MXPA99000786A - Glucoamylase protein engineering to increase thermostability and substrate specificity with ph opt - Google Patents

Abstract

A fungal glucoamylase that includes a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between the two members of the pair. The mutation provides increased thermal stability and reduced isomaltose formation to the enzyme. A fungal glucoamylase, including a 311-314 Loop mutation where reduced isomaltose formation is provided by the mutation, is also provided. A fungal glucoamylase is also provided, including a Ser4llAla mutation where increased pH and reduced deisomaltose formation are provided by the mutation. Combinations of engineered glucoamylase mutations are also provided as combinations with other glucoamylase mutations that provide increased thermal stability, increased pH and reduced isomaltose formation for cumulative improvements in engineering glucoamylases.

Description

GLUCOAMYLASE PROTEIN ENGINEERING TO INCREASE TERMOESTABI IDAD AND SPECIFICITY SUBSTRATE WITH pH OPTIMAL FIELD OF THE INVENTION The field of the invention relates to mutations to produce an enzyme fungal glucoamylase that is more selective for glucose production instead of the isomaltose disaccharide linked to-1,6, is more thermostable and has Increased pH "and produces increased amounts of glucose compared to wild-type enzymes BACKGROUND OF THE INVENTION Glucoamylase (EC 3.2.1.3) is a carbohydrase discovered in 1951, is an exo-hydrolase that breaks D-glucose from the nd reducing ends of malto-oligosaccharides, attacking bonds a- (1, 4) -, and at a much slower rate c¿- (1, 6) -glucosidic is one of more than 100 carbohydrases (EC 3.2.1) that break 0-glycosidic bonds, either of OI- or β- configuration The functional and structural relationship of these enzymes is reflected in the presence of at least three discrete regions of sequence homology between glucoamylase and several a-amylases, lucosidases and transglucanosilasas [Svensson, 1988] and a domain structure similar to carbohydrases that attack insoluble substrates [Knowles et al., 1987; Svensson et al., 1989)]. Glucoamylase from Aspergillus awamori (1,4-a-D-glucan glucohydrolase; 3. 2.1.3) is one of the most important glucoamylases. Glucoamylase is primarily used in the industry for the production of high-fructose corn sweeteners, in a process involving 1) -amylase to hydrolyze starch into moderate-length maltooligosaccharides (dextrin), * 2) Glucoamylase to hydrolyze dextrin in glucose, - and 3) glucose isomerase to convert glucose to fructose. Corn sweeteners have captured more than 50% of the sweetener market in the United States, and the three enzymes used to produce them are among the enzymes made with the highest volume. In addition, the glucose produced by glucoamylase can be crystallized or used in fermentation to make organic products such as citric acid, ascorbic acid, Usina, glutamic acid or ethanol for beverages and fuels. Approximately 12% of the country's corn production is processed with glucoamylase. Although glucoamylase has been used successfully for many years, it would be a more attractive product if higher amounts of glucose were produced instead of disaccharides, if it were more stable and if it could be used in the same container with glucose isomerase.

Glucoamylase does not yield 100% glucose yield from dextrin because it produces various di- and trisaccharides, especially isomaltose and isomaltotriose, from glucose [Nikolov et al., 1989]. These products, formed at high concentrations of substrate, result from the ability of glucoamylase to form - (1, 6) -glucosidic bonds. Glucoamylase is not as thermo-stable as either a-amylase or glucose isomerase. The optimum pH of GA (pH 4.5) is lower than that of α-amylase (pH 5-6.5) and glucose isomerase (pH 7-8). Therefore, hydrolysis of glucoamylase should be performed separately from other enzymatic reactions in a different container and at lower temperatures causing higher capital costs. The glucoamylase of the filamentous fungus Aspergillus niger, is the most widely used glucoamylase, and its biochemical properties have been extensively characterized. This enzyme is found primarily in two GAl forms (616 amino acids, referred to as AA below) and GAII (512 AA), different from the presence in GAl of a C-terminal domain 104-AA, required for adsorption in native starch granules [Svensson et al., 1982; Svensson et al., 1989]. Both forms have a catalytic domain (AA1-440) followed by a highly 0-glycosylated region rich in Ser / Thr (AA441-512) [Gunnarson et al., 1984]. The first thirty residues of this region are included in the three-dimensional structure of the enzyme [Aleshin et al., 1994; nineteen ninety six; Stoffer et al., 1995], - they wrap around the catalytic domain like a belt. There is strong AA sequence homology between the fungal glucoamylases in four different regions of the catalytic domain that correspond to the loops that form the substrate binding site [Itoh et al., 1987]. In A. niger glucoamylase these regions are AA35-59, AA104-134, AA162-196 and AA300-320. The second and third regions partially or completely overlap or overlap the three regions of homology to -amlases [Svensson, 1988]. In addition, the binding domain of crude starch (AA512-616) has high homology to similar domains of several starch degradation enzymes [Svensson et al., 1989]. Kinetic analysis showed that the substrate binding site is composed of up to seven subsites [Savel'ev et al., 1982] with hydrolysis occurring between subsites 1 and 2. The hydrolysis pKa 2.75 and . 55 [Savel'ev and Firsov, 1982], suggest that carboxylic acid residues in subsites 1 and 2, provide the catalytic acid and base for hydrolysis. Chemical modification experiments showed that three highly conserved residues Aspl76, Glul79 and Glul80, are protected and are in the active site, suggesting that one or more of them are possible catalytic residues [Svensson et al., 1990]. Chemical modification experiments also indicate that the highly conserved Trpl20 residue is essential and is located in subsite 4 [Clarke and Svensson, 1984]. "Trp 120 is homologous to Trp83 of α-amylase of Aspergillus oryzae [Clarke and Svensson, 1984], which is also located in the active site of that enzyme [Matsuura et al., 1984]. Site-directed mutagenesis studies have indicated that Glul79 is the catalytic acid residue, while Glu400 is the catalytic base residue [Frandse et al., 1994, Harris et al., 1993, Sierks et al., 1990] Glucoamylases from A. niger [Svensson et al., 1983; Boel et al. , 1984] and Aspergillus awamori [Nunberg et al., 1984] have been cloned and sequenced and have identical primary structures Innis et al. [1985] and more recently Colé et al. [1988] have developed vectors (pGAC9 and pPM18, respectively ) for expression of glucoamylase in yeast, allowing convenient manipulation and testing of glucoamylase mutants COMPENDIUM OF THE INVENTION According to the present invention, a glu coamilasa fungal (1,4-a-D-glucan glucohydrolase; EC 3.2.1) with decreased thermal inactivation (increased thermostability) and reduced isomaltose formation that is provided by the Asn20Cys mutation coupled with Ala27Cys form a disulfide bond between the two. Cumulative thermostability is also provided for GA by including mutation Asn20Cys coupled with Ala27Cys and at least one mutation from Table 13. An engineering GA including Ser20Pro, Glyl37Ala and Asn20Cys coupled with Ala27Cys provides even more thermostability. Cumulative thermostability is also provided for GA by including the Asn20Cys mutation coupled with Ala27Cys and at least two mutations of Table 13. The present invention also provides a fungal glucoamylase with reduced isomaltose formation including Asn20Cys coupled with Ala27Cys mutation (SS mutation) and minus one mutation selected from Table 14. In an Asn20Cys mode coupled with the Ala27Cys mutation and a 311-314Loop mutation (also referred to as 300Loop) are included in an engineering GA. In a further preferred embodiment, the engineered glucoamylase with reduced isomaltose formation includes Asn20Cys coupled with Ala27Cys, Ser30Pro and Glyl37Ala mutations. The present invention also provides engineered fungal glucoamylase including a 311-314 Loop mutation, whereby reduced isomaltose formation is provided by the mutation. In a further embodiment, fungal glucoamylase including a 311-314 Loop mutation and at least one mutation of Table 14 are prepared, so that cumulative reduced isomaltosis formation is provided by the additional mutation. The present invention provides a fungal glucoamylase including a Ser411Ala mutation whereby increased optimal pH and reduced isomaltose formation are provided by the mutation. In one embodiment, the Ser411Ala mutation is combined with at least one mutation of Table 15 whereby the cumulative increased optimal pH is provided by the mutations. In one embodiment, the Ser411Ala mutation is combined with at least one mutation of Table 14, whereby cumulative reduced isomaltose formation is provided by the mutations. In a further embodiment, an engineered fungal glucoamylase includes a Ser411Ala mutation and a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between the two members of the pair with which increased thermal stability, increased pH optimum and reduced isomaltose formation are provided by the mutations. In a still further embodiment, a fungal glucoamylase is engineered to include a Ser411Ala mutation and a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between the two members of the pair and a 311-314Loop mutation with which stability, thermal increased, increased pH optimum and reduced isomaltose formation are provided by the mutations. The present invention provides a method for obtaining a fungal glucoamylase with reduced isomaltose formation by designing mutations to decrease the α- (1, 6) -glucosidic binding affinity of GA. The present invention also provides a method for obtaining a fungal glucoamylase with decreased thermal inactivation by designing mutations to decrease the entropy of conformation of the unfolding enzyme and increase the stability of α-helices, increased disulfide bonds, hydrogen bonding, electrostatic interactions, Hydrophilic interactions, Vanderwalls interactions and compact packaging. The present invention also provides a fungal glucoamylase with increased optimal pH including changing polarity, charge distribution and hydrogen bonding in the microevette of the Glu400 catalytic base. The present invention also provides a method for genetically engineering glucoamylase that carries at least two cumulative additive mutations. Individual mutations are generated by site-directed mutagenesis. These individual mutations are classified and those selected that show increased pH increased and that have diminished rates of irreversible thermal inactivation or reduced isomaltose formation. Site-directed mutagenesis is then performed to produce enzymes that carry at least two of the selected isolated mutations. Finally, engineering enzymes are classified for cumulative additive effects of mutations in thermal stabilization or reduced isomaltose formation by the produced enzymes that carry at least two of the selected isolated mutations. Alternatively, the engineered enzyme is classified for cumulative additive effects of both mutations at optimum pH, thermostability and / or reduced isomaltose formation, by the produced enzymes that carry at least two of the selected isolated mutations. Vectors for each of the mutations and mutation combinations are also provided by the present invention, as well as host cells transformed by the vectors. DESCRIPTION OF THE DRAWINGS Other advantages of the present invention will be readily appreciated as it is better understood by reference to the following detailed description when considered in connection with the accompanying drawings in which: FIGURE 1 is a graph showing the relationship between the temperature and kd for GA wild type mutants (•) and substituted with proline: S30P (U), D345P (v), E408P (0) in Example 1. FIGURE 2 is a graph showing the effect of temperature on coefficients of first-order thermoinactivation rate of wild-type (O), A27C (•), N20C (v), A27C / N20C (t), A471C / T72C (D), A27C / N20C / G137A (M), A27C / N20C / S436P (0) and G137A / S436P () measured in buffer pH 4.5. FIGURE 3 is a graph showing initial reaction rates of wild-type glucoamylases (>;), A27C / N20C (•), A471C / T72C (v) and A29C / N20C / G137A (Or with 4% maltose in 0.05 M sodium acetate (pH 4.5) as a substrate at temperatures from 60 ° C to 76 ° C C.

FIGURE 4 is a graph showing the effect of temperature on wild-type and mutant GA activity. Error bars represent the standard deviation of three tests. Wild type (•), S30P / G137A (D), S-S / S30P / G137A (A). FIGURES 5A-C are graphs showing the effect of temperature on irreversible thermal inactivation rate coefficients of GA type-siltster and mutant. Figure 5A Wild type (•), S30P (M), G137A (?), S30P / G137A (D), - Figure 5B Wild type (•), S30P (M), SS (hexagon), SS / S30P (full circle with empty center), - Figure 5C Wild type (•), S30P / G137A (D), S- S / S30P (full circle with empty center), SS / S30P / G137A O) - FIGURES 6A-B are graphs showing saccharification of Maltrin MlOO at 28% (weight / volume) by wild type (•), S30P / G137A (D) and S-S / S30P / G137A (*). FIGURE 7 is a graph showing the saccharification of maltodextrin DE 10 to 30% of wild type () and mutant glycoamylases: 300Loop (M), S30P / G137A (*), SS (•), S30P / G137A / 300L? op (x), SS / 300Loop (>), at 55 ° C, enzyme concentration was 166.67 μg / mL. FIGURE 8 is a graph showing isomaltose production by wild type (•) and mutant glucoamylases: Y116 (M), Y175F (), R241K *), S411A (), S411G (hexagon), during glucose condensation at 55 ° C. ° C with 30% D-glucose (weight / volume) in 0.05 M sodium acetate buffer at pH 4.4, with 0.02% sodium azide for 12 days. FIGURE 9 is a graph showing the production of glucose by wild-type glucoamylases (•) and mutant: Y116W (U), Y175F (?), R241K (), S411A (• »), S411G (hexagon), during hydrolysis of maltodextrin DE 10 to 55 ° C with 28% maltodextrin (weight / volume) in 0.05M sodium acetate buffer at pH 4.4 with 0.02% sodium azide for 12 days. FIGURE 10 is a graph showing the initial rates of glucose production by wild-type (•) glucoamylases and S411A (M) during maltodextrin DE 10 hydrolysis at different pH values. The hydrolysis is carried out at 36 ° C with 28% maltodextrin (weight / volume) in 25mM phosphate citrate buffer at indicated pH with 0.02% sodium azide for 4 days. DETAILED DESCRIPTION OF THE PREFERRED MODALITY The present invention provides mutations for increased thermal stability, increased optimal pH and reduced isomaltose formation in the glucoamylase of fungal species that can provide increased glucose yields compared to wild-type glucoamylase. The predicted structure and known sequences of glucoamylase are conserved among the fungal species [Coutino et al., 1994]. As an example, Aspergillus awamori glucoamylase (1,4-aD-glucan glucohydrolase; EC 3.2.1.3; referred to as GA herein; NO SEQ ID NO: 1) is employed, but any other fungal species including glucoamylase can be employed. Aspergillus species. The number of amino acids of glucoamylase here is based on the sequence of the Aspergillus awamori specimen. Equivalent amino acid residue numbers are determined differently for different fungal species, as is known in the art [Coutino et al., 1994]. The present invention provides a fungal glucoamylase with decreased thermal inactivation (increased thermostability) and decreased isomaltose formation, which is engineered by the inclusion of a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between them (this mutation is abbreviated as Asn20Cys / Ala27Cys or SS). Additional mutations that provide decreased thermal inactivation are set forth in Summary Table 13. Cumulative thermostability for GA is also provided, including at least two of the mutations in the enzyme such as for example including Ser30Pro and Glyl37Ala mutations. Another example is to subject S-S engineering with Asn20Cys / Ala27Cys to the enzyme or to the Glyl37Ala pair with S-S. further, combinations of the individual mutations set forth in Table 13, particularly with S-S coupled with Ser30Pro also provide cumulative thermostability. In general, two mutation combinations are made but triple mutations can also be constructed. As for example, an engineering GA that includes the three mutations: Ser30Pro, Glyl37Ala, and Asn20Cys / Ala27Cys provides even more thermostability. By Asn20Cys coupled with Ala27Cys, we mean a pair of mutations that are abbreviated as "S-S" or Asn20Cys / Ala27Cys and between which a disulfide bond is formed as described herein in the Examples. In general, this is referred to as a simple mutation since both are required to form the disulfide bond. Cumulative generally means the 'additive (or almost additive) effects of two or more mutations in the parameter of enzymatic activity that is measured. The present invention also provides a fungal glucoamylase with reduced isomaltose formation and increased glucose yield, including the mutation 'Asn20Cys / Ala27Cys (SS mutations) and at least one mutation selected from Table 14. In one embodiment, the mutation Asn20Cys / Ala27Cys and 311-314Loop (300Loop) is included in GA. In a further preferred embodiment, the engineered glucoamylase with reduced isomaltose formation includes Asn20Cys / Ala27Cys and Ser30Pro and Glyl3Ala mutations. In one embodiment, a glucoamylase with the 311-314 Loop mutation, is constructed to provide reduced isomaltose formation. By the mutation 311-314 Loop is meant an insertion GA mutant with the sequence Tyr311-Tyr312-Asn313-Gly314-Tyr311-Asn-Gly-Asn-Gly-Asn-Ser-Gln-Gly314 (311-314 Loop; DO NOT. SEC ID: 2). The present invention provides a fungal glucoamylase that includes a Ser411Ala mutation with what is provided by the increased mutation, optimal pH and reduced isomaltose formation. In one embodiment, the Ser411Ala mutation is combined with at least one mutation of Table 15 whereby the cumulative increased optimal pH is provided by the combined mutations. In a further embodiment, the Ser411Ala mutation is combined with at least one mutation of Table 14 with what is provided by the mutations and cumulative reduced isomaltose formation. In a further embodiment, an engineered fungal glucoamylase includes a Ser411Ala mutation and the Asn20Cys / Ala27Cys mutation pair that forms a disulfide bond between them, thereby providing for the mutations increased thermal stability, increased optimal pH and reduced formation of isomalt. 5 In a still further embodiment, a fungal glucoamylase "that includes a Ser411Ala mutation and a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between the two members of the pair and a mutation 31i-314 Loop, with which increased thermal stability, 10 increased optimal pH and reduced formation of isomaltose, are provided by the combination of mutations. Mutations are indicated by the amino acid that is replaced followed by the residue number followed by the amino acid replacement. The amino acids are abbreviated with either the three-letter code or the single-letter code. Mutations are generated using site-directed mutagenesis as is known in the art. The sequence and residue number are of the Wild type (WT) or non-mutant enzyme. Biochemical characterization performs as described here below and in the Examples. The Examples provide specimens of the analysis for an individual mutation, to determine their characteristics and provide analysis specimens for combinations of mutations to determine if the , combination provides cumulative effects.

