MXPA99000230A - Procedure of production of adenovirus recombinan - Google Patents

Abstract

The present invention relates to a process for the production of recombinant adenoviruses according to which the viral DNA is introduced into an encapsulation cell culture and the produced viruses are collected after release in the supernatant. It also covers the viruses produced and their use

Description

RECOMBINANT ADENOV RUSS PRODUCTION PROCEDURE The present invention concerns a new process for the production of recombinant adenoviruses. It also concerns the purified viral preparations produced according to this procedure.

Adenoviruses have certain properties that are particularly favorable for use as a gene transfer vector in gene therapy. In particular, they have a broad spectrum of hosts, are capable of infecting quiescent cells, do not integrate into the genome of the infected cell, and have not been associated with important pathologies in humans. Adenoviruses have also been used to transfer genes of interest in the muscle (Ragot et al., Nature 361 (1993) 647), the liver (Jaffe et al., Nature genetics 1 (1992) 372), the nervous system (Akli et al. , Nature genetics 3 (1993) 224), etc.

Adenoviruses are linear double-stranded viruses with a size of approximately 36 (kilobases) kb. Its genome particularly comprises a repeated inverted sequence (ITR) in each extremity, an encapsulation sequence (Psi), of early genes and late genes. The main early genes are contained in the regions The, E2, E3 and E4. Among these, the genes contained in the El region are particularly necessary to viral propagation. The main late genes are contained in regions Ll to L5. The Ad5 adenovirus genome has been completely sequenced and is accessible on a database (see particularly Genebank M73260). Also the parts, up to the totality of other adenoviral genomes (Ad2, Ad7, Adl2, etc.) have also been sequenced.

For use in gene therapy, different vectors derived from adenoviruses have been prepared, incorporating different therapeutic genes. In each of these constructions, the adenovirus has been modified so as to render it incapable of replication in the infected cell. Thus, the constructs described in the previous specialty are adenoviruses deleted from the El region, essential to the viral replication, at the level of which the heterologous DNA sequences are inserted (Levrero et al., Gene. 101 (1991) 195; Gosh-Choudhury et al., Gene 50 (1986) 161). On the other hand, to improve the properties of the vector, it has been proposed to create other deletions or modifications in the adenovirus genome. Thus, a thermosensitive point mutation has been introduced into the tsl25 mutant, allowing the 72 kDa DNA binding protein (DBP) to be inactivated (Van der Vliet et al., 1975). Other vectors comprise a deletion of another region essential to replication and / or viral propagation, the E4 region. The E4 region is indeed involved in the regulation of late gene expression, in the stability of late nuclear RNAs, in the extinction of the expression of host cell proteins and in the efficiency of viral DNA replication. Adenoviral vectors in which the regions El and E4 are eliminated then possess a transcription fogging and a very reduced viral gene expression, such vectors have been described for example in the applications W094 / 28152, O95 / 02697, PCT / FR96 / 00088 ). In addition, vectors containing a modification at the level of the Iva2 gene have also been described (O96 / 10088).

The recombinant adenoviruses described in the literature are produced from different adenovirus serotypes. There are in fact different serotypes of adenoviruses, whose structure and properties vary slightly, but which have a comparable genetic organization. More particularly, the recombinant adenoviruses may be of human or animal origin. As regards the adenoviruses of human origin, those classified in group C, in particular adenovirus type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2), can be cited preferentially. Among the various adenoviruses of animal origin, adenoviruses of canine origin can be cited preferentially, and particularly all strains of CAV2 adenoviruses (manhatttan or A26 / 61 strain (ATCC VR-800) for example). Other adenoviruses of animal origin are cited in particular in the application W094 / 26914 incorporated herein by reference.

In a preferred embodiment of the invention, the recombinant adenovirus is a human adenovirus of group C. More preferably, it is an Ad2 or Ad5 adenovirus.

Recombinant adenoviruses are produced in an encapsulating strain, ie, a strain of cells capable of trans-complementing one or more of the deficient functions in the recombinant adenoviral genome. One of these strains is for example strain 293 in which a part of the adenovirus genome has been integrated. More precisely, strain 293 is a strain of human embryonic kidney cells containing the left extremity (approximately 11-12%) of the adenovirus serotype 5 (Ad5) genome, the left ITR comprising the encapsulation region, the El region. , which includes Ela and Elb, the coding region for the pIX protein and a part of the coding region for the pIVa2 protein. This strain is capable of transcomplementing defective recombinant adenoviruses for the El region, ie, devoid of all or part of the El region, and of producing viral stocks having high titers. This strain is also capable of producing, at permissible temperatures (32 ° C), virus stocks that also contain the thermosensitive E2 mutation. Other cell strains capable of complementing the El region have been described, based particularly on human lung carcinoma cells A549 (094/28152) or on human retinoblasts (Hum. Gen. Ther. (1996) 215). On the other hand, strains capable of trans-complementing various functions of the adenovirus have also been described. In particular, one can cite strains that complement the El and E4 regions (Yeh et al., J. Virol. 70 (1996) 559; Gen. Ther. (1995) 322; Krougliak El and E2 (W094 / 28152, o95 / 02697, WO95 / 27071).

Recombinant adenoviruses are usually produced by introduction of viral DNA into the encapsulating strain, followed by lysis of the cells after approximately 2 or 3 days (the kinetics of the adenoviral cycle being 24 to 36 hours). After lysis of the cells, the recombinant viral particles are isolated by gradient centrifugation of cesium chloride.

For the application of the method, the introduced viral DNA can be the complete recombinant viral genome, eventually constructed in a bacterium (O96 / 25506) or in a yeast (WO95 / 03400), transfected in one of the cells. It can also be a recombinant virus used to infect the encapsulating strain. The viral DNA can also be introduced in the form of fragments each containing a part of the recombinant viral genome and a zone of homology that allows, after introduction into the encapsulation cell, to reconstitute the recombinant viral genome by homologous recombination between the different fragments. . A classical adenovirus production process thus comprises the following steps: Cells (for example 293 cells) are infected in a culture box with a viral pre-reservation at a rate of 3 to 5 viral particles per cell (Multiplicity of Infection (MOI) ) = 3 to 5), or transfected with the viral DNA. The incubation lasts after 40 to 72 hours. The virus is then released from the nucleus by lysis of the cells, usually by several successive thawing cycles. The cell lysate obtained is then centrifuged at low speed (2000 to 4000 rpm) and the supernatant (clarified cell lysate) is then purified by centrifugation in the presence of cesium chloride in two stages: - A first rapid centrifugation of 1.5 hours on two layers of cesium chloride of densities 1.25 and 1.40, framing the density of the virus (1.34) in order to separate the virus from the proteins of the medium; - A second centrifugation in longer gradient (from 10 to 40 hours depending on the rotor used), which is the true and only stage of purification of the virus.

Generally, after the second stage of centrifugation, the band of the virus is the majority. However, two less dense, thin bands are observed, whose observation in electron microscopy has shown that they are viral particles that are empty or broken by the densest band, and of viral subunits (pentons, hexons) for the less dense band. After this step, the virus is harvested by needle puncturing in the centrifugation tube and the cesium is removed by dialysis or desalination.

Although the purity levels obtained are satisfactory, this type of process nevertheless presents certain drawbacks, in particular, it is based on the use of cesium chloride, which is a reagent incompatible with a therapeutic use in man. From this fact, it is imperative to remove the cesium chloride at the end of the purification. This method also has certain drawbacks in addition to those mentioned above, which limit its use on an industrial scale.

To remedy these problems, it has been proposed to purify the virus obtained after lysis, not by gradient of cesium chloride, but by chromatography. In this way the article by Huyghe and collaborators (Hum. Gen. Ther. 6 (1996) 1403) describes a study of different types of chromatographies applied to the purification of recombinant adenoviruses. This article describes in particular a purification study of recombinant adenoviruses using a weak anion exchange chromatography (DEAE). Previous works already described the use of this type of chromatography for this purpose (Klemperer et al, Virology 9 (1959) 536, Philipson L., Virology 10 (1960) 459, Haruna et al., Virology 13 (1961) 264). .

The results present in the article Haruna and collaborators, demonstrated a fairly efficient mediocre chromatography protocol by exchange of ion recommended So the resolution obtained is median, the authors indicate that virus particles are present in several chromatographic peaks; the yield is weak (yield on viral particles: 67%, yield on infectious particles: 49%) and the viral preparation obtained after this chromatographic step is impure, and a pretreatment of the virus by different enzymes / proteins is necessary. The same article also describes a study on the use of gel permeation chromatography, which shows very poor resolution and very weak performance (15-20%).

The present invention describes a new process for the production of recombinant adenoviruses. the method according to the invention results from modifications of the previous processes to the level of the production phase and / or to the level of the purification phase. The method according to the invention currently allows very quickly and industrially to obtain virus stocks in very high quantities and qualities.

One of the first aspects of the invention concerns more particularly a procedure for the preparation of recombinant adenoviruses in which viruses are harvested from the culture supernatant. Another aspect of the invention concerns an adenovirus preparation process comprising an ultrafiltration step. According to another aspect, the invention also concerns a procedure for purification of recombinant adenoviruses comprising an anion exchange chromatography step. The present invention also discloses an improved purification method using gel permeation chromatography, coupled with anion exchange chromatography, the method according to the invention makes it possible to obtain high quality viruses, in terms of purity, stability, morphology, and of infecciocidad, with very high yields and in conditions of production totally compatible with the industrial exigencies and with the regulation that concerns the production of therapeutic molecules.

In particular, in terms of industrialization, the method of the invention utilizes methods of treating culture supernatants tested on a large scale for recombinant proteins, such as microfiltration or deep filtration, and tangential ultrafiltration. On the other hand, from the fact of the stability of the virus at 37 ° C, this procedure allows a better organization to industrial stage to the extent that, contrary to the intracellular method, the collection time does not need to be precise near the middle of the day. It also guarantees maximum virus collection, which is particularly important in the case of defective viruses in several regions.

