MXPA98008409A - C4 cycle of pck type - Google Patents

Abstract

A method for transforming C3 plants which comprises introducing a number of enzymes contributing to the C4 photosynthetic cycle into the C3 plants to thereby impart the C4 cycle thereto. In this method, a gene encoding PEPC and a gene encoding PCK ligated to a gene encoding a transit peptide are introduced into the C3 plants.

Description

CYCLE C4 OF THE TYPE OF FQSFOEGMOLPI UVATO CARBOXICINASA BACKGROUND OF THE INVENTION The present invention relates to a process for transforming a C3 plant to provide it with a C4 cycle by introducing two or more enzymes participating in the C4 photosynthetic pathway.

TECHNICAL BACKGROUND Three types of photosynthetic pathway are known in higher plants, namely, the C3, C4 and CAM types. The foliar tissues of plants that have a photosynthetic pathway of type C4 (hereinafter sometimes referred to as C4 plants) comprise mesophilic cells and sheath cells of the conducting bundle that exist around the fibrovascular bundles »forming the specific structure of folic tissue. ar called anatomy of Kranz type. C4 plants bind carbon dioxide to a C4 compound by the action of a phosphoenol pyruvate carboxylase (hereinafter sometimes referred to as PEPC) located in the cytoplasm of the mesophilic cells. The fixed carbon dioxide is released by decarburization in the cells of the conductive beam sheath, which increases the level of carbon dioxide in the vicinity of the ribulose-1,5-carboxylactosylase / oxygenase diphosphate (hereinafter referred to sometimes like Rubisco). which is the enzyme necessary for the essential fixation of carbon dioxide. The metabolite resulting from decarboxylation in the sheath cells of the conducting bundle is transferred to mesophilic cells and converted to phosphoenol pi uvate (hereinafter sometimes referred to as PEP), a substrate for PEPC »by action of the pyruvate orthophosphate dithinase (hereinafter sometimes referred to as PPDK) localized in mesophilic cells »with simultaneous consumption of ATP. Namely, the two cell types in the green leaves of C4 plants are functionally differentiated; the cells of the mesophile is the site of the formation of the C4 compounds in the initial fixation of the carbon »as well as the place of the regeneration of the substrate of the PEPC» while the cells of the pod of the conductive beam is the place of 1 to decarboxy 1 ation of compound C4 and the essential fixation of carbon dioxide through the Cal vin-Benson cycle. The three steps »that is to say» the fixation of carbon dioxide by the PEPC »the improvement of the same in the vicinity of the Rubi seo» and the regeneration of the substrate of the PEPC accompanied by the consumption of ATP »constitute a reaction system cyclic called CA photosynthetic pathway. The pathway provides C4 plants with improved capacity to accumulate carbon dioxide, and to avoid the decrease in photosynthetic efficiency that may otherwise occur under high luminous intensity due to overproduction of ATP (prevention of photoinhibition). These properties do not exist in C3 »plants that have a regular photosynthetic pathway (photosynthesis of type C3). Thus »C4 plants do not exhibit photorespiration as in C3 plants and» therefore »the former show less deterioration of photosynthetic efficiency than the latter when placed under any atmosphere that is dry» that is at high luminous intensity, or at high temperature. As such, C4 plants are superior to C3 plants in their ability to carry out photosynthesis. It could be expected that a C4 photosynthetic pathway can be introduced into a C3 plant by cross-breeding and reproduction. However, "most species that have a C4 photosynthetic pathway, and those that have a regular C3 photosynthetic pathway, are grouped into different genera or families" and crossing between them is difficult. In addition, an attempt to introduce the properties of a C4 plant, where a C3 plant was crossed with a C4 plant selected from the same genus orzaga (Ohsug, R. Nogyo-gijutsu (1995) Vol. 30-36). Hudspeth et al. Observed that the green leaves of transgenic tobacco in which the gene for PEPC was introduced under the control of the gene promoter for chlorophyll a / b binding protein of the tobacco (promoter cab), showed duplication of PEPC activity and increased malate level (Hudspeth et al., Plant Physiol., (1992) 98: 458-464). Kogami et al. Observed that the green leaves of transgenic tobacco in which the gene for PEPC was introduced under the control of the 35S promoter of the cauliflower mosaic virus »contained approximately twice as much PEPC activity as untransformed tobacco (Kogami and others, Transgenic Research (1994) Vo1.3: 287-296). Thus »Hudspeth and others» and Kogami and others »simply observed the malate accumulation of compound C4 without confirming any change in the photosynthetic property caused by the introduction of PEPC as an indi idual gene in the C3 tobacco plant. The cells of C3 plants are unable to rapidly decarboxy a C4 compound to supply carbon dioxide to the Calvin cycle. Therefore »it would not be possible» by means of a simple introduction of the gene for PEPC in a C3 plant, in an attempt to provide the plant with the ability to carry out via C4 photosics »concentrate carbonate or avoid a photoinhibition» when it is desired to improve the photosynthetic property of a C3 plant. Japanese patent specification Hei 8-80197 discloses that a DNA fragment encoding a transit peptide was linked to a gene for phosphoenol pyruvate carboxykinase (PCK). The chimeric gene was introduced into rice »which is a C3 plant» by means of which it was possible to detect enzymatic activity in the raw green leaf extract »as well as the localization of the PCK protein in chloroplasts. These facts indicate that it is possible to allow the activity of the PCK to be located in the chloroplasts. However, no description is made about the establishment of a C4 photosynthetic pathway or change of photosynthetic property in transgenic plants. Ichikawa and others »N hon Sakumotsu Qakkai K? Ji, Vol. 63 »Suppl. 2 (1994), p. 247) describe that when PPDK was introduced in C3, Arabidopsis and tomato plants, the protein accumulated in the plants. However, no description was made about the establishment of a C4 photosynthetic pathway or change in the otosynthetic property of the transgenic plants. Japanese patent publication Hei 6-12990 describes the change in photosynthetic efficiency in the cotyledon protoplasts of Lycopersicon esculentum, where the carbonic anhydrase protein (sometimes referred to herein as CA) was incorporated. On the other hand, Majeau et al. Report that the overexpression in CA caused no change in the photosynthetic capacity of the plant (Plant Mol. Biol, (1994) 25: 337-385). As previously discussed »previous attempts to introduce a C4 photosynthetic pathway gene into a C3 plant by a genetic engineering method. were limited to the introduction of a gene for CA »PEPC» PCK or PPDK as an individual gene. These attempts did not allow confirming any C4 photosynthetic pathway or change in the efficiency of photosynthesis, even though in some attempts the expression of the introduced gene or the activity of the enzyme was observed.

BRIEF DESCRIPTION OF THE INVENTION An objective of the present invention is to provide a method for improving the photosynthetic property of C3 plants. Specifically, the present invention provides a method for transforming a C3 plant to provide it with a C4 photosynthetic pathway by introducing two or more enzymes involved in the C4 photosynthetic pathway. Another objective of the present invention is to provide a plant that has been transformed to provide it with a C4 photosynthetic pathway in accordance with the method of the invention. A further object of the present invention is to provide a vector that is useful for carrying out the transformation of a C3 plant.

BRIEF EXPLANATION OF THE DRAWINGS Figure 1 is an illustration of the C4 photosynthesis cycle of the PCK type. Figure 2 is an illustration of the genetic construction used in the transformation of a C3 plant. Figure 3 is a graph in which the relative amount of the isotopically-labeled carbon compound is plotted against the time course. Figure 4 is a graph showing the photosynthetic activity of the transformed rice.