By increased thermostability (or decreased thermal inactivation) it is understood that at temperatures between 65 ° C and 77.5 ° C, the mutants are inactivated irreversibly at a reduced rate compared to the wild type. The present invention provides a method for "obtaining fungal glucoamylases with decreased thermal inactivation by designing mutations to decrease the rate of irreversible thermal inactivation at temperatures between 65 ° C and 77.5 ° C compared to wild type." This is achieved by designing glucoamylases with decreased thermal inactivation when designing mutations to decrease the conformational entropy of the enzyme to unfold and / or increase stability of ce-helices, increased disulfide bonds, hydrogen bonding, electrostatic interactions, hydrophilic interactions, Vanderwalls interactions and compact package. thermostability of protein and factors that influence reversible and irreversible thermal inactivation, have been extensively studied [Argos et al., 1979; Klibanov, 1983; Wasserman, 1984; Ahern and Klibanov, 1985] Factors involved in stabilizing poteins at high temperatures. uras include 1) disulfide bonds, 2) non-covalent bonds such as salt bridges, hydrogen bonding, and hydrophobic interactions and 3) conformational rigidity [Nosoh and Sekiguchi, 1988]. The causes of irreversible inactivation at high temperatures include 1) aggregation, 2) formation of incorrect structures, 3) destruction of disulfide bonds, 4) deamination (especially of Asn in Asn-Gly sequences) and 5) breakdown of peptide bonds Asp-X It is apparent that the replacement of even a residue can have a large difference in protein thermostability [Matsumura and Aiba, 1985], due to small increases in free energy (20-30 kJ / mol) usually required to stabilize tertiary structures of proteins [Nosoh and Sekiguchi, 1988]. Genetic engineering to increase thermostability (or to decrease irreversible thermoinactivation) of enzymes has been successful in several cases [Perry and Wetzel, 1984; Imanaka et al., 1986; Ahearn et al., 1987]. However, the mechanisms regulating thermostability are not fully understood, so that replacements of amino acid (AA) that promote thermostability are not precisely predicted [Leatherbarrow and Fersht, 1986; Nosoh and Sekiguchi, 1988; Pakula and Sauer, 1989]. The method of the present invention allows a more accurate prediction.

By increased optimal pH, it is understood that the enzyme is functional at higher pH than that of wild type. The present invention also provides a method for designing a fungal glucoamylase with optimum pH increased by changing the polarity, charge distribution - and hydrogen bonding in the micro-environment of the Glu400 catalytic base. For example, they were designed as S411G and S411A to remove the hydrogen bond between Ser411 and Glu400 (see Example 8). By increased selectivity it is understood that there is a decreased isomaltose formation due to the decrease in the production of by-products a- (1, 6) - undesirable links (reversion products) to high concentrations of glucose [Lee et al., 1976]. As described above, GA hydrolyzes and synthesizes both a- (1, 4) and a- (1, 6) - • glycosidic bonds. Increasing selectivity indicates that the enzyme synthesizes a-1, 6-linked products at a lower rate than the wild type as illustrated by reduced levels of isomaltose formation in condensation reactions, with 30% glucose as a substrate compared with wild type GA. Additionally, the improved selectivity may result in increased glucose yields in saccharification reactions using maltodextran DE 10 at 28% as a substrate. The present invention provides a method for obtaining a fungal glucoamylase with reduced isomaltose formation by designing mutations to decrease the binding affinity of OI- (1,6) -glucosidic GA. That is, mutations are designed in the active site to reduce isomaltose formation due to glucose condensation. Mutations are designed to have decreased ability to synthesize isomaltose, while maintaining at least partial wild-type ability to digest bound a-1,4 substrates resulting in a lower rate of isomaltose formation to glucose formation than the wild type. These mutations are performed in positions that are not completely conserved based on the homology analysis. Kinetic studies have indicated that there are five to seven subsites of glucosyl binding, and the catalytic site is located between subsites 1 and 2 [Hiromi et al., 1973, Hiromi et al., 1983, Meagher et al., 1989, Tanaka et al., 1983 ] The resolved three-dimensional structure of the glucoamylase catalytic domain of Aspergillus awamori var X100, which has approximately 95% homology with the corresponding regions of GAs of Aspergillus awamori and Aspergillus niger [Coutinho &; Reilly, 1994], contain thirty-six oí-helices, twelve of which are arranged in pairs to form a barrel OÍ / OÍ [Aleshin et al., 1992, Aleshin et al., 1994]. The active site is located in the cavity of the center of the barrel. In addition, homology analysis of thirteen amino acid sequences of glucoamylases showed that five conserved regions define the active site [Coutinho & Reilly, 1994]. The catalysis mechanism of GA involves two carboxyl groups [Hiromi et al., 1966], Glul79 and Glu400 (in Aspergillus awamori or Aspergillus niger) [Frandsen et al., 1994, Harris et al., 1993, Sierks et al., 1990]. Glul79 protonates oxygen in the glycosidic bond, acting as a general acid catalyst, and Glu400 activates water (Wat500) for nucleophilic attack in C-1 carbon, acting as a general base catalyst [Frandsen et al., 1994]. The crystal structures of glucoamylase complexed with the pseudotetrasaccharides (acarbose and D-glyco-dihydrocarbons), showed that there are two different binding formers, of type pH 4 and of type pH 6, for pseudotetrasaccharides at pH 4 [Aleshin et al., 1996, Stoffer et al., 1995]. The union of the first two sugar residues of the pseudotetrasaccharides is the same, but there is an extraordinary variation in conjunction of the third and fourth sugar residues of the pseudotetrasaccharides [Stoffer et al., 1995]. The substrate specificity of an enzyme is determined by its ability to form a stable complex with a ligand in both the basal state and the transition state. The stability of the ligand-enzyme complex is affected by spherical constraints, hydrogen bonding, Waal 's and electrostatic forces, and hydrophobic contacts [see in general Fersht, 1985 Enzyme Structure and Mechanism) X Edition, Freeman , San Francisco] . Site-directed mutagenesis is employed to construct mutations at residues 119 and 121 to alter the hydrogen bond between enzyme and substrate. The OG atom of the hydrogen bonds Serll9 to 3 -OH of the fourth sugar residue of pseudo-tetrasaccharides only in the shaper of type pH 6, while the amide nitrogen of Glyl21 makes hydrogen bonds to the 6-OH of the third sugar residue in both shapers of type pH-4 and type pH-6. These mutations are designed to change substrate specificity (decrease condensation reactions -1.6) while maintaining the wild-type ability to hydrolyze bound OI-1,4 substrates. Serll9 is not conserved and is replaced by Ala, Pro and Glu in other GAs. Mutant S119E is designed to reinforce hydrogen bonding between the enzyme and the fourth sugar residue of the substrate to stabilize the pH-6 type conformer, and to carry a negative charge near subsite 4 in order to increase the electrostatic interactions in the active site The S119G mutant is designed to remove the same hydrogen bond in order to destabilize the pH-6 type former. The S119W mutant is designed to remove the same hydrogen bond and to increase the hydrophobic interactions between the enzyme and the pH-6 type conformer. Glyl21 is highly conserved in all glucoamylase sequences except in Clostridium sp. G005 GA, which has high activity at-1.6 and in which Gly is replaced by Thr. Since the angles f and? will allow an alanine in this position without causing a conformational distortion, G121A is designed to introduce a β-carbon at position 121 to displace the 6-OH group of the third sugar residue from its hydrogen bonding position. In addition, the double mutant G121A / S411G is designed to investigate additivity of the two substrate specificity mutations. S411G is shown here that reduces the proportion of initial speeds of! production of isomaltose (from glucose condensation reactions) to that of glucose production (from the hydrolysis of DE 10 maltodextrin).

The following provides further examples of the strategies employed for the design of mutations that have increased selectivity. 300Loop mutation: According to the homology study of the amino acid sequence [Countinho and Reilly, 1994], it was found that Rhizopus GAs and some other fungal families have a longer amino acid sequence and form a larger cavity or loop in the conserved S4 region compared to GAs A. niger or A. awamori. Since simple mutation events alone are unlikely to lead to substantial increases in the specificity of binding or synthesis hydrolysis, an insertion mutant GA is designed, designated 300Loop or 311-314Loop (SEQ ID NO: 2), and the seven amino acids inserted were adapted from Rhizopus since GA Rhizopus was the first enzyme to which the subsitio theory was applied successfully [Himori et al., 1973]. The 300Loop mutation is designed to decrease the α- (1, 6) -glucoside affinity by introducing a larger loop in the conserved S4 region. Tyrl75Phe: Tyrl75 is within the third conserved region. The closest distance between Tyrl75 and the fourth D-glyco-dihydrocarbon inhibitor residue is 4. 06 Á [Stoffer et al., 1995]. Tyrl75 is replaced by Phe or Gln in several other glucoamylases. Changing Tyrl75 to Phe is designed to increase the hydrophobic interaction between enzyme and substrate. Glyl2lAla: Glyl21 is highly conserved in all glucoamylase sequences except in GA Clostridium sp. G005, which has high activity at-1.6, and where Gly is replaced by Thr. Since f and? of Glyl21 will allow an alanine in this position without causing a conformational distortion, G121A is designed to introduce a β-carbon at position 121, to displace the 6-OH group of the third sugar residue from its hydrogen bonding position. Glyl21Ala with S411G (generally indicated as G121A / S411G): The double mutant is designed to investigate the (cumulative) additivity of the two specific substrate mutations. S411G reduces the ratio of initial production rates of isomaltose (from glucose condensation reactions, see Examples) to that of glucose production (from the hydrolysis of maltodextrin 10). The present invention provides a method for engineering mutations to fungal glucoamylase and then preparing engineered enzymes that carry cumulative additive mutations. The initial step is to generate individual mutations by site-directed mutagenesis and classify the individual mutations as described in the Examples. These individual mutations that show decreased irreversible thermal inactivation rates or reduced isomaltose formation or increased optimal pH, are then chosen for combination analysis. In general, mutations having at least wild-type reaction rates are chosen. The mutations are combined by site-directed mutagenesis to determine if their effects are additive as discussed herein in the Examples. Site-directed mutagenesis to produce enzymes that carry at least two of the selected isolated mutations is performed as is known in the art. These engineering enzymes are then classified for cumulative additive effects in thermal stabilization, optimal pH or reduced isomaltose formation. Alternately, engineering enzymes that carry cumulative mutations are classified for cumulative effects in two or more of the parameters. For biochemical characterization of the mutants, GA is purified from culture supernatants of 15-liter batch fermentation by ultrafiltration, column chromatography of DEAE-Sephadex, and column affinity chromatography using the potent acarbose inhibitor attached to a support [Sierks et al. , 1989]. The purities of the resulting preparations are tested by standard techniques such as SDS-polyacrylamide gel electrophoresis and isoelectric focusing with narrow-band ampholytes. Proteins are measured by absorbance at 280 nm or by the method of Bradford [1976]. GA activity is measured by a glucose oxidase / o-dianisidine assay (Sigma). Selectivity is determined by any method known in the art, but preferably by measuring the initial rate of isomaltose formation from 30% (w / v) glucose condensation reactions at pH 4.4 and 55 ° C in 0.05 sodium acetate buffer M and then by measuring the initial range of glucose formation in hydrolysis reactions of maltodextran DE 10 30% (weight / volume) at pH 4.4 and 55 ° C 0.05M sodium acetate buffer. From the resulting initial velocities, the ratio of isomaltose formation to glucose formation is calculated. Thermostability is measured as is known in the specialty but preferably by incubating the enzyme at selected temperatures between 65 ° C and 77.5 ° C at 2.5 ° C intervals followed by analysis of activity at 35 ° C using 4% maltose as a substrate. When first-order impairment is observed, as with WT GA, coefficients of deterioration rate are determined. Activation energies for deterioration are calculated from the velocity coefficients at different temperatures.

The optimum pH is measured as is known in the art, but preferably at 45 ° C at 16 pH values, in the range of 2.2 to 7.0 using 0.025M citrate-phosphate buffer, with maltose or maltoheptase as the substrate. Saccharification is measured as described in Examples Briefly, glucoamylase is incubated with maltodextran DE 10 as a substrate in 0.05M sodium acetate buffer at pH 4.4 at 55 ° C. Samples are taken at various times from 0.5 to 288 hours and glucose production is determined. The present invention provides vectors comprising an expression control sequence operably linked to the nucleic acid sequence of the various mutant sequences described herein, combinations of mutations and their portions. The present invention further provides host cells, selected from suitable eukaryotic and prokaryotic cells, which are transformed with these vectors. Vectors containing the cDNA of the present invention can be constructed by those skilled in the art and should contain all the expression elements necessary to achieve the desired transcription of the sequences. Other beneficial features may also be contained within the vectors such as mechanisms for recovering the nucleic acids in a different form. Examples are provided here. Phagemids are a specific example of these beneficial vectors because they can be used either as plasmids or as bacteriophage vectors. Examples of these vectors include viruses such as bacteriophages, baculoviruses and retroviruses, DNA viruses, cosmids, plasmids, liposomes and other recombination vectors. The vectors may also contain elements to be used in either prokaryotic or eukaryotic host systems. A person with ordinary skill in the art will know that host systems are compatible with a particular vector. The vectors can be introduced into cells or tissues by any of a variety of methods known between the art (calcium phosphate transfection, electroporation, lipofection, protoplast fusion, polybrene transfection, ballistic DNA delivery, lithium acetate). or CaCl transformation). The host cell can be any eukaryotic and prokaryotic cells that can be transformed with the vector and that will support the production of the enzyme. The above discussion provides a factual basis for thermostable and selective fungal glucoamylase mutants as well as methods to design the mutations and classify by the cumulative effect of the mutations and vectors containing the mutations. The methods employed with and the utility of the present invention can be shown by the following non-limiting examples and accompanying figures. EXAMPLES General methods in molecular biology: Standard molecular biology techniques known in the specialty and not specifically described, were generally followed as in Sambrook et al., Molecular Cloning: A Laboratory Manual (Molecular Cloning): A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989), and in Ausubel et al. / Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989) and Rose et al., Methods in Yeast Genetics: A Laboratory Course Manual (Methods in Yeast Genetics): A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1990). Polymerase chain reaction (PCR) is generally carried out as in PCR Protocols: A Guide to Methods and Applications (PCR Protocols: A Guide to Methods and Applications), Academic Press, San Diego, CA (1990). Oligonucleotides are synthesized as is known in the art. For example, an Applied Biosystems 380B DNA synthesizer may be employed. Materials: S. cerevisiae C468 (a leu2-3 leu 2- 112 his 3-11 his 3-15 mal ") and the plasmid YEpPM18 were gifts of Cetus Acarbosa was a gift from Miles Laboratories All restriction enzymes were acquired of Promega as well as T4 DNA ligase and pGEM-7Z (+), and a phagemid vector of E. coli, were obtained from Promega.

Maltose (G2), maltotriose (G3), maltotetraose (G4), maltopentaose (Gs), maltohexaose (G6), maltoheptaose (G7), glucose oxidase, peroxidase and a-naphthol were from Sigma.