On the other hand, the method of the invention allows easier and more precise monitoring of production kinetics, directly on homogenous samples of supernatant, without pretreatment, which allows a better reproducibility of the productions. The method according to the invention also allows to be released from the lysis stage of the cells. The lysis of the cells presents several drawbacks. Thus, it can be difficult to contemplate the breakdown of the cells by freeze-thaw cycles at the industrial level. On the other hand, alternative methods of lysis (Dounce, X-press, sonication, mechanical shear forces, etc.) have drawbacks: They are potentially generating aerosols difficult to confine for L2 or L3 viruses (level of virus confinement, which depends of their pathogenicity or their mode of dissemination), these viruses that have, on the other hand, the tendency to be infectious by airway; they generate cutting forces and / or a release of heat difficult to control, and that decreases the activity of the preparation. The solution of using detergents to lyse the cells would need to be validated and would also need a validation of detergent removal. Finally, cell lysis leads to the presence in the environment of numerous cellular debris, which makes purification more delicate. In terms of virus quality, the method of the invention potentially allows a better maturation of the viruses leading to a more homogeneous population. In particular, in the measurement of viral DNA packaging is the last stage of the viral cycle, the premature lysis of cells releases potentially empty particles that, although not replicable, are a priori infectious and also participate in the toxic effect of the virus and increase the proportion of specific activity of the preparations obtained. The specific infectiousness ratio of a preparation is defined as the ratio of the total number of viral particles, measured by biochemical methods (OD260nm, CLHP, PCR, immunoenzymatic methods, etc.) on the number of viral particles that generate a biological effect (formation of lysis spaces on cells in culture in solid medium, cell transduction). in practice, for a purified preparation, this ratio is determined by making the ratio of the concentration of the particles measured by OD to 260 nm on the concentration of units that form spaces in the preparation. This ratio must be less than 100.

The results obtained show that the method of the invention allows to obtain a virus of a purity at least equal to its homolog purified by centrifugation in cesium chloride gradient, in a single step and without previous treatment, starting from a concentrated viral supernatant.

A first objective of the invention then concerns a method of production of recombinant adenoviruses characterized in that the viral DNA is introduced into a culture of encapsulated cells and the produced viruses are collected after release in the supernatant of the culture. Contrary to the previous procedures in which the viruses are collected after a premature cellular lysis performed mechanically or chemically, in the method of the invention, the cells are not lysed by the intervention of an external factor. The culture is continued for a longer time, and the viruses are harvested directly into the supernatant, after spontaneous release by the encapsulating cells. The viruses according to the invention are thus recovered in the cell supernatant, whereas in the previous methods, it is an intracellular virus, more particularly intranuclear.

The Applicant has now shown that, despite the prolongation of the culture duration and despite the application of larger volumes, the method according to the invention allows to generate viral particles in a high quantity and of better quality. Furthermore, as indicated above, this procedure allows to release the lysis stages that are heavy at the industrial level and that generate numerous impurities.

The principle of the procedure then lies in the collection of viruses released in the supernatant. This method can involve a culture time superior to that of the previous techniques based on the lysis of the cells. As indicated above, the collection time has not been accurate in about half a day. It is essentially determined by the kinetics of virus release in the culture supernatant.

The kinetics of virus release can be followed in different ways. In particular, it is possible to use analytical methods such as RP-HPLC, IE-HPLC, semi-quantitative PCR (example 4.3), staining of dead cells with trypan blue, measurement of the release of intracellular enzymes from the type LDH, the measurement of particles in the supernatant by Coulter-type devices or by diffraction of light, immunological (ELISA, RIA, etc.) or nephelometric methods, titration by aggregation in the presence of antibodies, etc.

In a preferred manner, collection is performed when at least 50% of the viruses have been released into the supernatant. The time in which 50% of the viruses have been released can be easily determined by performing a kinetics according to the methods described below.

Even more preferentially, the collection is performed when at least 70% of the viruses have been released in the supernatant. It is particularly preferred to harvest when at least 90% of the viruses have been released into the supernatant, ie when the kinetics reaches a constant level. The release kinetics of the virus rests essentially in the replication cycle of the adenovirus, and may be influenced by certain factors, in particular, it may vary according to the type of virus used, and particularly according to the type of deletion effected in the recombinant viral genome. In particular, the removal of the E3 region appears to slow the release of the virus. Thus, in the presence of the E3 region, the virus can be collected from 24-48 hours after infection. On the contrary, in the absence of the E3 region, a longer culture time seems necessary. In this regard, the applicant has performed kinetic experiments for the release of an adenovirus deficient for the El and E3 regions in the supernatant of the cells, and demonstrated that the release begins approximately 4 to 5 days post-infection, and lasts up to 14 days approximately. The release usually reaches a constant level between day 8 and day 14, and the titer remains stable at least 20 days post-infection.

Preferentially, in the method of the invention, the cells are cultured for a period comprised between 2 and 14 days. On the other hand, the release of the virus can be induced by expression in the cell of encapsulation of a protein, for example viral, involved in the release of the virus. Thus, in the case of adenovirus, the release can be modulated by the expression of the Death protein encoded by the E3 region of the adenovirus (protein E3-11, 6K), possibly expressed under the control of an inducible promoter. From this fact, it is possible to reduce the time of virus release and to collect in the culture supernatant, more than 50% of the viruses 24-48 hours post-infection.

To recover the viral particles, the supernatant of the culture is favorable and previously filtered. The adenovirus that has a size of approximately 0.1 μm (120 nm), the filtration is carried out by means of membranes that have a sufficiently important porosity to allow the virus to pass, but fine enough to retain the contaminants, preferably the filtration is carried out by means of membranes having a porosity higher than 0.2 μm. According to a particularly favorable form of application, the filtration is carried out by successive filtrations on membranes of decreasing porosity. Particularly good results have been obtained by filtering on deep filters of decreasing porosity μm, 1.0 μm, then 0.8 μm-0.2 μm. According to another preferred variant, the filtration is performed by tangential microfiltration on Millipore flat membranes or concave fibers having a porosity comprised between 0.2 and 0.6 μm. The results presented in the examples demonstrate that this filtration step has a yield of 100% (No loss of virus has been observed by retention on the filter having the slightest porosity).

According to one aspect of the invention, the applicant has currently adjusted a procedure that allows to collect and purify the virus from the supernatant. For this purpose, the supernatant thus filtered (or clarified) is subjected to an ultrafiltration. This ultrafiltration allows (i) concentrating the supernatant, the volumes involved being important, (ii) effecting a first purification of the virus (iii) adjusting the preparation buffer in the subsequent stages of preparation. According to a preferred embodiment, the supernatant is subjected to a tangential ultrafiltration. The tangential ultrafiltration consists of concentrating and fractionating a solution between two compartments, retaining the filtrate, separated by membranes of determined threshold of cut, realizing a flow in the retained compartment of the device and applying a transmembrane pressure between this compartment and the filtration compartment. The flow is generally carried out by means of a pump in the retention compartment of the device and the trans-membrane pressure is controlled by means of a gate on the liquid vein of the retained circuit or of a variable-expense pump on the liquid vein of the circuit filtered out. The flow velocity and the trans-membrane pressure are selected so as to generate few shear forces (Reynolds number less than 5000 / sec, preferentially lower than 3000 / sec, pressure less than 1.0 bar) avoiding saturation of the membranes . Different systems can be used to perform ultrafiltration, such as spiral membrans (Millipore, Amicon), flat membranes or concave fibers (Amicon, Millipore, Sartorius, Pall, GF, Sepracor). the adenovirus that has a mass of approximately 1000 kDa, use favorably within the framework of invention, membranes having a cut-off threshold of less than 1000 kDa, preferably comprised between 100 kDag 1000 kDa.

The use of membranes that have a cut-off threshold of 1000 kDa or higher have as a consequence, in effect, a significant loss of virus at this stage. Preferentially, membranes having a cut-off threshold between 200 and 600 kDa, even more preferably, between 300 and 500 kDa are used. The experiences presented in the examples demonstrate that the use of a membrane having a cut-off threshold of 300 kDa allows the retention of more than 90% of the viral particles by eliminating contaminants from the medium (DNA, medium proteins, cellular proteins, etc.). ). The use of a cut-off threshold of 500 kDa offers the same advantages.

The results presented in the examples show that this stage allows to concentrate volumes of important supernatants, without loss of virus (yield of 90%), and that generates a virus of better quality, in particular, concentration factors of 20 to 100 times can be easily obtained.

This ultrafiltration step thus constitutes a supplementary purification in relation to the classical scheme insofar as contaminants of lower mass at the cut-off threshold (300 or 500 kDa) are at least partially eliminated. The improvement in the quality of the viral preparation is clear when comparing the appearance of the separation after the first ultracentrifugation step according to the two methods. In the classic procedure involving lysis, the tube of the viral preparation presents a cloudy appearance with a clot (lipids, proteins) that sometimes come to touch the band of viruses, while in the process of the invention, the preparation after release and ultrafiltration presents a band already well resolved from the contaminants of the medium that persists in the upper phase. The improvement of quality is thus demonstrated when comparing the profiles on ion exchange chromatography of a virus obtained by cell lysis in relation to the virus obtained by ultrafiltration as described in the present invention. On the other hand, it is still possible to improve the quality by continuing the ultrafiltration by diafiltration of the concentrate. This diafiltration is carried out on the same principle as the tangential ultrafiltration, and allows contaminants larger than the cut-off threshold of the membrane to be more completely eliminated, by balancing the concentrate in the purification buffer.

