MXPA98009882A - Artificial hybridization by erro alignment - Google Patents

Abstract

The present invention relates to an improved nucleic acid hybridization process which utilizes a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a variation in sequence. The modified probe contains at least one artificial misalignment in relation to the control nucleic acid target in addition to any misalignment that arises from the variation of the sequence (as shown in the figures). The invention has direct and advantageous application with numerous existing hybridization methods including applications using, for example, the polymerase chain reaction, parallel specific nucleic acid sequencing methods, and diagnostic hybridization methods.

Description

ARTIFICIAL HYBRID BY ERRONEOUS ALIGNMENT FIELD OF THE INVENTION The present invention relates to the field of molecular biology and more particularly to the field of nucleic acid hybridization.

BACKGROUND OF THE INVENTION A standard method for detecting a variation in a nucleic acid sequence depends on the specific recognition of an oligonucleotide chain of a complementary strand of target nucleic acid strand. When the probe and the target are not identical, the affinity of the two chains with each other is reduced. The reduced affinity is manifested by a decrease in thermal duplex stability which can be conveniently monitored by measuring the melting temperature (denaturation) of the duplex chain (TJ) The difference between the duplex melting temperature (? TJ between, for a Part, a probe that matches perfectly and, on the other hand, with the same probe with a second objective that differs from the first target in a nucleotide, has shown utility for detecting sequence variations in DNA Wallace, BR et al., Nucleic Acids Research 9: 879 (1981) discriminates between REF: 28838 short oligomers that differ on a single base. Subsequently, Conner, B.J. et al., Proceedings of the National Academv of Sciences USA 80: 278 (1983) used Wallace's approach to investigate points of mutation in the ß-globin gene. The thermodynamics underlying this molecular discrimination have been further characterized by Ikuta, S. et al., Nucleic Acids Research 15: 797 (1987), Doktycz, M.J. et al., Journal Bioloaical Chemistry 270: 8439 (1995), Breslauer, KJ, et al., Proceedings of the National Academic of Sciences USA 83: 3746 (1986), McGraw, RA, et al., BioTechnisues 8: 674- 678 (1990). As a result, thermal duplex stability can be predicted with reasonable accuracy based on misalignments in the sequence. The documents mentioned in this paragraph are specifically incorporated herein by reference. Although hybridization can be a useful and powerful technique, it is limited in that the difference in stability between a perfectly aligned duplex and a misaligned duplex, particularly if the misalignment is of only one base, can be very small, what corresponds to a difference in Tm between two of as little as 0.5 degrees. See Tibanyenda, N. et al., Eur. J. Biochem. 139: 19 (1984) and Ebel, S. et al., Biochem. 31: 12083 (1992), both of which are incorporated herein by reference. More importantly, it should be understood that as increases the length of the oligomeric probe, the effect of a misalignment of a single base on total duplex stability decreases. This is an important limitation because it is desirable to increase the length of the probe to increase the specificity of hybridization for single genes and at the same time weakly related genes are excluded. Therefore, the ability to specifically differentiate closely related genes does not coincide with the desire to focus hybridization studies on increasingly narrow regions of the genome. What is desired is a method that improves the ability to differentiate closely related genes by increasing the difference in the fusion temperatures of duplex chains formed between the probe and the target. A universal nucleoside analog, 1- (2'-deoxy-jβ-D-r-ofuranosyl) -3-nitropyrrole, maximizes the leveling interactions and at the same time minimizes hydrogen-binding interactions without sterically altering a strand of duplex DNA. This analogue is described in Nichols et al., "A universal nucleoside for use at ambiguous sites in DNA primers," Nature 369: 492 (1994) and Bergstrom, D.E. et al., "Synthesis, Structure, and Deoxyribonucleic Acid Sequencing with a Universal Nucleoside: 1- (2'-deoxy- /? - D-ribofuranosyl) -3-nitropyrrole," J.A. C.S. 117: 1201 (1995), both of which are incorporated herein by reference. The analog can function as a "wild card" in the base pairing within the nucleic acid duplex chains.

