MXPA98010447A - Gen that confirms resistance to diseases in the plants and uses of the - Google Patents

Abstract

The invention relates to the location and characterization of a gene (designated as NIM1), which is a key component of the trajectory of acquired systematic resistance, and which, in relation to chemical and biological inducers, makes possible the induction of expression of the acquired systematic resistance gene, and resistance to broad spectrum diseases in plants. The invention also relates to plants transformed with the NIM1 gene, as well as to methods that use the gene to create transgenic plants, and which use the gene in a selection test to obtain compounds capable of inducing a resistance to broad-spectrum diseases in the plant

Description

GEN THAT CONFIRMS RESISTANCE TO DISEASES IN PLANTS. AND USES OF THE SAME The present invention relates to the resistance to diseases in plants, and to the identification and development of resistance to diseases in plants. More particularly, the present invention relates to the identification, isolation, and characterization of a gene involved in resistance to broad-spectrum diseases in plants. Plants are constantly assaulted by a wide variety of pathogenic organisms, including viruses, bacteria, fungi, and nematodes. The crop plants are particularly vulnerable, because they usually grow as genetically uniform monocultures; When the disease arrives, the losses can be severe. However, most plants have their own innate mechanisms of defense against pathogenic organisms. Reproducers and plant pathologists have identified a natural variation for resistance to plant pathogens, and reproduce in many crop plants. These natural disease resistance genes often provide high levels of resistance to, or immunity against, pathogens. In many plant species, an initial inoculation by a necrotizing pathogen can immunize the plant for subsequent infection. This acquired resistance to the disease was first documented in 1901, and is thought to have an important role in the conservation of plants in nature. Particularly well-characterized examples of plant immunity are the phenomenon of systemic acquired resistance (SAR) and induced resistance in plants, such as tobacco, Arabidopsis, and cucumber. In these systems, the inoculation with a necrogenic pathogen results in a systemic protection against subsequent infections because it is pathogenic, as well as a number of other bacterial, fungal, and agronomically important viral pathogens. The acquired systemic resistance can also be triggered by chemical immunization compounds, certain chemicals that induce the immune response in plants. These compounds can be of natural origin, such as salicylic acid (SA), or can be synthetic chemicals, such as 2,6-dichloroisonicotinic acid (INA) and S-methyl ester of benzo (1, 2, 3) thiadiazole -7-carbothioic (BTH). Treatment with a pathogen or an immunization compound induces the expression of at least 9 sets of genes in tobacco, the best characterized species. Different numbers and types of genes can be expressed in other plants. The level of induction for genes related to acquired systemic resistance induced by immunization compounds is as high as 10,000 fold on the background. In particular, the acquired systemic resistance is characterized by the expression of acquired systemic resistance genes, including the genes related to pathogenesis (PR). The genes of acquired systemic resistance are induced immediately after infection by a pathogen. Some of these genes have a role in providing acquired systemic resistance to the plant. These plant proteins are induced in large quantities in response to infection by different pathogens, including viruses, bacteria, and fungi. Protein-related pathogenesis was first discovered in tobacco plants (Nicotiana tabacum) that reacted hypersensitively to infection with tobacco mosaic virus (TMV). Subsequently, protein-related pathogenesis has been found in many plant species (see Redolfi et al. (1983) Neth J. Plant Pathol 89: 245-254; Van Loon (1985) Plant Mol. Biol. 4: 111-116; and Uknes co-workers (1992) Plant Cell 4: 645-656). It is believed that these proteins are a common systemic defense response of plants to infection by pathogens. Proteins related to pathogenesis include, but are not limited to, the proteins, SAR8.2a and SAR8.2b, the acid and basic forms of the major tobacco proteins PR-la, PR-Ib, and PR-Ic; PR-1 ', PR-2, PR-2', PR-2", PR-N, PR-O, PR-0 ', PR-4, PR-P, PR-Q, PR-S, and PR -R, cucumber peroxidases, basic cucumber peroxidase, chitinase which is a basic counterpart of PR-P and PR-Q, beta-1,3-glucanase (glucan-endo-1,3-beta-glucosidase , EC 3.2.1.39) which is a basic counterpart of PR-2, PR-N, or PR-O, and chitinase inducible by cucumber pathogen These proteins related to pathogenesis are disclosed, for example, in Uknes et al. (1992) The Plant Cali 4: 645-656, and the references cited therein The acquired systemic resistance or acquired systemic resistance type genes are expressed in all plant species that exhibit an acquired systemic resistance. The expression of these genes can be determined by probing with known acquired systemic DNA resistance sequences, for example, see Lawton et al. (1992) Proceedings of the Second European Federation of Plant Pathology (1983), In: Mechan? .sm = = of ef npe Responses in Planta, B. Friting and M. Legrand (editors), Kluwer Academic Publishers, Dordrecht, pages 410-420; Uknes et al. (1992) Ih =. Plant Cell 4: 645_-656; and ard et al. (1991) The Plant Ce L 3: 1085-1094. Methods for hybridization and cloning are well known in the art. See, for example, Molecular Cloning, A. aboratory Manual, Second Edition, Volumes 1-3, Sambrook y- collaborators (editors), Cold Spring Harbor Laboratory Press (1989), and the references cited therein. In an alternative way, these acquired systemic resistance or acquired systemic resistance type genes can be found by other methods, such as protein selection, +/- selection, and so on. See, for example, Liang and Pardee (1992) Science 257: 967-971; and St. John and Davis (1979) Cell 16: 443. Despite much research and the use of sophisticated and intense crop protection measures, including genetic transformation of plants, the losses due to the disease remain in the billions of dollars annually. Disease resistance genes have been cloned earlier, but transgenic plants transformed with these genes would normally be resistant to only a subset of strains of a particular pathogen species. Despite efforts to clone genes involved in acquired systemic resistance, a gene that controls resistance to broad spectrum diseases has not been isolated and characterized. Several lines of evidence indicate that endogenously produced salicylic acid is involved in the path of signal transduction that couples the perception of pathogen infection with the establishment of acquired systemic resistance. Mutants that receive the ability to accumulate salicylic acid in response to the pathogen, and yet have lost the ability to induce genes of acquired systemic resistance, or resistance after the application of salicylic acid or 2,6-dichloroisonicotinic acid, have been described by Delaney et al., Proc. Nati Acad. Sci. 92: 6602-6606 (1995), and in International Publication Number WO 94/16077, all of which is incorporated herein by reference. It has now been discovered that these mutants contain a mutant gene, said gene, in its wild-type form, controls the expression of the acquired systemic resistance gene, and the acquired systemic resistance itself. The present invention recognizes that the mutant gene confers a susceptibility to broad-spectrum diseases to mutant plants, and renders them non-inducible for pathogens and chemical inducers. The present invention relates to the identification, isolation, and characterization of the wild type gene . { NIM1), a gene that allows the activation in a plant of acquired systemic resistance, and of the expression of the acquired systemic resistance gene, in response to chemical biological inducers. A mutant gene has been identified in the mutagenized Arabidopsis plants. It has been found that these plants are deficient in their normal response to infection of the pathogen, in that they do not express genes associated with acquired systemic resistance (SAR), nor are they capable of exhibiting acquired systemic resistance. These mutants contain a defective gene that has been labeled as niml (by non-inducible immunity). The present invention also relates to the use of the cloned NIM1 gene, and variants thereof, to create transgenic plants having a broad spectrum disease resistance, and to the transgenic plants produced by the same. The invention further relates to the use of the cloned NIM gene and variants thereof, in a selection method to identify compounds capable of inducing resistance to broad-spectrum diseases in plants.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows the effect of chemical inducers on the induction of PR gene expression in wild type and niml plants. Figure 2 illustrates the expression of the PR-1 gene in s-0 and niml plants infected with the pathogen during the course of 6 days from the initiation of the infection. Figure 3 shows the accumulation levels of salicylic acid in plants Ws-0 and niml infected with P. syringae. Figure 4 shows the genetic map of the NIM1 region, determined by AFLP and SSLP analysis. Figure 5 illustrates a physical map of the NIM1 region determined by analysis of the YAC clone. Figure 6 shows a physical map of a contig. Pl / BAC extended. Figure 7 shows a physical map that stipulates the positions of the Pl and BAC clones with respect to the flanking AFLP markers and the YACs.

Figure 8 shows a physical map of a contig. Pl / BA extended containing the NIM1 gene. Figure 9 shows a fine genetic and physical integrated map of the NJ? F region. Figure 10 shows an integrated map of the region NIM1. Figure 11 shows an integrated map of the NTM1 region, including the AFLP marker nodes. Figure 12 is a schematic representation of recombinants D169 and C105. Figure 13 is a global map of the chromosomal region centered on NIM1 with the indicated recombinants, including BACs, YACs, and Cosmides in the NIM1 region. Figure 14 provides the sequence of the 9.9 kb region of the BAC-04 clone containing the NIM1 gene. Figure 15 shows the nucleic acid sequence of the NIM1 gene, and the amino acid sequence of the NIM1 gene product, including the changes in the different alleles. Figure 16 shows the expression of NIM1 indicated by I? A, BTH, SA, and pathogen, in wild-type alleles and niml mutants. Figure 17 shows the expression of PR-1 in nziml mutants and wild-type plants. Figure 18 shows resistance to disease in different niml mutants.

Figure 19 is a comparison of the amino acid sequence of the Expressed Sequence Tag regions of the NIM1 protein and the cDNA protein products of rice genetic sequences (see SEQ ID NO: 3).

DEFINITIONS A: Amino Acid AFLP: Amplified Fragment Length Polymorphism. avrRpt2: avirulence gene Rp2, isolated from Pseudomonas syringae. BAC Bacterial Artificial Chromosome. BTH: S-methyl ester of benzo (1, 2, 3) thiadiazole-7-carbothioic acid. Col: AraJz > idopsis ecotype Columbia. ? Cs: combinations of enzymes. INA: 2,6-dichloroisonicotinic acid. er: Arabidopsis, ecotype Landsberg erect. NIM1: the wild type gene, which gives the plant resistance to diseases. nim: mutant allele of NIM1, which gives the plant susceptibility to diseases, n ± -nl: mutant plant line. ORF: open reading frame. PCs: Combiners of primers. SA: salicylic acid.

SAR: Acquired Systemic Resistance. SSLP: Simple Sequence Length Polymorphism. Ws-O: Arabidopsis, ecotype Wassilewskija. YAC: Artificial yeast chromosome.

The NIM1 gene has been cloned using forward mapping techniques that indicate that the gene is contained in a region d approximately 105 Kb. (See Figure 13 and Table 16). This region is delineated by the marker L84.6b on the left, and the marker L84.T2 on the right. Only three overlapping cosmids made from wild-type DNA from the 105 Kb region complement the niml mutant phenotype (Figure 13 and Table 16). These three cosmids only overlap in a 9.9 Kb region defined by the left end of the cosmid clone D7, the right end of the cosmid D5, as illustrated in Fig. 13. Many other cosmids made in other areas of the region of Kb do not complement the niml phenotype (Figure 13 and Table 16). A cDNA clone of almost complete length for the NIM1 gene indicates the appropriate intron-exon boundaries, and defines the amino acid sequence of the genetic product. Only the NJ 1 gene region within the 9.9 Kb complementary region has sequence changes in different niml mutant alleles (Table 18). Three other potential regions of the gene did not show sequence changes that are associated with the niml phenotype. The sequence changes found in the region of the NIM1 gene are consistent with the altered function or loss of function of the gene product. The severity of the change to the region of the NIM1 gene in a particular mutant allele is approximately correlated with the observed physiological severity of that niml allele. Only the NIM1 region had detectable RNA (transcription), and that RNA showed abundant changes consistent with the physiological role of NIM1 in the pathogenesis (Table 18 and Figure 16). The present invention relates to a fragment of isolated gene, the NIM1 gene, which is a key component of the path of acquired systemic resistance (SAR) in plants. NIM1 is associated with the activation of systemic resistance acquired by biological chemical inducers, and in conjunction with these inducers, is required for acquired systemic resistance and expression of the acquired systemic resistance gene. The location of the NIM1 gene is determined by molecular biological analysis of the genome of mutant plants known to carry the mutant niml gene, which gives host plants extreme sensitivity to a wide variety of pathogens, rendering them incapable of responding to pathogens and the chemical inducers of acquired systemic resistance. Niml mutants are useful as "susceptible to universal diseases" (UDS) plants by virtue of being susceptible to many pathogen strains and pathotypes of the host plant, and also to pathogens that do not normally infect the host plant, but that infect the host plant. other guests. It can be generated by treating the seeds or other biological material with mutagenic agents, and then the progeny plants are selected for the phenotype susceptible to universal diseases, by treating the plants of the progeny with known chemical inducers (for example, INA) d the acquired systemic response, and then the plants are infected with a known pathogen. Non-inducible mutants develop severe symptoms of the disease under these circumstances while non-mutants are induced by the chemical compound for acquired systemic resistance. The mutants can not be equally selected from mutant populations generated by chemical mutagenesis and irradiation, as well as from populations generated by the insertion of T-DNA and mutagenesis induced by transposon. The techniques for generating lines of mutant plants are well known in this field. The plant phenotype is used as a tool to identify an isolated fragment of ge that allows the expression of resistance to broad-spectrum disease in plants. The present invention comprises an isolated AD molecule comprising a mutant gene of the NIM1 gene, which is a niml gene. Following the use of a niml mutant or a plant to isolate the wild-type NI? Fl gene required for the constitutive expression of acquired systemic resistance genes, the resistance trait can be incorporated, and combined with other important characteristics for l production and quality, in the lines of the plant, through d reproduction. The approaches and reproduction techniques are known in this field. See, for example, Welsh J.R., Fundamentals of Plant Genetics and Breeding, John Wiley & amp;; - Sons,? Y (1J981); Crop Breeding. Wood D. R. (Ed) American Society or Agronomy Madison, Wisconsin (1983); May O., The Theorv of Plan Breeding, Second Edition, Clarendon Press, Oxford (1987); Singh, D.P., Breeding for Resistance to Diseases and Insect Pests, Springer-Verlag,? Y (1986); and Wricke and Weber, Quantitative Genetics and Selection Plant Breedin, Walter de Gruyter and Co., Berlin (1986). A further object of the invention is a chimeric gene comprising an active promoter in the plant, operably linked to a molecule of AD? heterologous encoding the amino acid sequence of a NIM1 gene product, and variants thereof, according to the invention. The methodologies for the construction of expression cassettes in plants, as well as the introduction of AD? strange in plants, is generally described in the art. In general, for the introduction of AD? strange in plants, have been used plasmid vectors Ti to deliver the AD? strange. Also, for this delivery, the direct recovery of DNA, liposomes, electroincorporation, microinjection, microprojectiles has been used. These methods have been published in the art. See, for example, Bilang et al. (1991) Gene 100: 247-250; Scheid et al., (1991) Mol. Gen. Genet. 228: 104-112 Guarche et al. (1987) Plant Science 52: 111-116 Neuhause et al. (1987) Theor. Appl. Genet 75; 30-36 Klein et al., (1987) Nature 327: 70-73; Ho ell et al. (1980) Science 208: 1265; Horsch et al. (2,985) Science 227: 1229-1231; DeBlock and collaborators, (1989) Plant Physioloay 91: 694-701; Methods for Plant Molecular Bioloqy (Weissbach and Weissbach, eds.), Academic Press, Inc. (1988); and Methods in Plant Molecular Bioloqy (Schuler and Zielinski, eds.), Academic Press, Inc. (1989). See also the Patent Applications of the United States of America with Serial Numbers 08 / 438,666 filed May 10, 1995, and VtZ 93/07278, both of which are hereby incorporated by reference in their entirety. It is understood that the transformation method will depend on the plant cell that is to be transformed. In addition, it is recognized that the components of the expression cassette can be modified to increase expression. For example, truncated sequences, nucleotide substitutions, or other modifications may be employed. The plant cells transformed with these modified expression systems. they would then exhibit an overexpression or a constitutive expression of the acquired systemic resistance genes necessary for the activation of acquired systemic resistance. The DNA molecule or gene fragment that confers disease resistance to plants, allowing the induction of the expression of the acquired systemic resistance gene, can be incorporated into plant or bacterial cells using conventional recombinant DNA technology. And generally, this involves inserting the DNA molecule into an expression system for which the DNA molecule is heterologous (ie, normally not present). The heterologous AD molecule is inserted into the expression system or into the vecto in an appropriate orientation and in the correct reading frame. The vector contains the necessary elements for the transcription and translation of the inserted protein coding sequences. A large number of vector systems known in the art can be used, such as plasmids, bacteriophage viruses, and other modified viruses. Suitable vectors include, but are not limited to, viral vectors such as the lambda vector systems Igtll, Igtll and Charon 4; Plasmid vectors, such as pBI121, pBR322, pACYC177, pACYC184, the pAR series, pKK223-3, pUC8, pUC9, pUC18, pUC19, pLG339, pRK290, pKC37, pKClOl, pCDNAII; and other similar systems. The DNA sequences can be cloned into the vector using standard cloning procedures in the art, as described by Maniatis et al., Molecular Cloning: Laboratory Manual, Cold Spring Laboratory, Cold Spring Harbo New York (1982). A further object of the invention is a recombinant vect comprising the chimeric gene according to the invention. In order to obtain efficient expression of the gene or gene fragment of the present invention, there must be a promoter present in the expression vector. RNA polymerase usually binds to the promoter, and initiates the transcription of a gene. Promoters vary in their strength, and say, in their ability to promote transcription. Depending on the host cell system used, any of a number of suitable promoters can be used. Suitable promoters include ubiquitin, promoter nos, promoter of the ribulose bisphosphate carboxylase gene d its small unit, the small subunit chlorophyll A / B binding polypeptide promoter, the 35S promoter of cauliflower mosaic virus d, and Promoters isolated from plant gene. See CE. Vallejos et al, "Localization and the Tomato Genome of DNA Restriction Fragments Containin Sequences Homologous to the RRNA (45S), the major chlorophyl Polypeptide and the Ribulose Bisphosphate Carboxylas Genes", Genetics 112: 93-105 (1986), which discloses the small subunit materials. The promoter us and the 35S promoter of the cauliflower mosaic virus are well known in the art. Once the disease resistance gene of the present invention has been cloned into an expression system, it is ready to easily transform into a plant cell.

Plant tissues suitable for transformation include leaf tissues, root tissues, meristems, and protoplasts. Bacteria of the genus Acrojbac erium can be used to transform the plant cells. Suitable species of these bacteria include Agrobacterium tumefaciens and Agrobacterium rhizogens. Agrobacterium tumefaciens (for example, strains LBA4404 and EHA105) is particularly useful, due to its well-known ability to transform plants. Another approach to transform plant cells with a gene involves propelling inert or biologically active particles into the tissues and cells of the plant. This technique is disclosed in the Patents of the United States of North America Nos. 4,945,050; 5,036,006, and 5,100,792, all to Sanford et al. In general, this method involves propelling inert or biologically active particles to the cells, under conditions effective to penetrate the outer surface of the cell, and provide incorporation therein. When inert particles are used, the vector can be introduced into the cell by coating the particles with the vector containing the desired gene. In an alternative way, the target cell may be surrounded by the vector, so that the vector is brought into the cell to awaken the particle. Biologically active particles can also be propelled (for example, dry yeast cells, dried bacteria, or a bacteriophage, each containing the AD that is intended to be introduced) into the tissue of the cell of the plant. The isolated gene fragment of the present invention can be used to confer disease resistance to a wide variety of plant cells, including those of gymnosperms, monocotyledons, and dicots. Although the gene can be inserted into any plant cell that falls within these broad classes, it is particularly useful in the cells of crop plants, such as rice, wheat, barley, rye, rr-aíz, potato, carrot, sweet potato , sweet beets, beans, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, chayote, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum, and sugar cane. The expression system of the present invention can be used to transform virtually any cell of a crop plant under suitable conditions. The transformed cells can be regenerated in whole plants, in such a way that the gene imparts resistance to the diseases to the intact transgenic plants. As described above, the expression system can be modified in such a way that the disease resistance gene is expressed continuously or constitutively.

TRANSFORMATION The present system can be used in any plant that can be transformed and regenerated. These methods for transformation and regeneration are well known in the art. As well as the references cited above, see also An, G., Watson, B.D., and Chiang, C.C. Transformation of tcbacco, tomato, potato, and Arabidopsis thaliana using a binary Ti vector system. Plant Physiol. 81: 301-305, 1986; Fry, J., Barnason, A. and Horsch, R.B. Transformation of Brassica napus with Agrobacterium tumefaciens based vectors. Pl. Cell Rep. 6: 321-325, 1987; Block, M.d. Genotype independent leaf disc transformation of potato (Solanum tuberosum) using Agrobacterium tumefaciens. Theor. appl. enet 76: 767-774, 1988; Deblock, M., Brouwer, D.D. and Tenning, P. Transformation of Brassica napus and Brassica oleracea using Agrobacterium tumefaciens and the Expression of the bar and neo genes in the transgenic plants. Plant Physiol. 91: 694-701, 1989; baribault, T.J. Skene, K.G.M. , Cain, P.A., and Scott, N.S. Transgenic grapevines: regeneration of shoots expressing beta-glucuronidase. Pl. Cell Rep. 41: 1045-1049, 1990; Hinchee, M.A.W., Newell, C.A. , Connod, D.V., Armstrong, T.A., Deaton, W.R., Sato, S.S., and Rozman, R.J. Transformation and regeneration of non-solanaceous crop plants. Stadler Genet Symp. 203212.203-212, 1990; Barfield, D.G. and Púa, E.C. Gene transfer in plants of Brassica júncea using Agrobacterium tumefaciens-mediated transformation. Pl. Cel. Rep. 10: 308-314, 1991; Cousins, Y.L. , Lyon, B.R., and Llewellyn, D.J. Transformation of an Australian cotton cultivar: prospects for cotton improvement through genetic engineering. Aust. J. "Plant Physiol., 18: 481-494, 1991; Chee, PP and Slinghtom, JL Transformation of Cucumber Tissues by Microprojectile, Bombardment Identification of Plants, Containing Functional and Nonfunctional Transferred Genes, GENE 118: 255-260, 1992; Christou, P ., Ford, TL, and Kofron, M. The development of a variety-independent gene-transfer method for rice Trends: Biotechnol 10: 239-246, 1992; D'Halluin, K., Bossut, M., Bonne , E., Mazur, B., Leemans, J., and Botterman, J. Transformation of sugarbeet (Beta vulgaris L.) and evaluation of herbicide resistance in transgenic plants, Bio / Technol 10: 309-314, 1992; Dhir , SK, Dhir, S., Savka, MA, Belanger, F., Kriz, AL Farrand, SK, and Widholm, JM Regeneration of Transgenic Soybean (Glycine Max) Plants from Electroporated Protoplasts PLANT PHYSIOL 99: 81-88, 1992; Ha, SB, Wu, FS, and Thorne, TK Transgenic turf-type tall fascue (Festuca arundinacea Schreb.) Plants regenerated from protoplasts, Pl. Cell Rep. 11: 601-604, 1992; the e. Genetic Transformation The New Tool for Wheat Improvement 78th Annual Meeting Address. CEREAL FOOD WORLD 38: 846-847, 1993; Casas, A.M. Kononowicz, A.K. Zehr, U.B., Tomes, D.T., Axtell, J.D., Butler, L.G. Bressan, R.A. , and Hasegawa, P.M. Transgenic Sorghum Plants via Microprojectile Bombardment. PROC NAT ACAD SCI USA 90: 11212-11216, 1993; Christou, P. Philosophy and Practice of Variety Independent Gene Transfer into Recalcitrant Crops. IN VITJ? 0 CELL DEV BIOL-PLANT 29P: 119-124, 1993; Damiani, F.,? Enz, E., Paolocci, F., and Arcioni, S. Introduction of Hygromycin Resistance in Lotus Through Agrobacterium Rhizogenes Transformation. TRANSGENIC RES 2: 330-335, 1993; Davies, D.R. Hamilton, J., and Mullineaux, P. Transformation of Peas. Pl. Cell Rep. 12: 180-183, 1993; Dong, J.Z. and Mchughen, A. Transgenic Flax Plants from Agrobacterium Mediated Transformation incidence of Chimeric Regenerants and Inheritance of Transgenic Plants. PLANT SCI 91: 139-148, 1993; Fitch, M.M.M., Manshardt, R.M. , Gonsalves, D., and Slightom, J.L. Transgenic Papaya Plants from Agrobacterium Mediated Transformation of Somatic Embryos. Pl. Cell. Rep. 12: 245-249, 1993; Franklin, C.l. and Trieu, T? Transformation of the Forage Grass Caucasian Bluestem via Biolistic Bombardment Mediated D? A Transfer. PLANT PHYSIOL 102: 167, 1993; Golovkin, M.V. , Abraham, M., Morocz, S., Bottka, S., Feher, A., and Dudits, D. Production of Transgenic Maize Plants by Direct D? A Uptake into Embryogenic Protoplasts. PLANT SCI 90: 41-52, 1993; Guo, G.Q., Xu, Wei, Z.M. and Chen, H.M. Transgenic Plants Obtained from Wheat Protoplast Transformed by Peg Mediated Direct Gene Transfer. CHJN SCI BUL 38: 2072-2078, 1993; Asano, Y. and Ugaki, M. Transgenic plants or Agrostis alba obtained by electroporation mediated direct gene transfer into protoplasts. Pl. Cell Rep. 13, 1994; Ayres,? .M. Park, W.D. Genetic Transformation of Rice. CRJT REV PLANT SC 13: 219-239, 1994; Barcelo, P., Hagel, C., Becker, D., Martin, A. and Lorz, H. Transgenic Cereal (Tritordeum) Plants Obtained at Hig Efficiency by Microprojectile Bombardment of Inflorescenc Tissue. PLANT J. 5: 583-592, 1994; Becker, D., Brettschneider, R. and Lorz, H. Fertile Transgenic Wheat from Microprojectil Bombardment of Scutella Tissue. PLANT J. 5: 299-307, 1994; Biswas G.C.G., Iglesias, V.A. , Datta, S.K., and Potrykus, I. Transgeni Indica Rice (Oryza Sativa L) Plants Obtained by Direct Gene Transfer to Protoplasts. J ". BIOTECHNOL 32: 1-10, 1994; Borkowska, M., Kleczkowski, K., Klos, B., Jakubiec, J., and Wielgat, B. Transformation of Diploid Potato with an Agrobacteriti tumefaciens Binary Vector System. l.Methodological Approach. ACT PHYSIOL PLANT 16: 225-230, 1994; Brar, G.S., Cohen, B.A., Vick, C.L. and Johnson, G.W. Recovery of Transgenic Peanut (Arachi Hypogaea L) Plants from Elite Cultivars Utilizing Accell (R) Technology. PLANT J. 5: 745-753, 1994; Christou, P. Geneti Engineering of Crop Legumes and Cereals Current Status and Recen Advances. AGRO FOOD IND Hl TECH 5: 17-27, 1994; Chupeau, M.C., Pautot, V., and Chupeau, Y. Recovery of Transgenic Trees Afte Electroporation of Poplar Protoplasts. TRANSGENIC RES 3: 13-19 1994; Eapen, S. and George, L. Agrobacterium Tumefaciens Mediate Gene Transfer in Peanut (Arachis Hypogaea L). Pl. Cell Rep 13: 582-586, 1994; Hartman, C.L., Lee, L., Day, P.R., and Tumer N.E. Herbicide Resistant Turfgrass (Agrostis Palustris Huds) b Biolistic Transformation. IDB -TECHNOLOGY 12: 919923, 1994; Howe G.T., Goldfarb, B., and Strauss, S.H. Agrobacterium Mediate Transformation of Hybrid Poplar Suspension Cultures an Regeneration of • Transformed Plants. Plant Cell Tissue & Orgar Cul ture 36: 59-71, 1994; Konwar, B.K. Agrobacterium Tumefacien Mediated Genetic Transformation of Sugar Beet (Beta Vulgaris L) PLANT BIOCHEM BIOTECHNOL 3: 37-41, 1994; Ritale, A., Aspegren, K., Kurten, U., Salmenkalliomarttila, M., Mannonen, L., Hannus, R., Kauppinen, V., Teeri, T.H. , and Enari, T.M. Fertile Transgeni Barley by Particle Bombardment of Immature Embryos. PLANT MO BIOL 24: 317-325, 1994; Scorza, R., Cordts, J.M. Ramming D.W., Emershad, R.L. Transformation of Grape (Vitis Vinifera 1) Somati Embryos and Regeneration of Transgenic Plants. J. CELL BIOCHE: 102, 1994; Shimamoto, K. Gene Expression in Transgenic Monocots. CORR OPINBIOTECHNOL 5: 158-162, 1994; Spangenberg, G., Wang, Z.Y., Nagel, J., and Potrykus, I. Protoplast Culture and Generatio of Transgenic Plants in Red Fescue (Festuca Rubra L). PLANT SC 97: 83-94, 1994; Spangenberg, G., Wang, Z.Y., Nagel, J., Potrykus, I. Gene Transfer and Regeneration of Transgenic Plants in Forage Grasses. J CELL BIOCHEM: 102, 1994; Wan, Y.C. and Lemaux, P.G. Generation of Large Numbers of Independently Transf ormed Fertile Barley Plants. PLANT PHYSIOL 104: 3748, 1994; Weeks, J.T., Anderson, O.D., and Blechl, A.E. Stable Transformation of Wheat (Triticum Aestivum L) by Microprojectile Bombardment. J CELL BIOCHEMILO, 1994; Ye, X.J., Brown, S.K., Scorza, R., Cordts, J., and Sanford, J.C. Genetic Transformation of Peach Tissues by Particle Bombardment. JAMER SOCHORTSCI 119: 367-373, 1994; Spangenberg, G., Wang, Z.Y., Nagel, J., and Potrykus, I. PROTOPLAST CULTURE AND GENERATION OF TRANSGENIC PLANTS IN FESCUE NETWORK (FESTUCA RUBRA L). Plant Science 1994 97: 83-94, 1995.

