sequence of the invention has sufficient sequence identity or homology to cause co-suppression of the expression of the homologous endogenous gene or the expression of a second preselected DNA sequence, which has substantial identity to the first preselected DNA sequence. As used herein, "substantially complementary" means that two nucleic acid sequences have at least about 65%, preferably about 70%, more preferably about 90%, and even more preferably about 98%, of sequential complementarity one. the other. A substantially complementary RNA molecule is one that has sufficient sequential complementarity to the mRNA that codes for a seed storage protein, to result in a reduction or inhibition of mRNA translation.

As used herein, "substantial reduction" or "substantial reduction" means that a plant, plant part, plant cell or transgenic plant tissue has a reduced or decreased amount, level or percentage by weight of a particular amino acid or polypeptide, with relation to the amount, level or percentage by weight of that amino acid or polypeptide ', in the plant, plant part, plant cell or non-transgenic plant tissue. Preferably, the amount, level or percent by weight of that amino acid or polypeptide in the plant, plant part, plant tissue or transgenic plant cell is about 10 to 100%, and more preferably about 70 to 100%, and yet more preferably from about 80 to 100%, relative to the amount, level or weight percentage of that amino acid or polypeptide, in the corresponding plant, plant part, plant tissue or non-transgenic plant cell. As used herein, "increased" or "elevated" levels, amounts or percentages of a polypeptide or amino acid in a plant cell, plant tissue, plant part or transformed (transgenic) plant are greater than the levels, amounts or percentages by weight of that amino acid or polypeptide in the corresponding plant cell, plant part, plant tissue or non-transformed plant. An increase in the weight percentage of an amino acid is an increase of about 1 to 50%, preferably about 5 to 40%, and. more preferably about 10 to 30%, in the weight percentage of the amino acid in a plant, plant part, plant tissue or transgenic plant cell, relative to the weight percentage of that amino acid in a plant, plant part, plant tissue, or cell vegetable, non-transgenic, corresponding. An increase in the amount of a polypeptide in a plant, plant tissue, plant part or transgenic plant cell is preferably at least about 2 to 100 times, more preferably at least about 3 to 80 times, and even more preferably at least about 5 times. to 30 times, in relation to the amount of that polypeptide in the plant, plant part, plant tissue or non-transgenic plant cell, corresponding. For example, the average lysine content in corn seed is approximately 0.24 to 0.26%, the average methionine content in corn seed is approximately 0.17 to 0.19%, and the average tryptophan content in corn seed is approximately 0.08 to 0.10% (Dale, 1996). Thus, the expression of a preselected DNA sequence of the invention, in the seed, results in an increased content of methionine, tryptophan or lysine in those seeds. The amino acid composition of a polypeptide can be determined by methods well known in the art (Jarrett et al., 1986; AACC, 1995). As used herein "genetically modified" or "transgenic" means a plant cell, plant part, plant tissue or plant comprising a segment of preselected DNA that is introduced into the genome of a plant cell, part of the plant, tissue plant or plant, by transformation. The term "wild type" refers to a plant cell, plant part, plant tissue or non-transformed plant, for example, one where the genome has not been altered by the presence of the preselected DNA segment. As used in the present "plant" or "plant" it refers to either a whole plant, a plant tissue, a part of the plant, such as pollen or an embryo, a plant cell, or a group of vegetables cells . The class of plants that can be used in the method of the invention is generally as broad as the class of higher plants that possess seeds, suitable for transformation techniques, including monocotyledonous and dicotyledonous plants. Seeds derived from plants regenerated from plant cells, plant parts and transformed plant tissues, or progeny derived from transformed, regenerated plants, can be used directly as food or nutrient, or can be altered by further processing. In the practice of the present invention, the most preferred vegetable seed is that of corn or Zea mays. The transformation of the plants according to the invention can be carried out essentially in any of the various ways known to those skilled in the art of plant molecular biology. These include, but are not limited to, microprojectile bombardment, microinjection, electroporation of protoplasts or cells comprising the partial cell walls, and DNA transfer mediated by Agroba c terium.

As used herein, the term "a seed storage protein deficient in at least one amino acid that is essential to an animal's diet" means that the protein has a lower than average weight percent of at least one amino acid that is essential for the diet of an animal. The amino acids that are essential for the diet of animals include arginine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan and valine. Preferred amino acids that are essential in the diet of animals include methionine, threonine, lysine, isoleucine, tryptophan, and mixtures thereof. A storage protein in plant seed may contain one or more of these essential amino acids. For example, the average weight percent of lysine in a corn seed is approximately 0.24-0.27%. Thus, a seed storage protein, such as an a-zein, which does not comprise lysine, is deficient in lysine. The average percentage by weight of a particular amino acid is determined by methods well known in the art. As used herein, "isolated" means either physically isolated from the cell or synthesized in vi tro based on the sequence of an isolated DNA segment. As used herein a "native" gene means a DNA sequence or segment that has not been manipulated in vi tro, for example, that has not been isolated, purified and amplified.

I. DNA Molecules of the Invention A. Isolation of DNA Sequences Preselected, Sense and Antisense 1. Seed Storage Proteins, a-zein A purified, isolated, genetically engineered DNA molecule useful in the invention may comprise a preselected DNA sequence encoding an RNA molecule substantially homologous to, or complementary to, all or a portion thereof, an mRNA. which codes for a storage protein in vegetable seed, for example, one of the α-zein proteins. As used herein, a "seed storage protein" is a protein that is one of the major proteins of mature plant seeds such as corn, and comprises a signal peptide sequence at the amino terminus of the plant. protein preform, and which comprises a tandem repeat of the amino acid sequences in the mature form of the protein. Storage proteins in vegetable seeds or zein proteins include, but are not limited to, zein proteins, such as a-zeins, eg, 19,000 and 22,000 dalton proteins; β-zein proteins, for example, proteins with a molecular weight of 14,000 Daltons; proteins? -zein, for example, proteins with molecular weights of 27.00 and 16.00 daltons; and d-zein proteins, for example, proteins with a molecular weight of 10,000 daltons. Certain seed storage proteins are deficient in at least one amino acid essential for the diet of animals. For example, the a-zein proteins of 19 kD and 22 kD contain low levels of amino acids lysine and tryptophan, which are essential for the diet of animals. In an alternative embodiment, the preselected DNA sequence is expressed as an RNA molecule that is substantially complementary to, or identical to, respectively, all or a portion of a family or subfamily the specific mRNA of the seed storage protein. The corresponding RNA molecule or DNA sequence has approximately 65%, or more preferably 90%, of homology or complementarity in the sequence of nucleic acids with another RNA, or DNA, respectively, which encode storage proteins in seeds of the same family or subfamily. The expression of a preselected, antisense DNA sequence. substantially inhibits the translation of the complementary mRNA, while the expression of a preselected DNA sequence in sense results in the cosuppression of the expression of the endogenous DNA sequences coding for the homologous seed storage proteins. A preferred pre-selected DNA molecule encodes an RNA molecule that is complementary to the DNA sequence encoding the 20 amino acid tandem repeat region of the same family or subfamily of seed storage proteins.

The preselected sense or antisense DNA sequence can encode an RNA molecule that is preferably about 15 nucleotides to 2000 nucleotides, and more preferably about 50 to 1,000 nucleotides. The DNA sequence may be derived from the 5 'end or the 3"end and may include all or only a portion of the coding and / or non-coding regions. It may be understood by those of skill in the art that a sequence of Sense or antisense DNA must provide an RNA sequence having at least about 15 nucleotides, in order to provide substantial inhibition of the mRNA expression encoding the seed storage protein The preselected DNA sequences of the invention they are obtained by cloning a DNA molecule, a sequence or a segment of DNA that it encodes, and can be expressed as a mRNA of a seed storage protein.The preselected portions of the DNA sequence can also include nucleotides of no coding located either at the 5 'or 3' ends of the coding sequence in the direction A DNA sequence preserves The invention, which encodes an RNA sequence that is substantially complementary to a mRNA sequence encoding a seed storage protein, is typically a "sense" DNA sequence cloned in the opposite orientation (e.g., 3 '). 5 'instead of 5' to 3 '). A sense DNA sequence encoding a seed storage protein can be cloned using standard methods such as described in Sambrook et al. (1989), and in US Patent No. 5, 508, 468. A subfragment of a preselected DNA sequence encoding a full-length seed storage protein can be generated using restriction enzymes. The subfragment is preferably selected based on the known functional domains of the seed storage proteins. A seed storage protein has at least four different functional domains: a signal peptide domain, a domain that includes the amino-terminal portion of the mature protein, which is located downstream or 3 'of the signal peptide, a domain including tandem repeats of a 20 amino acid sequence that is located downstream of the amino terminus of the mature protein, and a domain that includes the carboxyl terminus of the protein. The size and placement of these functional domains in a-zein proteins are shown in Figure 1, and can be determined for other seed storage proteins, by comparing the amino acid sequence of the other seed storage proteins to the amino acid sequence of a-zein proteins. Suitable examples of preselected DNA sequences that can provide all or a portion of a seed storage protein, in sense or in antisense, for example, the DNA sequence of a-zein, include cDNA clones, A20, A30, B49, B59, B36, Z4 and Z15 prepared as described by Messing et al. (1983). Preferred cDNA clones are an A20 clone, which codes for a 19 kD a-zein protein, and a Z4 clone, which codes for a 22 kD a-zein protein. Portions of the DNA sequences of Z4 and A20 can be generated with restriction endonucleases. It is also contemplated that preselected DNA sequences homologous or complementary to any portion of A20 or Z4 RNA, in vectors suitable for expression in plants, can be used to substantially decrease the production of seed storage proteins. Examples of such DNA sequences are sequences that can be homologous or complementary to the 5 'region of the DNA or RNA sequence such as the 3"region of the promoter and the cap site (cap) (FIG. 4A), or the 3 'region of the gene such as the polyadenylation signal similar to AATAAA, with upward direction of the poly (A) tail (Figure 4C). It is further contemplated that a DNA sequence preselected, homologous or complementary to a conserved domain, common to more than one gene in a family or subfamily of genes, such as domain IIIB or one or more other domains shown in Figure 1, it may also be useful to substantially inhibit the expression of members of the family or gene subfamily (Figure 4B). It is further contemplated that the preselected DNA sequence may encode an RNA molecule that is substantially identical to all or a portion of the mRNA encoding a seed storage protein, eg, a preselected DNA sequence encoding a molecule of RNA substantially identical to the mRNA encoding the 10 kD zein, 27 kD zein or MB1. In a preferred embodiment, a DNA sequence in the sense encoding a 19 kD a-zein protein and / or a DNA sequence in the sense encoding a 22 kD a-zein protein is prepared from a library of cDNA generated from the endosperm tissue as described in Hu et al. (1982) and Geraghty et al. (1982). The cDNA clones that encode a 29 kD a-zein protein and / or a 22 kD a-zein protein can be characterized by standard methods such as DNA hybridization or detection of gene expression by immunotopes including analysis of Stained Western. The presence of the coding sequence of the a-zein protein of 19 kD or 22 kD can be confirmed by DNA sequencing. 1. Other Preselected DNA Sequences Another preselected DNA sequence useful in the method of the present invention encodes a polypeptide, includes a plant protein, comprising at least one amino acid essential for the diet of the animals, operably linked to a functional promoter in a plant and / or seeds. The expression of the preselected DNA sequence, which codes for the polypeptide comprising at least one amino acid essential for the diet of the animals, in a plant cell, provides an increase in the expression of the polypeptide, so that the weight percentage of the Amino acid residue is substantially increased in the plant regenerated from the transformed plant cell, or the seed derived from the plant, on the amount normally present in the corresponding non-transformed plant or seed. Preferably, the preselected DNA sequence is co-transformed into plant cells with a second sequence of antisense or sense DNA, preselected, the expression of which results in the inhibition of the expression of a seed storage protein, relatively deficient in an essential amino acid in the diet of animals. The preselected DNA sequence encoding a polypeptide comprising at least one essential amino acid in the diet of the animals may be a polypeptide expressed in a plant seed, such as a 10 kD zein protein. Other polypeptides that contain one or more essential amino acid residues in the diet of the animals include the synthetic MB1 polypeptide (Beauregard et al., 1995). It is contemplated that any gene encoding a polypeptide of natural origin, or a synthetic polypeptide, containing at least one essential amino acid in the diet of an animal, may be used in the present invention. The Z10 and MB1 proteins are illustrative of a naturally occurring protein and a synthetic polypeptide, respectively, although one of skill in the art will realize that many other proteins are useful in the practice of the present invention. The preselected DNA sequences coding for these polypeptides can be obtained by standard methods, as described by Sambrook et al., Cited above. For example, a cDNA clone encoding a 10 kD zein protein can be obtained from the maize endosperm tissue, as described by Kirihara et al. (1988). The DNA sequence is then preferably combined with a promoter that is functional in plant cells or seeds. The preferred promoter is a functional promoter during the development of the seed of the plant, such as the promoter Z27 or Z10. The gene coding for the synthetic MBl polypeptide is obtained from Mary A. Hefford (Center for Food and Animal Research, Agriculture and Agri- Food Canada). The preselected DNA sequence encoding a synthetic polypeptide such as MB1 is operably linked to a signal sequence derived from a seed storage protein. For example, the MBl DNA sequence can be operably linked to the sequence of the 15 kD zein signal peptide. It is also contemplated that a preselected DNA sequence codes for a desirable seed storage protein. In this way, the expression of a first preselected DNA sequence can inhibit the expression of a storage protein in undesirable seed, while the expression of a sequence of. Preselected DNA can code for a desirable gene product, for example, a desirable seed storage protein. For example, it is considered that the expression of the first preselected DNA sequence, which comprises partial gene DNA sequences, may be advantageous for the suppression of the expression of undesirable seed storage proteins, if those partial DNA sequences are direct DNA or RNA sequences not present in the second preselected DNA sequence, which codes for a desirable polypeptide, e.g., the 10 kD zein or MB1, in order to avoid suppression of desirable polypeptide expression.

B. Optional Sequences for Expression Cassettes 1. Promoters Preferably, the preselected DNA sequence of the invention is operably linked to a promoter, which provides for the expression of the preselected DNA sequence. The promoter is preferably a functional promoter in plants and / or seeds, and more preferably a functional promoter during the development of the seed of the plant. A preselected DNA sequence is operably linked to the promoter when it is located downstream of the promoter, to form an expression cassette. Most of the endogenous genes have regions of DNA that are known as promoters, which regulate the expression of the gene. The promoter regions are typically found in the flanking DNA upstream of the coding sequence in prokaryotic and eukaryotic cells. A promoter sequence provides regulation of the transcription of the downstream gene sequence and typically includes from about 50 to about 2,000 nucleotide base pairs. The promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of expression of the gene. Some isolated promoter sequences can provide expression of the heterologous DNA, ie a DNA different from the native DNA or homologous. Promoter sequences that are strong or weak, or inducible, are also known. A strong promoter provides a high level of gene expression, whereas a weak promoter provides a very low level of gene expression. An inducible promoter is a promoter that provides the switching on and off of gene expression in response to an exogenously added agent, or to an environmental or developmental stimulus. A bacterial promoter such as the Ptac promoter can be induced at varying levels of gene expression, depending on the level of isothiopropylgalactoside added to the transformed bacterial cells. Promoters can also provide tissue or developmental specific regulation. An isolated promoter sequence that is a. Strong promoter for heterologous DNAs is advantageous because it provides sufficient level of gene expression to allow easy detection and selection of transformed cells and provides a high level of expression of the gene when desired. Preferred expression cassettes will generally include, but are not limited to, a plant promoter such as the CaMV 35S 'promoter (Odell et al., 1985), or others such as CaMV 19S (La ton et al., 1987), nos ( Ebert et al., - 1987), Adhl (Walker et al., 1987), sucrose synthase (Yang et al., 1990), a-tubulin, ubiquitin, actin (Wang et al., 1992), caJ (Sullivan et al., 1989 ), PEPCasa (Hudspeth et al., 1989) or those associated with the R gene complex (Chandler et al., 1989). Additional suitable promoters include the cauliflower mosaic virus promoter, the Z10 promoter of a gene encoding a 10 kD zein protein, a Z27 promoter from a gene encoding a 27 kD zein protein, the inducible promoters such as the light inducible promoter derived from the rbcS gene from pea (Coruzzi et al., 1971) and the actin promoter from rice (McElroy et al., 1990); Seed-specific promoters, such as the phaseolin promoter of beans, can also be used (Sengupta-Gopalan, 1985). The especially preferred promoter is functional during the development of the seed of the plant, such as the Z10 or Z27 promoters. Other promoters useful in the practice of the invention are known to those of skill in the art. Alternatively, novel, tissue-specific promoter sequences can be employed in the practice of the present invention. The cDNA clones from a particular tissue are isolated, and those clones that are specifically expressed in the tissue, are identified, for example, using Northern blotting. Preferably, the isolated gene is not present in a high number of copies, but is relatively abundant in specific tissues. The promoter and control elements of corresponding genomic clones can then be localized using techniques well known to those of ordinary skill in the art. A preselected DNA sequence can be combined with the promoter by standard methods as described in Sambrook et al. Cited above, to produce an expression cassette. Briefly, a plasmid containing a promoter such as the 35S CaMV promoter can be constructed as described in Jefferson (1987) or obtained from Clontech Lab in Palo Alto, California (e.g., pBI121 or pBI221). Typically, these plasmids are constructed to have multiple cloning sites that have specificity for different restriction enzymes downstream of the promoter. The preselected DNA sequence can be subcloned downstream of the promoter using restriction enzymes and placed to ensure that the DNA is inserted in the proper orientation with respect to the promoter, so that the DNA can be expressed as RNA in sense or in antisense Once the preselected DNA sequence is operably linked to a promoter, the expression cassette thus formed can be subcloned into a plasmid or other vector. Once the preselected, sense DNA sequence is obtained, all or a portion of the DNA sequence can be subcloned into an expression vector (see below) in the opposite orientation (eg, 3 'to 5' ). Similarly, all or a portion of the preselected DNA sequence can be subcloned in the sense orientation (eg, 5f to 3"). The preselected DNA sequence is subcloned in a downstream direction of a promoter to form a cassette. In a preferred embodiment, a cDNA clone encoding a 22 kD a-zein Z4 protein is isolated from a maize endosperm tissue.Using restriction endonucleases, the complete coding sequence for the Z4 gene is subcloned in the 3 'to 5' orientation into an intermediate vector to form an antisense DNA sequence The promoter region from a 10 kD zein protein, designated the Z10 promoter, is subcloned upstream of the sequence of Antisense DNA, which includes the complete coding sequence for the Z4 gene, to form a cassette, of expression.This expression cassette can then be subcloned into a vector suitable for the transformation of plant cells. In another preferred embodiment of the present invention, the promoter region from a 27 kD zein protein, designated the Z27 promoter, is subcloned upstream of the antisense DNA sequence. In another preferred embodiment of the present invention, using restriction endonucleases, the complete coding sequence of the A20 gene encoding a 19 kD a-zein protein is subcloned in the 3 'to 5' orientation into an intermediate vector for form an antisense DNA sequence. The Z10 promoter, or alternatively the Z27 promoter, is cloned upwardly from the antisense DNA sequence of A20. The partial DNA sequences of Z4 or A20 can also be cloned in a 3 'to 5' antisense orientation downstream of the Z10 or Z27 promoter.

In addition, it is contemplated that expression cassettes can be constructed, which comprise the Z10 or Z27 promoter with upward direction of partial or complete DNA sequences of Z4 or A20, wherein the DNA sequences are subcloned in the downstream direction of the DNA. promoter in a sense orientation, 5 'to 3'. 2. Direction Sequences to the Objective Additionally, expression cassettes can be constructed and employed to direct the product of the preselected DNA sequence or a segment thereof, to an intracellular compartment within the plant cells, or to direct a protein to the extracellular environment. This can be generally achieved by binding a DNA sequence encoding a transient or signal peptide sequence to the coding sequence of the preselected DNA sequence. The resulting transient or signal peptide will transport the protein to a particular intracellular or extracellular destination, respectively, and can then be post-translationally removed. Transient peptides act by facilitating the transport of proteins across intracellular membranes, for example, vacuolar, vesicular, plastid and mitochondrial membranes, while signal peptides direct proteins through the extracellular membrane. By facilitating transport of the protein into the compartments inside or outside the cell, these sequences can increase the accumulation of a particular gene product at a particular site. For example, see US Patent No. 5,258,300. 3. 3 'sequences When the expression cassette is to be introduced into a plant cell, the expression cassette may optionally also include the 3 ', non-translated, plant regulatory DNA sequences which act as a signal to terminate transcription and allow polyadenylation of the resulting mRNA. The 3 'untranslated regulatory DNA sequence preferably includes from about 300 to 1000 nucleotide base pairs and contains the transcriptional and translational termination plant sequences.

The preferred 3 'elements are derived from those of the nopalin-synthase gene of Agroba cteri um t umefaci ens (Bevan et al., 1983), the terminator for the T7 transcript from the octopine-synthase gene of Agroba ct eri um tumefa ci ens, and the 3 'end of the protease inhibitor genes I or II, from potato or tomato, although other 3' elements known to those of skill in the art may also be employed. These 3 'untranslated regulatory sequences can be obtained as described in An (1987) or are already present in plasmids available from commercial sources such as Clontech, Palo Alto, California. The 3 'untranslated regulatory sequences can be operably linked to the 3' end of the preselected DNA sequence, by standard methods. 4. Selectable and Separable Marker Sequences In order to improve the ability to identify transformants, it may be desired to employ a selectable marker gene as, or in addition to, the expressible pre-selectable DNA sequence or segment. "Marker genes" are genes that impart a different phenotype to cells expressing the marker gene, and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes can encode either a selectable marker, depending on whether the marker confers a trait or characteristic that someone can "select" by chemical means, for example, through the use of a selective agent (eg, a herbicide, antibiotic). , or similar), or whether this is simply a feature or characteristic that someone can identify through observation or testing, for example, by "selection" (eg, feature of locus R). Of course, many examples of suitable marker genes are known in the art, and can be employed in the practice of the invention. Included within the terms of selectable marker genes are also the genes encoding a "secretable marker" whose secretion can be detected as a means to identify or select transformed cells. Examples include markers encoding a secretable antigen that can be identified by antibody interaction, or even secretables that can be detected by their catalytic activity. Secretable proteins fall within a number of classes, including small, detectable, diffusible proteins, for example, by ELISA; and proteins that are inserted or trapped in the cell wall (for example, proteins that include a leader sequence such as that found in the expression unit of the tobacco extensin or PR-S). With respect to secretable, selectable markers, it is considered particularly advantageous to use a gene that codes for a polypeptide that becomes sequestered in the cell wall, and whose polypeptide includes a unique epitope. Such a secreted antigenic marker could ideally employ an epitope sequence that could provide a background in the plant tissue, a promoter leader sequence that could impart efficient expression and targeting through the plasma membrane, and that could produce protein that is bound in the cell wall and still accessible to antibodies. A normally secreted wall protein, modified to include a single epitope, would satisfy all these requirements. An example of a protein suitable for modification in this manner is extensin, or the glycoprotein rich in hydroxyproline (HPRG). The use of HPRG corn is preferred (Stiefel et al., 1990) since this molecule is well characterized in terms of molecular biology, expression, and protein structure. However, any of a variety of glycine-rich extensins and / or wall proteins could be modified.