BRIEF DESCRIPTION OF THE INVENTION The present invention is summarized to the extent that an improved method for hybridizing an oligonucleotide probe to a nucleic acid target is provided which improves the ability to differentiate a first nucleic acid target ("control") from a second target of nucleic acid ("variant") that differs from the control target. Accordingly, the present invention, in part, is a hybridization method that utilizes a modified oligonucleotide probe that generally complements but does not completely complement a control nucleic acid target. The probe is not complementary to the control target in that the probe is modified at least in a position different from the position that is known to vary. The modification generates a misalignment that is not complementary between the probe and the target. When the probe is thus artificially modified in a single position, the probe and the control target necessarily differ from each other in at least one position, while the probe and an objective containing the sequence variation will necessarily differ from each other so less in two positions (an artificial misalignment and true misalignment). Here we show that a greater difference in thermal duplex stability is observed between a duplex strand containing two erroneous alignments and a duplex strand that contains only one misalignment (Figure 1), panel B) than that observed between duplexes containing one strand. misalignment versus zero misalignment (figure 1, panel A). Accordingly, the method provides improved ability to discriminate a variant target of a control target after the hybridization reaction. The invention is also a method for determining whether a nucleic acid target in a sample contains a sequence variation of interest. In the method, the modified oligonucleotide probe is hybridized under suitable hybridization conditions to a target nucleic acid that can vary from the target control. An ^ uplex that forms the probe with the variant objective is less thermally stable and has a lower melting temperature (TB) than a duplex formed with the control lens because it contains a true misalignment in addition to the artificial misalignment. The "T" between the two duplexes is appreciably greater than in previous comparisons between perfectly aligned helices and helices with misalignment only in the polymorphic position, which facilitates discrimination of a control objective (or "normal") of a variant objective. The method of the present invention can be used directly in many existing molecular biology applications, as described in greater detail elsewhere herein, with the advantageous benefits of improved specificity and selectivity. An objective of the present invention is to improve the ability to differentiate between target nucleic acids which contain or lack a sequence variation. A further feature of the present invention is that the oligonucleotide hybridization probe and the control target are not complementary to each other in at least one nucleotide position other than the position of the sequence variation. Another feature of the present invention is that the non-complementarity of the probe reduces the stability and the Tm of a duplex containing the probe. An advantage of the present invention is that a larger Tm between duplexes formed with: (a) the modified probe and the control target is observed, and (b) the modified probe and the variant objective than that observed in previous methods that they use duplex chains formed with (c) an unmodified probe and a control target, and (d) the modified probe unmodified and the target variant.

Another advantage of the present invention is that the method provides greater selectivity and specificity in molecular biology processes. Other objects, advantages and features of the present invention will become apparent upon consideration of the following detailed description taken in conjunction with the accompanying drawings.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1A-C shows and compares two modalities of the artificial misalignment hybridization strategy with an existing strategy for detecting single nucleotide polymorphisms. Figure 2 compares the melting temperature of duplex chain containing an objective sequence and a probe having 0, 1, 2 or 3 bases misaligned. Figure 3 compares the duplex chain melting temperatures containing an objective sequence and a probe having an artificial misalignment at various positions along its length. The melting temperature of a duplex chain containing the same target sequence and a perfectly aligned probe is also shown. Figures 4A-C compare the effect of the distance between a true misalignment on the target and a artificial misalignment in the probe. Figures 4A-C also show the effect on? Ta as it varies in position in the zone corresponding to the true misalignment. Figure 5 shows the effect on Tm by varying the distance between artificial misalignments in a probe that contains more than one such misalignment. Figure 6 compares a conventional hybridization method with the artificial misalignment hybridization method of the present invention in an assay to discriminate between alleles strictly related to the locus HLA-DRB human.