Since niml host plants may also be susceptible to pathogens outside the range of hosts in which they normally fall, these plants also have significant utility in molecular genetics and in the biological study of host-pathogen interactions. In addition, the phenotype susceptible to universal diseases of the niml plants also makes them useful for the selection of the fungicide. The selected niml mutants in a particular host have considerable utility for the selection of fungicide using that host and host pathogens. The advantage lies in the phenotype susceptible to universal diseases of the mutant, which circumvents the problems encountered due to the fact that the hosts are very differentially susceptible to different pathogens and pathotypes, or even resistant to some pathogenic pathotypes. Pathogens of the invention include, but are not limited to, viruses or viroids, for example d-tobacco or cucumber mosaic virus, ring spot virus or d necrosis virus, pelargonium leaf ripple virus, mottled viru red clover, shrub wilt virus dj itomate, and similar viruses; fungi, for example Phythophthor parasitica and Peronospora tabacina; bacteria, for example Pseudomonas syringae and Pseudomonas tabaci; insects, such as aphids, for example Afyzus periscae; and lepidoptera, for example Heliothus spp.; and nematodes, for example Meloidogyne incógni ta. The methods of the invention are useful against a number of maize disease organisms, including, but not limited to, velvety molds, such as Scleropthora macrospora, Sclerophthora rayissiae, Sclerospora graminicola, Peronosclerospora sorghi, Peronosclerospora philippinensis, Peronosclerospora sacchari, and Peronosclerospora mayáis.; oxides, such as Puccinia sorphi, Puccinia polysora, and Physopella zeae; other fungi, such as Cercospora zeae-maydis, Colletotrichum graminicola, Fusarium monoli forme, Gibberella zeae, Exserohilum turcicum, kabatiellu zeae, and Bipolaris maydis; and bacteria, such as Erwinia stewartii.

DESCRIPTION OF SEQUENCE LIST SEQ ID NO: l - genomic sequence of 9,919 base pairs of Figure 14. SEQ ID NO: 2 - 5,655 base pair genomic sequence of Figure 15. SEQ ID NO: 3 - amino acid sequence of the NT? f wild-type protein encoded by the codons of SEQ ID? 0: 2. SEQ ID? O: 4 - amino acid sequence 33-155 of rice-1 of Figure 19. SEQ ID? O: 5: - amino acid sequence 215-328 of rice-1 of Figure 19. SEQ ID? O: 6 - amino acid sequence 33-155 of rice-2 of Figure 19. SEQ ID? O: 7 - amino acid sequence 208-288 of rice-2 of Figure 19. SEQ ID? O: 8 - amino acid sequence 33 -155 of rice-3 of Figure 19. SEQ ID? O: 9 - amino acid sequence 208-288 of rice-3 of Figure 19. SEQ ID? O: 10 - amino acid sequence 33-155 of rice-4 of Figure 19. SEQ ID? O: ll - amino acid sequence 215-271 of rice-4 of Figure 19.

DEPOSITS The following vector molecules have been deposited at the American Type Culture Collection 12301 Parklawn Drive Rockville, MD 20852 USA, on the dates indicated below: Plasmid BAC-04 was deposited with the ATCC on May 8, 1996, as ATCC 97543. Plasmid Pl-18 was deposited with the ATCC on June 13, 1996, as ATCC 97606. Cosmid D7 was deposited with the ATCC on September 25, 196, as ATC 97736.

EXAMPLES Example 1 Identification of NIM1 clones by map-based cloning. High Resolution Genetic Mapping and Physical Mapping of NIM1 in Arabidopsis. 1. Plant material and isolation of niml mutants. Niml mutants were isolated from two populations of Arabidopsis plants ecotype Ws-O, as described by Delaney et al., 81995) PNAS-a, 6602-6606. A mutant population was in the form of an M2 library derived from seeds mutagenized with ethyl methanesulfonate (EMS) (purchased from Lehle, Round Rock, TX), and the other was in the form of a population of T-DNA derived from seeds obtained at the Arabidopsis Biological Resource Center of Ohio State University (Columbus, OH ). The basis of the selection for the non-inducible immunity mutants (niml) was to select the populations of mutagenized plants, to determine the plants in which it could not induce resistance to a virulent pathogen by INA (2,6-dichloroisonicotinic acid; and collaborators, 1991. In: Advances in Molecular Genetics of Plant-Microbe Interactions, Volume 1, 432-439, Hennecke and Verma, editors, Kessmann and collaborators, 1993, In: Mode of action of agrochemicals, Y. Honma, ed. Vernooij et al., 1995, Molec, Pl. Microbe Interaction 8., 228-234). Plants of the mutant populations were grown in a high density in large trays, in a commercial planting mix. When the plants were two weeks old, the trays were sprayed with 0.25 milligrams / milliliter of 2,6-dichloroisonicotinic acid. Four days later, the plants were sprayed with a spore suspension of Peronospora parasitic, isolated EmWa (EmWa), in 5xl04 at lxlO5 spores / -mililitro. This fungus is usually virulent on the Ws-O ecotype of Arabidopsis, unless resistance is first induced in these plants with 2,6-dichloroisonicotinic acid or a similar compound. Following incubation in a high humidity environment, plants with visible disease symptoms were identified, usually 7 days after infection.

These plants did not show resistance to the fungus, despite the application of the resistance inducing chemical, and consequently, they were potential nim (non-immunity) mutant plants. Of 360,000 plants, 75 potential nim mutants were identified. These potential mutant plants were isolated from the lot, placed under low humidity conditions, and allowed to produce seeds. The plants derived from these seeds were selected in an identical way to determine the susceptibility to the EmWa fungus, again after their previous treatment with 2,6-dichloroisonicotinic acid. The plants of the progeny that showed symptoms of infection were defined as nim mutants. In this way, six nim lines were identified. A line . { niml) was isolated from the T-DNA population, and five from the ethyl methanesulfonate population. 2. Rating of Reactions of the Plant to 2,6-Dichloroisonicotinic Acid and to Other Chemical Inductors of Resistance to Diseases. i. Phenotypic analysis of niml. The salicylic acid (SA), and the S-methyl ester of benzo (1, 2, 3) thiadiazole-7-carbothioic acid (BTH), are two chemical products that, like the 2,6-dichloroisonic-tonic acid, induce resistance to broad-spectrum diseases, called Acquired Systemic Resistance (SAR), in wild-type plants. Since 2,6-dichloroisonicotinic acid did not induce resistance in niml plants, these plants were also evaluated for their disease resistance response following their previous treatment with salicylic acid and BTH (as is partially described in Delaney et al., 1995, PNAS 92, 6602-6606). The plants were sprayed with 1, 5, or 15 Mm of salicylic acid, or with 0.25 milligrams / milliliter of BTH, and inoculated to be stimulated with EmWa 5 days later (as described in example 1 above). Both salicylic acid and BTH failed to protect niml plants from fungal infection, as evidenced by the presence of disease symptoms and fungal growth in these plants. Consequently, niml plants did not respond to any of the acquired systemic resistance inducing chemicals, implying that the mutation was downstream from the entry points for these chemicals in the path of resistance induction. The niml was also evaluated to determine its response to the disease, to infection with two incompatible P. parasitica isolates, Wela and oco (ie, these fungal strains do not cause disease in wild-type Ws-O plants). The niml plants were sprayed with conidial suspensions of 5-10xl04 spores / milliliter of Wela or Ñoco, and incubated under high humidity for 7 days. Unlike wild-type plants, niml plants developed symptoms of disease in response to both Wela and Ñoco infection. The symptoms were spots and necrotic traces, with some sporulation. After staining with lactophenol blue, fungal hyphae were easily observed on the leaves of the niml plants. Therefore, niml plants are susceptible to normally incompatible P. parasitic isolates. This result shows that niml plants are not only deficient in chemically induced disease resistance, but also deficient in their natural resistance to microorganisms that are not normally pathogenic. ii. Biochemical analysis of niml. Salicylic acid, 2,6-dichloroisonicotinic acid, and BATH induce acquired systemic resistance, and the expression of acquired systemic resistance genes, which include the genes related to pathogenesis PR-1, PR-2, and PR -5 in Arabidopsis. Since these compounds did not induce disease resistance in niml (as described in example 1.2 above), this mutant line was analyzed to determine the expression of the acquired systemic resistance gene following a treatment with salicylic acid, acid 2, 6- dichloroisonicotinic, or BTH. After treatment of the niml plants with salicylic acid, 2,6-dichloroisonicotinic acid, or BTH, the plant tissue was harvested, and analyzed for RNA accumulation from PR-1, PR-2 genes , and PR-5. For this purpose, total RNA was isolated from the treated tissues, and electrophoresed on an agarose gel. Gel spots were prepared in triplicate, and each hybridized with a probe for one of these three acquired systemic resistance genes, as described in Delaney et al., 1995, PNAS .22., 6602-6606. In contrast to the case of wild-type plants, the chemicals did not induce RNA accumulation of any of these three systemic resistance genes acquired in niml plants, as shown in Figure 1. Taken together, the results indicate that the chemical products do not induce acquired systemic resistance, nor the expression of the systemic resistance gene acquired in niml plants. Since the chemical products did not induce acquired systemic resistance, nor the expression of the systemic resistance gene acquired in the niml plants, it was interesting to investigate if the infection by the pathogen could induce the expression of the acquired systemic resistance gene in these plants, as It does in the wild type plants. The Ws-O and niml plants were sprayed with EmWa spores, as described, and the tissue was collected for RNA analysis at various time points. Infection with the pathogen (EmWa) of wild-type Ws-0 plants induced expression of the PR-1 gene within 4 days after infection, as shown in Figure 2. However, in niml plants, expression was not induced. of the PR-1 gene until 6 days after infection, and the level was reduced in relation to the wild type at that time. Accordingly, following infection with the pathogen, the expression of the PR-1 gene in the niml plants relative to the wild type is delayed and reduced. Infection of wild type plants with pathogens that cause a necrotic reaction, leads to the accumulation of salicylic acid in infected tissues. It has been shown that this endogenous salicylic acid is required for signal transduction in the path of acquired systemic resistance, ie the decomposition of endogenous salicylic acid leads to a decrease in disease resistance. This defines the accumulation of salicylic acid as a marker in the trajectory of acquired systemic resistance (Gaffney et al., 1993, Science 2 - = 1, 754-756). The niml plants were tested for their ability to accumulate salicylic acid following infection by the pathogen. The tomato strain DC 3,000 from Pseudomonas syringae, which carries the avrRpt2 gene, was injected into the leaves of four-week-old niml plants. The leaves were harvested two days later for salicylic acid analysis, as described by Delaney et al., 1995, PNAS .22., 6602-6606. This analysis showed that the niml plants accumulated high levels of salicylic acid in the infected leaves, as shown in Figure 3. The uninfected leaves also accumulated salicylic acid, but not up to the same levels as the infected leaves, in a similar way. to what has been observed in wild-type Arabidopsis. This indicated that the nim mutation is mapped downstream of the salicylic acid marker in the signal transduction path. This was anticipated, since it is known that 2,6-dichloroisonicotinic acid and BTH (inactive in niml plants) stimulate a component in the path of systemic resistance acquired downstream of salicylic acid (Vernooij et al., 1995, Molec. Pl. Microbe Interaction 8, 228-234; Friedrich et al., The Plant Journal 9., in print; and Lawton et al., 1996, The Plant Journal 9, in print). In addition, as described in Example 1.2, exogenously applied salicylic acid did not protect the niml from the EmWa infection. 3. Genetic Analysis of niml. The niml plants were backcrossed with the wild-type Ws-0 plants, and the progeny Fl was tested for its resistance to EmWa after pretreatment with 2,6-dichloroisonicotinic acid, as described in Example 1.1 above. None of the Fl plants previously treated with 2,6-dichloroisonicotinic acid had symptoms of infection, while the niml control plants did show infection. Therefore, it was determined that the niml mutation is recessive.

The F2 population of the Ws-O x niml cross was also tested for disease resistance after pretreatment with 2,6-dichloroisonicotinic acid. Of this population, approximately a quarter (32/130 plants) showed symptoms of disease after EmWa treatment of plants previously sprayed with 2,6-dichloroisonicotinic acid, and three-quarters (98/130 plants) showed no disease. These results indicate that the nim mutation identifies a single genetic site, and corroborates the data from Fl that show the recessive nature of the mutation. 4. Identification of markers in, and genetic mapping of the NIM site. For the conventional map cloning of the NIM gene, we had to identify markers that were genetically linked closely to the mutation. This was done in two steps. First, the niml plants were crossed with a different Arabidopsis genotype, Landsberg erecta (Ler), and the F2 plants of this cross were identified that had an nziml phenotype (ie, plants that are homozygous nim / nim at the NIM site). ). Of these, plants that had a Ler genotype in a nearby DNA marker were identified by molecular analysis. These plants, by virtue of the identification criteria, are recombinant between the marker and the NIM site. The frequency of recombinants defines the genetic distance between the marker and the NIM site. The second prerequisite for map-based cloning is the identification of markers that are genetically very close to the NIM site, that is, markers that identify very few recombinants. If genetic markers are identified that are very close, then these can be used to isolate AD clones. genomic that are close to the NIM site. The NIM place can then be cloned by advance, if it is not already present in the AD? cloned The progress can be initiated from both sides of the gene. It relies on obtaining overlapping clones that are successively closer to the gene of interest. When you get a single AD marker? from an advance initiated from, for example, the extreme north, and does not identify recombinants between this marker and the gene of interest, it must be very close to the gene. However, if the marker identifies recombinants from the south end, the clone from which the marker was obtained must have crossed the gene. Then, by definition, the gene of interest is cloned. It should be located between this marker and the last marker of the north end that identifies the smallest number of recombinants from the north end. In a first step, a large number of recombinants are generated by genetic crossing. In a second step, recombinants that are close to the NIM gene are identified, with the use of molecular markers. Many markers have been described in the literature, and there are several methods for developing additional markers. Our approach has been supported by a number of bookmarking systems, including SSLPs and AFLPs (see below). i. Genetic crosses In order to map the chromosomal position of the NIM gene in relation to the SSLP and AFLP markers, niml was crossed with Ler to make a mapping population. The F2 plants of this cross were grown, and the leaves were harvested for future DNA extractions. Next, the F2 plants were scored to determine the niml phenotype, as described in Example 1.1 above. Also, F3 populations derived from the individual F2 plants were grown and scored to determine the nim phenotype. The DNA was extracted from the stored tissue of the niml phenotypes F2 and F3 by the CTab method, as described (Rogers and Bendich, 1988, Plant Molecular Biology Manual, A6, 1-10). This DNA was used for mapping the NIM gene, as described below. ii. Single-sequence length polymorphism markers Simple Sequence Length Polymorphism (SSLP), ATHGENEA and ngalll markers have already been described (Bell and Ecker, 1994, Genomics 19, 137-144). The primers used for the detection of these SSLPs are mentioned in Table 1.

Table 1. SSLP Sequences.

Genetic mapping of the NI? F gene in relation to the ATHGENEA marker. Using the ATHGENEA (1) primers for polymerase chain reaction amplification of Ler genomic DNA, a band of 205 base pairs was expected (bp), whereas with the genomic DNA of Ws-O, a band of 211 base pairs was expected (Bell and Ecker, 1994, Genomics 19, 137-144). The amplification products proved difficult to separate in conventional agarose gels. Accordingly, two alternative methods for the separation and detection of these fragments of the polymerase chain reaction were developed. In a first method, the primer set ATHGENEA (1) (Table 1) was used to amplify the genomic DNA in the presence of UTP labeled with 6-carboxy-rhodamine (dUTP-RUO, obtained in ABI), producing reaction fragments in polymerase chain labeled with rhodamine. The polymerase chain reactions were analyzed in a DNA Sequencer, which detects DNA fragments with a single nucleotide resolution. The specific reagents were: once a polymerase chain reaction regulator, 2 mM MgCl2, 200 mM dNTPs each, 2 mM dUTP-RUO, ATHGENEA (1) at 0.75 mM primers, 10 nanograms of DNA, and 0.75 polymerase units Taq in a reaction volume of 20 milliliters. The conditions of the amplification were: 3 minutes at 94 ° C, followed by 35 cycles of 15 seconds at 94 ° C, 15 seconds at 55 ° C, and 30 seconds at 72 ° C. These samples were analyzed on an ABI 377 DNA Sequencer, capable of detecting fluorescently labeled DNA fragments with a single nucleotide resolution (nt.). This allowed the plant samples to be genotyped: a DNA fragment of 205 nucleotides was obtained from the Ler DNA, and a band of 211 nucleotides was obtained from the Ws-O DNA. Accordingly, fragments of DNA that differed by six nucleotides in length could be easily distinguished, allowing samples to be easily genotyped as homozygous Ws-0, homozygous Ler, and heterozygous Ws-O / Ler at the ATHGENEA site. In order to increase the production of this system, a multiplexing scheme was used. Some DNA samples were amplified with polymerase chain reaction as described above, with the primer set ATHGENEA (1), while other samples were analyzed with the primer set ATHGENEA (2) (mentioned in Table 2), in each case in the presence of dUTP labeled with 6-carboxy-rhodamine. The ATHGENEA primer set was made based on the published ATHGENEA sequence (Simoens et al., 1988, Gene, 67, 1-11). This primer set amplified a DNA fragment of 139 base pairs from the Ler DNA, and a 145 base pair band from the Ws-O DNA. The reaction conditions of the amplification for the ATHGENEA primer set (2) were identical to those described for the primer set ATHGENEA (1), above. The simple reactions were mixed using the ATHGENEA primer set (1) and the simple reactions using the ATHGENEA primer set (2) with each other, before electrophoresis on the ABI 377 DNA Sequencer. This multiplexing approach allowed genotyping two samples in one single track of the Sequencer, one in positions of 145/139 nucleotides, and one in positions of 211/205 nucleotides in the Sequencer. In the second method, fragments of the polymerase chain reaction were labeled by using a fluorescent dye-labeled primer FAM-6 (6-carboxyfluorescein) (Integrated DNA Technologies, Inc.). The ATHGENEA primers in the ATHGENEA primer sets (1) and (2) are identical in sequence (see Table 1). This primer was labeled with FAM-6, and used in an amplification reaction with polymerase chain reaction, with the following reagents (Perkin Elmer): once XL regulator, 1 mM MgCl 2, dNTPs each at 200 mM, primers , each at 0.50 mM (forward primer labeled with FAM-6), 10 nanograms of genomic DNA, and 0.5 units of XL polymerase in a 20 milliliter reaction volume. The cycle conditions were: 3 minutes at 94 ° C, followed by 35 cycles of 15 seconds at 94 ° C, 15 seconds at 59 ° C, and 30 seconds at 72 ° C. Again, the simple reactions were mixed using the ATHGENEA primer set (1), and simple reactions using the primer set ATHGENEA (2) to each other before electrophoresis on the DNA sequencer ABI 377. This multiplexing approach allowed genotyping two samples on a single track of the Sequencer, one at positions of 145/139 nucleotides, and one at positions of 211/205 nucleotides. All samples F2 and F3 of the niml phenotype plants were graded to determine their genotype at the ATHGENEA site as described above. All samples that were heterozygous at this site identified plants that were recombinants between the niml site and the ATHGENEA site. In a population of 1,144 plants with niml F2 phenotype, and populations with niml phenotype F3 that were qualified in this way, 98 were heterozygous at the ATHGENEA site, giving an estimate of the genetic distance between this SSLP site and the NIM1 site of 4.3 cM. This established that the NIMI site was on chromosome 1, near the ATHGE? EA marker.