On the r hand, the applicant has also demonstrated that this ultrafiltration allows the virus to be purified directly by chromatography on an ion exchange column or by gel permeation chromatography, which allows excellent resolution of the peak of viral particles without the need for treatment of the preparation prior to chromatography. This is particularly unexpected and advantageous. Indeed, as indicated in the article of Hyughe et al mentioned previously, the purification by chromatography of viral preparations gives mediocre results and also needs a pretreatment of the viral suspension by Benzonaza and cyclodextrins.

More particularly, the method according to the invention is then characterized in that the viruses are collected by ultrafiltration.

As indicated above, the resulting concentrate is directly usable for a virus purification.

This purification can be carried out by the previous classical techniques, such as the gradient centrifugation of cesium chloride or anr ultracentrifugation means that allows the particles to be separated according to their size, density or sedimentation coefficient. The results presented in Example 4 demonstrate that the virus thus obtained has outstanding characteristics, in particular, according to the invention, it is possible to replace cesium chloride with a solution of iodixanol, 5,5 '- [(2-hydroxy) L-3-propanediyl) -bis (acetylamino)] bis [N, N'-bis (2,3-dihydroxypropyl-2,4,6-triiodo-1,3-benzenecarboxamide] in which the virus sediments at equilibrium at a density relative to between 1.16 and 1.24 The use of this solution is advantageous since, contrary to cesium chloride, it is non-toxic.Furthermore, the applicant has also shown that, in a favorable manner, the concentrate obtained thus allowed to purify the virus directly by an ion exchange mechanism or by gel permeation, and obtain an excellent resolution of the chromatographic peak of viral particles, without the need of pretreatment.

According to a preferred embodiment, the viruses are then harvested and purified by anion exchange chromatography.

For anion exchange chromatography, different types of supports can be used, such as cellulose, agarose, (Sepharose gels), dextran (gels) Sephadex), acrylamide (Sephacryl gels, Trisacryl gels), silica (gels TSK-gelSW), poly [styrene-divinylbenzene] (Source gels or Poros gels), the ethylene glycol-methacrylate copolymer (Toyopearl HW and TSK-gelPW gels), or mixtures (agarose-dextran: Superdex gel). On the r hand, to improve the chromatographic resolution, it is preferable within the framework of the invention to use supports in the form of beads, having the following characteristics: - as spherical as possible, - of calibrated diameter (pearls all identical or as homogeneous as possible), without imperfections or cracks, - of diameter as small as possible: the pearls of 10 μm have been described (MonoBeads of Pharmacia or TSK-gel of TosoHaas, for example). This value seems to constitute the lower limit for the diameter of pearls whose porosity must on the r hand be very high to allow the penetration of the objects to be chromatographed inside the beads (see below). - all the previous one conserving the rigidity to resist the pressure.

On the r hand, in order to chromatograph the adenoviruses that constitute objects of very large size (diameter> 100nm), it is important to apply gels that have an upper limit of high porosity, up to the highest possible, to allow the access of the viral particles to the functional groups with which they are called to interact.

Favorably, the support is selected from agarose, dextran, acrylamide, silica, poly [styrene-divinylbenzene], ethylene glycol-methacrylate copolymer, alone or in admixture.

For anion exchange chromatography, the support used must be activated by grafting a group capable of interacting with an anionic molecule. More generally, the group is constituted by an amine that can be ternary or quaternary. Using a ternary amine, such as DEAE for example, a weak anion exchanger is obtained. Using a quaternary amine, a strong ion exchanger is obtained.

Within the framework of the present invention, it is particularly favorable to use a strong ion exchanger. Thus, a chromatography support, as indicated below, activated by quaternary amines, is preferably used according to the invention. Among the supports activated by quaternary amines, the following can be mentioned as examples: Source Q, Mono Q, Q Sepharose, Poros HQ and Poros QE resins, Fractogel TMAE type resins, and Toyopearl Super Q resins.

Preferred examples of resins which can be used in the context of the invention are Source, particularly Source Q, such as 15 Q (Pharmacia), Monobeads, such as Q (Pharmacia), the Poros HQ and Poros QE type resins. Monobeads support ((bead diameter 10 ± 0.5 μm) has been commercially available for ten years and Source (15 μm) or Poros (10 μm or 20 μm) resins for the past five years. The advantage of having a wider internal pore distribution (ranging from 20 nm to 1 μm), thus allowing the passage of very large objects through the beads, also offer very little resistance to the circulation of liquid through the gel ( then very little pressure) and they are very rigid, the transport of solutes to the functional groups with which they are going to interact is then very fast.The applicant has shown that these parameters are particularly important in the case of adenovirus, whose diffusion is slow because of its size.

The results presented in the examples demonstrate that the adenovirus can be purified from the concentrate in a single step of anion exchange chromatography, whose purification performance is excellent (140% in terms of tdu, compared to the value of 49% reported by Huyghes et al.) and that the resolution is excellent. In addition, the results presented show that the adenovirus obtained has a high infectivity, and then possesses the characteristics required for a therapeutic use. Particularly advantageous results have been obtained with a strong ion exchanger, that is activated by quaternary amines, and particularly with the Source Q resin. Source Q15 resin is particularly preferred.

In this regard, another object of the invention concerns a method of purification of recombinant adenoviruses from a biological medium characterized in that it comprises a purification step by means of strong anion exchange chromatography.

According to this variant, the biological medium can be a supernatant of encapsulating cells that produce the said virus, a lysate of encapsulating cells that produce said virus, or a prepurified solution of said virus.

Preferably, the chromatography is carried out on an activated support with a quaternary amine. Always according to a preferred mode, the support is selected from the agarose, the dextran, the acrylamide, the silica, the [polystyrene-divinylbenzene], the ethylene glycol-methacrylate copolymer, alone or in admixture.

A particularly advantageous embodiment is characterized in that the chromatography is carried out on a Source Q resin, preferably Q15.

On the other hand, the procedure described below is favorably performed from a supernatant of producer cells, and comprises a previous ultrafiltration step. This step is advantageously carried out under the conditions defined above, and particularly, it is a tangential ultrafiltration on membrane having a cut-off threshold comprised between 300 and 500 kDa.

According to one embodiment of the method of the invention, the viruses are collected and purified by gel permeation chromatography.

Gel permeation can be performed directly on the supernatant, on the concentrate, or on the virus resulting from anion exchange chromatography. The supports mentioned for anion exchange chromatography can be used in this stage, but without activation.

In this regard, the preferred supports are agarose (gels Sepharose), dextran (gels Sephadex), acrylamide (gels Sephacryl), silica (gels TSK-gel SW), ethylene glycol-methacrylate copolymer (Toyopearl HW gels and TSK-gel PW), or mixtures (agarose-dextran: Superdex gel). Particularly preferred supports are: - the Superdex 200 HR (Pharmacia) - the Sephacryl S-500HR, S-100HR or S-2000 (Pharmacia) - the TSK G6000 PW (TosoHaas).

A preferred process according to the invention then comprises an ultrafiltration followed by anion exchange chromatography.

Another preferred process comprises ultrafiltration followed by anion exchange chromatography, followed by gel permeation chromatography.

Another variant of the invention concerns an adenovirus purification process from a biological medium comprising a first ultracentrifugation step, a second dilution or dialysis step, and a third step of anion exchange chromatography. Preferentially according to this variant, the first stage is performed by rapid ultracentrifugation on cesium chloride gradient. The term fast means an ultracentrifugation that goes from 0.5 to 4 hours approximately. In the course of the second step, the virus is diluted or dialysate against the buffer, to facilitate its injection on the chromatography gel, and the elimination of the ultracentrifugation medium. The third step is carried out using anion exchange chromatography as described above, preferably strong anions. In a typical experiment, from the virus collected in the supernatant (or possibly intracellular), a first rapid centrifugation is carried out with cesium chloride (as in example 3). Then, after a simple dilution of the sample (for example by 10 volumes of buffer) or after a simple dialysis in the buffer, the sample is chromatographed on ion exchange (as in Example 5.1.). The advantage of this variant of the method of the invention stems from the fact that it applies 2 completely different modes of virus separation (density and surface charge), and can eventually lead the virus to a level of quality that combines the executions of the virus. methods In addition, the chromatography step simultaneously allows to eliminate the medium used for the ultracentrifugation (cesium chloride for example, or any other equivalent means cited above).

Another object of the invention concerns the use of iodixazole, 5, 5 '- [(2-hydroxy-l-3 propanediyl) -bis (acetylamino)] bis [2,3-dihydroxypropyl-2,4,6-triodo-1, 3-benzenecarboxamide] for the purification of adenovirus.

For the application of the method of the invention, different encapsulation cells of the adenoviruses can be used, in particular, the encapsulation cells can be prepared from different pharmaceutically usable cells, that is to say cultivable under the industrially acceptable conditions and having no character recognized pathogen. It can be established cell strains or primary cultures and particularly human retinoblasts, human lung carcinoma cells, or kidney embryonic cells. It treats favorably of cells of human origin, infectible by an adenovirus. In this regard, the cells KB, Hela, 293, Vero, gmDBP6, HER, A549, HER, etc. can be cited.

The cells of strain KB are originated in a human epidermal carcinoma. They are accessible in the ATCC (ref CCL17) as well as the conditions that allow their cultivation. The strain of human Hela cells is originated in a carcinoma of the human epithelium. It is equally accessible in the ATCC (ref CCL2) as well as the conditions that allow its cultivation. The cells of strain 293 are human embryonic kidney cells (Graham et al., J. Gen. Virol. 36 (1977) 59). This strain contains particularly, integrated in its genome, the left part of the genome of human adenovirus Ad5 (12%). The DBP6 gm cell strain (Brough et al., Virology 190 (1992) 624) consists of Hela cells containing the E2 gene of adenovirus under the control of the MMTV LTR.

It can also be treated with cells of canine origin (BHK, MDCK, etc.). In this respect, the cells of MDCK canine strains are preferred. The culture conditions of MDCK cells have been described in particular by Macatney et al., Science 44 (1988) 9.