DETAILED DESCRIPTION OF THE INVENTION The present invention has been achieved as a result of exhaustive studies carried out by the inventors introducing a gene for PEPC in a C3 plant together with a gene for PCK that has been linked to the DNA fragment encoding a transit peptide. The present inventors focused their attention on the fact that in previous attempts, the respective gene of C4 photosynthetic components was introduced into the cytoplasm of a C3 plant as an individual gene. Thus, the inventors assumed that the above fact may explain the reason why previous attempts failed to activate the photosynthetic activity C4 or to improve the photosynthetic property even though some of the transgenic C3 plants acquired the activity of the introduced enzymes. Based on this assumption, the present inventors have designed a system wherein: the genes of two or more enzymes are introduced into a C3 plant in such a way that each enzyme will be expressed in a defined intracellular location; the chloroplasts will carry out the function of the cells of the pod of the conductive beam of a C4 plant; and said two or more enzymes required in the photosynthetic pathway C4 »will be simultaneously expressed in the mesophyll green cells. In accordance with said design, it is possible not only to provide a C3 plant with respective enzymatic activity, but B also allow the C3 plant to use a cyclic reaction that simulates the C4 otosynthetic activity of the C4 plants »to improve the capacity to accumulate carbon dioxide in the chloroplasts and to avoid the photoinhibition that can be caused by an excessive consumption of ATP. It is expected that the plants provided with said properties exhibit improved producti ty, improved tolerance to drought »improved tolerance to high temperatures, and improved photosynthetic property under conditions of low carbon dioxide concentration» as a result of improved photosynthetic property. The method of the present invention to provide the C4 photosynthetic pathway comprises: supplying meséf cells from a green leaf of C3 plants (e.g., rice); allow the enzyme (PEPC) of the first carbon dioxide fixation process of a C4 plant to act in the cytoplasm of said cells; allowing a decarburization for compound C4 to act on the chloroplasts of said cells; and »simultaneously, allowing the expression of an enzyme to regenerate PEP with the cytoplasm or chloroplasts of said cells. The decarboxes useful for this purpose include the PCK. PCK is the enzyme that decarboxylates oxaloacetate to generate PEP while consuming ATP. Thus, PCK can advantageously be used as a decarboxylase because the decarboxylation, the ATP consumption and the PEP regeneration can be effected by the individual enzyme. To allow a flaky decarbox to exhibit its activity in the chloroplasts, the gene for this enzyme binds to a transit peptide sequence. The transit peptide transports the polypeptide decarboxylase into the chloroplasts to allow the enzyme to exhibit its function therein. By means of the transformation as indicated above, the carbon dioxide fixation pathway that simulates the photosynthetic activity C4 derived from the structure of differentiated foliar tissue of C4 plants, is constituted in a C3 »plant where the cytoplasm of the green cells of the mesophyll of the leaves of the C3 plant simulates the mesophyll cells of the C4 plants, and the chloroplasts of the C3 plants simulate the sheath cells of the conductive bundle of the C4 plants (Fig. 1). Thus »it is possible to provide a C3 plant with the ability to concentrate carbon dioxide and avoid photoinitiation. The combination of PEPC »descarboxi lasa and an enzyme to regenerate PEP» will be enough to constitute the desired C4 photosynthetic pathway. However, "in a preferred embodiment" CA can be coexpressed in the cytoplasm to deliver bicarbonate ion as the direct substrate of PEPC "so that photosynthetic pathway C4 will function more uniformly. In addition »PPDK» that catalyzes the formation of PEP from pyruvate »can be coexpressed in addition to PEPC» PCK and CA »if an increased supply of PEP such as IO is desired substrate for PEPC »by means of which the C4 otosynthetic cycle will function even more uniformly. The present invention will be described in greater detail in the following. The present invention relates to a method for transforming a C3 plant to provide it with a C4 photosynthetic pathway by introducing, in said plant, a gene coding for PEPC and a gene coding for PCK that has been linked with a fragment of DNA that codes for a transit peptide. The genes for PEPC that can be used in the present invention include genes for PEPC from bacteria, protozoa »plants» etc. As a specific example of bacterial gene for PEPC »that of a glutamate-producing strain of Corynebacterium is known (patent publication Japanese Hei 7-83714). However, the preferred PEPCs are of plant origin; for example, those derived from corn are preferred (Japanese patent publication Hei 6-30587), Amaranthus (Rydzik, E. and Berry, JO, Plant Physiol., (1995) 110: 713), Flaveria tr nervia (Poetsch, W and others, FEBS Lett., (1991) 292: 133-136), tobacco (Koizumi, N. et al., Plant Mol. Biol. (1991) 17: 535-539), soybean (Japanese patent public description Hei 6-319567), rapeseed (Japanese patent public description Hei 6-90766), potato (Merkelbach, S. et al., Plant Mol. Biol., (1993) 23: 881-888), alfalfa (Pathariana, SM and others, Plant Mol. Biol., (1992) 20: 437-450), Mesembryanthenum crystal 1 ium (Cush an, JC and Bohnart, HJ »Nuc Acid Res. (1989), 6743-6744). Corn PEPC is especially preferred. Examples of genes encoding PCK used in the present invention are ATP-dependent genes derived from 5 plants and bacteria. Examples of plant PCK include those of Urochloa panicoides (Japanese patent public disclosure Hei 8-80197) and cucumber (Kim, D.-J. and Smith »SM, Plant Mol. Biol. (1994) 26: 423-434) , and examples of PCK of bacteria include those of E. coli (Medina »V. and others, J.