Genetic mapping of the NIM1 gene in relation to the ngalll marker. Two primer sets were used for the ngalll tag of SSLP (described in Bell and Ecker, 1994, Genomics 19, 137-144), to amplify the AD? genomic analysis of plants with niml phenotype F2 and F3, and the Ws-O and Ler control plants. The ngalll primer set (1) (described in Bell and Ecker, 1994, Genomics 19, 137-144 and mentioned in Table 1) was used under the following conditions: once polymerase chain reaction regulator, 2 mM MgCl 2, d? TPs at 200 mM, primers at 0.75 mM, 10 nanograms of AD ?, and 0.75 units of Taq polymerase in a reaction volume of 20 milliliters. The ngalll (2) primer set (mentioned in Table 1, and a derivative of the ngalll (1) primer set) was used under different conditions: once a polymerase chain reaction regulator, MgCl21.5 mM, d? TPs each one at 200 mM, primers at 1 mM, 10 nanograms of AD ?, and one unit of Taq polymerase in a reaction volume of 20 milliliters. Both reactions were amplified by incubation at 94 ° C for 1 minute, followed by 40 cycles of 15 seconds at 94 ° C, 15 seconds at 55 ° C, and 30 seconds at 72 ° C. The samples were analyzed on 3-5 percent agarose gels. The band obtained from the Ws-0 DNA amplification with any primer set was 146 base pairs, while the amplification of the Ler DNA resulted in a band of 162 base pairs. Plant samples that were heterozygous at the ngalll site identified plants that were recombinants between this SSLP marker and the NX site. Among 1,144 plants of niml phenotype F2, and populations of niml phenotype F3, 239 were identified as heterozygous for the ngalll marker, giving an estimate for the genetic distance between the SSLP marker and the NIM place of 10.4 cM. This corroborated that the NIM1 site was on chromosome 1. Since there were few plants of the niml phenotype that were heterozygous in both ATHGE? EA and ngalll, it was determined that the NIM1 site was between these two markers, finding ATHGE? EA to the north of the NIM1 gene, and locating ngalll south of the NIM1 gene. This put the NIM1 gene at approximately 10 cM north of ngalll, near position 85 on chromosome 1 (Lister and Dean, 1993, Plant J. 4, 745-750, Bell and Ecker, 1994, Genomics 19, 137- 144). iii. Amplitude fragment length polymorphism markers. For the map-based cloning of the NIM1 gene, it is necessary to identify molecular markers that are susceptibly closer to this gene. For this purpose, Amplified Fragment Length Polymorphism (AFLP) markers were generated, using the selective restriction fragment amplification method described by Zabeau and Vos (1993, European Patent Application Number EP 0534858), and Vos and collaborators ( 1995, Nucleic Acid Research 23., 4407-4414).

Illustration of AFLP Technology The use of AFLP technology in the mapping is based on the selective amplification of a set of DNA bands in two genetically distinct samples. The discovery that any of the bands obtained is different between the two genotypes identifies those bands as markers for this genotype. If the marker is cosegregated at a high frequency with the gene (mutation) of interest, then the marker is close to the genetic place. The selective amplification of a small set of DNA fragments in a complex DNA sample is achieved in a two-step process. First, DNA fragments are generated by digesting the DNA with restriction enzymes, followed by ligation of the adapters to the ends. Second, primers are used which consist of a complementary sequence for the adapters plus a 3 'extension (normally from 0 to 3 nucleotides), in order to amplify only those DNA fragments with ends that are complementary to these primers. If a single nucleotide extension is used, then theoretically, each primer will "fit" in about 1/4 of all the fragments, with 1/16 of all fragments having a primer adjustment at both ends. Accordingly, a limited set of DNA fragments is amplified with these primers. By additional radiolabelling of a primer, a still smaller subset of visible bands can be obtained.

AFLP analysis For AFLP analysis on DNA samples, 50 nanograms of DNA were digested with the appropriate enzymes (typically EcoRI and Msel, see below), and the adapters (mentioned in the following Table 2) were ligated to the restriction fragments (typically EcoRI and Msel). The sequences of the primers and YAC, Pl, and BAC clones are described in detail below. The templates were used for the amplification reactions (approximately 0.5 nanograms of DNA per reaction), using primers that were complementary to the adapters, with short 3 'extensions (2 or 3 nucleotides, primer sequences as mentioned below). Since one of the primers is radioactively labeled (usually the EcoRI primer), only a subset of the amplified fragments is visible after the autoradiographic analysis of the gel used to separate the bands. The amplification conditions for the cloned DNA (YAC, Pl, cosmid) were as follows: 36 cycles of 30 seconds at 94 ° C (denaturation), 30 seconds of annealing, and 1 minute of extension at 72 ° C. The tempering temperature in the first cycle was 65 ° C, and was reduced by 0.7 ° C in each cycle for the next 12 cycles, and then maintained at 56 ° C. For the genomic DNA of the Arabidopsis plants, the amplification was performed in two steps: in the first step (pre-amplification), the DNA was amplified with primers having a single extension of nucleotides (no primers were labeled). The reaction conditions for this amplification reaction were: 20 cycles of 30 seconds of denaturation (94 ° C), 1 minute of annealing (56 ° C), and 1 minute of extension (72 ° C). In the second step, the first amplification reaction was diluted 10-fold, and reamplified at 36 cycles with primers containing full-length extensions (using a labeled primer) under the following conditions: 30 seconds at 94 ° C (denaturation) , 30 seconds of tempering, 1 minute extension at 72 ° C. The tempering temperature in the first cycle was 65 ° C, and was reduced by 0.7 ° C in each cycle for the next 12 cycles, and then maintained at 56 ° C. The final reaction products were separated on a polyacrylic amide gel, and the gel was exposed to a film, allowing visualization of the radiolabeled polymerase chain reaction bands. When this procedure was applied to the DNA of two genotypes simultaneously, the AFLP bands that were diagnostic for one genotype or for the other were identified. These bands are called informative AFLP bands, or AFLP markers. Table 2 shows the Adapters used in the AFLP analysis.

Table 2 Generation of AFLP Markers and Fine Mapping of the NIM1 Place. A population of recombinant inbred lines derived from a cross between the ecotypes of Arabidopsis Landsberg erecta (Ler) and Columbia (Col) (Lister and Dean, 1993, Plant J. 4., 745-750) was used for the selection of the AFLP marker. The primers used for the selection of AFLP were: EcoRI primers: 5 '-GACTGCGTACCAATTCWN-3' Msel primers: 5 '-GATGAGTCCTGAGTAAXWN-3' An "N" in the primers indicates that this part was variable (A, C, G, or T), a "W" indicates A or T, and an "X" indicates a C. All 8 possible primers were used both for the EcoRI primer and for the Msel primer. This gave a total of 64 (8 x 8) combinations of primers (PCs) that were used to amplify the DNA from the recombinant inbred line, and the parental genotypes, Ler and Col, as described above. The amplification reactions were performed on a denaturing polyacrylic amide gel to separate the AFLP fragments by size, and the gene was exposed to film. The film was inspected to determine the bands that were present only in one genotype, ie, they were inspected to determine the AFLP markers. The AFLP markers, that is, DNA fragments that are polymorphic between both parents of the inbred recombinant lines, were used to construct a genetic map of the population of the recombinant inbred line. Example 1.5i below describes the mapping of the NIM1 gene on Arabidopsis chromosome 1, at approximately position 85. The AFLP markers that had been mapped (using the recombinant inbred line) between positions 81 and 88 of chromosome 1 were selected. of Arabidopsis, to analyze the recombinant plants in order to determine the presence of the AFLP markers, and therefore, to map the NIM2 gene in a more precise manner. 7 AFLP markers were identified from this region as informative; they were polymorphic between both parents of the niml x Ler cross. Six AFLP markers were specific to Ler, ie, these AFLP markers were absent in Ws (and Col as well). An AFLP marker was specific for Ws, that is, an AFLP marker specific for Col (absent in Ler) that was also present in Ws. These AFLP markers are: L81.1, L81.2, W83.1, L84, L85, L87 and L88 (one L marker is specific for the Ler ecotype, and one W marker is specific for both Col and Ws ecotypes; the number indicates the position on the map). These AFLP markers were used to analyze recombinant plants from the niml x Ler cross (see below). In addition, the AFLP C86 marker (a recombinant marker derived from inbred line specific for Col) was used in the isolation of AD? (See later) . Table 3 lists the sequences of primers that were used to obtain these AFLP markers. Table 3 shows the primer combinations of the AFLP markers derived from the population of the recombinant inbred line.

"EcoRI" - refers to the sequence 5 '-GACTGCGTACCAATTC-3', and "Msel" - refers to the sequence 5 '-GATGAGTCCTGAGTAA-3'.

Table 3 A detailed genetic map of the region was constructed using the AFLP markers described above, typing the recombinants. A total of 337 recombinant plants of 1,144 niml F2 plants were available. These recombinants were first selected with the AFLP northern flank markers L81.2 and ATHGENEA, and the south flank markers L88 and ngalll. Forty-eight homozygous niml / niml and heterozygous plants in ATHGENEA and L88.2, and 21 plants were homozygous niml / niml, and heterozygous in ngalll and L88. These recombinant plants were further analyzed with 9 AFLP markers in the NTM region, including four AFLP markers that were derived from the mapping population of the recombinant inbred line (W83.1, L84, L85, and L87), and 5 markers AFLP derived from the analysis of YAC clones (W83.3 / W84.1, W84.2, W85.1, W86.1, and L86, see below). The genetic map of NIM1, based on this analysis, is illustrated in Figure 4. As seen, 27 recombinants were found between marker W84.2 and NIM1, and 14 recombinants were found between W85.1 and NIM1. The L85 marker is closely linked to NIM1, but this marker could not be mapped onto the YAC, BAC, or Pl clones (see below), and therefore, could not be used for the identification of the NIM1 gene.

. Physical mapping of the NIM1 region i. Isolation of YAC clones using AFLP markers closely linked with NIM1. The CIC library, a library of Arabidopsis ecotype Columbia YAC (Bouchez et al., 1995, 6th Int. Conf on Arabidopsis Research, Madison, Wl), was selected to determine the YAC clones in the NIM region. This library has approximately 2.5 nuclear genome equivalents, and has an average insertion size of 450 kb. The YAC library was selected with two AFLP markers: W83.1 and C86. W83.1 is the recombinant AFLP marker derived from the most closely linked inbred line north of NIM1, and C86 is a recombinant AFLP marker derived from the inbred line specific for Col (absent in Ler and Ws). C86 maps to the south of the NIM1 gene on the population map of the recombinant inbred line. This Col AFLP marker has been used in place of closely linked Ler AFLP markers (Figure 4), because these latter AFLP markers detected only the erect Landsberg ecotype, and therefore can not be used to select the Columbia library. YAK. The YAC library was selected in steps. First, the cells of the YAC clones of each plate of the 96 96-well microtiter plates were pooled (a group of plates) and used for DNA isolation, as described by Ross et al. (1991, Nucleic Acids). Res. 19, 6053). The groups were selected with both AFLP markers. Subsequently, from each group of positive plaques, the DNA samples from each row (a group of 8 clones) and from each column (a group of 12 clones) were selected with the AFLP marker for which the group of plaques was positive. In this way, the individual positive YAC clones could be identified. The selection yielded a total of four YAC clones: YAC 12F04 and YAC 12H07 were isolated using the AFLP marker from the north W83.1, and YAC 10G07 and YAC 7E03 using the AFLP marker from the south C86 (for the nomenclature of the YAC clones, uses the CIC numbering). The traces were "traced" from the YACs by means of AFLP, giving specific AFLP fragments of YAC. The traces of the YACs were compared and used to estimate the overlaps between the YACs (see also Tables 5 and 6). Based on the AFLP traces, clone 7E03 is essentially covered by clone 10G07 (see also Table 5), and in the same way, clone 12H07 is essentially covered by clone 12F04 (see also Table 6). ii. Generation of AFLP markers from YAC clones Since the AFLP markers described above were genetically relatively distant from the NJ 2 gene (see Figure 3), additional AFLP markers were developed in an effort to find markers that were closer to the NJ gene. A selection to search for AFLP markers derived from additional YAC was performed on AD samples, of the following: AD? of the isolated YAC clones (4 YACs were identified, as described above), the yeast strain without a YAC, and the three ecotypes of Arabidopsis, Col, and Ws. In this way, the specific fragments for the YAC clones (absent in the yeast strain and present in Col) could be tested to determine the polymorphism in Ler and Ws) (the parents of the recombinant plants identified in example 1.5 below) ). All polymorphic fragments identified in this manner would be additional AFLP markers. In the first selection of AFLP, the combination of enzymes (EC) EcoRl / Msel was used. In this selection, two YAC, 10G07 and 7E03 clones (detected with the AFLP C86 marker, see below), the yeast strain without a YAC, and the three ecotypes of Arabidopsis, Col, Ler, and Ws were tested. The combinations of primers with selective extensions used can be divided into three groups, and are illustrated in Table 4. A total of 256 (64 + 96 + 96) combinations of primers were selected. In Table 4 below, the primer sequences used in the AFLP selection of two YAC, 10G07 and 7E03 clones, the yeast strain without a YAC, and the three ecotypes of Arabidopsis, Col, Ler, and Ws are shown. Three groups of primer combinations have been used. An "N" in the primers indicates that this part was variable (A, C, G, or T), an "S" indicates C or G, a "W" indicates A or T, and a "Y" indicates C or T. Table 4 EcoRI primers: 5 '-GACTGCGTACCAATTCG -3' 5 '-GACTGCGTACCAATTCTS-3' primers Msel: 5 '-GATGAGTCCTGAGTAAAAS-3' 5 '-GATGAGTCCTGAGTAAAS -3 • 5' -GATGAGTCCTGAGTAAATN-3 '5' -GATGAGTCCTGAGTAACAN-3 '5' -GATGAGTCCTGAGTAACTN-3 ' EcoRI primers: 5 '-GACTGCGTACCAATTCAN-3' 5 '-GACTGCGTACCAATTCCW-3' 5 '-GACTGCGTACCAATTCTW-3' Msel primers: 5 '-GATGAGTCCTGAGTAAAAS-3' 5 '-GATGAGTCCTGAGTAAASA-3' 5 '-GATGAGTCCTGAGTAAGAY-3' 5 '-GATGAGTCCTGAGTAAGTW-3' 5 '-GATGAGTCCTGAGTAATCG-3' 5 '-GATGAGTCCTGAGTAATCT-3' 5 '-GATGAGTCCTGAGTAATGW- 3 ' EcoRI primers: 5 '-GACTGCGTACCAATTCGW-3' '-GACTGCGTACCAATTCTN-3' Msel primers: 5 '-GATGAGTCCTGAGTAAGAW-3' 5 '-GATGAGTCCTGAGTAAGCW-3' 5 '-GATGAGTCCTGAGTAAGTW-3' 5 '-GATGAGTCCTGAGTAATAN-3' 5 '-GATGAGTCCTGAGTAATCW-3' 5 '-GATGAGTCCTGAGTAATGW- 3 '5' -GATGAGTCCTGAGTAATTS-3 ' In total, 83 specific fragments of Col, of which, 62 were shared by both YAC clones. Three fragments were polymorphic AFLP markers between Ws and Ler, of which two were AFLP markers of Ws (one Col fragment also present in Ws and absent in Ler), and one was an AFLP marker of Ler (a Col fragment also present in Ler). and absent in Ws). These results are presented in Table 5 below. Table 5 shows a number of shared and unique AFLP fragments detected in the YACs 10G07 and 7E03, and the number of informative AFLP markers between these fragments in the Ws and Ler genotypes.

Table 5 Therefore, this AFLP analysis produced three new AFLP markers (see Figure 4 and below). Their positions in relation to each other, and in relation to the AFLP markers derived from the recombinant inbred line, were determined by analysis of the recombinants with these AFLP markers. A second selection was made to determine the AFLP markers, testing all four identified YAC clones (see below), and using the combination of Pstl / Msel enzymes. The primers used are: PstI primers: 5 '-GACTGCGTACATGCAGAN-3 • 5' -GACTGCGTACATGCAGCW-3 '5' -GACTGCGTACATGCAGGW-3 '5' -GACTGCGTACATGCAGTN-3 'Msel primers: 5' -GATGAGTCCTGAGTAAAN-3 '5' -GATGAGTCCTGAGTAACW -3 '5' -GATGAGTCCTGAGTAAGW-3 '5' -GATGAGTCCTGAGTAATN-3 ' An "N" in the primers indicates that this part was variable (A, C, G, or T), and a "W" in the primers indicates that it was A or T. A total of 144 was selected (12 x 12) combinations of primers on the four isolated YAC clones, 12F04, 12H07, 10G07, and 7E03; the yeast strain without a YAC; and the three ecotypes of Arabidopsis, Col, Ler, and Ws. In total, 219 fragments of AFLP were generated, of which 144 were present in the clones of YAC, 12F04 and 12H07 (72 were unique for clone 12F04, and 72 were shared between both YACs), and of which, 75 were present in clones YAC, 10G07 and 7E03 (33 were unique for clone 10G07, and 42 were shared between the two YACs). Three fragments derived from the first set of YAC clones were polymorphic (AFLP markers of Ws). These results are presented in the following table 6. Table 6 lists the number of shared and unique AFLPs detected in YACs, and the number of informative AFLP markers among these fragments in the Ws and Ler genotypes.

Table 6 The results indicate that the YAC 12H07 clone is part of the larger YAC clone 12F04, and that the clone YAC 7E03 is a part of the larger YAC clone 10G07. These data indicate that the larger YAC clones, 12F04 and 10G07, do not overlap. These data do not allow the placement of the NIM1 gene in any of these YAC clones. The complete selection, which involved 400 combinations of primers that produced 302 fragments of AFLP in the NIM region, yielded five useful AFLP markers, of which four were Ws-specific, and one specific for Ler. These five additional AFLP markers have been mapped by analysis of recombinant plants (see Figure 4 and below), and were designated W84.1 (a.k.a. W83.3), W84.2, W85.1, W86.1 and L86. Table 7 lists the sequences of primers used to obtain these AFLP markers. These five additional AFLP markers raised the total number of AFLP markers to 12 in the region from L81.1 to L88 (see Figure 4 and below). Table 7 shows the primer combinations of the AFLP markers derived from the YAC clones. "EcoRI" refers to the sequence 5'-GACTGCGTACCAATTC-3 '"Msel" refers to the sequence 5'-GATGAGTCCTGAGTAA-3', and "PstI" refers to the sequence 5'-GACTGCGTACATGCAG-3 '.

Table 7 AFLP marker Combination of primers with selective extensions.

W84.1 PstI-AT Msel-TT W84.2 PstI-AA Msel-TT W85.1 EcoRI-CT Msel-GTA W86.1 EcoRI-GT Msel-CTT L86 EcoRI-GT Msel-CTT This information was used to construct a physical map of the region, as shown in Figure 5, with the approximate positions of the YAC clones, in relation to the genetic map. The map showed that the region containing the NIM1 site, between the markers W83.1 and W85.1, is partially covered by three YAC clones: 12F04 and 10G07 / 7E03. iii. Construction of a contig. Pl / BAC containing the NIM1 gene. In the previous sections, we described how the AFLP markers linked to the NT 1 region were isolated, and how the YACs corresponding to these markers were identified and mapped. The results obtained while locating the NIM1 gene in a chromosome fragment, did not allow the definition of a specific DNA segment that contained the NIM1 gene: the flanking AFLP markers were mapped in different YACs that did not overlap. Therefore, it was not possible to determine the precise physical position of the NIM1 gene; it could be located in either of the two YACs, or in the gap between the YACs. An alternative approach was selected to close the physical gap between the flanking markers: the Pl and BAC libraries were used to bridge the gap between the flanking AFLP markers. The libraries used to close the gap were an Arabidopsis library, ecotype Columbia Pl described by Liu et al. (The Plant J. 7, 351-358, 1995), and a Columbia BAC ecotype library described by Choi et al. (http / genome-www stanford.edu / Arabidopsis / ww / Vol2 / choi .html). The Pl library consists of approximately 10,000 clones, with an average insert size of 80 kb, and the BAC library consists of approximately 4,000 clones, with an average insert size of 100 kb. In theory, these libraries represent approximately 10 equivalents of nuclear genome (assuming a haploid genome size for Arabidopsis of 120 Mb). iv. Identification of Pl clones that correspond to the flanking markers. The flanking markers Ws84.2 and Ws85.1 were used to select the groups of Pl clones, using a strategy similar to that described above to select the YAC library (see Example 5.1i). Pl clones having the marker fragments were selected, and the "plasmid" DNA was isolated. The fingerprints of the different DNAs of the clone Pl were extracted using the combinations of enzymes EcoRl / Msel and HindIII / Msel, and the primers and selective nucleotides. A physical map was constructed, that is, a map that gave the size and that overlapped the clones, by means of a comparison of the AFLP tracks. The number of AFLP fragments that were unique, and the number of AFLP fragments that were common among the clones, indicate the extent of the overlaps. The map is shown in Figure 6. The AFLP trace revealed that two contig sets had been constructed. Pl not overlapped, each containing one of the flanking markers: Pl-1 and Pl-2 containing the marker Ws84.2; Pl-3 and Pl-4 containing the marker W85.1. Consequently, the gap between the flanking markers was not closed (Figure 6). The positions of the contigs. Pl with respect to the contig. YAC, were determined by removing the AFLP footprint from the YACs and the Pl clones with a number of combinations of YAC-specific primers described above. Clones Pl, Pl-1, and Pl-2, appeared to overlap completely with YAC CIC12F04, but only partially with YAC CIC12H07. Therefore, the last Pl clones could be placed on the contig of YAC, CIC12H07 / 12F04 (Figure 6). Clones Pl, Pl-3 and Pl-4 overlapped completely with both YACs, CIC7E03 and CIC10G07, and it seemed that the AFLP marker W86.1, like W85.1, was mapped in this contig. Pl (Figure 6). Next, marker L85 was used to identify the corresponding Pl and BAC clones. L85 is a specific marker of the Landsberg ecotype, and consequently, radiolabelled L85 DNA colony hybridization was employed for Pl and BAC filters. We did not identify a single Pl or BAC clone that hybridized to L85. This supported our earlier findings that the L85 sequence is missing in the genome of Arabidopsis ecotype Columbia, and therefore, is the most likely explanation why the corresponding clones were not identified. v. Extension of contig. Flanking Pl of NIM1 Different approaches were used to extend from contig. Flanking Pl: The YAC AFLP fragments specific for the southern end of YAC CIC12F04 (unique for CIC12F04, not present in CIC 12H07), were used to identify Pl clones by AFLP selection of the library groups. 1. YAC AFLP fragments were used from YAC 10G07 and overlapping with Pl-4, to identify Pl clones by AFLP selection of the Pl library groups. 2. The EcoRI restriction fragments were used from the clone Pl, Pl-6 (resulting from the selection of the Pl library based on AFLP from step 1), as hybridization probes on filters from the BAC library.

From this selection, several Pl and BAC clones were obtained, and all of them were fingerprinted with AFLP, with the combinations of enzymes EcoRl / Msel and HindIII / Msel, using primers without selective nucleotides. A new map was constructed, as described above, and as illustrated in Figure 7. Table 8 shows the different combinations of AFLP primers that have AFLP fragments mapped in the flanking YACs, and were used to select the Pl library for the corresponding Pl clones. Table 8 represents the different combinations of AFLP primers used to select the Pl library. The upper half of the table shows the specific primer combinations for the northern YACs, and the lower half shows the specific primer combinations for the southern YACs . YACs and Pl clones where the AFLP fragments were detected are also indicated.

Table 8 A contig was obtained. Pl / BAC of approximately 250 kb covering the southern end of YAC CIC12F04 (not extending from this YAC), and containing the marker W84.2. A contig was obtained. Pl of approximately 150 kb containing the markers W85.1 and W86.1; this contig is completely contained in the YAC CI7E03. The construction of a Pl / BAC contig covering the analysis of the AFLP marker of the NIM1 gene on the recombinants with markers from the southern end of the contig Pl / BAC of the north (WL84.4 and WL84.5, see below and Table 11), showed that previous "progress" steps were not successful in the construction of a contig containing the NX I gene (see next section). Therefore, the existing Pl / BAC contig of the north extended to the south for the purpose of "advancing" through the NIM1 gene, which would make it possible to define and isolate an AD segment? specific that contained the NIM1 gene. An approach based on hybridization was followed, where Pl or BAC clones located at the southern end of the Pl / BAC contig north were used to identify the clones placed closest to NIM1 (southern boundary). The new clones resulting from the advancement steps were mapped with respect to the existing contigs using the AFLP traces with the EcoRl / Msel and Hind / Msel enzyme combinations, as described above. It appeared that five subsequent steps of progress were necessary to "cross" the NIM1 gene. Table 9 shows the clones obtained in the different advance steps. Table 9 is an overview of the different advance steps, showing the hybridization probe used to select the Pl and BAC libraries, and the selected clones that hybridize in the probes and extend in the south direction.

