MXPA98006104A - Compositions and methods to determine the susceptibility and resistance to antiviral drug and the antivi drug examination - Google Patents

Abstract

The present invention relates to a method for determining the susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a segment derived from a patient and a reporter gene into a host cell; the host cell of (a), (c) measuring the expression of the reporter gene in a target host cell, and (d) comparing the expression of the reporter gene of (c) with the expression of the reporter gene measured when the steps (a) ) - (c) are carried out in the absence of the antiviral drug, where a test concentration of the antiviral drug is present in steps (a) - (c), in steps (b) - (c), or in step (c). This invention also provides a method for determining a resistance to the antiviral drug in a patient. This invention also provides a method for evaluating the effectiveness of a candidate antiviral drug compound. Compositions are provided including resistance test vectors comprising a segment derived from the patient and a reporter gene and the host cells transformed with resistance test vectors.

Description

COMPOSITIONS AND METHODS TO DETERMINE THE SUSCEPTIBILITY AND RESISTANCE TO THE ANTIVIRAL DRUG AND THE EXAMINATION OF ANTIVIRAL DRUG Technical field This invention relates to tests of susceptibility and resistance to antiviral drug that are to be used to identify effective drug regimens for the treatment of viral infections. The invention further relates to novel vectors, host cells and compositions for carrying out these tests for susceptibility and resistance to the antiviral drug. This invention also relates to the candidate drug test for its ability to inhibit viral sequences and / or selected viral proteins. More particularly, the invention relates to the use of recombinant DNA technology to first construct a resistance to the test vector comprising a segment derived from the patient and an identifying gene, and then introducing the resistance test vector into a host cell, and determining the expression or inhibition of the indicator gene product in a target host cell in the presence of an antiviral drug. This invention also relates to the means and methods for identifying antiviral drugs which have different patterns of resistance when compared to existing antiviral drugs. This invention also relates to methods and compositions for the identification and evaluation of the biological effectiveness of potential therapeutic compounds. This invention is more particularly related to susceptibility and drug resistance tests useful in providing an optimal therapeutic regimen for the treatment of various viral diseases, including, for example, human immunodeficiency virus / AIDS and hepatitis.

Background of the Invention Resistance to Viral Drug The use of antiviral compounds for chemotherapy and chemoprophylaxis of viral diseases is a relatively new development in the field of infectious diseases, particularly when compared with more than 50 years of experience with antibacterial antibiotics. The design of antiviral compound is not simple because several viruses present a number of unique problems. Viruses must be duplicated intracellularly and frequently employ host cell enzymes, macromolecules, and organelles for the synthesis of virus particles. Therefore, safe and effective antiviral compounds must be able to discriminate between cell functions and specific viruses with a high degree of efficiency. In addition, due to the nature of virus duplication, evaluation of the in vitro sensitivity of virus isolates to antiviral compounds should be carried out in a complex culture system consisting of living cells (e.g., tissue culture). The results of these assay systems vary widely according to the type of tissue culture cells which are employed and the conditions of the assay. Despite these complexities, nine drugs have been approved for AIDS therapy, five reverse transcriptase inhibitors AZT, ddl, ddC, d4T, 3TC, a non-nucleoside reverse transcriptase inhibitor, nevirapine and three saquinavir protease inhibitors, ritonavir and indinovir and several additional antiviral drug candidates have recently been developed such as nelfinavir, delaviridin, VX-478 and 1592.

Resistance to the viral drug is a substantial problem due to the high rate of mutation frequencies and viral duplication. The drug-resistant mutants were first recognized by the pox virus with tiosemicarbazine (Appleyard and Way (1966) Brit. J. Exptl. Pathol. 47, 144-51), for the polio virus with guanidine (Melnic et al. (1961) Science 134, 557), for the influenza virus with amantadine ( Oxford and others (1979) Nature 226, 82-83; Cochran and others (1965) Ann. NY Acad Sci 130, 423-429) and for the herpes simplex virus with iododeoxyuridine (Jawetz et al. (1970) Ann. NY Acad SCi 173, 282-291). Approximately 75 mutations of drug resistance of human immunodeficiency virus to various antiviral agents have been identified to date (Mellors et al. (1995) International Antiviral News, supplement and Condra, JH et al. (1996) J. Virol 70, 8270- 8276).

The efficient and small genomes of the viruses have lent themselves to the intensive research of the molecular genetics, the structure and the reproductive cycles of the most important human viral pathogens. As a consequence, sites and mechanisms have been characterized by both activity and resistance to antiviral drugs more precisely than those for any other class of drugs (Richman (1994) microbiology streams 2, 401-407). The possibility that resistant mutants emerge is a function of at least four factors: 1) the frequency of the viral mutation; 2) the intrinsic mutability of the viral target site with respect to the specific antiviral; 3) the selective pressure of the antiviral drug; and 4) the magnitude and rate of virus duplication. Regarding this first factor, for single strain RNA viruses, whose genomic duplication lacks a test reading mechanism, the mutation frequencies are approximately 3 x 10"5 per base pair per duplicative cycle (Holland et al. (1992) Curr. Tropics Microbial Immunol., 176, 1-20, Mansky et al. (1995) J Virol., 69, 5087-94, Coffin (1995) Science 267, 483-489.) Thus, a 10-kilobase genome. Only one, such as that of the human immunodeficiency virus (HIV), would be expected to contain on average one mutation for every three progenia viral genomes.As for the second factor, the intrinsic mutability of the viral target site in response to a specific antiviral agent can significantly affect the possibility of resistant mutants.For example, zidovudine (AZT) selects mutations in the human immunodeficiency virus reverse transcriptase more rapidly in vitro and in vivo than do the other d4T analogues. ogo thymidine approved (stavudine).

