MXPA99000521A - Immunization of dna against chlamydia infection - Google Patents

Abstract

The present invention relates to the immunization of nucleic acid, which includes DNA to generate a protective immune response in a host, including humans, against a major outer membrane protein of a Chlamydia strain, preferably containing a nucleotide sequence encoding a MOMP or an MOMP fragment that generates antibodies that specifically react with MOMP and a promoter sequence operably coupled to the first nucleotide sequence for the expression of MOMP in the host. The non-replicating vector can be formulated with a pharmaceutically acceptable carrier for in vivo administration to the host.

Description

IMMUNIZATION OF DNA AGAINST CHLAMYDIA INFECTION FIELD OF THE INVENTION The present invention relates to immunology, and, more particularly, immunization of hosts using nucleic acid to provide protection against Chlamydia infection.

BACKGROUND OF THE INVENTION DNA immunization is an approach to generate protective immunity against infectious diseases (ref 1 throughout this application, several references are cited in parentheses to describe more fully the state of the art to the which corresponds to this invention The complete bibliographic information for each situation is at the end of the specification, immediately before the claims The description of these references is thus incorporated by reference in the present description). Unlike protein or peptide-based subunit vaccines, DNA immunization provides protective immunity through the expression of foreign proteins by host cells, thus allowing the presentation of the antigen to the immune system in a manner more analogous to that which occurs during infection with viruses or intracellular pathogens (ref 2). Although considerable interest has been generated by this tique, successful immunity has been induced more consistently by the immunization of DNA for viral diseases (ref 3). The results have been more variable with non-viral pathogens that may reflect differences in the nature of the pathogens, in the immunizing antigens chosen, and in the immunization routes (ref 4). The further development of DNA vaccination will depend on the explanation of the fundamental immunological mnisms and expanding its application to other infectious diseases for which the existing vaccine development strategies have failed. Chlamydia trachoma tis is a necessary bacterial, intracellular pathogen that usually remains confined to the epithelial surfaces of the mucosa of the human host. Chlamydiae are dimorphic bacteria with a transmission cell similar to an extracellular spore called the elementary body (EB) and an intracellular replicative cell called the reticulated body (ref 5). From a public health perspective, Chlamydia infections are of great importance because they are the significant causes of infertility, blindness and are a prevalent co-factor that facilitates the transmission of the human immunodeficiency virus type 1 (ref 6). The protective immunity to C. trachomatis is effected through the cytokines released by the responses of the CD4 lymphocytes similar to TH1 and by the local antibody in the mucous secretions and it is thought that they are directed mainly to the main protein of the outer membrane (MOMP), which is quantitatively the dominant surface protein in the bacterial cell of Chlamydia and has a molecular mass of approximately 40 Da (ref 19). Initial efforts in the development of a vaccine for Chlamydia were based on parenteral immunization with the whole bacterial cell. Although this approach met with success in human trials, it was limited because the protection was short-lived, partial and vaccination could exacerbate the disease during subsequent episodes of infection, possibly due to pathological reactions to certain antigens of Chlamydia. (ref 8). The most recent attempts in the design of the Chlamydia vaccine have been based on a subunit design using protein or MOMP peptides. These subunit vaccines have also generally failed, perhaps because the immunogens do not induce protective cellular and humoral immune responses called by the native epitopes in the organism (ref 9). EP 192033 describes the provision of the DNA construct for the expression, in vitro, of MOMP polypeptides of Chlamydia trachoma tis, comprising the following operably linked elements: a transcriptional promoter, a DNA molecule encoding a MOMP polypeptide C. trachomatis, comprising a polynucleotide of MOMP of at least 27 base pairs in length, from the sequence provided in Appendix A of the present, and a transcriptional terminator, wherein at least one of the regulatory, transcriptional elements is not derived from Chlamydia trachoma tis. There is no description or suggestion in the prior art for effecting DNA immunization with any of these constructions. WO 94/26900 describes the provision of hybrid picornaviruses expressing Chlamydia trachoma tis MOMP Chlamydia epitopes and capable of inducing immunoreactive antibodies with at least three different Chlamydia servo variants. Preferably, the hybrid picornavirus is a hybrid poliovirus that is attenuated for administration in humans.

SUMMARY OF THE INVENTION The present invention relates to the immunization of nucleic acid, specifically DNA immunization, to generate protective antibodies to a MOMP of a Chlamydia strain in a host. DNA immunization induces a broad aspect of immune responses that include Th1-like CD4 responses and mucosal immunity. Accordingly, in one aspect, the present invention provides an immunogenic composition in vivo for in vivo administration to a host for the generation in the host of a protective nanoresponse to a major protein of the outer membrane (MOMP). English) of a Chlamydia strain, comprising a non-replicating vector, comprising a nucleotide sequence encoding a MOMP or fragment of MOMP that generates a specific imnumor response to MOMP, and a promoter sequence operably coupled to the nucleotide sequence for the expression of MOMP in the host; and a pharmaceutically acceptable carrier therefor. The nucleotide sequence can encode a full-length MOMP protein, or it can code for a fragment, such as the N-terminal half of the MOMP. The nucleotide sequence can encode an MOMP that stimulates a booster immune response after exposure to wild-type Chlamydia. The promoter may be the cytomegalovirus promoter. The Chlamydia strain may be a strain of Chlamydia that induces Chlamydia infection of the lung, including Chlamydia trachoma tis or Chlamydia neumoneae. The non-replicating vector can be the plasmid pcDNA3 into which the nucleotide sequence is inserted. The immune response that is stimulated may be predominantly a cellular immune response. In a further aspect of the invention, there is provided a method for immunizing a host against disease caused by infection with a Chlamydia strain, which comprises administering to the host an effective amount of a non-replicating vector comprising a nucleotide sequence that encodes a major outer membrane protein (MOMP) of a Chlamydia strain or fragment of MOMP that generates an imnumor response specific to MOMP, and a promoter sequence operably coupled to the nucleotide sequence for expression of the MOMP in the host . In this aspect of the present invention, the various options and alternatives discussed above can also be employed. The non-replicating vector can be administered to the host, including a human host, in any convenient manner, such as intramuscularly or intranasally. Intranasal administration stimulated the strongest immune response in the experiments carried out herein. The present invention also includes, in a further aspect thereof, wherein the non-replicating vector comprises the plasmid pcDNA3 which contains the promoter sequence and in which the nucleotide sequence is inserted in an operative relationship to the promoter sequence. In the further aspect of the invention, a further aspect of the present invention provides a method for producing a vaccine for the protection of a host against disease caused against infection with a Chlamydia strain., which comprises isolating a nucleotide sequence encoding a major outer membrane protein (MOMP) of a Chlamydia strain or fragment of MOMP that generates a specific imnumor response to MOMP, which operably links the nucleotide sequences to at least one sequence of control to produce a non-replicating vector, to the control sequence that directs the expression of MOMP when introduced to a host to produce an imnumor response or immune response to MOMP, and formulate the vector as a vaccine for in vivo administration to a host. Therefore, the advantages of the present invention include a method for obtaining an immune response, protective to the infection carried by a Chlamydia strain by immunization of the DNA encoding the main protein of the outer membrane and a Chlamydia strain. .