DETAILED DESCRIPTION OF THE INVENTION For purposes of this patent application, an "objective nucleic acid" can be a chromosome or any portion thereof or it can be a recombinant nucleic acid molecule such as a plasmid, oligonucleotide or other nucleic acid fragment, and it can naturally occur or be synthetic. The length of the target is not critical with the condition that 'the target is large enough to complement the modified probe, as described elsewhere in this document. The target nucleic acid can be DNA or RNA. When the goal is DNA, it it is understood that the DNA is provided for use in the method in denatured or single-stranded form capable of hybridizing with a single-stranded oligonucleotide probe. Also, in this application, a "sequence variation" or "variant" can include any change in an objective sequence relative to a normal target nucleic acid or control. The difference can be as small as a polymorphism in a single nucleotide, but it can also include two or more unique adjacent or non-adjacent nucleotide changes, as well as more pronounced changes in control which can include insertions, deletions and nucleic acid rearrangements. Such insertions and deletions may be as small as 1 nucleotide, and no upper limit of insertion or deletion size is expected if the oligonucleotide probe or primer is appropriately designed. It will be appreciated that the objective may be a "control" objective only with reference to the different sequences of a "variant" objective. For practical purposes, without a single objectivity has a clinical or laboratory significance in a particular assay and is the one sought for analysis, this objective must remain more stable to the oligonucleotide aligned under selected conditions of hybridization (which includes, mainly salt, temperature and pH conditions). Hybridization conditions must be such that a variant duplex having a thermal stability minor is destabilized in relation to a d plex control because the variant duplex contains a true misalignment between the two chains in addition to the artificial misalignment. Thus, if it is desired to detect a particular target nucleic acid sequence or if it is desired to use a particular sequence corresponding to the oligonucleotide in a subsequent method such as PCR or sequencing, the target containing this sequence should be designated as the "target control". For purposes of that application, a control target is defined as a nucleic acid target that hybridizes more stably with the primer or probe selected under the selected hybridization conditions. Also, in this patent application, the "corresponding" nucleotides are nucleotides in opposite strands that normally form base pairs with each other. An "erroneous alignment" is found in any position where there is no direct correspondence of Watson-Crick base pairs (A / T, G / C, C / G, T / A) between the oligonucleotide and the target in the region of complementarity between the two chains. An artificial misalignment is typically provided at one or more unique nucleotide positions in an oligonucleotide, but may include more extensive changes. A true misalignment in a duplex formed between an oligonucleotide and a variant target can include a substitution, an insertion, a deletion and a nucleic acid rearrangement of oligonucleotides in relation to the target. The substitution can be in one or more positions in the oligonucleotide. In the three panels of Figure 1A-C, the upper chain of a schematic duplex represents an oligonucleotide probe that will or will not form an artificial misalignment when maintained with the present invention. The lower chain represents an objective sequence that is normal (left) or variant in a single nucleotide position (right). The indicated misalignment represents a true misalignment, while the rounded symbol represents an artificial misalignment. Panel A represents a hybridization of allele-specific conventional oligonucleotides which compares the thermal stability of a perfectly matched duplex and a duplex containing true misalignment. Panel B represents an artificial misalignment hybridization strategy of the present invention wherein the oligonucleotide probe includes a unique artificial misalignment, 'purposely introducing so that the differential in thermal duplex stability is determined between the alignment duplex error of a base and the misalignment of a base and the duplex of misalignment of two bases. Panel C shows a second embodiment of the artificial misalignment hybridization strategy wherein more than one artificial misalignment can be introduced into the probe. When the probe contains two positions that will form artificial misalignments, the difference in thermal duplex stability is determined between the misalignment of two bases and an erroneous alignment of three bases. Hybridizations can be performed under standard conditions known in the art to join probes to targets. The conditions used in the examples are suitable, but it should be understood that variations in salt, temperature and pH can affect the strength of hybridization and the thermal stability of any formed duplex. A person usually skilled in the art can modify the hybridization conditions to optimize the present invention to a particular probe and target, for a particular application, as desired, in accordance with existing application protocols. The primer or probe sequences and the hybridization conditions should be determined in accordance with the art-recognized understanding of factors that affect duplex stability in various hybridization techniques. The inventors have determined that it may be easier to differentiate a duplex containing n erroneous alignment from a duplex containing n-l erroneous alignments (Figure 1, panels B and C) compared to the differentiation that is made with a duplex that contains an erroneous alignment from a perfectly aligned duplex (Figure 1, panel A), where n is two or more, and can vary up to 7 or even greater. In the method of the present invention, the ΔTm between such duplexes is generally between 1 ° C and 25 ° C, but may be higher or lower. For better discrimination, the difference is preferably between 5 ° C and 25 ° C, more preferably between 10 ° C and 25 ° C, and much more preferably between 15 ° C and 25 ° C. As a preliminary demonstration of this principle, the Tm of plex chains of 20 units containing 0, 1, 2 or 3 adjacent misalignments were determined by standard methods. The sequences of the probe and the target are shown below the graph in Figure 2. In all the tests shown in Figures 2-5, the absorbance was measured at 260 nanometers on a Hewlett Packard 8452A UV spectrometer equipped with a Peltier block. HP89090A. A temperature ramp speed of 1 ° C per minute was used. All measurements were made in 1.0 M NaCl, 0.1 nM EDTA, 10 mM sodium phosphate, pH 7.0, at a chain concentration of 50 μM. All melting temperatures were determined in triplicate and varied by less than 0.4 degrees. Melting curves show absorbance versus temperature and plotted as the average Tm of each given duplex. The data in Figure 2 is obtained using bases with natural misalignment shown below the graph. Figure 2 shows a higher melting temperature differential (ΔT for misalignment versus two erroneous alignments (ΔTm = 60 ° C - 47 ° C = 13 ° C) compared to a standard perfect alignment versus an erroneous alignment ( Tm = 65 ° C - 61 ° C = 4 ° C.) It can be seen that between natural bases with misalignment, there may be some residual interaction (see Werntges, H. et al., Nucleic Acids Research 14: 3773 (1986) The extent of interaction may vary based on the particular combination of misaligned bases.In addition, the thermal duplex stability may be affected by other variables that include the nature and position of the erroneous alignments in the probes, as well as the context of the sequence of erroneous alignments and the length of the probe To eliminate the effects caused by the nature of the misalignment itself, it is preferred that the nucleotide that will constitute the alignment Artificial error with the target is a non-natural nucleic residue in the probe. For the sake of simplicity, reference is made to an artificial or true "misalignment" in the probe, with compression that erroneous alignments occur in reality only when the modified probe is paired with a target. It is preferred that the artificial misalignment weakly binds to the four naturally occurring A, C, G and T nucleotides, so that a preferential stabilizing effect is not carried out solely by the introduction of the artificial misalignment. Preferred natural or unnatural artificial misalignments, therefore, are preferably universal misalignments. Such universal misalignment may be a modified nucleotide that occurs naturally or an unnatural nucleotide. When a suitable artificial misalignment is incorporated within an oligonucleotide probe, it will form a reasonably stable duplex, which preferably has a Tm in the range of 25-80 ° C. A non-naturally occurring nucleotide, 1- (2'-deoxy-β-D-ribofuranosyl) -3-nitropyrrole (also referred to as "3-nitropyrrole 2'-deoxyribonucleotide" or "3-nitropyrrole") has been identified by Nichols et al., Supra, as a universal nucleotide suitable for use in ambiguous sites in DNA primers. It has been shown that this nucleotide maximizes the stacking interactions while not interrupting the formation of the duplex chain. These same attributes make this molecule a desirable universal misalignment nucleotide for use in alignment hybridization probes wrong artificial. However, for short probe lengths, a duplex containing an erroneous artificial alignment of 3-nitropyrrole may be too unstable to form under hybridization conditions of normal room temperature. Such dramatic destabilization can be resolved by increasing the length of the oligonucleotide, which will necessarily produce a probe or primer that has greater specificity. Therefore, the destabilization that would otherwise have been an inconvenience to the method, can actually work providing a great advantage to the user. By preparing a probe of suitable length, one can balance the desire for high specificity with a desire to carry out a reaction at a convenient hybridization temperature. Therefore, improved discrimination can be obtained even in cases where the introduction of an artificial misalignment initially would appear to impede the formation of the duplex chain. In view of this description, a person usually familiar with the art will possess sufficient information to design a suitable probe or initiator, suitable for a given application and having the advantages of the present invention. In addition, commercially available computer programs can help determine a suitable oligonucleotide sequence, as well as suitable hybridization conditions for a reaction using such oligonucleotide. Since the technique recognizes that it is not possible to completely predict the behavior of probes and targets in a hybridization reaction under defined conditions, empirical tests of proposed oligonucleotides and conditions are known by those familiar in the art to constitute an aspect of the probe or design. of initiator and such proof, therefore, is not considered undue experimentation. The incorporation of an artificial misalignment in another manner should not affect the requirements of a probe or primer, although it may be desirable to adjust the hybridization conditions to improve discrimination, as indicated herein. Other pyrrole deoxyribonucleotides substituted with nitro and cyano may have similar strong stacking properties that would otherwise decrease the role of hydrogen bonding in a base pairing specificity. It may be desirable, in certain cases, to look for other universal base analogues which provide a higher plex stability, such as the 5-nitroindole derivatives described by Loakes, D. and D.M. Brown, Nucleic Acids Research 22: 4039 (1994), incorporated herein by reference. Alternatively, other N-substituted or cyano-substituted ones may also be suitable artificial misalignment nucleotides. In addition, a nucleotide to basic residue may be suitable. Unless indicated otherwise Thus, all subsequent work described in this application uses 3-nitropyrrole. Next, guidance is given regarding the effect of other variables on the stability in the duplex chain in the hybridization of artificial misalignment. Additional guidance is also provided in Nichols et al., Supra, and Bergstrom et al., Supra, both of which are incorporated herein by reference. Regarding the considerable extent to which a universal analog can be incorporated into a suitable probe.