Different strains of encapsulation cells have been described in the literature and are mentioned in the examples. It treats favorably of cells that trans-complement the El function of the adenovirus. Still more preferably, these are cells that trans-complement the El and E4 or El and E2a functions of the adenovirus. These cells are preferentially derived from human embryonic kidney or retinal cells, or from human lung carcinomas.

The invention thus provides a particularly favorable recombinant adenovirus production method. This method is adapted to the production of defective recombinant viruses for one or several regions, and in particular, of viruses defective for the El region, or for the El and E4 regions. On the other hand, it is applicable to the production of adenoviruses of different serotypes, such as those indicated above.

According to a particularly advantageous mode, the method of the invention is used for the production of recombinant adenoviruses in which the El region is inactivated by deletion of a PvuII-BglII fragment ranging from nucleotide 454 to nucleotide 3328, over Adéñovirus Ad5 sequence . This sequence is accessible in the database and also under the database (see in particular Genebank No. M73260). In another preferred embodiment, the El region is inactivated by deletion of a HinfII-Sau3A fragment ranging from nucleotide 382 to nucleotide 3446. In a particular mode, the method allows the production of vectors comprising a deletion of all of the E4 region. this can be done by cleaving a Maell-Mscl fragment corresponding to nucleotides 35835-32720. In another particular mode, only a functional part of E4 is suppressed. This part comprises at least phases ORF3 and ORF6. By way of example, these coding phases can be deleted from the genome in the form of PvuII-AluI and BglII-PvuII fragments respectively, corresponding to nucleotides 34801-34329 and 34115-33126 respectively. Deletions of the E4 regions of the Ad2 dl808 virus or Ad5 dll004, Ad5 dll007, Ad5 dllOll or Ad5 dll014 viruses can also be used within the framework of the invention, in this respect, the cells of the invention are particularly favorable for the production of viruses comprising an inactive region and a deletion in the E4 region of the type present in the genotype of Ad5 dll014, ie of E4 virus which preserves the ORF4 reading phase.

As indicated above, the deletion in the region It covers all or part of the ElA and E1BB regions favorably. This deletion must be sufficient to make the virus incapable of autonomous replication in a cell. The part of the region The deleted in the adenoviruses according to the invention favorably covers nucleotides 454-3328 or 382-3446.

The positions given above refer to the wild-type Ad5 adenovirus sequence as published and accessible in the database. Although minor variations may exist between the different serotypes of adenoviruses, these positions are generally applicable to the construction of recombinant adenoviruses according to the invention from all serotypes, and particularly adenoviruses Ad2 and Ad7.

On the other hand, the produced adenoviruses may possess other alterations at the level of their genome. in particular, other regions can be suppressed to increase the capacity of the virus and reduce its side effects related to the rexpression of viral genes. Also, all or part of the E3 or Iva2 region can be particularly suppressed. As far as the E3 region is concerned, it may nevertheless be particularly favorable to retain the coding part for the gpl9K protein. This protein makes it possible to avoid that the adenoviral vector makes the object of an immune reaction that (i) would limit its action and (ii) there could be undesirable side effects. According to a particular mode, the E3 region is deleted and the coding sequence for the gpl9K protein is reintroduced under the control of a heterologous promoter.

As indicated above, adenoviruses are very efficient gene transfer vectors for gene and cell therapy applications. Therefore, a heterologous nucleic acid sequence can be inserted into its genome, from which the transfer and / or expression in a cell, an organ or an organism is investigated. This sequence may contain one or several therapeutic genes, such as a gene whose transcription and eventually transduction in the target cell generate products that have a therapeutic effect. among the therapeutic products, it is possible to mention more particularly the enzymes, the blood derivatives, the hormones, the lymphokines: interleukins, interferons, TNF, etc. (FR 9203120), the growth factors, the neurotransmitters or their precursors or synthetic enzymes, the trophic factors: BDNF, CNTF, NGF, IGF, GMF, aFGF, bFGF, NT3, NT5, etc; apolipoproteins: ApoAI, ApoAIV, ApoE, etc. (WO94 / 25073), dystrophin or a midistrofin (WO93 / 06223), tumor suppressor genes: p53, Rb, RaplA, DCC, k-rev, etc. (W094 / 24297), the genes coding for factors involved in coagulation: Factors VII, VIII, IX, etc. the suicide genes: thymidine kinase, cytosine deaminase, etc. or still all or part of a natural or artificial immunoglobulin (Fab, ScFv, etc. W094 / 29446), etc. the therapeutic gene may also be a gene or a reverse sequence, whose expression in the target cell allows controlling the expression of genes or the transcription of cellular mRNAs. Such sequences can for example be transcribed, in the target cell, into RNAs complementary to cellular mRNAs and thus block their transduction in protein, according to the technique described in EP 140 308. The therapeutic gene can also be a gene coding for a peptide antigenic, able to generate in man an immune response, in view of the realization of vaccines. It can be particularly antigenic peptides specific to epstein bar virus, HIV virus, hepatitis B virus (EP 185 573), pseudo-rabies virus, or even more tumor-specific (EP 259 212). .

Generally, the heterologous nucleic acid sequence also comprises a promoter region of functional transcription in the infected cell, as well as a region located 3 'of the gene of interest, and which specifies a transcriptional end signal and a polyadenylation site. The set of these elements constitutes the expression cartridge, as far as the promoter region is concerned, it can be a natural promoter region responsible for the expression of the gene considered when it is capable of functioning in the infected cell. It is also possible to deal with regions of different origin (responsible for the expression of other proteins, or also synthetic ones). In particular, it can be promoter sequences of eukaryotic or viral genes or of any promoter or derivative sequence, which stimulates or represses the transcription of a gene in a specific manner or not and in an inducible manner or not. By way of example, it may be promoter sequences from the genome of the cell to be infected, or from the genome of a virus, and in particular, the promoters of genes ElA, adenovirus MLP, the CMV promoter, LTR-RSV, etc. among the eukaryotic promoters, mention may also be made of the ubiquitous promoters (HPRT, vimentin, ...) -actin, tubulin, etc.) the intermediate filament promoters (desmin, neurofilaments, keratin, GFAP, etc.) promoters of therapeutic genes (type MDR, CFTR, factor VIII, etc.) tissue-specific promoters (pyruvate kinase, villin, intestinal protein promoter binding fatty acids , promoter of the actin of smooth muscle cells, promoters specific for the liver, Apo AI, Apo AII, Human albumin, etc.) or even the promoters that respond to a stimulus (steroid hormone receptor, retinoic acid receptor, etc.). In addition, these expression sequences can be modified by the addition of activation, regulation sequences, or that allow tissue-specific or majority expression. On the other hand, when the inserted nucleic acid does not contain expression sequences, it can be inserted into the genome of the defective virus towards the end of such sequence.

On the other hand, the heterologous nucleic acid sequence can also contain, in particular towards the start of the therapeutic gene, an indicator sequence that directs the therapeutic product synthesized in the secretion pathways of the target cell, this indicator sequence can be the indicator sequence of the therapeutic product, but can also be any other functional indicator sequence, or of an artificial indicator sequence.

The expression cartridge of the therapeutic gene can be inserted in different sites of the genome of the recombinant adenovirus, according to the techniques described in the previous specialty. It can first be inserted at the level of the deletion El. It can also be inserted at the level of the E3 region, in addition or in substitution of sequences. It can also be located at the level of the suppressed E4 region.

The present invention also concerns the purified viral preparations obtained according to the process of the invention, as well as any pharmaceutical composition containing one or several defective recombinant adenoviruses perparated according to this method. The pharmaceutical compositions of the invention can be formulated in view of topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, infraocular, transdermal, etc. administration.

Preferably, the pharmaceutical composition contains pharmaceutically acceptable carriers for an injectable formulation. It can be, in particular, saline solutions (monosodium phosphate, disodium, sodium chloride, potassium, calcium, or magnesium, etc., or mixtures of said salts), sterile, isotonic, or dry compositions, particularly lyophilized, which, by addition according to the case of sterilized water or physiological saline, allow the constitution of injectable solutes. Other excipients may be used such as for example a hydrogel. This hydrogel can be prepared from all biocompatible and non-cytotoxic polymer (homo or hetero). Such polymers have for example been described in the application WO93 / 08845. Certain among them, as particularly those obtained from ethylene oxide and / or propylene are commercial. The doses of virus used for the injection can be adapted according to different parameters, and particularly depending on the mode of administration used, the corporid pathology, the gene to be expressed, or even the duration of the investigated treatment. In a general manner, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses comprised between 104 and 1014 pfu, and preferably 106 to 1010 pfu. the term pfu ("plaque forming unit") corresponds to the infectious power of an adenovirus solution, and is determined by infection of an appropriate cell culture, and measured, generally after 15 days, of the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature.

According to the therapeutic gene, the viruses thus produced can be used for the treatment or prevention of numerous pathologies, including genetic diseases (dystrophy, cystic fibrosis, etc.), neurodegenerative diseases (Alzheimer's, Parkinson's, Ais, etc.), cancers. , pathologies related to coagulation disorders or to lipoproteinemia problems, pathologies related to viral infections (hepatitis, AIDS, etc.), etc.

The present invention will be more fully described with the help of the following examples, which should be considered as illustrative and not limiting.

Explanatory title of the figures Figure 1: Study of the stability of the purified adenovirus according to example 4.

Figure 2: HPLC analysis (reverse phase) of the purified adenovirus according to example 4. Comparison with the adenovirus of example 3.

Figure 3: Kinetics of release of the Ad-Gal adenovirus in the 293 cell supernatant, measured by semi-quantitative PCR and Assay Plate.

Figure 4: Elution profile on Source Q15 of an ultrafiltered adenovirus supernatant (example 5.1.).