Table 9 A physical map of the different clones resulting from this forward effort is illustrated in Figure 8. A total distance of approximately 600 kb was covered, starting from the marker of the initial advance point W84.2. The southern end of the contig presented in Figure 8 seemed to contain the NIM1 gene (see next section). The contig extends more than 300 kb south from the YAC CIC12F04, and appeared not to overlap with the YACs CIC10G07 and CIC7E03, indicating that the NJMl gene is in the gap between the flanking YAC contigs, and that this gap is at least 300 kb. saw. Construction of an integrated genetic and physical map of the NIM1 region. In the previous sections, the manner in which the AFLP markers linked to the NIM1 region were isolated, the way in which the YACs corresponding to the flanking markers were identified, and the manner in which the Pl / BAC contig was constructed were described. approximately 550 kb to the south from the nearest north flank AFLP marker W84.2. This section describes the generation of new AFLP markers from the Pl / BAC contig, the physical mapping of these markers on this contig, and the genetic mapping of these markers with the available recombinants. 1. Generation of new AFLP markers from the Pl / BAC contig As described in the previous section, the Pl and BAC clones of the contig extension were characterized by the AFLP trace using the EcoRl / Msel and HindIII / Msel enzyme combinations. This very precisely defined the extent of the overlaps between the different Pl and BAC clones, and in addition, generated a number of AFLP fragments specific for these clones. AFLP primers without selective nucleotides were used in the fingerprints of the purified plasmid of the Pl or BAC clones. However, selective nucleotides will be necessary to be able to use these Pl or BAC-specific AFLP fragments for detection in Arabidopsis. By determining the end sequences of the amplified restriction fragments, AFLP primers having the appropriate selective bases can be designed, to amplify the AFLP fragment specific for Pl or BAC in Arabidopsis. All AFLP fragments originate from the Columbia (Col) ecotype, and therefore, it must also be determined if the Columbia AFLP markers are informative in the NIM1 recombinants that are derived from a cross of the Landsberg erectus ecotypes (Ler), and a mutant niml of the ecotype Wassilewskija (Ws -nim). In principle, there are four types of AFLP fragments, two of which are useful markers, as indicated in the following Table 10: Table 10 is an overview of the types of AFLP markers found. (+) or (-) indicates the presence or absence of the AFLP fragment.

Table 10 Col Ler Ws- -nim marker type + + + not informative + + - marker Ler + - + marker Ws + - - not informative In general, traces of Pl and BAC clones generated 30 to 40 AFLP fragments of EcoRl / Msel, and 60 to 80 AFLP fragments of HindIII / Msel for each individual clone. The end sequences of the individual fragments were determined by conventional sequencing techniques. Next, sets of specific AFLP primers with 3-nucleotide selective extensions were tested for both the EcoRI or HindIII primer, and the Msel primer, on the following panel of DNAs: 1. The Pl / BAC clone from which the DNA was derived. AFLP marker. 2a. Yeast 2b. Clone YAC, CIC12F04 (only for AFLP fragments from Pl-7) 2c. Clone YAC, CIC10G07. 3a. Col, origin of the Pl and BAC libraries. 3b. Ler, father 1 of the recombinants nim. 3c. Ws-nim, father 2 of the nim recombinants.

Six clones were selected for sequence analyzes of their AFLP fragments from EcoRl / Msel and HindIII / Msel: BAC-01 / P1-7, P1-17 / P1-18, BAC-04 / BAC-06. The AFLP fragments of clone Pl-7 were all detected in YAC CIC12F04, indicating that this clone is completely contained within this YAC. None of the Pl / BAC-specific AFLP fragments were detected in the YAC clone, CIC10G07, indicating that the Pl / BAC contig does not bridge the gap between the two flanking YAC contigs. The AFLP markers selected for the analysis of the nim recombinants are illustrated in Table 11. Table 11 is an overview of the AFLP markers selected from the combinations of AFLP primers specific for the different Pl and BAC clones. A "WL" marker is a marker that originates from the same combination of primers, and that exhibits two AFLP markers, a Ws marker and a Ler marker, that appeared to be completely bound in the repulsion phase on the analysis of the recombinants NJM.

Table 11 2. Physical Mapping of the New AFLP Markers The AFLP markers described above were physically mapped by detecting their presence in the different Pl and BAC clones. The results are presented in Figures 9 to ll. 3. Genetic Mapping of New AFLP Markers AFLP markers were all analyzed on a selected set of recombinants. The results obtained are summarized in Tables 12a, 12b, and 12c.

Table 12a -or W: genotype Ws; II: lictero-social; (): not 100% reliable or inferred from the neighboring scores; nini and Rniin: plants The AFLP, Ler84.8, Ler84.9a, Ler84.9b, and Ler84.9c, appeared to be mapped on the south side of NIM1. It was found that the recombinants were phenotypically niml (homozygous, genotype Ws-n-pt.l / Ws-ni.n-2), and heterozygous for these AFLP markers (AFLP-specific marker was detected).

Ler, and the genotype is Ws-niml / Ler). The AFLP marker, Ler84.8, appeared to be closer to NIM1: only one recombinant (C-105) was qualified as heterozygous Ws-niml / Ler, and homozygous Ws-nipJl / Ws-niml. The AFLP, Ler84.7 and Ler84.6c markers appeared to be completely cosegregated with NIM1. All recombinants had a genotype of NIM1 and marked AFLP identical. North of NIM1, marker L84.6b appeared to be closer to NJMl: it was found that three recombinant plants of the niml phenotype, C-074, D-169, and E-103 (Table 12c), are heterozygous Ws-n? ml / Ler in this marker. With the help of the contig of the cosmid generated from Pl-18, BAC-04, and BAC-06, the AFLP, Ler84.6b and Ler84.8 markers were mapped on Pl-18 and BAC-04, respectively, and found that they have a physical distance of approximately 110 kb. This defines that niml is located on a segment of AD? which is estimated to be 110 kb in length. From this analysis, it has been determined that the NIM1 gene is contained in clone BAC-04 or Pl-18. Clones BAC-04 and Pl-18 have been deposited with the ATCC, and have received deposit numbers ATCC 97543 and ATCC 97606, respectively.vii. Fine genetic and physical mapping of the NIM1 gene The previous section described the way in which a DNA segment containing the NIM gene was delineated by physical mapping of the flanking AFLP markers (Ler84.6b and Lrer84.8) on the contig Pl / BAC. The flanking markers appeared to be mapped on two overlapping clones, Pl-18 and BAC-04. This section describes how additional BAC-04-specific and Pl-18-specific markers were generated to increase the resolution of the genetic and physical map in the region containing the NIM1 gene. viii. Generation of additional AFLP markers from the cosmid array Four combinations of enzymes were selected to generate additional AFLP markers, for fine mapping of 2 \ rX? T2: PstI / MseI, Xbal / Msel, BstYI / Msel, and Taql / Msel . The AFLP fragments of Pstl / Msel and Xbal / Msel were generated on clone Pl-18 and BAC-04, and the selective sequences necessary for detection in Arabidopsis were determined. In a similar manner, AFLP fragments and selective sequences were determined for BstYI / Msel and Taql / Msel; however, in this case, the procedure was performed using the cosmid DNAs: All, C7, El, and E8 for BstYl / Msel (complete NTM2 region), and D7, E8, and E6 for Taql / Msel (southern side of the NIM1 region). The informative AFLP markers selected for another genetic and physical mapping are shown in Table 13. The additional adapters used in this work are shown in Table 14. Table 13 shows the AFLP markers used for the fine genetic and physical mapping of NIM1. "BstYI (T)" indicates that the restriction site and the corresponding primer were AGATCT or GGATCT. Table 13 Marker EC / PC I * er84.Yl BstYI (T) -GCT Msel-AAC s84.Y2 BstYI (T) -TCT Msel-GCA Ler84.Y3 BstYI (T) -AAG Msel-TAT I ^ er84.Y4 BstYI (T ) -GTT Msel-AGA Ws84.Tl Taql-TAC Msel-GGA I-.er84.T2 Taq-TTG Msel-GGA Table 14 shows the same Additional adapters used to identify the new AFLP markers. Table 14 BstYl: 5 '-CTCGTAGACTGCGTACC-3' 3 '-CATCTGACGCATGGCTAG-5' Taql: 5 '-CTCGTAGACTGCGTACC-3' 3 '-CATCTGACGCATGGGC-5' ix. Physical mapping of new AFLP markers for the cosmid contig The markers indicated above were physically mapped on the cosmid set by determining their presence in the different cosmid clones (Figure 11). 1. Genetic mapping of new AFLP markers The new AFLP markers were genetically mapped by AFLP analysis of the closest northern and southern recombinants. The closest northern (recombinant D169) and southern (recombinant C105) recombination sites were mapped (see Table 15). The AFLP analysis showed that recombinant D169 had a recombination south of marker L84.Y1, but north of marker W84.Y2. The recombination site in recombinant C105 was mapped between markers L84.T2 and L84.8. Using the available set of recombinants, this allowed us to make another delineation of the chromosomal interval containing NIM1; the distance between flanking recombination points appeared to be 60-90 kb (Figure 12).

Table 15 8 o Table 15. Recombinants between the AFLP markers, WL84.4 and 5 and Ler84.9c. The markers are not necessarily shown in order of their physical position. See Table 12 for more 2. Construction of a cosmid contig To complement the niml plant phenotype, the transformation of nim2 plants with a wild-type NIM1 gene is required. This can be done by transforming these plants with a cosmid containing the gene. For this purpose, a contig of the cosmid of the NIM1 region is constructed. Since Arabidopsis is transformed using Agrobacteriun-, the vector of the cosmid used is a binary vector. DNA was isolated from BAC-04, BAC-06, and Pl-18, and used to make a partial digestion using the restriction enzyme Sau3AI. The 20-25 kb fragments were isolated using a sucrose gradient, they were grouped, and filled with dATP and dTTP. The binary vector (04541) was dissociated with Xhol, and filled with dCTP and dTTP. Next, the fragments were ligated into the vector. The ligation mixture was packed and transduced into E. coli. This cosmid library was selected with clones BAC-04, BAC-06, and Pl-18, and positive clones were isolated. Next, the AFLP trace was removed from these cosmids, and they were configured in a contig of overlapping clones extending in the NIM1 region. The insert sizes of the cosmids were determined, and the limited restriction mapping was performed. The results are shown in Figure 10.

Example 2 Identification of a Clone Containing the NIM1 Gene 1. Complementation by means of stable transformation. Plasmids that are generated from clones extending in the NIM1 region (described above) are moved towards Agrobacterium by triparental coupling. These cosmids are then used to transform Arabidopsis niml by vacuum infiltration (Mindrinos et al., 1994, Cell 78, 1089-1099), or by conventional root transformation. The seeds of these plants are harvested and allowed to germinate on agar plates with kanamycin (or another appropriate antibiotic) as a selection agent. Only the plants that are transformed with the cosmid DNA can detoxify the selection agent and survive. The plants that survive the selection are transferred to the land, and are tested to determine the genotype nim, or their progeny are tested to determine the nim phenotype. Transformed plants that no longer have the nim phenotype identify cosmids that contain a functional NIM1 gene. 2. Complementation in a transient expression system The ability of DNA clones to complement the niml mutation in two transient expression systems is tested. In the first system, A-rajbidopsis niml plants containing a PR1 luciferase transgene (PRl-lux) are used as a bombardment receiving material. These plants are generated by the transformation of ecotype Columbia plants, with a PRl-lux construction by vacuum infiltration, followed by kanamycin selection of the harvested seeds, as described above. Transformed plants that express luciferase activity after induction with 2,6-dichloroisonicotinic acid, cross-breed, and homozygous plants are generated. These are crossed with niml plants. In the transient trial, the plants of the progeny of this cross that are homozygous for niml and for PRl-lux, are used for the identification of DNA clones that can complement the niml phenotype. For this purpose, the plants are first treated with 2,6-dichloroisonicotinic acid, as described in Example 1.1 above. Two days later, these plants are harvested, surface sterilized, and coated on a GM agar medium. The tissue of the leaf is then bombarded with the clones of the cosmid Pl or BAC (or subclones from the niml region, and after 1 day, the luciferase activity of the leaves is measured.The clones that induce luciferase activity contain the NIM1 gene In a second system, the plants are not treated with 2,6-dichloroisonicotinic acid (as described in Example 1.1 above), and two days later they are bombarded with the cloned DNA (clones or subclones of cosmid Pl, BAC, and / or YAC) from the region of the NIM1 site, a reporter plasmid The reporter plasmid contains the luciferase gene, driven by the Arabidopsis PR-1 promoter (PRl-lux). 2,6-dichloroisonicotinic acid does not activate the PR1 promoter (as described in Example 1.2 above), and therefore, can not induce luciferase activity from the reporter plasmid, however, when a cotransformed DNA clone contains the NIM1 gene of complement, 2,6-dichloroisonicotinic acid induces the PR1 promoter, as evidenced by an induction of luciferase activity. One day after the coombardeo, the luciferase activity of the whole plant is measured. DNA clones (clones or subclones of cosmid Pl or BAC) that induce luciferase activity that is significantly above the background levels, contain the NIM1 gene. 3. Changes in transcripts in the lines of the niml phenotype. Since the niml phenotype plants have mutations in the NJM1 gene, it is conceivable that in some lines, the gene is altered in such a way that there is no transcribed AR? M, or that an aberrant AR? M (size) is produced. To prove this, is the analysis of AR stain? on the niml lines. The AR? it is isolated from the Ws and Ler plants of these lines (after its treatment with water or 2,6-dichloroisonicotinic acid or BTH), and it is used to prepare Northern blot. These spots hybridize with fragments of AD isolated from clones of the DNA contig of place NIM1. DNA fragments that identify niml lines with aberrant DNA expression (aberrant in their size or in their concentration), possibly identify (part of) the NIM1 gene. The DNA fragment and the surrounding DNA is sequenced and used to isolate a cDNA (by library selection, or by reverse transcription polymerase chain reaction), which is also sequenced. The clone from which the fragment was isolated, or the isolated cDNA, is used to show the complementation of the niml phenotype in stable and transient expression systems.

Example 3 Determination of the DNA Sequence of the NIM1 Gene 1. Genomic Sighting The genomic clones that may contain the NIM1 gene are sequenced using methods known in the art. These include BAC-04, Pl-18, and the cosmids from the NIM1 region. For example, the cosmids are digested with restriction enzymes, and fragments derived from the insert are cloned into a vector for general purposes, such as pUC18 or Bluescript. The larger PA1 and BAC clones are randomly torn, and the fragments are cloned into a vector for general purposes. The fragments of these vectors are sequenced by conventional methods (for example, by "primer advance", or generation of insert deletions). The obtained sequences are assembled in a contiguous sequence. The insert sequence of a complementary clone contains the NIM1 gene. The approximate start and end of the NJM1 gene are deduced based on the sequence of AD ?, the sequence motifs such as the TATA frames, the open reading frames present in the sequence, the codon usage, the complementation data of the cosmid. The relative location of the AFLP markers, and additional relevant data that is collected (see Example 4 below). 2. Sequencing of AD? C. The cosmids or larger clones containing the NJM1 gene (as described in Example 2 above), are used to isolate AD? Cs. This is done using the clones (or the AD? Fragments) as probes in a selection from an AD? C library of wild-type Arabidopsis plants. The AD? Cs that are isolated are sequenced as described for the sequencing of the cosmid, and are used in complementation tests. For this purpose, full length AD? Cs are cloned into a suitable plant expression vector, behind a constitutive promoter. These constructions are used in the transient assays, as described above. Alternatively, AD? Cs are cloned into a binary expression vector, allowing expression in plant tissues, and for transformation of the plant mediated by Agrobacterium, as described in Example 2 above. A cDNA containing the NJM2 gene is sequenced (determined by complementation, isolation with a tightly bound AFLP tag, isolation with a cosmid fragment, or by other derivation). The genes from the Ws-O and niml plants are isolated and sequenced. The genes are obtained from a cosmid of the AD? C library, using a fragment of the NJM2 gene isolated as a probe. Alternatively, genes or AD? Cs are isolated by polymerase chain reaction, using specific primers of the NIM1 gene, and AD? genomic or AD? c as a template. In the same way, the niml alleles are isolated from other niml lines see Example 1.1 above), and are sequenced in a similar manner.

Example 4 Description of NIM1 Gene and Deducted Protein Sequence The sequence of AD? of the NJM1 gene, or AD? c, is determined as described in Example 3 above. This sequence is analyzed with the use of AD? Analysis programs, such as can be found in the Genetics Computer Group (GCG) package, in the Sequencer, or in Staden packages, or any AD analysis program package? Similary. Specifically, the start and end of the gene are determined, based on the analysis of the open reading frame, the presence of the arrest and potential start codons, the presence of potential promoter motifs (such as the TATA table), the presence of polyadenylation signals, and the like. Also, the predicted amino acid is deduced from the open reading frame. Both the DNA and the sequence of the protein are used to search the databases in order to find sequences with homologies, such as transcription factors, enzymes, or motifs of these genes or proteins.

Example 5 Isolation of NIM1 Homologs The NIM1 gene of Arabidopsis can be used as a probe in the selection of low stringency hybridization of a cDNA or genomic library, in order to isolate NIM1 homologs from other plant species. . Alternatively, this is accomplished by polymerase chain reaction amplification, using primers designed based on the sequence of the Arabidopsis NIM1 gene, and using the genomic DNA or the cDNA as a template. The NIM1 gene can be isolated from corn, wheat, rice, barley, rapeseed, sweet beet, potato, tomato, beans, cucumber, grape, tobacco, and other crops of interest, and sequenced. With a set of sequences from the homologues of the NIM1 gene at hand, new primers can be designed from the conserved portions of the gene, in order to isolate NIM1 homologs from the most distantly related plant species, by amplification with polymerase chain reaction. Example 6 Complementation of the niml-1 gene with Genomic Fragments 1. Construction of a cosmid contig A cosmid contig of the NJMl region was constructed using the AD? purified with CsCl, from BAC04, BAC06, and Pl-18. The AD? C of the three clones were mixed in equimolar amounts, and partially digested with the restriction enzyme Sau3A. The 20-25 kb fragments were isolated using a sucrose gradient, pooled, and filled with dATP and dGTP. Plasmid pCLD04541 was used as the cosmid vector of AD? -T. This plasmid contains a replicon based on pRK290 from a wide host range, a tetracycline resistance gene for bacterial selection, and the nptll gene for plant selection. The vector was dissociated with XhoI, and filled with dCTP and dTTP. Then the prepared fragments were ligated into the vector. The ligation mixture was packaged and transduced into E. coli strain XLl-blue MR (Stratagene). The resulting transformants were selected by hybridization with clones BAC04, BAC06, and Pl-18, and positive clones were isolated. The AD? of the cosmid was isolated from these clones, and the AD was prepared? of template using the enzyme combinations EcoRl / Msel and HindIII / Msel. The resulting AFLP fingerprint patterns were analyzed to determine the order of the cosmid clones. A set of 15 semi-overlapped cosmids was selected that extended into the nim region (Figure 13). The cosmid DNAs were also restricted with EcoRI, PstI, BssHII, and SgrAI. This allowed the estimation of the insert sizes of the cosmid, and the verification of the overlaps between the different cosmids, determined by AFLP fingerprint. 2. Identification of a Clone Containing the NJM Gene The cosmids generated from the clones extending in the NIM1 region were moved towards Agrobacterium tumef hundreds AGL-1, by conjugation transfers in a triparental coupling with the auxiliary strain HB101 (pRK2013). Then, these cosmids were used to transform a line of Arabidopsis niml-1 sensitive to kanamycin, using vacuum infiltration (Mindrinos et al., 1994, Cell 78, 1089-1099). The seeds of the infiltrated plants were harvested, and allowed to germinate on GM agar plates, containing 50 milligrams / milliliter of kanamycin as a selection agent. Only the plants that are transformed with the AD? of the cosmid can detoxify the selection agent and survive. The seedlings that survive the selection were transferred to the soil approximately two weeks after the coating, and were tested to determine the niml phenotype as described below. Transformed plants that no longer have the niml phenotype identify cosmids that contain a functional NIM1 gene. 3. Test to determine the niml phenotype of the transformants The plants transferred to the soil were grown in a phytotron for about a week after the transfer. 300 μm of acid 2 were applied, 6-dichloroisonicotinic acid as a fine mist to completely cover the plants using a Chromister. After two days, the leaves were harvested for RNA extraction and analysis of PR-1 expression. The plants were then sprayed with parasitic Peronospora (EmWa isolate), and were cultivated under high humidity conditions in a culture chamber at temperatures of 19 ° C / day / 17 ° C at night, and 8-hour light circles / 16 hours of darkness. From 8 to 10 days after the fungal infection, the plants were evaluated and classified as positive or negative for fungal growth. The Ws and niml plants were treated in the same way to serve as controls for each experiment. Total RNA was extracted from the collected tissue using a LiCl / phenol extraction regulator (Verwoerd et al., NAR 17: 2362). RNA samples were tested on an agarose gel with formaldehyde, and stained on GeneScreen Plus membranes (DuPont). The spots were hybridized with a 32 P-labeled PR-1 cDNA probe. The resulting spots were exposed to film to determine which transformants were capable of inducing the expression of PR-1 after treatment with 2,6-dichloroisonicotinic acid. The results are summarized in Table 16. Table 16 shows the complementation of phenotype niml by the cosmid clones. Table 16 Example 7 Sequencing of the NIM1 Gene Region of 9.9 Kb The DNA of BAC04 (25 micrograms, obtained from KeyGene) was the source of DNA used for the analysis of the sequence. This BAC proved to be the clone that completely encompassed the region that complemented the niml mutants. The DNA was randomly cut using a Cold Spring Harbor approach. Briefly, the BAC DNA was cut in a nebulizer to an average molecular weight of about 2 kb. The ends of the cut fragments were repaired using a two step protocol with dNTPS, T4 DNA polymerase, and Klenow fragment (Boehringer). The repaired end DNA was tested on a 1 percent low melting agarose gel, and the region between 1.3 kb and 2.0 kb gel was cut. The DNA was isolated from the gel fragment by means of a freeze-thaw approach. The DNA was then mixed with pBRKanF4 digested with EcoRV, and ligated overnight at 4 ° C. PBRKanF4 is a derivative of pBRKanFl, which was obtained from Kolavi Bhat at Vanderbilt University (Bhat, K.S., Gene 134 (1), 83-87 (1993)). The E. coli strain DH5a was transformed with the ligation mixture, and the transformation mixture was coated on plates containing kanamycin and X-gal. 1,600 KanR colonies white or light blue were selected for plasmid isolation. The individual colonies were collected in 96-well, deep cavity plates (Polyfiltronics, # U508) containing 1.5 milliliters of TB + Kan (50 micrograms / milliliter). The plates were covered and placed on a rotating platform agitator at 37 ° C for 16 hours. The plasmid DNA was isolated using the Wizard Plus 9600 Miniprep system (Promega, # A7000) according to the manufacturer's recommendations. The plasmids were sequenced using the Dye Finisher chemistry (Applied BioSystems PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit - Ready-to-Test Case for Sequencing of the PRISM Dye Terminator Cycle from Applied BioSystem), P / N 402078), and designed primers to sequence both chains of the plasmids. Data were collected on ABI 377 DNA sequencers. Approximately 75 percent of these reactions yielded useful sequence information. The sequences were edited and assembled in contigs using the Sequencer 3.0 (Gene Codes Corporation), Staden gap4 (Roger Staden, e-mail address rs@mrc-lmb.cam.ac.uk), and PHRED (Phil Green, e- mail address phg @ u. ashington, edu). The largest contig (approximately 76 kb) covered the complementary region to an average depth of independent calls / base. A region of approximately 9.9 kb defined by the overlap of the cosmids El and D7 was identified by complementation analysis to contain the niml region. Primers flanking the insertion site of the vector, and specific for the cosmid base structure, were designed using the Oligo 5.0 Primer Analysis Software (Nationa Biosciences, Inc.). The DNA of the cosmids D7 and El was isolated using a modification of the ammonium acetate method (Traynor, P.L., 1990. Bio Techniques 9 (6): 676). This DNA was sequenced directly using the chemistry of the previous Dye Terminator. The sequence obtained allowed the determination of the end points of the complementary region. A truncated version of the BamHI-EcoRV fragment was also constructed, resulting in a construct that contains nothing of the "gene 3" region (Figure 13). The following approach was necessary, due to the presence of HindIII sites in the Bam-Spe region of DNA. The BamHI-EcoRV construct was completely digested with Spel, then divided into two separate reactions for a double digestion. An aliquot was digested with BamHl, and the other with HindIII. A BamHI-Spel fragment of 2,816 base pairs and a HindIII-Spel fragment of 1,588 base pairs were isolated from agarose gels (QiaQuick gel extraction kit)., and ligated with pSGCGOl digested with BamHl-HindIII. The DH5a was transformed with the ligation mixture. The resulting colonies were selected to determine the correct insertion by digestion with HindIII followed by the preparation of the DNA using Wizard Magic MiniPreps (Promega). A clone containing the correct construction was electro-incorporated in Agrobacterium strain GV3101 for the transformation of Arabidopsis plants. Example 8 Identification of the NIM1 Gene Region by Allele Sequencing Table 17. Genetic segregation of non-inducible immunity mutants Data from Delaney et al. (1995) PNAS 92,6602-6606, b Wild type denotes wild-type strain Ws-0. 1. Genetic Analysis To determine the dominance of the different mutants that exhibited the niml phenotype, the pollen of wild type plants was transferred to the stigmata of niml -1, -2, -3, -4, -5, -6. If the mutation is dominant, then the niml phenotype will be observed in the resulting Fl plants. If the mutation is recessive, then the resulting Fl plants will exhibit a wild-type phenotype. The data presented in Table 17 show that, when niml -1, -2, -3, -4, and -6 are crossed with the wild type, the resulting Fl exhibits the wild-type phenotype. Therefore, these mutations are recessive. In contrast, all progeny Fl wild-type niml-5 X will exhibit the niml phenotype, indicating that this is a dominant mutation. Following the treatment with 2,6-dichloroisonicotinic acid, sporulation of P. parasí tica was not observed in the wild type plants, whereas the Fl plants supported the growth and some sporulation of P. parasí tica. However, the niml phenotype in these plants Fl was less severe than that observed when niml-5 was homozygous. To determine allelism, the pollen of the niml -1 mutant plants resistant to kanamycin was transferred to the stigmata of niml -2, -3, -4, -5, -6. The seeds resulting from the cross were coated on Murashige-Skoog B5 plates containing kanamycin at 25 milligrams / milliliter, to verify the hybrid origin of the seeds. Plants resistant to kanamycin (Fl) were transferred to the soil, and tested for the niml phenotype. Because the progeny Fl of the niml mutant -5 cross with the wild type Ws exhibited a niml phenotype, the niml -5 X nim-1 -1 F2 analysis was also performed. As shown in Table 17, all the resulting Fl plants exhibited the niml-1 phenotype. Therefore, the mutation in niml -2, -3, -4, -5, -6 was not complemented by niml -l; these plants all fall within the same complementation group, and therefore, are allelic. Analysis of the F2 progeny from the nimlS X niml-1 cross also exhibited the niml phenotype, confirming that niml -5 is a niml allele. 2. Sequence analysis and subcloning of the NIM1 region The 9.9 kb region containing the NIM1 region was analyzed for the presence of open reading frames in the six frames using the 3.0 sequencer, and the GCG package. Four regions containing large open reading frames were identified as possible genes (gene regions 1-4). These four regions were amplified by polymerase chain reaction from the wild-type father DNA and six different niml allelic variants. The primers for these amplifications were selected using Oligo 5.0 (National Biosciences, Inc.), and were synthesized by Integrated DNA Technologies, Inc. The polymerase chain reaction products were separated on 1.0 percent agarose gels, and were purified using the QIAQuick Gel Extraction Kit. The purified genomic polymerase chain reaction products were sequenced directly using the primers used for the initial amplification, and with additional primers designed to sequence through any regions not covered by the initial primers. The average coverage for these genetic regions was approximately 3.5 readings / base. The sequences were edited and assembled using the Sequencher 3.0. Specific base changes were identified for different niml alleles only in the region designated as the Gen 2 Region. The listed positions in Table 18 refer to Figure 14, and relate to the upper chain of the 9.9 kb region. provided in Figure 13. The open reading frames from the gene regions described in Figure 13 as 1, 2, 3, and 4, were sequenced, and changes in the different nízml alleles are shown in the table. The changes described are on the upper chain, 5F to 3F, as they would be related to Figure 13. It can be seen that the NIM1 gene was cloned, and that it remains within the Region of gene 2, since there are amino acid changes or alterations of the sequence within the open reading frame within the Gen 2 Region in the six niml alleles. At the same time, at least one of the niml alleles shows no change in the open reading frames within the Regions-of Gen 1, 3, and 4. Therefore, the only gene within the 9.9 kb region that could be NJMl, is the Region of Gen 2, the NIM1 gene. Section Ws of Table 18 indicates changes in the Ws ecotype of Arabidopsis in relation to the Columbia ecotype of Arabidopsis. Figures 13, 14, 15, and all others in which the sequence is shown, refer to the Columbia ecotype of Arabidopsis, which contains the wild type gene in the experiments that were conducted. The changes are listed as amino acid changes in gene 2 or NIM1 region, and are listed as changes in base pairs in the other regions. Figure 13 shows four different panels that describe the cloning of the NJMl gene, and describe the entire 9.9 kb region. Figure 14 is the sequence of the entire 9.9 kb region in the same orientation as described in Figure 13. Figure 15 is the sequence of the specific NIM1 gene region, which is the region of gene 2 indicated in Figure 13; the sequence of Figure 15 contains the NJM1 gene. Figure 15 shows the amino acid sequence in the single letter code, and shows the full length AD? C and the RACE product that was obtained in capital letters in the DNA sequence. Some of the allele mutations that were found are shown above the DNA sequence, and the particular allele of niml that had that change is indicated. The sequence analysis of the region, and the sequencing of different niml alleles (see below), allowed the identification of a cosmid region that contains the niml gene. This region is delineated by a Ba HI-EcoRV restriction fragment of approximately 5.3 kb. The cosmid DNA from D7, and the plasmid DNA from pBlueScriptII (pBSII), were digested with BamHI and with EcoRV (NEB). The 5.3 kb fragment from D7 was isolated from agarose gels, and purified using the QIAquick gel extraction kit (# 28796, Qiagen). The fragment was ligated overnight with the pBSII digested with Bam-EcoRV, and the ligation mixture was transformed into E. coli strain DH5a. The colonies containing the insert were selected, the DNA was isolated, and confirmation was made by digestion with HindIII. The Bam-EcoRV fragment was then designed in a binary vector (pSGCGOl) for transformation into Arabidopsis. 3. Northern analysis of the four regions of the gene. Identical Northern blots were made from RNA samples isolated from the Ws and niml lines treated with water, salicylic acid, BTH, and 2,6-dichloroisonicotinic acid, as described previously (Delaney et al., 1995, PNAS 92, 6602 -6606). These spots were hybridized with polymerase chain reaction products generated from the four regions of the gene identified in the 9.9 kb NIM1 gene region. Only the region of the gene containing the NIM1 gene (Gene 2 region) had a detectable hybridization with the RNA samples, indicating that only the NIM1 region contains a detectable transcribed gene (Figure 16 and Table 18). Table 18 shows the variation of the niml allele sequence.