(Keller et al., 1989) by adding an antigenic site to create a selectable marker. The elements of the present disclosure are exemplified in detail through the use of particular marker genes. However, in light of this description, numerous other possible selectable and / or separable marker genes will be apparent to those of skill in the art, in addition to what is described hereinafter. Therefore, it will be understood that the following discussion is exemplary rather than exhaustive. In light of the techniques described herein and the general recombinant techniques that are known in the art, the present invention makes possible the introduction of any gene, including marker genes, into a recipient cell to generate a transformed plant cell, by example, a monocot cell. Possible selectable markers for use in connection with the present invention include, but are not limited to, a neo gene (Potrykus et al., 1985) which codes for kanamycin resistance and can be selected by the use of kanamycin, G418, and the like; a bar gene which codes for bialaphos resistance; a gene encoding an altered EPSP-synthase protein (Hinchee et al., 1988) thereby conferring glyphosate resistance; a nitrilase gene such as bxn from Kl ebsi ella ozaenae that confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase (ALS) gene that confers resistance to imidazolinone, sulfonylurea or other ALS inhibitory chemicals (European Patent Application No. 154,204, 1985); a DHFR gene resistant to methotrexate (Thillet et al., 1988); a dalapon-dehalogenase gene that confers resistance against the dalapon herbicide; or a mutated anthranilate-synthase gene that confers resistance against 5-methyl-tryptophan. Where a mutant EPSP synthase gene is employed, additional benefit can be realized through the incorporation of a suitable transient chloroplast peptide, CTP (European Patent Application 0,218,571, 1987). An illustrative mode of a selectable marker gene, capable of being usable in systems for selecting transformants, are genes encoding the enzyme phosphinotricin-acetyltransferase, such as the bar gene from Streptomyces hygroscopius or the pa t gene from Streptomyces viri. dochromogenes (U.S. Patent No. 5,550,318). The enzyme phosphinotricin-acetyltransferase (PAT) inactivates the active ingredient in the bialaphos herbicide, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al., 1986; Twell et al., 1989) causing rapid accumulation of ammonia and cell death. The success in the use of the selective system in conjunction with the monocotyledons was particularly surprising due to the major difficulties that have been reported in the transformation of cereals (Potrykus, 1989). Selectable markers that can be employed include, but are not limited to, a ß-glucuronidase or vidA (GUS) gene which codes for an enzyme for which various chromogenic substrates are known; a locus R gene, which codes for a product that regulates production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., 1988); a ß-lactamase gene (Sutcliffe, 1978), which codes for an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a xylE gene (Zukowsky et al., 1983) which codes for a catechol-dioxygenase that can convert chromogenic catechols; a .la-amylase gene (Ikuta et al., 1990); a tyrosinase gene (Katz et al., 1983) which codes for an enzyme capable of oxidizing tyrosine to DODPA and dopaquinone, which in turn condenses to form the easily detectable compound, melanin; a ß-galactosidase gene, which codes for an enzyme for which chromogenic substrates exist; a luciferase gene (l ux) (Ow et al., 1986), which allows the detection of bioluminescence; or an aequorin gene (Prasher et al., 1985), which can be used in the detection of calcium sensitive bioluminescence, or a fluorescent green fluorescent gene (Niedz et al., 1995). Genes from the corn R gene complex are regarded as particularly useful as selectable markers. The R gene complex in corn codes for a protein that acts to regulate the production of anthocyanin pigments in most plant seeds and tissues. Corn strains can have one, or as many as four, R alleles that combine to regulate pigmentation in a specific manner of development and tissue. A gene from the R gene complex was applied to the transformation of corn, because the expression of this gene in transformed cells does not damage the cells. In this way, an R gene introduced into such cells will cause the expression of a red pigment and, if it is stably incorporated, it can be visually qualified as a red sector. If a corn line has dominant alleles for genes that code for enzymatic intermediates in the biosynthetic pathway of anthocyanin (C2, Al, A2, Bzl, and Bz2), but has a recessive allele at the R site, the transformation of any cell coming from that line with R, will result in red pigment formation. Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TR112, a derivative of K55 which is r-g, b, Pl. alternatively, any maize genotype can be used if the Cl and R alleles are introduced together. It is further proposed that the regulatory regions of the R gene can be used in chimeric constructions in order to provide mechanisms to control the expression of chimeric genes. More diversity of phenotypic expression is known in the R locus than in any other locus (Coe et al., 1988). It is contemplated that the regulatory regions obtained from the 5 'regions to the structural R gene could be valuable in the direction of gene expression, for example, insect resistance, drought resistance, herbicide tolerance or other coding regions. proteins For purposes of the present invention it is believed that any of the members of the R gene family can be successfully employed (e.g., P, S, Le, etc.). However, the most preferred will be in general Sn (particularly Sn: bol3). Sn is a dominant member of the R gene complex and is functionally similar to loci R and B since Sn controls the deposition of tissue-specific anthocyanin pigments in certain plant and plant cells, and therefore its phenotype is similar to R. An additional selectable marker contemplated for use in the present invention is firefly luciferase, encoded by the gene ux. The presence of the l ux gene in transformed cells can be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low light video cameras, photon counting chambers or multiple well luminometry. It is also considered that this system can be developed for population selection for bioluminescence, such as on tissue culture plates, or even for the selection of whole plants.

. Other Optional Sequences An expression cassette of the invention can also further comprise the plasmid DNA. Plasmid vectors include additional DNA sequences that provide for easy selection, amplification and transformation of the expression cassette into prokaryotic and eukaryotic cells, eg, pUC derived vectors such as pUC8, pUC9, pUC18, pUC19, pUC23, pUC119, and pUC120 , vectors derived from pSK, vectors derived from pGEM, vectors derived from pSP, or vectors derived from pBS. Additional DNA sequences include origins of replication to provide autonomous replication of the vector, additional, selectable marker genes, preferably encoding for resistance to antibiotics and herbicides, single, multiple cloning sites that provide multiple sites for inserting DNA sequences or genes encoded in the expression cassette, and sequences that increase the transformation of prokaryotic and eukaryotic cells. Another vector that is useful for expression in plant and prokaryotic cells is the binary Ti plasmid (as described in Schilperoort et al., US Patent No. 4,940,838) as exemplified by the vector pGA582. This binary Ti plasmid vector has previously been characterized by An, cited above, and is available from the vector An. This binary Ti vector can be replicated in prokaryotic bacteria such as E. coli and Agrobac t eri um. The plasmid vectors of Agrobacterium can be used to transfer the expression cassette to cells of dicotyledonous plants, and under certain conditions to monocotyledonous cells, such as rice cells. The binary Ti vectors preferably include the right and left boundaries of the nopaline T DNA, to provide efficient transformation of plant cells, a selectable marker gene, unique multiple cloning sites in the T boundary regions, colEl replication and a replicon of wide range of guests. Binary vectors Ti having an expression cassette of the invention can be used to transform prokaryotic and eukaryotic cells, but are preferably used to transform cells of dicotyledonous plants.

Selection In Vi tro of Expression Cassettes Once the expression cassette is constructed and subcloned into a suitable plasmid, it can be selected for the ability to substantially inhibit the translation of an mRNA encoding a seed storage protein, by standard methods such as hybrid translation stopped. . For example, for selection of hybrids or stopped translation, a preselected antisense DNA sequence is subcloned into a plasmid containing SP6 / T7 (as supplied by ProMega Corp.). For the transformation of plant cells, suitable vectors include plasmids such as those described herein. Typically, a hybrid stop translation is an in vi tro assay that measures the inhibition of translation of an mRNA that codes for a particular seed storage protein. This screening method can also be used to select and identify pre-selected antisense DNA sequences that inhibit the translation of a family or subfamily of zein protein genes. As a control, the cassette of corresponding sense expression is introduced into the plants and the phenotype is evaluated.

II. Distribution of DNA from DNA Molecules within Host Cells The present invention generally includes the steps directed to introducing a preselected DNA sequence, such as a preselected cDNA, into a recipient cell, to create a transformed cell. The frequency of appearance of cells that collect exogenous (foreign) DNA is believed to be low. In addition, it is more likely that not all recipient cells receive segments or DNA sequences, to result in a transformed cell, wherein the DNA is stably integrated into the genome of the plant and / or expressed. Some may show only initial and transient expression of the gene. However, certain cells from virtually any dicotyledonous or monocotyledonous species can be stably transformed, and these cells regenerated into transgenic plants, through the application of the techniques described herein.

The invention is directed to any plant species wherein the seed contains storage proteins containing relatively low levels, or none at all, of at least one essential amino acid. The cells of the plant tissue source are preferably embryonic cells or cell lines that can regenerate transgenic, fertile plants and / or seeds. The cells can be derived from any monocots or dicots. Suitable examples of plant species include wheat, rice, Arabi dopsi, tobacco, corn, soybeans, and the like. The preferred cell type is a monocot cell such as the corn cell, which may be in a cell culture in suspension, or it may be in an intact part of the plant, such as an immature embryo, or in a specialized plant tissue , such as callus, such as Type I or Type II calluses. The transformation of the cells from the plant tissue source can be conducted by any of a number of methods known to those of skill in the art. Examples are: transformation by direct transfer of DNA into plant cells by electroporation (U.S. Patent No. 5,384,253 and U.S. Patent No. 5,472,869, Dekeyser et al., 1990); direct transfer of DNA to plant cells by precipitation with PEG (Hayashimoto_ et al., 1990); direct transfer of DNA to plant cells by bombardment with microprojectiles (McCabe et al., 1988; Gordon-Kamm et al., 1990; US Patent No. 5,489,520, US Patent No. 5,538,877; and US Patent No. 5,538,880) and DNA transfer. to plant cells by means of infection with Agroba ct eri um. • Methods such as microprojectile bombardment or electroporation can be carried out with "naked" DNA where the expression cassette can simply be carried on any plasmid cloning vector derived from E. col i. in the case of viral vectors, it is desirable that the system retain the functions of replication, but that it lacks functions for the induction of the disease. The preferred method for the transformation of dicotyledons is by means of infection of the plant cells with Agroba ct eri um t umefa ci ens using the leaf disc protocol (Horsch et al., 1985). Monocotyledons such as Zea mays can be transformed by bombardment with microprojectiles of embryonic callus tissue or immature embryos, or by electroporation after partial enzymatic degradation of the cell wall with an enzyme containing pectinase (U.S. Patent No. 5,384,253; and U.S. Patent No. 5,472,869). For example, embryonic cell lines derived from immature Zea mays embryos can be transformed by accelerated particle treatment as described by Gordon-Kamm et al. (1990) or US Pat. No. 5,489,520; U.S. Patent No. 5,538,877 and U.S. Patent No. 5,538,880, cited above. The excised immature embryos can also be used as the target for transformation before induction of tissue culture, selection and regeneration as described in US Patent Application Serial No. 08 / 112,245 and PCT publication WO95 / 06128. In addition, methods for the transformation of monocotyledonous plants using Agrobact eri um t umefa ci ens have been described by Hiei et al. (European Patent 0,604,662, 1994) and Saito et al. (European Patent 0, 672, 752, 1995). Methods such as microprojectile bombardment or electroporation are carried out with the "naked" DNA where the expression cassette can simply be carried on any plasmid cloning vector derived from JE. col i. In the case of viral vectors, it is desirable that the system retain replication functions, but lacking the functions for the induction of the disease. The choice of the source of plant tissue for transformation will depend on the nature of the host plant and the transformation protocol. Useful tissue sources include callus, suspension culture cells, protoplasts, leaf segments, stem segments, spikelets, pollen, embryos, hypocotyls, tuber segments, meristematic regions, and the like. The tissue source is selected and transformed so that it retains the ability to regenerate complete fertile plants, after transformation, for example, which contains totipotent cells. Type I or Type II embryonic maize leaves and immature embryos are preferred sources of Zea mays tissue. The selection of tissue sources for monocot transformation is described in detail in US Patent Application Serial No. 08 / 112,245 and PCT publication WO95 / 06128. The transformation is carried out under conditions directed to the plant tissue of choice. Plant cells or plant tissue are exposed to DNA that has pre-selected DNA sequences for an effective period of time. This may be in the range of a pulse of electricity of less than one second for electroporation until two to three days of co-culture in the presence of Agrobac t erium cells possessing the plasmid. The dampers and the means used will also vary with the source of the plant tissue and with the transformation protocol. Many transformation protocols employ a feeder layer of suspended culture cells (tobacco or Dulce Mexicano Negro corn, for example) on the surface of the plates of solid medium, separated by a sterile filter paper disk from plant cells or tissues. that are transformed.

A. Electroporation Where it is desired to introduce the DNA by means of electroporation, it is contemplated that the method of Krzyzek et al. (U.S. Patent No. 5,384,253) will be particularly advantageous. In this method, certain cell wall degrading enzymes, such as pectin-degrading enzymes, are used to make target cells more susceptible to transformation by electroporation than untreated cells. Alternatively, the recipient cells may be made more susceptible to transformation, by mechanical wounding. To effect the transformation by electroporation, friable tissues such as suspension cell cultures, or embryonic calli, or alternatively, immature embryos or other organized tissues can be transformed directly. The cell walls of the preselected cells or organs can be partially degraded by exposing them to pectin-degrading enzymes (pectinases or pectoliases) or by mechanically injuring them in a controlled manner. Such cells could then be receptive to DNA uptake by electroporation, which can be carried out in this step, and the transformed cells are then identified by a suitable selection protocol, dependent on the nature of the newly incorporated DNA.

B. Bombardment with Microprojectiles A further advantageous method for the distribution of transformant DNA segments to plant cells is the bombardment with microprojectiles. In this method, the microparticles can be coated with the DNA and distributed to the cells by a propulsion force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. It is contemplated that in some cases the precipitation of the DNA on metal particles might not be necessary for the distribution of the DNA to a recipient cell, using a bombardment with microprojectiles. In an alternative embodiment, the non-embryonic BMS cells were bombarded with intact cells of the E bacteria. coli or Agroba c t eri um t umefa ci ens that contained plasmids with either the ß-glucuronidase gene or the bar gene, engineered for expression in corn. The bacteria were inactivated by dehydration with ethanol before bombardment. A low level of transient expression of β-glucuronidase was observed 24 to 48 hours after DNA distribution. In addition, stable transformants containing the bar gene were recovered after bombardment with either the E cells. coli or from Agroba c t eri um t umefa ci ens. It is contemplated that the particles may contain DNA instead of being coated with DNA. Therefore, it is proposed that particles can increase the level of DNA distribution but are not, in and of themselves, necessary to introduce DNA into plant cells. An advantage of microprojectile bombardment as well as being an effective means of reproducibly and stably transforming monocotyledons is that protoplast isolation is required (Christou et al., 1988), the formation of partially degraded cells or the susceptibility to Agrobac infection. teri um. An illustrative embodiment of a method for distributing DNA within maize cells by acceleration is a Biolistics Particle Distribution System, which can be used to propel the particles coated with the DNA or the cells, through a sieve, such as a sieve of stainless steel or Nytex, on a filter surface covered with corn cells grown in suspension (Gordon-Kamm et al., 1990). The sieve disperses the particles, so that they are not distributed to the recipient cells in large aggregates. It is believed that a sieve that intervenes between the projectile apparatus and the cells that are going to be bombarded, reduces the size of projectile aggregates and can contribute to a higher frequency of transformation by reducing the damage inflicted on the recipient cells by an aggregate projectile. For bombardment, the cells in suspension are preferably concentrated on filters or solid culture medium. Alternatively, immature embryos or other target cells can be accommodated on the solid culture medium. The cells to be bombarded are placed at an appropriate distance below the top plate of the macroprojectiles. If desired, one or more meshes or screens are also placed between the acceleration device and the cells to be bombarded. Through the use of the techniques described here you can obtain up to 1000 0 more foci of cells that transiently express a marker gene. The number of cells in a focus that express the product of the exogenous gene 48 after the bombardment is frequently present. in the range of about 1 to 10 and on average approximately 1 to 3. In the bombardment transformation, the pre-bombardment culture conditions and the bombardment parameters can be optimized to produce the maximum number of stable transformants. The physical and biological parameters for bombing are important in this technology. Physical factors are those that involve manipulation of the DNA / microprojectile precipitate or those that affect the trajectory and velocity of macro or microprojectiles. Biological factors include all steps involved in the manipulation of cells before and immediately after bombardment, the osmotic adjustment of the target cells to help alleviate the trauma associated with the bombardment, and also the nature of the transforming DNA, such as DNA linearized or intact, supercoiled plasmid DNA. It is believed that pre-bombardment manipulations are especially important for the successful transformation of immature embryos. Consequently, it is contemplated that someone may wish to adjust several of the bombardment parameters in small-scale studies, to fully optimize the conditions. Someone may particularly wish to adjust the physical parameters such as the distance of the free space, the distance of flight, the distance of the tissue, and the pressure of helium. Trauma reduction factors (TRFs) can also be minimized by modifying the conditions that influence the physiological state of the recipient cells, and which can therefore influence the transformation and integration efficiencies. For example, the osmotic state, the hydration of the tissue and the subculture stage or the cell cycle of the recipient cells, can be adjusted for optimal transformation. The results from such small-scale optimization studies are described herein and the dissemination of other routine adjustments will be known to those of skill in the art in light of the present disclosure.

III. Production and Characterization of Stable Transgenic Maize After carrying out the distribution of a preselected DNA sequence to the recipient cells by any of the methods discussed above, the following steps of the invention generally relate to the identification of transformed cells for subsequent cultivation and regeneration of the plant . As mentioned above, in order to improve the ability to identify transformants, it may be desired to employ a selectable or screened marker gene as, or in addition to, the preselected, expressible DNA sequence. In this case, someone could then generally evaluate the population of potentially transformed cells by exposing the cells to one or more selective agents, or the cells could be sifted or screened for the characteristic of the desired marker gene.

A. Selection An exemplary embodiment of the methods for identifying transformed cells involves exposing the bombarded cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, a herbicide or the like. Cells that have been transformed and have a marker gene stably integrated that confers resistance to the selective agent used will develop and divide in culture. Sensitive cells will not be suitable for subsequent culture. To use the barbialaphos or EPSPS-glyphosate selective system, the bombarded tissue is cultured for approximately 0 to 28 days on non-selective medium and subsequently transferred to the medium containing approximately 1 to 3 mg / liter of bialaphos or approximately 1 to 3 mM of glyphosate, as appropriate. While the ranges of approximately 1 to 3 mg / liter of bialaphos or approximately 1 to 3 mM of .glifosate will typically be preferred, it is proposed that the ranges of at least about 0.1 to 50 mg / liter of bialaphos or at least about 0.1 to 50 mM of glyphosate, will find utility in the practice of the invention. The fabric can be placed on any porous, inert, solid or semi-solid support for bombardment, including, but not limited to, filters and solid culture media. Bialaphos and glyphosate are provided as examples of suitable agents for the selection of transformants, but the technique of this invention is not limited thereto. An example of a trait or characteristic of selectable marker is the red pigment produced under the control of locus R in corn. This pigment can be detected by culturing the cells on a solid support containing nutritive media capable of supporting the development at this stage and selecting the cells from the colonies (visible aggregates of cells) that are pigmented. These cells can be further cultured, either in suspension or in solid media. The R locus is useful for the selection of transformants from immature bombarded embryos. In a similar way, the introduction of the Cl and B genes. will result in pigmented cells and / or pigmented tissues. The enzyme luciferase is also useful as a selectable marker in the context of the present invention. In the presence of the luciferin substrate, cells expressing luciferase will emit light, which can be detected on photographic or X-ray film, in a luminometer (or liquid scintillation counter), by devices that improve night vision, or by a video camera highly sensitive to light, such as a photon counting camera. All these assays are non-destructive and the transformed cells can be cultured subsequently after identification. The proton counting chamber is especially valuable since it allows to identify specific cells or groups of cells that are expressing luciferase, and manipulate them in real time. It is further contemplated that selectable and screeable marker combinations will be used for the identification of transformed cells. In some cell or tissue types a selection agent, such as bialaphos or glyphosate, may not provide sufficient killing activity to clearly recognize the transformed cells, or may cause substantial non-selective inhibition of transformants and similar non-transformants , thus causing the selection technique not to be effective. It is proposed that selection with a developmental inhibitor compound, such as bialaphos or glyphosate at concentrations below those that cause 100% inhibition followed by selection of developing tissue for the expression of a selectable marker gene, such as luciferase could allow transformants to recover from cell or tissue types that are not suitable for selection alone. In an illustrative modality, the Type II embryonic callus of Zea mays L. was selected with sublethal levels of bialaphos. The slowly developing tissue was subsequently selected for the expression of the luciferase gene, and the transformants were identified. In this example, neither the selection nor the selection conditions employed were sufficient, in and of themselves, to identify the transformants. Therefore, it is proposed that selection and screening combinations will make it possible to identify transformants in a wider variety of cell types and tissues.

B. Seed Regeneration and Production Cells that survive exposure to the selective agent, or cells that have been scored as positive in a screening assay, can be grown in media that support plant regeneration. In an exemplary embodiment, MS and N6 media have been modified (see Table 1 of the US Patent Application Serial No. 08 / 594,861) by the inclusion of substances such as growth regulators. A growth regulator, preferred for such purposes is the dicamba or 2, 4-D. However, other growth regulators may be employed, including NAA, NAA + 2, 4-D or perhaps even picloram. The improvement of the media in these and similar ways was found to facilitate the development of cells at specific stages of development. The tissue is preferably maintained in a growth medium with growth regulators until sufficient tissue is available to begin the regeneration efforts of the plant, or after the repeated rounds of manual selection, until the tissue morphology is suitable for the regeneration of the plant. regeneration, at least two weeks, and then transferred to media that lead to the maturation of embryos. The cultures are transferred every two weeks on this medium. The development of the outbreaks will signal the time to transfer them to the medium that lacks growth regulators.