-O Bacteriol. (1990) 172: 7151-7156) and Rhizobium (Osteras, M., et al., J. Bacteriol. (1995) 177: 1452-1460). The gene for PCK derived from a plant is preferred. especially of Urochloa panicoides. In addition »PCK is required to exhibit its function in 5 chloroplasts» as described above. To ensure this »a DNA fragment encoding the transit peptide sequence binds to the PCK gene. Several sequences of the transit peptide that can be linked to the PCK gene have been reported in 0 proteins located in chloroplasts (Keegstra K. and others »Annu, Rev. Plant, Mol. Biol. (1989) 4 ?: 471- 501). It is preferred in the present invention that the sequence of the transit peptide is derived from rice proteins. Especially preferred »the transit peptide sequence is the sequence 5 of the small subunit of Rubisco (SEQ ID N0: 2)» which can be obtained according to the method shown in 1Z following examples. The DNA fragment encoding a transit peptide sequence is linked in the reading frame with the PCK structural gene at the 5 'end and preferably the immediate 5' end thereof. In the present invention, a gene encoding CA can also be introduced into the cytoplasm of C3 plants to provide acid carbonate ion as a substrate for PEPC as described above. Several genes that code for CA and that can be used in the present invention are known as those derived from plants and animals. However, sequence homologies between CAs of higher plants and other organisms are not high. Furthermore, the enzymatic activity of the CA of higher plants is affected by inorganic phosphate (Sultemeyer, D. et al., Physiol. Plant. (1993) 88: 179-190). It is therefore preferred that the gene be derived from a plant such as spinach (Burnell et al., Plant Physiol. (1990) 92: 37-40), peas (RoesKe »CA and Ogren» WL. Res. (1990) 18: 3413), Arab dopsis (Raines, C.A. and others, Plant Mol. Biol. (1992) 20: 1143-1148), rice (095/11979) and corn (095/11979). Especially preferred is spinach-derived CA. Because the spinach CA is located in the chloroplasts, the enzyme gene contains a region that codes for the transit peptide. Thus, SEQ ID NO: 3 »the region encoding the transit peptide» is removed by the induction of a point mutation as described in Example 1, and the gene having the sequence represented by SEQ ID NO: 3 , it is used for genetic construction. Genes coding for PPDK and used in the present invention include the gene for C4 type PPDK of maize (Matsuoka, M. et al., J. Biol. Chem. (1988) 263: 11080-11083), the gene for PPDK of rice (Japanese patent public disclosure Hei 7-184657), the gene for PPDK of Fl averia pr nglei (Rosche, E. et al., Plant Mol. Biol. (1994) 26: 763-769), Mese bryanthemum crystal 1 i num (Fissl thai er »B. and others» Plant (1995) 196: 492-500) »and the gene for type C4 PPDK of maize is preferred. The gene for PPDK can be expressed in chloroplasts or in the cytoplasm. If it is desired to express the gene for PPDK in chloroplasts, the gene can be linked to a DNA fragment encoding the transit peptide. Promoter sequences useful for expressing the gene of the above enzymes are preferred, without being limited to some specific ones, although those that are specific for a photosynthetic organ are preferred. For example, the C4-type PPDK promoter from maize (Glackin et al. (1990) Proc. Nati, Acad. Sci. USA, 87: 3004: 3008), the C4-type PEPC promoter from maize (Hudspeth, RL and Gruía, JW, Plant Mol. Biol. (19B9) 12: 579-589), the promoter of the small subunit of rice Rubisco (Kyozuka, J. et al., Plant Physiol. (1993) 102: 991- 1000), and the chlorophyll a / b binding protein promoter for harvest in the presence of light (Sakamoto, M. et al., Plant Ce11 Physiol. (1991) 32: 385-393). The C4 type PPDK promoter of maize is specifically preferred. In the following examples, SEQ ID NO: i is used as a promoter. According to the present invention "the gene coding for each of the enzymes of the C4 photosynthetic pathway mentioned above" can be carried in a separate genetic construct (construction for the introduction of genes) that is used to transform a C3 plant . However, preferably, two or more of the genes are carried in an individual construct for the introduction of genes that are introduced into a C3 plant to effect a transformation thereof. In this case, there is no specific limitation regarding the order of the genes. The transformation of cells of C3 plants with said construction for the introduction of genes comprising genes derived or dependently linked to each other, can be carried out in accordance with a standard method by introducing the construction for the introduction of genes into the cells of a selected C3 plant. General methods for the introduction of genes are known in the art such as electroporation, electroinjection, chemical treatment with, for example, polyethylene glycol (PEG), and genetic bombardment. Among them, it is preferred that the genes be introduced to transform cells of C3 plants using the Agrobacter um method. The Agrobacterium um method is well known in the art and is capable of transforming both dicot leds (for example, Japanese patent public disclosure Hei 4-330234) and LEDonocs onocoti (W094 / 00977). Successful transformants can be selected by the method described below. The phenotypes of the transformants can be fixed by any of the appropriate conventional breeding methods and, consequently, a gene introduced into the progeny of the transformants can be transferred. The method of the present invention can be applied to any C3 plant, and is especially beneficial for crops such as rice, wheat, barley, soybean, potato, tobacco, rapeseed and the like, and productivity in dry weight is expected to be improved due to the increase in photosynthetic capacity. Preferably, the invention is applied to monocotyledons, more preferably to rice. The CA photosynthetic pathway in the present invention is constituted by the three processes, that is, the fixation of carbon dioxide by the PEPC described above, the release of carbon dioxide in the vicinity of the Rub sco by decarboxylase action, and the regeneration of substrates for PEPC using ATP. The method for confirming that the photosynthetic pathway C4 functions in a transformed C3 plant will be described in detail in the following examples. Briefly, the method comprises: (1) studying whether a C4 compound as an initial product is formed by the action of PEPC in the transformants when separate leaves of the transformant and the control plants are allowed to incorporate radioactive carbon dioxide (CO). ,), or study whether the introduced photosynthetic pathway C4 functions in the transformant following the proportion of carbon compounds marked with the passage of time; (2) to study whether the decarboxylation of compound C4 works by the action of PCK in the transformants when separate sheets of the transformant and control plants are allowed to incorporate poor radioactive (C ^ C-malathol) and the amount is compared relative of marked saccharose, after a determined period, between the transformant and the control plants; and / or (3) study any change in photosynthetic property in the transformant by measuring said property.

EXAMPLES To further illustrate the present invention in greater detail, and not by way of limitation, the following examples will be given. A. Photosynthetic path C4 of the PCK type EXAMPLE 1 Construction of transgenes (1) Sequence of the promoter The DNA fragment of the C4-type PPDK promoter region of the maize was obtained by the PCR method (Mcpherson, MJ, Quirke, P. and Taylor, GR. Ed .: PCR. approach »Oxford Express Press» Oxford NY (1991)) with the use of the following two synthetic primers prepared based on a known nucleotide sequence (Glackin »CA and Gruía, J. (1990) Proc. Nati. Acad. Sci USA 87: 3004-3008: S'-CTAAAGACATGGAGGTGGAAG-S '(5' side) (SEQ ID NO: 4) 5'-GTAGCTCGATGGGTGCACG-3 'Ilate 3' > (SEQ ID N0: 5 > Amplification was carried out using corn genomic DNA as a template "which had been obtained by extracting total nucleic acids from a green leaf of inbred corn B73 by the SDS-phenol method" followed by purification by ultracentrifugation with cesia chloride. -bromide of ethidium. The DNA fragment thus obtained was inserted into the cloning site of a plasmid vector pCRIOOO (manufactured by Invitrogen »USA). The plasmid thus obtained was digested with SaCI and shaved at its ends' and then an Ncol linker was added thereto. After being digested with HindIII »the IB 950 bp DNA fragment obtained containing the PPDK promoter region "was used in the genetic construct. SEQ ID NO: 1 shows the DNA sequence used in the present. (2) Gene for PEPC PEPC cDNA was isolated from CA maize plants by selecting 20,000 clones from a cDNA library obtained using mRNA prepared by using guanidine-hydrochloric acid from green leaves of corn seedlings (hybrid variety). "harvest queen") and lambdaZAP vector (manufactured by Stratagene »USA) in accordance with the instructions given in the annexed manual» with the use of the following synthetic oligonucleotide, as a probe »prepared based on a known nucleotide sequence (Hudspeth» RL and Gruía, JW (1989) Plant Mol. Biol. 12: 579-589): S'-GCCATGGCGCGGCGGGAAGCTAAGCACGGAAGCGA-a '(SEQ ID N0: 6) by a conventional method (Sambrook, J., Fritsch, E.F. and Maniatis, T. ed .: Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY (1989)). The clone thus obtained was digested with Xho I and then partially digested with Ncol. The approximately 3 kbp DNA fragment thus obtained was used in the genetic construct. (3) PCK gene The cDNA for PCK of Urochloa panicoides was used in a genetic construct, where the region coding for the transit peptide of the small subunit of the rice Rubisco had been added as previously reported (Japanese Patent Laid-open Hei 8-80197). Namely, lambda PCK170204 and lambda PCKIOOIOI were taken together in the Kpnl sites existing in the inserts thereof. Using the DNA fragment thus obtained as a template, PCR was carried out with the use of the following synthetic primers: PCK-f2: 5 * -GCTCTAGATCTCTGGCACGTGAATATGGCCCCAACCTCG-3 '(SEQ ID N0: 7), and PCK-r2: 5 '-CAGTGCATGCCGCCGAACAGGCATACAGATTTACACCAG-3 * (SEQ ID NO: 8).