Table 18 The positions listed in the table refer to Figure 14 which contains the 9.9 kb sequence. All alleles niml-1 to child-6 are strain Ws. Column 0 represents the wild type.

We also showed that the region of gene 2 (Figure 13) contains the functional NIM1 gene, doing additional complementation experiments. A fragment of BamHl / HindIII genomic DNA containing the region of gene 2 was isolated from cosmid D7 and cloned into the binary vector pSGCGO1 containing the gene for kanamycin resistance (Figure 13; Goff). The resulting plasmid was transformed into the Agrobacterium strain GV3101, and the positive colonies on kanamycin were selected. Polymerase chain reaction was used to verify that the selected colony contained the plasmid. The niml -1 plants sensitive to kanamycin infiltrated with this bacterium as described above. The resulting seeds were harvested and planted on GM agar containing 50 micrograms / milliliter of kanamycin. The plants that survived the selection were transferred to the soil, and were tested for complementation. The transformed plants and the Ws and control niml plants were sprayed with 300μm of 2,6-dichloroisonicotinic acid. Two days later, the leaves were harvested for RNA extraction, and PR-1 expression analysis. Then the plants were sprayed with Peronospora parasitica (isolated EmWa), and cultured as described above. Ten days after infection with the fungus, the plants were evaluated and classified as positive or negative for the growth of the fungus. All the fifteen transformed plants, as well as the Ws controls, were negative for the growth of the fungus following the treatment with 2,6-dichloroisonicotinic acid, while the niml controls were positive for the growth of the fungus. The RNA was extracted and analyzed as described above for these control transformants. The Ws controls and the fifteen transformants showed the infection of the PR-1 gene following the treatment with 2,6-dichloroisonicotinic acid, while the niml controls did not show the induction of PR-1 by 2,6-dichloroisonicotinic acid. 4. Isolation of a NIM1 cDNA. An Arabidopsis cDNA library made in the expression vector IYES (Elledge collaborators, 1991, PNAS 88, 1731-1735) was coated, and plaque surveys were performed. The filters were hybridized with a 32 P-labeled polymerase chain reaction product generated from the niml-containing gene region. We identified 14 positives from a selection of approximately 150,000 plates. Each plate was purified, and the plasmid DNA was recovered. The cDNA inserts were digested from the vector using EcoRI, purified on agarose gel, and sequenced. The sequence obtained from the longest cDNA is indicated in Figure 15. To confirm that we had obtained the 5F end of the cDNA, a Gibco BRL 5 'RACE kit was used following the manufacturer's instructions. The resulting RACE products were sequenced, and found to include the additional bases indicated in Figure 15. The transcribed region present in both cDNA clones, and detected in RACE, is shown as the upper case letters of Figure 15. The changes in the alleles are shown above the DNA chain. Capital letters indicate the presence of the sequence in a cDNA clone, or detected after the RACE polymerase chain reaction.

Example 9 Characterization of the NIM1 Gene Multiple sequence alignment was constructed using Clustal V (Higgins, Desmond G, and Paul M. Sharp (1989), Fast and sensitive multiple sequence alignments on a microcomputer, CABIOS 5: 151-153) as part of the DNA Generation Biocomputation software package * (1228 South Park Street, Madison Wisconsin, 53715) for Macintosh (1994). It has been determined that certain regions of the NIM1 protein are homologous in the amino acid sequence up to four different rice cDNA protein products. Homologies were identified using the NJM2 sequence in a search in GenBank BLAST. Comparisons of the regions of homology in NIM1 and rice AD? C products are shown in Figure 19. The NIM1 protein fragments show amino acid sequences of 36 to 48 percent identical with the four rice products.