Transformed cells, identified by screening or sieving and cultured in an appropriate medium that supports regeneration, will then be allowed to mature into plants. Developing seedlings are transferred to soil-free planting mixtures, and hardened, for example, in an environmentally controlled chamber at approximately 85% relative humidity, approximately 600 ppm C02, and approximately 25-250 microeinsteins m ~ 2 »s_1 of light. The plants are preferably matured either in a development chamber or in a greenhouse. Plants are regenerated from about 6 weeks to 10 months after a transformant is identified, depending on the initial tissue. During regeneration, the cells are developed on solid media in tissue culture vessels. Illustrative embodiments of such containers are petri dishes and Plant Con®s. The regenerating plants are preferably developed at approximately 19 ° to 28 ° C. After regenerating plants have reached the stage of emergence and root development, they can be transferred to a greenhouse for further development and testing.

Mature plants are then obtained from the cell lines that are known to express the trait or characteristic. If possible, the regenerated plants are self-pollinated. In addition, the pollen obtained from the regenerated plants is crossed to the plants developed by seed, from agronomically important inbred lines. In some cases, pollen from plants of these inbred lines is used to pollinate regenerated plants. The trait or characteristic is genetically characterized by the evaluation of the segregation of the trait in the first and in the last progeny of the generation. The heritability and expression in plants of the traits selected in tissue culture are of particular importance if the traits are to be commercially useful. The regenerated plants can be repeatedly crossed to endogamize maize plants, in order to introgress or integrate the preselected DNA sequence into the genome of inbred maize plants. This process is referred to as the backcross conversion. When a sufficient number of crosses to the recurrent inbred progeny have been completed, in order to produce a product of the backcross conversion process that is substantially isogenic with the recurrent inbred parent, except for the presence of the preselected DNA sequence, introduced , the plant is self-pollinated at least once in order to produce an endogamous individual converted by backcrossing, homozygous containing the preselected DNA sequence. Progeny of these plants are in true development, and the percentage by weight of a particular amino acid in a part of the plant, for example, the seeds, or the amount of corn in this progeny, are compared to the percentage by weight of that amino acid or the amount of starch in the recurrent inbred parent, in the field under a range of environmental conditions (see below). The determination of the weight percentage of an amino acid or the amount of starch are well known in the art. Alternatively, the seed from transformed monocotyledonous plants, regenerated from transformed tissue culture, develops in the field and self-pollinates to generate true culture or breeding plants. The seed from the fertile transgenic plants is then evaluated for the presence and / or expression of the DNA sequence in sense or antisense. The transgenic seed tissue can be analyzed for a substantial inhibition in the production of the seed storage protein using standard methods such as SDS-polyacrylamide gel electrophoresis. A substantial inhibition of the production of the seed storage protein is a decrease in the weight percentage of the seed storage protein, preferably from about 70 to 100%, and more preferably about 80 to 100% over that normally present <; in a non-transformed seed. The percentage by weight of a storage protein in seed or an amino acid is based on the amount of that protein or amino acid present by total weight of all the proteins or amino acids in the seed. The seed can also be evaluated for an increase in the percentage by weight of at least one essential amino acid in the diet of the animals, by standard methods. An increase in the percentage by weight of the target amino acid is preferably about 50 to 300%, and more preferably about 100 to 200%, over that normally present in the non-transformed seed. While not intended to limit the invention, the decrease in expression in the target seed storage protein is generally accompanied by an increase in other proteins that have essential amino acids in the diet of the animals. Once a transgenic seed is identified that expresses the sense or antisense DNA sequence, and that has an increase in the weight percentage of the essential amino acid in the diet of the animals, the seed can be used to develop true plants for breeding or cultivation. True breeding plants are used to develop a line of plants with an increase in the weight percentage of an essential amino acid in the diet of the animals, as a dominant trait or characteristic, while still maintaining other traits or functional agronomic characteristics , desirable. The addition of the trait or characteristic of increasing the percentage by weight of an essential amino acid in the diet of the animals to agronomically selected lines, can be achieved by backcrossing with this trait or characteristic, and with those without the trait or characteristic, and studying the pattern of inheritance in segregating generations. Those plants that express the trait or objective characteristic in a dominant manner are preferably selected. Backcrossing is carried out by crossing the original, fertile transgenic plants with a plant originating from an inbred line that shows functional, desirable agronomic characteristics, while not expressing the trait or characteristic of an increased weight percentage of the target amino acid. The resulting progeny is then backcrossed to the parent who does not express the trait. The progeny coming from this crossing will also segregate, so that some progeny will carry the trait or characteristic and some will not carry it. This backcrossing is repeated until the inbred line with desirable functional traits or agronomic characteristics is obtained, but without the trait of an increase in the weight percentage of an essential amino acid in the diet of the animals, which is expressed in a dominant way. Subsequent to backcrossing, the new transgenic plants are evaluated for an increase in the weight percentage of an essential amino acid in the diet of the animals, as well as for a battery of functional agronomic characteristics. These and other functional agronomic characteristics include corn hardness, yield, resistance to insect pests and diseases, drought resistance, and herbicide resistance. Plants that can be improved by these methods include, but are not limited to, processed plants (cañola, potatoes, tomatoes, lupins, sunflower and corn seed), forage plants (alfalfa, clover and lateon), and grains (corn, wheat, barley, oats, rice, sorghum, millet and rye). The plants or parts of the plants can be used directly as food or the amino acids can be extracted for use as an additive for food.

Determination of Vegetable Weaves Stable Transformed To confirm the presence of the preselected DNA sequence in the regenerating plants, or the seeds or progeny derived from the regenerated plant, a variety of tests can be performed. Such assays include, for example, "molecular biological" assays well known to those of skill in the art, such as Southern and Northern staining and PCR; "biochemical" assays, such as the detection of the presence of a protein product, for example, by immunological means (ELISAs and Western blots) or by enzymatic function; plant part tests, such as seed or root leaf tests; and also, by analyzing the phenotype of the complete regenerated plant. While the techniques of DNA analysis can be conducted using DNA isolated from any. part of a plant, RNA can only be expressed in particular cells or in particular types of tissues, and therefore it will be necessary to prepare RNA for analysis from these tissues. PCR techniques can also be used for the detection and quantification of RNA produced from pre-selected, introduced DNA segments. In this PCR application it is first necessary to reverse transcribe the RNA to DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques the DNA is amplified. In most cases, PCR techniques, while useful, will not demonstrate integrity of the RNA product. Additional information regarding the nature of the RNA product can be obtained by Northern blotting. This technique will demonstrate the presence of a species of RNA and will give information regarding the integrity of that RNA. The presence or absence of any RNA species can also be determined using Northern hybridizations by spot or slot staining. These techniques are modifications of Northern blotting and will demonstrate only the presence or absence of a species of RNA While Southern blotting and PCR can be used to detect the preselected DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. The expression can be evaluated by specific identification of the protein products of the preselected, introduced DNA sequences, or the evaluation of the phenotypic changes caused by their expression. Tests for the production and identification of specific proteins can make use of the physicochemical, structural, functional or other properties of proteins. Unique structural and physicochemical properties allow proteins to be separated and identified by electrophoretic methods, such as native or denaturing gel electrophoresis, or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography. The unique structures of individual proteins offer opportunities for the use of specific antibodies, to detect their presence in formats such as in an ELISA assay. Combinations of procedures with even greater specificity can be employed such as Western blotting in which the antibodies are used to localize individual gene products that have been separated by electrophoresis techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest, such as evaluation by sequencing of amino acids after purification. Although these are among the most commonly used, other procedures may be used additionally.

Very often the expression of a gene product is determined by the evaluation of the phenotypic results of its expression. These trials can also take many forms, including but not limited to analysis of changes in chemical composition, morphology or physiological properties of the plant. The chemical composition can be altered by expressing the preselected DNA segments that code for storage proteins, which change the amino acid composition and can be detected by amino acid analysis.

IV. Increase in the Weight Percentage of at least one Essential Amino Acid for the Diet of Animals The present invention is directed to increasing the amount of an amino acid essential for the diet of animals, in a transgenic plant or seed, on that normally present in the non-transformed (non-transgenic) plant, or its seed. The plant cells are stably transformed with a preselected DNA sequence which codes for an RNA molecule having substantial identity (in sense), or complementarity (antisense) to an mRNA that codes for a seed storage protein, preferably a protein of seed storage that is deficient in at least one essential amino acid in the diet of the animals. Transformed cells are used to regenerate fertile transgenic plants and seeds. The antisense or sense RNA sequence is expressed in the seeds in an amount effective to inhibit the production of the seed storage protein. The decrease in the seed storage protein, deficient in the essential amino acid, results in an increase in the percentage by weight of other amino acids, preferably essential amino acids, present in other proteins in the transgenic seed, on that normally present in the transformed seed. In a preferred embodiment, a corn cell line is transformed with an expression vector comprising a preselected DNA sequence encoding an RNA molecule substantially identical to, or complementary to, all or a portion of an mRNA encoding a 19 kD or 22 kD a-zein protein, operably linked to a promoter for a 10 kD zein protein. Another preferred embodiment includes linking the preselected DNA sequence to a Z27 promoter. The expression vector preferably further comprises at least one selectable marker gene. The corn cell line is transformed by biolistic transformation and the transformants are initially selected by development in the presence of an agent that is present at levels that inhibit the development of the corresponding non-transformed cells. Transformants are further characterized by the presence or expression of the DNA sequence by polymerase chain reaction (PCR) or reverse transcriptase analysis (RT-PCR). Transformed corn cell lines having the preselected DNA sequence are used to regenerate fertile transgenic plants by the method as described in PCT publication WO95 / 06128. The fertile transgenic plants are self-pollinated or crossed to a second variety of plants, and the transgenic seeds are characterized for the inhibition of the production of a 19 kD or 22 kD a-zein protein by quantitative western blotting, or SDS-PAGE, or for an increase in the weight percentage of an amino acid essential for the diet of animals, such as lysine. In an alternative embodiment, the present invention is directed to increasing the weight percentage of an essential amino acid in the diet of the animals, in a plant or seed by stably transforming the cells from a source of plant tissue with at least two different pre-selected DNA sequences. The first preselected DNA sequence comprises a preselected DNA sequence encoding an RNA molecule substantially identical to, or complementary to, an mRNA for a seed storage protein, preferably a seed storage protein which is deficient in at least an amino acid essential for the diet of animals. The second preselected DNA sequence encoding a polypeptide comprises at least one amino acid essential for the diet of the animals. Expression cassettes comprising one or both preselected DNA sequences, may optionally comprise a selectable marker gene and, optionally, a reporter gene. Each preselected DNA sequence can comprise a different, selectable marker gene, so that transformants containing both pre-selected DNA sequences can be easily selected. The cells of the plant tissue source, as well as the methods for transformation described, can be used in the co-transformation. The co-transformation can be conducted sequentially, that is, the cells of the plant tissue source can be transformed with the first preselected DNA sequence and the selected transformants. The transformants can then be transformed with the second preselected DNA sequence, and the transformants having both preselected DNA sequences can be selected. Typically, the initial selection is based on the trait or characteristic expressed by the selectable marker gene or genes. The co-transformation can also be conducted in one step, that is, the cells of the plant tissue source can be transformed with both preselected DNA sequences, all at once, for example, by electroporation or biolistic transformation. Alternatively, two plants can be crossed. The genome of one of the plants comprises the first preselected DNA sequence, and the genome of another plant at the crossing comprises the second preselected DNA sequence. Transformants containing both preselected DNA sequences are further characterized by the presence and / or expression of the first preselected DNA sequence, and the second preselected DNA sequence, by standard methods, such as PCR or RT-PCR, stain hybridization. of Southern, SDS-PAGE and quantitative Western spotting. Transformants having both introduced sequences are used to generate fertile transgenic plants and the seeds therefrom, as previously described. The transgenic seeds are then characterized by the presence and / or expression of both preselected DNA sequences. The expression of the first preselected DNA sequence can be detected and quantified by examining the seeds for a sequential inhibition of the production of a seed storage protein, deficient in an essential amino acid in the diet of the animals. The expression of the second preselected DNA sequence can be detected and quantified by quantitative Western blotting for the plant protein, comprising at least one essential amino acid in the diet of the animals and / or by an increase in the weight percentage of a amino acid - essential in the diet of animals, such as lysine or methionine, compared to a non-transformed seed. In a preferred embodiment, a maize cell line is cotransformed with a first preselected DNA sequence that encodes an RNA molecule substantially identical to, or complementary to, all or a portion of an mRNA encoding an α-zein protein of kD or 22 kD, and a second preselected DNA sequence encoding a 10 kD zein protein. The 19 kD or 22 kD a-zein protein is preferably deficient in at least one essential amino acid in the diet of the animals, such as lysine, methionine or tryptophan. The 10 kD zein protein preferably comprises at least one essential amino acid in the diet of animals, such as methionine. The isolated, purified DNA molecule comprising the first preselected DNA sequence also preferably comprises a selectable marker gene or a reporter gene, such as GUS. The second preselected DNA sequence may contain a second selectable marker gene, such as glyphosate-resistant EPSPS. In a further embodiment of the present invention, the corn is cotransformed with a first preselected DNA sequence, in sense, which codes for an RNA molecule which is identical, or complementary to the a-zein mRNA of 19 kD or 22 kD, and a second preselected DNA sequence that codes for the synthetic MBl protein. Alternatively, the second preselected DNA sequence encodes a 27 kD zein protein. Thus, it is contemplated that genes encoding other synthetic proteins or proteins of natural origin that comprise at least one essential amino acid in the diet of animals can be replaced by MBl. Even more preferably, the corn is cotransformed with a first, preselected, sense DNA sequence encoding an RNA molecule that is identical to, or complementary to, the 19 kD or 22 kD a-zein mRNA, a second DNA sequence. preselected coding for the MBl synthetic protein and a third preselected DNA sequence encoding a 27 kD zein protein. Transformants having both preselected DNA sequences are used to generate fertile transgenic plants and seeds. Transgenic seeds are characterized by a substantial inhibition of the production of a 19 kD or 22 kD a-zein protein, determined, for example, by quantitative Western blotting, and by an increase in the weight percentage of an essential amino acid in the diet of animals, such as methionine or lysine. Transgenic seeds and transgenic plants can be used to develop plants for true breeding so that the trait of an increase in the weight percentage of an essential amino acid in the diet of the animals, can be expressed as a dominant trait, while still maintains functional agronomic qualities as described hereinabove.

V. Methods to Increase the Starch Content of a Plant Seed The invention also provides an increase in the weight percentage of the starch in a plant and / or seed. The method comprises stably transforming the cells of a plant tissue with a first preselected DNA sequence, which codes for an RNA molecule substantially homologous or complementary to all or a portion of an mRNA that codes for at least one seed storage protein. . While it is not desired in any way to limit the invention, it is believed that a decrease in the expression of the seed storage protein in the seed results in an increase in the weight percentage of the starch in the seed. The preselected DNA sequence is preferably operably linked to a functional promoter in a plant and / or a seed. The transformed cells are used to regenerate transgenic, fertile plants and / or seeds. The transgenic seeds are characterized by the expression of the preselected DNA sequence by examining the seed for a substantial inhibition of the production of at least one seed storage protein, and for an increase in the weight percentage of the starch, on that normally present in a non-transformed seed. The first preselected DNA sequence can be derived from a DNA sequence encoding at least one storage protein in plant seed. The storage proteins in plant seeds include corn zein proteins such as the α-, β-, β-, or d-zein proteins. While it is not intended in any way to limit the invention, it is believed that a decrease in the expression of the seed storage protein results in an increase in the weight percentage of the starch in the seed. Preferably, the presence of the first preselected DNA sequence results in a substantial inhibition of at least one seed storage protein, and more preferably results in the inhibition of the a-zein proteins. The preparation of the first sequence of DNA as well as its binding to the appropriate promoters, can be achieved as described above in The present plant cells can be transformed as described above, and the transformants are selected Transformants are used to generate fertile transgenic plants and seeds Transgenic seeds are characterized by an increase in the weight percentage of the starch in the seed, on that present in the non-transformed seed.The weight percentage of the starch content in the seed can be determined by enzymatic hydrolysis and glucose determination.The weight percentage of the starch is calculated by comparing the weight of the starch in the seed, compared to the total weight of the seed An increase in the weight percentage of the starch in the transgenic seed, is preferably from about 1% to 10%, and more preferably from 3 to 8%, and even more preferably from 5 to 7%, on that in the non-transformed seed.The transgenic seeds with an increase in the Starch weight percent, can be used to develop plants for true breeding, which express this trait in a dominant manner, while still maintaining functional agronomic traits, as previously described.

The reduction of a-zein levels in corn grains can also increase the degree of recovery of starch from operations such as wet grinding of grains, since a-zeins constitute the largest portion of the protein matrix which surrounds the granules of starch in the grain (Lopes and Larkins, 1993). A reduction in the amount of these hydrophobic proteins could facilitate the recovery of starch grains. This is of particular significance for specialty starches, such as those obtained from corn with a high content of amylose or waxy corn, because these starches are of much more value than those obtained from yellow cogged maize No. 2. An increase in the yield of starch, for example, the percentage of the starch present in the grain that can be recovered by milling on a wet basis, is preferably from about 1% to 20%, more preferably from about 3% to 15%, and even more preferably from about 6% to 12%, higher in grains of plants containing the preselected DNA sequence, on the grain from plants that do not contain the preselected DNA sequence.

SAW . A Method to Inhibit the Expression of a Family or Protein Subfamily de_ Storage in Seed The invention also provides a method for inhibiting the expression of a family, or subfamily, of seed storage proteins. Seed storage proteins such as corn zein proteins are encoded by multiple gene families. The multiple gene families corresponding to zein proteins have different molecular weights: a-zein proteins include proteins with molecular weights of 19 kD and 22 kD; the ß-zein proteins include proteins with a molecular weight of 14 kD; proteins? -zeins include proteins with molecular weights of approximately 27 kD and 16 kD; and the d-zein proteins include proteins with molecular weights of about 10 kD. Each family can have several subfamilies. For example, subfamilies of a-zein proteins are determined based on the sequence homology to cDNA clones A20, A30, B49, B59 or B36 as described by Messing et al., Cited above, or the cDNA clone of Z4 that codes for 22 kD a-zein. Typically, members of the same subfamily share approximately 90 to 100% sequential amino acid homology, and members of different subfamilies share approximately 60% to 80% homology in the amino acid sequence. The examination of the amino acid sequence for the α-zein subfamily has identified four functional subdomains and regions of shared homology of amino acids in these functional subdomains, as shown in Figure 1. These regions of homology in the amino acid sequence can be used to analyze the amino acid sequence from other subfamilies and families of zein proteins for homology. In addition, these regions can be used to select DNA sequences that encode an RNA molecule that can inhibit the production of a family or a subfamily of zein proteins. An antisense RNA sequence that can inhibit the production of a family or subfamily of zein proteins is preferably a sequence that is substantially complementary to a portion of an mRNA sequence that is substantially homologous among all members of the subfamily or family of proteins. the proteins zeins. Alternatively, it is contemplated that the preselected sense DNA sequences may be used to suppress the synthesis of a family or a subfamily of zeins. For example, as shown in Figure 1, subfamilies A20, A30 and B49 share homology in the amino acid sequence in the signal peptide region and in the amino-terminal region of the proteins. An antisense DNA sequence that codes for these regions of the zein protein can encode an RNA molecule that can inhibit expression for a family of zein proteins. The antisense DNA sequence encoding these regions can be selected based on the homology of the amino acid sequence in these regions, and can be used to inhibit the expression of more than one subfamily of a family of the zein proteins. The domain that contains the tandem repeats of the 20 amino acids has the greatest variability in the amino acid sequence and in size. There are insertions and deletions in this region when comparing the sequences of different subfamilies. A preselected antisense DNA sequence encoding this region of the a-zein protein can be used to express an RNA molecule that can inhibit the expression of a subfamily of zein proteins.

The preselected, antisense DNA sequence. . . originating from this region of the zein protein is substantially homologous within a subfamily, but is not substantially homologous between subfamilies. The preselected antisense DNA sequence is obtained by restriction endonuclease digestion of a cDNA or genomic clone encoding a seed storage protein. The antisense DNA sequence, preselected is linked to a promoter to form an antisense expression cassette to determine the ability of the antisense DNA sequence, to inhibit the translation of a family or subfamily of seed storage proteins. A standard assay such as translation stopped by hybrid can be employed. The preselected antisense DNA sequence results in substantial translation inhibition of cDNA clones from various families such as A20, Z4, A30, and / or B49. The preselected antisense DNA sequence can inhibit a family of zein proteins. The preselected antisense DNA sequence substantially inhibits translation of cDNA clones or genomic clones within a subfamily and the preselected antisense DNA sequence can be used to inhibit the expression of a subfamily of zein proteins. The preselected antisense DNA sequence is used to stably transform plant cells. as described hereinabove. Sense DNA sequences can also be used. Fertile transgenic plants and seeds are generated from the transformed cells. The transgenic seeds are characterized for the expression of the antisense DNA sequence, preselected by evaluating the inhibition of the production of two or more members of a zein family or subfamily of proteins, by using techniques such as Western quantitative spotting. . In a preferred embodiment, the preferred antisense DNA sequence encoding an RNA molecule, substantially complementary to an mRNA encoding the repeated tandem region of domain 3 of an a-zein protein in an A20 subfamily, is combined with a Z10 promoter. The expression cassette comprising the preselected antisense DNA sequence may also comprise one or more selectable marker genes. The preselected antisense DNA sequence is stably transformed into a corn cell line and the transformants are selected. Transformed cells are used to generate fertile transgenic plants and seeds. The transgenic seeds are evaluated for the expression of the preselected antisense DNA sequence, by confirming the substantial inhibition in the production of the A20 subfamily of a-zein proteins by quantitative Western blotting.

VII. Method to Increase the Production of a Preselected Polypeptide in Seeds The invention further provides an increase in the expression of a particular polypeptide in plants and / or seeds. The method involves the stably transformation of cells with a first preselected DNA sequence to suppress the synthesis of a seed storage protein, deficient in an essential amino acid and a second preselected DNA sequence encoding a polypeptide, such as an enzyme or a storage protein in seed. While not intending to limit the invention in any way, it is believed that a substantial inhibition of the production of at least one seed storage protein is accompanied by an increase in the ability of the plant cell and / or the seed to produce other proteins. Transformed cells having first and second preselected DNA sequences are obtained and used to generate fertile transgenic plants and / or seeds. The first preselected DNA sequence encodes an antisense or sense RNA for at least one seed storage protein. The first preselected DNA sequence is combined with a functional promoter in plant and / or seed, to form an expression cassette. Optionally and preferably, the expression cassette also comprises a selectable marker gene and, optionally, a reporter gene.