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 illustrates delayed, hypersensitive (DTH) type responses after immunization. Balb / c mice (four per group) were immunized intramuscularly (pMOMP IM) or intranasally (pMOMP IN) with the plasmid DNA containing the coding sequence of the MOMP gene or with the elementary bodies (EB) of MoPn at 0, 3, 6 weeks. The control group was treated with the preliminary plasmid vector (pcDNA3). Fifteen days after the last immunization, the mice were tested for the MoPn specific DTH response as follows: 25 μl of MoPn EB, heat inactivated (5 x 10 ÜFI) in an SPG buffer was injected into the right posterior plantar pad and in the same volume of SPG buffer was injected into the left posterior plantar pad. The swelling of the footpad was measured at 48 and 72 hours after the injection. The difference between the thickness of the two foot pads was used as a measure of the DTH response. The data is shown as the mean ± SEM. Figure 2, which has panels A and B, illustrates protection against MoPn infection with the gene products of MOMP after DNA immunization. Balb / c mice were immunized with (o) pcDNA3 (n = 11), (•) pMOMP intramuscularly (n = 12), (?), PMOMP intranasally (n = 5) or (•) EB of MoPn (n = 12). Eighteen days after the last immunization, the mice were challenged intranasally with infectious MoPn (1000 IFU). Panel A shows the loss of body weight. Body weight was measured daily after stimulation with infection and each point represents the mean ± SEM of body weight loss. Panel B shows the clearance of Chlamydia in vivo. Mice were sacrificed on day 10 after infection and recovery of infectious MoPn from lung tissue was analyzed by quantitative tissue culture in order to determine clearance of Chlamydia in vivo. The data represent the mean ± SEM of log10 per lung. Figure 3 illustrates the detection of the serum antibody to MOMP of MoPn in mice immunized with DNA by the untransfer analysis. On day 60, the serums P741 mixed from mice immunized with MoPn MS (path A), pMOMP (Path B), preliminary pcDNA3 vector (Path C) or saline (path D), were diluted 1: 100 and reacted with the EBs of Purified MoPn that have been separated in a 10% SDS-polyacrylamide gene and transferred to a nitrocellulose membrane. Figure 4, comprising panels A, B, C and D, compares the IgG2a of subclasses of serum IgG (panels A and C) with IgG, (panels B and D) against recombinant MOMP protein (loaves A and B) or the EB of the MoPn (panels C and D) induced by DNA immunization. Mice were not immunized or immunized intramuscularly with pMOMP, CTP synthetase DNA (pCTP) or the preliminary or blank plasmid vector (pcDNA3) at 0, 3, 6 weeks and the mixed sera from each group were harvested. weeks after the last immunization (day 10). The data represents the mean ± SEM of the OD value of four duplicates. Figure 5, which has panels A and B, demonstrates that DNA vaccination with the MOMP gene improved clearance of MoPn infection in the lung.

Groups of Balb / c mice were immunized with pMOMP = (n = 10), pcDNA3 (n = 10) or saline solution (n = 5).

Eighteen days after the last immunization, the mice were stimulated intranasally with MoPn P741 infectious (10 IFU). Panel A shows the body weight of the mice, measured daily after the challenge infection until the mice were sacrificed on day 10. Each point represents the mean ± SEM of the body weight change. * represents P_ < a .045 compared to the group treated with pcDNA3. Panel B: mice were sacrificed after infection days, and MoPn growth in the lung was analyzed by quantitative tissue culture. The data represent the mean ± SEM of log10 IFÜ per lung. * represents P <; .01 compared to the group treated with pcDNA3. Figure 6, which has panels A and B, shows the evaluation of the responses of the mice to the intranasal stimulation infection with MoPn. In panel A, the change in body weight after stimulation is shown and in panel B, the growth of MoPn in the lung tissue collected after 10 days after stimulation is shown. Mice were immunized in a feigned act (£), immunized intraperitoneally with EB of MoPn (when they died °), recovered from lung infection before MoPn (T) or immunized intramuscularly with pl / 2MOMP (*) Figure 7 shows the elements and the construction of plasmid pcDNA3 / MOMP.