Isomaltose (iG2) were purchased from TCI America. FROM 10 Maltodextrin with the average degree of polymerizations (DP) of 10, 6 and 4, respectively, were from Grain Processing Corporation. Plates for high performance thin layer chromatography (HPTLC) (LHPK silica gel 60 Á, x 10 cm) were from Whatman. Site-directed mutagenesis: Site-directed mutagenesis is performed in accordance with the Muta-Gen mutagenesis team in phagemid Mu biogen from Bio-Rad, which is based on the method of Kunkel et al [1985]. A coding of 1.7 kb DNA fragment XhoI- ^ BamHI for the catalytic domain of glucoamylase is cloned into a pBluescript II KS (+) vector from Stratagene. Oligonucleotides used as mutagenic primers are provided with the specific Example. The presence of individual mutations is confirmed by sequencing and each gene fragment that has been mutated is subcloned in YepPM18 [Colé et al 1988] and transformed into S. cerevisiae. Enzyme production and purification: Wild type (WT) enzymes - and mutants are produced by developing yeast at 30 ° C in 5.3 L SD + His medium for 72 hours at pH 4.5 in a 5.0 L fermentor. After 48 hours, 100 g of dextrose and 22 g of (NH4) 2S04 in 300 ml of H0 are added as a supplement. After growth, the culture is centrifuged to remove yeast cells, the supernatant is concentrated by ultrafiltration, diafiltra against 0.5 NaCl / 0.1 M NaOAc, pH 4.5 and purified by affinity chromatography of acarbose-sepharose. GA is eluted with Tris-Cl 1.7 M, pH 7.6, dialyzed against H20, further concentrated by ultrafiltration and diafiltra against buffer 0.05 M NaOAc, pH 4.5. The protein concentration is determined according to the bicinchoninic acid protein assay Pierce [Smith et al., 1985] using bovine serum albumin as a standard. Enzyme activity assays: Enzyme activities were determined at 50 ° C using 4% maltose in 0.05M NaOAc buffer pH 4.5 as substrate. An international unit (IU) of enzyme activity is defined as the amount of enzyme required to produce 1 μmol / min of glucose at assay conditions. Following mixing of enzyme with substrate, six 100 μl samples are removed at seven minute intervals for "42 minutes, the reaction is stopped with 40 μl of" Tris-Cl 4.0 M, pH 7.0 and the glucose concentration is determined from according to the o-dianisidine glucose / peroxidase-glucose oxidase Sigma assay kit. Irreversible thermal inactivation: Duplicate aliquots of 40 μg / ml of purified wild type and mutant enzymes were subjected to inactivation at six or more temperatures between 65 ° C and 80 ° C at 2.5 ° C intervals. Samples were taken at six different points in time, immediately placed on ice and stored at 4 ° C for 24 hours. The residual activity of the inactivated samples together with a corresponding sample that was not subjected to thermal inactivation was determined as described above but at 35 ° C. PH dependence of glucoamylase activity: Dependence of glucoamylase activity pH is measured at 45 ° C at 16 different pH values, in the range of 2.2 a 7. 0, using a 0.025 M citrate-phosphate buffer [Mcllvane, 1921], with maltose or maltoheptase as a substrate. The ionic concentration of the phosphate-citrate buffer is maintained at 0.1 by adding potassium chloride. The pK values of substrate-enzyme complex and free enzyme are measured at substrate concentrations (i) smaller than 0.2 km, such that the initial velocity (v) was proportional to kcat / Km and (ii) greater than 10 Km, such that the initial velocity (v) was proportional to kcat [Sierks _ & Svensson, 1994, see also Whitaker (1994) Principie .of enzymology for the food sciences, 2nd Edition, Marcel Dekker, NY]. The pK values of two catalytic groups of substrate-enzyme complex and free enzyme were calculated by adjusting the initial velocities as a function of pH values to the equation log Y = log [C / (l + H / ^ + ^ / H ] when using the Enzfitter software, and is the observed value of the parameter of interest (ie kcat / Km or kaat) measured at different pH values, C is the Y independent pH value (ie the maximum value of kcat / Km or kcat), H is the concentration of hydrogen ion, J¿ and K2 are constants of dissociation of catalytic groups of enzyme When the values of pK ± and pK2 are separated by less than 3 units of pH, the values of pK are adjusted by the equations (H +) 1 + (Hf) 2 = Kx + 4 (í / +) opt and (i-i * ') ™, -. = v7 K? K2 [Whitaker, 1994]. The concentration of hydrogen ion at the optimum pH, (H *) opt is calculated from pHopt which is equal to the average of pK and pK2. (fí +) i and (H *) z (apparent Kx and K2) correspond to the hydrogen ion concentrations when the pH values are equal to apparent pK * and pK2, respectively. The hydrolysis of maltodextrin DE 10 (Saccharification): Hydrolysis is carried out at 35 ° C and / or 55 ° C (as indicated in the text) with maltodextrin DE 10 to 28% (weight / volume) as substrate in 0.05 M sodium acetate buffer at pH 4.4 with addition of 0.02% sodium azide, used to inhibit microbial growth in the reaction mixtures. The enzyme concentration was 2.64 μM for both wild-type and mutant GAs. Samples were taken at various times (from 0.5 to 288 hours) and reactions were stopped by adding samples to the same volume of 1 M Tris-HCl buffer at pH 7.0, since Tris is a known inhibitor of glucoamylase [Clarke & Svensson, 1984]. The production of glucose is determined by the glucose oxidase method [Rabbo & Terkildsen, 1960]. Initial rates of glucose production were determined by adjusting the experimental data to the equation c = At / (1 + Bt), where c is the product concentration, t is time and A (the initial velocity) and B is obtained from the non-linear regression. At 55 ° C, only the points in time before 70 hours were used for the calculations, since glucose production at that time had already declined for wild type GA. Glucose condensation reactions: Glucose condensation reactions were performed at 35 ° C and 55 ° C with D-glucose at 30% (w / v) as a substrate in 0.05 M acetate buffer at pH 4.4 for 12 days with the addition of 0.02% sodium azide used to inhibit microbial growth in the reaction mixtures. The enzyme concentration was 2.64 μM for both wild-type and mutant GAs. Samples were taken at various times and reactions were stopped by adding samples to the same volume of 1 M Tris-HCl buffer at pH 7.0. Thin Layer Chromatography with High Performance (HPTLC) and Image Formation Densitometry were used to determine the production of isomaltose by a method modified from that described by Robyt et al.

[Robyt and Mukerjea, 1994]. One microliter of variously diluted samples and six different norm concentrations (containing glucose, maltose and isomaltose) were applied to the HPTLC plates. The developed solvent system containing acetonitrile, ethyl acetate, 1-propanol and water in the proportions by volume of 85: 20: 50: 40. Only one ascent was used to reveal the carbohydrate separation in HPTLC plates. After development, the plates were air-dried, immersed in an EtOH solution containing a-naftbl 0.3% (weight / volume) and 5% H2SO4 (volume / volume), air-dried again and incubated at approximately 10 minutes at 120 ° C to visualize carbohydrates. Densities of the isomaltose points in HPTLC plates were quantified by Image Formation Densitome(Bio-Rad, Model GS-670), using the Molecular Analyst software (BioRad). The experimental data were adjusted to the equation c = At / (1 + Bt), described above for the maltodextrin hydrolysis of DE 10, to obtain the initial production rates of isomaltose. EXAMPLE 1 STABILIZATION OF GLUCOAMYLASE FROM ASPERGILLUS AWAMORI BY SUBSTITUTION OF PROLINE The following example refers to the methods and procedures that are used in the analysis of an individual mutation of a glucoamylase. To investigate the mechanisms governing the thermal stability of Aspergillus awamori glucoamylase, three proline substitution mutations were constructed. These mutations were predicted to increase GA stability by decreasing the conformational entropy of cleavage of the enzyme. Glucoamylase from Aspergillus awamori or £-1, 4-D-glucan glucohydrolase, EC 3.2.1.3; GA) is an enzyme that catalyzes the release of β-glucose from the non-reducing ends of related starch and oligosaccharides. GA is employed in, and defines the rate limiting step of the commercial conversion of starch to high glucose syrups which can be converted to fructose syrups by glucose isomerase, or used in fermentations to produce ethanol. GA is used industrially at 55 ° -60 ° C; at higher temperatures, the enzyme is rapidly and irreversibly activated. Therefore, a GA variant with increased thermostability would be industrially advantageous to decrease reaction times and / or to increase solids concentrations. Previous work has shown that the natural stability of oligo 1, 6-glucosidase [Suzuki et al., 1987] and pullulanase [Suzuki et al., 1991] can be positively correlated with the percentage in proline template present in the protein, and in a general rule for protein stability has been proposed [Suzuki, 1989]. This work has been extended to show that the bacteriophage T4 lysozyme [Matthews et al., 1987] and oligo 1, β-glucosidase from Bacillus cereus ATCC 7064 [Watanabe et al., 1994] can be stabilized by engineering proline at selected sites, thus decreasing the entropy of conformational splitting of the protein. Three sites (Ser30, Asp345 and Glu408-Pro) were chosen for proline substitution based on structural and evolutionary considerations. Mutations in these sites were constructed using the cloned gene TO . awamori [Innis et al., 1985] and the proteins were expressed in Saccharomyces cerevisiae [Cole et al., 1988]. The stability of the mutant proteins was measured by their resistance to irreversible thermal inactivation at various temperatures. As used here, the Ser30-Pro mutation increased. However, unexpectedly the Glu408-* Pro mutation decreased and the Asp345-Pro mutation does not significantly alter GA stability. Site-directed mutagenesis: Site-directed mutagenesis is performed as described here before. The following oligonucleotides were used: C o m o c e b a d o r e s m u t g e n i c o s: CAGAGTCCGCGCCCGG.CACCCAAGCACCGTC (Ser30-Pro) (ID NO.

SEC. : '3), AAGTCCAGCGACACAGGTGTGACCTCCAACGAC (Asp345-Pro) (SECTION ID NO .: 4) and CGAGCGGAAAGCTGCGGCCATCAGACTTGTC (Glu408-Pro) (No. SEQ ID NO: 5). Selection of sites for proline substitution: Based on the almost identical catalytic domain of A. awamori var X100 GA whose structure is known [Aleshin and -collaborators, 1992], three substitution sites were chosen that meet the following criteria: 1) Ramachandran angles (f,?) were within the allowed values for proline [Ramachandran and collaborators, 1963]. For this work, the angles f and? at the replaced site is restricted to the wide range f = -90 ° to -40 °,? = 120 ° to 180 ° or f = -90 ° to -40 °,? = -50 ° to lOd 2) Residues were highly exposed to solvents, since the mutation of residues in the nucleus of the enzyme is considered to decrease more likely the catalytic efficiency of the enzyme. 3) The residues do not participate in hydrogen bonding with other amino acids. Additionally, based on sequence alignments with GA's from other organisms [Coutinho and Reilley, 1994b] only residues that meet the previous structural criteria and were not well preserved, were selected for mutation. Ser30 can be aligned with proline in GAs of Hormoconis grísea var thermoidea and H. resiae GamP [Coutinho and Reilly, 1994b], which made them particularly attractive for proline substitution. RESULTS Specific activity None of the proline substitution mutations significantly alters GA-specific enzyme activities. wild type and mutant at 50 ° C and pH 4.5. This suggests that these mutations do not significantly alter the structure of the enzyme around the active site or alter its interaction with the substrate. Irreversible thermal stability GA's of wild type and mutant are subjected to thermal inactivation at pH 4.5 as described in the experimental protocols. Semi-logarithmic plot of residual activity in percent versus inactivation time produces inactivation velocity coefficients (kd). Figure 1 shows the relationship between temperature and kd for wild type and mutant GAs. Based on these data, activation energies for thermal inactivation (? G '), were calculated using the theory of transition state and melting temperatures (Tm), the temperature at which the enzyme was inactivated 50% after 10 minutes (Table 1) . As can be seen, the Glu408-Pro mutation was greatly reduced, the Asp345-Pro mutation is not significantly altered and the Ser30- * Pro mutation increases GA stability. It should be noted that although Table 1 shows that the mutant GA Asp345-Pro demonstrates slightly increased? G 'and Tm, these changes are generally not significant or that the mutant GA Asp345-Pro is more stable than the wild type since the kds for this enzyme mutant at two well separated temperatures (65 ° and 75 ° C) are essentially indistinguishable from the wild type (Figure 1). The proline substitution mutations had different thermostabilities when measured by their resistance to irreversible thermal inactivation. When compared to wild-type GA, Glu408-* Pro decreases, Asp345 ^ Pro does not significantly alter and Ser30 Pro increases GA stability (Figure 1 and Table 1). GA destabilized Glu408-Pro. As first suggested by Schimmel and Flory [1968] and has been expanded by others [MacArthur and Thornton, 1991; Hurley et al., 1992] proline not only restricts the values f ,? for the site in which they exist, but also the values f ,? of the preceding residue. These reports suggest that the values (f,?) For the residue preceding proline should be restricted to approximately f = -180 ° to -55 ° and f = 55 ° to 180 ° or f = -180 ° to -55 ° and? = -30 ° to -70 ° for all residues in Xaa-Pro except for Xaa-Gly, for which the foregoing still applies, but extends to include f = 45 ° to 180 °. In the catalytic domain structure published A. awamori var. XI 00 [Aleshin et al., 1992], Asp408 (f = -65 °,? = 146 °) which aligns with Glu408 in A. awamori GA, has f values? within ranges acceptable for proline. However, the preceding residue Gly407 (f = 80 °,? = -5 °) has f ,? outside of acceptable ranges for the positions preceding proline. It is not surprising then that the Glu408-Pro destabilizes GA. Additionally, X-ray crystallography suggests that position 408 in the closely related A. awamori var.