The second preselected DNA sequence, which codes for a polypeptide, is operably linked to a functional promoter in plant and / or seed. Preferably, the promoter is functional during the development of the plant and the seed. The second preselected DNA sequence encodes a polypeptide that provides the seed or plant with a desirable functional characteristic, such as increased resistance against diseases or pests, drought resistance, increased amino acid biosynthesis, increased nutritional value, increased grain hardness , and similar. The preselected DNA sequences can be operably linked to the promoter by standard methods provided in Sambrook et al. Cited above, and as previously described. Optionally and preferably, the expression cassette comprising the second preselected DNA sequence also comprises a selectable marker gene different from the selectable marker gene present in the expression cassette comprising the first preselected DNA sequence.

The transformation of plant cells is conducted by any of the previously described methods. The plant cells can be transformed with the first and / or second preselected DNA sequences, sequentially or simultaneously. When the plant cells are sequentially transformed, the transformants comprising the first preselected sequence are obtained based on the presence of a selectable marker gene. These transformed cells are then transformed with the second preselected DNA sequence and the transformants are obtained based on the presence of each of the selectable marker genes present on the expression cassette, comprising the first preselected DNA sequence and present on the expression cassette comprising the second preselected DNA sequence. Transformants containing the first and second preselected DNA sequences are used to regenerate fertile transgenic plants and / or seeds. The transgenic seeds are characterized by the expression of the first and second preselected DNA sequences. The expression of the first preselected DNA sequence is evaluated by measuring a substantial inhibition in the production of at least one seed storage protein. The expression of the second preselected DNA sequence is evaluated by detection of the pre-selected polypeptide, using standard phenotypic or genotypic methods, such as Western quantitative staining. An increase in the expression of a polypeptide can be determined by comparing the weight percent of the protein produced in transformed plants or seeds with the second preselected DNA sequence. The expression of the polypeptide is preferably increased approximately 2 to 100 times, and more preferably approximately 5 to 30 times, on that in a plant and / or a seed only transformed with the second preselected DNA sequence. The invention will be further described by the following examples.

EXAMPLE 1 Construction of the Plasmid Containing the Constructs of Antisense DNA Cassettes of antisense expression were obtained by using sequences from cDNA clones that encode the zein proteins. The cDNA clones were prepared by standard methods, previously described by Geraghty et al. (1982) and Hu et al. (1982). The A20 cDNA clone codes for an α-zein protein of the 19 kD size class of the Z1A subfamily of the zein genes. Another cDNA clone designated Z4 encodes an a-zein of the 22 kD size class of the Z1B family of genes. The subfamilies Z1A and Z1B and their characteristics are shown in Table I.

TABLE I Prolamin Fraction from the Multiple Zein Genes Family of Corn (Soluble in Alcohol) Zl z2 Subfamily (non-reducing conditions) (reducing conditions zlA zlB zlC zlD z2A (ASC) z2B z2C Representing clone A20 A30 B49 B59 B36 Z15A of Mrx lOO cDNA Mainly 19 Mainly 19 Mainly-- Mainly 19 27 15 10 Some of 22 Some of 19 Locus 4L, 7S, 10L 4L 7S 4L???? Amino acid? Re ___ P? A? _e Glutamine Glutamine Glutamine Glutamine proline Cysteine methionine Synchronization of Approx. 12 dap Approx. 12 dap Approx. 18 dap Approx. 12 dap Approx. 18 dap Approx. 18 dap Approx. 18 expression dap Transactional mutants o2 + .o7 +++ O2 + .07-H- o2 + -H-.o7 ++ o2 + .o7 ++ o2 + .o7 + o2 + .o7 ++ o2 ++. O7 ++ (06-H - +. Fl2 + .Mc +) From * -B30 + From * -B30 + From * -B30 ++ From * -B30 + From * -B30 + From * -B30 + From * -B30 + No. of genes < 25 < 20 < 15 < 5 2 2? + reduced synthesis ++ increasingly reduced synthesis +++ strongly reduced synthesis Antisense expression cassettes comprising the complete cDNA sequence for clones A20 and Z4, as well as portions of those sequences, were also generated. The portions of each sequence were selected by examining the sequence of the a-zein proteins of 19 kD and 22 kD. As shown in Fig. 1, the primary sequence of the polypeptides can be divided into four domains, as described by. Messing et al. (1983). Domain I contains the highly conserved 21-amino acid signal peptide that is cleaved during co-transductional transport of zein proteins to the lumen or internal space of the endoplasmic reticulum. Domains III and IV are the N-terminal and C-terminal regions, respectively, of the mature zein proteins. Domain III represents the largest source - of sequential homology between subfamilies, since it contains 9 to 10 tandem repeats of the sequence that codes for a -sequence of 20 amino acids. The number of repeats present in Domain III determines the size of the a-zein protein (19 kD or 22 kD).

Typically, individual members within a subfamily share 90 to 100% of sequential homology, and while the sequence homology between subfamilies is in the range of about 65 to 85%. All the antisense plasmids for systematic in vi tro analysis were constructed by standard recombinant techniques as detailed below, using the transcriptional vectors pSP72 and pSP73 (Promega, Madison, Wl). These transcription vectors are circular plasmids of 2.46 kb, which contain 103 base pairs of the inserted polylinker sequence between the convergent T7 and SP6 transcriptional promoters. The two transcription vectors differ in the orientation of the polylinker with respect to the promoters. The antisense plasmids, complementary to all or portions of the cDNA clones A20 and Z4, were constructed as described below. The RNA sequence for zein A20 (SEQ ID No. 1) and the DNA sequence for zein Z4 (SEQ ID No. 2) are shown in Figures 2 and 3, respectively. The relevant A20 and Z4 genes and the gene fragments used in the antisense constructs are shown in Table II.

TABLE II Designation of the Construction Enzymes of Antisense Size Restriction Insert SP20 with BalI / EcoRI 711- SP20R3 'BalI / PstI 488 SP20R Pstl / Pstl 262 SP20P BalI / EcoRI 863 SP20P5' AccI / EcoRI 458 SPZ4ent SacI / BamHI 960 SPZ4R3 'Xbal / BamHI 713 SPZ4R5' BamHI / Ddel 246 SPZIOent EcoRI 640 All restriction and modification enzymes and buffers were obtained from New England Biolabs, Inc. (Beverly, MA), unless otherwise indicated, and used according to the manufacturer's specifications. All insert fragments were gel isolated and purified by the Genclean method (BIO 101, Vista, California), and all vectors were treated with calf intestinal phosphatase (Boehringer-Mannheim Corporation, Indianapolis, IN), then isolated in gel on low melting agarose before addition to the ligation reactions. The antisense constructs encoding all or a portion of the cDNA clones from A20 and Z4 were prepared as follows: SP20ENT: The parental plasmid pUC12 / A20, which contains the 3 'mature and untranslated coding sequence (nts) from the A20 cDNA clone (the A20 RNA sequence is shown in Figure 2), was digested at the site EcoRI (nt 175) and the Ball site (nt 886) to generate a 711 nucleo fragment containing the complete sequence except for the 55 base pairs of the 3 'nucleos. The fragment was ligated into pSP72 which has been digested with EcoRI and PvuII, resulting in the 3 'to 5' antisense orientation of the gene with respect to the SP6 promoter.

SP20R3 ': A fragment of 488 base pairs, which contains the sequence encoding the intermediate repeat region through the 3'-A20 nucleos, was isolated from the parent plasmid pl020R3', prepared as in Example 2 from the Pst I site at nucleo 298 to the Ball site at nucleo 886. The fragment was obtained by digestion of pl020R3 'with Kpnl and HindIII, and after isolation, the fragment was ligated into pSP72 which had also been digested with these enzymes . The gene fragment was therefore oriented 5 'to 3' with respect to the SP6 promoter.

SP20R: A fragment of 262 base pairs, from nucleo 398 to nucleo 660, was obtained by digestion of pUC12 / A20 with PstI. The purified fragment was ligated into pSP72 digested with PstI to make pSP20R, which contains the sequence encoding the intermediate repeat region of A20 in the 3 'orientation relative to the SP6 promoter.

SP20P: The 5 'end of the transcription unit A20 was reconstructed by PCR amplification of a fragment containing the 5' nucleos and coding for the signal pep through the intermediate repeat region, since the nucleos 5 ' and the signal pep sequence was not contained in clone pUC12 / A20. The primers used in the amplification are designated A20P5'.2 (SEQ ID No. 3) and A20P3 '(SEQ ID No. 4).

The fragment was amplified from the genomic DNA isolated from leaf tissue of the maize A654 inbred line, and contained 458 base pairs of the A20 cDNA sequence, from nucleo 58 to nucleo 490. The conditions for PCR are detailed later; all reactions were carried out in a Biosycler oven (Bios Corporation) Each reaction contained 10 μl of the 10X PCR reaction buffer, 10 μl of 20 mM magnesium chloride, 10 μl of 2 mM dNTPs, 10 μl of each primer (reserve of 2.5 ml) and 0.5 μl (2.5 U) of Taq polymerase (Perkin-Elmer Cetus), for a total of 100.5 μl / reaction. An annealing temperature of 56 ° C was used, and a total of 30 cycles were performed, including the first 3 cycles with the prolonged incubation at the denaturing temperature of 94 ° C. The parameters for the first three amplification cycles were as follows: 60 seconds at 94 ° C, 30 seconds at the annealing temperature of 56 ° C, and 30 seconds at the synthesis temperature of 72 ° C. For the remaining 27 cycles, the parameters were as follows: after bringing the reactions to 94 ° C, 15 seconds at this temperature, then 15 seconds at 56 ° C, followed by 15 seconds at 72 ° C.

The 458 base pair product was designed to add a 5 'EcoRI site, and included a 3' Accl site, endogenous. After digestion with these enzymes, the amplified fragment was ligated into pSP20ENT, also digested with these enzymes, replacing a 320 base pair fragment containing the shortest 5 'end fragment of A20 from pSP20ENT. After construction, the gene was approximately 860 base pairs in length, and contained approximately 55 nucleotides of the 5 'nucleotides, the sequence encoding the signal peptide, and the complete coding sequence, as well as the nucleotides 3. ' The reconstructed gene is oriented 3 'to 5' with respect to the SP6 promoter.

SP20P5 ': The 5' end of the A20 gene, after PCR amplification and digestion with EcoRI and Accl as described above, was cloned into pSP72 to generate pSP20P5 '. This construct contains 458 nucleotides of the A20 sequence, including 55 nucleotides of the 5 'untranslated sequence and 403 nucleotides of the coding sequence, which includes approximately the N-terminal half of the coding sequence. The inserted sequence is oriented from 3 'to 5' with respect to the SP6 promoter.

SPZ4ENT: Essentially, the complete Z4 transcription unit is contained in this clone, with a total insert size of 960 nucleotides. The gene was reconstructed from two subclones Z4, pSPZ4R3 'and pSPZ45', which are described below. The progenitor vector was pSPZ4R3 ', which contained 713 nucleotides of the intermediate repeat of the 3' nucleotide sequence, from nucleotide 630 to nucleotide 1341 of the sequence of Z4 (the DNA sequence of Z4 is shown in Figure 3) . The 5 'end of the Z4 sequence was released by digestion with Sacl (which breaks the polylinker sequence outside the inserted gene) and Ba Hl, and the insert containing the 5' sequence from pSPZ45 ', obtained by Sacl (the which also breaks the polylinker sequence) a digestion with dBamHI was ligated to the linearized pSPZ4R3 ', resulting in the reconstitution of the intact Z4 transcription unit.

SPZ4R3 ': An insert fragment of 713 nucleotides, which contained the intermediate repeat region to the 3' non-coding sequence, was isolated after digestion with BamHI (nucleotide 630) and Xbal (nucleotide 1341). The fragment was ligated into pSP72 digested with the same enzymes, resulting in the orientation of the gene fragment in the 3 'to 5' direction with respect to the SP6 promoter.

SPZ45 ': A fragment of 247 nucleotides containing 76 nucleotides of the 5' non-coding sequence, the signal peptide sequence, and about 100 nucleotides of the sequence encoding the mature protein was cloned into pSP72. After digestion with Ddel, the DNA was treated with Klenow to create blunt ends, then digested with BamHl to release the desired fragment. The fragment was ligated into pSP72 digested with EcoRV and BamH1, resulting in 3 'to 5' orientation of the gene fragment with respect to the SP6 promoter.

SPZ10ENT: A fragment of 670 nucleotides containing the complete Z10 transcriptional unit was isolated from the cDNA clone of the 10 kD zein, plOkZ.l by digestion with EcoRI (the sequence of the 10 kD zein gene can be found in Kirihara et al., 1988). After digestion of pSP72 with EcoRI as well, the insert was ligated with the vector to produce pSPZIOENT, a 3.16 kb circular plasmid. The clones were obtained containing both orientations, and the clone used in the hybrid arrest studies contained the 10 kD transcription unit oriented 3 'to 5' with respect to the SP6 promoter.

EXAMPLE 2 Construction of Plasmids Containing an Antisense DNA Sequence for Use in Corn Transformation A group of antisense plasmids was constructed for expression in corn, using complete sequences or portions of the sequences Z4 and A20 as detailed in Example 1 above. The antisense constructs were combined with a functional promoter in the plant endosperm tissue, to form a DNA sequence that can be expressed in a plant seed.

Construction of the Vector Plasmids plOB and plOX were constructed from pZ10nos3 '. The pZ10nos3 'construct contains 1137 base pairs of the Z10 promoter from a gene coding for a 10 kD zein promoter, upstream (5') of a short polylinker, which is adjacent to the 3 'polyA element of us. The vectors plOX and plOB were created by digestion of pZlO nos 3 'with BamHl, treatment with Klenow to blunt the BamHl site, then ligation with a polylinker insert, resulting in clones containing both orientations of the polylinker with respect to the Z10 promoter. . The polylinker fragment was obtained by digestion of pSP73 with BglIII and Xhol, followed by treatment with Klenow and then ligation with the vector pZ10nos3 'prepared. The plOX version contains the oriented polylinker with the Xhol site next to the Z10 promoter, while the plOB version contains the oriented polylinker with the BglIII site close to the Z10 promoter. Both plasmids are circular plasmids of approximately 4.65 kb. The antisense DNA constructs, prepared as described in Example 1, were combined with a functional promoter in a plant seed, using plasmids plOB and plOX, as described below. 1020ENT: An insert fragment of 725 nucleotides containing the coding sequence of mature A20 and non-coding 3 '(see Example 1, section SP20ENT) and including some polylinker sequence, was obtained by digestion of SP20ENT with Clal (cuts in the polylinker sequence) and Xhol. The vector, plOX, was prepared by digestion with Clal and Xhol as well, then the insert and the vector were ligated, generating pl020ENT, which contains the sequence A20 inserted 3 'to 5'. with respect to the Z10 promoter. 1020R3 ': An insert fragment of 488 nucleotides, containing the intermediate repeat to the 3' non-coding sequence of A20, was isolated from the pUC12 / A20 clone. The insert contains the sequence from the PstI site at nucleotide 398, and continues to the Ball site at nucleotide 886. The insert was obtained by digestion of pUC12 / A20 with. HindIII which cuts off the A20 sequence, then partial digestion with PstI (digestion only from the PstI site at nucleotide 398), followed by gel isolation of the desired 740 nucleotide fragment. After purification, the HindIII / PstI fragment was digested with Ball, which removed approximately 252 nucleotides from the 3 'end to generate a 488 nucleotide fragment with the PstI / BalI ends. This fragment was ligated into plOB which had been cut with Smal and PstI, resulting in the insertion of the A20R3 'fragment in the 3' to 5 'orientation with respect to the Z10 promoter. 102 OR: An insert fragment of 262 nucleotides containing the intermediate repeat region from A20 (as in SP20R of Example 1) was obtained by digestion of pUC12 / A20 with PstI. The vector plOX was also digested with PstI and, after ligation, clones were obtained with both orientations of the fragment with respect to the Z10 promoter. An Accl asymmetric site within the insert was used to select clones containing the fragment in the desired antisense orientation. pDPG380: The 863-nucleotide insert fragment containing the reconstructed A20 gene (as described for pSP20P above) was obtained by digestion of pSP20P with Xhol and BglII (which cut into the polylinker), then ligate the fragment into plOX that had been digested with Xhol and BamHl. This resulted in a 3 'to 5' orientation of the reconstructed A20 gene, relative to the Z10 promoter. pDPG340: A fragment of 875 nucleotides containing the complete Z4 gene as described above for pSPZ4ENT, was obtained by digestion of pSPZ4ENT with HindIII, treatment with Klenow, and then digestion with SalI. These enzymes cut into the polylinker sequence outside the gene in pSPZ4ENT. The vector plOX was digested with Ncol, treated with Klenow, and then digested with Xhol before ligation with the insert fragment. The resulting clone contained the gene in the 3 'to 5' orientation with respect to the Z10 promoter. 10Z4R3 'An insert of approximately 750 nucleotides, consisting of the intermediate repeat Z4 through the 3' non-coding (as described in Example 1 for pSPZ4R3 ') was obtained by digestion of pSPZ4R3' with Sacl and SalI, which cut in the polylinker sequence. The vector, plOX, was digested with Sali and Xhol, and since Xhol and Sali create compatible ends, this resulted in the directional cloning of the Z4R insert in the 3 'to 5' orientation with respect to the Z10 promoter. 10Z45 ': An intermediate vector 119Z45', containing the insert of the sequence Z45 '(see construction of SPZ45' Example 1) was first constructed using the pUC119 backbone (Sambrook et al., 1989). The final construction, 10Z45RN, was constructed by moving the insert -Z45 * from 119Z451 to the vector plOB. First, 119Z45 'was digested with BamHI and PstI, releasing a fragment of 270 base pairs. The vector, plOB, was prepared by digestion with BamHl and PstI and then the vector and the insert were ligated to produce plOZ45 ', containing the insert Z45' in the antisense orientation with respect to the Z10 promoter.

PDPG530 PDPG531 pDRG530 and pDRG531 were made by cutting a fragment of approximately 960 base pairs from SPZ4Ent and filling in the ends. The vector was a construction of the 3 'promoter region Z27: nos, in pBSK (-) which contained a unique Ncol site between the promoter and the terminator. The vector and the insert were made blunt at the end and ligated. Clones were identified with the orientation in the sense of the Z4 DNA sequence (pDPG531) and the antisense orientation of the Z4 DNA sequence (pDPG530).

EXAMPLE 3 Jn Vi tro method for the Selection of DNA Sequences that Contain the Antisense Once an expression cassette comprising a pre-selected antisense DNA construct and a functional promoter in a plant seed was prepared, as described in Example 2, the expression cassette was selected for the ability to stop the translation of the genes that code for the a-zein proteins of 19 kD (A2?) and 22 kD (Z4). The expression cassettes comprising the antisense DNA sequences were selected by the standard translation stopped by hybrid, as described below.

Production of the Template. All reagents for in vitro transcription were obtained from Promega (Madison, Wl) using their SP6 / T7 transcription protocol. Slight modifications were made to the Promega protocol. The plasmids were digested with appropriate enzymes in order to linearize them in the templates, preventing transcription beyond the end of the inserted gene. The templates were digested with Xhol for the transcription of SP6, and with BglII for the transcription of T7, unless otherwise indicated. Twenty micrograms of DNA were digested in a total volume of 100 μl. After analyzing aliquots for complete digestion, digestions were extracted with phenol / chloroform and chloroform, then precipitated with 0.1 volumes of 3 M sodium acetate, and 2.5 volumes of ethanol. After washing with 70% ethanol, the buttons or concentrates were resuspended in 10 μl of RNase-free sterile water Transcription reactions. After all the reagents were thawed at room temperature, master transcript mixtures were prepared, excluding the template DNA. This resulted in greater uniformity of reaction performance. For each reaction, the following components were added to 5 μl of the template DNA at 1 μg / μl in RNase-free water; 20 μl of the transcription buffer 54, 10 μl of 0.1 M DTT, 2.5 μl of recombinant RNasin (an inhibitor of 'RNase delivered at 40 U / μl), 20 μl of 10 mM rNTP mixture, 2.5 μl of SP6 or T7 (20 U / μl), and 45 μl of RNase-free water. The reactions were incubated at 37 ° C for two hours before the withdrawal of the template. The templates were removed by digestion with the RQ1 DNase (1 U / μl), 5.0 μl of enzyme were added to the transcription reactions, which were then incubated at 37 ° C for 15 minutes before extraction and precipitation of the transcript. The extraction, precipitation and washing were performed as described above for the preparation of the template. The transcript yield was determined by absorbance readings at 260 nm, and the integrity of the preparations was determined by gel analysis, either native or denaturing. Although the native gels occasionally showed bands of abnormal mobility, in general the preparations of the transcripts showed an approximately linear relationship between the expected size of the transcript and its mobility on the native gels.

Annealing of the Transcripts for Hybrid Formation. Before transcription, the transcripts were allowed to collect under saline conditions and controlled temperature, using constant molar proportions of the transcript in sense to the antisense. The conditions for annealing were as follows: 10 mM Tris, pH 7.5, 100 mM sodium chloride, RNA (s), and RNase-free water to bring the total volume to 20 μL. The amount of aggregated RNA was based on a 4: 1 mole ratio of the antisense transcript to the sense, with 4 μg of the sense transcript in each reaction, and a variable μg amount of the antisense transcript added to maintain the 4: 1 mole ratio. Prior to annealing, all transcripts were heated to 65 ° C, then maintained at 0 ° C to reduce the potential formation of intramolecular secondary structures which could reduce the efficiency of duplex formation. After annealing for 45 minutes at 45 ° C, the reaction was divided in half, so that 10 μl of the reaction could be translated in vi tro, and the remaining 10 μl was analyzed on 1.2% agarose gels to determine the degree of hybrid formation in each sample. Although some abnormalities in mobility were observed that were probably due to intramolecular interaction, this method was generally useful to analyze the degree of duplex formation between two transcripts, and it correlated perfectly with the results of hybrid translation.

Translation In Vi tro of Annealing Reactions and Analysis of Translation Products The transcription of the Z4ENT and A20ENT transcripts was carried out using the wheat germ lysate and rabbit reticulocyte lysate systems (Promega). Although both systems produced plant proteins when the translation products were analyzed by SDS-PAGE and autoradiography, the rabbit reticulocyte system translated the Z4ENT and A20ENT transcripts more efficiently than the wheat germ system.