Separately "a DNA fragment encoding the transit peptide of the small subunit of rice Rubisco was isolated by the PCR method with the use of the following primers synthesized based on the sequence of the small subunit of the Rubisco of rice (Matsuoka et al., Plant Cell Physiol., 29: 1015-1022 (1988)): TP-f1: 5 '-GGAATTCCATGGTGCATCTCAAGAAGTAC-3 *' (SEQ ID NO: 9); and TP-rl: 5 '-GCTCTAGACTGCATGCACCTGATCC-3' (SEQ ID NO'.IO) The mold was a rice genomic DNA that had been prepared from green leaves of the Japanese rice variety "Nihonbare" by the SDS-phenol method. By using the amplified DNA fragment as a template, PCR was carried out again using the following synthetic primer: TP-f2: 5 '-GGAATTCCATGGCCCCCTCCGTGATGG-3' (SEQ ID N0: ll) and the TP-1 initiator mentioned above. Then a DNA fragment of approximately 2 Kpb obtained by partial digestion of the cDNA fragment for PCK amplified by the PCR reaction with Xbal and Sphl was ligated with a fragment of approximately 150 bp (represented by SEQ ID NO: 2) obtained by digestion of the DNA fragment of the transit peptide sequence amplified by the second PCR with Ncol and Xbal. The resulting DNA fragment of approximately 2.2 kbp was used in the genetic construct. (4) CA gene A vector was obtained by inserting a 1.8 kbp fragment containing the spinach CA cDNA region (which is obtained by digesting a lambda phage clone (lambdaCA4S) reported previously (Burnell, JN et al. 1990) Plant Physiol. 92: 33-40) with HindIII and Kpnl) at the HindIII / Kpnl site of pBluescriptSK- (manufactured by Stratagene »USA). From this cDNA, the region coding for the transit peptide involved in the transport of AC in chloroplasts was deleted. To effect the deletion, the final amino acid residue in the transit peptide region was altered from serine to methyonin so that the dot mutation introduced an Ncol recognition site. The mutation was effected by the use of the following synthetic oligonucleotide: "_GGTGGCACAGATAACCATGGATCCAGTTAGCCGACGGTGGC-3 * (SEQ ID NO: 12); and Mutan-K ™ (manufactured by Takara Shuzo Co. »Ltd.). The plasmid obtained carrying the mutation was digested with Ncol to thereby suppress the region encoding the transit peptide thereof. This plasmid was then digested with Sph1 and the obtained DNA fragment of approximately 700 bp was used in the genetic construct. SEQ ID NO: 3 shows the sequence of said fragment. (5) Terminator sequences The terminator regions used were a DNA fragment from the region of the NOS terminator obtained by digesting PBI121 (Jefferson, RA (1987) Plant Mol. Biol. Rep. 5: 387-405) with SalI and EcoRI » and a DNA fragment from the 1 region of the 35S terminator obtained by digesting pGL2 (B lang »R. and others (1991) Gene 100: 247-250) with Sphl and EcoRI. (6) Construction of plasmids for introduction The promoter »the cDNA and the DNA fragments of the terminator thus obtained were combined and ligated as indicated below» and then inserted between the HindIII- EcoRI sites of pBluescriptIISK- (manufactured by Stratagene, USA) to thus construct plasmids (plasmids for introducing an individual gene, see figure 2). promoter for PPDK :: cDNA for PEPC :: terminator NOS (pDPN) promoter for PPDK:: cDNA for CA:: terminator 35S (pDCS) promoter for PPDK :: cDNA for PCK :: terminator 35S (pDKS). In addition, pDKS was digested with Clal »shaved at its ends and then digested with Xbal. The DNA fragment thus obtained was inserted into pDPN in the sites digested with Smal and Xbal to thereby give the plasmid pPK possessing the two genes "ie" for PEPC and PCK (see Figure 2). Then »pDCS was digested with Smal» and a HindIII linker was added to it.

After being digested with HindIII, the obtained DNA fragment was inserted into the HindIII site of pDPN to give the plasmid pCP. In addition »pDKS was digested with Clal» shaved at its ends and then digested with Xbal. The fragment of DNA thus obtained was inserted in pCP in the site digested with Smal and Xbal »to give the plasmid pCPK carrying the three genes, ie» for CA »PEPC and PCK (see figure 2). Afterwards, pPK was digested with Xbal »and then partially digested with HindIII to thereby give a DNA fragment of approximately 7.5 kbp »while pCPK was digested with Xbal and then partially digested with HindlII to thereby give another DNA fragment of approximately 9.5 kbp. These DNA fragments were inserted into pSBll (Komari T. and others »Plant J. (1996) 10: 165-174) respectively» in the sites digested with Xbal and HindIII to thereby construct the superbi-ary intermediate plasmids pSPK and pSCPK. Each of these vectors was introduced into strain LE392 of Escherichia coli. After, introduction into Agrobacter um and homologous recombination (Komari, T. et al., Plant J. (1996) 10: 165-174) were carried out by triparental pairing with LBA4404 / pSB4 of Agrobacter um and HB101 / pRK2013 of E coli to give thus the plasmids pSB4PK and PSB4CPK. (7) Construction of vectors harboring CA, PEPC, PCK and / or PPDK The plasmid vector pCRIOOO (manufactured by Invitrogen, USA) having the PPDK promoter region »which has been obtained by the PCR method as described previously, it was digested with HindIII and EcoRI, and then inserted between the HindlII and EcoRI sites of pBluescrípt IISK- (manufactured by Stratagene »USA) from which the Sacl site had been deleted. After »the resulting product was digested with Sacl and shaved at its ends. Next »a fragment of approximately 200 bp containing the first catalase intron of Ric nus communis (which had been obtained by digesting PIG221 (Ohta and others: Construction and expression in tobáceo of a beta-glucuroni dase (GUS) reporter gene containing an intron Within the coding sequence, Plant Cell Physiol., 31: 805-813 (1990)) with Ba Hl and Sali followed by blunting), was inserted therein to give the plasmid pSK-D? containing the PPDK promoter (catl). This plasmid was then digested with Ndel and shaved at its ends to give another plasmid, pSK-Di2, which has the Ncol linker inserted into the my sms. CDNA was isolated for PPDK from maize C4 plants by selecting a cDNA library prepared by a conventional method (Sambroo »J. and others» ibid.) Med before the use of the lambda ZAP vector (manufactured by Stratagene »USA) with the use of the following synthetic oligonucleotide: '-TAGCTCGATGGGTTGCACGATCATATGGAGCAAGG-3 * (SEQ ID NO: 13) prepared based on the known nucleotide sequence (MatsuoKa »M., Ozeki, Y., Yamamoto» N. »Hirano» H .. Kano-Murakami »Y. and Tanaka, Y .: Pri ary structure of maize pyruvate» orthophosphate dikinase as deduced from cDNA sequence »J. Biol. Chem. 163: 11080-11083 (1990)). In addition, cDNA for corn-isolated PPDK was used to achieve amplification by the PCR method (Mcpherson, MJ and others »ibid.) With the use of the following synthetic primers prepared based on the known sequence (Sheen» J. : Molecular mechanisms underlying the differential expression of Maize Pyruvate »Orthophosphate dikinase genes» Plant Cell 3: 225-245 (1991)): '- - TTCAT? TGGCGCCCGTTCAATGTGCGC GTTCGCAGAGGGTGTTCCACTTC-GGCAA-3 '(side 5 ») (SEQ ID NO: 14); Y '-GTACTCCTCCACCCACTGCA-3 »(1 ad ° 3') (SEQ ID NO: 15 > to thereby give a DNA fragment of approximately 250 bp.