X100 GA2, is located within a β-strand; a site not well suited for proline substitution. Asp345 (f = -65 °,? = -26 °) and the preceding Thr344 (f = -116 °,? = 178 °) have values of angle f ,? disposed well within allowable values for proline substitution at position 345. However, the mutant AG Asp345-Pro does not demonstrate stability significantly different from wild type GA. This is particularly unexpected since position 345 is at the N-terminus of an a-helix2, - a previously demonstrated position that is particularly favorable for proline substitution [Watanabe et al., 1994]. Ser30 (f = -49 °,? = 130 °) is preceded by Val29 (f = -127 °,? = 46 °), both of which have acceptable values of angles f,? except Val? = 46 ° which is slightly smaller than the ideal for substitution of proline at position 30. In summary, when expressed in Saccharomyces cerevisiae, Glu408 ^ Pro greatly decreases, Asp345 ^ Pro, does not significantly alter and Ser30 ^ Pro strongly stabilizes the enzyme. The mutant GA Ser30 ^ Pro showed a significantly decreased rate of irreversible thermal inactivation when analyzed between 65 ° and 77.5 ° C without decreased enzyme activity. At 65 ° C, a 1.7-fold decrease in thermal inactivation rate coefficients is seen and the activation energy for thermal inactivation is increased by 1.6 kJ / mol relative to the wild type GA. EXAMPLE 2 DISULFIDE LINKS OF ENGINEERING The following Example is of methods and procedures that are used in the analysis of an individual mutation of a glucoamylase. The process of thermoinactivation of GA is considered to be dominated by the formation of enzymes with incorrect conformation [Munch and Tritsch, 1990]. Previous work supports this hypothesis. Site-directed mutagenesis has been employed to eliminate peptide deamidation and hydrolysis sites Chen et al., 1994 a, b). The corresponding mutations Asnl82 ^ Ala and Asp257-Glu have reduced irreversible thermal inactivation rates at pH 4.5 below 70 ° C but increase speeds above 70 ° C. In this way GA thermoinactivation is predominantly caused by "encrypted" structures rather than deamidation and hydrolysis of peptides. In addition, mutations Glyl37-Ala, Glyl39-Ala and Glyl37 / 139-Ala, made to reduce helix flexibility, showed increased thermostability up to 75 ° C (Chen et al, 1996) apparently by slowing the formation of incorrect structures. To improve the thermostability of protein by avoiding the formation of incorrect structures, several strategies have been proposed including introducing covalent bonds such as disulfide bonds (Perry and Wetzel, 1984, Wetzel, 1987, Matsumura et al., 1989, Clarke and Fersht, 1993). There is a total of nine cysteine residues in A. awamori GA, eight of which form disulfide-linked pairs, which are considered to improve the folding and stability of GA, residues 210 and 213, 262 and 270, 222 and 449 [Aleshin et al., 1992] and 509 and 604 [Williamson and collaborators, 1992b]. In this example, additional disulfide bonds are introduced into GA to explore the thermostability effect and catalytic activity. Engineered disulfide-binding mutants designated A27C / N20C (abbreviated S-S) and A471C / T72C were constructed. The new disulfide bond formed by A27C / N20C connects the C-terminus of helix 1 (Asn20) and one spin, where the Ala27 residue is located, while A471C / T72C bridges the N-terminus of helix 3 and the waste end 30 region of highly O-glycosylated band as a whole. Disulfide bonds form spontaneously after fermentation and have different effects on GA thermostability and catalytic activity. Site Directed Mutagenesis: Site-directed mutations are performed as previously described. Oligonucleotide primers are: 5 '-CGT ACT GCC ATC CTG TGT AAC ATC GGG GCG GA-3' (N20C, AAT-TGT) (SEQ ID NO: 6), 5'-ATC GGG GCG GAC GGT TGT TGG GTG TCG GGC GCG-3 '(A27C, GCT-TGT) (SEQ ID NO: 7), 5' -CGA AAT GGA GAT TGC AGT CTC-3 '(T72C, ACC-TGC) (NO. SEC ID: 8), 5 '-G AGT ATC GTG TGT ACT GGC GGC ACC-3' (A471C, GCT-TGT) (SEQ ID NO: 9), with underlined letters indicating mutations nucleotide SDS-PAGE and Tio-titration: SDS-PAGE is carried out using 10% polyacrylamine gels with thickness 0.75 mm following the method of Garfin [1990]. For thio-titration, GA at 2 mg / ml concentration is denatured by boiling in denaturing solution containing 2% SDS, 0.08 M sodium phosphate (pH 8.0) and 0.5 mg / ml EDTA [Habeeb, 1972] with or without 50 mM DTT [Pollitt and Zalkin, 1983] for 10 minutes The denatured GA (reduced or not reduced) is concentrated using Centricon 30 concentrators (Amicon, MA, USA) and the reduced GA is applied to Bio-spin 30 chromatography columns. (Bio-Rad, CA, USA) precompensated with denaturing solution to remove DTT The resulting solution as well as the unreduced denatured GA sample are divided into two portions, one portion used for a protein concentration assay and the other portion is tested for the reduction by mixing with 4 mg / ml DTNB in denaturing solution with a volume ratio of 30: 1 followed by incubation at room temperature for 15 minutes, and absorbance measurement 412 nm with a molar adsorn value of / 13,600 M "1 cm "1 [Habeeb, 1972]. GA activity assay: As described hereinabove, maltose is used as a substrate in enzyme kinetics studies, with concentrations in the range from 0.2 Km to 4 Km at 35 ° C and pH 4.5 as previously described [Chen et al. , 1994b]. Kinetic parameters were analyzed by the ENZFITTER program. In residual enzyme activity assays, the conditions are the same as in the enzyme kinetics studies, except that they are a concentration of maltose (4%) is used as a substrate. Specific activity assays are carried out with 4% maltose as a substrate at 50 ° C and pH 4.5. One unit (IU) - is defined as the amount of enzyme required to produce 1 μmol of glucose per minute under the conditions of the assay. To compare the temperature oum of catalytic activities of wild type and mutant GA, activities at pH 4.5 with 4% maltose were tested as a substrate at different temperatures. Irreversible thermoinactivation: As previously described, purified or mutant wild-type GA proteins were incubated at five different temperatures of 65 ° C to 75 ° C at intervals of 2.5 ° C to 40 μg / ml in 0.05 M NaOAC buffer (pH 4.5 ). At six different points in time, aliquots of the incubation enzyme were removed, cooled rapidly in ice, stored at 4 ° C for 24 hours and tested for residual activity. The irreversible thermoinactivation of GA obeys first-order kinetics [Chen et al., 1994b]. The thermoinactivation speed coefficients, Kd, were determined as previously described [Chen et al., 1994b]. Computer Modeling and Three-dimensional View of Mutated Residues: GA Candidate Wastes A. awamori to form disulfide bond were modulated with the crystal structure of A. awamori var. Xl OO GA [Aleshin et al., 1992] (Igly in the Brookhaven protein data bank) as reference by the SSBOND program (Hazes and Dijkastra, 1988) installed on a DEC 3100 workstation. Selection of Mutation Site: waste Asn20, Ala27 and Thr72, Ala471 are chosen to be replaced with cysteine. After analysis of the crystal structure of A. awarpori var. Xl OO GA [Aleshin et al., 1992] by the SSBOND program, 132 pairs of residues are found to be potentially sites for a disulfide bond. Pairs containing glycine were discarded in consideration that glycine may be required for flexibility at that site. Also, the residues involved in hydrogen bonds and electrostatic interactions were eliminated. Residues 20 in pairs with 27 as well as 72 in pairs with 471 were chosen as candidates for disulfide bond formation according to geometric analysis. Alignment of amino acid sequence between related GAs showed that there is a disulfide bond between position 20 and 27 in Neurospora crassa [Coutinho and Reilly, 1994b], which suggests that introducing disulfide bond between positions 20 and 27 will not cause unfavorable interactions in A. awamori GA. In addition, the 20/27 disulfide bond will link the C-terminus of helix 1 and the conserved SI fragment of GA involved in substrate binding [Coutinho and Reilly, 1994a] to form a loop, near another very critical loop for catalysis containing Trp 120, a residue involved in the binding of substrate [Sierks et al., 1989]. Therefore, the proposed 20/27 disulfide bond is expected to stabilize GA by maintaining the correct conformation for catalysis and substrate bonding. Another additional candidate for a disulfide bond pair was between positions 471 and 72. This disulfide bond will link the N-terminus of helix 3 and the terminus of residue 30 (440-470) highly O-glycosylated band region to form a loop . This disulfide bond will also make an additional bond between the catalytic domain and the O-glycosylated linker. This O-glycosylated linker has been shown to be important for GA thermostability in limiting the available conformational space to the unfolded peptide GA [Semimaru et al., 1995 and Williamson et al., 1992]. This disulfide bond can have a global effect on the thermostability of GA due to this bond. The -OH group of secondary chain of Thr72 in A. awamori var. Xl OO GA [Aleshin et al., 1992] is bonded with hydrogen to the N-atom of Asp73 backbone. In A. awamori GA, however, serine is found in -73 residue instead of Asp. It is possible that the hydrogen bond between residues 72 and 73 does not exist in A. awamori GA and therefore replacing Thr72 with Cys will not disturb this interaction. This hydrogen bonding is apparently not critical for GA since Thr72 is replaced by Ala, Lys or Val in other GAs [Coutinho and Reilly, 1994b]. Engineering Disulfide Links Formed Spontaneously: After GA purification, the engineering disulfide bonds or bonds are formed spontaneously by the following two approaches. First, mutant A471C / T72C has more rapid mobility than the wild type during SDS-PAGE under non-reducing conditions, suggesting that an additional disulfide bond forms a new loop by retarding migration. The possibility that a truncated enzyme is formed in this case is eliminated by DNA sequencing of the MALDI analysis and mutant cDNA. The MALDI data showed that the mutant GA had the same molecular weight as the wild-type GA. The A27C / N20C mutant had the same migration as wild type GA, which may be due to the additional loop caused by the disulphide bond. engineering is too small (seven residues) to affect migration. Second, the new disulfide bonds were demonstrated by titration with the thio group. Comparing the numbers of free thio groups before and after treatment of the DDT reduction reagent, the total disulfide bonds in mutant and wild type GA were deduced as reported in Table 2. GA A27C / N20C, and A417C / T72C wild type they have in total 8.6, 10.9 and 10.4 free thio groups respectively according to the proportion [SH] / molecule in the presence of the DTT reducing reagent (Table 2). In the absence of DTT, the numbers are 0.9, 0.9 and 1.3, respectively (Table 2). This suggests that the number of disulfide linkages between A27C / N20C and wild type A471C / T72C are 4, 5 and 5, respectively. Therefore, the introduced cysteine residues form disulfide bonds instead of remaining free thiols. Enzymatic Activity and Optimal Temperature of Catalysis: The enzymatic properties of the A27C / N20C and A471 / T72C double mutations are not changed compared to wild type at 35 ° C and 50 ° C as illustrated in Table 3, whereas single mutations have reduced significant activity. The mutants A27C / N20C and A471C / T72C have specific activities at 50 ° C and kinetic parameters at 35 ° C very close to wild type GA (Table 3). The single mutant A27C has increased slightly Km but the same Kcatt value as the wild type GA, and thus a reduced K ^ / K ratio of "30%." The N20C mutant has the same Km but both have decreased Kcat and Kcat / Km ratio and a specific activity decreased to 50 ° C greater than 50% Irreversible GA thermoinactivation: Irreversible thermoinactivation of wild type and mutant GA is studied at 65 ° C, 67.5 ° C, 70 ° C, 72.5 ° C and 77.5 ° C with irreversible first-order thermal inactivation coefficients Kd illustrated in Figure 2. The mutants A27C, A27C / N20C and A471C / T72C have smaller Kd values than wild type GA within the range of temperatures measured, which means that the activity deteriorated more slowly than the wild type, whereas the mutant N20C has a higher Kd value than the wild type at all temperatures except 75 ° C, which means that N20C deteriorated faster than the wild type . The Table 4 shows the enthalpy of activation (? Hi.), Entropy (? Si) and free energy of unfolding (? G-) at 65 ° C and 75 ° C of wild type and mutant GAs, calculated according to the theory of transition state. The enthalpies of N20C and A27C / N20C decrease by 42 and 24 KJ / mol respectively, while no significant change occurs for A27C and A471C / T72C. The mutants N20C and A27C / N20C have decreased entropy of 115 KJ / mol and 75 KJ / mol respectively, while the entropy of mutants A27C and A471C / T72C showed no significant changes. The mutant A27C and A471C / T72C has a "G" slightly "greater than wild-type GA at 65 ° C and 75 ° C (<0.5 kJ / mol), while" G 'of A27C / N20C was higher than that of wild type 1.5 and 2.2 KJ / mol at 65 ° C and 75 ° C respectively The N20C mutant had a? G1 decreased by 3.0 and 1.8 kJ / mol at 65 ° C and 75 ° C, respectively, compared to GA of Therefore, the engineered disulphide mutant A27C / N20C significantly increases the thermostability of GA compared to wild type GA, whereas single mutants produce either a slight increase (A27C) or a slight decrease (N20C). ) in thermostability The other mutant with disulfide bond has the same thermostability as wild type GA EXAMPLE 3 A27C / N20C MUTATION IN COMBINATION WITH OTHER MUTATIONS In previous studies the applicants have constructed the thermostable mutant G137A [Chen et al., 1996] and S436P (Li et al., 1996), which They have the potential to combine and improve thermostability in an additive way. In this example, these mutations are combined with each other and with A27C / N20C (S-S, Example 2) to test their effects (cumulative / additive) on thermostability and GA activity. Enzymatic Activity and Optimal Temperature of Catalysis: The combined mutants A27C / N20C / G137A and A27C / N20C / S436P have increased specific activity while mutant G137A / S436P has specific activity similar to wild type GA (Table 3). The double mutants A27C / N20C and A471C / T72C as well as the combined mutant A27C / N20C / G137 have changed optimum temperatures for catalysis. The activity assays relating to temperatures from 60 ° C to 74 ° C (Figure 3) showed that the wild-type mutant A27C / N20C and A471C / T72C had the highest activity at 71 ° C, 72 ° C and 72.5 ° C , respectively. From 60 ° C to 67.5 ° C, the wild-type mutant GA had very similar activities. However, when the temperature was above 70 ° C, their relative activities differ substantially. The mutants A27C / N20C and A27C / N20C / G137A had higher activity than the wild type consistently from 70 ° C to 76 ° C with a peak of 72.5 ° C, whereas the mutant A471C / T72C had lower activity than the wild type from 70 ° C to 71 ° C and 73 ° C to 74 ° C but higher than 72 ° C which is its optimum temperature. Thus, GAs mutant A27C / N20C, A471C / T72C and the 'A27C / N20C / G137A combined mutant had an increased optimal temperature over wild type GA by 1.5 ° C. Irreversible GA thermoinactivation: The irreversible GA thermoinactivation mutant and wild type is studied at 65 ° C, 67.5 ° C, 70 ° C, 72.5 ° C and 77.5 ° C, with irreversible heat-inactivation coefficients of first order Kd shown in Figure 2. The mutants A27C, A27C / N20C and A471C / T72C, A27C / N20C / G137A,, A27C / N20C / S436P and G137A / S436P have kd values smaller than wild type GA within the measured temperature range, which means that the activity deteriorates more slowly than the wild type, whereas the N20C mutant has a higher kd value than the wild type at all temperatures except 75 ° C, which means that N20C deteriorates faster than the wild type, Table 4 shows the activation enthalpy (? HX) , entropy (? SX) and unfolded free energy (? GX) at 65 ° C and 75 ° C of wild type GAs and mutants calculated according to the theory of transition state.

The G137A mutant with helix flexibility showed additive thermostability, when combined with either S436P or A27C / N20C. The combination S436P with A27C / N20C does not show additivity. EXAMPLE 4 ADDITIONAL STUDIES WITH COMBINED MUTATIONS To investigate, additionally if individual stabilizing mutations can cumulatively stabilize glucoamylase Aspergillus awamori (GA), mutant enzymes containing thermostabilizing mutant combinations were constructed. Previous work has shown that the following mutations stabilize GA as demonstrated by irreversible thermal inactivation rates when inactivated in the absence of carbohydrates: Ser30-Pro (S30P; Example 1), Glyl37-Ala (G137A), and Asn20-Cys / Ala27-Cys (which creates a disulfide bond between residues 20 and 27 and is therefore noted as S-S for convenience, Example 2). To investigate whether individual stabilizing mutations can cumulatively stabilize GA, additional combined mutant enzymes were prepared using these three mutations. Site Directed Mutagenesis: The combined mutant SS / S30P / G137A is constructed using the SS / S30P oligonucleotide listed above and a single-stranded DNA template derived from a vector II KS (+) with a DNA fragment 1.7 Kb XhoI-BamHI encodes for the catalytic domain GA, which already contains mutations conferring the amino acid substitutions S30P and G137A. The presence of the individual mutations is confirmed by sequencing and each mutated GA gene fragment is subcloned into YEpPM18 [Colé et al. , 1988] and transforms into S. cerevisiae. Thiol analysis: 10 nmol of wild-type GAs SS / S30P and mutant SS / S30P / G137A are incubated in 0.2, 5'-dithiobis (2-nitrobenzoic acid), 6M GdnHCl, and 50 mM Tris, pH 8 in duplicate [Fierobe et al., 1996]. The thiol concentration is calculated from a standard curve stabilized using 0-30 μM cysteine. Irreversible thermal inactivation: Wild-type and mutant GAs are subjected to thermal inactivation at six or seven temperatures between 65 ° and 80 ° C at 2.5 ° C intervals in duplicate. Following 24 hours at 4 ° C, the residual activities of the inactivated samples were analyzed at 35 ° C together with a corresponding sample that has not been inactivated [Chen et al., 1996]. Saccharification analysis: duplicate saccharifications were performed using heating blocks with agitation and hermetically sealed ampules to avoid evaporation. Eight μg / ml of wild-type and mutant GAs were tested using maltodextrin Maltrin DE 10 28% (w / v) in 0.05 M NaOAc pH 4.5 as substrate. At various times, samples were removed, appropriately diluted in 0.05 M NaOAc pH 4.5 and the reaction stopped by adding 100 μl of diluted sample to 40 μl of 4.0 M Tris-Cl, pH 7.0. The glucose concentration is determined by a 'glucose oxidase / dianisidine assay' [Banks and Greenwood, 1971]. RESULTS Enzyme activities Table 5 shows the specific activities of wild type and mutant GAs at 50 ° C and pH 4.5 using maltose as substrate. None of the mutant GAs showed reduced enzyme activity and the mutants S30P / G137A and S-S / S30P / G137A were somewhat more active than the wild type at 50 ° C. To further investigate this observation, the activities of these mutant enzymes were tested at various temperatures between 35 ° and 68 ° C (Figure 4). The mutant GAs S30P / G137A and S-S / S30P / G137A are more active than the wild type at all temperatures examined. Thiol Analysis The formation of a disulfide bond between positions 20 and 27 in the mutant GA Asn20-Cys / Ala27-Cys has been confirmed (Example 2). Table 6 shows the results of thiol analysis for the combined mutants S / S30P and S-S / S30P / G137A. GA A. awamori, has a free cysteine at position 320. The combined mutant GAs show slightly higher thiol content per molecule than the wild type which may reflect less complete disulfide bond formation between positions 20 and 27. However, if the disulfide bond is completely disarmed, the [SH] / protein will be expected to increase to approximately three with the addition of the two free cysteine residues. Therefore, we conclude that the disulfide bridge is formed at 70-80% of the expected theoretical yield for complete formation. Irreversible Thermal Inactivation Wild type and mutant GAs are subjected to thermal inactivation at pH 4.5 between 65 ° and 80 ° C. Semi-logarithmic plot of residual activity against activation time produces inactivation velocity coefficients (kd). Figure 5 shows the effect of temperature in kd for wild type and mutant GAs. As can be seen, the combined mutants are significantly more stable than the individual mutant enzymes. Additionally, the temperature at which the enzymes were inactivated at 50% after 10 minutes (Tm), is calculated by extrapolation from the thermal inactivation tracings and transition state theory is used to calculate the activation energies for inactivation thermal (? G '). Table 7 shows the changes in? G '(?? G') and Tm for the mutant GAs combined with respect to wild type GA. These data clearly demonstrate that combining the individual stabilizing mutations can cumulatively stabilize the enzyme. Sacrifice Analysis Figure 6 shows the saccharification analysis results at 55 ° C and "65 ° C for wild-type GAs S30P / G137A and SS / S30P / G137A, using maltodextrin substrate DE 10 industrial Maltrin MlOO (28 % p / v) from Grain Processing Corporation, complete conversion of maltodextrin DE 10 28% w / w glucose will result in a 1.71 M glucose syrup, however prior saccharification analysis in our laboratory has shown that wild type GA results in maximum theoretical glucose yield of approximately 90% at 55 ° C (not shown) At 55 ° C, no significant difference in glucose production is observed between the wild-type and mutant enzymes, however, at 65 ° C the GAs mutants produce 8-10% more glucose than the wild type, although none of the enzymes tested produce as much glucose as at 55 ° C probably due to thermal inactivation at the high reaction temperature.