The translation of the annealed samples was performed using a lysis system of rabbit reticulocytes, treated with nuclease (Promega), and 35S-methionine was used to label the translation products (Amersham). The reactions were performed essentially according to the Promega protocol with the modifications as described below. To analyze the translation products, reactions were run on SDS-PAGE, using a 4% stacking gel and a 15% separation gel, with 0.75 or 1.5 mm spacers. The gels were run on a Hoefer apparatus, at 35 mA with constant current, for 3 to 3.5 hours. The samples were prepared for electrophoresis by adding 10 μl of each reaction to 40 μl of Ix of sample buffer, then bubbling for 7 minutes before centrifuging for 30 seconds in a microcentrifuge. After removing the stacking gel, the gels were incubated for 30 minutes with shaking in a 1 M sodium salicylate solution to improve detection of the radioisotope. The gels were then rinsed briefly in water and dried on a plate dried under vacuum at 65 ° C for 2 hours. The dry gels were exposed to film overnight, using intensification screen (Lightning Plus, Dupont Cronex) at -70 ° C. After development, the gels were scanned using an LKB 2202 Ultroscan laser densitometer, and the data was collected and analyzed using the maximum software (software) logic for chromatographic analysis (Waters Co.). The results of the translation in vi tro of the linearized plasmids containing the complete copies of the Z4 and A20 genes in the orientation in sense, show that the translation systems in vi tro could be used to periodically verify the effects of the antisense constructions. about the translation of zein genes. Both translation systems produced proteins of the expected weight species of 19 kD, corresponding to the product of the mature A20 gene. Interestingly, however, while the rabbit reticulocyte system translated the Z4ENT transcript into. the 22 kD preprotein, the wheat lysate system processed the preprotein Z4, removing the signal peptide to produce the mature zein, resulting in a protein of approximately the same size as that of 19 kD. In both systems, the translation of the A20ENT transcript was at least 2 to 5 times more efficient than the translation of the Z4ENT transcript, probably due to the lack of a signal peptide in the A20ENT protein or differences in the accessibility of the initial codon between the two transcribed, since the A20ENT transcript did not contain the 5 'non-coding sequence. The packing of transcripts Z4ENT and A20ENT. It was carried out as a possible means to increase the efficiency of translation, using co-transcriptional and post-transcriptional procedures. No increase in translation efficiency was observed with any method. Stop-by-hybrid translations were made using the sense transcripts, Z4ENT, and the Z4ENT antisense transcripts to establish annealing and translation conditions. A titration experiment was carried out to determine the proportion of the antisense transcripts: sense necessary to completely abolish the synthesis of Z4. Amounts of antisense transcript were added in an excess of 1, 2 and 5 times the amount of the transcript in sense, and were allowed to stand under controlled conditions. The results of this experiment are shown in Table III. Subsequent experiments, using a 4: 1 ratio of antisense: sense in the annealing reactions, were found to also eliminate the synthesis of Z4, and thus this ratio was used for subsequent experiments.

TABLE III Effect of Increasing the Proportion of Antisense Transcript to Sense on Synthesis of Z4% Reduction in Synthesis of Z4 Transcripts Proportion Interval Mean Z4ENTS Na Na Na Z4ENTAS / Z4ENTs 1: 1 55 - 63 59 Z4ENTes / Z4ENTs 2: 1 84 - 85 8 5 Z4ENTres / Z4ENTs 5: 1 1 0 0 1 0 0 Experiments were also performed to determine if the radiation dose / exposure to the film plot was sufficiently linear to allow quantification of the protein using laser densitometer readings of the film. To test this, the amount of the extract loaded per band was varied in a range of 25 times. The results indicated that the dose / response plot was acceptable at a 10-fold interval only. The densitometry of the autoradiograms indicated that an overnight exposure of gels to the film produced a significant dose-response curve, but that the longer exposures did not. - Having established a basic protocol using the Z4ENT transcripts in sense and antisense, perfectly complementary, complete, a series of experiments was initiated to compare these results with the effect of antisense transcripts made from constructs containing only a portion of the transcriptional unit Z4, as well as with antisense transcripts made from of constructions containing all or portions of transcriptional unit A20. Data were collected from several hybrid arrests of translation experiments, all performed using a molar ratio of 4: 1 of the antisense transcript: sense, and incorporating all the Z4ENT transcript in sense without the antisense transcript added as a negative control (representing 100% synthesis). % of Z4, or 0% reduction in the synthesis of Z4), and the Z4ENT transcript with the antisense transcript of Z4ENT added as a positive control (representing 100% reduction in the synthesis of Z4). A lambda transcript and a polylinker transcript were used as controls. The results are shown in Table IV.

TABLE IV Translation Stopped by Hybrid Densitometry data collected for the reduction in protein synthesis Z4 Transcribed Antisense Reduction Number of Experiments Average (%) Done Z4ENT 100 5 Z45 '80 3 Z4R3' 75 3 A20ENT 81 3 A20R 59 2 Z10E 42 2 Transcribed lambda 32 1 Transcribed polyligador 0 2 General conclusions regarding the results can be obtained by adding the complete data established to generate a rough approximate consensus for the efficiency of the antisense transcripts when effecting the shutdown or stoppage of the synthesis of Z4, which are as follows: Z4ENT > Z45 '> A20ENT > Z4R3 '> A20R »Z10ENT > lambda > polylinker These data indicate that the complete complementary transcript as expected is more efficient at reducing translation, and that the antisense transcripts that anneal to the translation start sequence are generally more efficient than the transcripts that anneal to the transcript. downstream coding region.

EXAMPLE 4 Production of Reagent Antibodies for the Analysis of Corn Transformants In order to select the effects of antisense gene expression on the levels of expression of zein in transformed cell lines and plants, polyclonal antibodies reactive with the target a-zeins and with the total zeins were produced. The antigens were extracted and purified as described below before inoculation into rabbits, and subsequent antiserum characterization.

A. Purification of the Antigen Total zeins were obtained by extraction of the corn inbred line BSSS53. In this procedure, 4 grams of dry grains were crushed to a fine powder in a Braun coffee mill, defatted by incubation with 15 ml / g of acetone, with stirring, for 90 minutes at room temperature. The defatted flour was then filtered through a Buschner funnel and allowed to dry. Two extractions were then made with 10 ml / g of 0.5 M sodium chloride; the mixture was stirred at room temperature for 30 minutes before filtering as described above Finally, two extractions were made on the product with 10 ml / g each of 70% ethanol,% BME, for 60 minutes each At room temperature with stirring, the ethanolic extracts, totaling 80 ml, were combined and filtered through a 0.45 micron filter before reducing the volume in a rotary evaporator (Rotovapor R110, Buchi Corp.). 65 ° C, and after about 45 minutes the volume was reduced to 20 ml of solution, which had a cloudy appearance.This solution was diluted to 40 ml with sterile deionized water before freezing and lyophilization. 329 mg, and a 1 mg sample was weighed, resuspended in 1 ml of 70% ethanol, and the protein content was quantified by the Peterson test (Peterson, 1979). The zeins were found to comprise 45% of the dry weight of the sample, and thus about 140 mg of the zein were obtained. Samples containing a range of 2.5 to 25 μg of protein were analyzed for the purity and presence of the expected zein profile, by SDS-PAGE and silver or Coomassie blue staining of the gels (Sambrook et al., 1989). The preparation showed the expected protein profile, with the zeins of 27 kD, 19/22 kD, 16 kD, 15 kD and 10 kD, all present in the expected proportions. This preparation was, therefore, used as the antigen to produce the polyclonal sera against the total zeins. The α-zeins (19/22 kD zeins) were extracted from the seed of the A654 maize inbred line, as follows: 6 grams of dry grains were ground and processed as described above for the total zeins, from the which approximately 500 mg of the lyophilized sample were obtained. After determining the protein content, it was found that the zeins comprised 80% of the dry weight of the sample. To purify the a-zeins from the rest of the zeins, the sample was subjected to preparative SDS-PAGE: 10 mg of sample were weighed, resuspended in 500 μl of sample buffer / 5% MBE, then incubated for 10 minutes to eliminate the aggregates before centrifuging for 30 seconds in the microcentrifuge. Aliquots of 55 μl / band were run on a 3 mm thick gel, with a 4% stacking gel and a 15% separation gel. Extra long plates (25 cm long by 14 cm wide) were used to improve the resolution. After running at 50 mA constant current for 3 hours, the gel was run at 15 mA overnight. The proteins were visualized by staining with cold 0.25 M TCA for approximately 10 minutes. Bands in the 19/22-kD range were then excised and washed in running buffer in SDS gel until the gel pieces appeared clear. This buffer was saved, the gel pieces were transferred to dialysis cutting pipe. molecular weight of 2000. Additional 25 mg of the starting material were processed in this way as well, and all the gel slices were combined before dialysis. The dialysis tubing was sealed with fasteners, and it was. placed in a Biorad ini-sub gel apparatus with clamps or fasteners oriented perpendicularly to the direction of electrophoresis. The SDS run buffer was added to the level of the pipe, and the elution was performed at 10 mA overnight. The electrodes were briefly inverted, then the buffer inside the dialysis bag was combined, with the reserve buffer coming from the initial washings of the gel slices, and dialyzed against 1 liter of deionized water, changing the water five times in several hours. The dialysate was lyophilized, the protein quantified, and then examined for purity by SDS-PAGE and plaque staining. No contaminating protein species were visible, and thus the purified antigen was used to inoculate rabbits for the production of polyclonal antibodies. The total amount of purified α-zein obtained from this procedure was 10.9 mg, resulting in a yield of 31% for the procedure.

B Antigen Preparation and Injection A total of six New Zealand white rabbits were used for antibody production. Three were injected with the purified a-zeins, and the remaining three were injected with the purified total zeins as described below. Two of the six rabbits were treated using the complete and incomplete Freund's adjuvant, traditional, and the remaining four rabbits were treated with a synthetic adjuvant, as described below. Both zeinas, '? as the totals were weighed, resuspended, and heated to 65 ° C to completely solubilize the zeins; 0.5 mg of the purified a-zein or 1.0 mg of the total zein were resuspended in 60 μl of 70% ethanol for each rabbit to be injected. Rabbits 1-3 received total zein as the antigen, and rabbits 4-6 received the purified a-zein antigen. For rabbits 1 and 4 (designated hereinafter, IF and 4F), 440 μl of PBS / Tween (phosphate buffered saline / 2% Tween 80, Sigma) was added to the zein solution, then 500 μl of Freund's complete adjuvant (Sigma) was added and the tubes were vortexed vigorously. The remaining four samples were constituted as follows: at 60 IU of the purified or total zein solution, 50 μl of AVRIDINE (a synthetic Kodak adjuvant) constituted in 100% ethanol up to 140 mg / ml, 760 μl of 10% fat emulsion Intralipid (Travenol), and 300 μl of PBS / Tween. After vortexing, samples were sonicated in a cup sonicator for shots or bursts of 2 to 30 seconds (Ultrasonics, Inc.) to ensure complete emulsion prior to injection. The samples were administered in 100 μl aliquots injected at multiple sites through the back of the animals. The reinforcers were administered every three weeks, following the above procedure for the formulation of injection mixtures, except that incomplete Freund's adjuvant replaced the complete adjuvant for rabbits 1F and 4F. A total of three boosters were administered, in addition to the primary injection. Small-volume bleedings (less than 5 ml) were performed to obtain sera, to verify the antibody titer and specificity during the process. The specificity and the titer of the antisera were made by running the total zeins on SDS-PAGE / Western spotting, as described below. Once the titers were found to be sufficient (reactive at a 1: 1000 serum dilution), several large consecutive bleedings (50 ml) were performed.

C. Analysis of Antisera To determine the immunoreactivity and titer of the antisera, the total zein was evaluated by SDS-PAGE / Western, with dilutions of antiserum tested from 1:50 to 1: 1000. The basic procedure was as follows: 500 ng of the total zein / band were dissolved in 10 μl of sample buffer / 2% BME, 7.5 minutes were emitted, and then loaded onto a 15% minigel (Mini Protean II, .BioRad) with molecular weight markers (BRL) in alternating bands, and run at 200 V for 45 minutes. The stacking gel was removed, and the gel was equilibrated in transfer buffer (0.025 M Tris-HCl, 0.194 M glycine, 20% methanol) for 10 minutes before being superimposed with a prepared membrane (Millipore Immobilon-P). The preparation of the membrane was performed by rinsing with methanol, according to the manufacturer's recommendations, before equilibrium in the transfer buffer. Proteins were transferred at 27 V for 40 minutes in a Genie electromancer (Scientific idea). After transfer, the membranes were rinsed and blocked in 3% BSA / PBS for one hour at 37 ° C on a shaker platform. The membranes were divided into strips by cutting in the bands containing the molecular weight markers, and incubated with 10 ml of test antisera of the appropriate dilution, -all night at 4 ° C, as well as with the control polyclonal antisera directed against the total zein.

After removal of the primary antisera, the membrane strips were washed in lx PBS, for 5 washes of 10 minutes, before incubation with the secondary antibody. The secondary antibody consisted of goat anti-rabbit antibody, conjugated with alkaline phosphatase (Kirkegaard-Perry Laboratories), diluted 1: 1000 in 3% BSA / PBS. After incubating 1 hour at room temperature with shaking, the strips were washed as described above, and the strips were incubated in 4-chloronaphthol (KPL) substrate solution until the color development was complete, about 2-5 minutes. The reactions were stopped by rinsing the strips with deionized water. The results showed that the sera from the six mice showed the expected immunoreactivity profiles. Specifically, sera from 1F, 2 and 3 mice immunostained only the 19/22 kD zeins, and not the other zeins (indicating that the quality of the purified gel antigen was at least as good as predicted by silver staining of SDS-PAGE, since antibody production could actually be a more sensitive measure of contamination with other protein species). In addition, the sera from rabbits 4F, 5 and 6 showed reactivity with all zeins in approximate proportion to the relative amounts of the protein present in the profile, showing light to moderate marking of the 27 kD zein, very strong labeling of the abundant 19/22 kD zeins, moderate labeling of the 16 and 14 kD zeins, and light labeling of the 10 kD less abundant zein. The title of the antisera was also characterized by performing immunolabeling of the spotted ones with dilutions in the range of 1:50 to 1: 1000 (for the last bleeds). Although the lower dilutions of the antisera immunostained the same zeins as the sera corresponding to higher dilutions, the antecedent staining of the membrane was increased at serum dilutions of less than 1: 500. Since the expected immunoreactivity profiles (as discussed above) were obtained at a dilution of 1: 1000, this dilution was used for the subsequent analysis. The test of the sera at dilutions of 1: 2000 and higher, could be indicated if the preservation of the sera is desired, since dilutions greater than 1: 1000 were not tested in these experiments. The total amounts of the sera obtained from the animals were as follows: 40 ml of each of the sera of the rabbits 1, 4 and 6, and 80 ml of each of the sera of rabbits 2, -3 and 5. The last rabbits were chosen for subsequent bleedings because the immunoreactivity profiles appeared to be slightly more specific for the a-zeins in the case of sera from rabbits 2 and 3, what was the serum from the rabbit IF (which may have shown a very slight reactivity with the 10 kD zein), and slightly more reactive with the zein from 10 kD in the case of sera from rabbits 5 and 6 than what was rabbit serum 4F.

EXAMPLE 5 Corn Transformation with the Z10 Promoter Antisense Constructions Type II embryogenic maize cultures were initiated from immature embryos isolated from developing seeds derived from a cross between the genotypes B73 and Al 88 as described in PCT publication WO 95/06128 and in US Patent Application No. 08 / 112,245. Type II cultures were bombarded with microprojectiles with a combination of the plasmid vectors pDPG340 (antisense Z4 DNA sequence of the Z10 promoter, described above), or pDPG380 (antisense DNA sequence A20 of the Z10 promoter, as described above) and pDPG363 which comprises an expression cassette in plants containing the 35S promoter of the Cauliflower Mosaic virus operably linked in the 5 'to 3' order to intron 1 from the corn alcohol dehydrogenase I gene, the bar gene isolated from Streptomyces hi groscopi cus, and the 3 'terminator and the polyadenylation sequences from the nopalin-synthase gene of Agrobacteri um t umefaci ens. Transformed cell lines were selected for resistance to the bialaphos herbicide, conferred by the expression of the bar gene as described in U.S. Patent Nos. 5,489,520, 5,550,318 and PCT publication WO 95/006128. The transformation of corn is further described in U.S. Patent Nos. 5,538,877, 5,538,880 and PCT publication WO 95/06128. The identification of transformed cell lines can be achieved by the use of screened or selectable markers, as described hereinabove. The presence of the antisense DNA sequence in the transformants was verified by the polymerase chain reaction (PCR). The priming sequence of 5 'PCR was TCTAGGAAGCAAGGACACCACC (SEQ ID NO: 5). The sequence of the 3 'PCR primer was GCAAGACCGGCAACAGGATTCA (SEQ ID NO: 6). The PCR reaction produced a DNA fragment of approximately 1.0 kilobase size in the transformants containing pDPG380 and a DNA fragment approximately 1.1 kilobases in size in the pDPG340 transformants. The transformed callus lines containing the antisense DNA sequences operably linked to a Z10 promoter were used to generate plants and seeds. In general, the plants are regenerated as follows. The cells that survive the exposure to the selective agent, the cells that have been classified as positive in a selection test, were cultured in media that support the regeneration of the plants. In an exemplary embodiment, the inventors modified the MS and N6 media (see Table 1 of U.S. Patent Application No. 08 / 594,861) by including additional substances such as growth regulators. A growth regulator, preferred, for such purposes is dicamba or 2, 4-D. However, other growth regulators, including NAA, may be employed; NAA + 2, 4-D or picloram. The improvement of the media in these and in similar ways was found to facilitate the development of the cells at specific stages of development. The tissue was preferentially maintained in a growth regulating medium, until sufficient tissue was available to begin the regeneration efforts of the plants, or after repeated rounds of manual selection, until the morphology of the tissue is adequate for regeneration. , at least two weeks, then transferred to media that lead to the maturation of embryoids. The cultures were transferred every two weeks on this medium. The development of the outbreaks will signal the time to transfer to the medium that lacks growth regulators. Transformed cells, identified by screening or screening and cultured in an appropriate medium that supports regeneration, were then allowed to mature into plants. Developing seedlings were transferred to a mixture of plant growth, without soil, and hardened, for example, in an environmentally controlled chamber at approximately 85% relative humidity, 600 ppm C02, and 25-250 microeinsteins m -2 -i light The plants were preferably matured either in a growth chamber or greenhouse. Plants were regenerated for approximately 6 weeks up to 10 months after a transformant was identified, depending on the initial tissue. During regeneration, the cells were grown on solid media in tissue culture vessels. Illustrative embodiments of such containers were petri dishes and Plant Con®s. The plants in regeneration were preferably developed at approximately 19 ° C to 28 ° C. After the plants in regeneration reached the stage of outbreak and the development of the root, these were transferred to a greenhouse for further development and testing. By providing transgenic, fertile offspring, it can subsequently, through a series of breeding manipulations, move a selective gene from one line of maize to a completely different line of maize, without the need for additional recombinant manipulation. The movement of genes between corn lines is a basic issue in the corn farming industry, which involves simply backcrossing the corn line that has the desired gene (trait or characteristic). The introduced transgenes are valuable because they behave genetically like any other corn gene, and can be manipulated by breeding or cultivation techniques in a manner identical to any other corn gene. Transformants containing the antisense constructs of the Z10 promoter (pDPG340 and / or pDPG380) were crossed into various inbred maize lines, including elite or selected inbred lines designated AW, CN, CV and DD. The zein proteins were extracted from mature grains of a maize plant transformed with the plasmids pDPG340 and pDPG380, and crossed to the inbred individuals AW or CN, according to Tsai. (1980), as follows. 50 mg of ground grain were suspended in 0.5 ml of 70% ethanol, 1% β-mercaptoethanol and extracted at room temperature for 30 minutes overnight. The sample was vortexed, centrifuged at 12,000 rpm for 5 minutes. 50 μl of the supernatant containing the zein proteins was removed and dehydrated. The zein proteins were suspended in 5.0 μl of SDS polyacrylamide gene charge buffer containing 1% β-mercaptoethanol. The protein was separated on SDS-polyacrylamide genes and stained with Coomassie blue. No qualitative differences were observed in the amounts of the a-zein proteins of 19 kD and 22 kD (Figure 5). In addition, the total expression of jprotein in the grain appears to be similar in antisense transformants and untransformed corn lines. We undertook 1 analysis of the amino acid composition of Z10 antisense DNA transformants. The amino acids were extracted from mature grains as described in Jarret et al., 1986; Jones et al., 1983; AACC, 1995). The results are summarized in Table V. The data were made by the t tests and differences were noted between the transformed and untransformed grains, which were significant at the level of p < 0.05 of significance. The transformed and untransformed grains are from the same ear. The level of leucine was only statistically significantly decreased in the transformant DD021. The level of lysine was statistically significantly increased and the level of leucine was significantly statistically decreased in the transformants DD015 and DD018. These results are expected if the expression of the decreased a-zeins in the antisense transformants and the expression of other proteins in the endosperm are increased. The α-zein proteins are rich in leucine residues and therefore it could be expected that in the presence of the reduced expression of α-zein proteins, the level of leucine in the grain could be increased. Similarly, non-zein proteins contain more lysine than zein proteins, and therefore increased expression of non-zein proteins results in increased levels of lysine in the grain. Therefore, the data of the amino acid composition relative to Z10 antisense transformants, is consistent with a slight reduction of a-zein expression and increased expression of non-zein proteins, resulting in diminished levels of leucine and increased levels of lysine in the seed. Similar increases in lysine levels and decrease in leucine levels are observed in the opaque -2 maize mutants in which the zein synthesis is killed and the synthesis of non-zein proteins is increased. Mu mutants -2, however, show other phenotypic differences from wild-type maize (Di Fonzo et al., 1988, Bass et al., 1992).

TABLE V Transformant Lisinaa, b Leucinaa'b Transformed Not transformed Transformed Not transformed DD015 1.96 * 1.75 11.68 13.97 2.13 1.90 1 1.69 * 14.50 DD021 2.40 2.09 15.90"17.90 2.13 2.03 16.97 17.75 DD038 1.96 2.00 12.66 13.89 1.82 1.96 15.87 15.73 DD018 2.74 * 2.43 17.57 19.13 2.30 * 2.15 13.19"15.52 a All amino acid concentrations are expressed as milligrams of amino acid per gram of seed. b The asterisk denotes that the amino acid concentration is statistically significantly different from the concentration of amino acids in an untransformed grain. The t-tests were performed to compare the concentrations of amino acids in transformed and non-transformed isogenic grains. The statistically significant differences are those for which p < 0.05.