EXAMPLE 10 Phenotypic Characterization of the Different Alleles niml 1. Analysis of chemical responsivity in niml alleles We analyzed the differences between the different niml alleles in terms of chemical induction of PR gene expression, and resistance to Peronospora parasí tica (see Figures 17 and 18). The mutant plants were treated with chemical inducers, and then assayed for PR gene expression and disease resistance. 2. Plant growth and chemical application Wild-type seeds, and seeds for each of the niml alleles. { niml -1, -2, -3, -4, -5, -6) were seeded in a MetroMix 300 culture medium, covered with a transparent plastic dome, and placed at 4 ° C in the dark for 3 days . After 3 days of treatment at 4 ° C, the plants were moved to a phytotron for two weeks. In about two weeks after planting, the germinated seedlings had produced four true leaves. The plants were then treated with H20, 5mM salicylic acid, 300μM BTH, or 300μM 2,6-dichloroisonicotinic acid. Chemicals were applied as a fine mist to completely cover the seedlings using a Chromister. The control plants in water were returned to the crop phytotron while the chemically treated plants were kept in a separate but identical phytotron. After 3 days, the plants were divided into two groups. One group was harvested for RNA extraction and analysis. The second group was inoculated with P. parasí tica. 3. Inoculation of parasitic Peronospora and analysis The 'EmWa' isolate is the P. parasí tica of P.p. which is compatible with the ecotype Ws. Compatible isolates are those that are capable of causing the disease in a particular host. The 'NoCo' isolate of P. parasí tica is incompatible on Ws, but it is compatible on the Columbia ecotype. Incompatible pathogens are recognized by the potential host, causing a host response that prevents the development of the disease. Three days after the application of the chemical, the plants treated with water and chemically were inoculated with the compatible 'EmWa' isolate. The inoculation of 'NoCo1 was conducted only on plants treated with water. Following the inoculation, the plants were covered with a transparent plastic dome to maintain a high humidity, required for a successful P infection. parasitic, and were placed in a culture chamber with temperatures of 19 ° C day / 17 ° C at night, and cycles of 8 hours of light / 16 hours of darkness. At several points of time after the inoculation, the plants were analyzed microscopically to evaluate the development of the symptom. Under an amplification, the sporulation of the fungus can be observed in the very early stages of the disease development. The percentage of plants / pot showing sporulation at 5 days, 6 days, 7 days, 11 days, and 14 days after inoculation was determined., and the density of sporulation was also recorded. Figure 18 shows the evaluation of the disease of the different niml alleles following the inoculation of P. parasí tica. The most distinctive time points are 5 and 6 days after inoculation. At 5 days after inoculation, niml -4 shows an infection of approximately 80 percent under all induction chemical treatments performed, clearly indicating that this allele / genotype has the most severe susceptibility to disease. Six days after the inoculation, niml, -2, -3, -4, and - 6 show a significant incidence of disease under all chemical induction treatments. However, niml -5 shows less infection than wild-type Ws under all treatments on day 5. Therefore, niml -5 is the most resistant to the disease of the different niml alleles. niml -2 appears intermediate with respect to susceptibility to disease after BTH, but not with the other induction treatments. The expression of the PR-1 gene indicates that niml -4 is the least responsive to all the induction chemicals tested (Figure 17), while niml-5 shows high levels of PR-1 expression in the absence of inducers. These results of the expression of the PR-1 gene are consistent with the evaluation of the disease carried out with P. parasí tica (Figure 18), and indicate that the niml alleles can cause resistance or susceptibility. The samples obtained above were used to analyze the expression of the NJM1 gene (Figure 17). In the wild-type plants the AR? M of NIM1 was present in the untreated control samples. Following treatment with salicylic acid, 2,6-dichloroisonicotinic acid, BTH, or infection with a compatible pathogen, the AR? M of NIM1 accumulated to higher levels. Differences in the abundance of the message of NIM1 (AR? M) were observed in the alleles or l, compared with the wild type. The abundance of AR? M of NIM1 in the untreated mutant plants was lower than that observed in the wild type, with the exception of niml -2 and -5, where the amounts were similar, niml-1, -3 , and -4 had low message levels of NIM1, while nim2-6 had a very low accumulation of AR? m of NIM1. Increases in the AR? M of NIM1 followed by salicylic acid, 2,6-dichloroisonicotinic acid, or BTH, were observed in niml -1, -2, -3, but not in niml -5 or -6. However, this increase was less than that observed in wild-type plants. Following infection with the pathogen, additional bands were observed that hybridized to the NJM1 cDNA probe in both the wild type and the mutants, and the AR? M level of NIM1 was elevated relative to the controls not treated, except in niml -6. Figure 18 shows the evaluation of the disease resistance by means of the evaluation of the infection of the different niml alleles, as well as the plants? AhG at different times after the inoculation with Peronospora parasí tica. WsWT indicates the wild-type parent line Ws, where the niml alleles are found. The different niml alleles are indicated in the table, and the plant? AhG is also indicated. The plant? AhG has already been published previously. (Delaney et al., Science 266, pages 1247-1250 (1994)). The Arabidopsis? AhG is also described in International Publication Number WO 95/19443. The NahG gene is a Pseudomonas putida gene that converts salicylic acid into catechol, thereby eliminating the accumulation of salicylic acid, a component of signal transduction necessary for the systemic resistance acquired in plants. Accordingly, Arabidopsis NahG plants do not exhibit a normal acquired systemic resistance. In addition, they show a much higher susceptibility in general to pathogens. Therefore, NahG plants serve as a kind of universal susceptibility control. In addition, the NahG plants still respond to the chemical inducers of 2,6-dichloroisonicotinic acid and BTH; this is shown in the two lower panels of Figure 17. From Figure 18, it can be seen that the alleles niml-4 and nii? i2-6 seem to be the most severe; this can be observed more easily in the first points of time, described earlier in the results section of this, and from the results stipulated in the EmWa BTH panel, the lower panel, in the figure. In addition, the allele nim2-5 shows the greatest response to both 2,6-dichloroisonicotinic acid and BTH, and therefore, it is the weakest niml allele. NahG plants show a very good response to both 2,6-dichloroisonicotinic acid and BTH, and they look very similar to the n-p-2-5 allele. However, at the later time points, on day 11 of the figure, resistance to induced diseases in the NahG plants begins to fade, and there is a profound difference between 2,6-dichloroisonicotinic acid and BTH , in which the resistance induced by 2,6-dichloroisonicotinic acid fades much faster and more severely than the resistance induced in plants NahG by BTH. In these experiments, it is also seen that 2,6-dichloroiso-nicotinic acid and BTH induced very good resistance in Ws to EmWa, and niml-1, niml-2, and other niml alleles show virtually no response to salicylic acid or 2,6-dichloroiso-nicotinic acid with respect to disease resistance. Figure 18 lists the percentage of plants that are showing sporulation after infection with the EmWa strain of P. parasitica, and each of the bar graphs indicates the number of days after the infection in which the resistance to The diseases. Northern analysis was also performed, analyzing the expression of the acquired systemic resistance gene PR1 on the same samples, as illustrated in Figure 17. Figure 17 shows that the wild-type plant shows a very good response to salicylate, to acid , 6-dichloroisonicotinic, to BTH, and also to the infection by the pathogen, as it is manifested by the better expression of the PR-1 gene. On the other hand, the niml-1 allele shows only a very limited response to all chemical inducers, including the pathogen. The induction by the pathogen is at least several times lower in the niml-1 allele than the wild type. The alleles niml-2, niir-1-3, and niml-6 show a response similar to the allele ni? R-2-1 to the different treatments. However, the niml-4 allele has virtually no expression in its response to any of the inducers used. Basically, all you see is the background level. The niml-5 allele shows a very high background level in relation to the controls with water, and that background level is maintained in all treatments; however, there is limited induction or no induction with chemical inducers. The NahG plants serve as a good control, showing that they are unable to induce PR-1 in the presence of salicylic acid; on the other hand, both 2,6-dichloroisonicotinic acid and BTH both induce a very high level of expression of PR-1. The effect of infection by the pathogen is similar to that of salicylic acid; there is no expression of PR-1 in the NahG plants treated with EmWa. These same RNA samples produced in the induction studies, were also probed with a NIM1 gene, using a full-length cDNA clone already probed. In Figure 16, it can be seen that 2,6-dichloroisonicotinic acid induces the NIM1 gene in the wild-type Ws allele. However, the allele of the niml-1 mutation shows a lower baseline expression of the NJM1 gene, and is not inducible by 2,6-dichloroisoni-cotinic acid. This is similar to what is observed in the niml-3 allele and the niml-6 allele. The niml-2 allele shows approximately normal levels in the untreated sample, and shows an induction similar to that of the wild-type sample, as does the niml-4 allele. The niml-5 allele appears to show a higher baseline expression of the NJM1 gene, and a much stronger expression when induced by chemical inducers. The induction of NIM1 by chemical inducers of resistance and other inducers, is consistent with its role in the defense to the pathogen, and is also additional evidence that we have obtained the correct gene in the 9.9 kb region.UENCES (1. GENERAL INFORMATION: (i) APPLICANT: (A) NAME: Novartis AG (B) STREET: Schwarzwaldallee 215 (C) CITY: Basel (E) COUNTRY: Switzerland (F) POSTAL CODE: 4002 (G) TELEPHONE: +41 61 69 11 11 ( H) TELEFAX: +41 61 696 79 76 (I) TELEX: 962 991 (ii) TITLE OF THE INVENTION: GEN THAT CONFIRMS RESISTANCE TO THE DISEASES IN THE PLANTS, AND USES OF THE SAME. (iii) SEQUENCE NUMBER: 11 (v) COMPUTER LEGIBLE FORM: (A) TYPE OF MEDIA: Flexible disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIn Relay # 1.0, Version # 1.30 (2) INFORMATION FOR SEQ ID NO: l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 9919 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1 TGATCATGAA TTGCGTGTAG GGTTGTG? TT TAAAGATAGG GATGAGCTGA AGAAGGCGGT 60 GGACTGGTGT TCCATTAGAG GGCAGCAAAA GTGTGTAGTA CAAGAGATTG AGAAGGACGA 120 GTATACGTTT AAATGCATCA GATGGAAATG CAATTGGTCG CGTCGGGCAG ATTGAATAGA 180 AGAACATGGA CTTGTTAAGA TAACTAAGTG TAGTTGGTCC ACATACTTGT TGTTCTATTA 240 AGCCGGAAAA CTTCAACTTG TAATTTGCAG CAGAAGAGAT TGAGTGTCTG ATCAGGGTAC 300 AACCCACTCT AACAGCAGAG TTGAAAAGTT TGGTGACATG CTTAAAACTT CAAAGCTGCG 360 GGCAGCAGAA CAGGAAGTAA TCAAAGATCA GAGTTTCAGA GTATTGCCTA AACTAATTGG 420 CTGCATTTCA CTCATCTAAT GGGCTACTTG TGGACTGCAA TATGAGCTTT TCCCTAATCC 480 TGAATTTGCA TCCTTCGGTG GCGCGTTTTG GGCGTTTCCA CAGTCCATTG AAGGGTTTCA 540 ACACTGTAGA CCTCTGATCA TAGTGGATTC AAAAGACTTG AACGGCAAGT ACCCTATGAA 600 ATTGATGATT TCCTCAGGAC TCGACGCTGA TGATTGCTTT TTCCCGCTTG CCTTTCCGCT 660 TACCAAAGAA GTGTCCACTG ATAGTTGGCG TTGGTTTCTC ACTAATATCA GAGAGAAGGT 720 AACACAAAGG AAAGACGTTT GCCTCGTCTC CAGTCCTCAC CCGGACATAG TTGCTGTTAT 780 TAACGAACCC GGATCACTGT GGCAAGAACC TTGGGTCTAT CACAGGTTCT GTCTGGATTG 840 TTTTTTGCTTA CAATTCCATG ATATTTTTGG AGACTACAAC CTGGTGAGCC TTGTGAAGCA 900 GGCTGGATCC ACAAGTCAGA AGGAAGAATT TGATTCCTAC ATAAAGGACA TCAAAAAGAA 960 GGACTCAGAA GCTCGGAAAT GGTTAGCCCA ATTCCCTCAA AATCAGTGGG CTCTGGCTCA 1020 TGACCAGTGG TCGGAGATAT GGAGTCATGA CGATAGAAAC AGAAGATTTG AGGGCAATTT 1080 GTGAAAGCTT TCAGTCTCTT GGTCTATCAG TGACAGCG? Á C3CACCTGCA CATGTGGGAA 1140 1 1 « GTTTCAATCG ÁAGAAGTTTC CATGTATGCA CCCAGAAATG GTGCAAAGGA TTGTTAACTT 1200 GTGTCATTCA CAAATGTTGG ATGCAATGGA GCTGACTAGG AGAATGCACC TTACACGCCC 1260 ACTCAGTGTT CTCTTATCTC TAGACCTGAA ACTAACTTGC TGTGTAATTC GAGTTACAAA 1320 AGGTTAAAGG AAGAATTAGG AAGATACATA TAACATGAAT GTTGCCAGAA GTTCAGGGAA 1380 CTTGAATATT CTTTTGGTTC TTGGTGGAAA ATATCCAACA GATGAACAAT TTGACATTAT 1440 TTCACACTTT GATTCTAGCA ACTCTGTAAC ACCATCATGG GTTATTGTTG ATGTACATAA 1500 ATATATATTA CAAATCTGTA TACCATTGGT TCAAATTGTT ACAACATTTG TTTGAAGCAC 1560 ACCTGCAGCA ATAATACACA GGATGCAAAA CGAAGAGCGA AACTATATGA CGCCAACGAT 1620 AGACATAAAC AGTTACAGTC ATCATGAAAA CAGAATTATA TGGTACAGCA AAAATTACAC 1680 TAAGAGGCAA GAGTCTCACC GACGACGATG AGAGAGTTTA CGGTTAGACC TCTTTCCACC 1740 GGTTGATTTC GATGTGGAAG AAGTCGAATC TGTCAGGGAC GAATTTCCTA ATTCCAAATT 1800 GTCCTCACTA AAGGCCTTCT TTAGTGTCTC TTGTATTTCC ATGTACCTTT GCTTCTTTTG 1860 TAGTCGTTTC TCAGCAGTGT CGTCTTCTCC GCAAGCCAGT TGAGTCAAGT CCTCACAGTT 1920 CATAATCTGG TCGAGCACTG CCGAACAGCG CGGGAAGAAT CGTTTCCCGA GTTCCACTGA 1980 TGATAAAAAA AACAAGGTCA GACAGCAAGT AACAAAACCA TGTTTAAAGA TCATTTAGTT 2040 TTGTTTTTTG TGATAAGGAG TCCGA.TGAAG TGGGTGAGAA TCCATACCGG TTTTAGAAAG 2100 CGCTTTTAGT CTACTTTGAT GCTCTTCTAG GATTCTGAAA GGTGCTATCT TTACACCCGG 2160 TGATGTTCTC TTCGTACCAG TGAGACGGTC AGGCTCGAGG CTAGTCACTA TGAACTCACA 2220 TGTTCCCTTC ATTTCGGCGA TCTCCATTGC AGCTTGTGCT TCCGTTGGAA AAAGACGTTG 2280 AGCAAGTGCA ACTAAACAGT GGACGACACA AAGAATAGTT ATCATTAGTT CACTCAGTTT 2340 CCTAATAGAG AGGACATAAA TTTAATTCAA ACATAT AG AATAAGACTT GATAGATACC 2400 TCTATTTTCA AGATCGAGCA GCGTCATCTT CAATTCATCG GCCGCCACTG CAAAAGAGGG 2460 AGGAACATCT CTAGGAATTT GTTCTCGTTT GTCTTCTTGC TCTAGTATTT CTACACATAG_2520_AGAGAATGCT TGCATTGCTC CGGGATATTA TTACATTCAA CCGCCATAGT 2580 GGCTTGTTTT GCGATCATGA GTGCGGTTCT ACCTTCCAAA GTTGCTTCTG ATGCACTTGC 2640 ACCTTTTTCC AATAGAGATA GTATCAATTG TGGCTCCTTC CGCATCGCAG CAACATGAAG 2700 CACCGTATAT CCCCTCGGAT TCCTATGGTT GACATCGGCA AGATCAAGTT TTAAAAGATC 2760 TGTTGCGGTC TTCACATTGC AATATGCAAC AGCGAAATGA AGAGCACACG CATCATCTAG_2820_ATTGGTGTGA TCCTCTTTCA AAAGCAACTT GACTAACTCA ATATCATCCG AGTCAAGTGC 2880 CTTATGTACA TTCGAGACAT GTTTCTTTAC TTTAGGTACC TCCAAACCAA GCTCTTTACG 2940 TCTATCAATT ATCTCTTTAA CAAGCTCTTC CGGCAATGAC TTTTCAAGAC TAACCATATC 3000 TACATTAGAC TTGACAATAA TCTCTTTACA TCTATCCAAT AGCTTCATAC AAGCTTTACC 3060 ACATATATTA GCAAGCTTGA GTATAACCAA TGTGTCCTCT ATAACAACTT TGTCTACAAC 3120 GTCCAATAAG TGCCTCTGAA ATACAAATAC AAGTACTCAA GTAAGAACAT ATTCATGAAT 3180 GTGTAACCAT AGCTTAATGC AGATGGTGTT TTACCTGATA GAGAGTAATT AATTCAGGGA 3240 TCTTGAAGAT GAAAGCCAAA TAGAGAACCT CCAACATGAA ATCCACCGCC GGCCGGCAAG 3300 CCACGTGGCA GCAATTCTCG TCTGCGCATT CAGAAACTCC TTTAGGCGGC GGTCTCACTC 3360 TGCTGCTGTA AACATAAGCC AAAACAGTCA CAACCGAATC GAAACCGACT TCGTAATCCT 3420 TGGCAATCTC CTTAAGCTCG AGCTTCACGG- CGGCGGTGTT GTTGGAGTCT TTCTCCTTCT 3480 TAGCGGCGGC TAAAGCGCTC TTGAAGAAAG AGCTTCTCGC TGACAAAACG CACCGGTGGA 3540 AAGAAACTTC CCGGCCGTCG GAGAGAACAA GCTTAGCGTC GCTGTAGAAA TCATCCGGCG 3600 AGTCAAAGAC GGATTCGAAG CTGTTGGAGA GCAATTGCAG AGCAGATACA TCAGGTCCGG 3660 TGAGTACTTG TTCGGCGGCC AGATAAACAA TAGAGGAGTC GGTGTTATCG GTAGCGACGA 3720 AACTAGTGCT GCTGATTTCA TAAGAATCGG CGAATCCATC AATGGTGGTG TCCATCAACA 3780 GGTTCCGATG AATTGAAATT CACAAATTAA AGAGATCTCT GCTAATCAAC GAAGAGACCT 3840 TATCAACTGG ATTTGGTTAA AGATCGAAGA TAACCATTGA CGAGCAGAGC CAAGTCAAGT 3900 CAACGAGAGT GGTGGTGAGA TATGAAGAAG CATCCTCGTC CCACGGTTTA CATTTCACCA 3960 AAACCGGTAA ATTTCCAGGA AAGGAATCTT TGTCAGAGAT CTTTTTTAAA AAGATATAAC 4020 AGGAAGCTAA ACCGGTTCGG GTTATAAATG TTAGTATTTA TACCGGAGAC ATTTTGTGTT 4080 GCTAATTTTT GTATATGAGA AGTTCAATCC GGTTCGGTAA GCCCCTGAAC CAAACTAGAT 4140 TTGGAGATGA TATAAATATA TAAAATTTAT TTTTCATCCG GTTCGTTATT TTCATATAAA 4200 TATATAAATA TTATTTTTTA AATTTAAGAA TTAGATTTAC ATGTGAAAGT TACATTTCTG 4260 TTTATTTTCT TTGAAGTAAA ATGATAAAGG GAACGTATAT TAAGTTTCAT GCTTTATTCA 4320 CATAAGTTTT GTAATGTATA TTATATTTTT CGTTTATTGA AAAAGTAATT TTCAGTGTTC 4380 AGCATGTTTA CACTATAATT AAATCAAGTC GAATATTTCC TGGAACTATT CTCCTTGTTC 4440 TATAGCAAAT GAAAACGCTC TTCACAACAA AATCAT ATA GATATAGGAA TAAATTACAT 4500 TAAAAACATG AAAGTCATAA TGAATATATT TTTTTAATTA GGATTTGATT TAAAAACAAT 4560 TATTGTATAC ATATAAAAGA CTTCTTTAGT TATTTGCCTT CAACTTCTCG TTCTGAATCA 4620 TGCGATAAAT CAGCTTTTTC AATAACTACG ACGTAAAAGC AAATTCATAA CACGTCTAAA 4680 CAAATTTGGC TCATCCTTCA CTTGATTGGT GTTTTCCGGA CTCGATGTTG CTGGAAACTG 4740 AGAAGAAGAA GGAATCTGCA TAATCACCTC TTGGTTCCTC ACCGGTAGAC TCATTTTGTT 4800 GGATCGAAAA CGATCGAGAT CAGAAAATGA AAAGATAGGT TAAAGATGCC TATGAATACA 4860 ACAACGTAAG ATTATGTTGA ATAAACAGAG TACTTTATAT AGGAGTTATA ATAAGGTAAA 4920 TAAATTATTG CTTTCCGCGT TTTTTACTTT TGTATTTCTT AAATGATAAG TTAAATTAGG 4980 ATAAGATTTG TATGATTTTA AGTAAATTTA CAATAACTCT CTATAACTCA ATAGCATCAC 5040 ATATTTAATT AATTTTACTA ATTATCTTTT GAACAATTTT ATGAAATAGT TTTCTTTTAA 5100 TTAATTTTTT AAAATGATAT ATTATAAAAT TTAATTGAAT CAATCTGATA TAATTTTTTT 5160 ATCTTCTACC ATCTATTATA GTTGATAAAT ATTGTGATAA ACTTTAGATA AACACCCAAT 5220 TGCCAAATAT TTAATAAATT TTGTGTACCA TGCGTTTTTT TTGGAGAATA TATATACGTG 5280 GACAGCATAC CGTACATATA TTGTATAAAA GCTTATAAAA CATAGATACG GGTTATATTG 5340 GTAAGCTATA AATATATGTA AACAATAGTA AGATATTACG TGTTGTGTCT AAATATGTGT 5400 TGCTTTAGAT ATTATGTATA TCTAATATAT TAAAATATCT TTTATTAACT AATATATTAT 5460 TTAAGAGAGA AAATTGGGAC ACTATTTTCT ATACAGTAAC TGTTTTCAAC TATAAACAGG 5520 AACCCTTGAT ATAATAAAAT AACTAGCCAA AAAATCAGAT TAAATATTCA TAAAACAATG 5580 TTTGGTATTA TTACATAAAC CTAAGAAACA AAATTCAATA TTCCTTTTTA CCTTATAAAA 5640 AAC ATTAAA CATCACTAGA TA ATT ATG CCCCACAATG AGCGAGCCAA TTGAGACTTG 5700 AGACTTGAGA TCCTTGTCAA CTACGTTTGC ATTTGTCGGC CCATTTTTTT TATTTTTTTT 5760 TTAAAGTGTC GGCCCGTTGC TTCTTCCGTT CAGATCAACC CTCTCGTAAT CAGAACAAAA 5820ACGAAAGAAC AATCAGATCC ctcttttttt GCATAAACTA AATTCAACTT 5880 CTCTGCGTTT ATGTTGTAGA GGCAACCACG ATCACTACTA CGAAACAATA CAACGTCGTT 5940 GCTTGGAGTC CACGTAATCA AATCTACTCC AATGCTTTTA ATATCTTTCA CTTTAACCCA 6000 CGACTTTTCA AAACTGCTCT TTAAAACCCA TAACTCGTGA ACATCTTCTT GATCTTTGTT 6060 TGTCCACTGA CGAATAGCAC CTAGCTTCCC TTCGTATCTG ACTAATCCTG AGAAAACATC 6120 AGAGTTCGGA GTATGGAAGA AGGACCAAGT TTCGGTTTTG AGACAAAACC GGATCACATT 6180 GTTGTTCCGT GATATCCAAT GCAAGAACCC CGAAACTTGT ATCGGGTTGG AAAAAATTAA 6240 TCTGTCTGTT TTTGGTAGAC GCAAATTTTC TAATCTCTTC CAGGTAAACG AATCAGAATC 6300 GAAAACTTCG CACATAAAAG TTCTGTGATT CAAATGGTAG ATACCCCGAG ACATACACAT 6360 ACGCCGAGAC TGCGAAAGCC TTTGTATTTT ATACCGGAAA GGGTTCAATC CGATTACCGC 6420 TAAACCCAAT GACATATCCC AACCCTTCAC TTCTGGCTTT GGTATGACCT GATACTGTTT 6480 AGTGGTTGGT TTGAAGACTA TGTATCCACG TGATGGTTTT GTATACTTAA CACAAAGCAA 6540 TATCCCATGA CTTGCATCAC AAGCTTCGAT CTTTATCATT CCGGGTGGCA GAAAGTCGAT 6600 GGAGACTCCA TTGTTTTGTA AATCACTCCT CTCATGGACA AAACTGGTTC GAAGTTCGTG 6660 TCCTTTTACT ATGTAGTGTT GTATGAAGTA TCCCGAAATA CGATTGGTTC TAAGGAGATT 6720 AAGATTGACA AACCATGACT CGTAGCTTCT CTTGTTGCAC TCTTTATTCA GGAGCCTGAA 6780 TTTTCCGATT TTTGACGCCG GAAGATAAGA AAGAAATTCT TGGATCATGT CTTGATTTAT 6840 CACCGGAGAA CTCATGATCC TGTCGGGAAT AAAGAGATGA GCACGATCAC TGAATGAGAA 6900 ATGAAAAAAT CAGGATCGGT AGAGAACAAC TTATGATGAA TAAAGTGTTT ATATATCCTT 6960 TCTTTTTTTTA AGGAAAGTAT CAAAATTTGC CTTTTTCTTC GCTAGTCCTA AAACAAACAA 7020 ATTAACCAAA AGATAAAATC TTTCATGATT AATGTTACTT GTGATACCTT AAGCCAAAAC 7080 TTTATCTTTA GACTTTTAAC CAAATCTACA GTAATTTAAT TGCTAGACTT AGGAAACAAC 7140 TTTTTTTTTTT ACCCAACAAT CTTTGGATTT TAATTGTTTT TTTTTCTACT AATAGATTAA 7200 CAACTCATTA TATAATAATG TTTCTATCAT AATTGACAAT t tttctttt TAATAAACAT 7260 CCAGCTTGTA TAATAATCCA CAAGTCAATT TCACCATTTT GGCCAATTTA TTTTCTTATA 7320 AAAATTAGCA CAAAAAAGAT TATCATTGTT TAGCAGATTT AATTTCTAAT TAACTTACGT 7380 AATTTCCATT TTCCATAGAT TTATCTTTCT TTTTATTTCC TTAGTTATCT TAGTACTTTC 7440 TTAGTTTCCT TAGTAATTTT AAATTTTAAG ATAATATATT GAAATTAAAA GAAGAAAAAA 7500 AACTCTAGTT ATACTTTTGT TAAATGTTTC ATCACACTAA CTAATAATTT TTTTTAGTTA 7560 AATTACAATA TATAAACACT GAAGAAAGTT TTTGGCCCAC ACTTTTTTTGG GATCAATTAG_7620_TACTATAGTT AGGGGAAGAT TCTGATTTAA AGGATACCAA AAATGACTAG TTAGGACATG 7680 AATGAAAACT TATAATCTCA ATAACATACA TACGTGTTAC TGAACAATAG TAACATCTTA 7740 CGTGTTTTGT CCATATATTT GTTGCTTATA AATATATTCA TATAACAATG TTTGCATTAA 7800 GCTTTTAAGA AGCACAAAAC CATATAACAA AATTAAATAT TCCTATCCCT ACCAAAAAAA 7860 AAAATTAAAT ATTCCTACAG CCTTGTTGAT TATTTTATGC CCTACGTTGA GCCTTGTTGA 7920 CTAGTTTGCA TTTGTCGGTC CATTTCTTCT TCCGTCCAGA TCAACCCTCT CGTAATCAGA 7980 ACAAAAGGGG AAACAAACGT AAGAGGCAAA ATCCTTGTTT GTATGAACTA AGTTTAACTT 8040 CTCTGTGTTT AAGTTGTAGA GGCAAACATG ATCCCAACTA GAAAGCATTA CGACGTCGTT 8100 GCTTGGTATC CACGTAATAT GCTCTACTCC AATGCTTTCA ATATCTTTCA CTTTTTTCCCA 8160 CGACTTTTCA AAACTGCTCT TTAAAACCCA TAATCTGTGA ACATCTTCTT GATTGTTGTT 8220 TATCCAGTGA CG.fATAACAC CTAGCTTCCC TTCGTAGCTG ACTAACTCTG GGAATAAACC 8280 AACGTTTGGA GTATGTAAGA AAGACCAAGT TTCGGTTTTG GGACATAACC GGATCACATT 8340 GTGGTTCCAT GATCTCCAAT GCAAGAACCC TGAAGCTTGT ACCGGGTTTG AAAGAATTAG_8400_ACCGTCTGTT CTCGGTAGAC GCAAATTTTT TAATCTCTTC CACATAAACG AATCGGAATC 8460 AAAAACTTCG CACGCAAAAG TTCTGAGATT CCGAGTCATA CCAGGCGATT TCGAAAGCCT 8520 AAATATTTTA TACCGGAAAG GCTGCAATCC GGTTACCGTT AGACCTAATG ACTTATCACA 8580 ACTCCTCACT TTTGGGTTTG GTATGATCTG ATACTGTTTT GTTGTTGGTT TGCAGACTAT 8640 GTATTCCGGT AT GGTCTTG TATCATTATA ACAAAGCAAT ATCCCATGAC GTGCATCACA 8700 AGCTTTGATC TTTACCTCTC CTTGTGGCAG AAAATCGATG GAGACTCCTT TGTTATCCAA 8760 ATCTCTCCTC TCATGGAAAA AACTGGTATC AAGTTTGTAT CCTCTTTCGT AGCGTTCTAG_8820_GAAGTATCCA GAGATATTGT TGGTTCGATG GAGATTTAGG TTGACAAACC AAGACTCGTA 8880 GCTTCTCTTG TTGCACTCTT TATTGATGAG CCTCAATTTT CCGATTTCGG ACCCCCGAAG 8940 ATAAGAAAGA ACCTCTTGGA TCGTGTCCTG ATTTATCACC GGAGAACTCA TGATCTTATT 9000 GGAAAAAAGA AAGAAAGAGA TGAGCACGAT CAGTGAATGA GATATATAGA AATCAGGATT 9060 GGTAGAGAAC CGACGATGAT GAATATACAA GTGTTTATAA GTATCACAAA TTGCCnTTT 9120CCCAAAACAA GCAAATTAAC CAAAGATAAA ATCTTCATTA ATGTTTTCCT 9180 TTTTCTTCGC CAGTCCCAGA TAAAAATATA TATAAAATAT TTCATTAGGT TACTTGTAGT 9240 ACCTTGAGCC CAAAGTTTCT CTTTTGACTT TTAACCAAAT TAACAGTAAT TTAATAGCTA 9300 GACTTAGAAA ACAACATTTT GTATATATAT TCTTTGACAT CAAAATTCAA CAATCTTTGG 9360 GTTTCTATAG TGTTTTTTTT CTTATTCTAA TAGATTACCA CTCATTATAT CATATACAAA 9420 GTGTTTCCTT TTCAATCAAC ATCCATTTTC TTTAAAAATT AGCAAGTTTG TTCTTATATC 9480 ATCATTCAGC AGATTTCTTA ATTAAACTTA GTGATTTCCA TTTTGCACCT ATATGTTTCT 9540 CTTTCTTAGT TTAG ACTTT AAATTTTCAT ATATATAATT TATTAAAATT AAAAGTAAAA 9600 ACTCCAGTTT AACTTATGTT AAATGTTTCA TCACACTAAA AGAGCATTAA GTAATAAATA 9660 TTTTAGCTTT ATGAAAAAAA ATATCAAATC ACTGAAGACA TTTGTTGGCC TATACTCTAT 9720 TTTTTTATTTG GCCAATTAGT AATAGACTAA TAGTAACTCA TATGATATCT CTCTAATTCT 9780 GGCGAAACGA ATATTCTGAT TCTAAAGATA GTAAAAATGA ATTTTGATGA AGGGAATACT 9840 ATTTCACACA CCTAGAAAGA GTAAGGTAGA AACCTTTTTT TTTTTGGTCA GATTCTTGTA 9900 TCAAGAAGTT CTCATCGAT 9919 (2) INFORMATION FOR SEQ ID NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 5655 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: No (iv) ANTI-SENSE: No (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 2787..3347 (D) OTHER INFORMATION: / product = "first exon of NJMl" (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 3427..4162 (D) OTHER INFORMATION: / product = "second exon of NJMl" (ix) FEATURES: (A) NAME / KEY: exon (B) LOCATION: 4271..4474 (D) OTHER INFORMATION: / product = "third exon of NJMl" (ix) CHARACTERISTICS: (A) NAME / KEY: exon (B) LOCATION: 4586.-4866 (D) OTHER INFORMATION: / product = "NJMl exon fourth" (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: union (2787.-3347, 3427..4162, 4271..4474, 4586..4866) (xi) DESCRITION OF THE SEQUENCE: SEQ ID NO: 2: TGTGATGCAA GTCATGGGAT ATTGCTTTGT GTTAAGTATA CAAAACCATC ACGTGGATAC 60 ATAGTCTTCA AACCAACCAC TAAACAGTAT CAGGTCATAC CAAAGCCAGA AGTGAAGGGT 120 TGGGATATGT CATTGGGTTT AGCGGTAATC GGATTGAAC C7TTCCGGTA TAAAATACAA 180 AGGCTTTCGC AGTCTCGGCG TATGTGTATG TCTCGGGGTA TCTACCATTT GAATCACAGA 240 ACTTTTATGT. GCGAAGTTTT CGATTCTGAT TCGTTTACCT GGAAGAGATT AGAAAATTTG 300 CGTCTACCAA AAACAGACAG ATTAATTTTT TCCAACCCGA TACAAGTTTC GGGGTTCTTG 360 CATTGGATAT CACGGAACAA CAATGTGATC CGGTTTTGTC TCAAAACCGA AACTTGGTCC 420 TTCTTCCATA CTCCGAACTC TGATGTTTTC TCAGGATTAG TCAGATACGA AGGGAAGCTA 480 GGTGCTATTC GTCAGTGGAC AAACAAAGAT CAAGAAGATG TTCACGAGTT ATGGGTTTTA 540 AAGAGCAGTT TTGAAAAGTC GTGGGTTAAA GTGAAAGATA TTAAAAGCAT TGGAGTAGAT 600 TTGATTACGT GGACTCCAAG CAACGACGTT GTATTGTTTC GTAGTAGTGA TCGTGGTTGC 660 CTCTACAACA TAAACGCAGA GAAGTTGAAT TTAGTTTATG CAAAAAAAGA GGGATCTGAT 720 TGTTCTTTCG TTTGTTTTCC GTTTTGTTCT GATTACGAGA GGGTTGATCT GAACGGAAGA 780 AGCAACGGGC CGACACTTTA AAAAAAAAAT AAAAAAAATG GGCCGACAAA TGCAAACGTA 840 GTTGACAAGG ATCTCAAGTC TCAAGTCTCA ATTGGCTCGC TCATTGTGGG GCATAAATAT 900 ATCTAGTGAT GTTTAATTGT TTTTTATAAG GTAAAAAGGA ATATTGAATT TTGTTTCTTA 960 GGTTTATGTA ATAATACCAA ACATTGTTTT ATGAATATTT AATCTGATTT TTTGGCTAGT 1020 TATTT ATTA TATCAAGGGT TCCTGTTTAT AGTTGAAAAC AGTTACTGTA TAGAAAATAG_1080_TGTCCCAATT TTCTCTCTTA AATAATATAT TAGTTAATAA AAGATATTTT AATATATTAG_1140_ATATACATAA TATCTAAAGC AACACATATT TAGACACAAC ACGTAATATC TTACTATTGT 1200 TTACATATAT TTATAGCTTA CCAATATAAC CCGTATCTAT GTTTTATAAG CTTTTATACA 1260 ATATATGTAC GGTATGCTGT CCACGTATAT ATATTCTCCA AAAAAAACGC ATGGTACACA 1320 AAATTTATTA AATATTTGGC AATTGGGTGT TTATCTAAAG TTTATCACAA TATTTATCAA 1380 CTATAATAGA TGGTAGAAGA TAAAAAAATT ATATCAGATT GATTCAATTA AATTTTATAA 1440 TATATCATTT TAAAAAATTA ATTAAAAGAA AACTATTTCA TAAAATTGTT CAAAAGATAA 1500 TTAGTAAAAT TAATTAAATA TGTGATGCTA TTGAGTTATA GAGAGTTATT GTAAATTTAC 1560 TTAAAATCAT ACAAATCTTA TCCTAATTTA ACTTATCATT TAAGAAATAC AAAAGTAAAA 1620 AACGCGGAAA GCAATAATTT ATTTACCTTA TTATAACTCC TATATAAAGT ACTCTGTTTA 1680 TTCAACATAA TCTTACGTTG TTGTATTCAT AGGCATCTTT AACCTATCTT TTCATTTTCT 1740 GATCTCGATC GTTTTCGATC CAACAAAATG AGTCTACCGG TGAGGAACCA AGAGGTGATT 1800 ATGCAGATTC CTTCTTCTTC TCAGTTTCCA GCAACATCGA GTCCGGAAAA CACCAATCAA 1860 GTGAAGGATG AGCCAAATTT GTTTAGACGT GTTATGAATT TGCTTTTACG TCGTAGTTAT 1920 TGAAAAAGCT GATTTATCGC ATGATTCAGA ACGAGAAGTT GAAGGCAAAT AACTAAAGAA 1980 GTCTTTTATA TGTATACAAT AATTGTTTTT AAATCAAATC CTAATTAAAA AAATATATTC 2040 ATTATGACTT TCATGTTTTT AATGTAATTT ATTCCTATAT CTATAATGAT TTTGTTGTGA 2100 AGAGCGTTTT CATTTGCTAT AGAACAAGGA GAATAGTTCC AGGAAATATT CGACTTGATT 2160 TAATTAT GT GTAAACATGC TGAACACTGA AAATTACTTT TTCAATAAAC GAAAAATATA 2220 ATATACATTA CAAAACTTAT GTGAATAAAG CATGAAACTT AATATACGTT CCCTTTATCA 2280 TTTTACTTCA AAGAAAATAA ACAGAAATGT AACTTTCACA TGTAAATCTA ATTCTTAAAT 2340 TTAAAAAATA ATATTTATAT ATTTATATGA AAATAACGAA CCGGATGAAA AATAAATTTT 2400 ATATATTTAT ATCATCTCCA AATCTAGTTT GGTTCAGGGG CTTACCGAAC CGGATTGAAC 2460 TTCTCATATA CAAAAATTAG CAACACAAAA TGTCTCCGGT ATAAATACTA ACATTTATAA 2520 CCCGAACCGG TTTAGCTTCC TGTTATATCT TTTTAAAAAA GATCTCTGAC AAAGATTCCT 2580 TTCCTGGAAA TTTACCGGTT TTGGTGAAAT GTAAACCGTG GGACGAGGAT GCTTCTTCAT 2640 ATCTCACCAC CACTCTCGTT GACTTGACTT GGCTCTGCTC GTCAATGGTT ATCTTCGATC 2700 TTTAACCAAA TCCAGTTGAT AAGGTCTCTT CGTTGATTAG CAGAGATCTC TTTAATTTGT 2760 GAATTTCAAT TCATCGGAAC CTGTTG ATG GAC ACC ACC ATT GAT GGA TTC GCC 2813 Met Asp Thr Thr He Asp Gly Phe Wing 1 5 GAT TCT TAT GAA ATC AGC AGC ACT AGT TTC GTC GCT ACC GAT AAC ACC 2861 Asp Ser Tyr Glu He Ser Ser Thr Ser Phe Val Wing Thr Asp Asn Thr 10 15 20 25 GAC TCC TCT ATT GTT TAT CTG GCC GCC GAA CAA GTA CTC ACC GGA CCT 2909 Asp Ser Ser He Val Tyr Leu Ala Wing Glu Gln Val Leu Thr Gly Pro 30 35 40 GAT GTA TCT GCT CTG CAA TTG CTC TCC AAC AGC TTC GAA TCC GTC TTT 2957 Asp Val Ser Wing Leu Gln Leu Leu Ser Asn Ser Phe Glu Ser Val Phe 45 50 55 GAC TCG CCG GAT GAT TTC TAC AGC GAC GCT AAG CTT GTT CTC TCC GAC 3005 Asp Ser Pro Asp Asp Phe Tyr Ser Asp Ala Lys Leu Val Leu Ser Asp 60 65 70 GGC CGG GAA GTT TCT TTC CAC CGG TGC GTT TTG TCA GCG AGA AGC TCT 3053 Gly Arg Glu Val Ser Phe His Arg Cys Val Leu Ser Ala Arg Ser Ser 75 80 85 TTC TTC AAG AGC GCT TTA GCC GCC GCT AAG AAG GAG AAA GAC TCC AAC 3101 Phe Phe Lys Ser Ala Leu Ala Ala Ala Lys Glu Lys Asp Ser Asn 90 95 100 105 AAC ACC GCC GCC GTG AAG CTC GAG CTT AAG GAG ATT GCC AAG GAT TAC 31 S Asn Thr Wing Wing Val Lys Leu Glu Leu Lys Glu He Wing Lys Asp Tyr 110 115 120 GAA GTC GGT TTC GAT TCG GTT GTG ACT GTT TTG GCT TAT GTT TAC AGC 3197 Glu Val Gly Phe Asp Ser Val Val Thr Val Leu Ala Tyr Val Tyr Ser 125 130 135 AGC AGA GTG AGA CCG CCG CCT AAA GGA GTT TCT GAA TGC GAC GAC GAG 3245 Ser Arg Val Arg Pro Pro Pro Lys Gly Val Ser Glu Cys Wing Asp Glu 140 145 150 AAT TGC TGC CAC GTG GCT TGC CGG CCG GCG GTG GAT TTC ATG TTG GAG 3293 Asn Cys Cys His Val Wing Cys Arg Pro Wing Val Asp Phe Met Leu Glu 155 160 165 GTT CTC TAT TTG GCT TTC ATC TTC AAG ATC CCT GAA TTA ATT ACT CTC 3341 Val Leu Tyr Leu Wing Phe He Phe Lys He Pro Glu Leu He Thr Leu 170 175 180 185 TAT CAG GTAAAACACC ATCTGCATTA AGCTATGGTT ACACATTCAT GAATATGTTC 3397 Tyr Gln TTACTTGAGT ACTTGTATTT GTATTTCAG AGG CAC TTA TTG GAC GTT GTA GAC 3450 Arg His Leu Leu Asp Val Val Asp 190 195 AAA GTT GTT ATA GAG GAC ACA TTG GTT ATA CTC AAG CTT GCT AAT ATA 3498 Lys Val Val He Glu Asp Thr Leu Val He Leu Lys Leu Ala Asn He 200 205 210 TGT GGT AAA GCT TGT ATG AAG CTA TTG GAT AGA TGT AAA GAG ATT ATT 3546 Cys Gly Lys Wing Cys Met Lys Leu Leu Asp Arg Cys Lys Glu He He 215 220 225 GTC AAG TCT AAT GTA ATG GTT AGT CTT GAA AAG TCA TTG CCG GAA 3594 Val Lys Ser Asn Val Asp Mee Val Ser Leu Glu Lys Ser Leu Pro Glu 230 235 240 GAG CTT GTT AAA GAG ATA ATT GAT AGA CGT AAA GAG CTT GGT TTG GAG 3642 Glu Leu Val Lys Glu He He Asp Arg Arg Lys Glu Leu Gly Leu Glu 245 250 255 GTA CC: AAA GTA AAG AAA CAT GTC TCG AAT GTA CAT AAG GCA CTT GAC 3690 Val Pro Lys Val Lys Lys His Val Ser Asn Val His Lys Ala Leu Asp 260 265 270 275 TCG GAT GAT ATT GAG TTA GTC AAG TTG CTT TTG AAA GAG GAT CAC ACC 3738 Ser Asp Asp He Glu Leu Val Lys Leu Leu Leu Lys Glu Asp His Thr 280 285 290 AAT CTA GAT GAT GCG TGT GCT CTT CAT TTC GCT GTT GCA TAT TGC AAT 3786 Asn Leu Asp Asp Ala Cys Ala Leu His Phe Ala Val Ala Tyr Cys Asn 295 300 305 GTG AAG ACC GCA ACA GAT CTT TTA AAA CTT GAT CTT GCC GAT GTC AAC 3834 Val Lys Thr Wing Thr Asp Leu Leu Lys Leu Asp Leu Wing Asp Val Asn 310 315 320 CAT AGG AAT CCG AGG GGA TAT ACG GTG CTT CAT GTT GCT GCG ATG CGG 3882 His Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala Wing Met Arg 325 330 335 AAG GAG CCA CAA TTG ATA CTA TCT CTA TTG GAA AAA GGT GCA AGT GCA 3930 Lys Glu Pro Gln Leu He Leu Ser Leu Leu Glu Lys Gly Ala Ser Wing 340 345 350 355 TCA GAA GCA ACT TTG GAA GGT AGA ACC GCA CTC ATG ATC GCA AAA CAA 3978 Ser Glu Wing Thr Leu Glu Gly Arg Thr Wing Leu Met He Wing Lys Gln 360 365 370 GCC ACT ATG GCG GTT. GAA TGT AAT AAT ATC CCG GAG CA TGC AAG CAT 4026 Wing Thr Met Wing Val Glu Cys Asn Asn He Pro Glu Gln Cys Lys His 375 380 385 TCT CTC AAA GGC CGA CTA TGT GTA GAA ATA CTA GAG CAA GAA GAC AAA 4074 Ser Leu Lys Gly Arg Leu Cys Val Glu He Leu Glu Gln Glu Asp Lys 390 395 400 CGA GAA CAA ATT CCT AGA GAT GTT CCT CCC TCT TTT GCA GTG GCG GCC 4122 Arg Glu Gln He Pro Arg Asp Val Pro Pro Ser Phe Wing Val Wing Wing 405 410 415 GAT GAA TTG AAG ATG ACG CTG CTC GAT CTT GAA AAT AGA G 4162 Asp Glu Leu Lys Met Thr Leu Leu Asp Leu Glu Asn Arg 420 425 430 GTATCTATCA AGTCTTATTT CTTATATGTT TGAATTAAAT TTATGTCCTC TCTATTAGGA 4222 AACTGAGTGA ACTAATGATA ACTATTCTTT GTGTCGTCCA CTGTTTAG TT GCA CTT 4278 Val Ala Leu 435 GCT CA CT CGT CTT TTT CCA ACG GAA GCA CA GCT GCA ATG GAG ATC GCC 4326 Wing Gln Arg Leu Phe Pro Thr Glu Wing Gln Wing Wing Met Glu He Wing 440 445 450 GAA ATG AAG GGA ACA TGT GAG TTC ATA GTG ACT AGC CTC GAG CCT GAC 4374 Glu Met Lys Gly Thr Cys Glu Phe He Val Thr Ser Leu Glu Pro Asp 455 460 465 CGT CTC ACT GGT ACG AAG AGA ACA TCA CCG GGT GTA AAG ATA GCA CCT 4422 Arg Leu Thr Gly Thr Lys Arg Thr Ser Pro Gly Val Lys He Wing Pro 470 475 480 TTC AGA ATC CTA GAA GAG CAT CA AGT AGA CTA AAA GCG CTT TCT AAA 4470 Phe Arg He Leu Glu Glu His Gln Ser Arg Leu Lys Ala Leu Ser Lys 485 490 495 ACC G GTATGGATTC TCACCCACTT CATCGGACTC CTTATCACAA AAAACAAAAC 4524 Thr 500 TAAATGATCT TTAAACATGG TTTTGTTACT TGCTGTCTGA CCTTGTTTTT TTTATCATCA 4584 G TG GAA CTC GGG AAA CGA TTC TTC CCG CGC TGT TCG QCA GTG CTC 4629 Val Giu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser Wing Val Leu 505 510 515 GAC CAG ATT ATG AAC TGT GAG GAC TTG ACT CA CTG GCT TGC GGA GAA 4677 Asp Gln He Met Asn Cys Glu Asp Leu Thr Gln Leu Ala Cys Gly Glu 520 525 530 GAC GAC ACT GCT GAG AAA CGA CTA CAA AAG AAG CA AGG TAC ATG GAA 4725 Asp Asp Thr Ala Glu Lys Arg Leu Gln Lys Lys Gln Arg Tyr Met Glu 535 540 545 ATA CAA GAG ACA CTA AAG AAG GCC TTT AGT GAG GAC AAT TTG GAA TTA 4773 He Gln Glu Thr Leu Lys Lys Wing Phe Ser Glu Asp Asn Leu Glu Leu 550 555 560 GGA AAT TCG TCC CTG ACA GAT TCG ACT TCT TCC ACA TCG AAA TCA ACC 4821 Gly Asn Ser Ser Leu Thr Asp Ser Thr Ser Ser Thr Ser Lys Ser Thr 565 570 575 GGT GGA AAG AGG TCT AAC CGT AAA CTC TCT CAT CGT CGT CGG TGA 4866 Gly Gly Lys Arg Ser Asn Arg Lys Leu Ser His Arg Arg Arg * 580 585 590 GACTCTTGCC TCTTAGTGTA ATTTTTTGCTG TACCATATAA TTCTGTTTTC ATGATGACTG 4926 TAACTGTTTA TGTCTATCGT TGGCGTCATA TAGTTTCGCT CTTCGTTTTG CATCCTGTGT 4986 ATTATTGCTG CAGGTGTGCT TCAAACAAAT GTTGTAACAA TTTGAACCAA TGGTATACAG 5046 ATTTGTAATA TATATTTATG TACATCAACA ATAACCCATG ATGGTGTTAC AGAGTTGCTA 5106 GAATCAAAGT GTGAAATAAT GTCAAATTGT TCATCTGTTG GATATTTTCC ACCAAGAACC 5166 AAAAGAATAT TCAAGTTCCC TGAACTTCTG GCAACATTCA TGTTATATGT ATCTTCCTAA 5226 TTCTTCCTTT AACCTTTTGT AACTCGAATT ACACAGCAAG TTAGTTTCAG GTCTAGAGAT 5286 AAGAGAACAC TGAGTGGGCG TGTAAGGTGC ATTCTCCTAG TCAGCTCCAT TGCATCCAAC 5346 ATTTGTGAAT GACACAAGTT AACAATCCTT TGCACCATTT CTGGGTGCAT ACATGGAAAC 5406 TTCTTCGATT GAAACTTCCC ACATGTGCAG GTGCGTTCGC TGTCACTGAT AGACCAAGAG 5466 ACTGAAAGCT TTCACAAATT GCCCTCAAAT CTTCTGTTTC TATCGTCATG ACTCCATATC 5526 TCCGACCACT GGTCATGAGC CAGAGCCCAC TGATTTTGAG GGAATTGGGC TAACCATTTC 5586 CGAGCTTCTG AGTCCTTCTT TTTGATGTCC TTTATGTAGG AATCAAATTC TTCCTTCTGA 5646 CTTGTGGAT 5655 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 594 amino acids (B) TI PO: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) ) DESCRIPTION OF SEQUENCE: SEQ ID NO: 3: Met Asp Thr Thr He Asp Gly Phe Wing Asp Ser Tyr Glu He Ser Ser 1 5 10 I5 Thr Ser Phe Val Wing Thr Asp Asn Thr Asp Ser Ser He Val Tyr Leu 20 25 30 Ala Ala Glu Gln Val Leu Thr Gly Pro Asp Val Ser Ala Leu Gln Leu 35 40 45 Leu Ser Asn Ser Phe Glu Ser Val Phe Asp Ser Pro Asp Asp Phe Tyr 50 55 60 Being Asp Ala Lys Leu Val Leu Being Asp Gly Arg Glu Val Ser Phe His 65 70 75 80 Arg Cys Val Leu Ser Ala Arg Ser Ser Phe Phe Lys Ser Ala Leu Ala 85 90 95 Ala Ala Lys Lys Glu Lys Asp Ser Asn Asn Thr Ala Ala Val Lys Leu 100 105 110 Glu Leu Lys Glu He Ala Lys Asp Tyr Glu Val Gly Phe Asp Ser Val 115 120 125 Val Thr Val Leu Wing Tyr Val Tyr Ser Ser Arg Val Arg Pro Pro Pro 130 135 140 Lys Gly Val Ser Glu Cys Wing Asp Glu Asn Cys Cys His Val Wing Cys 145 150 155 160 Arg Pro Wing Val Asp Phe Met Leu Glu Val Leu Tyr Leu Wing Phe He 165 170 175 Phe Lys He Pro Glu Leu He Thr Leu Tyr Gln Arg His Leu Leu Asp 180 185 190 Val Val Asp Lys Val Val He Glu Asp Thr Leu Val He Leu Lys Leu 195 200 205 Wing Asn He Cys Gly Lys Wing Cys Met Lys Leu Leu Asp Arg Cys Lys 210 215 220 Glu He He Val Lys Ser Asn Val Asp Met Val Ser Leu Glu Lys Ser 225 230 235 240 Leu Pro Glu Glu Leu Val Lys Glu He He Asp Arg Arg Lys Glu Leu 245 250 255 Gly Leu Glu Val Pro Lys Val Lys Lys His Val As Asn Val His Lys 260 265 270 Wing Leu Asp Ser Asp Asp He Glu Leu Val Lys Leu Leu Leu Lys Glu 275 280 285 Asp His Thr Asn Leu Asp Asp Wing Cys Wing Leu His Phe Wing Val Wing 290 295 300 Tyr Cys Asn Val Lys Thr Wing Thr Asp Leu Leu Lys Leu Asp Leu Wing 305 310 315 320 Asp Val Asn His Arg Asn Pro Arg Gly Tyr Thr Val Leu His Val Ala 325 330 335 Ala Ket Arg Lys Glu Pro Gln Leu He Leu Ser Leu Leu Glu Lys Gly 340 345 350 Wing Being Wing Being Glu Wing Thr Leu Glu Gly Arg Thr Wing Leu Met He 355 360 365 Wing Lys Gln Wing Thr Met Wing Val Glu Cys Asn Asn He Pro Glu Gln 370 375 380 Cys L-ys His Ser Leu Lys Gly Arg Leu Cys Val Glu lie Leu Glu Gln 385 390 395 400 Glu Asp Lys Arg Glu Gln He Pro Arg Asp Val Pro Pro Ser Phe Wing 405 410 415 Val Ala Ala Asp Glu Leu Lys Met Thr Leu Leu Asp Leu Glu Asn Arg 420 425 430 Val Ala Leu Ala Gln Arg Leu Phe Pro Thr Glu Ala Gln Ala Ala Met 435 440 445 Glu He Wing Glu Met Lys Gly Thr Cys Glu Phe He Val Thr Ser Leu 450 455 460 Glu Pro Asp Arg Leu Thr Gly Thr Lys Arg Thr Ser Pro Gly Val Lys 465 470 475 480 He Wing Pro Phe Arg He Leu Glu Glu His Gln Ser Arg Leu Lys Wing 485 490 495 Leu Ser Lys Thr Val Glu Leu Gly Lys Arg Phe Phe Pro Arg Cys Ser 500 505 510 Wing Val Leu Asp Gln He Met Asn Cys Glu Asp Leu Thr Gln Leu Ala 515 520 525 Cys Gly Glu Asp Asp Thr Ala Glu Lys Arg Leu Gln Lys Lys Gln Arg 530 535 5 or Tyr Met Glu He Gln Glu Thr Leu Lys Lys Wing Phe Ser Glu Asp Asn 5 * 5 550 555 560 Leu Glu Leu Gly Asn Be Ser Leu Thr Asp Ser Thr Ser Ser Thr Ser 565 570 575 Lys Ser Thr Gly Gly Lys Arg Ser Asn Axg Lys Leu Ser His Arg Arg 580 585 590 Arg (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TI MOLECULE PO: peptide gone (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4: Arg Arg Met Arg Arg Ala Leu Asp Ala Ala Asp He Glu Leu Val 1 5 10 15 Lys Leu Met Val Met Gly Glu Gly Leu Asp Leu Asp Asp Ala Leu Ala 20 25 30 Val His Tyr Ala Val Gln His Cys Asn 35 40 (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 38 amino acids v (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 5: Pro Thr Gly Lys Thr Ala Leu His Leu Ala Ala Glu Met Val Ser Pro 1 5 10 15 Asp Met Val Ser Val Leu Leu Asp His His Wing Asp Xaa Asn Phe Arg 20 25 30 Thr Xaa Asp Gly Val Thr 35 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant ( ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 6: Arg Arg Met Arg Arg Ala Leu Asp Ala Ala Asp He Glu Leu Val 1 5 10 15 Lys Leu Met Val Met Gly Glu Gly Leu Asp Leu Asp Asp Ala Leu Ala 20 25 30 Val His Tyr Ala Val Gln His Cys Asn 35 40 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant ( ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 7: Arg Arg Pro Asp Ser Lys Thr Ala Leu His Leu Ala Ala Glu Met Val 1 5 10 15 Ser Pro Asp Met Val Ser Val Leu Leu Asp Gln 20 25 (2) INFORMATION FOR SEQ ID NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant ( ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 8: He Arg Arg Met Arg Arg Ala Leu Asp Ala Wing Asp He Glu Leu Val 1 5 10 15 Lys Leu Met Val Met Gly Glu Gly Leu Asp Leu Asp Asp Ala Leu Ala 0 25 30 Valéis Tyr Ala Val Gln His Cys Asn 35 40 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: ( A) LENGTH: 27 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 9: Arg Arg Pro Asp Ser Lys Thr Ala Leu His Leu Ala Ala Glu Met Val 1 5 10 15 Ser Pro Asp Met Val Ser Val Leu Leu Asp Gln 20 25 (2 INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 41 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant (ii) ) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 10: Arg Arg Met Arg Arg Ala Leu Asp Ala Ala Asp He Glu Leu Val 1 5 - 10 15 Lys Leu Met Val Met Gly Glu Gly Leu Asp Leu Asp Asp Ala Leu Ala 20 25 30 Val His Tyr Ala Val Gln His Cys Asn 35 40 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (C) TYPE OF CHAIN: not relevant (D) TOPOLOGY: not relevant ; Ü) TYPE OF MOLECULE: peptide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11: Pro Thr Gly Lys Thr Ala Leu His Leu Ala Wing Glu Met Val Ser Pro i 5 10 15 Asp Met Val