In summary, these data show that the double mutant enzyme S30P / G137A was more stable than any single mutant GA when analyzed by resistance for irreversible thermal inactivation between 65 ° C and 80 ° C. The combined GA mutant S-S / S30P was also more stable than in either S30P or the mutant GAs S-S. The combined SS / S30P / G137A mutant was the most stable GA variant constructed, particularly at temperatures above 70 ° C when inactivated in "a buffer system lacking mono or polysaccharide." Saccharification analysis showed that mutant enzymes perform better at elevated temperatures than wild type GA Importantly, none of the combined mutant GAs showed decreased enzyme activity when analyzed at 50 [deg.] C. Discussion Mutation sites As described in Example 2, Asn20-* Cys mutations and Ala27-Cys form a disulfide bond between the C-terminus of an a-helix and an extended loop between the a helices one and two S30P and G137A are designed to stabilize the enzyme by reducing its entropy of unfolding conformation and are the most stabilizers in a series of substitution mutations proline (Xaa-Pro) and Gly-Ala, respectively Ser30 is located in the second position of the ß turn of type II in a loop extended between a-helices one and two and Glyl37 is located in the middle of the fourth a-helix. It is of particular importance to note the positions of S30P and the mutations forming disulfide linkage. The disulfide bond is formed between positions 20 and 27; relatively close to position 30. The fact that both mutations forming disulfide bond and S30P stabilize GA, suggests that this region of the enzyme is critical for irreversible thermal inactivation and may represent a region of local cleavage important for thermal inactivation. Additionally, previous researchers have suggested that a disulfide bond should not be engineered into four amino acids of a proline in a primary sequence [Balaji et al., 1989]. This Example demonstrates that this rule is not absolute since the thiol analysis shows that the disulfide bond is formed in the combined mutants SS / S30P and SS / S30P / G137A and the thermal inactivation studies show that the stabilizing effects of the mutations, They were cumulative. Cumulative stabilization Previous work by the applicants has shown that combining two stabilizing mutations does not necessarily stabilize GA [Chen et al., 1996]. The present study, however, demonstrates that combining stabilizing mutations, including mutations very close to each other in the protein, can cumulatively stabilize GA as measured by resistance to irreversible thermal inactivation. The mutant S30P / G137A showed more than additive stabilization at low temperatures (65 ° -70 ° C), but less than additive stabilization at high temperatures (77.5 ° -80 ° C) (Figure 5A and Table 7). At 80 ° C, the inactivation rate for the combined mutant S30P / G137A was almost identical with the single mutant protein S30P. This indicates that both regions are very important for thermal inactivation at low temperature, but at high temperatures the inactivation becomes governed by other processes. It was somewhat surprising that combining S30P with mutations that form disulfide bonds result in cumulative stabilization. This is not only because the engineering disulfide bond is as close to the engineering proline as discussed above, but also because both are targeting the same region of the protein (ie, the extended loop between -helices one and two). It is expected that either the disulfide bond or S30P stabilizes this region to the fullest, and further stabilization at this site will not result in a functionally more stable enzyme. As can be seen in Figure 5B, this was not the case. Combining the mutations results in an approximately additive stabilization at all temperatures examined between 65 ° C and 80 ° C. The combined mutant S-S / S30P / G137A was not more stable than S30P / G137A GA at low temperatures (65 ° -70 ° C), but was slightly more stable at higher temperatures (75 ° -80 ° C) (Figure 5C and Table 7). Interestingly, S-S / S30P GA is also more stable than S30P / G137A GA at high temperatures. Therefore, it appears that the introduced disulfide bond is particularly effective in stabilizing GA at high temperatures. EXAMPLE 5 INDUSTRIAL APPLICATION To determine whether thermal stabilizing mutations: S30P / G137A and S-S / S30P / G137A improve GA performance under industrial conditions, wild type enzymes and mutants are subjected to high temperature saccharifications (Figure 6). Saccharification analysis showed that the mutant enzymes outperformed the wild type at 65 ° C, but not at 55 ° C, probably due to their increased stability. Conclusion The double mutant S30P / G137A cumulatively stabilizes GA as demonstrated by decreased irreversible thermal inactivation rates relative to any single mutant enzyme when analyzed between 65 ° C and 80 ° C. Similarly, the combined mutant S-S / S30P also demonstrates cumulative stabilization. The combined mutant S-SS30P / G137A was more stable than any of the "double" mutants, particularly at temperatures above 70 ° C. The combined mutant S-S / S30P had the same activity as the wild type and the S30P / G137A and S-S / S30P / G137A mutants increase the enzyme activity by 10-20% when tested between 35 ° and 68 ° C. The mutant GAs S30P / G137A and S-S / S30P / G137A decrease the thermal inactivation rates approximately three times compared to wild type when inactivated in the presence of 1.71 M glucose at 65 ° C. Additionally, at 55 ° C, no difference in glucose yield is observed between these mutant GAs and wild type for saccharification of the industrial substrate Maltrin MlOO, while at 65 ° C, GAs S30P / G137A and SS / S30P / G137A produce 8 -10% more glucose than the wild type. EXAMPLE 6 MUTATIONS WITH INCREMENTED SELECTIVITY Interactions between substrates and charged residues in sub-sites' 1 and 2 of GA play a very important role in substrate specificity since the catalytic site is located between these sites. Therefore, mutations were designed and analyzed to determine residues within these regions, where mutations will increase the selectivity of the enzyme reaction. In addition, several mutations that were designed to have thermostability were also classified for selectivity, as well as mutations designed to increase the optimal pH. Site-directed mutagenesis: site-directed mutagenesis is performed as described here before. The following mutagenic oligonucleotide primers were synthesized at Iowa State University Nucleic Acid Facility: 5 '-GGT CTC GGT GAG CCC AGG TTC AAT GTC GAT-3' (Lysl08- * Arg; SEC ID NO.:10), 5 '-GGT CTC GGT GAG CCC ATG TTC AAT GTC GAT-3 '(Lysl08- * Met; SEC ID NO .: 11), 5' -GAG GAC ACG TAC TGG AAC GGC AAC CCG-3 '(Tyr312-Trp; NO. SEC.: 12), and 5 '-TAC CCT GAG GAC ACG TAC AAC GGC AAC GGC AAC TCG CAG GGC AAC CCG TGG TTC CTG TGC-3' (311-314 Loop; SEQ ID NO: 13), the sub-striped letters indicate the nucleotides changed or added. Results Kinetics of Enzyme As illustrated in Table 11, the kcat and K ^ kinetic parameters for the hydrolysis of G2 to G7 as well as iG2 in 0.05 M acetate buffer, pH 4.4 at 45 ° C, are given in Table 8. mutant 311-314Loop had Jcat values 50-80% for all substrates a- (1, 4) bound and only 30% for iG2, values KM 50-75% for all substrates. The kcat values for Glyl37- * Ala / Ser30- * Pro GA are 10-30% more generally that the wild-type GA for all substrates. The KM values of Glyl37- > Ala / Ser30-Pro GA are approximately half to two times for all bound OI- (1.4) substrates and essentially reach the wild-type level for iG2. The Kca_ values for the engineering GA to transport the triple mutation SS / Glyl37-Ala / Ser30-Pro, are in the range of 80 to 120% in general for all substrates, and the K ^ values are 30-80% for all substrates compared to wild type GA. The kcat values for S-S are 85-110% for all substrates and values "M SS GA are generally 90- 110% for all substrates, however, KM SS GA values are 140% for G5 and 190% for G6.Kcat / KH values are 75-105%, 60-110%, 60-110%, and 60-120% for the Tyr312-Trp mutation, the Ser30-Pro / Glyl37-Ala dual mutation combined, the triple mutation SS / Ser30-Pro / Glyl37- * Ala combined and the Engineering GAs SS respectively Catalytic efficiencies for the GA 311-314 Loop are 85-120% for all bound a- (1, 4) substrates and only 50% for iG2 compared to wild type GA.

Table 8 shows the ratios of the catalytic efficiencies for G2 to iG2 for wild type and mutant GAs. Engineering GAs with the mutation 311-314Loop and the Lys108-* rg mutation have the highest (240%) and lowest (20%) catalytic efficiencies to linked substrates a- (1,4) on a- (1, 6), respectively. The engineering GAs with the Tyr312- * Trp and S-S mutations show increases of 50% and 20% for this ratio respectively. All other mutants have lower proportions, indicating a more poor a- (1, 4) hydrolytic ability with respect to a- (1, 6) hydrolytic ability than wild type GA. Hydrolysis of Mal tool igosacárido gone of engineering with the mutation 311-314Loop or with the mutation S-S had the highest average glucose yields (Figure 7). GA 311-314 Loop had the lowest initial speeds for glucose production (64%, 61%, and 82% compared to wild-type GA to , 45, and 55 ° C, respectively) due to specific activity of only 60% wild-type GA (data not shown). Glucose concentrations decreased after reaching maximum values due to conversion to ol'igosaccharides. Glucose Condensation Reactions IG2 concentration profiles in 30% (w / v) glucose concentration reactions at 35, 45 and 55 ° C were analyzed. Engineering GAs with the Lysl08Arg mutation had the highest and the 311-314Loop mutation as well as the S-S mutation at the lowest equilibrium iG2 concentrations at all three temperatures. GAs Tyr312-Trp, Ser30- Pro / Glyl37-Ala, and S-S / Ser30- * Pro / Glyl37? Ala essentially exhibit the same equilibrium concentrations in iG2 as wild type GA. For all tested thermostable GAs, Ser436-Pro, S-S / Ser436-Pro, S-S / Glyl37-Ala and Glyl37-Ala / Ser436-Pro, all achieved higher equilibrium iG2 concentrations than wild-type GA. Table 9 shows the initial rates of formation of iG2 in 30% (w / v) glucose condense reactions. GAs mutants S-S and 311-314Loop have the lowest initial velocities at all three reaction temperatures tested. GA mutant Lysl08 Arg showed the highest initial rates among all mutant GAs tested at all three reaction temperatures. All tested thermostable GAs except Ser30-Pro / Giyl37?, and S-S / Ser30- * Pro / Glyl37-Ala had much higher initial rates than wild-type GA at 35 ° C, but were off at slightly higher or almost the same rate as wild-type GA at 55 ° C.

The specificity for a synthesis of a- (1,) -link on a hydrolysis of - (1, 4) -link. The ratio of the initial rate of production of iG2 in a glucose condensation reaction to 30% (w / v), that deformation of glucose in hydrolysis of maltodextrin DE 10 to 30% is calculated to estimate the selectivity for the synthesis of products ( l, 6) - linked to the hydrolysis of substrates a (1, 6) -linked. These proportions of iG2 / glucose and their relative proportions for wild type and mutant GAs are given in Table 9. Mutants K108R and SS show the highest and lowest relative proportions between wild type GAs and all mutants in all reaction temperatures, respectively. Therefore, K108R had more specificity (1, 6) -links than a- (1, 4) -links and GA SS had more affinity for a- (1,4) -links than cc- (1, 6) - links The GA 311-314 Loop also showed very low relative proportions at these three temperatures. EXAMPLE 7 ANALYSIS OF MUTATION WITH ADDITIONAL SELECTIVITY Using the methods as previously established, additional mutations were classified by selectivity as illustrated in Table 10 and Figures 8 and 9.

Enzyme kinetics: The kinetic parameters are seen in (• fccat and -Km) for the hydrolysis of bound isomaltose a- (1, 6) and maltooligodextrins a- (1, 4) -linked (DP2-7) at 45 ° C and pH 4. 4 is given in Table 10. Mutant Y175F was active. The kcat and K ^ values were 83-141% and 106-171%, respectively of that of the wild type for the different tested substrates and catalytic efficiencies were 69-102% of the wild type. The R241K mutant was also active. The mutant S411G was highly active. The kcat and K ^ values were 93-129% and 83-203% respectively of the wild type for the different tested substrates and catalytic efficiencies were 55-122% of the wild type. The S411A mutant had a similar catalytic efficiency ratio as the wild type. Mutants Y116W, R241K, and S411G had decreased catalytic efficiency ratios compared to that of wild-type GA. Hydrolysis of 10 Maltodextrin: At 55 ° C, the highest glucose yield was approximately 95% achieved by GA engineered with mutant S411A at 216 hours compared to the wild-type yield of approximately 90% (Figure 9). All GAs except S411A achieved their highest glucose yields quickly. The glucose yield of S411A increases slowly over a prolonged period of time. The initial glucose production rates at 55 ° C were 5 to 8 times higher than those at 35 ° C. Glucose condensation reaction: Glucose condensation reactions were used to study the ability of wild-type and mutant GAs to synthesize isomaltose at high concentrations of glucose (Figure 8). The same concentrations of glucoamylases (2.64 μM) were used as in the hydrolysis of DE 10 Maltodextrin. At 55 ° C, despite the different initial production rates of isomaltose for wild type, R241K and Y175F, the production of isomaltose reached almost the same concentration at the last point in time for these three mutant GAs (Figure 8), indicating that the production of isomaltose was close to the equilibrium state. The production of isomaltose for S411A and S411G was much lower than the wild type and almost linear as well as at 35 ° C. Unexpectedly, the production of isomaltose for Y116W had a different (lower) equilibrium state compared to the wild type. The initial production rates of isomaltose at 55 ° C were 5 to 7 times higher than those at 35 ° C. R241K had a decreased initial rate of isomaltose production at 55 ° C compared to that of wild-type, and also had a smaller (approximately 5-fold) increase in the initial rate of isomaltose production from 35 ° C to 55 ° C, compared with the increase of wild type (approximately 7 times). Y116W, Y175F, S411A and S411G had increased initial production rates of isomaltose or about 7, 6 and 5 times respectively from 35 ° C to 55 ° C. Selectivity: The ratio of the initial production rate of isomaltose (from glucose condensation reactions) to the production of glucose (from hydrolysis of DE 10 maltodextrin) is calculated to evaluate the selectivity for the synthesis of products a-1, 6-linked against the hydrolysis of a-1, 4-linked substrates. This ratio represents the ability of a GA to synthesize isomaltose at a standardized level of hydrolytic activity of DE 10 maltodextrin. The mutants Y175F, S411A S411G had a decreased proportion of the initial rate of production of isomaltose with respect to glucose production in 12%, 35% and 56% at 35 ° C respectively and a proportion decreased by 24%, 60% and 62%. % at 55 ° C respectively compared to the wild type. R241K had a very similar proportion to the wild type at both 35 ° C and 55 ° C.

EXAMPLE 8 MUTATIONS TO PROVIDE pH OPTIMIZATION Using the methods as previously established, the additional mutations S411G, S411A, S411C, S411H, S411D were classified for increased optimal pH as illustrated in Figure 10 and Tables 11 and 12. Enzyme kinetics The kcat and Km kinetic parameters for the hydrolysis of maltose a-1, 4-linked and maltoheptaose and isomaltose a-1, 6-linked at 45 ° C and pH 4.4 are given in Table 11. Glucoamylase S411G mutant was highly active in comparison with the wild type, with kcat and Km 13 - 30% and 11 - 59% respectively in the substrates tested. The catalytic efficiencies (kcat / Km) were 71 - 116% with respect to the wild type. The S411A mutant maintains 65-74% of the wild-type catalytic efficiency with a slightly diminished kcat and a slightly increased Km. The mutant S411C maintains 54-73% of the catalytic efficiency of wild type with a decrease in both values kcat and Km. Since the mutants S411H and S411D only have approximately 6-12% of the wild-type catalytic efficiency resulting from a severely decreased kcat and an increased Km, the kinetic parameters for the hydrolysis of isomaltose were not determined. Only mutants S411H and S411D had large increases (5.5 to 7.5 kJ / mol) in the transition state energy? (? G), for the hydrolysis of maltose and maltoheptase. Large increases in transition state energy indicated that the introduction of histidine or aspartic acid at position 411, substantially destabilizes the binding between GA and substrate in the transition state. PH activity dependency GA The kcat / Km and kcat kinetic parameters of maltose hydrolysis by wild-type and mutant glucoamylases at different pH values were calculated from initial velocities obtained at low concentrations (less than 0.2 km ) and high (greater than 10 km) of maltose. The effects of pH in kcat / Km and kcat of maltose hydrolysis were used to determine the pK values (Table 12) of both free enzymes and enzyme-substrate complexes. Although wild-type GA had a higher catalytic efficiency (kcat / Km) than all mutant glucoamylases at all tested pH values, the S411G and S411A mutants had higher kca values than those of wild type at some pH values. The S411H and S411D complexed with maltose and without complexing showed bell-shaped curves narrower than those of the wild type. The effects of pH on the hydrolysis of maltoheptaose by wild-type GAs, S411G and S411A, were measured to further investigate the change of optimal pK values and pH of enzyme-substrate complexes using a long-length substrate.

"" Surprisingly, not only S411G, but also S411A were highly active compared to wild type at the optimum pH. Values of pKx for wild type GA (ionization of the catalytic base) were 2.77, 2.11 and 2.6 for the free enzyme, the maltose-complexed form and the maltoheptaose-complexed form, respectively. The pK2 (catalytic acid ionization) wild type values were 5.80, 5.85 and 6.78 for the free enzyme, the maltose complexed form and the maltoheptaose complexed form respectively [Bakir et al., 1993, Hiromi et al., 1966, Sierks. and Svensson, 1994]. In comparison with the wild type, the S411G mutation increased the pKx of both the maltose complexed form and the maltoheptaose complexed form, by approximately 0.6 unit, whereas S411G had no effect on the pK2 either of the enzyme-substrate complex and it had only a minor effect on pKx and pK2 of the free enzyme.

The combined effect of S411G on x and pK2 was an optimum pH increased for both the maltose complexed form and the complexed form with maltoheptase at approximately 0.3 unit. The S411G mutation, however, had no effect on the optimal pH of the free enzyme. S411A and S411C had very similar effects on the pH dependence of maltose hydrolysis. S411A and S411C increase the pKx of the free enzyme and the complexed forms with maltose- by 0.3 - 0.5 and 1.21 units, respectively. Surprisingly, S411A and S411C also increased pK, of the complexed form with maltose by approximately 0.5 unit. In addition, S411A increased the pKx and pK2 of the complexed form with maltoheptaose by 1.31 and 0.4 unit, respectively. S411H increased the pKx of the free enzyme and the complexed form of maltose by 0.33 and 1.47 units, respectively; however, the pK2 of the free enzyme and the complexed form with maltose decreased by 0.79 and 1.16 units, respectively. S411D increased the pKa of the free enzyme and the complexed form with maltose by 0.36 and 1.23 units, respectively. S411D also decreases the pK2 of the complexed form with maltose by 0.32 unit. For wild type GAs, S411G and S411A, the pKx, pK2 and pHopt values for maltoheptaose complexed forms were higher than those of the corresponding maltose complexed forms at approximately 0.5, 0.9 and 0.7 unit, respectively. For S411G and S411A, the increments in optimal pH (compared to that of the wild type), obtained using the long-length substrate (maltoheptaose), were almost the same as those obtained using the short-length substrate (maltose). All five mutants at position 411 showed a displacement of 0.15 to 0.87 unit at the optimum pH of the substrate-enzyme complex, as compared to the wild type (Table 12), primarily due to increased pKx values. In comparison with other mutants, S411A was the pH mutant with the best performance. S411A increases the optimum pH by 0.84 unit while also maintaining a high level of both catalytic activity (kcat) and catalytic efficiency (kcat / Km). The hydrolysis of maltodextrin 10 The hydrolysis of maltodextrin 28% (w / v) is used to study the pH dependence of GA activity at a high concentration of long-length substrate. Maltodextrin 10 is a mixture of maltodextrin with an average (and higher) degree of polymerization of 10. The production of glucose by wild type glucoamylases and S411A during the hydrolysis of maltodextrin 10 to 11 different pH values, is determined and used to calculate the initial rates of glucose production at different pH values (Figure 10). The production of glucose increases following a hyperbolic curve. S411A had higher glucose production rates than the wild type when pH values were above 6.6 (Figure 10). Through this application, reference is made to various publications by Author and year and patents listed by number. Complete citations for publications are presented below. The descriptions of these publications and patents are hereby fully incorporated by reference in this application in order to more fully describe the state of the art to which this invention relates. The invention has been described in an illustrative form, and it will be understood that the terminology that has been employed is intended in the nature of description words rather than limitation. Obviously, many modifications and variations of the present invention are possible in light of the above teachings. Therefore, it will be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.