A perhaps inevitable consequence of the action of an antiviral drug is that it confers a sufficient selective pressure on the duplication of the virus to select drug-resistant mutants (Herrmann et al. (1977) Ann NY Acad Sci 284, 623-7) . With respect to the third factor, with increased exposure to the drug, the selective pressure on the duplicating virus population increases to promote the more rapid emergence of drug-resistant mutants. For example, higher doses of AZT tend to select drug-resistant viruses more rapidly than do lower doses (Richman et al. (1990) J. AIDS 3, 743-6). This selective pressure for the resistant mutants increases the possibility of such mutants arising whenever significant levels of virus duplication are sustained.

The fourth factor, the magnitude and rate of reproduction of the virus population, has major consequences on the possibility of the emergence of resistant mutants. Many virus infections are characterized by high levels of virus duplication with high rates of virus turnover. This is especially true in relation to chronic infections with the human immunodeficiency virus as well as hepatitis B and C viruses. The possibility of the emergence of AZT resistance increases in patients infected with human immunodeficiency virus with diminishing CD4 lymph cell counts. which are associated with increased levels of HIV duplication (in the same place). r Higher levels of viruses increase the likelihood of existing mutants. It has been shown that the emergence of a resistant population results from the survival and selective proliferation of a previously existing subpopulation that emerges at random in the absence of selective pressure. All "viruses have a baseline mutation rate, with estimates of approximately 1010 the new virions being generated daily during human immunodeficiency virus infection (Ho et al. (1995) Nature 373, 123-126), a mutation rate of 10"4 to 10" 5 per nucleotide ensures the pre-existence of almost any mutation at any time during infection with the human immunodeficiency virus. Evidence is accumulating that drug-resistant mutants do indeed exist in subpopulations of individuals infected with human immunodeficiency virus (Najera et al. (1994) human retrovirus AIDS response 10, 1479-88; Najera et al. (1995) J Virol 69, 23-31). The pre-existence of the picornavirus mutants resistant to the drug at a rate of approximately 10"5 is very well documented (Ahmad et al. (1987) Antiviral research 8, 27-39).

Human Immunodeficiency Virus (HIV) The acquired immune deficiency syndrome (AIDS) is a fatal human disease, generally considered one of the most serious diseases that have affected humanity. Globally, the numbers of individuals infected with the human immunodeficiency virus (HIV) and cases of AIDS increase incessantly and it is believed that efforts to limit the course of the pandemic, some consider it to be of limited effectiveness. Two types of human immunodeficiency virus have been recognized: HIV-1 and HIV-2. As of December 31, 1994, a total of 1,025,073 cases of AIDS had been reported by the world health organization. This is only a part of the total cases, and the world health organization estimates that by the end of 1994, allowing a subdiagnosis, and a lower report and delays in the report, and based on the estimated number of immunodeficiency virus infections human, there must be around 4.5 million cumulative AIDS cases worldwide (Mertens et al. (1995) AIDS 9 (Supplement A), S259-S272). Since HIV began its spread in North America, Europe and sub-Saharan Africa, about 19.5 million men, women and children are estimated to have become infected (the same place). One of the distinguishing characteristics of the pandemic has been its global spread within the last 20 years, with around 190 countries reporting AIDS cases to date. The projections of the global human immunodeficiency virus infection by the world health organization are alarming. The projected cumulative total of adult AIDS cases for the year 2000 is almost 10 million. By the year 2000, the cumulative number of AIDS-related deaths in adults is predicted to rise to more than 8 million from the total account of around 3 million.

HIV-1 and HIV-2 are retroviruses enveloped with a diploid genome having two identical RNA molecules. The molecular organization of HIV is (5 ') U3-R-U5-gag-pol-env-U3-R-U5 (3') as shown in Figure la. The sequences U3, R and U5 form the long terminal repeats (LTR) which are the regulatory elements that promote the expression of viral genes and sometimes of nearby cellular genes in infected hosts. The internal regions of the viral RNA code for the structural proteins: gag (core proteins p55, pl7, p24 and p7), pol (protease plO, reverse transcriptase p66 and p51 and integrase p32) and env (glycoproteins of over gpl20 and gp41) . The gag codes for a polyprotein precursor that is divided by a viral protease into three or four structural proteins; the pol codes for reverse transcriptase (RT) and the viral protease and integrase; the env codes for the transmembrane and another glycoprotein of the virus. The gag and pol genes are expressed as a genomic RNA while the env gene is expressed as a divided subgenomic RNA. In addition to the env gene there are other HIV genes produced by divided subgenomic RNAs that contribute to the reproduction and biological activities of the virus. These genes include: tat which encodes a protein that activates the expression of viral and some cellular genes; the rev that encodes a protein that promotes the expression of split-unique or undivided viral mRNAs; the nef which encodes a myristilated protein that seems to modulate viral production under certain conditions; vif which encodes a protein that affects the ability of virus particles to infect target cells but does not appear to affect viral expression or transmission by cell-to-cell contact; vpr which encodes a protein associated with virion; and the vpu which encodes a protein that appears to promote the extracellular release of viral particles.