Figure 5: CLHP Ressource Q analysis of virus peak harvested by chromatography on Source Q15 resin of an ultrafiltrate adenovirus supernatant (example 5.1.).

Figure 6: (A) Source Q15 elution profile of an ultrafiltrate Ad-APOAl adenovirus supernatant (Example 5.3); and (B) Analysis in CLHP (Resource Q) of the virus peak collected.

Figure 7: (A) Elution profile on Source Q15 of an ultrafiltrate Ad-TK adenovirus supernatant (Example 5.3).

Analysis in CLHP (Resource Q) of the different fractions (start and end of peak) of virus collected: (B) Fraction F2, in the middle of the peak; (C) Fraction F3, peak limit; (D) Fraction F4, end of peak.

Figure 8: Elution profile on Mono Q resin of a concentrated culture supernatant of adenovirus-producing cells (example 5.4). BG25F1: Virus supernatant concentrated and purified on cesium. BG25C: Infected supernatant, concentrated.

Figure 9: POROS HQ gel elution profile of a concentrated culture supernatant of adenovirus producing cells (example 5.4) BG25F1: Virus supernatant concentrated and purified on cesium. BG25C: Infected supernatant, concentrated.

Figure 10: Profile of purification by permeabilization of ggel on Sephacryl SIOOOHR / Superdex 200HR of an ultrafiltrate adenovirus supernatant (example 6).

Figure 11: Electron microscope analysis of a purified adenovirus pool according to the invention.

Figure 12: Electron microscope analysis of the density virus band 1.27.

General molecular biology techniques The methods conventionally used in molecular biology such as the preparative extractions of plasmid DNA, the centrifugation of plasmid DNA in cesium chloride gradient, the electrophoresis on agarose or acrylamide gels, the purification of DNA fragments by electroelution, the extractions of proteins to phenol or to phenol-chloroform, the precipitation of DNA in saline medium by ethanol or isopropanol, the transformation in Escherichia coli, etc ... are well known to those skilled in the art and are abundantly described in the literature [Maniatis T and collaborators, "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982; Ausubel F. M. et al. (Eds.), "Current Protocols in Molecular Biology", John Wiley & Sons, New York, 1987].

Plasmids of type pBR322, pUC and phages of the M13 series are of commercial origin (Bethesda Research Laboratories). For ligatures, DNA fragments can be separated according to their size by electrophoresis in agarose or acrylamide gels, extracts to phenol or by a phenol / chloroform mixture, precipitated to ethanol then incubated in the presence of phage T4 DNA ligase (Biolabs ) according to the supplier's recommendations. The filling of the prominent 5 'extenders can be effected by the Klenow fragment of the DNA polymerase and E. coli (Biolabs) according to the supplier's specifications. The destruction of prominent 3 'exterminities is effected in the presence of the T4 phage DNA polymerase (Biolabs) used according to the manufacturer's recommendations. The destruction of the prominent 5 'exterminities is effected by a treatment driven by nuclease Sl.

The in vitro directed mutagenesis by synthetic oligonucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764] using the equipment distributed by Amersham. Enzymatic amplification of DNA fragments by the aforementioned PCR technique [Polymerase-catalyzed Chain Reaction, Saiki R.K. et al., Science 230 (1985) 1350-1354; Mullis K. B. and Faloona F. A. Meth. Enzym. 155 (1987) 335-350] can be performed using a "DNA thermal cycler" (perkin-Elmer Cetus) according to the manufacturer's specifications. The verification of the nucleotide sequences can be carried out by the method developed by Sanger et al. [Proc. Natl. Acad. USA, 74 (1977) 5463-5467] using the equipment distributed by Amersham.

Examples Example 1: Cellular encapsulation strains The encapsulation cells used in the framework of the invention can come from any cell strain that can be infected by an adenovirus, compatible with its use for therapeutic purposes. It is more preferably a cell selected from the following cell strains: - The cells of strain 293: Strain 293 is a strain of human kidney embryonic cells containing the left extremity (approximately 11-12%) of the adenovirus serotype 5 (Ad5) genome, comprising the left ITR, the encapsulation region, the El region, including Ela, Elb, the coding region for the pIX protein and a part of the coding region for the pIVa2 protein (Graham et al., J. Gen. Virol. 36 (1977) 59). This strain is capable of trans-complementing defective recombinant adenoviruses for the El region, ie devoid of all or part of the El region, and of producing viral stocks having high titers.

- The cells of strain A549 Cells that complement the Adenovirus region have been constructed from A549 cells (Imler et al., Gene Ther. (1996) 75). These cells contain a restricted fragment of the El reagent, devoid of the left ITR, located under the control of an inducible promoter.

- The cells of the HER strain The embryonic cells of the human retina (HER can be infected by an adenovirus (Byrd et al., Oncogene 2 (1988) 477). Adenovirus encapsulation cells prepared from these cells have been described by example in application W094 / 28152 or in the article by Fallaux et al. (Hum. Gene Ther. (1996) 215), strain 911 comprising the El region of the Ad5 adenovirus genome, from nucleotide 79 to nucleotide 5789 integrated into the Her cell genome This strain of cells allows the production of defective viruses for the El region.

- The IGRP2 cells IGRP2 cells are cells obtained from 293 cells, by integration of a functional unit of the E4 region under the control of an inducible promoter. these cells allow the production of defective viruses for the El and E4 regions (Yeh et al., J. Virol (1996) 70).

- VK cells The VK cells (VK2-20 and VK10-9) are cells obtained from 293 cells, by integration of the integrality of the E4 region under the control of an inducible promoter, and of the coding region for the pIV protein. These cells allow the production of defective viruses-for the El and E4 regions (Krougliak et al., Hum. Gene Ther.6 (1995) 1575). - 293 E4 cells 293 E4 cells are cells obtained from 293 cells, by integrating the integrality of the E4 region. These cells allow the production of defective viruses for the El and E4 regions (WO95 / 02697; Cancer Gene Ther. (1995) 322).

Example 2: Viruses used The viruses produced within the framework of the examples that follow are an adenovirus containing the LacZ marker gene of E. coli (Ad-ßGal), an adenovirus containing the gene encoding thymidine kinase of herpes virus type I (Ad-TK), an adenovirus containing the gene encoding the human p53 tumor suppressor protein and a virus coding for apolipoprotein Al (Ad-apoAI). These viruses are derived from serotype Ad5 and have the following structure: - A deletion in the region covering, for example, nucleotides 382 (Hinfl site), at 3446 (site Sau3a).

A gene expression cartridge, under the control of the RSV or CMV promoter, inserted at the level of the aforementioned suppression.

- A deletion of the E3 region.

The construction of these viruses has been described in the literature (WO94 / 25073, WO95 / 14102, FR95.01632, Stratford-Perricaudet et al., J. Clin.Invest (1992) p626). It is understood that any other construction can be produced according to the method of the invention, and particularly viruses containing other heterologous genes and / or other deletions (E1 / E4 or E1 / E2 for example).

Example 3: Virus production by lysis of the cells This example reproduces the prior art of virus production, consisting of using the encapsulation cells to recover the viruses produced. 293 cells are infected up to 80-90% in culture box with a pre-stock of Ad-ßGal or Ad-TK virus (example 2) in a proportion of 3 to 5 viruses per cell (Multiplicity of Infection MOI = 3 to 5) . The incubation lasts 40 to 72 hours, the timing of collection is judged by the observation under the microscope of the cells that are rounded, become more refractive and more adherent and weaker in the support of the culture, in the literature the kinetics of the viral cycle lasts from 24 to 36 hours.

At the level of a laboratory production it is important to collect the cells before they are detached in order to eliminate the infection medium at the time of collection without loss of cells after collecting them in a minimum volume (the concentration factor is according to the crop size in the order of 10 to 100 times).

The virus is then released from the nucleus for 3 to 5 successive thawing cycles (carborefrigerated ethanol at -70 ° C, water bath at 37 ° C).

The cell lysate obtained is then centrifuged at low speed (2000 to 4000 rpm) and the supernatant (clarified cell lysate) is then purified by cesium chloride gradient ultracentrifugation in two steps: - A first rapid ultracentrifugation (step) of 1.5 hours 35,000 rpm rotor sw 41, on two layers of cesium 1.25 and 1.4 framing the density of the virus (1.34) in order to separate the virus from the proteins of the medium; the rotors can be rotors "swinging" (Sw28, Sw41Beckman) or fixed angle (Ti 45, Ti 70, Ti 70.1 Beckman) depending on the volumes to be treated; - A second ultracentrifugation in a longer gradient (from 10 to 40 hours depending on the rotor used), for example 18 hours at 35000 rpm in sw-41 rotor that constitutes the true and only purification of the virus, the virus is in a linear gradient. the balance at a density of 1.34.

Generally, at this stage, the virus band is the majority. However, it is sometimes observed two less dense, thin bands of which observation in an electron microscope has shown that they were empty or broken viruses and for the band less dense viral subunits (pentons, hexons). After these stages the virus is collected in the tube by needle puncture and the cesium is eliminated by dialysis or desalination on G25.

Example 4: Production of viruses in the supernatant This example describes an experience of virus production by recovery after spontaneous release, the virus is then harvested by ultrafiltration, then purified by cesium chloride. 4. 1 Protocol In this method, contrary to example 3, the cells are not collected 40 to 72 hours post-infection, but the incubation is prolonged between 8 to 12 days so as to obtain a total lysis of the cells without having to proceed to the cycles of freezes thawing. The viruses are in the supernatant.

The supernatant is then clarified by filtration on deep filters of decreasing porosity (10 μm / 1.0 μm / 0.8-0.2 μm).

The virus has a size of 0.1 μm and at this stage we have not observed any loss of virus by retention on the filter that has the slightest porosity (0.22 μm). The supernatant, once clarified is then concentrated by tangential ultrafiltration on spiral membrane Millipore that has a cutoff threshold of 300kDa.