TABLE 1 Changes in? G * and Tm for the mutant GAs with respect to the wild type. G *? Bp Shape GA (kJ / mol.) (° C) Ser30- * Pro 1.6 1. .7 Asp345-Pro 0.5 0, .4 Glu408-Pro -7.2 -6 .7 TABLE 2 Summary of titratable sulfhydryl groups with DTNB in wild type and mutant GA with or without reduction DTT Enzymes [SH] / molecule No. of disulphide bonds * DTT + DTT- WT 8.6 0.9 4 A27C / N20C 10.9 0.9 5 A471C / T72C 10.4 1.3 5 * No. of disulfide bonds ([SH] / molecule (DTT +) [SH] / molecule (DTT -)) / 2 TABLE 3 Catalytic properties of wildtype and mutant GAs Form GA Activity Spec. Km XKm (IU / ma GA) (mM) 'Xl) (s 1mM "1) WTa 20.6 + 0.2 ° 0.72 + 0.03 8.67 + 0.17 12.0 A27C 14.9 + 1.1 0.86 + 0.11 8.02 + 0.45 9.3 N20C 8.1+ 0.5 0.70 ± 0.05 3.97 + 0.12 5.7 A27C / N20C 18.3+ 0.7 0.90 + 0.08 9.61 + 0.40 10.7 A471C / T72C 22.7+ 1.5 0.87 + 0.07 10.17 + 0.40 11.6 A27C / N20C / S436 22.5+ 1.8 N / Dc N / A N / A A27C / N20C / G137A 24.2+ 0.8 N / A N / A N / A G137A / S436P 25.0+ 0.9 N / A N / A N / A Produced in shake flasks b standard error not determined TABLE 4 Activation parameters for irreversible thermoinactivation of wild type (WT) and mutant GAs at pH 4. 5. Form GA? H *? S *? G4: (65 ° C)? G * (75 ° C) (kJ / mol) (J / mol.K) (kJ / mol) (kJ / mol) WTa 366 + 1 769 ± 4 105.7 98.0 A27C 370 + 15 780 + 44 106.3 98.5 N20C 324 ± 11 654 + 33 102.7 96.2 A27C / N20C 342 ± 16 694 + 46 107.2 100.2 A471C / T72C 365 ± 9 768 ± 26 106.0 98.3 A27C / N20C / S436P 352 ± 6 724 + 18 107.9 100.7 A27C / N20C / G137A 362+ 1 751 ± 2 108.4 100.9 G137A / S436P 362 ± 20 752 + 57 107.7 100.2 S436PC 351+ 8 723 + 24 106.2 99.0 G137Ad 330+ 6 661 + 17 106.5 99.9 produced by shake flask b standard error Li et al., 1996 d Chen et al., 1996 TABLE 5. Specific activities of wild type and mutant GAs Specific Activity3 Form GA (IU / ma) Type wild 21.1 + 0.1 S30P / Glyl37A 24.0 ± 1.2 SS / S30P 21.2 + 0.5 SS / S30P / G137A 24.5 + 0.2 a Standard deviation resulting from three or more assays TABLE 6. Thiol analysis of wild type and mutant GAs Form GA rProtein (uM) rSH] (μM) to TSH1 / [Protein] Wild type 10 8 0.8 SS / S30P 10 11 1.1 SS / S30P / G137A 10 13 1.3 Average of duplicate analysis TABLE 7. Changes in free energies for thermal inactivation (?? G *) and temperatures in which the enzyme is inactive 50% after 10 minutes (Tm) with respect to wild type GA Form GA (kJ / mol) ATindC) S30PD 1.6 1.7 G137AC 0.8 1.2 TABLE 7. (Continued) Form GA (kJ / mol) ATm (° C) S-Sd 1.2 1.4 S30P / G137A 4.5 3.5 S-S / S30P 3.5 3.2 S-S / S30P / G137A 4.4 3.9 a Calculated at 65 ° C b De Alien et al8 De Chen et al6. De Li et al1.

• • TABLE 8 Kinetic parameters of wild type and mutant GAs for hydrolysis of maltooligosaccharides DP 2-7 (G2-G7) at 45EC in 0.05 M acetate pH 4.4. Glucoamylase G2 G G4 G5 Ge G7 Wild type * cat is'1! 18.6 ± 0.4 ° 50.8 t 0.6 67.5 ± 1.9 61.5 + 0.33- 65.9 ± 1.2 81.5 + 1.8 M (mMl? .09 ± o.oe 0.353 ± 0.013 0.239 + 0.017 0.094 + 0.002 0.098 ± 0 .007 0.136 + 0.009 kcat / KM Is "1" ^ "1! 17.1 + 0.9 144 + 4 282 + 13 653 ± 10 671 + 36 599 + 27 10 Lysl08Arg 17.3 + 0.5 32.6 ± 0.9 46.6 + 1.6 • 51.7 ± 1.4 55.2 ± 1.4 86.2 + 3.1 1.52 + 0.11 0.570 + 0.038 0.383 ± 0.029 0.307 ± O.019 0.276 ± 0 016 0.481 ± 0.031 11.4 ± 0.6 57.2 i 2.5 122 ± 5 168 + 6 200 + 8 179 + 6 0.92 2.10 1.91 3.08 2.75 2.74 Tyr312Trp 15 fccat (s "1) 17.2 + 0.3 36.8 + 0.9 50.7 + 0.9 50.7 ± 0.8 56.0 + 0.8 63.3 + 0.6 00 KM imM) 0.940 ± 0.059 0 343 + 0.028 0.193 ± 0.010 0.100 + 0.006 0.108 + 0 005 0.103 + 0.003 fcca ^ M Is ^ mM "1) 18.3 ± 0.90 107 + 6 262 ± 9 508 + 22 519 + 20 617 + 1 1 ? (? G) (kJ mol "1) -0.16 0.67 0.17 0.57 0.58 -0.07 300 oop ^ ca I» "1 '14-7 ± ° -3 25-9 ± ° -6 34.1+ 0.8 43.0 ± 0.6 41.4 + 0.8 41.9 + 0.7 20 M (mM) 0.738 ± 0.055 0.234 ± 0.019 0.114 ± 0.008 0.072 + 0.004 0.064 + 0.005 0.083 + 0.005 kcat iCM Is "1 * -" 1) 20.0 ± 1.2 111 + 7 300 ± 17 598 + 28 642 ± 47 506 ± 25? (? G) (kJ mol "1) -0.35 0.60 -0.14 0.20 0.10 0.38 Ser30Pro / Glyl37? The kcat l» '1) 25.0 + 1.1 50.2 + 3.0 77.9 ± 2.2 77.7 + 1.6 77.0 ± 2.2 80.3 ± 2.2 (mM) 1.62 + 0.11 0.596 ± 0.010 0.261 + 0.020 0.175 í 0.011 0.204 + 0. 017 0.151 + 0.013 kcat / K (s * 1"" "1) 15.5 + 1.2 84.2 + 3.1 299 + 16 444 + 21 377 ± 23 533 + 37 25? (? G) 1.42 -0.15 1.02 1.52 0.31 TABLE 8 (continued) SS / Ser30 *? Ro / Glyl37Ala ¿cat t »" 1) 23.0 + 0.9 42.1 ± 1.0 72.0 + 2.1 72.2 ± 1. 0 79.5 i 1.7 81.5 ± 1.4 iCM (mM) 1.66 ± 0.07 0.470 ± 0.032 0.236 + 0.019 0.172 + 0.007 0.157 ± 0.011 0.198 ± 0.010 ¿ca / * M '1) 13.9 + 0.9 B9.6 + 4.2 305 ± 17 420 + 13 505 ± 26 410 ± 15? (? G) (kJ mol'1) 0.55 1.26 -0.21 1 16 0.75 '1.00 10 SS ca (s * 1) 20.7 ± 0.6 40.8 ± 0.9 72.1 ± 1.3 76.5 + 0.8 76.4 + 2.1 71.8 + 0.6 c » K '(mM) 1.16 * + 0.10 0.394 + 0.025 0.217 + 0.011 0.132 + 0.005 0.184 + 0.015 0.114 ± 0.003 kcat KM (s' ^ nM'1) 17.8 + 1.1 104 + 5 331 ± 12 579 + 16 414 ± 26 632 + 15 15? (? G) (kJ mol "1) -0.10 0.88 -0.42 0.32 1.28 -0.14 a Standard error b Transition state energy change? (? G) = -RG1? [(Kcat%) mut. kcat fM) w] 20 TABLE 9 Initial rates of glucose and isomaltose production in the hydrolysis of maltodextrin MlOO at 30% (w / v) and glucose condensations of 30% (w / v) respectively and their relative proportions for wild type and mutant glucoamylases at 35 ° C , 45 ° C and 55 ° C.

'Initial Speeds Enzymes Glucose3 (Gl) Isomaltose0 (iG2) (μg / mL.h) xlO ~ 3 (μa / mL, h) xlO3 35 ° C Wild type 21.5 ± 0.6C 289 ± 5 Lysl08Arg 22.0 + 0.4 969 + 12 Tyr312Trp 17.9 + 0.5 294 + 4 311-314LOOP 13.8 ± 0.4 128 + 3 Ser30Pro / Glyl37Ala 27.7 + 0.4 298 + 6 SS / Ser30Pro / Glyl37Ala 30.1 + 0.5 245 +6 SS 31.8 + 0.6 135 + 3 Ser436Pro 29.9 + 0.6 903 + 12 SS / Ser436Pro 31.7 + 0.5 824il2 SS / Glyl37Ala 35.2 + 0.6 982 + 15 Glyl37Ala / Ser436Pro 36.6 ± 0.7 776 + 10 45 ° C Wild Type 66.2 + 2.2 3880 + 60 TABLE 9 (Continued) Initial Rates Enzymes Glucose3 (Gl) Isomaltose0 (iG2) (μa / mL.h) xlO "3 (μcr / mL. H) xlO3 Lysl08Arg 50.2 + 2.0 6420 + 110 Tyr312Trp 52.6 + 2.1 3.360 + 60 311-314 Loop 40.4 + 1.8 1430 + 40 Ser30Pro / Glyl37Ala 76.3 + 2.7 3690 + 70 S-S / Ser30Pro / Glyl37Ala 84.3 + 3.0 3520 + 60 E-S 86.3 + 3.3 963 + 28 55 ° C Wild type 156+ 3 4890 + 80 Lysl08Arg 101 + 1 8200 + 120 Tyr312Trp 110 + 2 4440 + 70 311-314Loop 128 + 2 1890 + 50 Ser30Pro / Glyl37Ala 157 + 3 7200 + 110 S-S / Ser30Pro / Glyl37Ala 167 + 3 5690 + 100 S-S 164 + 3 1230 + 40 Ser436Pro 218 + 3 4710 + 80 S-S / Ser436Pro NDd 5130 + 100 S-S / Glyl37Ala 225 + 3 5720 + 100 Glyl37Ala / Ser436Pro 208 + 3 ND TABLE 9 (CONTINUED) Proportions Enzymes Proportions Relative proportions (iG, / Gl) xlQ6 ° C Wild type 13.5 1.00 Lysl08Arg 44.1 3.25 Tyr312Trp 16.4 1.21 311-314Loop 9.3 0.69 Ser30Pro / Glyl37Ala 10.8 0.80 S-S / Ser30Pro / Glyl37Ala 8.2 0.60 S-S 4.2 0.31 Ser436Pro 30.2 2.23 S-S / Ser436Pro 26.0 1.92 S-S / Glyl37Ala 27.9 2.07 Glyl37Ala / Ser436Pro 21.2 1.57 45 ° C Wild type 58.7 1.00 LyslOdArg 128 2.18 Tyr312Trp 63.9 1.09 311-314Loop 35.3 0.60 Ser30Pro / Glyl37Ala 48.4 0.83 SS / Ser30Pro / Glyl37Ala 41.7 0.71 SS 11.2 0.19 TABLE 9 (CONTINUED) Proportions Enzymes Proportions Proportions (JGdGDxlO6 relative 55 ° C - Wild type 31.3 1.00 Lysl08Arg 81.0 2.59 Tyr312Trp 40.5 1.29 311-314Loop 14.8 0.47 Ser30Pro / Glyl37Ala 45.8 1.47 SS / Ser30Pro / Glyl37Ala 34.1 1.09 SS 7.5 0.24 Ser436Pro 21.6 0.69 SS / Ser436Pro ND ND SS / Glyl37Ala, 25.4 0.81 Glyl37Ala / Ser436Pro ND ND 3 Samples were taken from hydrolysis reactions of MlOO 30% (w / v) in buffer NaOAc 0.05 M, pH 4.4, glucose concentrations were determined by the glucose oxidase method. Samples were taken from glucose condensation reactions at 30% (w / v ) in buffer NaOAc 0.05 M, pH 4.4, isomaltose concentrations were determined by HPTLC c Standard error d Not determined • XABLA 10 Kinetic parameters of wild type and mutant glucoamylase for hydrolysis of isomaltose and DP maitooligodextrins 2- 7 Substrate kcat / Km (G2) Enzyme Isomaltose Maltose Maltottose Altotetraose Maltopentaose Maltohexaose and Maltoheptaosa kcat / Km (? G2) (G2) (G2) (G3) (G4) (G5) (G6) (G7) Wild type 656 * .., (S "') Ü72 ± 00lk 204 ± 02 482 ± 07 645 ± 29 718 ± 19 737 ± 2,1 723 ± 09 10 Km (mM) 235 ± 06 101 ± 003 Ü 25 ± 0 Ul 1 0 lll ± 0017 01101 0010 0107 t 00IÜ 0083 ± 0004 k Km (S-mM-1) 0031 ± OOUl 203 ± 055 196 ± y 582 i 65 6i I ± 1 685 ± 47 870 ± 35 Y48F49W ND * c (S ') 0236 ± Ü0lo 199 ± 008 K. &ampnM) ND "99 ± 18 ND NI) NI) ND 49 ± 03 i? ÍS'mW1) 0024 ± 0003 0408 ± 0010? (? G) C (KJ mol ') 178 203 15 Y1I6 498 J, (s') ) 069 ± 002 117 ± (12 194 ± 03 509 ± 19 500 1 17 531 ± 19 560 ± 11 Km (mM) 288 ± 25 098 ± 006 020 ± 001 02 (1 ± 002 0132 ± 0 (114 0I43 ± 0017 ü 118 ± 0008 kr Km (S'mM1) 0024 ± ü 001 120 ± (160 98 ± 6 256 ± 17 378 ± 30 372 ± 32 475 ± 25? (? G) (KJ mol ') 067 139 181 217 115 162 160 YI75F 752 * t., (S- ') 102 ± 005 212 ± U2 400 ± 06 81) 1 1 1 796 ± 19 765 ± 15 721 ± 08 K "(m) 401 ± 43 113 ± 004 029 ± 002 01871 0012 0 I20 ± 0010 01131 0008 0095 ± 0004 20 k Km (S 'M') 0025 ± 0002 188 ± 05 136 ± 6 429 ± 19 6 ± 42 677 ± 37 761 ± 27 (? G) (KJmol ') 055 020 097 081 • 005 003 035 a Determined at 45 ° C in sodium acetate buffer 0.05 pH 44 b Standard error c Transition state energy changes? (? G) - -RTii \ [(^ CJ, / ?. ' , ")" U "/ (* CJl / A :,") l 25 d Not determined • TABLE 10 (continued) Subscription UKn (02) Enzyme Isomaltose 1 Maltose Maltotriose Maltothetraose Maltopentaose Maltohexaose Maltoheptaosa kJKm (IG2) IG2) (G2) (G3) (G4) (G5) (G6) (G7) R24IK 261 * c (S- ') 1 J4 ± 0 U8"201 1 (1) 168 110 m _ 72 707 1 21 758 1 27 806 ± 16 10 K "(mM) 393 ± 58 227 i (111 0621001 (Mi. ÜII9 (119 1 002 020 1 0U2 020 1 001 í? ÍS- ' rtiM-1) 0034 ± 0003 89 ± 0) 76 p 164 i IK 168 121 373 125 411 ± 16? (? G) C (KJ mol1) -028 219 251 i 16 152 1 1 1 8 S4II? 681 * t. , (S ') 063 ± 002 189 ± 0) 446 ± 01 585 ± 1.6 5) 1 1 12 54.7 ± 1.7 594 ± 06 K (mM) 279 ± 29 126 ± 006 04/1 (104 0 IB2 ± 0014 0120 ± ü 009 0 Ii5 ± 0.012 0104 ± 0.004 15 U ^^ mM '*) 0022 ± 0002 150 ± 05 941 154 322 ± 18 113 127 476 ± 41 570 ± 17 (? G) (KJmor') 084 080 1 1 156 115 096 112 S4IIG 402 * «(s- ') 093 ± 006 2) 0 ± 04 551 116 597 ± 18 751 ± 21 759 ± 43 840 ± 2.5 Kn (M) 262 ± 27 1.591008 050 ± 004 00921 0010 00941 0010 0.1251 0024 01321 0012 k Km (SlmMl) 0036 ± ü 004 145 ± 06 108 ± 6 649 155 795 ± 61 609 187 634 ± 41 20 (? G) (KJmor ') -039 089 156 -029 -052 031 084 a Determined at 45 ° C in sodium acetate buffer 0.05 pH 4.4 b Standard error c Transition state energy changes? (? (J) = -R? lni (kcJKm) m (kCM / K "d Not determined 25 • TABLE 11 Kinetic parameters of wild type and mutant glucoamylases for isomaltose, maltose and maltoheptase hydrolysis Mutant Substrate Wild type S4IIG S II A S4I1C S4IIII S4IID Isomaltose (G2) »(Sl) 072 1 OOl" 091 i 006 063 1 002 022 ± 001 Km (inM) 235 ± 06 262 ± 27 279 i 29 123 1 09 ND ND "IKul &? MM") 0031 ± 0001 0O36 ± U004 0022 ± 0002 0018 ± 0001 10? (? G) c (KJp -ol ') -039 084 14 Maltose (G2) * «.. (S') 204 ± 02 230 1 04 189 + 03 778 ± 007 531 ± 015 436 ± 0.05 O Km (M) 101 ± 003 159 i 008 1 6 006 053 i 002 367? 025 358 ± 0.11 15 * ", / *," (S-mM-1) 203 ± 06 145 ± 06 150 i 05 148 ± 06 145 1 006 1.22 ± 003? (? G) e (KJ mol ') 089 080 083 698 743 Maltoheptaosa (G7) kcu (S- ') 723 ± 09 840 ± 25 594 i 06 330 X 05 324 ± 09 15.8 ± 03 Ka (mM) 0083 ± 0004 0132 ± 0012 0104 ± 0004 00701 0005 0336 ± 0024 0148 ± 0009 20 Al.1 // r. (S-, mM ') 870 ± 35 634 L 41 570 i 1 474 125 97 ± 5 107 i 5? (? G) * (KJmol') 084 112 160 581 554 a Determined at 45EC in 0.05 M sodium acetate buffer, pH 44. b Standard error c Transition state energy changes? (? O) - = -RI "l ?? [(Al.11 /?.*" 1) lmll / { A (.lll / A: 1I 25 d not determined.