No disease better exemplifies the problem of viral drug resistance than AIDS. The isolates of Drug resistant HIV has been identified by inhibitors of nucleoside reverse transcriptase or without nucleoside and for protease inhibitors. The emergence of HIV isolates resistant to AZT is not surprising since AZT and other reverse transcriptase inhibitors only reduce the replication of the virus by about 90 percent. The high rates of virus reproduction in the presence of selective pressure of a drug treatment provides ideal conditions for the emergence of drug resistant mutants. Patients in later stages of infection who have higher levels of virus duplication develop resistant viruses with AZT treatment more rapidly than those in the early stages of infection (Richman et al. (1990) J AIDS 3, 743-6). The initial description of the emergence of resistance to AZT identified escalated and progressive reductions in drug susceptibility (Larder et al. (1989) Science 243, 1731-1734). This was explained by the recognition of multiple mutations in the gene for reverse transcriptase that contributed to reduced susceptibility (Larder et al. (1989) Science 246, 1155-1158). These mutations have an additive or even synergistic contribution to the reduced susceptibility phenotype (Kellam et al. (1992) Proc. Nati, Acad. Sci. 89, 1934-1938). The cumulative acquisition of such mutations resulted in progressive decreases in susceptibility. Similar effects have been seen with nucleoside reverse transcriptase inhibitors (Nunberg et al. (1991) J Virol 65, 4887-4892; Sardanna et al. (1992) J Biol Chem 267, 17526-17530). Studies of protease inhibitors have found that the selection of HIV strains with a reduced susceptibility to the drug occur within weeks (Ho et al. (1994) J Virol 68, 2016-2020; Kaplan et al. (1994) Proc. Nati Acad. Sci. 91, 5597-5601). While recent studies have shown that protease inhibitors are more powerful than reverse transcriptase inhibitors, resistance has nonetheless developed (Condra et al., And report of the third conference on retroviruses and opportunistic infections, March nineteen ninety six) . Subtherapeutic drug levels, whether caused by reduced dosage, drug interactions, malabsorption or reduced bioavailability due to other factors, or self-imposed drug parties, all allow for increased viral duplication and increased opportunity for mutation and resistance (same).

The selective pressure of the drug treatment allows the growth of pre-existing mutants. With continued viral replication in the absence of a fully suppressive antiviral drug activity, the cumulative acquisition of multiple mutations may occur over time, as described for protease inhibitors and AZT HIV. Indeed the multiplication of viral mutants resistant to different drugs has been observed (Larder et al. (1989) Science 243, 1731-1734, Larder et al. (1989) Science 246, 1155-1158, Condra et al. (1995) Nature 374 , 569-71). With the inevitable emergence of resistance in many viral infections, such as with the human immunodeficiency virus for example, strategies should be designed to optimize treatment against resistant virus populations. The determination of the contribution of drug resistance to the failure of said drug is a difficult problem because the patients who are most likely to acquire resistance to drugs are more likely to have other confounding factors that will predispose them. to a poor prognosis (Richman (1994) AIDS Res Hum Retroviruses 10, 901-905). 'In addition, patients contain mixtures of viruses with different susceptibilities.

Hepatitis B (HBV) HBV is a causative agent for acute and chronic hepatitis, which hits around 200 million patients worldwide. Zuckerman A. J. Trans. R. Soc. Trop. Med. Hygiene (1982) 76, 711-718. HBV infection acquired in adult life is often not clinically apparent, and more acutely infected adults recover completely from the disease and leave the virus. Rarely, however, acute liver disease can be so severe that the patient dies of fulminating hepatitis. A small fraction, perhaps 5 to 10 percent of acutely infected adults, are persistently infected by the virus and develop a chronic liver disease of varying severity. The neonatally transmitted HBV infection, however, is rarely clarified and more than 90% of children become chronically infected. Because HBV is commonly spread from the infected mother to the newborn infant in densely populated areas of Africa and Asia, several hundred million people throughout the world are persistently affected by HBV for most of their lives and suffer of varying degrees of chronic liver disease, which greatly increase your risk of developing cirrhosis and hepatocellular carcinoma (HCC >; . In fact, the risk of hepatocellular carcinoma is increased 100-fold in patients with chronic hepatitis, and the lifetime risk of hepatocellular carcinoma in men infected at birth reaches 40%. Beasley RP et al., Lancet (1981) 2, 1129-1133. Thus, a large fraction of the world's population suffers and dies of these late complications of HBV infection. The development of anti-HBV drugs has been expected for a long time, but has been impaired by the too narrow host range of HBY-HBV duplicates mainly in human and chimpanzee livers and not in experimental animals or in culture cells. . Tiollais, P and others. Nature (London) (1985) 317, 489-495.