Effect of wrong alignment position Figure 3 shows that the thermal duplex stability varies based on the position of the wrong alignment of 3-nitropyrrole unique in a probe. The Tm of a stable duplex between a target sequence (5 '-AGATACTTCTATAACCAAGAG-3') and a fully complementary probe along its entire length of 15 bases long from about 52 ° C under the conditions used. When the artificial misalignment is at or near the center of the oligonucleotide probe, the probe / target duplex chain is maximally destabilized (for example, the Tm decreases -17 ° C in relation to the perfect alignment when the wrong alignment is between the fifth and ninth positions of the probe). When the artificial misalignment is closer to either end, the duplex chain is destabilized to a lesser degree (for example, the Tm decreases 6 ° C or 7 ° C in relation to the perfect alignment when the misalignment is in the terminal nucleotide of the probe).

Effect of the distance between the true and artificial misalignments In Figures 4A-C, nucleotide 3-nitropyrrole is systematically introduced into a position in probe 1 to 6 bases away from a true misalignment. The position of the true misalignment is varied to correspond to position 8, 6 or 4 of an oligonucleotide probe of 15 units (Figure 4A, 4B, 4C, respectively). Below each graph, in each case, the control objective, the variant objective, and the six probe variants for each case are shown. For comparison, Figures 4A-C also show the? Tm between d plex containing 1 and 0 erroneous alignments (as in Figure 1, panel A), which is generally smaller than the? Tm in the duplexes that involve alignments artificial errors. The greater the? Tm observed when a single artificial misalignment is introduced three or four bases away from the true misalignment, without Consider whether the true misalignment is located in position 8, 6 or 4 of the 15 unit probe. Figures 4A-C directly illustrate that the artificial misalignment hybridization method provides superior discrimination of single nucleotide polymorphisms compared to standard hybridization methods because a greater difference in thermal duplex stability is observed than in the methods of standard hybridization. Furthermore, this series of results demonstrates that the effect of artificial misalignment on the hybridization stability depends strongly on the relative position of the true and artificial misalignments, where the greatest destabilization occurs consistently when three to four bases separate the two. In such optimal separation, the ΔTm are increased by 3 ° C to 8 ° C, which corresponds in each case to approximately 50% discrimination gain. Figures 4A-C, taken together, also show that as the true misalignment is closer to one end of the probe, the maximum differential melting temperature decreases from about 15 ° C or 16 ° C to less than 10 ° C, so the improvement provided by the present method is reduced to some extent. This observation corresponds to that shown in Figure 2, and a preference is suggested for using a probe where the true misalignment corresponds to the center, or near the center of the probe. In each case, however, improvement will still be observed with respect to previous methods. Similar experiments were carried out using misalignments of natural unmodified bases, however, mixed results are obtained. In some cases, adding a second misalignment significantly destabilizes the duplex chains, and the? Tm between a misalignment of two bases and a misalignment of a base (Figure 1, panel B) is much greater than the? Tm between the misalignment of a base and a perfectly aligned duplex chain (figure 1, panel A). However, in other cases, adding a second misalignment only slightly destabilizes the duplex chain and there is virtually no difference in the observed Tm. In contrast to the ambiguities inherent in misalignments of natural bases, the use of a base that does not occur naturally in the probe consistently improves the ability to discriminate changes from a single base.