In the experiences reported in the present invention, the concentration factor is dictated by the dead volume of the system which is 100 ml. Volumes of supernatant from 4 to 20 liters. They have been concentrated with this system, which allows to obtain volumes of 100 ml concentrate. to 200 ml. without difficulties, which corresponds to a concentration factor of 20 to 100 times.The concentrate is then filtered over 0.22 μm purified by centrifugation over cesium chloride as described in example 3, followed by a dialysis step. 4. 2 Results Purity When the intracellular virus tube (example 3) presents a turbid appearance with a clot (lipids, proteins) that sometimes come to touch the band of virus, the viral preparation obtained after the first stage of centrifugation on cesium chloride by the The method of the invention presents a band of virus already well isolated from the contaminants of the medium that persist in the upper phase. Analysis in high performance liquid chromatography (HPLC) on a Resource Q column (see example 5) also demonstrates this advantage in purity of the starting material obtained by ultrafiltration of infected supernatant with a decrease in nucleic acid contaminants (OD 260/280 higher ratio). or equal to 1.8) and protein (DO 260/280 ratio lower than).

Stability of the virus in a supernatant at 37 ° C: The stability of the virus has been determined by titration by the plate assay method of an infectious culture supernatant from which aliquots have been sampled at different times of incubation at 37 ° C after infection. The results are presented below: Ad-TK virus: Q - titre 10 days post-infection = 3.5 X 10 pfu / ml. - title 20 days post-infection = 3.3 X 10 pfu / ml.

Ad-ßGal virus or - title 8 days post-infection = 5.8 X 10 pfu / ml or - titre 9 days post-infection = 3.6 X 10: pfu / ml - titre 10 days post-infection = 3.5 X 10 pfu / ml Q - title 13 days post-infection = 4.1 X 10 pfu / ml - titer 16 days post-infection = 5.5 X 10 pfu / ml The results obtained show that, at least 20 days post-infection, the supernatant titre is stable at the limit of precision of the dosage. On the other hand, Figure 1 shows that, in the elution buffer, the virus is stable for at least 8 months, at 80 ° C as at -20 ° C.

Specific infectiousness of the preparations This parameter, corresponding to the proportion of the number of viral particles measured by HPLC on the number of pfu, accounts for the infectious power of the viral preparations. According to the recommendations of the FDA, it should be less than 100. This parameter has been measured as follows: Two series of culture flasks containing 293 cells have been infected in parallel at the same time with the same viral pre-reservation under the same conditions. This experience has been carried out for a recombinant adenovirus. Adbgal, then repeated for an Ad-TK adenovirus. For each adenovirus, a series of flasks is collected 48 hours post-infection and is considered to be an intracellular virus production purified in cesium gradient after freeze thawing. The other series is incubated 10 days after infection and the virus is collected in the supernatant. The purified preparations obtained are titrated by plaque assay and the quantification of the number of total viral particles is determined by measuring the concentration in PVII protein by reverse phase CLHP on a C4 Vydac 4.6 × 50 mm column after denaturation of the samples in guanidine 6.4 M. The amount of PVII proteins per virus (Horwitz, Virology, second edition (1990)). This method is correlated with the measurements of viral particles on preparations purified by the densiometric method at 260 nm, taking for specific extinction coefficient 1.0 absorbance unit = 1.1 X 10 12 particles per ml.

The results obtained show that, for the Ad-ßGal virus, this proportion is 16 for the supernatant virus and 45 for the intracellular virus. For the Ad-TK virus, the ratio is 78 in the case of virus collection in the supernatant method and 80 for the virus collected by the intracellular method.

Analysis in electronic microscope: This method makes it possible to detect the presence of empty particles or copurified free viral subunits, as well as to appreciate a protein contamination of the purified viral preparations or the presence of non-dissociable aggregates of viral particles.

Protocol: 20 μl of sample are deposited on a carbon mesh then treated for observation in negative coloration by 1.5% uranyl acetate. For observation, a Jeol electronic microscope is used 1010 from 50 kV to 100 kV.

Result: The analysis carried out on a virus collected in the supernatant shows a clean preparation, without contaminants, without aggregates and without empty viral particles. It is also possible to distinguish the virus fibers as well as their regular geometric structure. These results confirm the high quality of the viral particles obtained according to the invention.

Analysis of the protein profile in HPLC and SDS PAGE: Analysis in SDS PAGE: 20 μl of sample is diluted in Laemmli buffer (Nature 227 (1970) 680-685), reduced by 5 min. at 95 ° C, then loaded on Novex 1 mm X 10 well gels gradient 4-20%. After migration, the gels are colored to coomasie blue and analyzed on Image Master VDS Pharmacia. The analysis reveals an electrophoretic profile for the virus collected in the supernatant according to the literature data (lennart Philipson, 1984 H. S. Ginsberg editors, Plenum Press, 310-338).

Analysis in reverse phase HPLC: Figure 2 shows the superposition of 3 chromatograms obtained from two virus samples collected intracellularly and a virus sample purified by the supernatant method. The experimental conditions are as follows: column Vydac ref 254 Tp 5405, RPC4 4.6 X 50 mm. , Solvent A: H20 + TFA 0.07%; Solvent B: CH3CN + TFA 0.07%, gradient lineall: T = 0 min. % B = 25; T = 50 min. % B = 50%; Expense = 1 ml./min., Detector = 215 nm. The chromatograms show a perfect identity between the samples, with no difference in the relative intensities of each peak. The nature of each peak has been determined by sequence formation and that the proteins present are all of viral origin (See Table below) Peak (Min.) Identification: 19-20 Precursor PVII 21-22 Precursor PVII; Precursor PX1 to 12 27-28 PVI precursor; Precursor PX 32-33 Precursor PX 34 35-36 PVII mature 37 PVII mature; PVIII precursor 39-41 mature PVI 45 pX 46 pIX In vitro analysis of transduction efficiency and cytotoxicity The analysis of the cytotoxicity is carried out by infecting HCT116 cells in 24 deep plates for increasing MOIs and determining the percentage of living cells in relay to an uninfected control, 2 and 5 days post-infection, with the help of the staining technique. Violet glass.

The results are presented in the following Table: Adenoviruses MOI = 3.0 MOI = 10.0 MOI = 30.0 MOI = 100.0 Supernatant J2 91% 96% 87% 89% Supernatant J5 97% 90% 10% < 5% Analysis of transduction efficiency For an adenovirus AD-βGal, the transduction efficiency of a preparation is determined by infecting W162 cells, not allowed in the replicate, cultured in 24 deep plates, with increasing concentrations of viral particles. For the same amount of viral particles deposited, cells expressing beta-galactosidase activity after incubation with X-gal as a substrate are enumerated 48 hours post-infection. Each blue cell is listed as a transduction unit (TDU), the result is multiplied by the dilution of the sample in order to obtain the concentration in unit of transduction of the sample. The transduction efficiency is then expressed by making the ratio of the concentration in viral particles to the concentration in TDU. The results obtained show that purified viruses have good in vitro transduction efficiency.

Analysis of intracerebral expression In vivo In order to evaluate the efficiency of the adenoviruses according to the invention for the transfer and expression of genes in vivo, the adenoviruses have been injected stereotaxicly into the striatum of immunocompetent mice 0F1. For this, volumes of 1 μl to 107 pfu of virus have been injected to the following stereotaxic labels (by the incisor bar at 0 mm): Antero-posterior: + 0.5; medio-lateral: 2; Depth: -3.5.

The brains have been analyzed 7 days after the injection. The results obtained show that the transduction efficiency is great: thousands of transduced cells, very intense expression in the nucleus and frequent and intense diffusion in the cytoplasm. 4. 3. virus release kinetics This example describes a study of the kinetics of release of adenoviruses in the culture supernatant or encapsulation cells.

This study was carried out by semi-quantitative PCR in the medium of oligonucleotides complementary to regions of the adenovirus genome. For this purpose, the linearized viral DNA (1-10 ng) was incubated in the presence of dXTP (2 μl, 10 mM), a pair of specific oligonucleotides and Taq Polymerase (Cetus) in a 10 X PCR buffer, and subjected to 30 cycles of amplification without the following conditions: 2 min. at 91 ° C, 30 cycles (1 min 91 ° C, 2 min at strengthening temperature, 3 minutes at 72 ° C), 5 min. 72 ° C, then 4 ° C. PCR experiments have been performed with the oligonucleotide pairs of the sequence: - Pair 1: TAATTACCTGGGCGGCGAGCACGAT (6368) - Sec ID No. 1 ACCTTGGATGGGACCGCTGGGAACA (6369) - Sec ID No. 2 - Pair 2: TTTTTGATGCGTTTCTTACCTCTGG (6362) - SEQ ID No. 3 CAGACAGCGATGCGGAAGAGAGTGA (6363) - SEQ ID No. 4 - Couple 3: TGTTCCCAGCGGTCCCATCCAAGGT (6364) - SEQ ID No. 5 AAGGACAAGCAGCCGAAGTAGAAGA (6365) - SEQ ID No. 6 - Couple 4: GGATGATATGGTTGGACGCTGGAAG (6366) - SEQ ID No. 7 AGGGCGGATGCGACGACACTGACTT (6367) - SEQ ID No. 8 The amount of adenovirus released in the supernatant was determined on a supernatant of 293 cells infected by Ad-βGal, at different post-infection times. The results obtained are presented in figure 3. They show that cell liberation starts from the fifth or sixth day post-infection.

It is expected that any other virus determination technique can be used for the same purpose, on any other strain of encapsulation, and for all types of adenovirus.