The hepatitis B virus is a DNA virus with a compact genomic structure; Despite its 3200 base pairs of small circular, HBV DNA codes for four sets of viral products and has a complex multiple particle structure. In HBV it achieves its genomic economy by relying on an efficient strategy of coding proteins from four overlapping genes: S, C, P and X. HBV is one of a family of animal viruses, hepadnavirus, and is classified as type 1 hepadnavirus. similar viruses infect certain species of marmots, certain ground and tree squirrels and Pekin ducks. All hepadnaviruses, including HBV, share the following characteristics: 1) there are three distinctive morphological forms, 2) all members have proteins that are also functional and structural counterparts for HBV envelope and nucleocapsid antigenes, 3) these are duplicated within the liver but can also exist in extrahepatic sites, 4) they contain an endogenous DNA polymerase with both DNA polymerase activities dependent on RNA- and DNA, 5) their genomes are circular DNA molecules of partially doubled taste, 6) these are associated with acute and chronic hepatitis and hepatocellular carcinoma and 7) the reproduction of its genome goes through an intermediate RNA which is reverse transcribed in DNA using the DNA polymerase activity dependent on the endogenous RNA of the virus in a manner analogous to that seen in retroviruses. In the nucleus of the infected liver cells, the partially double-wise DNA is converted to double-covalently closed circular DNA (cccDNA) by the DNA-dependent DNA polymerase. The transcription of the viral DNA is achieved by a host RNA polymerase and gives rise to several RNA transcripts that differ in their initiation sites but all end in a common polyadenylation signal. The longest of these RNA acts as the pregenome for the virus as well as the message for some of the viral proteins. The viral proteins are tranred from the progenomic RNAs, and the proteins and the pregenome RNA are packaged in virions and secreted from the hepatocyte.

Although HBV is difficult to grow in vitro, several cells have been successfully tranted with HBV DNA resulting in the in vitro production of HBV particles.

There are three particulate forms of HBV: the non-infectious 22 nm particles which appear as either spherical or long filament forms, and the 42 nm double-shell spherical particles which represent the infectious hepatitis B virion intact. The envelope protein HBsAg is the product of the S HBV gene and was found on the outer surface of the virion and on the smaller spherical and tubular structures. Upstream of the open reading frame of the S gene are the open reading frames of the pre-S, pre-Sl and pre-S2 gene, which encode the pre-S gene products; including receptors on the HBV surface for polymerized human serum albumin and binding sites for hepatocyte receptors. The intact 42 nm virion can be disrupted by mild detergents and the 27 nm nucleocapsid core particle isolate. The nucleus is composed of two nucleocapsid proteins encoded by the C gene. The C gene has two initiation codons defining a nucleus and a pre-core region. The major antigen expressed on the nucleocapsid core surface is encoded by the core region and is referred to as the hepatitis B core antigen (HBcAg). Antigen B of hepatitis B (HBeAg). The hepatitis B antigen (HBeAg) is produced from the same C gene by initiation into the pre-core ATG.

Also packed inside nucleocapsid nucleus is a DNA polymerase, which directs the duplication and repair of HBV DNA. The DNA polymerase is encoded by the P gene, the third and the longest of the HBV genes. The enzyme has both DNA-dependent DNA polymerase activities and RNA-dependent reverse transcriptase and is also required for efficient encapsidation of pregenomic RNA. The fourth gene X, encodes an associated protein without small particle which has been shown to be able to transactivate the transcription of both viral and cellular genes.

Even though HBV reproduction is well known, the initial steps in HBV infection have not been well defined. Cellular receptors or attachment sites on virions can not be studied without appropriate tissue culture assays. In an effort to refer to this problem, certain cell lines have been developed, human hepatoblastoma cells Huh (HB 611) (Ueda, K. and others, Virology (1989) 169, 213-216) and HepG2 cells (Galle , PR and Theilmann, L. Arzneim-Forsch, Drug Res. (1990) 40, 1380-13829 for the evaluation of anti-HBV drugs.

Recently, stress has focused on the molecular variants of HBV. Variation occurs across the HBV genome and clinical isolates of HBV that do not express viral proteins have been attributed to mutation at individual or even multiple gene sites. For example, variants have been described which lack nucleocapsid proteins, envelope proteins, or both. Two mutants have attracted attention. The first is found in certain patients with a severe chronic HBV infection. These patients were found to be infected with a mutant HBV that contained an alteration in the "prenucleus region making the virus unable to encode HBeAg." The mutation most commonly found in such patients is a single-base substitution from G to A which occurs in the second before the last codon of the pre-C gene in nucleotide 1896. This substitution results in the replacement of the tryptophan codon TGG by a stop codon (TAG), which prevents the translation of HBeAg. Preclear patients who are unable to secrete HBeAg tend to have severe liver disease that progresses rapidly to cirrhosis and does not respond easily to antiviral therapy.

The second category of HBV mutants consists of escape mutants, in which a single substitution of acid wine, from glycine to arginine, occurs at position 145 of the immunodominant a common determinant for all subtypes of HBsAg. This change in HBsAg leads to a critical conformational change resulting in a loss of neutralizing activity by the anti-HBs antibody.