TABLE 12 PK values and optimal pH of wild-type and mutant glucoamylase for hydrolysis of maltose and maltoheptase at 45 ° C Free enzyme enzyme-substrate complex (uncomplexed) (complexed maltose) -E £? OE EHopt- -EEi EK2 EHopt, Wild type 2.77 5.80 4.29 2.11 5.85 3.98 S411G 3.01 5.57 4.29 2.68 5.81 4.24 S411A 3.11 5.86 4.49 3.32 6.32 4.82 S411C 3.26 5.86 4.56 3.32 6.38 4.85 S411H 3.10 5.01 4.05 3.58 4.69 4.13 S411D 3.13 5.72 4.42 3.39 5.53 4.44 TABLE 12 (CONTINUED) Enzyme-substrate complex (maltoheptase complexed) pKi E £ 2 EHopt Wild type 2. 60 6.78 4.69 S411G 3. 22 6.73 4.98 S411A 3. 91 7.18 5.54 S411C NDa ND ND S411H ND ND ND S411D ND ND ND Not determined.

TABLE 13 Free energy increases for thermal inactivation (?? G *) with respect to wild type GA calculated at 65 ° C ?? G * Form GA (kJ / moll S436P 0.5 S30P 1.6 G137A 0.8 SS 1.2 SS / S436P 2.2 G137A / S436P 2.0 S30P / G137A 4.5 SS / S30P 3.5 SS / G137A 2.7 SS / S30P / G137A 4.4 ?? G * greater than zero indicates increased thermostability.

TABLE 14 Decrease in the relative rate of initial rate of isomaltose formation from glucose condensation reactions 30% (w / v) with respect to glucose formation in maltodextrin hydrolysis reactions MlOO 30% (w / v).

Form GA Relative proportions' Wild type 1.00 SS 0.24 S30P 0.77 G137A 0.54 Y175F 0.76 300Loop 0.47 S411A 0.40 S411G 0.38 S436P 0.70 SS / G137A 0.81 G121A / S411G 0.44 All the above reactions were carried out in 0.05 M sodium acetate buffers, pH 4.4, at 55 ° C. a Proportions less than 1.00 indicate increased specificity for substrates 0f- (l, 4) versus OI- (1,6) linked.

TABLE 15 Increase in the optimum pH of the enzyme-substrate complex of mutant glucoamylase for maltose hydrolysis at 45 ° C compared to that of wild-type. Form GA Increment pH "r, -a S411G 0.26 S411A 0.84 S411C 0, .86 S411H 0, .15 S411D 0, .46 a The optimal pH of the enzyme-substrate complex of wild-type glucoamylase for hydrolysis of maltose at 45 ° C was pH 3.98. REFERENCES Ahearn and Klibanov. The Mechanism of Irreversible Enzyme Inactivation at 100 ° C (The mechanism of Inactivation of Irreversible Enzyme at 100 ° C). Science, 228, 1280 (1985). Ahearn and collaborators. Control of Oligomeric Enzyme Thermostability by Protein Engineering (Control of Thermostability of Oligomeric Enzyme by Protein Engineering). Proc. Nat. Acad. Sci. U.S.A., 84 675 (1987).

Aleshin et al., 1992. Crystal structure of glucoamylase from Aspergillus awamori var. Xl OO to 2.2- A resolution (Crystal structure of glucoamylase from Aspergillus awamori var. Xl OO at resolution 2.2-A). J. Biol. Chem. 267: 19291-19298. Aleshin et al., 1994. Refined structure for the complex of acarbose with glucoamylase from Aspergillus awamori var. XlOO to 2.4-A resolution (Refined structure for the acarbose complex with glucoamylase from Aspergillus awamori var. Xl OO a Resolution 2. 4-A). J. Biol. Chem. 269: 15631-15639. Aleshin et al., 1994, J. "Mol. Biol. 238: 575-591. Aleshin et al, 1996. Crystallographic complexes of glucoamylase with maltooligosaccharide analogs: relationship of stereochemical distortions at the nonreducing end to the catalytic mechanism (crystallographic complexes of glucoamylase with maltooligosaccharide analogues: relationship of stereochemical distortions at the non-reducing end to the catalytic mechanism). Biochemistry 35: 8319-8328. Argos and collaborators. Thermal Stability and Protein Structure (Thermal Stability and Protein Structure). Biochemistry, 18, 5698 (1979).

Bakir et al., (1993) Protein Eng. 6: 939-946. Balaj i et al., 1989. Modification of protein stability by introduction of disulfide bridges and prolines; Geometric criteria for mutation sites (Modification of protein stability by introduction of disulfide and proline bridges, Geometric criteria for mutation sites). Biochem. Biophys. Res. Commun. 160: 109-114. Banks,. and Greenwood, C. J. 1971. The specific estimation of glucose using glucose oxidase (The specific estimation of glucose using glucose oxidase). Stárke. 23: 222-228. Boel and collaborators. Glucoamylases Gl and G2 from Aspergillus niger Are Synthesized from Two Different but Closely Related mRNAs (Glucoamylase Gl and G2 from Aspergillus niger are synthesized from two different but closely related mRNAs). EMBO J., 3, 1097 (1984). Bradford. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding (A Fast Method and Sensitive for the Quantification of Quantities of Micrograms of Micro-Protein Using the Principle of Protein-Dye Binding). Anal. Biochem. 72, 248 (1976). Chen, and collaborators (1996). Effect of replacing helical glycine residues with alanine on reversible and irreversible stability and production of Aspergillus awamori glucoamylase (Effect of replacing helical glycine residues with .alanine in reversible and irreversible stability and glucoamylase production of Aspergillus awamori). Protein Eng. 9: 499-505. Chen et al., (1995) Protein Eng., 8, 575-582. Chen et al. (1994a). Increased thermostability of Ansl82- * Ala mutant Aspergillus awamori glucoamylase (Increased thermo stability of glucoamylase Aspergillus awamori mutant Asnl82- * Ala. Biotechnology and Bioengineering). Bioteciipologry and Bioengineering. 43: 101-105. Chen et al., (1994b) Biochem. J., 301, 275-281. Clarke and Svensson. Identification of an Essential Tryptophanyl Residue in the Primary Structure of Glucoamylase G2 from Aspergillus niger (Identification of a Triptofanil Esencial Waste in the Primary Structure of Glucoamylase G2 from Aspergillus niger) Carlsberg Res.

Commun. , 49, 559 (1984). Clarke Fersht, (1993) Biochemistry (Biochemistry), 32, 4322-4329. Cole and collaborators. Stable Expression of Aspergillus awamori Glucoamylase in Distiller's Yeast (Stable Expression of Glucoamylase from Aspergillus awamori in Yeast from Distillers). Bio / Technol. , 6, 417 (1988). Coutinho and Reilly, (1994a) Protein Eng., 1, 393-400. Coutinho and Reilly, 1994b. Structural similarities in glucoamylases by hydrophobic cluster analysis (Structural similarities in glucoamylases in hydrophobic swarm analysis). Protein Eng. 7: 749-760. Fierobe et al., 1996. Mutational modulation of substrate bond-type specificity and thermostabillity of glucoamylse from Aspergillus awamori by replacement with short homologue active site sequences and thiol / disulfide engineering (Mutation modulation of specificity and thermostability of glucoamylase substrate binding type of Aspergillus awamori by replacements with short homologous active site sequences and thiol / disulfide engineering). Biochemistry 35: 8696-8704.

Frandson et al., 1994. Biochemistry (Biochemistry) 33: 13808-13816. Garfin, (1990) In: Guide to protein purification (In: Protein purification guide). M. P. Deutscher, Ed. Methods in Enzymology. vol. 182. Academic Press, San Diego, CA. p. 425-441. Gunnarsson and collaborators. Structural Studies on the O-Glucosidical Linked Carbohydrate Chains of Glucoamylase Gl from Aspergillus niger (Structural Studies in the 0-Glicosidically Linked Carbohydrate Chains of Glucoamylase Gl from Aspergillus niger).

Eur. J. Biochem. , 145, 463 (1984). Habeed, (1972). Methods in Enzymology (Methods in Enzymology). vol. 25. Academic Press, San Diego, CA. pp. 457-464. Harris et al., 1993. Refined structure for the complex of 1-deoxynoj irimycin with glucoamylase from Aspergillus awamori var. XlOO to 2.4-A resolution (Structured refined for the complex 1-deoxinoj irimicina with glucoamylase from Aspergillus awamori var Xl OO at resolution 2.4-A). Biochemistry 32: 1618-1626. Himori et al., 1983, Mol. Cell. Biochem, 51: 79-95 Himori et al. (1966) J. Biochem. 59: 469-475. Hurley et al., 1992. Flexible-geometry conformational energy maps for the amino acid residue preceding a proline (flexible geometry conformation energy maps for the amino acid residue preceding a proline). Biopolymers 32: 1443-1446. Imanaka and collaborators. A New Way of Enhancing the Thermostability of Proteases. (A New Way to Improve the Thermostability of Proteases). Nature, 324, 695 (1986). Innis and collaborators. Expression, Glucosylation, and Secretion of an Aspergillus Glucoamylase by Saccharomyces cerevisiae (Expression, Glycosylation and Sequestration of an Aspergillus Glucoamylase by Saccharomyces cerevisiae). Science, 228, 21 (1985). Itoh and collaborators. Nucleotide Sequence of the Glucoamylase Gene GLU1 from Saccharomycopsis fibuligera (Nucleotide Sequence of the GLU1 Glucoamylase Gene from Sacaromicopsis fibuligera). J. Bacteriol. , 169, There (1987). Klibanov. Stabilization of Enzymes Against Thermal Inactivation (Stabilization of Enzymes Against Thermal Inactivation). Adv. Appl. Microbiol. , 29, 1 (1983). Knowles and collaborators. Cellulase Families and Their Genes (Cellulase Families and Their Genes). Trends Biotechnol. , 5, 255 (1987). Kunkel Rapid and Efficient Site-Specific Mutagenesis Without Phenotyping Selection (Fast and Efficient Site Specific Mutagenesis Without Phenotype Selection). Proc. Nat. Acad. Sci. USES . , 82, 448 (1985). Kunkel et al., 1987. Rapid and efficient site-specific mutagenesis without phenotypic selection (rapid and efficient site-specific mutagenesis without phenotypic selection). Methods Enzymol. 154: 367-382. Lee and collaborators. Pilot Plant Production of Glucose with Glucoamylase Immobilized to Porous Silica (Production of Pilot Glucose Plant with Glucoamylase Immobilized in Silica Porous). Biotechnol. Bioeng. , 16 1507 (1976). Leatherbarrow and Fersht. Protein Engineering (Protein Engineering). Protein Eng., 1, 7 (1986). Matthews et al., 1987. Enhanced protein thermostability from site-directed mutations that decrease the entropy of unfolding (Improved protein stability of site-directed mutations that decrease entropy of unfolding). Proc. Nati Acad. Sci. USES. , 84: 6663-6667. MacArthur and Thornton, 1991. Influence of proline residues on protein conformation (Influence of proline residues in protein conformation). J. Mol. Biol. , 218: 397-412: Masumura et al., (1989) Nature, 342, 291-293. Matsumura and Aiba. Screening for Thermostable Mutant of Kanamycin Nucleotidyltransferase by the Use of a Transformation System for a Thermophile, Bacillus stearothermophilus (Classification for Thermostable Mutant of Nucleotidyltransferase Canamycin by the Use of a Transformation System for a Thermophile, Bacillus stearotermofilus). J. Biol. Chem. , 260, 15298 (1985). Matsumura, and collaborators. A Cumulative Effect of Intragenic Amino Acid Replacements on the Thermostability of a Protein (TJn Cumulative Effect of Amino Replacement Intractatic Acids in the Thermostability of a Protein). Nature, 323, 356 (1986). Matsuura and collaborators. Structure and Possible Catalytic Residues of Taka-Amylase A (Structure and Possible Catalytic Residues of Taka-Amylase A). J. Biochem. , 95, 697 (1984). Mcllvane (1921) Biochem. J. 49: 183-6. Meagher et al., 1989, Biotechnol Bioeng. 34: 681-688. Munch and Tritsch. Irreversible Thermoinactivation of Glucoamylase from Aspergillus niger and Thermostabilization by Chemical Modification of Carboxyl Groups (Irreversible thermoinactivation of Glucoamylase from Aspergillus niger and Thermo stabilization by " Chemical Modification of Carboxyl Groups). Biochim.

Biophys. Acta, 1041, 111 (1990). Nikolov and collaborators. Kinetics, Equilibria, and Modeling of the Formation of Oligosaccharides from D-Glucose by Aspergillus niger Glucoa ylases I and II (Kinetics, Equilibria and Modeling of the Formation of Oligosaccharides from D-Glucose by Glucoamylases I and II of Aspergillus niger). Biotechnol. Bioeng. , 34, 694 (1989). Nosoh and Sekiguchi. Protein Engineering for Thermostability (Protein Engineering for Stability). Biocatal. , 1, 257 (1988).

Nunberg and collaborators. Molecular Cloning and Characterization of the Glucoamylase Gene of Aspergillus awamori (Molecular Cloning and Characterization of the Gene Glucoamylase from Aspergillus awamori). Mol. Cell. Biol. , 4, 2306 (1984). Pakula and Sauer. Genetic Analysis of Protein Stability and Function (Genetic Analysis of Stability and Protein Function). Ann. Rev. Genet. , 23, 289 (1989). Perry and Wetzel. Disulfide Bond Engineered into T4 Lysozyme: Stabilization of the Protein Toward Thermal Inactivation (Disulfide Linkage Engineering in T4 Lysozyme: Protein Stabilization to Thermal Inactivation). Science, 226, 555 (1984). Pollitt and Zalkin, (1983). J. Bacteriology, 153, 27-32. Rabbo and Terkildsen (1960). Scandinav J. & Lab.

Investigation 12: 402-407. Ramachandran et al., 1963. Stereochemistry of polypeptide chain configurations (Stereochemistry of polypeptide chain configurations). J. Mol. Biol. , 7: 95-99. Robyt & Mukerjea (1994) Carbohydr. Res. 251: 187-202.