Claims (2)

CLAIMS An isolated DNA molecule comprising a gene NIM1. 2. An isolated DNA molecule according to claim 1, which comprises the nucleotide sequence stipulated in SEQ ID NO: 2. 3. An isolated DNA molecule of about 9.9 kb, which encodes the NIM1 gene product. 4. An isolated DNA molecule according to claim 1, which comprises the nucleotide sequence stipulated in SEQ ID NO: 1. 5. An isolated DNA molecule of claim 1, which encodes the amino acid sequence of the NJM1 gene product stipulated in SEQ ID? O: 2. 6. A molecule of AD? isolated comprising an NJMl mutant gene of claim 1, which is a niml gene. 7. Clone BAC-04, ATCC deposit Number 97543. 8. A chimeric gene comprising an active promoter in a plant operably linked to a heterologous DNA molecule encoding the amino acid sequence of a product jde NIM1 gene. 9. A chimeric gene comprising an active promoter in the plant, operably linked to the heterologous DNA fragment according to claim 3. 10. A chimeric gene comprising an active promoter in a plant, operably linked to a heterologous DNA molecule encoding the amino acid sequence stipulated in SEQ ID N0: 2. 11. A chimeric gene comprising an active promoter in a plant, operably linked to a heterologous DNA molecule, which encodes the amino acid sequence of a niml gene product. 12. A recombinant vector comprising the chimeric gene of any of claims 8 to 11. 13. A recombinant vector according to claim 12, wherein this vector is capable of being stably transformed into a host cell. 14. A recombinant vector according to claim 12, wherein this vector is capable of being stably transformed into a plant, plant seeds, plant tissue, or plant cell. 15. An expression cassette in a plant comprising a chimeric gene of any of claims 8 to 11. 16. An expression cassette in a plant, comprising a chimeric gene of claims 8 to 10. 17. A cassette of expression in a plant comprising a chimeric gene of claim 11. 18. An expression cassette in a plant according to claims 15 to 17, which expresses the chimeric gene in a continuous or constitutive manner. 19. A plant, plant cells, and progeny thereof, comprising the chimeric gene of any of claims 8 to 11. A plant, plant cells, and progeny thereof, comprising the chimaeric gene of any of claims 8 to 10, which have a broad spectrum of disease resistance. 21. A plant, plant cells, and progeny thereof, comprising the chimeric gene of claim 11. 22. A plant, plant cells, and the progeny thereof of claim 19, wherein said plant it is selected from the group consisting of gymnosperms, monocotyledons, and dicotyledons. 23. A plant, plant cells, and the progeny thereof of claim 19, wherein this plant is a crop plant. 24. A plant, plant cells, and the progeny thereof of claim 23, wherein this plant is selected from the group consisting of rice, wheat, barley, rye, corn, potato, carrot, sweet potato, sweet beets, beans, peas, chicory, lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, chayote, pumpkin, zucchini, cucumber, apple, pear, quince , melon, plum, cherry, peach, nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, sorghum, and sugar cane. 25. The use of an isolated DNA molecule according to claim 1, of the gene to confer resistance to diseases in plants. 26. The use of an isolated DNA molecule according to claim 1, and variants thereof, in a screening method for identifying compounds capable of inducing resistance to broad spectrum diseases in plants. 27. The use of a plant phenotype according to claim 17, for identifying an isolated gene fragment that allows the expression of a broad spectrum of disease resistance in plants. 28. The use of an isolated DNA molecule according to any of claims 1 to 5, to confer disease resistance to plant cells, plants, and their progeny. 29. The use of an isolated DNA molecule according to claim 6, to confer a university susceptibility to diseases on plant cells, plants, and their progeny. 30. The use of resistant plants and their progeny according to claim 20, to incorporate the resistance trait in the lines of the plant through its development.