EXAMPLE 6 Corn Transformation with Z27 Promoter Antisense Expression Cassettes Corn plants of genotype A188 x B73 were crossed to Hi-II corn plants (Armstrong et al., 1991). Immature embryos (1.2-2.0 mm in length) were excised from ears grown in greenhouse, surface sterilized, from Hi-II, 11 to 12 days after pollination. The Hi-II genotype was developed from an A188 x B73 cross for the high frequency development of type II callus from immature embryos (Armstrong et al., 1991). Approximately 30 embryos were plated per petri dish with the shaft side down in a modified N6 medium containing 1 mg / l 2, 4-D, 100 mg / l of casein hydrolyzate, 6 mM L-proline, 0.5 g / 1 of 2- (N-morpholino) ethanesulfonic acid (MES), 0.75 g / 1 of magnesium chloride and 2% of sucrose solidified with 2 g / 1 of Gelgro, pH 5.8 (Medium # 735). The embryos were cultured in the dark for 2 to 4 days at 24 ° C. Approximately four hours before the bombardment, the embryos were transferred to the previous culture medium with the sucrose concentration increased from 3% to 12%. When the embryos were transferred to the highly osmotic medium, they were arranged in concentric circles on the plate, starting 2 cm from the center of the box, placed so that their coleorrhizal end was oriented towards the center of the box. Two concentric circles are usually formed with 25 to 35 embryos per plate. Gold particles were prepared containing 10 μg of pDPG165 (described in US Pat. No. 5,489,520), and 10 μl of pDPG530. The plates containing embryos were placed in the third shelf from the bottom, 5 cm below the stop mesh or stopping in the bombardment chamber. Discs that break at 77.3 kg / cm2 (1100 psi) were used. Each embryo plate was bombarded once. The embryos were allowed to recover overnight over medium high osmotic strength before the start of the selection. The embryos were allowed to recover on highly osmotic medium (735.12% sucrose) overnight (16 to 24 hours) and then transferred to selection media containing 1 mg / l of bialaphos (# 739, 375 plus 1 mg / l of bialaphos or # 750, 735 plus mannitol 0.2 M and 1 mg / l of bialaphos). The embryos were kept in the dark at 24 ° C. After 3 to 4 weeks on the initial selection plates, approximately 90% of Type II callus embryos had formed and were transferred to selective medium containing 3 mg / l of bialaphos (# 758) The bialaphos resistant tissue was subcultured approximately every two weeks on fresh selection medium (# 758). Transformants were confirmed using PCR analysis to detect the presence of plasmid pDPG530. The PCR primers used to confirm the presence of the antisense expression cassette Z27 in the transformed tissue were as follows: 5 'GCA CTT CTC CAT CAC CAC CAC 3' (SEQ ID NO: 6) and 5"TAT CCC • CTT TCC AAC TTT CAG 3 '(SEQ ID NO: 7). PCR amplification of the transformants pDPG530 and pDPG531 yielded a DNA product of approximately 500 base pairs. The transformants were regenerated as generally described in PCT publication WO 95/06128. The transformed embryo callus was transferred to regeneration culture medium (MS culture medium (Murashige and Skoog, 1962), which contained 0.91 mg / l L-asparagine, 1.4 g / l L-proline, 20 g / 1 of D-sorbitol, 0.04 mg / l of naphthaleneacetic acid (NAA) and 3 mg / l of 6-benzylaminopurine). The cells were grown for about 4 weeks on this culture medium, with a transfer to fresh medium at approximately two weeks. The transformants were subsequently transferred to the MSO culture medium (MS medium without added phytohormones). The regenerated plants were transferred to the soil as previously described in this application. The plants were crossed to corn inbred lines designated AW, CV and DJ. The seeds containing the Z27 antisense expression cassette were of opaque phenotype, similar to the opaque -2 mutant grains. In addition, the seeds resulting from the crossings of antisense transformants Z-27 hemizygous to untransformed inbred individuals, resulted in the segregation of the seeds for the opaque phenotype in correlation with the presence of the antisense expression cassette DNA sequence. Z-27. The zein proteins were extracted from the mature grains of the corn plants transformed with the plasmids pDPG530 and crossed to AW or inbred CVs as follows. Fifty milligrams of ground grain were suspended in 0.5 ml of 70% ethanol, with 1% β-mercaptoethanol and extracted at room temperature for 30 minutes overnight. The sample was vortexed, centrifuged at 12,000 rpm for 5 minutes. 50 μl of the supernatant containing the zein proteins was removed and dehydrated. (The zein proteins were resuspended in 50 μl of SDS-polyacrylamide gel loading buffer containing 1% β-mercaptoethanol, the protein was separated on the SDS-polyacrylamide gels and stained with Coomassie blue. reduced by the a-zeins of 19 kD and 22 kD in five transformants analyzed A polyacrylamide gel stained with Coomassie blue of the pDPG530 transformants and the isogenic controls, is shown in Figure 6. In a transformant, designated KP014, it was also decreased the expression of the 27 kD zein protein, a? -type zein protein, suggesting that the expression of an antisense DNA sequence in a maize, can reduce the expression of a related family of genes, for example, the a- zeins, but also a member of a related family of proteins, for example, the 27 kD zein A similar reduction in 27 kD was observed for the sense DNA sequences (see Figure 10) Isogenic controls were grains in segregation derived from plants lacking the DNA sequences of pDPG530, recovered from crosses of plants transformed with pDPG530 to untransformed inbred individuals. In addition, the expression of total protein in the grain appears to be the largest in antisense transformants than in untransformed corn lines, as evidenced by the staining of the complete protein with Coomassie blue over polyacrylamide gels (Figure 7). The reduction of a-zein synthesis is observed in opaque -2 mutants, but the reduction is much lower than in corn transformants expressing the antisense Z4.

It is contemplated that the antisense repression of the zein protein synthesis in the seed is a result of the reduction of the amount of zein RNA present in the cell, and consequently less synthesis of zein proteins. Northern blot analysis was completed to determine the level of RNA synthesis of zein at rest in the pDPG580 transformants. The procedures for Northern blotting are described in Sambrook et al. (1989). RNA isolated from corn grains 21 days after pollination was separated by agarose gel electrophoresis and spotted onto a Nitrobind membrane. The spot was shaded with the Z4 coding sequence. A spotting analysis of Northern of the transformant KP015 is shown in the Figure 8. The darker signals on autoradiography, for example, bands 3, 9 and 14 (upper panel) and bands 3, 5, 11 and 12- (lower panel), correspond to the non-transformed seeds, which showed a normal level of zein synthesis. Other bands (lighter signals) correspond to the grains that showed reduced levels of zein synthesis and the opaque type in seeds containing the expression cassette. The analysis of the amino acid composition of Z27 antisense DNA transformants was undertaken. The amino acids were extracted from the mature grains derived from three independent transformed lines, as follows. 50 mg of ground maize flour and 1 ml of 6 N HCl were hydrolyzed under argon gas atmosphere for 24 hours at 110 ° C. Samples were diluted to 50 ml and filtered through a 0.45 micron filter. Norvaline was added to each sample as an internal standard before HPLC analysis. The amino acids were separated on a Supelcosil LC-8 HPLC column (Jarrett et al., 1986, Jones et al., 1983, AACC, 1995). The results of the analysis of the simple grains are summarized in Table VI. The data were analyzed by the t tests and differences were noted between the transformed and untransformed grains, which were significant at the level of p < 0.05 of significance. The transformed and untransformed grains are isogenic segregates of a growing or breeding population. Lysine levels were statistically significantly increased in all analyzed grains of KP015 and KP016 transformants, and lysine was increased in four of six grains analyzed from transformant KP014. As expected, leucine levels were decreased in most of the transformed grains that were analyzed. These data demonstrate that the expression of an antisense Z4 DNA sequence in transformed corn kernels causes reduction in the amounts of a-zeins present in the grain. The total protein in the grain that expresses the antisense, does not seem to be reduced. In addition, the decrease observed in a-zeins correlates with the grains transformed with an opaque phenotype.

TABLE VI Transformant Lisinaa'b Leucinaa'b Transformed Not transformed Transformed Not transformed KP014 2.60 * 2.08 13.94 16.85 2.85 * 2.22 15.03 * 17.08 3.09 * 2.40 15.66 18.14 2.94 * 2.45 15.27 * 19.14 2.60 2.56 10.08 14.95 2.45 * 2.08 9.21 10.58 KP015 1.90 * 1.02 3.85 * 7.80 1.92 * 1.02 3.86 * 7.98 1.48 * 0.94 4.44 * 5.87 1.43 * 1.01 4.32 * 6.26 KP016 2.10 * 1.52 8.58 * 1 1.90 2.17 * 1.54 8.95 * 1 1.65 2.66 * 2.03 14.16 * 20.37 2.76 *. 1.81 14.68 * 18.66 4.65 * 2.14 11.01 * 21.32 4.51 * 2.3 1 11.26 * 23.28 3.91 * 2.22 12.96 * 23.99 3.98 * 2.36 13.29 * 24.06 2.47 * 1.76 9.60 * 16.55 2.48 * 1.70 9.70 * 14.83 * Denotes the differences from untransformed grains, which are statistically significant at the confidence level of p < 0.05. The endosperm cells in the corn kernel are comprised mainly of large starch granules and protein sequestered in the protein bodies (Lopes and Larkins)., 1993). Zein proteins are essential for maintaining the structure of protein bodies (Lendind and Larkins, 1989). A reduction in the number of protein bodies present in the endosperm cells derived from an antisense transformant of the Z27 promoter was observed by light microscopy (Figure 9). This observation is further evidence that the synthesis of a-zein was reduced in the antisense DNA transformants of the Z27 promoter.

EXAMPLE 7 Corn Transformation with the Promoter Z27 Sense Expression Cassettes In higher plants, the phenomenon of co-suppression of gene expression has been described (Napoli et al., 1990). Co-suppression refers to the suppression of expression of the endogenous gene by expression of a cassette for transgenic DNA expression. It was contemplated that a cassette of sense zein expression in corn may result in the suppression of endogenous zein expression in a manner similar to that described in Example 6, after expression of an antisense expression cassette. .

The plasmid vector pDPG531 comprises a cassette for expression of the 3 'region of the nopalin synthase of the coding sequence in the Z4 direction of the Z27 promoter. pDPG531 differs from pDPG530 in that the Z4 coding sequence is operably linked to Z27 in the opposite orientation, for example, pDPG531 is capable of being transcribed and translated into the 22 kD zein protein. The plasmids pDPG531 and pDPG165 were introduced into maize cells as described in Example 6. The transformants were selected and regenerated as described in Example 6. The plants were regenerated from three expression cassettes in the Z27-Z4 direction. and crossed to the inbred individuals designated AW, CV and CN. The amount of α-zein proteins present in the Z27-Z4 and non-transformed transformants was compared on polyacrylamide gels stained with Coomassie blue, as previously described, with reference to the analysis of the antisense transformants. The sample preparation and analysis were performed as described in Example 6. Figure 10 shows a polyacrylamide gel stained with Coomassie blue. Each band represents the proteins zeins extracted from a simple seed of a segregating population of the seed transformed with the cassette of untransformed expression and in sense. Lanes 1 through 8 represent seeds derived from the transformant designated KQ012, and lanes 13 through 19 represent seeds derived from a second transformant designated KQ020. Bands 9 to 12 represent unprocessed corn seed. Bands 3, 4, 7, 8, 14 and 15 represent the seed transformed with the expression cassette in sense, in which the a-zein levels are surprisingly reduced to a large extent in a manner comparable to that observed in the transformants antisense In addition to the unexpected reduction in the concentration of the zein protein in the sense transformants, the seed with reduced zein content also showed in general the opaque phenotype, and a reduction in Z27 zein levels. In order to further determine whether the phenotype of the Z4-direction transformants of the Z27 promoter was similar to the antisense transformants, the concentrations of lysine and leucine in the seed derived from individual grains were analyzed. The amino acids were analyzed as described in Example 6. In a transformant, designated KQ018, the levels of lysine and leucine were statistically the same in transformed and non-transformed isogenic seeds. However, in a transformant designated KQ012, lysine levels were statistically increased in the transformant, and leucine levels were statistically significantly decreased in the transformant. It is therefore apparent that the Z27-sense Z4 promoter transformants produce a phenotype of seed morphology, protein composition and amino acids, similar to that observed in antisense transformants.

EXAMPLE 8 Method to Increase the Content of Methionine in Plants A method for increasing the methionine content of the seeds involves cotransformation of the corn tissue culture with a sense or antisense DNA, zein (either A20 or Z4) and a DNA sequence containing a gene encoding a 10 kD zein protein. It is known that 10 kD zein proteins are rich in methionine. A decrease in the expression of zein proteins A20 and / or Z4, combined with an increase in the expression in the zein proteins of 10 kD, is likely to lead approximately at 50% to 300% increases in the total weight percent of methionine in the seed. Sequences of sense or sense DNA containing a DNA sequence complementary or homologous to A20 and / or Z4, have been prepared as described in Examples 2 and 7. Conditions for the successful transformation of maize cell lines with the sense or antisense DNA sequence have been described in Examples 5 and 6. A DNA sequence containing a gene encoding a 10 kD zein protein was prepared as described in US Patent No. 5,508,468. Preferably, a Z10 DNA sequence contains a gene encoding a 10 kD zein protein, including the 3 'non-coding sequence combined with the promoter from a 27 kD zein protein. A plasmid with this DNA sequence has been prepared and is designated pZ27Z10 and is described in U.S. Patent No. 5,508,468. The transformed callus lines, plants and seeds containing a DNA sequence encoding a 10 kD zein protein were prepared as described in Examples 5 and 6. The Met 1 seeds were generated as described in U.S. Patent No. 5,508,468. The expression of the Z10 chimeric gene at the RNA level in Met 1 seeds was also demonstrated. Immature endosperms (21 DAP) were harvested from a segregating ear of the antecedent Metí x A654 BC2. DNA and RNA were prepared from individual endosperm samples. The DNA was analyzed by PCR for the presence / absence of the Z27-Z10 gene. The RNA samples were analyzed by Northern blotting, probed with an oligonucleotide spanning the junction between the Z27 promoter and the Z10 coding region. The results show that the gene is expressed in the endosperm tissue of PCR + seeds and not in that of PCR- seeds. Seeds containing a DNA sequence containing the 10 kD zein protein combined with the 27 kD promoter were field tested.

A total of 130 ears were genotyped by PCR (using DNA from samples of combined leaves of germinated seedlings) and analyzed for methionine content by amino acid analysis, and 10 kD zein levels by ELISA. There is a positive correlation between zein levels of 10 kD and the methionine content in several maize records tested. It is therefore contemplated that if the synthesis of α-zein is reduced by the expression of the sense or antisense zein constructs, the expression of a transgenic 10 kD zein will increase the methionine content of a seed. The results indicate that if it is possible to express the expression of the 10 kD zein at least about 5 to 10 times, the methionine contents in the corn grain can be significantly elevated (up to 2.5 to 3%). Additional transformants with the 10 kD zein functionally linked to the 27 kD zein promoter, Z4 zein promoter of 22 kD and / or to the 10 kD zein promoter, which show high levels of the 10 kD zein and methionine in transformed seeds, have also been generated as described above and in U.S. Patent No. 5,508,468. The corn tissue cultures are cotransformed with a sense or antisense DNA sequence and a DNA sequence of the 10 kD zein, and a selectable marker gene. Transformed cell lines containing both DNA sequences are identified by PCR analysis. The transformed cell lines, positive for PCR analysis for the antisense DNA sequences and the 10 kD zein, are used to regenerate transformed plants and seeds, as described in Example 6. The seeds were analyzed for the expression of the zein of 10 kD and Z4 (22 kD) using Western spotting. The total methionine content of the seed is determined as described in Examples 5 and 6. An increase in zein expression of 10 kD, combined with a decrease in zein protein A20 and / or Z4 results in an increase significant (up to about 5 to 300%) in the total methionine content of the seed.

EXAMPLE 9 Method to Increase the Content of Amino Acids, of Particular Amino Acids in Seed The content of amino acids in seeds is increased by the expression of a gene encoding a synthetic polypeptide comprising one or more amino acids for which altered levels are desired in the seed. The amino acid content is altered by the expression of a gene encoding a polypeptide of natural or synthetic origin, comprising one or more desired amino acids, in a seed in which the expression of seed storage proteins has been repressed, endogenous, by the expression of a DNA sequence of the seed storage protein, in sense or antisense. For example, a gene encoding the synthetic protein MB1 is introduced into a plant in which the storage protein synthesis is repressed by the expression of a sense or antisense DNA sequence. The MBl coding sequence is introduced into a transgenic plant with reduced expression of the storage protein, wherein the plant was previously transformed with a sense or antisense DNA sequence of the storage protein. Alternatively, the MBl sequence is transformed into a plant simultaneously with a sense or antisense DNA sequence of the storage protein. In a preferred embodiment of the present invention, a cassette of antisense expression or in the sense of the storage protein, and an expression cassette of MB1 are transformed into maize simultaneously or sequentially as described in Examples 5, 7 and 8. A plasmid vector, designated pDPG780, which contains a vegetable expression cassette MBl, was constructed. The coding sequence of the MBl protein was obtained from Mary A. Hefford (Center for Food and Animal Research, Agriculture and Agri-Food Canada, Ottawa, ON K1A OC6, Canada) and the DNA sequence is described in Beauregard et al. 1995. MBl is a synthetic protein enriched in methionine, threonine, lysine and leucine, and shows the a-helical structure similar to a zein protein. The plasmid vector pDPG780 was constructed by the operable linkage of a signal sequence from the endoplasmic reticulum (Pedersen et al., 1986) from a gene coding for the 15 kD zein protein, 5 'to the coding sequence of MBl. The MBl sequence of the 15 kD zein was inserted into the plasmid vector pZ27-nos between the Z27 promoter element and the 3 'region of the nopalin-synthase (nos.) The expression cassette comprises, in the 5' orientation 3 ', the Z27 promoter, the Z15 signal sequence, the MB1 coding sequence, and the 3' nos region.Anyone skilled in the art could construct additional plasmid vectors containing a seed-specific promoter, operably linked to a signal sequence of the endoplasmic reticulum, the coding sequence of the protein, and the 3 'region, wherein said sequence encoding the protein comprises a DNA sequence encoding a protein of the desired amino acid composition. The plasmid vector pDPG780 is introduced into maize in conjunction with a vector comprising a selectable marker gene, for example, pDPG165 comprising the bar gene. The MBl expression cassette is transformed into maize plants containing a transgene of sense or antisense zein, in which the synthesis of a-zein proteins is repressed. Alternatively, the sense or antisense zein construction is transformed into the corn, simultaneously with the MBl expression cassette. The plants are regenerated as described in Examples 5, 6 and 7. The composition of the seed protein is analyzed by polyacrylamide gel electrophoresis, as described in Examples 5 and 6. The reduction in zein proteins is observed, and the expression of a protein in the desired amino acid composition is also observed. The amino acid composition of the seed is determined as described in Examples 5, 6 and 7. The desired amino acid levels are altered according to the amino acid composition of the protein encoded by the transgene. While the present invention has been described in connection with the preferred embodiment thereof, it will be understood that many modifications will be readily apparent to those of skill in the art, and this application is intended to cover any adaptations. or variations thereof.

REFERENCES CITED Altenbach, SB, Pearson, KW, Meeker, G., Staraci, L. C, Sun, SSM 1989. Pl ant Mol ecul ar Bi olgy 13: 513-522 Enhancement of the methionine content of seed proteins by the expression of a chimeric gene encoding a methionine-rich protein in transgenic plants.

American Association of Cereal Chemists. 1995. Approved Methods. Vol. 1. 9th edition.

An, G. 1987. Methods in Enzymol ogy. 153: 292.

Armstrong, C.L., Green: C.E., & Phillips, R. L. 1991.? Faize Geneti cs Coopera ti on Newsl et ter. 65: 92-93. Development and availability of germplasm whit high Type II culture formation response.

Bass, H. W., Webster, C, O'Brian, G. R, Roberts, J. K. M. Boston R. S. 1992. Pl ant Cel l. 4: 225-234. A Maize Ribosome-Inactivating Protein Is Controlled by The Transcriptional Activator Opaque -2.

Beauregard, M., Dupont, C, Teather, R.M. Hefford, M.A. 1995. Bi o / Technolgy. 13: 974-981. Design, Expression, And Initial Characterization Of MBl, To De Novo Protein Enriched In Essential Amino Acids.

Bevan M., Barnes W. M., Chilton, M.D. 1983. Nucl ei c Aci d Research. 11: 369-385. Structure and transcription of the Nopaline synthae gene of T-DNA.

Brandle, J. E., McHugh, S. G., James, L., Labbé, H., and Miki, B.L. 1995. Bi o / Technol ogy. 13: 994-998. Instability of Transgene Expression in Field Grown Tobacco Carrying the csrl-I Gene for Sulfonylurea Herbicide Resistance.

Chandler V. L., Radicella, J. P., Robbins P. P., Chem J., and Turks, D. 1989. Th e Pl an t Cell. .1: 1175-1183. Two Regulatory Genes of the Maize Anthocyanin Pathway are Homologous: Isolation of B Utili zi ng R Genomi c Sequences. . ._ Christou, P., Murphy, J. E., & Swain, W. F. 1987. PNAS. 84: 3962-3966. Stable transformation of soybean by electroporation and root formation. from transformed callus.

Coe, E. H., Neuffer, M.G., and Hoisington, D.A. 1988. In Corn and Corn Improvement, eds. Sprague, G. F. & Duddley, J. W. (Am. Soc. Agron., Madison, Wl), pp. 81-258.

Coruzzi, G., Broglie, R., Edwards, C. & Chua, H._ H. 1971. EMBO J. 3: 1671. Tissue-specific and light-regulated expression of a nuclear pea gene encoding the small subunit of ribulose-1, 5-bisphosphate corboxylase.

D'Halluin, K., Bonne, E., Bossut, M., De Beuckeleer, M., and Leemans, J. 1992. Th e Pl ant Cell. 4: 1495-1505. Transgenic Maize Plants by Tissue Electroporation.

Dale, N, 1996. Feedstuffs Reference Issue. 68: 24-31 Dekeyser, R., Claes, B., De Rycke, R.M. U., Habets, M.E., Van Montague, M.C., & Caplan, A. B. 1990. Th e Pl an t Cell. 2: 591-602. Transient Gene Expression in Intact and Organized Rice Tissues Dellaporta, S., Greenblatt, BJ, Kermicle, J., Hicks, JB, Wessler, S. 1988. In: Chromosome Structure and Function: Impact of New Concepts, 18th Stadler Genetics Symposium, Jp. P. Gustafson and R. Appels, eds. (New York: Plenum Press) pp. 263-282.