P741 GENERAL DESCRIPTION OF THE INVENTION To illustrate the present invention, the plasmid DNA containing the MOMP gene of the mouse pneumonitis (MoPn) strain of C. trachoma tis, which is a natural murine pathogen, was constructed. allows experimentation to be done in mice. It is known that the main infection in the model induces strong protective immunity to re-infection. For immunization in humans, a human pathogenic strain is used. Any convenient plasmid vector such as pcDNA3, an eukaryotic II-selectable expression vector (Invitrogen, San Diego, CA, USA), containing a cytomegalovirus promoter can be used. The MOMP gene can be inserted into the vector in any convenient way. The gene can be amplified from the genomic DNA of Chlamydia trachoma tis by PCR using suitable primers and the PCR product cloned in the vector. The plasmid having the MOMP gene can be transferred, such as by electroporation, into E. coli for replication therein. Plasmids of E. coli can be extracted in any convenient manner. The plasmid containing the MOMP gene can be administered in any convenient manner to the host, such as muscularly or intranasally, in conjunction with a pharmaceutically acceptable carrier. In the P741 experimentation summarized below, it was found that intranasal administration of the plasmid DNA produced the strongest immune response. The data presented herein and described in detail below demonstrate that immunization of DNA with the MOMP gene of C. trachoma tis produces both a cellular and humoral immune response and produces protective immunity, significant to lung stimulation infection with MOMP. of C. trachoma tis. The results are more encouraging than those obtained using the MOMP protein, recombinant or synthetic peptides and suggest that DNA immunization is an alternative method to distribute a Chlamydia subunit immunogen in order to produce the immune, protective, necessary, cellular responses and humoral. The data presented herein also demonstrate the importance in the selection of an antigen gene for DNA immunization. The antigen gene produces immune responses that are capable of stimulating the memory or recall immunity after exposure to the natural pathogen. In particular, the injection of a DNA expression vector that codes for the main surface protein (in pMOMP) but does not code for a cytoplasmic enzyme (CTP-).

P741 synthetase) of C. trachomatis generated protective immunity, significant to the subsequent stimulation with Chlamydia. The protective immune response seemed to be predominantly mediated by cellular immunity and not by humoral immunity because antibodies produced by DNA vaccination did not bind to native EBs. In addition, immunization of MOMP DNA but not of CTP synthetase, produced a cellular immunity easily remembered by native EBs as shown by the positive reactions of DTH. In addition, the mucosal distribution of MOMP DNA is demonstrated herein that is more significantly efficient in the induction of protective immunity to C. trachoma tis infection than intramuscular injection. This may be relevant to the nature of the C. trachoma tis infection, which is essentially restricted to the surfaces of the mucosa and the efficiency of antigen presentation (ref 14). The rich population and rapid recruitment of dendritic cells in the respiratory epithelium of the lung may be relevant to the improved efficiency of intranasal DNA immunization experiments (ref 15). The data presented herein represents the demonstration of a first subunit Chlamydia vaccine that creates a substantial, protective immunity.