This fragment was digested with Ndel and SacII and replaced by the region between the Ndel and SacII sites of the cDNA for PPDK mentioned above. After »was digested with Ndel and Clal "and the approximately 2.9 kbp DNA fragment thus obtained was used as? N cDNA for PPDK in the genetic construct. As the region of the terminator, the terminator of gene 7 contained in the plasmid pPGA643A (Gynheung AN, Paul R.

Ebert, Ami ava Mitra and Sa B. HA: binary vectors, Plant Molecular Biology Manual A3: i-19 (1998)). The terminator of gene 7 was obtained by digesting pPGA643 (Gynheung AN and others, ibid.) With Clal and Kpnl. The terminator was inserted between the Clal and Kpnl sites of pBluescript IISK- (manufactured by Stratagene, U.S.A) to thereby give a plasmid. This plasmid was digested with Kpnl and shaved at its ends »and an Xbal linker was added thereto. After digestion with Clal and Xbal, the resulting DNA fragment was used in the genetic construct. The cDNA for PPDK and the terminator of gene 7 were inserted between the Ndel and Xbal sites of pSK-D? to thereby give the pSK-DiDT plasmid containing the gene for PPDK. A DNA fragment of approximately 3.4 Kpb, which had been obtained by deleting the pDPN mentioned above with Xbal and then partially digesting with Ncol, was inserted between the Ncol and Xbal sites of pSK-Di2 to thereby give a plasmid gone pSK- DiPN that contains the gene for PEPC. A DNA fragment of approximately 2.4 Kbp »which had been obtained by digesting the aforementioned pDKS with Ncol and Xbal, was inserted between the Ncol and Xbal sites of pSK-Dα2 to give a plasmid pSK-D? S that contains the gene for PEPCK. A DNA fragment of approximately 1 kbp »which had been obtained by digesting the aforementioned pDCS with Ncol and Xbal» was inserted between the Ncol and Xbal sites of pSK-Di2 to give a pSK-DiCS plasmid containing the gene for CA .

A Smal linker was inserted into the Xho I site of pSK-DiPN and digested with Smal. The DNA fragment of approximately 4.5 Kpb thus obtained was inserted into pSK-DiCS at the site that had been digested with PstI and shaved at its ends to thereby give a plasmid pSK-CiPi. After deleting the Xbal site from pSK-DiDT "an Xbal linker was added to the Xho I site of the plasmid" and was digested with Xbal and Not I. The DNA fragment of about 4.8 kbp thus obtained was inserted between the Xbal and Not sites. I of the plasmid pSK-CiPi to thus give the plasmid pSK-CiPiDi. A Not I linker was added to the Xho I site of pSK-CiPiDi »and a digestion was carried out with Not I to thereby give a DNA fragment of approximately 12 kbp. pSBll (Komari, T. et al, Plant J. 10: 165-174 (1996) was digested with HindIII and EcoRI and shaved at its ends, then a Not I linker was added thereto. inserted the above-mentioned DNA fragment of approximately 12 kbp to give the plasmid pSBmCiPiDi, a Xbal linker was added to the Xho I site of pSK-Di S »and the digestion was carried out with Xbal, the DNA fragment of approximately 3.3 kbp obtained was inserted into the Xbal site of pSBrnCiPiDi to give the plasmid pSBmCiKiPiDi, then the introduction into Agrobacterium and the homologous recombination (Komari, T. and others »ibid.) were carried out by triparental mating between the strain DH5a of E cabbage carrying the plasmid pSBmCiPiK? Di »LBA4404 from Agrobacterium carrying pSB4, and strain HB101 from E. coli which carries pRK2013 to give the plasmid pSB4CiPiKiDi EXAMPLE 2 Construction of transformants Throughout the rice transformation study, a variety of Japanese rice (cultivar "Tsukinohikari") was used. Rice transformants having pDPN »pDKS and pDCS introduced into them were constructed by the electroporation method described above (Japanese patent specification Hei 8-S0197). Rice transformants having pSB4PK »pSB4CPK and pSB4C?" P? "DiKi introduced therein were also constructed by the Agrobacterium method reported and described (Hiei, Y. et al. (1994) Plant J. 6: 271-282) . These transformants were grown in a greenhouse with air conditioning (daylight period: 16 hours »day: 28 ° C» night: 23 ° C).

EXAMPLE 3 Enzyme detection and measurement of enzymatic activities Approximately 100 g of the green leaves of the transformants or control rice ("Tsukinohikari") were homogenized in 1 ml of ice-cold extraction buffer (50 M HEPES-KOH, pH 7.O, 100 mM). magnesium chloride, 2 mM manganese chloride »1 M sodium pyruvate» 1 M phosphoric acid, 1 M EDTA, 0.1% 2-mercaptoethanol, 20% glycerol, 1 mM phen fluoride Imeti Isulfoni , 1 mM benzamine »1 mM 6-amino-n-caproic acid» isoascorbic acid at 0.2% (w / w), and polyclar AT at 2% (w / v)). The homogenate was centrifuged at 15 »OOO x g for 20 minutes at 4 ° C. Then the supernatant obtained was desalted by passing it through a NAP5 ™ column (manufactured by Pharmacia, Sweden) which had been equilibrated at room temperature with a column pH regulator (50 mM HEPES-KOH »pH 7.0» 10 M of magnesium chloride »2 mM manganese chloride» 1 mM EDTA »2-mercaptoethanol 0.1%» and glycerol 20%) to give a crude extract. The content of chlorophyll in the homogenate was determined by a previously reported method (intermans and deMots (1965) Biochem. Biophys. Acta 109: 448-453), while the protein content in the crude extract was determined using the Protein Assay kit. Kit ™ (manufactured by BioRad »USA).

The expression of the enzymes in the transformants was detected by Western blotting in the following manner. The crude extracts obtained above were subjected to SDS-PAGE to adjust the concentration of proteins at the same level. The separated proteins in the gel were transferred electrically on a nitrocellulose membrane (manufactured by Schleicher S Schüll »Germany) and the expression of each of the proteins was detected using an anti rabbit serum against the corn PEPC protein, PCK protein from Urochloa pañico des, protein CA from spinach or protein PPDK from corn »a goat anti-rabbit IgG conjugated with alkaline phosphatase (manufactured by Organon TekniKa» USA) and AP Immun-Blot Assay KIT ™ equipment (manufactured by BioRad, USA ). The activity of PEPC was determined by measuring the rate of decrease in NADH uptake at 340 nm by using 1 ml of a reaction mixture containing 25 mM HEPES-KOH (pH 8. O), 5 M sulfate magnesium, 4 mM of dithiothreitol »5 M of potassium hydrogen carbonate» 0.25 mM of NADH »1 mM of glucose-6-phosphate» 5 M of phosphoenol pi uvate, 1 U of malate dehydrogenase (manufactured by Boehringer Mannheim, Germany ), and 25 μl of the crude extract. The activity of the PCK was determined by measuring the rate of decrease in the absorption of oxaloacetic acid at 280 nm with the use of 1 ml of a reaction mixture containing 25 M HEPES-KOH (pH 8.O), 4 mM dithiothreitol »0.2 mM of oxaloacetic acid, 1 U of pyruvate kinase (manufactured by Boehringer Mannheim, Germany), O.2 M of ATP and SO μl of the crude extract. The activity of the CA was determined by adding 0.5 ml of water saturated with carbon dioxide and cooled with ice to 0.3 ml of 50 M pH regulator HEPES-KOH (pH 8.0) stained with bromothymol blue and IOl of the crude extract, and measuring the time required until the coloration of the reaction mixture disappeared on the ice. The activity was calculated in accordance with the method reported previously (Burnell, J.N. and Hatch, M.D. (1988) Plant Physiol. 86: 1252-1256). The activity of the PPDK was determined by measuring the rate of decreased absorption of NADH at 340 nm with the use of 1 ml of a reaction mixture containing 25 mM HEPES-KOH (pH 8.0) »10 M d tiotrei tol »10 mM potassium hydrogen carbonate» 8 mM magnesium sulfate, 5 mM ammonium chloride, 2.5 M monosodium acid phosphate, 1 mM ATP »1 mM glucose-6-phosphate» 5 mM pyruvate sodium. O.2 M of NADH »2 U of bad ato dehydrogenase, 2 U of PEPC (manufactured by Wako Puré Chemical Industries» Japan), and 200 μl of crude extract.