Effect of providing and placing more than one artificial misalignment When a probe contains more than one artificial misalignment, improved discrimination is always observed in relation to the conventional method. The improvement it is observed regardless of whether the erroneous alignments are introduced, although a clear preference is observed to separate the erroneous alignments so that they are separated by a complete turn of the helix, and therefore are in relatively close proximity to each other. A separation of 10 bases between the positions of artificial misalignment is preferred. The noticeable decrease observed in thermostability at this separation distance suggests a physical or chemical interaction between the misalignment groups. For example, Figure 5 shows that the Tm abruptly decreases to the lowest point (approximately 44 ° C), when two 3-nitropyrrole nucleotides are placed symmetrically around the center of an oligonucleotide of 21 units and if they are separated by ten bases. At larger separations, the Tm increases slowly with increasing separation. The d plex Tm formed between the target and a probe containing the various pairs of artificial misalignments shown in Figure 5 varies from about 56 ° C to about 44 ° C, based on the distance between the residues in misalignment. Probably, to a lesser but still significant extent, effects can be observed if the erroneous alignments are closer to one end of the probe, as has been shown for a single erroneous alignment, supra, Figures 3 and 4A-C. For Comparison, Figure 5 shows a Tm of approximately 68 ° C for a duplex formed with the objective of 21 long bases indicated and a probe that is perfectly aligned with the target. Table 1 presents the differential of melting temperatures observed in conventional hybridization and hybridization of artificial misalignment when the probes contain two nucleotides of 3-nitropyrrole. The term "Z" represents a 3-nitropyrrole in the indicated position. The polymorphic phase in each objective is underlined.

TABLE 1 Distance between probe sequence? Tm (° C) 3-nitropyrrol Objective A * Objective B * N / A 5 'CTCTTGAGAGAGCTAGTATCT 3' 2.0 2.2 8 5'CTCTTGZGAGAGCT GTATCT 3 '3.3 3.8 10 5' CTCTT £ AGAGAGCTA £ TATCT 3 ' 6.4 7.4 12 5 'CTCTZGAGAGAGCTAGZATCT 3' 3.1 3.9"OBJECTIVE A: AGATACTAGC £ CTCTCAAGAG" OBJECTIVE B: AGATACTAGCTCQCTCAAGAG PERFECTLY ALIGNED TARGET: AGATACTAGCTCTCTCAAGAG In the first row of Table 1 are shown the? Tm comparing a duplex chain perfectly aligned with a duplex of misalignment, of a single base, where, in both cases, the probe does not have an artificial misalignment. In the perfectly aligned duplex, the objective is completely complementary to the probe. In duplexes with misaligned single-base alignment, the target is a polymorphic A or B target. The following rows of Table 1 show the? TB for erroneous alignments of two bases versus three bases, as diagrammed in Figure IC, again using polymorphic A and B targets. The various probes are shown in Table 1. When the artificial misalignments are separated by either eight to twelve bases, the? Tm is increased by approximately 50%, which is similar to the results obtained for a single artificial misalignment. Interestingly, when the separation between the artificial misalignments is ten bases, which correspond as in the above to approximately one full helical turn, the? Tm is markedly increased up to about three times greater than that obtained for a conventional misalignment of a single base. The sudden increase in the ability to discriminate between duplexes at a separation of ten 'nucleotides correlates with the decrease in stability observed at the same separation, as shown in Figure 5.