P741 Additionally, it may be possible to amplify (and / or channel) the protective immune response by co-administering the DNAs expressing immunomodulatory cytokines in addition to the antigen gene in order to achieve complete immunity (ref 21). The use of multiple genes of Chlamydiae antigens can increase the level of protective immunity achieved by DNA vaccination. A possible interest regarding the immunization of MOMP DNA originates from the observation that MOMP between the human C. trachoma tis strains is highly polymorphic (ref 16) and therefore it can be difficult to generate a universal vaccine. Chlamydia based on this antigen gene. One way to solve this problem may be to look for the protective epitope (s), conserved within the MOMP molecule. Another, possibly the most feasible way, is to design a multivalent vaccine based on multiple MOMP genes. This latter approach is justified by the fact that the deduced amino acid sequences of MOMP between the related servovariates are relatively conserved and the repertoire of the C. trachomatis genevars seems to be finite (ref 16). It is clearly apparent to one skilled in the art that the various embodiments of the present invention have many applications in the fields of P741 vaccination, diagnosis and treatment of Chlamydia infections. A non-limiting, additional discussion of these uses is presented further below. 3 __ ^ Preparation; ¡£ Use of the Vaccine. Immunogenic compositions, suitable for use as vaccines, can be prepared from the MOMP genes and vectors as described herein. The vaccine produces an immune response in a subject that includes the production of anti-MOMP antibodies. Immunogenic compositions, including vaccines, containing the nucleic acid can be prepared as injectable solutions, in physiologically acceptable liquids, or emulsions for the administration of polynucleotides. The nucleic acid may be associated with liposomes, such as lecithin liposomes or other liposomes known in the art, such as a nucleic acid liposome (e.g., as described in WO 9323640, ref 12) or the nucleic acid may be associated with an adjuvant, as described in more detail below. Liposomes comprising cationic lipids interact spontaneously and rapidly with polyanions, such as DNA and RNA, resulting in liposome-nucleic acid complexes that capture up to 100% of the polynucleotide. In addition, the complexes Polycationic P741 fuses with cell membranes, resulting in an intracellular distribution of the polynucleotide that derives the degrading enzymes from the lysosomal compartment. The published PCT application WO 94/27435 describes compositions for genetic immunization comprising cationic lipids and polynucleotides. Agents that aid in the cellular admission of the nucleic acid, such as calcium ions, viral proteins and other agents that facilitate transfection, can be used in an advantageous manner. Immunogenic preparations of polynucleotides can also be formulated as microcapsules, which include biodegradable release particles over time, in this way, U.S. Patent No. 5,151,264 discloses a particulate carrier of a phospholipid / glycolipid / polysaccharide, nature that is has called Bio Vecteurs Supra Moleculaires (BVSM). Carriers in the form of particles are proposed to transport a variety of molecules having biological activity in one of the layers thereof. U.S. Patent No. 5,075,109 describes the encapsulation of the hemocyanin antigens of the trinitrophenylated limpet, and staphylococcal enterotoxin B in poly (DL-lactidoco-glycolide) 50:50. Other polymers for encapsulation are suggested, such as poly (glycolide), poly (DL-lactide-co-glycolide), copolyoxalates, polycaprolactone, poly (lactide-co-caprolactone), poly (esteramides), polyorthoesters and poly (8-hydroxybutyric acid), and polyanhydrides. The published PCT application number WO 91/06282 describes a delivery vehicle comprising a plurality of bioadhesive microspheres and antigens. The microspheres that are of starch, gelatin, dextran, collagen or albumin. This distribution vehicle is particularly proposed for the admission of the vaccine through the nasal mucosa. The distribution vehicle may additionally contain an adsorption enhancer. The MOMP gene that contains the non-replicating vectors can be mixed with pharmaceutically acceptable excipients that are compatible therewith. These excipients may include, water, saline, dextrose, glycerol, ethanol, and combinations thereof. Immunogenic compositions and vaccines may additionally contain additional substances, such as wetting or emulsifying agents, pH buffering agents, or adjuvants to improve the effectiveness thereof. Immunogenic compositions and vaccines can be administered parenterally, P741 by subcutaneous injection, intravenously, intradermally or intramuscularly, possibly after pretreatment of the injection site with a local anesthetic. Alternatively, the immunogenic compositions formed in accordance with the present invention can be formulated and distributed in a manner to evoke an immune response on mucosal surfaces. In this way, the immunogenic composition can be administered to mucosal surfaces, for example, by the nasal or oral (intragastric) routes. Alternatively, other modes of administration that include suppositories and oral formulations may also be desirable. For suppositories, the binders and carriers may include, for example, polyalkylene glycols or triglycerides. Oral formulations may include excipients normally employed, such as, for example, pharmaceutical grades of saccharin, cellulose and magnesium carbonate. The immunogenic preparations and vaccines are administered in a manner compatible with the dosage formulation, and in such an amount that it will be therapeutically effective, protective and immunogenic. The amount to be administered depends on the subject to be treated which includes, for example, the ability of the individual's immune system to synthesize MOMP and antibodies P741 for this, and if necessary, to produce a cell-mediated immune response. The precise amounts of the active ingredient required to be administered depend on the judgment of the practitioner. However, suitable dose ranges can be readily determined by one skilled in the art and can range from about 1 μg to about 1 mg of the vectors containing the MOMP gene. Suitable regimens for initial administration and doses of boosters are also variable, but may include an initial administration followed by subsequent administrations. The dose may also depend on the route of administration and variety according to the size of the host. A vaccine that protects with only one pathogen is a monovalent vaccine. Vaccines containing antigenic material of various pathogens are combined vaccines and also correspond to the present invention. These combined vaccines contain, for example, material from several pathogens or from several strains of the same pathogen, or from combinations of various pathogens. Immunogenicity can be significantly improved if the vectors are coadministered with adjuvants, commonly used as a 0.05 to 0.1 percent solution in phosphate buffered saline. Adjuvants improve the immunogenicity of an antigen, P741 but are not necessarily immunogenic by themselves. The adjuvants can act by retaining the antigen in a local manner near the site of administration to produce a depot effect facilitating a sustained, slow release of the antigen to the cells of the immune system. The adjuvants can also attract cells from the immunization antigen reservoir and stimulate these cells to produce immune responses. Agents or immunostimulatory adjuvants have been used for many years to improve host immune responses to, for example, vaccines. In this way, adjuvants have been identified that improve the immune response to antigens. Some of these adjuvants are toxic, however, and can cause undesirable side effects, rendering them unsuitable for use in humans and many animals. In fact, only aluminum hydroxide and aluminum phosphate (collectively referred to commonly as alum) are routinely used as adjuvants in human and veterinary vaccines. A wide range of extrinsic adjuvants and other immunomodulatory material can motivate potent immune responses to antigens. These include saponins complexed to the antigens of the membrane protein to produce simulation complexes Immune P741 (ISCOMS), pluronic polymers with mineral oil, microbes killed in mineral oil, Freund's complete adjuvant, bacterial products, such as muramyl dipeptide (MDP) and lipopolysaccharide (LPS), as well as monoforyl lipid A, QS 21 and polyphosphazene. In particular embodiments of the present invention, the non-replicating vector comprising a first nucleotide sequence encoding a Chlamydia MOMP gene can be delivered in conjunction with a targeting molecule to target the vector to selected cells that include the cells of the immune system. The non-replicating vector can be distributed to the host by a variety of methods, for example, Tang et al. (Ref 17) described that the introduction of gold microprojectiles coated with the DNA that codes for bovine growth hormone (BGH) in the skin of the mice resulted in the production of anti-BGH antibodies in the mice, while xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx, showed that a jet injector could be used to transfect the skin, muscle, fat and breast tissues of the living animals.

P741 2. Immunoassays. The MOMP genes and vectors of the present invention are useful as immunogens for the generation of anti-MOMP antibodies for use in immunoassays, including enzyme linked immunosorbent assays (ELISA), RIAs and other non-antibody binding assays. linked to enzymes, or methods known in the art. In ELISA assays, the non-replicating vector is first administered to a host to generate antibodies specific to MOMP. These MOMP-specific antibodies are immobilized on a selected surface, for example, a surface capable of binding the antibodies, such as the wells of the polystyrene microtiter plate. After washing to remove the incompletely absorbed antibodies, a non-specific protein, such as a solution of bovine, serum albumin (BSA) that is known to be antigenically neutral with respect to the test sample, may bind to the selected surface. This allows the blocking of non-specific absorption sites on the immobilization surface and thus reduces the background caused by non-specific binding of the antisera on the surface. The immobilization surface is then contacted with a sample, such as clinical or biological materials, which are to be tested in a manner conducive to P741 the formation of an immune complex (antigen / antibody). This procedure may include diluting the sample with diluents, such as the BSA solution, bovine gamma-globulin (BGG) and / or phosphate buffered saline (PBS) / Tween. The sample is then allowed to incubate for about 2 to 4 hours, at temperatures such as the order of about 20 ° to 37 ° C. After incubation, the surface contacted with the sample is washed to remove non-immobilized cells. The washing process may include washing with a solution such as PBS / Tween or a borate buffer. After the formation of the specific immunocomplexes between the test sample and the MOMP-specific, bound antibodies, and subsequent washing, the occurrence, and even the amount, of the immunocomplex formation can be determined.