Example 5: Purification of the virus by ultrafiltration and ion exchange This example illustrates how the adenovirus contained in the concentrate can be purified directly and in a single chromatographic step of ion exchange, with very high yields. . 1. Protocol In this experience, the starting material is then constituted of the concentrate (or ultrafiltration retentate) described in example 4. This retentate has a total protein content between 5 and 50 mg / ml, and more preferably between 10 and 50 mg / ml. and 30 mg./ml., in a PBS buffer (10 M phosphate, pH 7.2 containing 150 M NaCl).

The ultrafiltration supernatant obtained from a virus preparation is injected onto a column containing Source Q 15 (Pharmacia) equilibrated in buffer with 50 mM Tris / HCl, pH 8.0 containing 250 mM 1.0 mM NaClm MgC12, and 10% glycerol (Tampon A). After rinsing with 10 column volumes of buffer A, the absorbed species are eluted with a linear gradient of NaCl (250 mM to 1 M) over 25 column volumes at a linear expense of 60 to 300 cm / h, more preferably 12 cm./h. The typical elution profile obtained at 260 nm is presented on figure 4. The fraction containing the viral particles is collected. It corresponds to a symmetric fine peak, whose retention time coincides with the retention time obtained with a preparation of viral particles purified by ultracentrifugation. It is possible to inject under the conditions described below, at least 30 mg. of total proteins per ml. of resin Source Q15 always maintaining an excellent resolution of the peak of viral particles.

In a representative experiment carried out from a preparation of a ß-gal adenovirus (Example 2), 12.6 mg. of total proteins have been injected on a Resource Q column (1 ml), that is 5 X IO10 PFU and 1.6 X 1010TDU. The peak of viral particles collected after chromatography (3.2 ml, Fig. 5) contained 173 μg of proteins and 3.2 X 10 PFU and 2.3 X icr? TDU. The viral particles have then been purified 70 times (in terms of amount of proteins) and the purification yield is 64% in PFU and 142% in TDU (See Table below).

OR . 2. Purity After this purification step, the fraction collected has a purity > or = at 98% in viral particles (UV detection at 260 nm), when analyzed by high performance liquid chromatography (CLHP) on a Respurce Q column (1 ml.) in a following chromatographic system: 10 μl of the fraction purified by chromatography as described in Example 5.1 are injected onto a Resource Q 15 column (1 ml gel; Pharmacia) equilibrated in buffer with 50 mM Tris / HCl pH 8.0 (buffer B). After rinsing with 5 ml. of buffer B, the adsorbed species are eluted with a linear gradient of 30 ml. of NaCl (0 to 1 M) in buffer B at an expense of 1 ml./min. The eluted species are detected at 260 nm. This analysis by CLHP (Figure 5) further shows that the residual bovine serum albumin present in the ultrafiltration retentate is completely eliminated in the course of preparative chromatography. Its content in the purified fraction is eliminated it is estimated that it is < 0.1%. Western blot analysis with a polyclonal anti-BSA antibody (with ECL disclosure, Amersham) indicates that the BSA content in the chromatographic preparation is less than 100 ng per mg. of viruses.

The analysis in electrophoresis of the purified adenoviral fraction by chromatography is carried out in polyacrylamide gel (4-20%) under denaturing conditions (SDS). The protein bands are then revealed to silver nitrate. This analysis shows that the adenoviral preparation obtained by chromatography has a level of purity at least equal to that of the preparation conventionally obtained by ultracentrifugation since it does not have a band of supplementary proteins that would indicate a contamination of the preparation by non-adenoviral proteins.

The adenoviral preparation obtained by chromatography has an absorbance ratio of 260nm / A280nm equal to 1.30 ± 0.05. This value, which is identical to that obtained for the best preparations obtained by ultracentrifugation, indicates that the preparation is devoid of contaminating proteins or contaminating nucleic acids.

The electron microscope analysis carried out under the conditions described in Example 4.2 on an Ad-ßgal virus purified by chromatography shows a clean preparation, without contaminants, without aggregate and without empty viral particles (Figure 11). In addition, the cesium chloride gradient ultracentrifugation of this preparation reveals a single band of density 1.30, which confirms the absence of contamination of the chromatographic preparations by occasional empty particles or fragments of capsules. After purification, the chromatographic peak of the virus is followed by a backup (or secondary peak) on its back, which is not collected with the main peak. The cesium chloride gradient ultracentrifugation of this fraction reveals a band of density 1.27, and the analysis of the composition of this fraction shows that it does not contain nucleic acids. Electron microscopy analysis shows that this fraction contains irregularly shaped particles, which have surface perforations (figure 12). It is then empty particles (devoid of DNA) and incomplete. This then shows that the purification of the adenovirus by chromatography removes the empty particles present in a slight amount in the preparations before purification. . 3. Purification of adenoviruses containing a therapeutic gene such as genes encoding ApoAl or thymidine kinase proteins.

This example illustrates how adenoviruses that contain in their genomes heterologous nucleic acid sequences encoding therapeutic proteins can be purified directly and in a single chromatographic step of ion exchange. It also shows that the chromatographic behavior of the adenovirus is independent of the heterologous nucleic acid sequences it contains, which makes it possible to apply the same purification procedure for different adenoviruses carrying diverse heterologous nucleic acid sequences.

In a typical purification experience, an adenovirus containing in its genome a heterologous nucleic acid sequence encoding the ApoAl protein (Example 2, WO94 / 25073) is purified by chromatographing, in the system described in Example 5.1, 18 ml. (72 mg of protein; 1.08 X IO13 particles) of concentrated supernatant of a cell culture harvested 10 days post-infection (Figure 6A). The peak of viral particles collected after chromatography (14 ml, 1.4 mg of proteins) contained 9.98 X IO12 particles, indicating a particle yield of 92% and a purification factor of 51. After this purification step, the fraction collected presented (Figure 6B) a purity higher than 98% in viral particles after the chromatographic analysis under the conditions described in 5.2. the analysis by electrophoresis of the purified adenoviral fraction by chromatography carried out under the conditions described in Example 5.2. has shown that this preparation had a level of purity at least equal to that of the preparation conventionally obtained by ultracentrifugation, and that it is devoid of contaminating proteins or contaminating nucleic acids.

In another typical purification experience, an adenovirus containing in its genome a heterologous nucleic acid sequence encoding the herpes simplex type 1 thymidine kinase protein (Example 2, WO95 / 14102) is purified by chromatography in the system described in example 5.1. 36 ml. (180 mg of protein, 4.69 X 10 1'3 particles) of concentrated supernatant of a cell culture (Figure 7A). The peak of viral particles collected after chromatography (20 ml, 5.6 mg of proteins) contained 4.28 X IO13 particles, indicating a particle yield of 91% and a purification factor of 32. After this purification step, the fraction collected had (Figures 7B-D) a purity greater than 99% in viral particles after the chromatographic analysis under the conditions described in Example 5.2. and an absorbance ratio of 1.29. the electrophoresis analysis of the purified adenoviral fraction by chromatography carried out under the conditions described in Example 5.2. has shown that this preparation had a level of purity at least equal to that of the preparation conventionally obtained by ultracentrifugation, and that it is devoid of contaminating proteins or contaminating nucleic acids. . 4. Purification of intracellular adenovirus by strong anion exchange.

This example illustrates an adenovirus containing in its genome a heterologous nucleic acid sequence can be directly purified in a single chromatographic step of ion exchange from a lysate of encapsulating cells producing said virus.

In a typical purification experience, an adenovirus containing in its genome a heterologous nucleic acid sequence coding for the β-gal protein is purified by chromatography in the system described in Example 5.1 (FineLine Pilot 35 column, Pharmacia, 100 ml. of resin Source 15 Q), 450 ml. (ie 2.5 X 1014 particles) of concentrated lysate from a cell culture collected 3 days post-infection by chemical lysis (1% t een-20). the peak of viral particles collected after chromatography (110 ml.) contained 2.15 X 1014 particles, indicating a particle yield of 86%. After this purification step, the fraction collected had a purity higher than 98% in viral particles after the chromatographic analysis under the conditions described in 5.2. the analysis by electrophoresis of the purified adenoviral fraction by chromatography carried out under the conditions described in example 5.2 has shown that this preparation had a level of purity at least equal to that of a preparation conventionally obtained by ultracentrifugation, and that it is devoid of proteins pollutants or contaminating nucleic acids. . 5. Purification of the virus by ultrafiltration and ion exchange chromatography on different columns.

This example illustrates how the adenovirus contained in the concentrate can be purified directly and in a single chromatographic step of ion exchange using a gel different from the Source 15 Q support, operating totally on the same principle of separation, the exchange of anions by interaction with the quaternary amino groups of the matrix.

In a typical adenovirus purification experience, different recombinant adenoviruses (coding for β-Gal, apolipoprotein AI and TK) have been purified by chromatography on a Source Q30 gel column following the protocol described in Example 5.1. The results obtained show that the Source Q30 gel allows to obtain viral preparations of a purity of the order of 85%, with a yield comprised between 70 and 100%. In addition, the results obtained show that Q30 has, for the purification of adenovirus, an efficiency (expressed by the number of theoretical plates) of 1000 and one (maximum amount of virus that can be chromatographed without altering the peaks) of 0.5 to 1 X 10 12 pv per ml. These results show that the Source Q30 gel can then agree to the purification of recombinant adenoviruses, even if its properties remain inferior to those of Source Q15 (purity of the order of 99%, efficiency of the order of 8000 and capacity in the order of 2.5 to 5 X 1012 pv per ml).

In a typical adenovirus purification experience, a ß-Gal adenovirus is purified by chromatography on a MonoQ HR 5/5 column following the protocol described in Example 5.1. The chromatographic image corresponding to the ultrafiltration retentate and the purified viral preparation thus obtained is illustrated on Figure 8.

In a typical adenovirus purification experience, a β-Gal adenovirus is purified by chromatography on a Poros HQ / M column following the protocol described in Example 5.1. The chromatographic image corresponding to the ultrafiltration retentate and the purified viral preparation thus obtained is illustrated on Figure 9.