Currently available Viral Resistance Tests The definition of viral drug susceptibility is generally understood to be the concentration of the antiviral agent in which a given percentage of viral duplication is inhibited (for example, the ICS0 for an antiviral agent is the concentration at which 50% of the duplication of virus is inhibited). Therefore, a decrease in viral drug susceptibility is the contrast that an antiviral has selected for the mutant virus that is resistant to the antiviral drug. Resistance to the viral drug is generally defined as a decrease in the susceptibility of a viral drug in a given patient over time. In the clinical context, resistance to the viral drug is evidenced by the antiviral drug being less effective or no longer being clinically effective in a patient.

Currently, the tools available to the researcher and clinician to establish antiviral drug susceptibility and resistance are inadequate. The classical test to determine the resistance and sensitivity to the human immunodeficiency virus for an antiviral agent is complex, time-consuming, costly and is more dangerous in the sense that it requires the cultivation of pathogenic viruses of each and every animal. patients (Barre-Sinoussi et al. (1983) Science 220, 868-871; Popovic et al. (1984) Science 224, 497-500). In this procedure, the peripheral blood mononuclear cells of the patient (PBMC) are first cultured to establish a viral supply of known multiplicity of infection (MOI), and the viral supply thus produced is used to infect a cell line of indicator of objective. The explosion resulting from viral duplication is then typically measured in the presence and in the absence of an antiviral agent by determining the production of viral antigenes in the cell culture. Such tests can be carried out reliably only in the hands of expert researchers, and can take two to three months to be carried out at a cost of hundreds of dollars per patient for each agent tested. Furthermore, since viral supplies of sufficient multiplicity of infection of the PBMC of some human immunodeficiency virus patients can not be established, the classical test for human immunodeficiency virus resistance can not be carried out on all individuals infected with immunodeficiency virus. human More significantly in the course of generating the viral supply through the passage of the virus in the culture, the characteristics of the viruses themselves may change and therefore be obscure to the true nature of the patient's virus, thus, the application of the classical test it has been limited to information gathered around the currents in clinical trials and has not been available for a prospective analysis that could be used to tailor an antiviral therapy for a given patient. Despite these limitations, the classical test has two important qualities: it is specific for the agent under evaluation, and this proportion of the patient's own virus phenotype information, this is the concentration of the drug which inhibits 50% of the reproduction viral (IC50).

A number of attempts have been made to improve the classical test but each of these has had serious disadvantages. The first type of these tests can be described as non-specific in the sense that they do not determine the characteristics of the patient's own viruses at all, but also provide an independent measure of the course of the infection. Among these tests are those which measure the CD4 + T cell count of the patient, the contrast in the progression of human immunodeficiency virus disease (Goedert et al. (1987) JAMA 257, 331-334), which measure viral antigen levels (eg, the core antigen p24 (Allain et al. (1987) N. Engl. J. Med. 317 1114-1121)), and those that measure viral RNA and DNA levels (e.g. the quantitative polymerase chain reaction and the branched DNA assays (Piatak et al. (1993) Science 259, 1749-1754; Urdea (1993) Clin. Chem. 39, 725-726)). The primary disadvantage of such non-specific tests is that they do not provide any information about the resistance to the viral drug by itself, but they also try to infer this information from the apparent course of the patient's disease. In addition, many factors other than resistance to the viral drug can affect the level of consideration under parameter. In other words, CD4 + cell counts, p24 antigen levels and viral HIV and RNA levels can vary for many reasons other than drug resistance during the course of the disease.

Another modified classical test amplifies the viral gene that is the target of the antiviral agent. In this test the viral gene of a given patient is amplified and then recombined into a biologically active proviral clone of the human immunodeficiency virus. This proviral clone is transfected into human cells to generate a viral supply of multiplicity of known infection which can then be used to infect a target indicator cell line. In the manner of the classical test, one then determines the production of the viral antigenes in the presence or in the absence of an antiviral agent. Such an assay described by Kellaman and Larder (1994) Quimo and Antimicrobial Agents 38, 23-30, involves the PCR amplification of the reverse transcriptase encoding sequences from a patient which is then introduced into a proviral DNA clone by homologous recombination to reconstitute the complete viral genome including the reverse transcriptase gene which was deleted. The resulting recombinant virus produced from such clones is then cultured in the T cell lines and the drug sensitivity is tested in the CD4 + HeLa plaque reduction assay. However, this kind of test still requires the cultivation of viruses to determine resistance to the drug, and is therefore difficult, time consuming and expensive and requires a laboratory researcher to handle dangerous viral cultures. In addition, given the inherent variation of the virus itself during the culture process, the results may be correspondingly inaccurate.

A second class of test attempts to provide specific information about the genotype of the patient's immunodeficiency virus, with the ultimate goal of correlating this genotypic information with the drug-resistant genotype of the virus. Indeed, substitutions of specific amino acids within viral genes such as protease and reverse transcriptase genes have been shown to correspond to specific levels of viral resistance to protease and reverse transcriptase inhibitors, respectively (Larder et al. (1994) J. Gen Virol 75, 951-957). A disadvantage associated with such an analysis is that it is indirect and may be obfuscated by secondary mutations which have been shown to add or contradict the effects of the first mutation.

This is the complex interplay of all the amino acid residues within a viral polypeptide given which ultimately determines the activity of the gene product in the presence or in the absence of an inhibitor. Therefore, a database of coarse and impractical proportions would be necessary to interpret the state of drug sensitivity or resistance of a given genotype, given the number of potential amino acid changes in the human immunodeficiency virus genome.