EXAMPLES The foregoing description generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples. These examples are described only for purposes of illustration and are not intended to limit the scope of the invention. Changes in the form and substitution of equivalents are considered as P741 circumstances that may suggest or become expedited. Although specific terms have been employed herein, these terms are proposed in a descriptive sense and not for purposes of limitation.

Example 1: This example illustrates the preparation of a plasmid vector containing the MOMP gene. The expression vector of pMOMP is made as follows. The MOMP gene was amplified from the genomic DNA of the mouse pneumonitis (MoPn) strain of Chlamydia trachoma tis, by the polymerase chain reaction (PCR) with a 5 'primer.

(GGGGATCCGCCACCATGCTGCCTGTGGGGAATCCT) (SEQ ID NO: 1) which includes a BamHI site, a ribosomal binding site, an initiation codon and the N-terminal sequence of the mature MOMP of MoPn and a 3 'primer (GGGGCTCGAGCTATTAACGGAACTGAGC) (SEQ ID NO: 2) which includes the C-terminal sequence of the MoPn MOMP, an Xhol site and a terminator codon. The DNA sequence of the gene sequence of the MOMP leader peptide was excluded. After digestion with BamHI and XhoI, the PCR product was cloned into the II-selectable expression vector, pcDNA3 (Invitrogen, San Diego) with transcription under the control of a region of the anterior, intermediate enhancer, P741 major human cytomegalovirus (CMV promoter). The plasmid encoding the MOMP gene was transferred by electroporation into E. coli DH5aF which was cultured in LB broth containing 100 μg / ml ampicillin. The plasmids were extracted by the Wizard MR DNA purification system.

Plus Maxiprep (Promega, Madison). The sequence of the recombinant MOMP gene was verified by direct sequence analysis of PCR, as described (ref 20). The purified plasmid DNA was isolated in saline at a concentration of 1 mg / ml. The concentration of the DNA was determined by a DU-62 spectrophotometer (Beckman, Fullertonm, CA) at 260 nm and the plasmid size was compared to DNA standards on agarose gel stained with ethidium bromide. The plasmid containing the MOMP gene, pcDNA3 / MOMP is illustrated in Figure 7.

Example 2: This example illustrates the immunization of DNA from mice and the results of the DTH test. A model of murine pneumonia induced by the mouse pneumonitis strain [MoPn] of C. trachomatis was used (ref 11). Dependent of most strains of C. trachomatis that are restricted to produce infection and disease in humans, MoPn is a murine pathogen, P741 natural. It has been previously shown that infection in this model induces strong protective immunity to reinfection. In addition, the clearance of the infection is relative to the responses of the Th1 CD4 lymphocytes and is dependent on the presentation of the MHC class II antigen (ref 11). For the experimental design, groups of Balb / c mice (5 to 13 per group) females 4 to 5 weeks of age were immunized intramuscularly (IM) or intranasally (IN) with the plasmid DNA containing the sequence of MOMP gene coding of MoPn (1095 bp), prepared as described in example 1, or with the coding sequence of the serovarian of C. trachoma tis the L2 CTP synthetase gene (1619 bp) (refs. , 12), prepared by an analogous procedure described in Example 1. CTP synthetase is a cytoplasmic Chlamydia enzyme, conserved and catalyses the final step in the biosynthesis of pyrimidine and is not known to induce protective immunity. The negative control animals were injected with saline or with the plasmid vector lacking an inserted Chlamydia gene. For immunization by IM, both quardiceps were injected with 100 μg of DNA in 100 μl of saline per injection site three times, at 0, 3 and 6 weeks. For immunization by IN, the mice P741 anesthetized aspirated 25 μl of saline containing 50 μg of DNA three times at 0, 3 and 6 weeks. As a positive control, a separate group of mice received 5 x 10 inclusion formation units (IFUs) of the MoPn EBs administered intraperitoneally in incomplete Freund's adjuvant according to the previous program. At week 8, all groups of mice had sera collected to measure antibodies and tested for delayed type hypersensitivity (DTH)., for its acronym in English) to the EB of MoPn for the injection to the plantar pad (ref 13). A positive DTH reaction of 48 and 72 hours was detected between the mice immunized with the MOMP DNA or with the MoPn EB but not between the mice immunized with the preliminary or blank vector (see Figure 1). The reaction of DTH produced with the MOMP DNA distributed intranasally was comparable to that observed among mice immunized with EB. No DTH reaction was detected between the groups of mice vaccinated with the CTP-synthetase DNA (see Table 1 below). In this way, injection of the MOMP DNA generated a DTH reaction that was able to be remembered by the naturally processed peptides from the C. trachomatis EBs while the injection of the CTP synthetase DNA failed to do so. .