These results suggest that by incorporating additional artificial misalignments into a probe sequence, it will be possible to elongate the total length of the probe, thereby further enhancing the specificity of the probe sequence and the ability to distinguish between DNA sequences closely. related in complex funds. The data presented here suggest that a separation of ten nucleotides between artificial misalignments is desirable. In addition, it will be appreciated that smaller separations are also effective within the method. An acceptable increase in ΔTm with a separation of eight bases has been demonstrated, and it is considered that similar results will be observed with separations as low as four bases. In view of the further recognition that a duplex containing too many misalignments is too unstable to be formed at room temperature, it is preferred by the inventors that the artificial misalignment positions constitute no more than about 20% of the total number of positions in a probe modified for use in the present invention! More preferably, no more than about 15% of the positions in the probe must be artificial misalignments. More preferably, no more than about 10% of the positions in the probe must be artificially misaligned. It will also be appreciated that the technique is within the subjects related to the length and hybridization of probes. The present invention can be applied to oligonucleotides of any length acceptable in the art. The oligonucleotide does not need to correspond to the full length of the target. Similarly, the oligonucleotide may include sequences different from that of the portion that is generally complementary to the target. The length of the oligonucleotide is limited only by the ability to synthesize oligonucleotides. By using the current technology, synthetic oligonucleotides in the range of about 100-150 nucleotides are easily manufactured. The largest synthetic nucleotides of up to about 200 bases are now more difficult to prepare. However, it is anticipated that as the development field matures, it will become easier to synthesize oligonucleotides of 200 bases or greater. More typically, oligonucleotides of about 50 bases are conveniently synthesized and are those which are used, and it is a preferred length. However, the oligonucleotides can also be less than about 50 bases, more preferably less than about 40 bases, and even more preferably less than about 25 bases. Recognizing that the specificity for a particular polymorphic locus is increased by increasing the length of the probe, the complete complement portion of the probe is preferably at least ten bases long if a moderate level of specificity is desired. A washing step for destabilizing the variant duplex may be, but need not be, performed in connection with the invention. It may be desirable to completely eliminate the less stable duplex, however, this may not be essential; or it may be necessary only to break preferentially to the less stable duplex. Alternatively, it may be desirable to break part, but not all, of the more stable plex in addition to the less stable plex. Detection methods can be used, including surface-sensitive methods, which can discriminate between the presence and absence of a duplex. Detection methods that do not require a washing step after hybridization include surface plasmon resonance and evanescent wave fluorescence detection. Hybridization of artificial misalignment increases the ability to discriminate normal sequences of point mutants. The ability to discriminate single nucleotide polymorphisms at the HLA-DRB locus illustrates the utility of artificial misalignment hybridization to increase the specificity of for example, tissue typing, DNA diagnostic tests, of genetic identity, PCR specific for allele and sequenced by hybridization and sequenced by hybridization when applying the principles of the invention to the existing methods. Having demonstrated the concept of the invention and its ability to detect underlying changes of single nucleotides, as well as additional more complex differences between targets, the present inventors also note the general applicability of the invention to other techniques that use nucleic acid hybridization in ways different to the diagnostic indicators of a particular sequence variation. Allele-specific PCR and allele-specific DNA sequencing, both of which are existing techniques that have been limited by their insufficient ability to discriminate between alleles, are non-limiting examples of such uses. In any case, when selecting primers that complement one strand but not the other, then an artificial misalignment is provided in the priming oligonucleotide, and by selecting the appropriate hybridization conditions (eg, temperature, pH, and saline concentration) it is It is possible to ensure that stable plex chains are formed between the oligonucleotide and one allele, but not between the oligonucleotide and the other allele. After forming the stable duplex, the amplification or sequencing reactions initiated in this way can be carried out. according to existing protocols, with the advantage of selectively amplifying (using, for example, PCR or other amplification method) or by chain extension sequencing (using, for example, a DNA polymerase for primer extension) of a single allele. Likewise, the general hybridization method described herein is applicable for selective detection of individual genetic sequences in complex mixtures of sequences. For example, it is anticipated that a viral genome profile in a sample can be carried out by sequential or concurrent probing of a DNA sample using a set of probes specific to a particular virus, where the probes contain artificial misalignment to improve the specificity of detection. Similarly, the method allows the selective detection of heterozygotes when the alleles can be differentiated by careful design of a probe. A stable d plex formed in the method .. and hybridization of the present invention can be detected by any of the methods or means available. For example, detection can be carried out by monitoring the subsequent production of a fragment amplified by PCR, or by labeling the oligonucleotide and monitoring for detection of its presence or by surface-sensitive methods indicated above. This list of detection strategies is not intended to be exhaustive. Rather, the detection of a formed duplex in the present improved hybridization method can be carried out using any method or medium used in any existing application that includes a hybridization step. The utility of the process does not necessarily depend on the desire to detect the most stable duplex formed in the reaction. It is contemplated that both duplexes can be detected from the same hybridization that monitors the difference in stability between the two, for example, by monitoring the binding or breaking kinetics in the reaction. It is additionally specifically contemplated that the detection strategy can be used in an automated system that can provide, for example, visual, auditory confirmation or some other sensory confirmation of duplex formation. Applicants now present a non-limiting example of an assay in which the hybridization method of the present invention is used as a diagnostic tool to differentiate complex related loci in the highly polymorphic HLA-DRB locus.

EXAMPLE Discrimination between single nucleotide polymorphisms in HLA-DRB The nucleotide sequence of the human HLA-DRB region is known and has been shown to contain many polymorphic sites, some of which are difficult to discriminate from each other by conventional hybridization. Three different locus regions defined by amplification using PCR primers are used as target sequences. The genotypes of the PCR products are DRB1 * 0301, D B1 * 1101 and DRB1 * 1301, which were described by Bodmer, J. et al., Tissue Antisens 39: 161 (1992), incorporated herein by reference. Three amplified portions are approximately 260 nucleotides long. Six oligonucleotide probes of the sequence either perfectly complementary to the target DNAs or misaligned in one or two adjacent bases are immobilized on glass supports as described by Guo, Z. et al., Nucleic Acids Research 22: 5456 (1994), incorporated herein by reference. Each oligonucleotide probe possesses a dT separator of fifteen bases long at its 5 'end and a fifteen base long hybridization sequence, and is described by Guo, supra. The hybridization sequences of the oligonucleotide probes, the target regions to which they correspond, and their position on the glass support are shown in Table 2. All the bases correspond to objective polymorphisms are bold and underlined. All bases in italics and underlined are replaced by 3-Nitropyrrole in hybridization experiments of artificial misalignment.