A third class of test, a recently developed bacterial-based assay, was used of a molecularly cloned viral gene (specifically, the reverse transcriptase gene) which has been inserted into the bacterial expression vector. With the transformation of the special E. coli separations which are deficiencies in polymerase I of bacterial DNA, the cloned reverse transcriptase gene can reduce the growth of the bacteria under selected growth conditions. In the production of E. coli dependent on the reverse transcriptase for its growth, one can establish the effects of certain reverse transcriptase inhibitors on the activity of the viral gene (PCT Application No. WO 95/22622).

A major disadvantage with this approach, however, is that the inhibitor can be transported through the cell membrane and metabolized differently by bacteria than it is by a human cell, and as a result of the concentration of the inhibitor. The true metabolic reverse transcriptase may be very different in the bacterium than it would be in a relevant human cell target of infection, or the true inhibitor may be absent altogether. In truth, the nucleoside metabolism is known to differ markedly between human and bacterial cells. Another significant disadvantage of this approach is that the assay measures the DNA polymerase activity dependent on -DNA of the reverse transcriptase but not the RNAse H activities or RNA-dependent polymerase DNA transfer assay of the reverse transcriptase. Therefore, an antiviral compound which acts, at least in part, on these activities would not have its full inhibitory activity in this assay. Yet another difficulty with this approach is that this is a base growth approval, so if an inhibitor (for example, a nucleoside analog, also blocks bacterial growth for reasons other than its effects on reverse transcriptase, it does not it can be adequately tested in this system.

Viral Vectors Viral vectors and particularly retroviral vectors have been used to modify mammalian cells due to the high efficiency with which retroviral vectors infect target cells and integrate into the target cell genome. Due to its ability to be inserted into the genome of mammalian cells, much attention has been focused on retroviral vectors for use in gene therapy. Details on retroviral vectors and their use can be found in patents and patent publications including European patent application EPA 0 178 220, United States of America patent No. 4,405,712, PCT application WO 92/07943 , U.S. Patent No. 4,980,289, U.S. Patent No. 5,439,809 and PCT Application WO 89/11539. The teachings of these patents and publications are incorporated herein by reference.

One consequence of the emphasis on retroviral vector technology has been the development of packaging cell lines. A major problem with the use of retroviruses is the possibility of spreading the replication-competent retrovirus. Therefore, there is a need to produce auxiliary vectors that can not be processed in virions. As a result it has been developed to pack defective vectors and packaging cell lines. The details of defective packaging vectors and packaging cell lines can be found in the patents and in the patent publications including the patent of the United States of America No. 5, 124,263, European Patent Application Publication No. 0386 882, PCT Application No. WO 91/19798, PCT Application No. WO 88/08454, PCT Application No. WO 93/03143, United States Patent No. 4,650,764, U.S. Patent No. 4,861,719 and U.S. Patent No. 5,278,056, the disclosures of which are incorporated herein by reference.

It is an object of this invention to provide a susceptibility and drug resistance test capable of showing whether a viral population in a patient is resistant to a given prescribed drug. Another object of this invention is to provide a test that will allow the physician to substitute one or more drugs in a therapeutic regimen for a patient who has become resistant to a drug or drugs given after a previous course of therapy. Still another object of this invention is to provide a test that will allow the selection of an effective drug regimen for the treatment of virus infections. Yet another object of this invention is to provide a safe, standardized, economical, rapid, accurate and reliable drug susceptibility and resistance test for clinical application and research. Still another object of this invention is to provide a test and methods for evaluating the biological effectiveness of candidate drug compounds which act on specific viral genes and / or viral proteins particularly with respect to resistance to the viral drug and resistance crusade. It is also an object of this invention to provide the means and compositions for evaluating the resistance to the viral drug and its susceptibility. These and other objects of this invention will be apparent from the description as a whole.

Synthesis of the Invention The objects of the present invention are achieved by a novel test for determining susceptibility for an antiviral drug comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the reporter gene from step (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of the antiviral drug is present in steps (a) - (c); in steps (b) - (c); or in step (c).

This invention also provides a method for determining resistance to the antiviral drug in a patient comprising: (a) developing a standard curve of drug susceptibility for an antiviral drug; (b) determining the susceptibility to the antiviral drug in the patient using the susceptibility test described above; and (c) comparing the susceptibility to the antiviral drug in step (b) with the standard curve determined in step (a), wherein a decrease in antiviral susceptibility indicates the development of a resistance to the antiviral drug in the patient .

This invention further provides a method for determining resistance to the antiviral drug in a patient comprising: (a) determining the susceptibility to the antiviral drug in the patient at the first moment according to the above-mentioned method, wherein the segment derived from the antiviral drug. patient is obtained from the patient at that time; (b) determine the susceptibility to the antiviral drug of the same patient at a later time; and (c) comparing the susceptibilities to the antiviral drug determined in step (a) and step (b), wherein a decrease in susceptibility to the antiviral drug at the last moment compared to the first moment indicates the development or progression of resistance to the antiviral drug in the patient.