P741 Example 3: This example illustrates the immunization of DNA from mice and the generation of antibodies. The injection of CTP synthetase DNA as described in example 2 resulted in the production of serum antibodies to the recombinant CTP synthetase (Table 1) (ref 14). Antigen-specific serum Abs (antibodies) were measured by ELISA. Flat bottom 96-well plates (Corninig 25805, Corning Science Products, Corning, NY) were coated with either recombinant Chlamydia CTP-synthetase (1 μg / ml) or purified MoPn EB (6 × 10 IFU / well) during overnight at 4o C. Plates were rinsed with distilled water and blocked with 4% BSA PBS-Tween and 1% low-fat skim milk for 2 hours at room temperature. Dilutions of the serum samples were performed on the 96-well round bottom plates immediately before application on the plates coated with the antigen. The plates were incubated overnight at 4 ° C and washed ten times. Biotinylated goat anti-mouse IgGl or goat anti-mouse IgG2a (Southern Biotechnology Associates, Inc., Birmingham, AL) were then applied for 1 hour at 37 ° C. After washing, the streptoavidin-alkaline phosphatase conjugate was added ( Jackson Imnumorresearch P741 Laboratories, Inc. Mississagua, Ontario, Canada) and incubated at 37 ° C for 30 minutes. After another washing step, phosphatase substrate in phosphatase buffer (pH 9.8) was added and allowed to develop for 1 hour. Plates were read at 405 nm on a BIORAD 3550 microplate reader. The IgG2a antibody titers were approximately 10 times greater than the IgG1 antibody titers suggesting that DNA immunization produced a more dominant TH1-like response. Injection of MOMP DNA as described in Example 2 resulted in the production of serum antibodies to MOMP (Table 2) as detected in the immunoblot assay (Figure 2). However, neither mice immunized with CTP synthetase DNA nor MOMP DNA produced antibodies that bound to native C. trachomatis EBs (Table 1), suggesting that antibody responses can not be the dominantly protective mechanism. A comparison of the subclasses of serum IgG, IgG2a (panels A and C) and IgGX (panels B and D) against the MOMP protein (panels A and B) or MoPn (panels C and D) induced by DNA immunization as described above, is contained in Figure 4.

P741 Example 4: This example illustrates the immunization of DNA from mice to achieve protection. To investigate whether a cell-mediated immune response produced by MOMP DNA was functionally significant, the protective efficacy was evaluated in vivo in mice stimulated intranasally with 1 x 10 IFU of MoPn from C. trachoma tis. To provide a measure of the morbidity induced by Chlamydia, the loss in body weight was measured for 10 days after stimulation with C. trachomatis (see Figure 2, panel A). Mice injected with the unmodified vector were used as controls and mice immunized with EB were used as the positive controls. Mice immunized with MOMP DNA maintained intranasally a body weight comparable to that observed among mice immunized with EB. Mice immunized intramuscularly with MOMP DNA lost body mass but not at a lower rate than the negative control group. A more direct measure of the effectiveness of DNA vaccination is the ability of mice immunized with MOMP DNA to limit the in vivo procedure of Chlamydia after a sublethal infection of the lung. The 10th day after the simulation is the maximum growth time (ref 13) and was chosen for the comparison of the lung titers between the various groups of mice. Mice immunized with MOMP DNA had Chlamydia lung titers that were more than 1000 times smaller (log10 IFU 1.3 ± 0.3; mean ± SEM) than those of the control mice immunized with the preliminary or blank vector (log10 IFU 5.0 ± 0.3, p <0.01) (see Figure 2, Panel B). Mice immunized intramuscularly with MOMP DNA had Chlamydia lung titers that were more than 10 times lower than the unmodified vector group (p = 0.01). Mice immunized intranasally with MOMP DNA had significantly lower Chlamydia lung titers than mice immunized with MOMP DNA intramuscularly (log10 IFU 1.3 ± 0.8 versus log10 IFU 0.66 ± 0.3 respectively, p = 0.38). The substantial difference (2.4 logs) in Chlamydia lung titers observed among mice immunized with MOMP DNA intranasally and intramuscularly, suggested that mucosal immunization is more efficient in inducing immune responses to accelerate clearance of Chlamydia in the lung. The lack of protective effect with the control of the unmodified vector confirms that the DNA per se was not responsible for the imnumor response. In addition, the absence of immunity Protective P741 after immunization with the CTP-synthetase DNA confirms that the immunity was specific to the MOMP DNA (see Table 1). Figure 5 shows similar data of stimulation at a higher stimulation dose.

Example 5: This example describes the construction of pl / 2M0MP. A MoPn gene, cloned by PCR, was constructed, containing an expression mutation at codon 17. This recitation produces a truncated MOMP protein containing approximately 183 amino-terminal amino acids (ref 10). This construct, called pl / 2MOMP, was cloned into the vector pcDNA3 (Invitrogen), in the manner described in Example 1.

Example 6: This example illustrates the immunization of the mice with pl / 2M0MP. Balb / c mice were immunized in the quadriceps three times at a three week interval with 100 μg of pl / 2MOMP DNA. Fifteen days after the last immunization and 60 days after the first injection, the mice P741 bled for the measurement of the serum antibodies of the MoPn EB in an EIA assay and were injected into the footpad with 25 μl (5 x 10 inclusion formation units) of the heat-killed EBs for the DTH measurement that it was measured at 72 hours (ref 13). Mice were challenged intranasally with 1000 infective units of MoPn and their body weight was measured daily for the subsequent 10 days. At that time, the mice were sacrificed and the quantitative cultures of MoPn in the lung were determined (ref 13). Table 3 shows that immunization of pl / 2MOMP produced a positive DTH response to the injection into the footpad of the MoPn EBs. Serum antibodies of low titers (titre approximating 1-100) were also detected to surface determinants in EB on day 60 after vaccination. Immunization with the unmodified vector did not produce either serum antibodies or a DTH response. Figure 6, Panel A shows that immunization of P1 / 2MOMP evoked a protective immune response to the stimulation of MoPn as measured by the change in body weight after infection and by the in vivo growth of MoPn in the tissue of lung on day 10 after stimulation. The in vivo growth between mice treated with saline was log10 5.8 ± 0.21 and between P741 mice immunized with pl / 2M0MP was log10 3.9 ± 0.25, p < 0.001, Figure 2, Panel B. As a positive control, mice immunized with MoPn EBs heat killed or recovered before lung infection with MoPn were markedly and equivalently protected against challenge infection (p <.0001) . As can be seen in this example, using a deletion mutant of the reading frame in codon 117 or the MOMP gene, a significant protective immunity to the stimulation infection occurred suggesting that protective sites can be found in the amino terminal half of the protein. SUMMARY OF THE INVENTION In summary of this description, the present invention provides a method of immunizing nucleic acid, including DNA, of a host, including humans, against the disease caused by infection with the Chlamydia strain, specifically C. trachoma. tis, employing a non-replicating vector, specifically a plasmid vector, containing a nucleotide sequence encoding the major outer membrane protein (MOMP) of a Chlamydia strain and a promoter to effect the expression of MOMP in the host. Modifications are possible within the scope of this invention.