DiFonzo, N., Hartings H., Brembilla, M., Motto, M., Soave, C, Navarro, E., Palau, J., Rhode, W. And Salamini, F. 1988. Mol. Gen Genet 212: 481-487, The B-32 Protein From Maize Endosperm, An Albumin Regulated By The 02 Locus: Nucleic Acid (cDNA) And Amino Acid Sequences.

Ebert, P. R. Ha, S. B., An G. 1987, Proc Na ti. Acad. Sci. USES. 84: 5745-5749. Identification of an essential upstream element in the nopaline synthase promoter by stable and transient assays.

Flavell, R. B. 1994. Proc. Na ti. Acad. Sci. USES . 91: 3490-3496. Inactivation Of Gene Expression In Plants As A Consequence Of Specific Sequence Duplication.

Fromm, M.E., Morrish, F., Armstrong, C, Williams, R., Thomas, J. And Klein, T.M. 1990. Bi o / Technol ogy. 8: 833-839. Inheritance And Expression Of Chimeric Genes In The Progeny Of Maize Plants.

Geraghty, D. E., Messing, J., Rubinstein, I. 1982. EMBO J. 1: 1329. Sequence Analysis And Comparison Of cDNAs Of The Zein Multigene Family.

Gordon-Kamm, WJ, Spence, TM, Mangano, ML, Adams, TR, Daines, RJ, Start, WG, O'Brien, JV, Chambers, SA, Adams, Jr., WA, Willetts, NG, Rice, TB , Mackey, CJ, Krueger, RW, Kausch, AP, & Lemaux P. G. 1990. Th e Pl an t Cell. 2: 603-618. Transformation of Maize Cells and Regeneration of Fertile Transgenic Plants.

Hansel, L.W., Tsai, C.Y., Nelson, O. E. 1973, Cereal Chem. 50: 383. The Effect Of The Floury-2 Gene On The Distribution Of Protein Fractions And Methionine In Maize Endosperm.

Hayashimoto, A., Li, Z., Murai, N. 1990. ' Pl ant Physi ol. 93: 857-863. A Polyethylene Glycol-Mediated Protoplast Transformation System for Prpduction of Fertile Transgenic Rice Plants.

Heidecker, G. And Messing, J. 1986. Ann Rev Pl an t Physi ol. 37: 439-466. Structural Analysis Of Plant Genes.

Hinchee, M.A. W., Connor-Ward, ^ D.V., Newell, C.A., McDonell, R.E., Sato, S.J., Gasser, C.S., Fischhoff, D.A., Re, C.B., Fraley, R.T., Horsch, R.B. 1988. Bi o / Technolgy. 6: 915-922. Production of Transgenic Soybean Plants Using Agrobacterium-Mediated DNA Transfer.

Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers, S.G. and Fraley, R.T. 1985. Sci ence. 227: 1229-1231. A Simple And General Method For Transferring Genes Into Plants.

Hu, T.-T., Peifer, M.A., Heidecker, G., Messing, J., Rubenstein, J. 1982. EMBO J. 1: 1337. Primary Structure Of A Genomic Zein Sequence Of Maize.

Hudspeth, R. L., and Gruia, J. W., 1989. Pl ant Mol ecul ar Bi olgy. 12: 579-589. Structure and expression of the maize gene encoding phosphoenolpyruvate carboxylase isozyme involved in C4 photosynthesis. Ikuta, N., Souza, M. B. N., Valencia, F. F., Castro, M. E. B., Shenberg, A. C. G. Pizzirani-Kleiner, A., Astolfi-Filho, S. 1990. Bi o / Technol ogy. 8: 241-242.

The a-amylase gene as a marker for gene cloning: Direct sreening of recombinant clones.

Jarrett, H. W., Cooksy, K. D., Ellis, B., and Anderson J. M. 1986. Analytical Biochemistry. 153: 189-198 The Separation of a-Phthalaldehyde Derivatives of Amino Acids by Reversed-Phase Chromatography on Octylsilica Columns.

Jefferson, R. A. 1987. Plant Molecular Biol ogy Repórter. 5: 387-405 Assaying Chimeric Genes In Plants: The GUS Gene Fusion System.

Jones, R. A. 1978. Biochem. Genet 16:27. Effects Of Fl oury-2 Locus On Zein Accumulation And RNA Metabolism During Maize Endosperm Development.

Jones, R. A., Larkins. B.A., Tsai, C. Y. 1977. Plant Physiol. 59: 525. Storage Protein Synthesis In Maize II. Reduced Synthesis Of A Major Zein Component By The Opa That -2 Mutant Of Maize.

Jones, B. N. And Gilligan, J. P. 1983, Journal of Chromatography. 266: 471-482 O-Phthalaldeyde Precolumn Derivatization and Reversed-Phase High-Performance Liquid Chromatography of Polypeptide Hydrolysates and Physiological Fluids.

Katz, E., Thompson, C.J., Hopwood, D.A. 1983, J. Gen Microbiol. 129: 2703-2714. Cloning and expression of the tyrosinase gene from Streptomyces antibi oti cus in Streptomyces lividans.

Keller, B., Schmid, J., and Lamb, C. J. 1989. EMBO J. 8: 1309-1314. Vascular Expression of A Bean Cell Wall Glycine-Rich Protein: ß-Glucuronidase Gene Fusion In Transgenic Tobacco.

Kiribara, J.A., Hunsperger, J.P., Mahoney, W.C., Messing, J. 1988. Mol. Gen Gene t. 211: 477 -484.

Lawton, M.A., Tierney, M.A., Nakamura, I., Anderson, E., Komeda, Y., Dube, P.Hoffman, N., Fraley, R.T., Beachy, R.N.987. Pl an t Mol ecul ar Bi olgy. 9: 315-324. Expression of a soybean ß-conclycinin gene under the control of the Cauliflower Mosaic Virus 355S and 19S promoters in transformed petunia tissues.

Lending., C. R., and Larkins, B. A. 1989. Plant Cell. 1: 1011-1023. Changes in the Zein Composition of Protein Bodies during Maize Endosperm Development.

Lopes, M. A. And Larkins, B. A. 1993. Pl an t Cel l. 5: 1383-1399. Endosperm Origin, Development And Function.

Lopes, M. A. And Larkins, B. A. 1991, Crop Sci ence. 31: 1655-1662. Gamma-Zein Content Is Related to Endosperm Modification in Quality Protein Maize.

Matzke. M. A. And Matzke, A.J.M. 1995. Pl ant Physi o. 107: 679-685. How And Why Do Plants Inactivate Homologous (Trans) Genes? McCabe, D.E., Swain, W.F., Matinell, J.B., Christou, P. 1988. Bio / Technology. 6: 923-926. Stable Transformation Of Soybean (Glycine Max) By Particle Acceleration.

McElroy, D., Zhang, W., Cao, J., & Wu R. 1990. Th e Pl an t Cell. 2: 163-171, Isolation of an Efficient Actin Promoter for Use in Rice Transformation.

Mertz, E.T., Bates, L.S., and Nelson, 0. E. 1964. Sci ence. 145: 279-280. Mutant gene that protein composition and increases lysine content of maize endosperms.

Messing, J., Geraghty, D., Heidecker, G., Hu, NT, Kridl, J. Rubenstein, I. 1983. in Gene ti c Engineering of Pl an ts, Kosuge, T. Meredith, CP, and Hollaender, A., eds. Plenum Press, NY. 211-227. Plant Gene Structure.

Misra, P. S., Jambunathan, R., Mertz, E. T., Glover, D.V., Barbosa, H.M., McWhirter, K.S. 1972. Sci ence. 176: 1425. Endosperm Protein Synthesis In Maize Mutants With Increased Lysine Content.

Murakami, T., Anzai, H., Imai, S., Satoh, A., Nagaoka, K., Thompson, C.J. 1986. Mol. Gen. Genet. 205: 42-50. The bialaphos biosynthetic genes of Streptomyces hygroscopi cus: Molecular cloning and characterization of the gene cluster.

Murashige, T. And Skoog, F. 1962. Physiol. Plant. 15: 473-497. A Revised Medium For Rapid Growth And Bioassays With Tobacco Tissue Cultures.

Napoli, C, Lemieux, C, Jorgensen, R. 1990. Pl ant Cell. 2: 279-289. Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in trans.

Niedz et al. 1995. Plant Cell Reports. 14: 403.

Odell, J.T., Nagy, F., Chua, N.H. 1985. Na ture. 313: 810-812. Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter.

Ow, D. W., Wood, K.V., DeLuca, M., de Wet, J.R., Helinski, D.R., Howell, S.H. 1986, Sci ence. 234: 856-859.

Paulis et al. 1978. Cereal Chem. 55: 705 Origin Oh High Methionine Content In Sugary-I Corn Endosperm.

Pedersen, K., Argos, P., Naravana, S.V.L., Larkins, B.A. 1986. J. Biol Chem. 261: 6279-6284 Sequence And Characterization Of A Maize Gene Encoding A. High-Sulfur Zein Protein Of M-15,000.

Peterson, G. L. 1979. Analytical Biochemistry. 100: 291-220.

Potrykus, I., Saul, M.W., Petruska, J., Paszkowski, J., Shillito, R.D. 1985. Mol Gen. Genet. 199: 183-188. Direct gene transfer to cells of a graminaceous monocot.

Potrykus I. 1989. Trends Biotech. 7: 269-273.

Prasher et al. 1985. Biochem. Biophys. Res. Comm. 126: 1259-1268.

Rodermel, S.R., Abbott, M.S., Bogorad, L. 1988. Cell. 55: 673-681. Nuclear-Organelle Relationships: Nuclear Antisense Gene Inhibitis Ribulose Bisphosphate Carboxylase Enzyme Levéis In Transform.ed Tobacco Plants.

Rubenstein, J. L. R. 1982. in Maize for Biological Research, W. F. Sheridan, ed., U. Of N. Kakota Press.

Pp. 189-196. The Zein Multigene Family. Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989.

Molecular Cloning: A Laboratory Manual. 2nd Edition (Cold Spring Harbor, NY: Cold Spring Harbor Press).

Sengupta-Gopalan, C, Reichert, N.A., Barker, R.F., Hall T. C, Kemp, J. D. 1985. Proc. Na ti. Acad. Sci. USES . 83: 3320-3324 Developmentally regulated expression of the bean β-phaseolin gene in tobáceo seed.

Stalker, D.M., McBride, K.E., and Malyj, L. 1988. Sci ence. 242: 419-423. Herbicide Resistance in Transgenic Plants Expressing a Bacterial Detoxification Gene.

Stiefel, V., Ruiz-Avila, L., Raz, R., Valles, M P., Gómez, J., Pages, M., Martínez-I zquierdo, JA, Ludevid, MD, Langdale, JA, Nelson, T. And Puigdomenech, P. 1990. The Pl ant Cel l. 2: 785-793. Expression Of A Maize Cell Wall Hydroxyproline-Rich Glicoprotein Gene In Early Leaf And Vascular Differentiation.

Sullivan, T. D., Christensen, A. H., and Quiail, P. H. 1989. Mol. Gen. Genet. 215: 431 Isolation and characterization of a maize chlorophyll a / b binding protein gene that produces high levéis of mRNA in the dark.

Sutcliffe, J. G. 1978. Proc Nati. Acad. Sci USA. 75: 3737-3741. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322.

Thillet, J., Absil, J., Stone, S.R., & Pictet, R. 1988. J. Biol Chem. 263: 12500-1208. Site-directed Mutagenesis of Mouse Dihydrofoíate Reductase.

Tsay, C. Y. 1980. Cereal Chem. 57: 288-290. Note On The Effect Of Reducing Agent On Zein Preparation.

Tsai et al. 1978. Biochem. Genet 16: 883. Interaction Of The Opaque-2 Gene With Starch-Forming Mutant Genes On The Synthesis Of Zein In Maize Endosperm.

Twell, D., Klein, T.M., Fromm, M.E., and McCormick, S. 1989. Plant Physiol. 91: 1270-1274. Transient Expression Of Quimeric Genes Delivered Into Pollen By Microprojectile Bombardment. van der Krol, A.R., Lenting, P.E., Veentra, J., van der Meer, I.M., Joes, R.E., Gerats, A.G.M., Mol J.N.M. and Stuitje, A.R. 1988c, Nature 333: 866-869. An anti-sense chalcone synthase gene in transgenic plants inhibits flower pigmentation. van der Krol, A.R., Mol, J.N. M. & Stuitje, A. R. 1888a. Biotechniques. 6: 958-976. Regulation Of Eukaryotic Gene Expression By Complementary RNA Or DNA Sequences: An Overview. van der Krol, A.R., Mol, J.N. M. & Stuitje, A. R. 1988b. Gene. 72:45. Antisense Genes In Plants: An Overview.

Walker, J.C., Howard, E.A., Dennis, E.S., and Peacock, W.J. 1987. Proc. Nati Acad. Sci. USES. 84: 6624-6628. DNA Sequences Required for Anaerobic Expression of Maize Alcohol Dehydrogenase 1 Gene.

Walters, D.A., Vetsch, C.S., Potts, D.E., & Lundquist, R.C. 1992. Plant Molecular Biology. 18: 189-200. Transformation and inheritance of a hygromycin phosphotransferase gene in maize plants.

Wang et al. 1992. Mol Cell. Biol. 12: 3399 Yang, N. S. and Russell, D. 1990. Proc. Nati Acad. Sci. USA. 87: 4144-4148. Maize Sucrose Synthase-1 Promoter Directs Phloem Cell-Specific Expression of Gus Gene In Transgenic Tobacco Plants. Zukowsky- 1983. Proc Nati. Acad. Sci. USES. 80: 1101.

LIST OF SEQUENCES (1. GENERAL INFORMATION (i) APPLICANT: DEKALB Genetics Corporation (ii) TITLE OF THE INVENTION: METHOD FOR ALTERING THE NUTRITIONAL CONTENT OF PLANT SEEDS (iii) NUMBER OF SEQUENCES (iv) DOMICILE FOR CORRESPONDENCE: (A) RECIPIENT: Schwegman, Lundberg, Woessner & Kluth, P.A. (B) STREET: P.O. Box 2938 (C) CITY: Minneapolis (D) STATUS: MN (E) COUNTRY: United States (F) ZIP CODE: 55402 (V) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible Disk (B) COMPUTER: Compatible with IBM (C) OPERATING SYSTEM: DOS (D) SOFTWARE: FastSEQ Version 2.0 (vi) CURRENT REQUEST DATA: ( A) APPLICATION NUMBER: Unknown (B) SUBMISSION DATE: 09 / DEC / 1997 (C) CLASSIFICATION: (vii) DATA FROM THE PREVIOUS APPLICATION: (A) APPLICATION NUMBER: 08 / 763,704 (B) DATE OF SUBMISSION: 09 / DEC / 1996 (A) APPLICATION NUMBER: 08 / 112,245 (B) DATE OF SUBMISSION: AUGUST 25, 1993 (A) APPLICATION NUMBER: 07 / 508,045 (B) SUBMISSION DATE: ll / APR / 1990 (A) APPLICATION NUMBER: 07 / 467,983 (B) DATE OF SUBMISSION: 22 / JAN / 1990 (viii) ATTORNEY / AGENT INFORMATION: (A) NAME: Woessner, Warren D (B) REGISTRATION NUMBER: 30,440 (C) REFERENCE NUMBER / CASE: 950.011WO1 (ix) 'INFORMATION FOR TELECOMMUNICATION: (A) TELEPHONE: 612-339-0331 (B) FAX: 612 - 339-3061 (C) TELEX: (2) INFORMATION FOR SEQ ID NO: 1 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 921 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomic RNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO AAñAUCUGGA AAPG lAACsU CUUAUUUCUG GUsGOCCACA TB-CftXJCAACC AUAUUAU? iA 60 GACCA? CAI-3 C-AACAOAGAA AGOOGAAUCC AOTAGCAACA ACAGAGCAAC AAUGGCGACC X20 AAGAXJ? .UUUU CCC CCUD3_s GC? CCOUGCU C'UUUCUUCA? CJUUU UGCVI To CGCGACAAsp XTO UUCCC. CAAO GCsCACAAGC pccaAUAGcu ucccuocuoc CCCCAOACCs OCCKU ??? XJG 240 A? AGCUUCAG? AOSUGAAAA CCCAGCUCDU CAGCCCOA? A GGCUCCAACA AGCAA? CGCA 300 GCAAG..AACA tDVC UUUA C ACCCUUUUUG ssu AACAAU GCCAGCCCs ADC? U? GGUG 360 CAG Cf-DsGG U3-CAAACCAU CAGG JCACAG CAG cps AGO AACDCGUGCs ACCTJG? GA? C 420 AACCA..S ?? G CsCUGGGAAA CCWJU JCCC PACOCUCAGC AACñACAAUs UC UCCAIJ? C 480 AAc__R_ _cuss CUACACUGAA cccüGcsGca ÜA? D? GCAGC AACAACXDV? U ACXAUUCAGC 540 CAGCTT _GCOA CTJGCC? ACUC sCAGCAACAA GAACOUC? DC CALTUUAACCA. AX? JGGCCGCA SOO CCT? AA CCCG C? GCUUAUUU GCAGCAGCAA A? AC? AC? AC CAUO-JAGCCA GCOAGCUGCA eeo GCAAA '.' CGTJG cpuccuacuD GACACAGCAA CAGUUGCTJGC CUU-J 'UACCA QCAG UUGCG 720 GC? A? __- CCCG CAACCCTTCU? ACAAC? ACAA CAAUUt? JUGC CCUUUüUCCA AUUUGCUUUG 700 ACAGA'-CCAG CGGCC? CCUA CCAACAACAC ATTCAUaGGDG GsGCC U UU OUAG psGcp - T40 TOVUUAÍÍÜUGU AAtjsCAAUAA? AAAGUODO? tJGGAUGAUGU AUCGOGGCCAA CCAGAAAPAA 900 G? AGÜ 'ACAU UUCCAÍ-ADDU ü 921 (2) INFORMATION FOR SEQ ID NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1364 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomic RNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 CGAGG.?A??C UUUAAACCGA trpAIJUACACA AUUUAACCAC ACUAAAA.JUA ACATDGÍDGA eo AÜCGCaCCAU (3AU UUUUU-. ÜAGUGCAAAA UAGCCAAACC AAGCAAAACA PAPGPGGCQA X20 UCGUC? CA A UGUsUAAAGG PAPPGCAOC? CACCAUUGUC ACCCAOGOAU ÜOQGACAAOA 180 CCGACftGGAA AAACC? O? A UUUAUUUCJAP UUUA? CAAGU POAPCPPGCs? ACGÜ OAAA 240 U? A-D-ACCCA ACAAAGUAAU CACtrAAATT.Tl7 CAAAACCAAC ÜAGAHACCAP GU AUCUCUA 300 C UUACTCI JA JA CsAAT? AUUCU UUUl-GCAAAA UCGAAAA ??? ADCUPGCACA. AGCACAAGGA. 360 CpC _? _ AUGDG UATrn Aiuaic UC? JUAGA ?? A GUAGAUAAPA PAOCGCACAP A-JOA? UGAGA 420 CCAAC? AGCA ACAUACAAAG CACAAPAUUC- UACCAAUAAs GGCAGGCAAA APAUUUUCCC 460 • DCAtTcAtrGCU CCXTCJ G? CUU UUUCCAAG? G csscuACGGc GAGCAuuuuC CCGCAAOGCD 5 0 CACA? GCUCC tJAUAGCOsCC cupcppcccc CAUACCPCUC ACCAGCGAPG PC? UCAGPAP 600 G-TGA-J-AUCC AAUUCIT? COA CCCUACAGOA UCCAACAGGC AAUCGCAGCA GGCAiJCUUAC 660 _! UUU./ 7CAC.C OUUuU.J_.COC CAACAAPCAU CAGC_.CCA.TKJ A AGCAÜU A CCPPUGGPGC 720 AUUUA? GGC ACAAAACAUC AQOGCACAAC AACUAGAACA ACPCGPGC? A GCAAAL.VUUG 780 cuGcccAcsc ÜCAG AACAG 3VGUOJVCCUO? GGOGCAIJUU GUUUGCACAA AACAPCAGGG 840 CACAAC.?Ct. ACAACAACOC G? GC? AGCAA ACCUUGCOGC CTJACPCPCAG CAACAACAGU 5) 00 uscosc _? -rs CAACCA? C? A GCUGCAU? GA ACTCÜGCUOC UUAUUUUCAG CAACAACAAC 960 XJACDACCAUU CAGCCAGCUA GCOGCOGCCO ACCCCCGGCA AUUUCUUCCA UDCAACCAAC X020 __GG__A (_.._ ACrs GLAACUCUCA? GCPPAPG? AC AACAACAACA AC? AC? ACCA UUCAGCCAGC 1080 OAGCDGCTGU GAGCCC? GCT GCCUUC0OGA C? CAGCAACA UUUUUUGCCG UUCUACCDGC 1X40 ACACUGOGCC PAACGPPGGC ACCCPCUÜAC AACPGCAACA ADUGCUGCCA XJU-GACCAAC 1200 Tjs CÜO.JGAC AAACCCAGCA GU ULUUACC AACAACCCAP CAUU'ü? U GP GCCCU UUUU 1260 UGA UUAUAG PDCAAPAAtIA AAGsssuDüü PGCUGAOAPU ÜGPGGCCPCC 1320 CAGAAA AAG AAAGUA__Atpi tTCDAGAUUCU? A? GUU UUC OATP X364 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3 GACCAACAAG CAACATAGA 19 (2) INFORMATION FOR SEQ ID NO: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: AGCAGCAGGG TTCAGTGTAG ACA 23 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5 TCTAGGAAGC AAGGACACCA CC 22 (2) INFORMATION FOR SEQ ID NO: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO GCAAGACCGG CAACAGGATT CA 22 (2) INFORMATION FOR SEQ ID NO: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO GCACTTCTCC ATCACCACCA C 21 (2) INFORMATION FOR SEQ ID NO: 8 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 8 TATCCCCTTT CCAACTTTCA G 21 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims (96)

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. An expression cassette comprising a preselected DNA sequence encoding an RNA molecule operably linked to a functional promoter in a host cell, characterized in that the RNA molecule is substantially complementary to all or a portion of an mRNA encoding a storage protein in plant seed.

2. An expression cassette comprising a preselected DNA sequence encoding an RNA molecule operably linked to a functional promoter in a host cell, characterized in that the RNA molecule is substantially idenl to all or a portion of an mRNA encoding a storage protein in plant seed.

3. The expression cassette according to claim 1 or 2, characterized in that the storage protein in plant seed is a storage protein in maize seed.

4. The expression cassette in accordance with - claim 3, characterized in that the storage protein in corn seed is an α-'zein protein.