The assay of this invention allows a physician to evaluate whether an antiviral gene encoding a viral protein or a functional viral sequence, each of which may be the target of an antiviral agent has been mutated to render the drug less effective. More particularly, the novel assay of this invention allows one to determine whether a virus has become resistant to a particular antiviral drug. In addition, this invention allows a physician to evaluate the susceptibility and resistance to the drug of a combination therapy. further, the trial allows one to alter a therapeutic regimen prospectively by testing particular drugs or combinations of drugs and determining whether these drugs, alone or in combination, inhibit one or more viral genes and / or viral proteins. This invention provides significant advantages over currently available assays by providing a safe, more economical, more reliable, faster and more effective assay of susceptibility and drug resistance to assess the therapeutic efficacy of a particular drug or antiviral drugs or combinations of drugs allowing the doctor to optimize the treatment. The assay of this invention has the significant advantage of allowing the evaluation of resistance and susceptibility at all stages of drug development: 1) during preclinical evaluation of candidate compounds; 2) during the clinical evaluation of the new drugs; 3) during the patient's therapy allowing the design of an effective therapeutic regimen to overcome the problem of drug resistance; and 4) as part of an epidemiological surveillance evaluating the prevalence of resistance during the use of approved and experimental drugs.

The present invention is directed to methods and compositions for evaluating drug susceptibility and resistance, including: (a) the test method of determining the susceptibility and resistance of a segment derived from the patient to an antiviral drug; (b) compositions including resistance test vectors comprising a segment derived from the patient and a reporter gene; and (c) host cells containing the resistance of the test vectors. This invention is further directed to the compositions and methods for constructing the vectors and host cells which are used in the drug susceptibility and resistance assay of this invention.

In one aspect of the invention there is provided a method for determining the susceptibility to a drug against human immunodeficiency virus comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the reporter gene from step (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the drug against the human immunodeficiency virus, wherein a test concentration of the drug against the human immunodeficiency virus is present in steps (a) - (c); in steps (b) - (c); or in step (c).

In one aspect of the invention there is provided a method for determining the susceptibility of a drug against human immunodeficiency virus comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring an indicator in a target host cell wherein said indicator is a DNA or RNA structure; and (d) comparing the measurement of the indicator of step (c) with the measurement of the indicator when steps (a) - (c) are carried out in the absence of the drug against the human immunodeficiency virus, wherein a Test concentration of the drug against human immunodeficiency virus is present in steps (a) - (c); in steps (b) - (c); or in step (c).

In one aspect of the invention there is provided a method for determining the susceptibility for a drug against HBV comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene into a host cell; (b) culturing the host cell of step (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the reporter gene from step (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the drug against HBV; wherein a test concentration against -HBV is present in steps (a) - (c), in steps (b) - (c); or in step (c).

In one aspect of the present invention there is provided a method for determining the susceptibility to an anti-HBV drug comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring an indicator in a target host cell wherein said indicator is DNA or an RNA structure; and (d) comparing the measurement of the indicator of step Ce) with the measurement of the indicator when steps (a) - (c) are carried out in the absence of the anti-HBV drug, wherein a concentration test of the anti-HBV drug is present in steps (a) - (c); in steps (b) - (c); or in step (c).

This invention also provides a method for determining anti-HIV drug resistance in a patient comprising: (a) developing a standard curve of drug susceptibility for an anti-HIV drug; (b) determining the susceptibility to the anti-HIV drug in the patient using the susceptibility test described above; and (c) comparing the susceptibility to the anti-HiV drug in step (b) with the standard curve determined in step (a), wherein a decrease in susceptibility against HIV indicates a development of the resistance of the anti-HIV drug in the patient.

This invention is also provided to a method for determining the resistance of the anti-HBV drug in a patient comprising: (a) developing a standard curve of a drug susceptibility to an anti-HBV drug; (b) determining the susceptibility to the anti-HBV drug in the patient using the susceptibility test described above; and (c) comparing the susceptibility to the anti-HBV drug in step (b) with the standard curve determined in step (a), wherein a decrease in anti-HBV susceptibility indicates the development of drug resistance. anti-HBV in the patient.

This invention also provides a method for evaluating the biological effectiveness of a candidate antiviral drug compound comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the indicator of step (c) with the expression of the indicator measured when steps (a) - (c) are carried out in the absence of the candidate antiviral drug compound, wherein a test concentration of the candidate antiviral drug compound is present in steps (a) - (c); in steps (b) - (c); or in step (c).

This invention also provides a method for evaluating the biological effectiveness of a candidate antiviral drug compound comprising (a) introducing a resistance test vector comprising a segment derived from a patient and a reporter gene within a host cell; (b) culturing the host cell of step (a); (c) measuring an indicator in a target host cell wherein said indicator is a DNA or RNA structure; and (d) comparing the measurement of the indicator of step (c) with the measurement of the indicator when steps (a) - (c) are carried out in the absence of the candidate antiviral drug compound, wherein a test concentration of antiviral drug candidate compound is present in steps (a) - (c); and in steps (b) - (c); or in step (c).