Table 1 Serum antibody titers and delayed type hypersensitivity (DTH) responses and in vivo growth of Chlamydia trochomatis after immunization with pCTP synthetase or EB of MoPn. The results are presented as means ± SEM.

Anti-EB antibodies Anti-Anti-EB Antibodies of Log10 IFU / MoPn's lung (log10) pCTP-synthetase DTH (mm x dlO after the (log10) 10 'stimulation IgGl IgG2a IgGl IgG2a Solution <2 <2 < 2 < 2 4.5 ± 1.5 4.9 ± .24 saline? (n = 9) pCTP- < 2 < 2 3.8 ± .3 4.7 ± .1 1.4 ± 1.5 4.7 ± .13 synthetase (n = 11) EB (n = 4) 5.0 ± .2 4.8 ± .3 3.6 ± 2.9 ± 0 15.2 ± 2.0 Table 2 ELISA titers of serum antibodies to the recombinant MOMP of mouse pneumonitis of Chlamydia trachoma tis and EB were measured 60 days after the initial immunization between mice immunized with the preliminary vector alone (pcDNA3), the vector containing the MOMP (pMOMP) and the vector that contains the CTP synthetase (pCTP). Unimmunized mice were also tested rMOMP EB IgG2a IgGl IgG2a IgGl PeAD 3 < 2.6 * < 2.6 < 2.6 < 2.6 PMOMP 3.77 ± 0.1 2.90 ± 0.14 3.35 ± 0.11 < 2.6 PCTP ND ND < 2.6 < 2.6 Preimmuni < 2.6 < 2.6 < 2.6 < 2.6 tion * loglO media + SE IgG titre of the specific antibody of the isotype NO = not found P741 Table 3 Immune responses on day 60 after immunization of pl / 2MOMP or EB DTH Response antibody titre Immunogen IgG2a to EB to EB (log10) (mm x 10) EB (n = 13) 5.6 + 0.4 9.6 + 2.0 P1 / 2MOMP (n = 2.0 ± 0 6 + 1.6 13) pcDNA3 (n = 13) 1.3 + 0 1 + 1 P741 REFERENCES 1. M.A. Liu, M.R. Hilleman, R. Kurth, Ann. N.Y. Acad, Sci. 772 (1995). 2. D.M. Pardoll and A.M. Beckerieg, Immunity 3, 165 (1995); W.M. McDonnell and F.K. Askari, N. Engl. J. Med. 334, 42 (nineteen ninety six) . 3. J.B. Ulmer et al., Science 259, 1745 (1993); B. Wang et al., Proc. Nati Acad. Sci. USA 90, 4156 (1993); G.J.M. Cox, T.J. Zamb, L.A. Babiuk, J. Virol. 67, 5664 (1993); E. Raz et al., Poc. Nati Acad. Sci. USA, 91, 9519 (1994); Z.Q. Kiang et al., Virology 199, 132 (1994); J.J. Donnelly et al., J. Infect. Dis. 713, 314 (1996); D. L. Montgomery et al., DNA. Cell Biol. 12, 777 (1993); J.J. Donnelly et al., Nature Medicine 1, 583 (1995); G.H. Rhodes et al., Dev. Biol booth. 82, 229 (1994); H.L. David, M. L. Michel, R.G. Whalen, Human Molecular Genetics 2, 1847 (1993); J.B. Ulmer et al., Vaccine 12, 1541 (1994); Z. Xiang and H.C.J. Ertl. Immunity 2, 129 (1995); E.F. Fynan et al, Proc. Nati Acad. Sci USA 90, 11478 (1993); E. Manickan, R.J.D. Rouse, Z. Yu, J. Immunol. 155, 259 (1995).

P741 4. M. Sedegah, R. Hedstrom, P. Hobart, S.L. Hoffman, Proc. Nati Acad. Sci. USA 91, 9866 (1994); M.A. Barry, W.C. Lai, S.A. Johnston, Nature 377, 632 (1995); D. Xu and F.Y. Liew, Vaccine 12, 1534 (1994); D.B. Lowrie, R.E. Tascon, M.J. Olston, Vaccine 12, 1537 (1994).

. J.W. Moulder, Microbol. rev 55, 143 (1191). 6. J. Schachter, Curr. Top. Microbol. Immunol. 138, 109 (1988); S.D. Hillis and J.N. Wasserheit, N. Engl. J. Med 334, 1399 (1996). 7. R.C. Brunham and R.W. Peeling, Infectious Agents and Disease 3, 218 (1994); R.P. Morrison, D.S. Manning, H.D. Caldwell, in Advences in Host Defense Mechanics, T.C. Quin, Ed. (Raven Press, New York, 1992), pp. 57-84. 8. J.T. Grayston and S, P, Wang, Sex. Trans. Dis. 5, 73 (1978); J.T. Grayston and S. P. Wang, J. Infect. Dis. 132, 87 (1975). 9. H.R. Taylor, J. Whittum-Hudson, J. Schachter, Invest. Ophthalmol. Vis. Sci. 29, 1847 (1988); B.E. Batteiger, R.G. Rank, P.M. Bavoil, J. Gen. Microbiol. Ophthalmol. Vis. Sci. 36, 1477 (1995); H. Su, M. Parnell, H.D. Caldwell, vaccine 13, 1023 (1995); T. W. Tan, A.J. Herring, I.E. Anderson, Infect. Immun. 58, 3101 (1990); M. Tuffrey, F. Alexander, W. Conlan, J. Gen. Microbiol. 138, 1707 (1992).