EXAMPLE 4 Experiment with tracer using ^ CQ.

Foliar apices (approximately 5 cm) of the rice trans and rice control ("Tsukinohikari"), which had been grown in an air-conditioned greenhouse, were separated, and each cut end was covered with absorbent cotton immersed in water. These samples were placed in an assimilation chamber (approximately 120 ml or 50 ml capacity) manufactured by the inventors. After passing the fresh air at a flow rate of approximately 5 1 per minute for 30 minutes under irradiation at approximately 27, OOO lx, radioactive carbon dioxide gas, which had been generated by mixing 100%, was injected into the closed system. a ISO μl of 60% perchloric acid with a 50% to 70 μCi solution of aH ^^ CO. (manufactured by Amersham, England) in a gas-tight syringe. After a 5-second pulse »the leaves were frozen in liquid nitrogen to stop all biological activities» and then placed in 80% hot ethanol for about 30 minutes, to extract the soluble matter. After a pulse of 5 seconds, open air was introduced into the system. 10, 30 and 90 seconds later »the leaf samples were removed from the chamber and submerged in liquid nitrogen to cease all biological activities. Then the soluble matter was extracted in 80% hot ethanol. The extracts thus obtained were each evaporated in an evaporator. and subjected to two-dimensional thin layer chromatography on Funaseru SF Cellulose Thin Layer Piet ™ (manufactured by Funakoshi Japan »of 20 cm x 20 cm). The development was carried out at room temperature by using a mixture of phenol-water-glacial acetic acid-EDTA at 0.5 M (47: 84: 5.5: 1.14 »v / v) as a primary development solvent and an isovolumic mixture of a solution A (n-ethanol: water 74: 5 »v / v) with a solution B (propionic acid: water» 9:11 »v / v) as secondary development solvent. After completion of the development »the plate was dried» followed by autoradiography with the Analyzer Bas ÍOOO system of Bioimage (Fuji Film »Japan) to determine the relative amount of each spot. Thus, the proportion of the substance labeled with the radioisotope was examined.

EXAMPLE 5 Experiment with tracer using C14C3-mal ato The leaves of the rice transformant and the control ("Tsukinohikari") "that had been grown in a greenhouse with conditioned air" were separated "placed in 10 mM of phosphate pH regulator (pH 6.4)" and then irradiated to 27,000 Ix for 1 hour. Then »these sheets were placed in 100 μl of a solution to which 5 μl of 1 μCi C1- * C-malate (manufactured by Amersham, England) had been added. After a certain period. the leaf samples were extracted. After. the part submerged in the solution was 3A removed and immersed in boiling ethanol at 80% to cease all biological activities. The soluble matter was allowed to elute therefrom by boiling for 30 minutes. The eluted product was evaporated in an evaporator. The substance labeled with the radioisotope was separated by two-dimensional thin-layer chromatography "followed by autoradiography with the Bioimage Analyzer Bas 1000 system to determine the radioactivity of each spot. Thus, the relative amount of the substance labeled with the radioisotope was examined.

EXAMPLE 6 Measurement of photosynthetic activity The rice transformants that have 3 genes introduced in them "and the control (" Tsukinohikari "), which had been grown in the greenhouse with air conditioning, were transferred to be grown in a growth cabinet (daylight period: 12 hours »lighting: approximately 35» 000 Ix »25 ° C) to achieve its acl ization. Then, the photosynthetic activities of fully expanded leaves that showed no symptoms of senescence were measured by the use of a photosynthesis measuring system (LI-6200, manufactured by Ll-COR, E.U.A.).

EXAMPLE 7 Production of transgenic rice through the photosynthetic CA pathway of the PCK type, and determination data Transforming individuals were obtained for each genetic construct prepared above »and the expression of the transgenes was examined by Western blotting. Among 19 transformants of rice that had the pDPN gene construction introduced in them (transformants with PEPO), the expression of the PEPC protein was confirmed in 15 transformants Among 31 rice transformants that have the pDKS gene construction introduced in them (transformants with PCK), the expression of the PCK protein was confirmed in 20 transformants Among 41 rice transformants having the pDCS gene construct introduced therein (transformants with CA), the expression of the CA protein was confirmed at relatively high levels in 3 transformants Among 21 rice transformants that have the pSB4PK genetic construct introduced into them (transformants with two genes), the expression of two proteins, ie PEPC and PCK, was confirmed in 12 transformants. have the genetic construction PSB4CPK introduced in them (transformants with three genes), the expression of three proteins, ie CA, PEPC and PCK, in 15 transformants. Among 72 rice transmen that have the genetic construct pSB4CiPiKiDi introduced in them (transformants with four genes), the expression of 4 proteins, ie CA, PEPC, PCK and PPDK, was confirmed in 22 transformants. Among these rice transformants, Rl progenies were obtained by showing relatively high expression levels of the enzymes introduced therein. The activity of each enzyme was then examined in crude extracts of green leaves. Table 1 shows the results. As clearly shown in Table 1, the crude extracts of the transformants of the Rl generation showed higher activities of the enzymes introduced therein, than those in the control rice ("Tsukinohikari"). These facts indicate that the enzymes expressed from the genes introduced in the transformants »exhibit their enzymatic activities. The genetic constructs for the introduction of the PCK used in this example were chimeric genes to which the region encoding the transit peptide of the small subunit of the rice Rubisco had been added, similar to those previously reported (public description of Japanese Patent Hei 8-80197). Thus, the PCK protein can be localized in chloroplasts due to the action of the transit peptide.

TABLE 1 Enzyme activity in rice transformants Enzymatic activity (U / mg chlorophyll) CA PEPC PCK PPDK transformant with CA 18, 760 0.458 0 nd transformant with PEPC 2,250 1,880 O nd transformant with PCK 1 »364 0.474 7,744 nd transformant with 2 genes 2,143 1,171 5,780 nd transformant with 3 genes 9,269 1,071 3,001 nd transformant with 4 genes 9,450 1,490 3,170 O. 3 control (Tsukinohikari) 2,171 O.322 O O.2 ' nd: not determined "CO ... was supplied to leaf sections of Rl generation plants of rice transformants that have 2 and 3 genes introduced in them and control (Tsukinohikari)." After 5 seconds, the biological activities in the tissues, and the relative amount of labeled C4 compounds was examined.As a result, it was found that the contents of labeled malate and labeled aspartic acid in the transformants were, respectively, about 10 times and approximately 2 times higher than those in the sample 3S control (see table 2). These facts indicate that the introduced PEPC functioned in the green foliar tissues of the transformants "so that the first process of fixing carbon dioxide in the photosynthetic pathway C4 was carried out in them.