1 ^ 5 SUMMARY The invention relates to the localization and characterization of a gene (designated NIM1), a key component of the path of systemic acquired resistance, and that, in relation to chemical and biological inducers, allows induction of expression of the acquired systemic resistance gene, and resistance to broad spectrum diseases in plants. The invention further relates to transformed with the NIM1 gene plants, as well as methods using the gene to create transgenic plants, and employing gene in a screening assay to obtain compounds capable of inducing disease resistance broad spectrum in plants. * -k * -k -k Molecular Phenotype of Mutant niml PR-5 Figure 2 146 147 recombinants

2. 2 '. 2 1.4 .4 • V1. 9.7 cM -f Figure 4. Genetic map of the NIM region, showing the approximate position of N1M, the positions of the markers, oo the number of recombinants that are identified by each marker, and the genetic distances (cM) between the markers. ? sj.i Uß - .. 1 184 1/1) 4.2 M ß5.t UM.1 CIC12H07 cic o3 i I CIC12.0. CICI0C07 I i I I I I I I I I I I I I I I I I I I I I I. Figure 5. i-O Schematic representation of the Nim flanking YACs with respect to the genetic map and the AFLP markers, below the physical distance is indicated in n x 100 kb. Only the positions of marker W34.2 were determined very precisely, and the other markers can only be placed within a certain interval. CIC12N07 :::::: 1 CtCIZFOt "." '".'. ... -] 0 UO "* 200 300 40D 1 IIIIIIII ll 1.1 1.1 1.1 1.1 III, I, 1.1 II. IIIIII 1.1 II, II 1 I iiii I iiii I iiii 1 iiii I iiii I iiit I iiii 1 iii .I.1-. .I ---.- Figure 6: Positions of the Pl and BAC clones with respect to the flanking AFLP markers and YACs The positions of clones Pl-3 and Pl-4 with with respect to the YACs 10G07 and 7e03 were not determined, in the lower part the physical distance in Kb is indicated. The physical distance and the extension of the overlaps are the best estimates and are not exact values. Ufl -.2 UU-5.1 WJ4.1 CIC12FK 0 100 200 300 00 1 I I I I l l l l.l 1,1.1 l i l i l l l I I I I I I I I I I I I I 1.1 l i l i l i i '' i 'I' i i 'I I' 'I I I t I I I I I I I I I I I I I I I t I I I I I i I I i i i Figure 7: Contig of Pl and extended BAC covering the southern end of YAC CIC12F04 and the flanking markers. Clones Pl-3, m Pl-4, and Pl-9 completely overlapped with Y? Cs 10G07 and 7E03, and were not placed with respect to these YACs. In the lower part, the physical distance in Kb is indicated. The physical distance and the extension of the overlaps are the best estimates, and they are not exact values. ue? .2 vas.t ??. 1 100 200 300 (00 500 00 1, 1 III l. L IIII 'i I' I 'I' I 'I II I I I I I I I -_L l '' '' I '' '' i- I - iiiliiit I iiii I Figure 8: Schematic representation of all identified Pl and CN BAC clones and their relative positions in the Nim region. In the lower part, the physical distance in Kb is indicated. The physical distance and the extension of the overlaps are the best estimates and are not exact values. 6a db 6c 9b 9a 9c Pl-23/24 Pl-21 BAC-05 Pl-17 Pl-22 Pl-l? | BAC-06 B? C-04 20 40 60 00 100 120 140 160 180 200 kb i Iiii i i .1,!, .., 1 '' I '' '' I '' 'i 1' .lll I til 1 II I . or. Figure 9: Integrated genetic and physical fine map of the NIM region. The scale at the bottom is in kb. 155 Figure 13 Figure '14A Niml Length:: 9919 1 tgatcatgaa ttgcgtgtag ggttgtgttt taaagatagg gatgagctga 51 agaaggcggt ggactggtgt. tccattagag ggcagcaaaa gtgtgtagta 101 'caagagattg agaaggacga gtatacgttt aaatgcatea gatggaaatg 151 caattggtcg cgtcgggcag attgaataga agaacatgga cttgttaaga 201 taactaag g tagttggtcc acatacttgt tgttctatta agccggaaaa 251 cttcaacttg taatttgcag cagaagagat tgagtgtctg atcagggtac 301 aacccactct aacagcagag ttgaaaagtt tggtgacatg cttaaaactt 351 caaagctgcg ggcagcagaa caggaagtaa tcaaagatca gagtttcaga 401 gtattgccta aactaattgg ctgcatttca ctcatctaat gggctacttg 451 tggactgcaa tatgagcttt tccctaatcc tgaatttgca tccttcggtg 501 gcgcgttttg ggcgtttcca cagtccattg aagggtttca acactgtaga 551 cctctgatca tagtggattc aaaagaettg aacggcaagt accctatgaa 601 attgatgatt tcctcaggac fccgacgctga tgattgcttt ttcccgcttg 651 cctttccgc taccaaagaa gtgtccactg atagttggcg ttggtttctc 701 actaatatca gagagaaggt aacacaaagg aaagacgttt gcctcgtctc 751 cagtcctcac ccggacatag fctgctgttat taaegaaccc ggatcactgt 801 ggcaagaacc ttgggtctat -cacaggttct gtctggattg tttttgct a 851 caattccatg atatttttgg agactacaac ctggtgagcc ttgtgaagca 901 ggctggatcc acaagtcaga aggaagaatt tgattcctac ataaaggaca 951 tcaaaaagaa ggactcagaa gctcggaaat ggttagccca attccctcaa 1001 aatcag ggg ctctggctca tgaccagtgg tcggagatat ggagtcatga 1051 cgatagaaae agaagatttg agggcaattt gtgaaagctt tcagtctctt 1101 ggtctatcag tgacagegaa cgcacctgca catgtgggaa gtttcaatcg 1151 aagaagtttc catgtatgca cccagaaatg gtgcaaagga ttgttaactt 1201 gtgtcattca caaatgttgg atgcaatgga gctgactagg agaatgcacc 1251 ttacacgccc actcagtgtt ctcttatctc tagacctgaa actaacttgc 1301 tgtgtaattc gagttacaaa aggttaaagg aagaattagg aagatacata 1351 taacatgaat gttgccagaa gttcagggaa cttgaatatt cttttggttc 1401 ttggtggaaa atatccaaca gatgaacaat ttgacattat ttcacacttt 1451 gattctagca actctgtaac accatcatgg gttattgttg atgtacataa 1501 atatatatta caaatctgta fcaccattggt fccaaattgtt acaacatttg 1551 tttgaagcac acctgcagca ataatacaca ggatgcaaaa cgaagagcga 1601 aactatatga cgccaacgat agacataaac agttacagtc atcatgaaaa 1651 cagaattata tggtacagca aaaattacac taagaggcaa gagtctcacc 1701 gacgacgatg agagagttta cggttagacc tctttccacc ggttgatttc 17S1 gatgtggaag aagtcgaatc fcgtcagggac gaatttccta attccaaatt 1801 gtcctcacta aaggccttct ttagtgtctc ttgtatttcc atgtaccttt 1851 gcttcttttg tagtcgtttc tcagcagtgt cgtcttctcc gcaagccagt 1901 tgagtcaagt cctcacagtt cataatctgg fccgagcactg ccgaacagcg 1951 cgggaagaat cgtttcccga gttccactga tgataaaaaa aacaaggtca 2001 gacagcaagt aacaaaacca tgtttaaaga tcatttagtt ttgttttttg 2051 tgataaggag tccgatgaag tgggtgagaa tccataccgg ttttagaaag 2101 cgcttttagt ctactttgat gctcttctag gattctgaaa ggtgctatct 2151 ttacacccgg tgatgttctc ttcgtaccag tgagacggtc aggctcgagg 2201 ctagtcacta tgaactcaca tgttcccttc atttcggcga tctccattgc 2251 agcttgtgct tccgttggaa aaagacgttg agcaagtgca actaaacagt 2301 ggacgacaca aagaatagtt atcattagtt cactcagttt cctaatagag 2351 aggacataaa tttaattcaa acatataaga aataagactt gatagatacc 2401 tctattttca agatcgagca gcgtcatctt caattcatcg gccgccactg 2451 caaaagaggg aggaacatct ctaggaattt gttctcgttt gtcttcttgc 2501 tctagtattt ctacacatag tcggcctttg agagaatgct tgcattgctc 2551 cgggatatta ttacattcaa ccgccatagt ggcttgtttt gcgatcatga 2601 gtgcgg tct accttccaaa girtgcttctg atgcacttgc acctttttcc 2651 aatagagata gtatcaattg tggctccttc cgcatcgcag caacatgaag 2701 caccgtatat cccctcggat tcctatggtt gacatcggca agatcaagtt 2751 ttaaaagatc tgttgcggtc ttcacattgc aatatgcaac agcgaaatga 2801 agagcacacg catcatctag attggtgtga tcctctttca aaagcaactt 2851 gactaactca atatcatccg agtcaagtgc cttatgtaca ttcgagacat 2901 gtttctttac 'tttaggtacc tccaaaccaa gctctttacg tctatcaatt 14B 2951 atctctttaa caagctcttc cggcaatgac ttttcaagac taaccatatc' 3001 ttgacaataa tacattagac tctctttaca 'tctatccaat agcttcatac 3051 aagctttacc acatatatta gcaagcttga gtataaccaa tgtgtcctct 3101 ataacaactt tgtctacaac gtccaataag tgcctctgaa atacaaatac 3151 aagtactcaa gtaagaacat atteatgaat gtgtaaccat agcttaatgc 3201 agatggtgtt ttacctgata gagagtaatt aattcággga tcttgaagat 3251 gaaagccaaá tagagaacct ccaacatgaa atccaccgcc ggccggcaag 3301 ccacgtggca gcaattctcg tctgcgcatt eagaaactce tttaggcggc 3351 ggtctcactc tgctgctgta aacataagcc aaaacagtca caaccgaatc 3401 gaaaccgact tcgtaatcct tggcaatctc cttaagctcg agcttcacgg 3451 cggcggtgtt gttggagtct ttctccttct tagcggcggc taaagcgctc 3501 ttgaagaaag agcttctcgc tgacaaaacg caccggtgga aagaaacttc 3551 ccggccgtcg gagagaacaa gcttagcgtc gctgtagaaa tcatccggcg 3601 agtcaaagac ggattcgaag ctgttggaga gcaattgcag agcagataca 3651 tcaggtccgg tgagtacttg ttcggcggcc agataaacaa tagaggagtc 3701 ggtgttatcg gtagcgacga aactagtgct gctgatttca taagaatcgg 3751 cgaatccatc aatggtggtg tccatcaaca ggttccgatg aattgaaatt 3801 cacaaattaa agagatctct gctaatcaac gaagagacct tatcaactgg 3851 atttggttaa taaccattga agatcgaaga cgagcagagc caagtcaagt 3901 ggtggtgaga caacgagagt tatgaagaag catcctcgtc ccacggttta 3951 aaaccggtaa catttcacca atttccagga aaggaatctt tgtcagagat 4001 cttttttaaa aagatataac aggaagctaa accggttcgg gttataaatg 4051 ttagtattta taccggagac attttgtgtt gctaattttt gtatatgaga 4101 agttcaatcc ggttcggtaa gcccctgaac caaactagat ttggagatga 4151 tataaatata taaaatttat ttttcatccg gttcgttatt ttcatataaa 4201 ttatttttta tatataaata aatttaagaa ttagatttac atgtgaaagt 4251 tacatttctg tttattttct tt gaagtaaa atgataaagg gaacgtatat 4301 taagtttcat gctttattca cataagtttt gtaatgtata ttatattttt 4351 cgtttattga aaaagtaatt ttcagtgttc agcatgttta cactataatt 4401 aaatcaagtc gaatatttcc tggaactatt ctccttgttc tatagcaaat 4451 ttcacaacaa gaaaacgctc aatcattata gatataggaa taaattacat 4501 taaaaacatg aaagtcataa tgaatatatt tttttaatta ggatttgatt 4551 taaaaacaat tattgtatac atataaaaga cttctttagt tatttgcctt 4601 ttctgaatca caacttctcg tgcgataaat cagctttttc- aataactacg 4651 aaattcataa acgtaaaagc cacgtctaaa caaatttggc tcatccttca 4701 cttgattggt gttttccgga ctcgatgttg ctggaaactg agaagaagaa 4751 ggaatctgca taatcacctc ttggttcctc accggtagac tcattttgtt 4801 cgatcgagat ggatcgaaaa cagaaaatga aaagataggt taaagatgcc 4851 tatgaataca acaacgtaag attatgttga ataaacagag tactttatat 4901 ataaggtaaa aggagttata taaattattg ctttccgcgt tttttacttt 4951 tgtatttctt aaatgataag ttaaattagg ataagatttg tatgatttta 5001 caataactct agtaaattta ctataactca atagcatcac atatttaatt 5051 aattttacta attatctttt gaacaatttt atgaaatagt tttcttttaa 5101 tta atttttt aaaatgatat attataaaat ttaattgaat caatctgata 5151 taattttttt atcttctacc atctattata gttgataaat attgtgataa 5201 actttagata aacacccaat tgccaaatat ttaataaatt ttgtg ACEA 5251 tgcgtttttt ttggagaata tatatacgtg gacagcatac cgtacatata 5301 gcttataaaa ttgtataaaa catagatacg ggttatattg gtaagetata 5351 aacaatagta aatatatgta agatattacg tgttgtgtct aaatatgtgt 5401 tgctttagat attatgt ta tctaatatat taaaatatct tttattaact 5451 aatatattat ttaagagaga aáattgggac actattttct atacagtaac 5501 tgttttcaac tataaacagg aacccttgat ataataaaat aactagccaa 5551 aaaatcagat taaatattca taaaacaatg tttggtatta ttacataaac 5601 aaattcaata ctaagaaaca ttccttttta ccttataaaa aacaattaaa 5651 catcactaga tatatttatg ccccacaatg agegagecaa ttgagacttg 5701 tccttgtcaa agacttgaga ctacgtttgc atttgtcggc ccattttttt 5751 tatttttttt ttaaagtgtc ggcccgttgc ttcttccgtt cagatcaacc 5801 cagaacaaaa ctctcgtaat cggaaaacaa acgaaagaac aatcagatec 5851 ctcttttttt gcataaacta aattcaactt ctctgcgttt atgttgtaga 5901 atcactacta ggcaaccacg cgaaacaata caacgtcgt t gcttggagtc Figure 14C 5951 cacgtaatca aatctactcc aatgctttta atatctttca ctttaaccca 6001 cgacttttca aaactgctct ttaaaaccca taactcgtga acatcttctt 6051 gatctttgtt tgtccactga cgaatagcac ctagcttccc ttcgtatctg 6101 actaatcctg agaaaacatc agagttcgga gtatggaaga aggaccaagt 6151 ttcggttttg agacaaaacc ggatcacatt grttgttccgt gatatccaat 6201 gcaagaaccc cgaaacttgt atcgggttgg aaaaaattaa tctgtctgtt 6251 tttggtagac gcaaattttc taatctcttc caggtaaacg aatcagaatc 6301 gaaaacttcg cacataaaag ttctgtgatt caaatggtag ataccccgag 6351 acatacacat acgccgagac tgcgaaagcc tttgtatttt ataccggaaa 6401 gggttcaatc cgattaccgc taaacccaat gacatatccc aaeccttcac 6451 ttctggcttt ggtatgacct gatactgttt agtggttggt ttgaagacta 6501 tgtatccacg tgatggtttt gtatacttaa cacaaagcaa tatcccatga 6551 cttgcatcac aagcttcgat ctttatcatt ccgggtggca gaaagtcgat 6601 ggagactcca ttgttttgta aatcactcct ctcatggaca aaactggttc 6651 gaagttcgtg tccttttact atgtagtgrtt gtatgaagta tcccgaaata 6701 cgattggttc taaggagatt aagattgaca aaccatgact cgtagcttct 6751 cttgttgcac tctttattca ggagcctgaa ttttccgatt tttgacgccg 6801 gaagataaga aagaaattct tggatcatgt cttgatttat caccggagaa 6851 ctcatgatcc tgtcgggaat aaagagatga gcacgatcac tgaatgagaa 6901 atgaaaaaat caggatcggt agagaacaac ttatgatgaa taaagtgttt 6951 atatatcctt tctttgttta aggaaagtat caaaatttgc ctttttcttc 7001 gctagtccta aaacaaacaa attaaccaaa agataaaatc tttcatgatt 7051 aatgttactt gtgatacctt aagccaaaac tttatcttta gacttttaac 7101 caaatctaca gtaatttaat tgctagactt aggaaacaac tttttttttt 7151 acccaacaat ctttggattt taattgtttt tttttctact aatagattaa 7201 caactcatta tataataatg tttctatcat aattgacaat tctttctttt 7251 taataaacat ccagcttgta taataatcca caagtcaatt tcaccatttt 7301 ggccaattta ttttcttata aaaattagca caaaaaagat tatcattgtt 7351 tagcagattt aatttctaat taacttacgt aatttccatt ttccatagat 7401 ttatctttct ttttatttcc ttagttatct tagtactttc ttagtttcct 7451 tagtaatttt aaattttaag ataatatatt gaaáttaaaa gaagaaaaaa 7501 aactctagtt atacttttgt taaatgtttc atcacactaa ctaataattt 7551 tttttagtta aattacaata tataaacact gaagaaagtt tttggcccac 7601 acttttttgg gatcaattag tactatagtt aggggaagat tctgatttaa 7651 aggataccaa aaatgactag ttaggacatg aatgaaaact tataatctca 7701 ataacataca tacgtgttac tgaacaatag taacatctta cgtgttttgt 7751 ccatatattt gttgcttata aatatattca tataacaatg tttgcattaa 7801 gcttttaaga agcacaaaac catataacaa aattaaatat tcctatccct 7851 accaaaaaaa aaaattaaat attcctacag ccttgttgat tattttatgc 7901 cctacgttga gccttgttga ctagtttgca tttgtcggtc catttcttct 7951 tccgtccaga tcaaccctct cgtaatcaga acaaaagggg aaacaaacst 8001 aagaggcaaa atccttgttt gtatgaacta agtttaactt ctctgtgttt 8051 aagttgtaga ggcaaacatg atcccaacta gaaagcatta cgacgtcgtt 8101 gcttggtatc cacgtaatat gctctactcc aatgctttca atatctttca 8151 ctttttccca cgacttttca aaactgctct ttaaaaccca taatctgtga 8201 acatcttctt gattgttgtt tatccagtga cgaataacac ctagcttccc 8251 ttcgtagctg actaactctg ggaataaacc aacgtttgga gtatgtaaga 8301 aagaccaagt ttcggttttg ggacataacc ggatcacatt gtggttccat 8351 gatctccaat gcaagaaccc tgaagcttgt accgggtttg aaagaattag 8401 accgtctgtt ctcggtagac gcaaattttt taatctctc cacataaacg 8451 aatcggaatc aaaaacttcg cacgcaaaag ttctgagatt ccgagtcata 8501 ccaggcgatt tcgaaagcct aaatatttta taccggaaag gctgcaatcc 8551 ggttaccgtt agacctaatg acttatcaca actcctcact tttgggtttg 8601 gtatgatctg atactgtttt gttgttggtt tgcagactat gtattccggt 8651 attggtcttg tatcattata acaaagcaat atcccatgac gtgcatcaca 8701 agctttgatc tttacc ctc cttgtggcag aaaatcgatg gagactcctt 8751 tgttatccaa atctctcctc catggaaaa aactggtatc aagtttgtat 8801 cctctttcgt agcgttctag gaagtatcca gagatattgt tggttcgatg 8851 gagatttagg ttgacaaacc aagactcgta gcttctcttg ttgcactctt 8901 tattgatgag cctcaatttt ccgatttcgg acccccgaag ataagaaaga Figure 14D 8951 acctcttgga tcgtgtcctg atttatcacc ggagaactca tgatcttatt 9001 aagaaagaga ggaaaaaaga tgagcacgat cagtgaatga gatatataga 9051 aatcaggatt ggtagagaac cgacgatgat gaatatacaa gtgtttataa 9101 gtatcacaaa ttgccttttt cttcgctagt cceaaaacaa gcaaattaac 9151 atetteatta caaagataaa atgttttcct ttttcttcgc cagtcccaga 9201 taaaaatata tataaaatat ttcattaggt tacttgtagt accttgagcc 9251 caaagtttet cttttgaett ttaaccaaat taacagtaat ttaatagcta 9301 gacttagaaa acaacatttt gtatatatat tctttgacat caaaattcaa 9351 caatctttgg gtttctatag tgtttfctttt tagattacca cttattctaa 9401 etcattatat catatacaaa gtgtttcctt ttcaatcaac atccattttc 9451 tttaaaaatt agcaagtttg ttettatate- ateatteage agatttetta 9501 gtgatttcca attaaactta ttttgcacet atatgtttct ctttcttagt 9551 ttagtacttt aaattttcat atatataatt tattaaaatt aaaagtaaaa 9601 aacttatgtt actccagttt aaatgtttca tcacactaaa agageattaa 9651 ttttagcttt gtaataaata atgaaaaaaa actgaagaca atatcaaatc 9701 tttgttggcc tatactetat tttttátttg gccaattagt aatagactaa 9751 tagtaaetca tatgatatct etetaattet ggcgaaacga atattctgat 9801 tetaaagata gtaaaaatga attttgatga atttcacaca agggaatact 9851 gtaaggtaga ectagaaaga aacctttttt tttttggtca gattcttgta 9901 tcaagaagtt etcategat . . . - - - - c gc '. eatgtgr- »cgtctc-ggggtaLCCAccai'C - gaatcacagßoCcrr.taMtg --- ^ gs cgtctßccaaaaaca acagatcaaccttcr-ccßßcccgacßCdiagcttctjaggctcctíicar.rg jatar.c.icp'ja caaca r.gcgatcKggtectgtc tcßaaaccgaBnctcggtc-:? trcctcc r.aetccgaactccgatgttcCCtcaggactagccd atacgaa'jgg? agctaggtgc attC9Ccagc? gAc A --- ac-d3agaccaa9aagat9C - a- ^ agcr.a ogcc c - ^ aga c gtCtc aAaa cc r.gg (] LCaAa c? taaagacatC-i aagv cc 9agr-a -ac Ccgat «-acgtggactccaagcßacgac9trgtactgCf .? - cgta.icagtgatcgt3gr.tgccccr.acacaca u-? cgcagagßagctgaacc - agcccacg c ----- saaaagagagacccg? cr.gcccct rcgttcgccccccßccttgttccga - cacpag? gc? < tcr-gacccg-? acggaagaagcaacgggecgacacct? a aaaaa - aa? t --- M4 - aaaaat9gge - gaCdaacgca? dcgt-? gtCgac - aggaccccaagtCCc - agtct8 a - c - agtga - gtceaactgttttceac --- tgg-: aaaaaggaacactaaatett ttcccca9gr-tcat9CaacBacaccaaac «c?: gttttacgaatactt« ACccsat- cecc9oocAsr cßtc?: caccaC4ccaap »gr.cectflCCtacagctgAA-? caacr.acct] Cacag-uu-acagcgccccaacctCccccctt A aaeaae &eaeeAgetaacaaaagacaeeeLaaeaeaetag * - aea - ac * at-aecCAA * gc ? AacAcaeateugacacaacacgeaar-aeccta - eaeege ecacatacaeceaea atatatar.tcecca ceeaccaAcaeaacccgcaec.taegccecaca * gcctttacacaatAtacqeacggcacgccgeccacgr-aa-MaBacgcatggta - a - aa atecaecaaAeaectgg- »actQggegccc &? Tc ------- aactt ACCAC aeacteaceaaceataaea ?? aeageagaagA ca-- -aa-taatcaeatc - gaecgAtccaaet ?? aecttacaacaeac -ar.tct «maA? aecaar .-- a ---- u gaaaaccatr.ecaeaaaaecgeecaAaagaeaA et4geaaaatta * eeaaaeaegegatgcr.aeepaúteAeagagagceaeegtaaaeteaCec ----- ¡? at - * ta. ^ taagaaaeaCAaaagta AAaacnc ^? -tapcaa --rtaeecaeeeacceedCC --- e --- acecceaeaeaaageacr.cegece -? Cr.caacat * atccea - geer3 cr.gtaeccaraggcatcrr.caacctaececet (v-eeee: cgAececoatc-gcceecsAr-ccaa? aaaeaagcccaccggcgaggaaccaagaggr.gAtc aegcagaCtc? cecei-crececastr.eccanvaAcaec.tagcccggaBaacaceaa -a - gegaaggatg6gccaaatCCgectagacgegetar-gaaet; tgcttctacgcc tagtcac.r.gaaßaagctgatLCaccgcacgacccagaacgagaagcegaaggc aacaacuaagaagcceeccaeacgtaracaac -?????? trgccctt.adaccaa-atccr atcáaaa aeacac.u.catt ?? C ^ Aceetcatgccct aacgtÁateeatucceatatccaeaatgacettgtr.gtga agagc ttttcattt-gccaeao - ACAA pagaa - agtCccagg --- uc »Ctcg« cccgacetaaceac? Dcgca --- acaegctg? 2tcactgaaaaeeaccct ttcaa - aaacg2M-- áCacaatßt ^ < - > ? ecacd? aaceeßtgcgaacaßagcatgaaacteaaLdtacgtCCCCtttaccatcttactecaß --- gaaaataa acagaaata? aceeecaC --- cgc ----- atcr.aaccct '^ a-itcta - dAaaeaatar.eeatatactt? Car.ga? aaacacgaaccggatgaaaaatdaattet ft acatttacar .-- aeccc ^ aacctapt r.ggttca999gccgnccg --Acc ^ qaccg - actr.ctcaca - ac - aaaattagcaacacaaaatgtctccggt aeaaacace-? Aeaetr.ae - aca - gaaccfi? Ctr.agcet CCgeeatatCttcceaaaa - aga - ctctg¿ - ^^ ttost «-3u? CRrAA CC < -ri \ 3 ---- ac-- -A- ^ TTT? A ----- AAATCC-V - Ttc-AT? A «- ^ C SA INA BTH EmWa nim1-2 * »» - | nim 1-4: li nim ß ^ • w ^^ - f W ^ r Ü VH C SA INA BTH EmWa nim1'1 nim1-2 nim1-3 nim 1-4 nim 1-5 nim 1-6 infection with P. parasitica Figure 19 nim 267 V = NVHK-U-DSDDIE-LVTa-¿?? XEDHt ^^ 307 + + + A? -D + D1ELVT L ++ + + I-DDA? + H + AV + CN Rice 1 33 XRRMRR? I? ADADELVT- MVKGEGLD --- ODA ^ 155 nxm 327 PRGYTVt, HV? AMR SPQ --- IllSr, r-EKGAS? SEATLEGRT 26t P 'GT LH + AA P ++ LL + A' + T + fi T Rice 1 215 PTs - OTALHI-- AEMVSPDMVSVLLDH-iAD ^ p ^ lT --X5 T -328 nxm 267 V = VHKW ^ DSODIEI-? VKLLL EDHO ---- DD? CAL-íFAVAYCN 307 • * + -t-ALD * DIELVXL + +. + + I.DD? ? + H +? V + CN Rice 2. 33 IRRlClRALDAADIBLVKLMVMGEGr.DLDD? I-? VHY? VQHCN 155 325 KNPRGYTVLHVAAMRKBPQI-ILSI-I.e 351 pim -R P T LH + AA P ++ LL ++ Rice 2 208 RRPDSKTALHLA? EHVSPDMVSVLLDQ 288 267 VSNVW? ALDSDDIELVX - I LKEDHTN D - ACA HF? V? YCN 307 nirn + + + ALD + -3IELVKL ++ + + LDDA A + H + AV + CN Rice 3 33 IRBMRRALDAADIELVK MVMGEG DLDDALAVHYAVQHCN 155 325 RNPRGY VLHVAAMRKSPQLII-SLLEK 351 nim P T LH + ÁA. P ++ LL ++ "Rice 3 208 RRPDS TALHLAAE« VSPDMVSVLr-DQ 288 nxm 267 VSNVHKAr-DSDDIE VKLLIiKEDHTNLDDACALHFAVAYCN 307 + * + ALD + DIELVKL ++. + + I - DDA A + H + AV + CN Rice 4 33 XR-Í-M-? RA - DAADIELVKI-KVMGEGLDDDDAI-AVHYAVQHC1Í 155 nxm 327 PRGYTVLHVAÁMRKEPQr-r 345 P G V LH + AA P ++ Rice 4 215 PTGKTALHIAAEMVSPDMV 271