. P. X. Zhang, J.G. Fox, Y. Ho, Mol. Biol. Evol. 10, 1327 (1993). 11. R.P. Morrison, K. Feilzer, D.B. Turnas, Infect, Immun. 63, 4661 (1995); H. Su and H.D. Caldwell, Infect. Immun. 63, 3302 (1995); J.U. Igietseme et al., Reg. Immunol. 5, 317 (1993); J.U. Igietseme and R.G. Rank, Infect. Immun. 59, 1346 (1991); D.M. Williams, J. Schachter, J.J. Coalson, J. Infect. Dis. 149, 630 (1984). 12. G. Tipples and G. McClarty, J. Biol. Chem. 270, 7908 (1995). 13. X. Yang, K.T. HayGlass, R.C. Brunham, J. Immunol., 156, 4338 (1996). 14. H. Su and H.D. Caldwell, Infect. Immun. 63, 946 (1995) . ACE. McWilliam, D. Nelson, J.A. Thomas, J. Exp. Med. 179, 1331 (1994); M.R. Neutra, E. Pringault, J.P. Kraehenbuhl, Annu. Rev. Immunol. 14, 275 (1996); J.M.

P741 Austyn, J. Exp. Med. 183, 1287 (1996). 16. R. Brunham et al., J. Clin. Invest. 94, 458 (1994); R.C. Brunham et al., J. Infect. dis. 173, 950 (1996). 17. Tang et al., Nature 1992, 356: 152-154. 18. Furth et al., Vaccine 1994, 12: 1503-1509. 19. Morrison RP, Manning DS, Caldwell HD. Immunology of Chlamydia trachoma tis infections: Immunoprotective and immunopathogenic responses. In: Quin TC. Advances in host defense mechanics. Sexually transmitted diseases. Vol. 8. New York: Raven Press, 1992; 52-84.

. Brunham R., Yang C., Maclean I., Kimani J., Maitha G., PLummer F., Chlamydia trachoma tis from individuáis in a sexually transmitted disease core group exhibit frequent sequence variation in the major outer membrane protein (ompl) gene . J. Clin. Invest. 1994; 94: 458-63. 21. Xiang Z. Ertl HCJ. Manipulation of the immune response to a plasmid-encoded viral antigen by coinoculation with plasmids expressing cytokines. Immunity 1995; 2: 129-35.

Claims (9)

1. An immunogenic composition for in vivo administration to a host for generation in the host of an immune response, protective to a major outer membrane protein (MOMP) of a Chlamydia strain, characterized by a non-replicating vector comprising: nucleotide sequence encoding a MOMP or a fragment of MOMP that generates a specific immune response to MOMP, and a promoter sequence operably coupled to the nucleotide sequence for expression of the MOMP in the host; and a pharmaceutically acceptable carrier therefor.

2. The composition according to claim 1, characterized in that the nucleotide sequence codes for a full-length MOMP.

3. The immunogenic composition according to claim 1, characterized in that the nucleotide sequence codes for an N-terminal fragment of the MOMP of about half the size of the full-length MOMP.

4. The immunogenic composition according to any P741 of claims 1 to 3, characterized in that the promoter sequence is a cytomegalovirus sequence.

5. The immunogenic composition according to any of claims 1 to 4, characterized in that the strain of Chlamydia is a strain that causes Chlamydi a infections of the lung.

6. The immunogenic composition according to any of claims 1 to 4, characterized in that the strain of Chlamydi a is a strain of Chlamydi to trachoma ti s. 1 . The immunogenic composition according to any of claims 1 to 6, characterized in that the non-replicating vector comprises the plasmid pcDNA3 which contains the promoter sequence and in which the nucleotide sequence is inserted in operative relation to the promoter sequence. 8. The immunogenic composition according to any of claims 1 to 7, characterized in that the immune response is predominantly an immune, cellular response. The immunogenic composition according to any of claims 1 to 8, characterized in that the nucleotide sequence encodes an MOMP that stimulates a booster immune response after exposure to Chlamydi to wild type. P741 10. The use of a non-replicating vector comprising: a nucleotide sequence encoding a major outer membrane protein (MOMP) of a Chlamydi a strain or a fragment of MOMP that generates a specific immune response to MOMP, and a promoter sequence operably coupled to the nucleotide sequence for the expression of the MOMP in a host to which the vector is administered in vivo, in the manufacture of an immunogenic composition for the generation of an immune response, protective of the MOMP by the in vivo administration of the immunogenic composition. The use according to claim 10, characterized in that the nucleotide sequence codes for a full-length MOMP. The use according to claim 10, characterized in that the nucleotide sequence codes for an N-terminal fragment of the MOMP of about half the size of the full-length MOMP. 13. The use according to any of claims 10 to 12, characterized in that the promoter sequence is a cytomegalovirus promoter. 14. Use according to any of the P741 claims 10 to 13, characterized in that the strain of Chlamydi a is a strain that causes Chlamydial infections of the lung. 15. The use according to any of claims 10 to 14, characterized in that the Chlamydia strain is a strain of Chlamydia trachoma ti s. 16 The use according to any of claims 10 to 15, characterized in that the non-replicating vector comprises plasmid pcDNA3 which contains the promoter sequence and in which the nucleotide sequence is inserted in operative relation to the promoter sequence. 1

7. The use according to any of claims 10 to 16, characterized in that the immunogenic composition is administered intranasally. 1

8. The use according to any of claims 10 to 17, characterized in that the host is a human host. 1

9. A method for producing a vaccine for the protection of a host against the disease caused by infection with a strain of Chlamydia, characterized by: isolating a nucleotide sequence encoding a major protein of the membrane External P741 (MOMP) from a strain of Chlamydi a or qoe codes for a fragment of MOMP that generates a specific immune response to MOMP. operably linking the nucleotide sequence to at least one control sequence to produce a non-replicating vector, the control sequence that directs the expression of the MOMP when introduced to a host to produce an immune response to the MOMP, and formulate the vector as a vaccine for in vivo administration to a host. 20. A vaccine produced by the method of claim 19. P741