TABLE 2 Experiment with tracer using, CQa Uptake of - »C (%) malate aspartate (Tsukinohikari) 0.7 0.9 transformant with 2 genes 9.8 2.0 transformant with 3 genes 8.1 1.9 In the same way, "CO ^ was supplied, for 5 seconds, to leaf sections of Rl generations of the rice transformants that have two» three or four genes introduced in them »as well as the control of rice (Tsukinohikari) and the corn control Subsequently, the behavior of C4 compounds was followed over time • In rice transformants, the labeled C4 compounds decreased in a similar way as in the case of corn (ie a C4 plant). »The C4 compounds marked in the rice control showed no significant change (see Fig. 3) .These facts indicate that» in the rice transformants »the C4 compounds formed by the carbon dioxide fixation by the introduced PEPC were immediately metabolized into other substances, similar to the phenomena observed in the green foliar tissues of C4 plants, C ^ ^ Ci-malate was supplied to leaf sections of the progenies Rl d e the rice transformants that have 2 and 3 genes introduced in them and the control (Tsukinohikari). After 15 minutes »the biological activities in the tissues ceased» and the proportion of the labeled compounds was examined. As a result, it was found that the relative amount of labeled sucrose in the transformants was approximately 3 times higher than that in the control sample (see Table 3). This fact indicates that the introduced PCK functioned in the green foliar tissues of the rice transorders, so that carbon dioxide was transferred from the C4 compound in the C4 photosynthetic pathway to the Cal vin-Benson cycle.

TABLE 3 Experiment with tracer using ca - »C3- alato Uptake of "C in sucrose (%) control (Tsukí nohikar) 6.2 transformant with 2 genes 15.7 transformant with 3 genes 22.5 The photosynthetic activities of the Rl progenies of the rice transformants having 3 genes introduced in them and the control of rice (Tsukinohikari) were measured while the concentration of the carbon dioxide supplied in the leaves was varied. The rate of photosynthesis against the intercellular concentration of carbon dioxide was plotted (see Fig. 4). As a result, the intercellular concentration of carbon dioxide of the transformant, at the point where it was assumed that the apparent photosynthetic activity (ie, the intersection on the? Axis of the line in Figure 4) would disappear, was less than that of the control of rice. This fact means that the compensation point of C0.x. of the rice transformant is smaller than that of the control. In general, C4 plants show CO compensation points, lower than those of C3 plants.

Thus, it can be concluded that the rice transformants constructed in the present are similar, in photosynthetic characteristics, to the C4 plants »compared to the rice control. The results described above indicate that rice transformants having 2 and 3 genes introduced therein contain active forms of the enzymes related to C4 photosynthesis, which are the products of expression of the introduced genes and, in addition, that the pathway C4 photosynthetic works on these plants to improve photosynthetic potency. Accordingly, the present invention allows the C4 photosynthetic pathway of the PCK type to function in C3 plant cells to thereby alter the photosynthetic potency.