TABLE 2 Location of the point Sequence of the probe Perfect alignment with: First row, left 5'-GGTGCGGT £ CCT £ GA-3 '(DRB 1 * 0301) First row, right 5'-GGTGCGGT? CCTG_GA-3 * (DRB1 * 1101) (DRB1 * 1301) Second row, left 5'-CCTGATG £ CGA £ TAC-3 '(DRB 1 * 0301) Second row, right 5'-CCTGATGAG_GACTAC-3' (DRB1 * 1101) Third row, left 5'-GATACTTClAT CC-3 '(DRB1 * 1 101) Third row, right 5'-GATACTTC? ATA4.CC-3' (DRB 1 * 0301, DRB1 * 1301) HLA-DRB target DNA is amplified from genomic DNA by PCR using a fluorescently labeled primer and a biotinylated primer. The primers used were 5 '- (F) -CGCCGCTGCACTGTGAAGCTCTC-3' and 5'-biotin-TTCTTGGAGTACTCTACGTCT-3 ', where F indicates a fluorescein label. PCR was performed on a Thermocycler Perkin-Elmer Cetus model 9600 using 35 cycles of 94 ° C for 30 seconds, 55 ° C for 1 minute and 70 ° C for 1 minute 30 seconds. This method is described in more detail in Baxter-Lowe, et al., J. Clinical Investigation 84: 613-18 (1989), which is incorporated herein by reference. The two complementary strands are separated, and the fluorescently labeled strand hybridizes to the oligonucleotide array attached to the support. For conventional hybridization, hybridizations are performed at room temperature in 5x SSPE, 0.5% SDS buffer, followed by two 15 minute wash steps at 30 ° C using 2x SSPE, 0.1% SDS buffer. The same conditions were used for the hybridization of artificial misalignment, except that a short wash step of 5 minutes was performed at room temperature. It is noted that the washing step at room temperature is suitable for destabilizing duplex chains between the probe and the variant targets. Sometimes lower melting temperatures are observed on the surface, instead of the hybridization and solution reaction, especially with large targets such as PCR fragments. In addition, the lower salt conditions were used in this example compared to those used in the melting temperature analyzes presented above, thereby further reducing the melting temperatures of the duplex chains. Hybridization was detected by fluorescence scan. The fluorescence images were obtained using Molecular Dynamics Fluorlmager 575. It is very clear from Figure 6 that a fluorescent PCR amplification product provides a detectable binding to a perfectly aligned probe when using the artificial misalignment hybridization method. The method discriminates completely against duplex with misalignment of one or two bases. In contrast, even after extensive washing, both duplexes, perfectly aligned and misaligned, show a fluorescence signal after the conventional misalignment hybridization method. These results demonstrate the higher discrimination power of the artificial misalignment hybridization approach over the conventional hybridization approach. The present invention is not intended to be limited to the embodiments described in the specification or example, but rather encompass all those modifications and variations of the invention as they fall within the scope of the following claims.

LIST OF SEQUENCES (1. GENERAL INFORMATION: (i) APPLICANT: Guo, Zhen Smith, Lloyd M (ii) TITLE OF THE INVENTION: ARTIFICIAL HYBRIDIZATION BY ERRONEOUS ALIGNMENT (iii) SEQUENCE NUMBER: 20 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: Quarles & Brady (B) STREET: 1 South Pinckney St. (C) CITY: Madison (D) STATE: Wl (E) COUNTRY: EU (F) ZIP: 53703 (v) READABLE FORM OF THE COMPUTER: (A) TYPE OF MEDIUM: DISCO flexible (B) COMPUTER: IBM Compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE OR PROGRAM: PatentIn Relay # 1.0, Version # 1.30 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) INFORMATION FROM THE LAWYER / AGENT (A) NAME: Berson, Bennett J (B) REGISTRATION NUMBER: 37094 (C) REFERENCE / FILE NUMBER: 960296.93901 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 608-251-5000 (B) TELEFAX: 608-251-9166 (2) INFORMATION FOR SEC. FROM IDENT. NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. N0: 1 CAGATCGGCT GAACTCCACA 20 (2) INFORMATION FOR SEC. FROM IDENT. NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) r -..-? 0 OF MOLECULE: another nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2 GTCTAGCCGA CTTGAGGTGT 20 (2) INFORMATION FOR SEC. FROM IDENT. NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3 AGATACTTCT ATAACCAAGA G 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 4 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4 TGGTTATAGA AGTAT 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 5 GAGAACCAAT ATCTTCATAG A 21 (2) INFORMATION FOR SEC. FROM IDENT. NO 6 : (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (8, 14) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (7, 15) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (6, 16) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (5, 17) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (4, 18) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO 6: CTCTTGAGAG AGCTAGTATC T 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7 GAGAACTCTC TCGATCATAG A 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (7, 15) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (6, 16) (ix) CHARACTERISTICS: (A) NAME / KEY: modified_base (B) LOCATION: group (5, 17) (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 8 CTCTTGAGAG AGCTAGTATC T 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9 AGATACTAGC GCTCTCAAGA G 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc «" oligonucleotide " (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 10 AGATACTAGC TCGCTCAAGA G 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 11 AGATACTAGC GCTCTCAAGA G 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 12: AGATACTAGC TCTCTCAAGA G 21 (2) INFORMATION FOR SEC. FROM IDENT. NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 13 GGTGCGGTAC CTGGA 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 14: GGTGCGGTCC CTGGA 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 15 CCTGATGCCG AGTAC 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 16 CCTGATGAGG AGTAC 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 17 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 17 GATACTTCTA TAACC 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 18: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 18 GATACTTCCA TAAC 15 (2) INFORMATION FOR SEC. FROM IDENT. NO: 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 19 CGCCGCTGCA CTGTGAAGCT CTC 23 (2) INFORMATION FOR SEC. FROM IDENT. NO: 20: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF HEBRA: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: other nucleic acid (A) DESCRIPTION: / desc = "oligonucleotide" (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 20 TTCTTGGAGT ACTCTACGTC T 21 It is noted that in relation to this date, the best method known by the applicant to carry out the aforementioned invention, is the conventional one for the manufacture of the objects to which it relates. Having described the invention as above, property is claimed as contained in the following:

Claims (25)

1. A process for hybridizing an oligonucleotide to a target nucleic acid, the method is characterized in that it comprises the steps of: providing an oligonucleotide having a nucleic acid sequence complementary in part with the target, but comprising at least one true mismatch in relation to the objective and at least one artificial misalignment in relation to the objective, the artificial misalignment and the true misalignment are in different nucleotide positions; and combining the oligonucleotide and the target under selected hybridization conditions to form a product, the hybridization conditions are selected such that a first duplex comprising oligonucleotide and having true misalignment is less stable than a second duplex comprising the oligonucleotide but that it lacks the true misalignment.

2. The process according to claim 1, characterized in that the artificial misalignment comprises a universal misalignment ucleoside.

3. The process according to claim 2, characterized in that the nucleoside of Universal misalignment is 1- (2'-deoxy- / S-D-ribofuranosyl) -3-nitropyrrole.

4. The process according to claim 1, characterized in that the artificial misalignment and the true misalignment are separated by three or four nucleotide positions.

5. The process according to claim 1, characterized in that the oligonucleotide comprises two artificial misalignments.

6. The process according to claim 5, characterized in that the oligonucleotide comprises two artificial misalignments separated by ten nucleotides.

7. The process according to claim 1, characterized in that the true misalignment is selected from a group consisting of a substitution, an infection, a deletion and a prearrangement of nucleic acid in relation to the target.

8. The process according to claim 1, characterized in that the part of the oligonucleotide complementary to the target comprises no more than about 150 nucleotides.

9. The process according to claim 1, characterized in that it further comprises the step of detecting a duplex comprising the oligonucleotide.

10. The process according to claim 9, characterized in that the step of detecting the duplex comprising the oligonucleotide is selected from the group consisting of monitoring the subsequent production of a fragment amplified by PCR, monitoring the label form of the oligonucleotide, measuring the resonance of Plasma surface, and measure evanescent wave fluorescence.

The process according to claim 9, characterized in that it further comprises the step of preferentially cutting the first duplex.

The process according to claim 11, characterized in that the cutting step comprises the step of washing the product of the combination step under conditions that favor the cutting of the first duplex.

The process according to claim 1, characterized in that it further comprises the step of selectively amplifying a nucleic acid fragment after forming the second duplex.

The process according to claim 1, characterized in that it further comprises the step of selectively extending a nucleic acid fragment after forming the second duplex.

15. A process for discriminating between a first target nucleic acid and a second target nucleic acid having a sequence variation in relation to the first target, in a test sample comprising nucleic acid, the process is characterized in that it comprises the steps of: providing an oligonucleotide having a nucleic acid sequence complementary in part to the first target but that it comprises at least one artificial misalignment in relation to the first target in a position different from that of the sequence variation, - and combining the oligonucleotide and the nucleic acid under selected hybridization conditions to form a product, the product is selected from the group consisting of: (a) a first duplex chain comprising the oligonucleotide and the first target, (b) a second duplex comprising the oligonucleotide and the second target which is less stable than the first d plex, and (c) a mixture comprising both the first duplex and the second duplex; and selectively detect the first duplex or the second duplex.

16. The process according to claim 15, characterized in that the step of detecting the first duplex or the second duplex is selected from the group consisting of monitoring the subsequent production of a fragment amplified by PCR, monitoring a labeled form of the oligonucleotide, measure the surface plasmon resonance, and measure the evanescent wave fluorescence.

17. The process according to claim 15, characterized in that it further comprises the step of preferentially cutting the second duplex.

18. The process according to claim 17, characterized in that the cutting step comprises the step of washing the product of the combination stage under conditions that favor the cutting of the second duplex.

19. The process according to claim 15, characterized in that the artificial misalignment comprises a universal nucleoside for misalignment.

The process according to claim 19, characterized in that the universal nucleoside for misalignment is 1- (2'-deoxy - /? - D-ribofuranosyl) -3-nitropyrrole.

21. The process according to claim 15, characterized in that the artificial misalignment and the variation of sequences are separated by three or four nucleotide positions.

22. The process according to claim 15, characterized in that the oligonucleotide comprises two artificial misalignments.

23. The process according to claim 22, characterized in that the oligonucleotide comprises two artificial misalignments separated by ten nucleotides.

24. The process according to claim 15, characterized in that the sequence variation is selected from a group consisting of a substitution, an insertion, a deletion and a rearrangement of nucleic acid in relation to the target.

25. The process according to claim 15, characterized in that part of the oligonucleotide complementary to the first target comprises no more than about 150 nucleotides. An improved nucleic acid hybridization process is provided which utilizes a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a variation in sequence. The modified probe contains at least one artificial misalignment in relation to the control nucleic acid target in addition to any misalignment that arises from the variation of the sequence (as shown in the figures). The invention has direct and advantageous application with numerous existing hybridization methods including applications using, for example, the polymerase chain reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.