5. The expression cassette according to claim 1 or 2, characterized in that it also comprises a selectable marker gene.

6. The expression cassette according to claim 1 or 2, characterized in that it also comprises plasmid DNA.

7. The expression cassette according to claims 1 or 2, characterized in that the promoter. It is a functional promoter during the development of the seed of the plant.

8. The expression cassette according to claim 1, characterized in that the promoter comprises the 10 kD zein promoter.

9. The expression cassette according to claim 1, characterized in that the promoter comprises the 27 kD zein promoter.

10. The expression cassette according to claims 1, 8 or 9, characterized in that the preselected DNA sequence encodes an RNA molecule that is substantially complementary to all or a portion of mRNA for a 19 kD a-zein protein.

11. The expression cassette according to claims 1, 8 or 9, characterized in that the preselected DNA sequence encodes an RNA molecule that is substantially complementary to all or a portion of mRNA for a 22 kD a-zein protein.

12. The expression cassette according to claims 2, 8, 9, characterized in that the preselected DNA sequence codes for an RNA molecule that is substantially idenl to all or a portion of mRNA for a 19 kD a-zein protein.

13. The expression cassette according to claims 2, 8 or 9, characterized in that the preselected DNA sequence codes for an RNA molecule that is substantially idenl to all or a portion of mRNA for a 22 kD a-zein protein.

14. The expression cassette according to claims 2 or 9, characterized in that the preselected DNA sequence encodes MBl.

15. The expression cassette according to claim 1 or 2, characterized in that it further comprises a preselected DNA sequence that codes for the hardness of the grain.

16. A method for increasing the weight percentage of at least one amino acid that is essential for the diet of animals in plant seeds, characterized in that it comprises: a) Stably transforming the plant cells with an expression cassette comprising a sequence of pre-selected DNA encoding an RNA molecule operably linked to a functional promoter in the plant cell, to produce a transformed plant cell, wherein the RNA molecule is substantially idenl, or complementary, to all or a portion of an mRNA that code for a seed storage protein; b) the regeneration of the transformed cells in a fertile transgenic plant, which produces seeds, in which the preselected DNA sequence is expressed in the seeds in an amount sufficient to decrease the percentage by weight of the storage protein in seed with relation to the percentage by weight of the seed storage protein present in the seeds of a corresponding non-transgenic plant; and c) the recovery of the transgenic seeds of the transgenic plant.

17. A method for increasing the weight percentage of the starch in a seed, characterized in that it comprises: a) Stably transforming the plant cells with an expression cassette comprising a preselected DNA sequence encoding an RNA molecule operably linked to a promoter functional in the plant cell, to produce transformed plant cells, wherein the RNA molecule is substantially identical, or complementary, to all or a portion of an mRNA that codes for a seed storage protein; b) the regeneration of the transformed cell into a fertile transgenic plant, which produces seeds, in which the preselected DNA sequence is expressed in an effective amount to decrease the production of the seed storage protein, to increase the percentage in weight of the starch in v the transgenic seed, on the weight percentage of the starch present in the corresponding non-transformed seed; and c) the recovery of transgenic seeds.

18. A method for increasing the starch extraction capacity of a seed, characterized in that it comprises: a) Stably transforming the plant cells with an expression cassette comprising a preselected DNA sequence encoding an RNA molecule operably linked to a promoter functional in the plant cell, to produce transformed plant cells, wherein the RNA molecule is substantially identical, or complementary, to all Q a portion of an mRNA that codes for a seed storage protein; b) the regeneration of the transformed cell in a fertile transgenic plant, which produces seeds, in which the preselected DNA sequence is expressed in an amount effective to decrease the production of the seed storage protein, to increase the capacity of extraction of starch from the transgenic seed on the extraction capacity of the starch "of the non-transformed seed, corresponding, and c) the recovery of the transgenic seeds.

19. A method for inhibiting the expression of a storage protein in plant seed, in a plant seed, characterized in that it comprises: a) Stably transforming plant cells with an expression cassette comprising a preselected DNA sequence encoding for an RNA molecule operably linked to a functional promoter in a plant cell, to produce transformed plant cells, wherein the RNA molecule is substantially identical, or complementary, to all or a portion of a messenger RNA for the storage protein in seed; b) the regeneration of the transformed cells in a fertile transgenic plant which generates plant seeds, wherein the preselected DNA sequence is expressed in the seeds in an amount effective to substantially reduce the expression of the storage protein in the seed of plant; and c) the recovery of the seeds.

20. The method according to claims 16, 17, 18 or 19, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially identical to all or a portion of the mRNA that codes for a seed storage protein.

21. The method according to claims 16, 17, 18 or 19, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially complementary to all or a portion of the mRNA that codes for a seed storage protein.

22. the method according to claim 20, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially identical to all or a portion of the mRNA that codes for an a-zein protein.

23. The method according to claim 21, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially complementary to all or a portion of the mRNA that codes for an a-zein protein.

24. The method according to claim 16, 17, 18 or 19, characterized in that the plant cell is a monocot cell.

25. The method according to claim 24, characterized in that the cell is a corn cell.

26. The method according to claim 16 or 19, characterized in that the seeds of the transgenic plant have an increased weight percentage of at least one essential amino acid.

27. The method according to claim 26, characterized in that the essential amino acid is selected from the group consisting of methionine, threonine, lysine, tryptophan, isoleucine and mixtures thereof.

28. The method according to claim 26, characterized in that e? Weight percent of the amino acid is increased by at least about 50% to 300%.

29. The method according to claims 16, 17, 18 or 19, characterized in that the preselected DNA sequence is operably linked to a functional promoter during the development of the seed of the plant.

30. The method according to claims 16, 17, 18 or 19, characterized in that it comprises the 10 kD zein promoter.

31. The method according to claims 16, 17, 18 or 19, characterized in that the promoter comprises the promoter of the 27 kD zein.

32. The method according to claim 21, characterized in that the preselected DNA sequence encodes an RNA molecule substantially complementary to all or a portion of an mRNA encoding a 19 kD a-zein protein.

33. The method according to claim 21, characterized in that the preselected DNA sequence encodes an RNA molecule substantially complementary to all or a portion of a messenger RNA encoding a 22 kD a-zein protein.

34. The method according to claim 20, characterized in that the preselected DNA sequence encodes an RNA molecule substantially identical to all or a portion of an mRNA that codes for a 19 kD a-zein protein.

35. The method according to claim 21, characterized in that the preselected DNA sequence codes for an RNA molecule substantially identical to all or a portion of an mRNA that codes for a 22 kD a-zein protein.

36. The method according to claim 16, 17, 18 or 19, characterized in that it further comprises stably transforming the cells with a second preselected DNA sequence that codes for the hardness of the grain.

37. The method according to claim 16, 17, 18 or 19, characterized in that the cell is transformed by a method selected from the group consisting of electroporation, microinjection, bombardment with microprojectiles, and liposomal encapsulation.

38. The method according to claims 16, 17, 18 or 19, characterized in that it further comprises stably transforming the cells with at least one selectable marker gene.

39. The method according to claim 26, characterized in that it further comprises cultivating or raising the fertile transgenic plant to produce a progeny plant having an increase in the weight percentage of at least one amino acid, as a dominant trait or characteristic, while still maintaining functional agronomic characteristics in relation to the non-transformed, corresponding plant.

40. The method according to claim 17 or 18, characterized in that it further comprises cultivating or raising the fertile transgenic plant to produce a progeny plant that has an increase in the weight percentage of starch as a dominant trait, while still maintaining functional agronomic characteristics in relation to the non-transformed, corresponding plant.

41. A method to inhibit the expression of a gene family of seed storage protein, in a plant seed, characterized the method because it comprises: a) Stably transforming plant cells with a first preselected sequence of DNA encoding an RNA molecule operably linked to a functional promoter in a plant or seed, to produce plant cells transformed, wherein the RNA molecule is substantially identical, or complementary, to all or a portion of a messenger RNA that codes for a polypeptide that is substantially homologous to seed storage proteins; and the regeneration of the transformed cells in a fertile transgenic plant, which produces transgenic seeds, wherein the preselected DNA sequence is expressed in the seeds in an amount effective to substantially reduce the expression of seed storage proteins in the seeds transgenic, in relation to the expression of seed storage proteins in the corresponding non-transgenic seeds.

42. A method for increasing the weight percentage of at least one essential amino acid for the diet of animals in a plant seed, characterized in that it comprises: a) Stably transforming plant cells with a first preselected DNA sequence and a second DNA sequence pre-selected to produce transformed plant cells, wherein the first preselected DNA sequence encodes an RNA molecule substantially identical, or complementary, to all or a portion of a messenger RNA encoding a seed storage protein, wherein the second The preselected DNA sequence encodes a polypeptide having at least one amino acid essential for the diet of the animals, and wherein each preselected DNA sequence is operably linked to a functional promoter in a plant or seed; and the regeneration of the transformed cells in a fertile transgenic plant, which produces transgenic seeds, wherein the first preselected DNA sequence is expressed in an "effective amount to substantially reduce the production of said seed storage protein, in the seeds transgenic, relative to the amount of the seed storage protein present in the corresponding non-transgenic seeds, and wherein the second preselected DNA sequence is expressed in an amount sufficient to increase the weight percentage of at least one essential amino acid in transgenic seeds, in relation to the amount of the essential amino acid present in the corresponding non-transgenic seeds

43. A method for increasing the production of a polypeptide in a seed, characterized in that it comprises: a) Stably transforming plant cells with a first sequence DNA pre-selection and a second preselected DNA sequence to produce a transformed cell, wherein the first preselected DNA sequence encodes an RNA molecule substantially identical to, or complementary to, all or a portion of at least one messenger RNA encoding a protein seed storage, wherein the second preselected DNA sequence encodes a polypeptide, and wherein each preselected DNA sequence is operably linked to a functional promoter in the plant; and b) the regeneration of the transformed cells in a fertile transgenic plant, which produces transgenic seeds, wherein the first preselected DNA sequence is expressed in the transgenic seeds in an amount effective to substantially reduce the production of the seed storage protein. with respect to the amount of the seed storage protein present in the corresponding non-transgenic seeds, and wherein the second preselected DNA sequence is expressed in the transgenic seeds as a protein in a percentage by weight that is substantially increased over the percentage in weight of that protein in the corresponding non-transgenic seeds.

44. The method according to claims 41, 42 or 43, characterized in that it also comprises the harvesting of the transgenic seeds.

45. The method according to claim 41, characterized in that the polypeptide is substantially homologous to the a-zein proteins.

46. The method according to claim 42 or 43, characterized in that the first preselected DNA segment codes for an RNA molecule that is substantially identical to all or a portion of the mRNA that codes for a seed storage protein.

47. The method according to claim 42 or 43, characterized in that the first preselected DNA segment codes for an RNA molecule that is substantially complementary to all or a portion of the mRNA that codes for a seed storage protein.

48. The method according to claim 46, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially identical to all or a portion of the mRNA that codes for an a-zein protein.

49. The method according to claim 47, characterized in that the preselected DNA segment codes for an RNA molecule that is substantially complementary to all or a portion of the mRNA that codes for an α-zein protein.

50. The method according to claim 41, 42 or 43, characterized in that the plant cell is a monocot cell.

51. The method according to claim 50, characterized in that the cell is a corn cell.

52. The method according to claim 42, characterized in that the seeds of the transgenic plant have an increased weight percentage of at least one essential amino acid.

53. The method according to claim 52, characterized in that the essential amino acid is selected from the group consisting of methionine, threonine, lysine, tryptophan, isoleucine and mixtures thereof.

54. The method according to claim 52, characterized in that the weight percentage of the amino acid is increased by at least about 50% to 300%.

55. The method according to claims 41, 42 or 43, characterized in that the preselected DNA sequence is operably linked to a functional promoter during the development of the seed of the plant.

56. The method according to claims 41, 42 or 43, characterized in that the promoter comprises the 10 kD zein promoter.

57. The method according to claims 41, 42 or 43, characterized in that the promoter comprises the 27 kD zein promoter.

58. The method according to claim 49, characterized in that the preselected DNA sequence encodes an RNA molecule substantially complementary to all or a portion of an mRNA that codes for a 19 kD a-zein protein.

59. The method according to claim 49, characterized in that the preselected DNA sequence encodes an RNA molecule substantially complementary to all or a portion of a messenger RNA encoding a 22 kD a-zein protein.

60. The method according to claim 48, characterized in that the preselected DNA sequence encodes an RNA molecule substantially identical to all or a portion of an mRNA that codes for a 19 kD a-zein protein.

61. The method according to claim 48, characterized in that the preselected DNA sequence codes for a molecule of RNA substantially identical to all or a portion of a messenger RNA encoding a 22 kD a-zein protein.

62. The method according to claim 42 or 43, characterized in that the second preselected DNA sequence codes for MBl.

63. The method according to claim 42 or 43, characterized in that the second preselected DNA sequence codes for a 10 kD zein.

64. The method according to claim 42 or 43, characterized in that the cells are stably transformed with a third preselected DNA sequence, which codes for the hardness of the grain.

65. The method according to claim 64, characterized in that the third preselected DNA sequence encodes a 27 kD zein protein.

66. The method according to claim 41, characterized in that the cells are stably transformed with a second preselected DNA sequence that codes for the grain hardness.

67. The method according to claim 66, characterized in that the second preselected DNA sequence codes for a 27 kD zein protein.

68. The method according to claim 41, 42 or 43, characterized in that the cell is transformed by a method selected from the group consisting of electroporation, microinjection, bombardment with microprojectiles, and liposomal encapsulation.

69. The method according to claims 41, 42 or 43, characterized in that the cells are stably transformed with at least one selectable marker gene.

70. The method according to claim 42, characterized in that it further comprises the cultivation or breeding of the fertile transgenic plant to produce a progeny plant having an increase in the weight percentage of at least one amino acid, as a dominant trait at the same time as it also maintains functional agronomic characteristics in relation to the corresponding non-transformed plant.

71. A fertile transgenic plant of Zea mays having an increased weight percentage of at least one amino acid that is essential to an animal's diet, the genome of which is stably increased by a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary, to an mRNA that codes for a storage protein in plant seed, characterized in the preselected DNA sequence because it is expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of the protein in the plant. storage in seed relative to the amount of the seed storage protein in the cells of a plant that only differ from the cells of the transgenic plant in that the preselected DNA sequence is absent, and wherein the preselected DNA sequence is transmitted through a normal, complete sexual cycle, from the transgenic plant to the next generation.

72. A fertile transgenic plant of Zea mays having an increased starch content, the genome of which is stably increased by a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary, to an mRNA that encodes a storage protein in plant seed, characterized the preselected DNA sequence because it is expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of the storage protein in the seed and to increase the starch content in relation to the amount of the storage protein in the seed, and the content of the starch in the cells of a plant which only "differ from the cells of the transgenic plant in which the preselected DNA sequence is absent, and wherein the DNA sequence pre-selected is transmitted through a complete normal sexual cycle of the transg plant Emphasize the next generation.

73. A fertile transgenic plant of Zea mays, the seeds of which have an increased starch extraction capacity, the plant genome that is stably increased by a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary, to an mRNA that codes for a storage protein in plant seed, characterized the preselected DNA sequence because it is expressed in the seeds of the transgenic plant in an amount sufficient to decrease the amount of the storage protein in the seed, and to increase the starch extraction capacity of the seed, in relation to the amount of seed storage protein and the extraction capacity of the starch in the seeds of a plant, which differ only from the seeds of the transgenic plant in that the preselected DNA sequence is absent, - and where the pre-DNA sequence Selected is transmitted through a complete normal sexual cycle of the transgenic plant to the next generation.

74. A fertile transgenic plant of Zea mays, which has a decreased amount of seed storage protein, the genome of which is stably increased by a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary to an mRNA that codes for a seed storage protein, wherein the RNA molecule is substantially identical or complementary, to all or a portion of a mRNA molecule that encodes a peptide that is substantially protein homologous. Seed storage, characterized in that the preselected DNA sequence is expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of storage proteins in the cells of a plant, which differ only from the cells of the plant. transgenic plant in which the preselected DNA sequence is absent, and wherein the preselected DNA sequence is transmitted through a normal, complete sexual cycle, from the transgenic plant to the next generation.

75. A fertile transgenic plant of Zea mays, having a decreased content of seed storage protein, the genome of which is stably increased by a preselected DNA sequence encoding an RNA molecule that is substantially identical, or complementary to a MRNA coding for a seed storage protein, wherein the preselected DNA sequence expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of the protein in the cells of a plant, which differ only from the cells of the transgenic plant in which the preselected DNA sequence is absent, and wherein the preselected DNA sequence is transmitted through a normal, complete sexual cycle, from the transgenic plant to the next generation.

76. A fertile transgenic plant of Zea mays, having an increased weight percentage of at least one amino acid essential for the diet of an animal, the genome of which is stably increased by a first preselected DNA sequence and a second preselected DNA sequence, characterized in that the first preselected DNA sequence encodes an RNA molecule that is substantially identical, or complementary to, an mRNA encoding a seed storage protein, wherein the second preselected DNA sequence encodes a polypeptide that "has less an essential amino acid for the diet of an animal, wherein the first preselected DNA sequence is expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of the storage protein in the seed, and the second DNA sequence preselected is expressed in the cells of the transgenic plant in an amount sufficient to increase the weight percentage of at least one amino acid essential for an animal's diet, relative to the amount of the storage protein in the seed and the percentage by weight of said essential amino acid in the cells of a plant, which they differ only from the cells of the transgenic plant in that the preselected DNA sequences are absent, and wherein the preselected DNA sequences are transmitted through a normal, complete sexual cycle of the transgenic plant to the next generation.

77. A fertile transgenic plant of Zea mays, having an increased amount of a preselected polypeptide, the genome of which is stably increased by a first preselected DNA sequence and a second preselected DNA sequence, characterized in that the first preselected DNA sequence encodes for an RNA molecule that is substantially identical, or complementary, to an mRNA that codes for a seed storage protein, wherein the second preselected DNA sequence encodes a preselected polypeptide, wherein the first preselected DNA sequence is expressed in the cells of the transgenic plant in an amount sufficient to decrease the amount of the seed storage protein, and the second preselected DNA sequence is expressed in the cells of the transgenic plant in an amount sufficient to increase the amount of the preselected polypeptide in relation to the amount of said seed storage protein, and the pr.eselected polypeptide in the cells of a plant that differ only from the cells of the transgenic plant in which the preselected DNA sequences are absent, and wherein the DNA sequences Preselected are transmitted through a normal, complete sexual cycle, from the transgenic plant to the next generation.

78. A seed derived from the plant according to claims 71, 72, 73, 74, 75, 76 or 77.

79. A plant progeny, characterized in that it is derived from the seed of conformity, with claim 78.

80. The transgenic plant according to claim 74, characterized in that the preselected DNA sequence encodes an RNA molecule that is substantially identical, or complementary, to all or a portion of an mRNA that encodes a peptide that is substantially homologous to the a-zein proteins.

81. The transgenic plant according to claim 71 or 75, characterized in that the seeds of the transgenic plant have an increased weight percentage of at least one essential amino acid.

82. The transgenic plant according to claim 81, characterized in that the essential amino acid is selected from the group consisting of methionine, threonine, lysine, tryptophan, isoleucine and mixtures thereof.

83. The transgenic plant according to claim 81, characterized in that the weight percentage of the amino acid is increased by at least about 50% to 300%.

84. The transgenic plant according to claims 71, 72, 73, 74 or 75, characterized in that the promoter comprises the 10 kD zein promoter.

85. The transgenic plant according to claim 76 or 77, characterized in that at least one promoter comprises the 10 kD zein promoter.

86. The transgenic plant according to claims 71, 72, 73 74 or 75, characterized in that the promoter comprises the 27 kD zein promoter.

87. The transgenic plant according to claim 76 or 77 characterized in that at least one promoter comprises the 27 kD zein promoter.

88. The transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that the preselected DNA sequence, which codes for an RNA molecule substantially complementary to all or a portion of a mRNA encoding for a seed storage protein, it encodes an RNA molecule substantially complementary to all or a portion of an mRNA encoding the 19 kD a-zein protein.

89. The transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that the preselected DNA sequence, which codes for an RNA molecule substantially complementary to all or a portion of a mRNA encoding for a seed storage protein, it encodes an RNA molecule substantially complementary to all or a portion of an mRNA that codes for a 22 kD a-zein protein.

90. The transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that the preselected DNA sequence, which codes for an RNA molecule substantially identical to all or a portion of an mRNA encoding for a seed storage protein, it encodes an RNA molecule substantially identical to all or a portion of an mRNA that codes for the 19 kD a-zein protein.

91. The transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that the preselected DNA sequence, which codes for an RNA molecule substantially identical to all or a portion of an mRNA encoding for a seed storage protein, it encodes an RNA molecule substantially identical to all or a portion of an mRNA that codes for a 22 kD a-zein protein.

92. The transgenic plant according to claim 76 or 77, characterized in that the second preselected DNA sequence codes for MBl.

93. The transgenic plant according to claim 76 or 77, characterized in that the second preselected DNA sequence encodes a 10 kD zein.

94. The transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that it further comprises stably transforming the cells with a gene encoding the grain hardness.

95. the transgenic plant according to claims 71, 72, 73, 74, 75, 76 or 77, characterized in that the cell is transformed by a method selected from the group consisting of electroporation, microinjection, bombardment with microprojectiles, and liposomal encapsulation.

96. The transgenic plant according to claims 75, 76, 77, 78, 79, 80 or 81, characterized in that it further comprises the stably transforming the cells with at least one selectable marker gene. SUMMARY OF THE INVENTION The invention provides preselected DNA sequences, engineered by genetic engineering, and methods for using them to alter the nutritional content of the seed of the plant. The methods of the invention are directed to increasing the weight percentage of at least one amino acid essential for the diet of the animals, or to increase the starch content of a plant. Such a method involves stably transforming a plant cell with a preselected DNA sequence encoding an RNA molecule substantially identical or complementary to a messenger RNA (mRNA) encoding a storage protein in plant seed, preferably a Seed storage protein that is deficient in at least one amino acid essential for the diet of animals. An alternative method employs stably transforming cells with at least two preselected DNA sequences, one of which codes for an RNA molecule substantially identical or complementary to a messenger RNA (mRNA) encoding a storage protein in plant seed, and the other preselected ^ .DNA molecule encoding a preselected polypeptide. The transformed cells are used to generate fertile transgenic plants and seeds. The transgenic seeds are characterized by the expression of the preselected DNA sequence which results in a substantial inhibition of the production of a seed storage protein, deficient in at least one amino acid essential for the diet of animals and / or an increase in in the percentage by weight of an amino acid essential for the diet of animals.