EFFECTS OF THE INVENTION According to the present invention, a cyclic reaction similar to the C4 photosynthetic pathway of C4 plants can be activated in cells of the mesophyll of C3 plants in order to impart in the latter a function of increasing the concentration of carbon dioxide in the chloroplasts. »And another function to prevent photoinhibition due to the consumption of ATP. Due to improved otosynthetic power, it is expected that plants acquiring these functions achieve a high yield in dry weight "improved drought resistance" improved resistance to high temperatures "improved tolerance to high light intensities" and improved photosynthetic power under conditions of low concentration of carbon dioxide.UENCES (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 930 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (genomic) (vi) ORIGINAL SOURCE: (A) ORGANISM: Zea mays (B) CLASS: Inbred line B73 (ix) CHARACTERISTICS: Gene promoter region for type C4 (partial) PPDK ( ? i) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: i: CTAAAGACAT GGAGGTGGAA GGCCTGACGT AGATAGAGAA GATGCTCTTA GCTTTCATTG 60 TCTTTCTTTT GTAGTCATCT GATTTACCTC TCTCGTTTAT ACAACTGGTT TTTTAAACAC 120 TCCTTAACTT TTCAAATTGT CTCTTTCTTT ACCCTAGACT AGATAATTTT AATGGTGATT 180 TTGCTAATGT GGCGCCATGT TAGATAGAGG TAAAATGAAC TAGTTAAAAG CTCAGAGTGA 240 TAAATCAGGC TCTCAAAAAT TCATAAACTG TTTTTTAAAT ATCCAAATAT TTTTACATGG 300 AAAATAATAA AATTTAGTTT AGTATTAAAA AATTCAGTTG AATATAGTTT TGTCTTCAAA 360 AATTATGAAA CTGATCTTAA TTATTTTTCC TTAAAACCGT GCTCTATCTT TGATGTCTAG_420_TTTGAGACGA TTATATAATT TTTTTTGTGC TTACTACGAC GAGCTGAAGT ACGTAGAAAT 480 ACTAGTGGAG TCGTGCCGCG TGTGCCTGTA GCCACTCGTA CGCTACAGCC CAAGCGCTAG_540_AGCCCAAGAG GCCGGAGTGG AAGGCGTCGC GGCACTATAG CCACTCGCCG CAAGAGCCCA 600 AGAGACCGGA GCTGGAAGGA TGAGGGTCTG GGTGTTCACG AATTGCCTGG AGGCAGGAGG 660 CTCGTCGTCC GGAGCACAGG CGTGGAGAAC GTCCGGGATA AGGTGAGCAG CCGCTGCGAT 720 AGGCGCGTGT GAACCCCGTC GCGCCCCACG GATGGTATAA GAATAAAGGC ATTCCGCGTG 780 CAGGATTCAC CCGTTCGCCT CTCACCTTTT CGCTGTACTC ACTCGCCACA CACACCCCCT 840 CTCCAGCTCC GTTGGAGCTC CGGACAGCAG CAGGCGCGGG GCGGTCACGT AGTAAGCAGC 900 TCTCGGCTCC CTCTCCCCTT GCTCCATATG (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 153 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA for mRNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Qryza sativa (B) CLASS: Nihonbare (ix) CHARACTERISTICS: Region of the transit peptide sequence from 1 to small subunit of Rubisco ( xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 2: ATG GCC CCC TCC GTG ATG GCG TCG TCG GCC ACC ACC GTC GCT CCC TTC 48 Met Wing Pro Ser Val Met Wing Ser Ser Wing Thr Thr Val Wing Pro Phe 1 5 10 15 CAG GGG CTC AAG TCC ACC GCC GGC ATG CCC GTC GCC CGC CGC TCC GGC 96 Gln Gly Leu Lys Ser Thr Wing Gly Met Pro Val Wing Arg Arg Ser Gly 20 25 30 AAC TCC AGC TTC GGC AAC GTC AGC AAT GGC GGC AGG ATC AGG TGC ATG 144 Asn Ser Ser Phe Gly Asn Val Ser Asn Gly Gly Arg lie Arg Cys Met 35 40 45 CAG TCT AGA 153 Gln Ser Arg 50 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 697 base pairs (B) TYPE: nucleic acid (OR TYPE OF CHAIN: double (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: cDNA for mRNA (vi) ORIGINAL SOURCE: (A) ORGANISM: Spinacea olerácea (i?) CHARACTERISTICS: mRNA for carbonic anhydrase without coding region of the transit peptide (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 3: CC ATG GAG TTA GCC GAC GGT GGC ACA CCA TCC GCC AGT TAC CCG GTT 47 Met Glu Leu Wing Asp Gly Gly Thr Pro Be Wing Ser Tyr Pro Val 5 10 15 CAG AGA ATT AAG GAA GGG TTT ATC AAA TTC AAG AAG GAG AAA TAC GAG 95 Gln Arg lie Lys Glu Gly Phe lie Lys Phe Lys Lys Glu Lys Tyr Glu 20 25 30 AAA AAT CCA GCA TTG TAT GGT GAG CTT TCT AAG GGC CAÁ GCT CCC AAG 143 Lys Asn Pro Wing Leu Tyr Gly Glu Leu Ser Lys Gly Gln Wing Pro Lys 35 40 45 TTT ATG GTG TTT GCG TGC TCA GCC TCC CGT GTG TGT CCC TCG CAC GTA 191 Phe Met Val Phe Ala Cys Ser Asp Ser Arg Val Cys Pro Ser His Val 50 55 60 CTA GAT TTC CAG CCC GGT GAG GCT TTC ATG GTT CGC AAC ATC GCC AAC 239 Leu Asp Phe Gln Pro Gly Glu Wing Phe Met Val Arg Asn lie Wing Asn 65 70 75 ATG GTG CCA GTG TTT GAC AAG GAC AAA TAC GCT GGA GTC GGA GCC GCC 287 Met Val Pro Val Phe Asp Lys Asp Lys Tyr Wing Gly Val Gly Ala Wing 80 85 90 95 ATT GAA TAC GCA GTG TTG CAC CTT AAG GTG GAG AAC ATT GTC GTG ATT 335 lie Glu Tyr Ala Val Leu His Leu Lys Val Glu Asn lie Val Val lie 100 105 110 GGA CAC AGT GCT TGT GGT GGA ATC AAG GGG CTT ATG TCT TCT CCA GAT 383 Gly His Ser Wing Cys Gly Gly lie Lys Gly Leu Met Ser Ser Pro Asp 115 120 125 GCA GGA CCA ACC ACT ACT GAT TTT ATT GAG TGT TGG GTC AAA ATC TGC 431 Wing Gly Pro Thr Thr Thr Asp Phe lie Glu Asp Trp Val Lys lie Cys 130 135 140 TTG CCT GCC AAG CAC AAG GTG TTA GCC GAG CAT GGT AAT GCA ACT TTC 479 Leu Pro Ala Lys His Lys Val Leu Ala Glu His Gly Asn Ala Thr Phe 145 150 155 GCT GAA CAÁ TGC ACC CAT TGT GAA AAG GAA GCT GTG AAT GTA TCT CTT 527 Wing Glu Gln Cys Thr His Cys Glu Lys Glu Wing Val Asn Val Ser Leu 160 165 170 175 GGA AAC TTG TTG ACT TAC CCA TTT GTA AGA GAT GGT TTG GTG AAG AAG 575 Gly Asn Leu Leu Thr Tyr Pro Phe Val Arg Asp Gly Leu Val Lys Lys 180 185 190 ACT CTA GCT TTG CAG GGT GGT TAC TAC GAT TTT GTC AAT GGA TCA TTC 623 Thr Leu Ala Leu Gln Gly Gly Tyr Tyr Asp Phe Val Asn Gly Ser Phe 195 200 205 GAG CTA TGG GGA CTC GAA TTC GGC CTC TCT CCT TCC CA TCT GTA 668 Glu Leu Trp Gly Leu Glu Phe Gly Leu Ser Pro Ser Gln Ser Val 210 215 220 TGAACCAACA CAACCATTTG ACTGCATGC 697 (2) INFORMATION FOR SEQ ID N?: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 pairs of bases (B) TYPE: nucleic acid (OR TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID N0: 4: CTAAAGACAT GGAGGTGGAA G 21 (2) INFORMATION FOR SEQ ID NQ: 5i (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (OR TYPE OF CHAIN: ind idual (D) TOPOLOGY: linear < ii> TYPE OF MOLECULE: DNA (synthetic) (? i) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 5? GTAGCTCGAT GGGTGCACG 19 (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: ind vidual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 6: GCCATGGCGC GGCGGGAAGC TAAGCACGGA AGCGA 35 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: ind vidual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (? i) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: 7: GCTCTAGATC TCTGGCACGT GAATATGGCC CCAACCTCG 39 (2) INFORMATION FOR SEQ ID N0: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: individual (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (synthetic) (? I) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: B: CAGTGCATGC CGCCGAACAG GCATACAGAT TTACACCAG 39 (2) INFORMATION FOR SEQ ID N0: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: individual (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (synthetic) (? I) DESCRIPTION OF THE SEQUENCE: SEQ ID N?: 9: GGAATTCCAT GGTGCATCTC AAGAAGTAC 29 (2) INFORMATION FOR SEQ ID N?: I ?: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCR IPTION OF THE SEQUENCE: SEQ ID N? : i? : GCTCTAGACT GCATGCACCT GATCC 25 (2) INFORMATION FOR SEQ ID N0: li: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (synthetic) (? i) DESCRIPTION OF SEQUENCE: SEQ ID N?: ll: GGAATTCCAT GGCCCCCTCC GTGATGG 27 (2) INFORMATION FOR SEQ ID NO: 12"(i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: ind vidual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID N0: 12: GGTGGCACAG ATAACCATGG ATCCAGTTAG CCGACGGTGG C 41 (2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: individual (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: l3: TAGCTCGATG GGTTGCACGA TCATATGGAG CAAGG 35 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 56 base pairs (B> TYPE: nucleic acid (OR CHAIN TYPE: ind vidual ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: TTTCATATGG CGCCCGTTCA ATGTGCGCGT TCGCAGAGGG TGTTCCACTT CGGCAA (2) INFORMATION FOR SEQ ID N0: l5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID N0: l5: GTACTCCTCC ACCCACTGCA 20

Claims (5)

NOVELTY OF THE INVENTION CLAIMS

1. - A method for transforming a C3 plant »characterized in that it comprises introducing a gene coding for a phosphoenol pyruvate carbo? lasa (PEPC) and a gene encoding a phosphoenolpyruvate carboxykinase (PCK) that has been linked to a DNA fragment encoding a transit peptide in a C3 plant, such that the introduced genes will function to supply the plant with a photosynthetic path C4.

2. A method according to claim 1, characterized in that a gene coding for a carbonic anhydrase (CA) is also introduced into the plant C

3. 3. A method according to claim 1, characterized in that a gene coding for a pyruvate orthophosphate dithinase (PPDK) is also introduced into a C3 plant.

4. A method according to any of the rei indications 1 to 3, characterized in that a promoter sequence is a specific promoter sequence of photosynthetic tissue.

5. A method according to any of claims 1 to 4 »characterized in that two or more of said genes are carried in an individual genetic construct capable of introducing them in a plant» by means of which the genes are introduced in a C3 plant. & - A chimeric gene "characterized in that it comprises a gene encoding a phosphoenolpyruvate carboxylase (PEPO) and a gene encoding a phosphoenolpyruvate carboxykinase (PCK)" that has been linked to a DNA fragment encoding a transit peptide 1.- A plant that has been transformed by a method according to any of claims 1 to 5, characterized in that said plant has a C4 otosynthetic pathway.