Example 6: Purification of the virus by ultrafiltration and gel permeation This example illustrates how the adenovirus contained in the concentrate (ultrafiltration retentate) can be purified directly by gel permeation chromatography, in very high yields. 6. 1 Protocol 200 μl of the ultrafiltration retentate obtained in Example 4 (ie 1.3 mg of proteins) are injected onto a HR 10/30 column (Pharmacia) filled with Sephacryl S-1000SF (Pharmacia) equilibrated for example in PBS buffer, pH 7.2 containing 150 mM NaCl (buffer C). The species are fractionated and eluted with buffer C at an expense of 0.5 ml / min. and detected in the column output in UV at 260 nm.

Alternatively, a column filled with Sephacryl S-2000 that allows a better resolution than the Sephacryl S-1000HR column for particles from 100 nm to 1000 nm can be used under the same application conditions.

The resolution of two chromatographic gel permeation systems described below can be favorably improved by chromatographing the ultrafiltration supernatant (200 μl) on a two-column HR 10/30 system (Pharmacia) coupled in series (Sephacryl S-1000HR or S column). -2000 followed by a column of Superdex 200 HR) balanced in the tempon C. The species are eluted with the Ca buffer at an expense of 0.5 ml./min. and detected in UV at 260 nm. In this system, the peak of viral particles is very clearly better separated from the species of weaker molecular weight than in the system containing a Sephacryl S-1000 HR or Sephacryl S-2000 alone column.

In a representative experiment, an ultrafiltration retentate (200 μl, 1.3 mg of protein) was chromatographed on a 2-column system Sephacryl S-OOOOO-Superdex 200 HR 10/30 (figure 10). The chromatographic peak containing the viral particles has been collected. Its retention time coincides with the retention time obtained with a preparation of viral particles purified by ultracentrifugation. The peak of viral particles collected after chromatography (7 ml.) Contained 28 μg of protein and 3.5 109 PFU. Its analysis by analytical chromatography of ion exchange under the conditions described in example 5.2. shows the presence of a pollutant peak more strongly retained on the analysis column, whose surface represents approximately 25% of the surface of the viral peak. Its absorbance ratio 260 nm./280 nm. which has a value of 1.86 indicates that this polluting peak corresponds to nucleic acids. The viral particles have then been purified approximately 50 times (in terms of amount of proteins) and the yield of the purification is 85% in PFU.

Alternatively, it is possible to chromatograph the preparations of viral particles (ultrafiltrates or fractions as anion exchange chromatography) on a TSK G6000 PW column (7.5 X 300 mm; TosoHaas) equilibrated in the tempon C. The species are eluted with the buffer C at an expense of 0.5 ml./min. and detected in UV at 260 nm. In the same way it may be advantageous to increase the resolution of the chromatographic system, in particular to increase the separation of the peak of viral particles from the weakest molecular weight species, by chromatographing the ultrafiltration supernatant (50 to 200 μl) on a 2-column system serially coupled [TSK G6000 PW column (7.5 X 300 mm) followed by a Superdex 200 HR column] equilibrated in buffer C. The species are eluted with buffer C at an expense of 0.5 ml./min. and detected in UV at 260 nm.

Example 7: Virus purification by ültrafiltration, ion exchange and gel permeation.

The fraction of viral particles resulting from the anion exchange chromatography (example 5) can be advantageously chromatographed in one of the chromatographic systems by gel permeation described below, for example with the aim of still improving the level of purity of the particles viral, but also mainly for the purpose of conditioning the viral particles in a compatible medium or adapted to the subsequent uses of the viral preparation (injection ...).

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) applicant (A) NAME: Rhóne Poulenc Rorer SA (B) STREET: 20, Raymond Aron Avenue (C) CITY: ANTONY (E) COUNTRY: France (F) POSTAL CODE: 920165 (ii) TITLE OF THE INVENTION: RECOMBINANT ADENOVIRUS PRODUCTION PROCEDURE. (iii) SEQUENCE NUMBER: 8 (iv) DESCIFRABLE FORM BY COMPUTER: (A) TYPE OF SUPPORT: from diskette (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFT WARE: Patentin Relay No. 1.0, Version N. 1.30 (OEB) (2) INFORMATION FOR SEQ ID NO: l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) FILAMENT NUMBER: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) DESCRIPTION OF THE SEQUENCE SEQ ID NO: 1: TAATTACCTG GGCGGCGAGC ACGAT 25 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) DESCRIPTION OF SEQUENCE SEQ ID NO: 2: ACCTTGGATG GGACCGCTGG GAACA 25 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 3: TTTTTGATGC GTTTCTTACC TCTGG 25 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 4: CAGACAGCGA TGCGGAAGAG AGTGA 25 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 5: TGTTCCCAGC GGTCCCATCC AAGGT 25 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) DESCRIPTION OF SEQUENCE SEQ ID NO: 6: AAGGACAAGC AGCCGAAGTA GAAGA 25 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 7: GGATGATATATG GTTGGACGCT GGAAG 25 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleotide (C) NUMBER OF FILAMENTS: simple (D) CONFIGURATION: linear (ii) TYPE OF MOLECULES: DNA (xi) SEQUENCE DESCRIPTION SEQ ID NO: 8: AGGGCGGATG CGACGACACT GACTT 25 It is noted that in relation to this date the best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, it is claimed as property in the following

Claims (32)

1. Process for producing recombinant adenoviruses which is characterized in that the viral DNA is introduced into a culture of encapsulating cells and the produced viruses are collected after release in the supernatant.

2. The method according to claim 1, characterized in that the collection is carried out when at least 50% of the viruses have been released in the supernatant.

3. The method according to claim 1, characterized in that the recolection is performed when at least 70% of the viruses are released in the supernatant.

4. The method according to claim 1, characterized in that the collection is carried out when at least 90% of the viruses have been released in the supernatant.

5. The method according to claim 1, characterized in that the viruses are collected by ultrafiltration.

6. Process according to claim 5, characterized in that the ultrafiltration is a tangential ultrafiltration.

7. Process according to claim 5 or 6 which is carcaterized because the ultrafiltration is carried out on a membrane having a cut-off threshold of less than 1000 kDa.

8. The method according to claim 1, characterized in that the viruses are collected by anion exchange chromatography.

9. Process according to claim 8, characterized in that the anion exchange chromatography is a strong anion exchange chromatography.

10. Process according to claim 9 which is characterized in that the anion exchange chromatography is carried out on a support selected from the Q, Mono Q, Q Sepharose, Poros HQ and Poros QE resins, the Fractogell TMAE and Toyopearl Super type resins Q.

11. The method according to claim 1, characterized in that the viruses are collected by gel permeation chromatography.

12. Process according to claim 11, characterized in that the gel permeation chromatography is carried out on a support selected from the gels Sephacryl S-500 HR, Sephacryl S-1000 SF, Sephacryl S-1000 HR, Sephacryl S-2000, Superdex 200 HR , Sepharose 2B, 4B or 6B and TSK G6000 PW.

13. The method according to claim 1, characterized in that the viruses are collected by ultrafiltration followed by anion exchange chromatography.

14. The method according to claim 13, characterized in that the viruses are collected by ultrafiltration followed by anion exchange chromatography after gel permeation chromatography.

15. The method according to one of the preceding claims, characterized in that the encapsulation cell is a cell that trans-complements the El function of the adenovirus.

16. The method according to claim 15, characterized in that the encapsulation cell is a cell that trans-complements the El and E4 functions of the adenovirus.

17. The method according to claim 15, characterized in that the encapsulation cell is a cell that trans-complements the El and E2a functions of the adenovirus.

18. Method according to one of claims 15 to 17, characterized in that the cell is an embryonic human kidney cell, a human retinoblast or a human carcinoma cell.

19. Purification method of recombinant adenoviruses from a biological medium which is characterized in that it comprises a purification step by means of strong anion exchange chromatography.

20. The method according to claim 19, characterized in that the biological medium is a supernatant of encapsulating cells producing said virus.

21. The method according to claim 19, characterized in that the biological medium is a lysate of encapsulating cells producing said virus.

22. Process according to claim 19, characterized in that the biological medium is a pre-purified solution of the mentioned virus.

23. Process according to claim 19, characterized in that the chromatography is carried out on an activated support with a quaternary amine.

24. Process according to claim 23, characterized in that the support is selected from agarose, dextran, acrylamide, silica, poly [styrene-divinylbenzene], ethylene glycol-methacrylate copolymer, alone or as a mixture.

25. Process according to claim 24, characterized in that the chromatography is carried out on a Source Q, Mono Q, Q Sepharose, Poros HQ, Poros QE, Fractogel TMAE, or Toyopearl Super Q.

26. Process according to the re-excitation 25 which is characterized in that the chromatography is carried out on a Source Q resin, preferably Source 15.

27. Process according to claim 19, characterized in that it comprises a previous stage of ultrafiltration.

28. Process according to claim 27 which is characterized in that the ultrafiltration is a tangential ultrafiltration on membrane having a cut-off threshold comprised between 300 and 500 kDa.

29. Purified viral preparation which is characterized in that it is obtained according to the method of claim 1 or 19.

30. A pharmaceutical composition which is characterized in that it comprises a viral preparation according to claim 29 and a pharmaceutically acceptable carrier.

31. Use of ioddixanol, 5, 5 '- [(2-hydroxy-l-3-propanediyl) -bis (acetylamino)] bis [N, N'-biss (2,3-dihydroxypropyl-2,4,6-triodo-1) , 3-benzenecarbazone -amide] for the purification of adenovirus.

32. Adenovirus purification proce from a biological medium comprising a first stage of ultracentrifugation, a second stage of dilution or dialysis, and a third stage of anion exchange chromatography.