Savel'ev and Firsov. Carboxyl Groups at the Active Site of Glucoamylase from Aspergillus awamori (Groups Carboxyl in the Active Site of Glucoamylase of Aspergillus awamori). Biochemistry (U.S.S.R.), 47, 1365 (1982) -. Savel'ev and collaborators. Study of the Active Center of Glucoamylase from Aspergillus awamori (Study of the Active Center of Glucoamylase from Aspergillus awamori). Biochemistry (U.S.S.R.), 47, 330 (1982). Semimaru et al., (1995). Appl. Environ. Microbiol., 61, 2885-2990. Sierks & Svensson (1994) Protein Eng. 7: 1479-1480. Sierks et al. Site-Directed Mutagenesis at the Active Site Trpl20 of Aspergillus awamori Glucoamylase (Site-Directed Mutagenesis in the Active Site Trpl20 of Glucoamylase from Aspergillus awamori). Protein Eng., 2, 621 (1989). Sierks and collaborators. Catalytic Mechanism of Fungal Glucoamylase as Defined by Mutagenesis of Aspl76, Glul79 and GluldO in the Enzyme from Aspergillus awamori (Catalytic Mechanism of Fungal Glucoamylase as Defined by Mutagenesis of Aspl86, Glul79 and Glu 180 in the Aspergillus awamori Enzyme). Protein Eng., 3, 193 (1990). Smith et al., 1985. Measurement of protein using bicinchoninic acid (Measurement of protein using bicinchoninic acid). Anal Biochem. 150: 76-85. Stoffer et al., 1995. Refined structure for the complex - of D-gluco-dihydroacarbose with glucoamylase from Aspergillus awamori var. XlOO a 2.2 A resolution: dual conformations for the extended inhibitors bound to the active site of glucoamylase (Structure refined for the D-gluco-dihydroacarbose complex with glucoamylase from Aspergillus awamori var. Xl OO a Resolution 2. 2 A: dual conformations for the extended inhibitors linked to the active site of glucoamylase). FEBS Letters. 358: 57-61. Suzuki et al., 1987. A strong correlation between the increase in the number of proline residues and the rise in thermostability of five Bacillus oligo-1, 6-glucosidases (A strong correlation between the increase in the number of proline residues and the increase in thermostability of five Bacillus oligo-1, 6-glucosidases). Appl. Microbiol. Biotechnol. 26: 546-551. Suzuki et al., 1991. A hyperthermostable pullulanase produced by an extreme thermophile, Bacillus flavocaldarius KP 1228, and evidence for the proline theory of increasing protein • thermostability (A hyperthermostable pullulanase produced by an extreme thermophile, Bacillus Flavocaldarius KP 1228, 5 and evidence for the proline theory of increasing protein thermostability). Appl. Microbiol. Biothnol. 34: 707-714. Suzuki, 1989. A general principle of increasing protein thermostability (A general principle of • 10 increased protein thermostability). Proc. Jpn. Acad. Be B 65: 146-148. Suzuki and collaborators. Site-Directed Mutagenesis Reveals Functional Contribution of Thr218, Lys220, and Asp304 in Chymosin (Site-Directed Mutagenesis Reveals Functional Contribution of Thr218, Lys220, and Asp304 in Chymosin). Protein Eng., 4, 69 (1990). Svensson. Regional Distant Sequence Homology Between Amylases, a-Glucosidases and Transglycolylases (Homology of Regional Distant Sequence Among Amylases, twenty - . 20 -Glucosidases and Transglycosylases). FEBS Lett. , 230, 72 (1988). Svensson et al. Characterization of Two Forms of Glucoamylase from Aspergillus niger (Characterization of Two Forms of Glycoamylase from Aspergillus niger). Carlsberg Res. Commun. , 47, 55 (1982). Svensson et al. The Complete Amino Acid Sequence of the Glycoprotein, Glucoamylase Gl, from Aspergillus niger (The Complete Amino Acid Sequence of the Glycoprotein, Glucoamylase Gl, from Aspergillus niger).

Carlsberg Res. Commun. , 48, "529 (1983), Svensson et al .. Sequence Homology Between Putative Raw-Starch Binding Domains from Different Starch-Degrading Enzymes (Sequence Homology Between Domain Names of Starch-Crudo Putativo de Diferentes Starch Degradation Enzymes). Biochem. J. Lett. , 264, 309 (1989). Svensson et al. Identification of Carboxylic Acid Residues in Glucoamylase G2 from Aspergillus niger That Particípate in Catalysis and Substrate Binding (Identification of Carboxylic Acids Residues in Glucoamylase G2 from Aspergillus niger Que Participates in Catalysis and Substrate Union). Eur. J. Biochem. , 188, 29 (1990). Tanaka et al., 1983, \ Biochem. , 93: 1037-1043 Watanabe et al., 1994. Multiple proline substitutions cumulatively thermostabilize Bacillus cereus ATCC7064 oligo-1, 6-glucosidase (Multiple substitutions of proline cumulatively thermostabilize oligo-1,6-glucosidase Bacillus cereus ATCC7064). Eur. J. Biochem. 226: 277-283. Wasserman. . Thermostable Enzyme Production (Thermostable Enzyme Production). Food Technol. , 38, 78 (1984) . Wetzel, R. (1987) Trends Biochem. Sci. , 12, 478-482 Williamson et al., (1992). Biochem. J. 282, 423-428 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: Alien, Martin Fang, Tsuei-Yun Li, Yuxing Liu, Hsuan-Liang Chen, Hsui-Mei Coutinho, Peter Hanzatko, Richard Ford, Clark (ii) TITLE OF THE INVENTION: GLUCOAMYLASE PROTEIN ENGINEERING TO INCREASE OPTIMUM pH, SUBSTRATE SPECIFICITY AND THERMOESTABILITY (iii) SEQUENCE NUMBER: 12 (iv) (A) CORRESPONDENCE ADDRESS: Kohn & Associates (B) STREET: 30500 Northwestern Hwy. (C) CITY: Farmington Hills (D) STATE: Michigan (E) COUNTRY: E.U.A. (F) POSTAL CODE: 48334 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible disk (B) COMPUTER: PC COMPATIBLE WITH IBM (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM (SOFTWARE): Patentln Reeléase # 1.0, Version • 1.30 (vi) CURRENT REQUEST DATA: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) AGENT / LAWYER INFORMATION: (A) ) NAME: Kohn, Kenneth I. (B) REGISTRATION NUMBER: 30,955 (C) RECORD NUMBER / REFERENCE: 0812. 00001 '(ix) TELECOMMUNICATIONS INFORMATION: (A) TELEPHONE: (248) 539-5050' (B) ) TELEFAX: (248) 539-5055 (2) INFORMATION OF NO. SEC ID : 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 616 amino acids (B) TYPE: amino acid (C) HEBRA: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETIC: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Aspergillus (xi) SEQUENCE DESCRIPTION: NO. SEC ID: 1: Wing Thr Leu Asp Ser Trp Leu Ser Asn Glu Wing Thr Val Wing Arg Thr 1 5 10 15 Ala lie Leu Asn Asn He Gly Wing Asp Gly Wing Trp Val Ser Gly Wing 20 25 30 Asp Ser Gly He Val Val Wing Ser Pro Thr Asp Asn Pro Asp Tyr 35 40 45 Phe Tyr Thr Trp Thr Arg Asp Ser Gly Leu Val Leu Lys Thr Leu Val 50 55 60 Asp Leu Phe Arg Asn Gly Asp Thr Ser Leu Leu Ser Thr- He Glu Asp 65 70 75 80 Tyr He Ser Ala Gln Ala He Val Gln Gly He Ser Asn Pro Ser Gly 85 90 95 Asp Leu Ser Ser Gly Wing Gly Leu Gly Glu Pro Lys Phe Asp Val Asp 100 105 110 Glu Thr Wing Tyr Thr Gly Ser Trp Gly Arg Pro Gln Arg Asp Gly Pro 115 120 125 Wing Leu Arg Wing Thr Wing Wing He Gly Phe Gly Gln Trp Leu Leu Asp 130 135 140 Asn Gly Tyr Thr Ser Thr Wing Thr Asp He Val Trp Pro Leu Val Arg 145 150 155 160 Asn Asp Leu Ser Tyr Val Wing Gln Tyr Trp Asn Gln Thr Gly Tyr Asp 165 170 175 Leu Trp Glu Glu Val Asn Gly Be Ser Phe Phe Thr He Wing Val Gln 180 185 190 His Arg Ala Leu Val Glu Gly Be Ala Phe Ala Thr Ala Val Gly Ser 195 200 205 Ser Cys Ser Trp Cys Asp Ser Gln Ala Pro Glu He Leu Cys Tyr Leu 210 215 220 Gln Ser Phe Trp Thr Gly Ser Phe He Leu Ala Asn Phe Asp Ser Ser 225 230 235 240 Arg Ser Gly Lys Asp Wing Asn Thr Leu Leu Gly Ser He His Thr Phe 245 250 255 Asp Pro Glu Ala Ala Cys Asp Asp Ser Thr Phe Gln Pro Cys Ser Pro 260 265 270 Arg Ala Leu Ala Asn His Lys Glu Val Val Asp Ser Phe Arg Ser He 275 280 285 Tyr Thr Leu Asp Asp Gly Leu Ser Asp Ser Glu Ala Val Wing Val Gly 290 295 300 Arg Tyr Pro Glu Asp Thr Tyr Tyr Asn Gly Asn Pro Trp Phe Leu Cys 305 310 315 320 Thr Leu Wing Wing Wing Glu Gln Leu Tyr Asp Wing Leu Tyr Glp Trp Asp 325 330 335 Lys Gln Gly Ser Leu Glu Val Thr Asp Val Ser Leu Asp Phe Phe Lys 340 345 350 Wing Leu Tyr Being Asp Wing Wing Thr Gly Thr Tyr Being Ser Being Ser 355 360 365 Thr Tyr Being Ser He Val Asp Wing Val Lye Thr Phe Wing Asp Gly Phe 370 375 380 Val Ser Val Glu Thr Hxs Ala Wing Ser Asn Gly Ser Met Ser slu 385 390 395 400 Gln Tyr Asp Lys Ser Asp Gly Glu Gln Leu Ser Wing Arg Asp Leu Thr 405 410 415 Trp Ser Tyr Ala Ala Leu Leu Thr Ala Asn Asn Arg Arg Asn Ser Val 420 425 430 Val Pro Wing Ser Trp Gly Glu Thr Ser Wing Ser Val Val Gly Thr 435 440 445 Cys Wing Wing Thr Ser Wing He Gly Thr Tyr Ser Ser Val Thr Val Thr 450 455 460 Ser Trp Pro Ser He Val Wing Thr Gly Gly Thr Thr Thr Thr Ala Thr 465 470 475 480 Pro Thr Gly Ser Gly Ser Val Thr Ser Thr Ser Lys Thr Thr Wing Thr 485 490 495 Wing Ser Lys Thr Ser Thr Ser Thr Ser Ser Thr Ser Cys Thr Thr Pro 500 505 510 Thr Ala Val Ala Val Thr Phe Asp Leu Thr Ala Thr Thr Thr Tyr Gly 515 520 525 Glu Asn He Tyr Leu Val Gly Ser He Ser Gln Leu Gly Asp Trp Glu 530 535 540 Thr Ser Asp Gly He Wing Wing Leu Wing Asp Lys Tyr Thr Ser Ser Asp 545 550 555 560 Pro Leu Trp Tyr Val Thr Val Thr Leu Pro Wing Gly Glu Ser Phe Glu 565 570 575 Tyr Lys Phe He Arg He Glu Ser Asp Asp Ser Val Glu Trp Glu Ser 580 585 590 Asp Pro Asn Arg Glu Tyr Thr Val Pro Gln Wing Cys Gly Thr Ser Thr 595 600 605 Wing Thr Val Thr Asp Thr Trp Arg 610 615 (2) INFORMATION FOR: NO. SEC ID: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (C) HEBRA: single (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: peptide - '(xi) SEQUENCE DESCRIPTION: NO. SEC ID: 2: sn Gly Asn Gly Asn Ser Gln '- - • -. fifteen . - (2) INFORMATION FOR: NO. SEC ID: 3 .: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. SEC ID : 3: CAGAGTCCGC GCCCGGCACC CAAGCACCGT C 31 (2) INFORMATION FOR: NO. SEC. ID: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: '33 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. ID SEC .: 4: AAGTCCAGCG ACACAGGTGT GACCTCCAAC GAC 33 (2) INFORMATION FOR: NO. SEC ID : 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid '(C) HEBRA: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. SEC ID : 5: CGAGCGGAAA GCTGCGGGCC ATCAGACTTG TC 32 (2) INFORMATION FOR: NO. SEC ID : 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. SEC ID : 6: CGTACTGCCA TCCTGTGTAA CATCGGGGCG GA 32 (2) INFORMATION FOR: NO. SEC ID: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) HEBRA: single (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other acid nucleic (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. ID SEC .: 7: ATCGGGGCGG ACGGTTGTTG GGTGTCGGGC GCG 33 (2) INFORMATION FOR: NO. SEC. ID: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. ID SEC .: 8: GAGTATCGTG TGTACTGGCG GCACC 25 (2) INFORMATION FOR: NO. ID SEC .: 9: TOPOLOGY (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. ID SEC .: 9: GGTCTCGGTG AGCCCAGGTT CAATGTCGAT 30 (2) INFORMATION FOR: NO. ID SEC. 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other acid nucleic (A) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. SEC. 10 ID: GGTCTCGGTG AGCCCATGTT CAATGTCGAT 30 (2) INFORMATION FOR: NO. ID SEC. 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "PRIMER" (xi) DESCRIPTION OF SEQUENCE: NO. SEC. ID: 11: GAGGACACGT ACTGGAACGG CAACCCG 27 (2) INFORMATION FOR: NO. SEC ID : 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) HEBRA: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) ) DESCRIPTION: / desc = "PRIMER" (PRIMER) (xi) SEQUENCE DESCRIPTION: NO. -DE SEC ID: 12: TACCCTGAGG ACACGTACAA CGGCAACGGC AACTCGCAGG GCAACCCGTG GTTCCTGTGC 60 /

Claims (25)

1. CLAIMS 1. A fungal glucoamylase that includes a pair of Asn20Cys mutation coupled with Ala27Cys forming a disulfide bond between the two members of the pair.
2. 2. The glucoamylase according to claim 1, characterized in that the mutation provides increased thermal stability and reduced isomaltose formation.
3. 3. The fungal glucoamylase as set forth in claim 1, characterized in that it includes at least one mutation selected from Table 13 wherein the cumulative thermal stability is provided by the additional mutations.
4. 4. The fungal glucoamylase as set forth in claim 1, characterized in that it also includes Ser30Pro, Glyl37Ala mutations wherein the cumulative thermal stability is provided by the additional mutations.
5. 5. The fungal glucoamylase as set forth in claim 1, characterized in that it includes at least one mutation of Table 14 wherein cumulative reduced isomaltose formation is provided by the additional / mutations.
6. 6. The fungal glucoamylase as set forth in claim 1, characterized in that it also includes the 311-314 Loop mutation in which cumulative reduced isomaltose formation is provided by the mutation.
7. 7. A fungal glucoamylase that includes a 311-314 Loop mutation.
8. 8. The glucoamylase according to claim 7, characterized in that the formation of reduced isomaltose is provided by the mutation.
9. 9. The fungal glucoamylase according to claim 7, characterized in that it includes at least one mutation of Table 14 wherein the cumulative reduced isomaltose formation is provided by the additional mutation.
10. 10. A fungal glucoamylase that includes a Ser411Ala mutation.
11. 11. The glucoamylase according to claim 10, characterized in that the optimum pH and reduced isomaltose formation are provided by the mutation.
12. 12. The glucoamylase according to claim 10, characterized in that it includes at least one mutation of Table 15, wherein the cumulative increased optimal pH is provided by the mutations.
13. 13. The glucoamylase according to claim 10, characterized in that it includes at least one mutation of Table 14, wherein the cumulative reduced isomaltose formation is provided by the mutations.
14. 14. A fungal glucoamylase that includes a Ser411Ala mutation and a pair of Asn20Cys mutation coupled with Ala27Cys that forms a disulfide bond between the two members of the pair.
15. 15. The glucoamylase according to claim 14, characterized in that the increased thermal stability, increased pH optimum and reduced isomaltose formation are provided by the mutations
16. 16. A fungal glucoamylase that includes a Ser411Ala mutation and a coupled Asn20Cys mutation pair. with Ala27Cys forming a disulfide bond between the two members of the pair and a mutation 311-314Loop
17. 17. The glucoamylase according to claim 16, characterized in that increased thermal stability, increased pH optimum and reduced formation of isomaltose are provided by the mutations.
18. 18. A vector containing the cDNA for an engineered glucoamylase as set forth in claims 1-17
19. 19. A host cell transformed with the vector of claim 18.
20. 20. A fungal glucoamylase according to claims 1-17, characterized in that the glucoamylase is an Aspergillus glucoamylase.
21. 21. The fungal glucoamylase according to claim 20, characterized in that the glucoamylase is glucoamylase from Aspergillus awamori.
22. 22. A method for obtaining a fungal glucoamylase with decreased thermal inactivation by designing mutations having decreased conformational cleavage entropy or increased stability of a-helices, or increased disulfide bonds or hydrogen bonding and electrostatic interactions and hydrophobic interactions and Vanderwalls interactions and compact package.
23. 23. A method for obtaining a fungal glucoamylase with reduced isomaltose formation by designing mutations to decrease the binding affinity to (l), 6) -glucosidic.
24. 24. A method to obtain fungal glucoamylase with optimum pH increased by changing the polarity, charge distribution and hydrogen bonding in the microenvironment of the Glu400 catalytic base.
25. 25. A method for selecting mutations for fungal glucoamylase, for use in constructing glucoamylases with cumulative mutations by: designing and generating individual mutations by site-directed mutagenesis; classify individual mutations and select those that show at least increased optimal pH, decreased irreversible thermal inactivation rates or reduced isomaltose formation; perform site-directed mutagenesis to produce enzymes that carry at least two of the selected isolated mutations for either increased optimal pH, decreased irreversible thermal inactivation rates or reduced isomaltose formation; and classifying for cumulative additive effects of the mutations at optimum pH, thermal stabilization or reduced isomaltose formation by the enzymes produced by transporting at least two of the selected isolated mutations.