The resistance test vector comprising viral segments derived from the patient (e.g., HIV, HBV, etc.) and the reporter gene may additionally include one or more segments derived not from the patient. In one embodiment, the resistance test vector is constructed of a genomic viral vector which may include a deletion in one or more genes. For example, in the case of HIV, the env is deleted in a resistance test vector which otherwise preserves the mRNA expression and processing characteristics of the whole virus. Alternatively, the resistance test vector is constructed of a subgenomic viral vector which may include only one or a few viral genes which are typically the target of the antiviral drug. For example, in the case of HBV, one or more of the HBV genes encoding certain structural and enzymatic functions necessary for the duplication of HBV DNA and virus particle formation (eg, C, S and X genes) can be deleted from a resistance test vector which otherwise preserves the mRNA expression and processing characteristics of the whole virus. The resistance test vector further comprises either the native promoter / enhancer of the particular virus or a foreign enhancer / promoter for the expression of the antiviral target genes.

The expression of the reporter gene in the resistance test vector in the target cell ultimately depends on the action of the segment sequences derived from the patient. The indicator genome can be functional or non-functional. In the case of a non-functional reporter gene, the reporter gene is not efficiently expressed in a host cell expressed by the resistance test vector until it becomes a functional indicator gene through the action of one or more of the segment products derived from the patient.In one embodiment, the reporter gene becomes non-functional through the use of a permuted promoter, for example, a promoter that, even though it is in the same transcriptional orientation as the reporter gene, follows the coding sequence of the indicator gene In addition, the orientation of the non-functional reporter gene is opposite to that of the viral promoters or LTRs. Therefore, the coding sequence of the non-functional reporter gene can be either transcribed by the permuted promoter and by the viral promoters. In the case of HIV the reporter gene is rearranged as a consequence of reverse transcription so that the permuted promoter now precedes the reporter gene sequence, which as a result can be expressed functionally. In the case of HBV, the reporter gene is rearranged as a consequence of the circularization of the genome during the duplication of HBV. In a second embodiment, the reporter gene becomes non-functional through the use of a permuted coding region, eg, an indicator gene coding region in which the 5 'part of the coding region follows rather than precedes the coding region. part 3 'of the coding region. In this configuration, no mRNA is expressed which can result in a functional reporter gene product. In the case of HIV, the reporter gene is rearranged as a consequence of reverse transcription so that the 5 'coding region of the reporter gene now precedes the 3' coding region, and as a result the reporter gene can be functionally expressed . In the case of HBV, the reporter gene is rearranged as a result of genome circularization during HBV duplication. In a third embodiment, the reporter gene becomes non-functional through the use of an inverted intron, for example, an intron inserted into the coding sequence of the reporter gene with a transcriptional orientation opposite to that of the reporter gene. In addition, the reporter gene itself contains a functional promoter with the complete transcriptional unit oriented opposite to the viral promoters. Therefore, the non-functional reporter gene is in the wrong orientation that is going to be transcribed by the viral LTRs in the case of HIV or the HBV promoter-enhancer and can not be functionally transcribed by its own promoter, since the intron inverted it can not be adequately removed by division. However, in the case of retroviruses and hepadnaviruses, and HiV and HBV specifically, transcription by viral promoters results in the formation of mRNA in which the removal of inverted intron can occur by division. In retroviruses, as a consequence of the reverse transcription of the resulting divided transcript and the integration of the resulting provirus into the chromosome to be the host, the reporter gene can now be functionally transcribed by its own promoter. In HBV, as a consequence of the reverse transcription of the resulting split transcript and the circularization of the genomic DNA in the host cell, the reporter gene can now be functionally transcribed by its own promoter.

The resistance test vectors comprising a non-functional reporter gene can be used to carry out the resistance tests in either a particle-based or a particle-free assay. The particle-based assay is based on viral particles of resistance test vector, which are of a defective duplication, being produced by host cells of resistance test vector. The trans-action factors necessary for the production of the viral particles of resistance test vector are provided by the packaging expression vectors which are transfected into the packaging host cell. In contrast, the non-particle base resistance test is carried out by transfecting a single host cell with a resistance test vector in the absence of the packaging expression vectors.

In the case of the functional indicator gene, the functional reporter gene is efficiently expressed in a first host cell transfected by the resistance test vector, referred to herein as host cell resistance test vector). Therefore, the function of the reporter gene in the host cell of the resistance test vector does not depend on the segment derived from the patient. However, the ability of the reporter gene to be expressed in a second host cell, referred to herein as a target host cell) will depend on the production of the viral particles of functional resistance test vector in the test vector host cell. of resistance. Therefore, the activity of the reporter gene in the target host cells depends on the activity of the patient-derived segments.

In another aspect, this invention is directed to antiviral drug resistance and susceptibility tests for HIV / AIDS or HBV. The particular resistance test vectors of the invention for use in the HIV / AIDS antiviral drug susceptibility and resistance test are also identified as host cells of the resistance test vector. In still another aspect this invention is directed to tests of susceptibility and resistance of antiviral drug for hepatitis. Similarly, in the case of HBV, the particular resistance test vectors (also referred to herein as resistance test vector systems) of the invention for use in the antiviral drug (HBV) susceptibility and resistance test are thus identified as the host cells of resistance test vector.

In yet another aspect, this invention provides the identification and evaluation of the biological effectiveness of the potential therapeutic antiviral compounds for the treatment of viral diseases. In still another aspect of the invention is directed to a host cell transfected with one or more vectors to establish the susceptibility to the drug. In another aspect, the invention is directed to a novel resistance test vector comprising a viral gene or genes derived from the patient and a reporter gene.

Brief Description of the Drawings Figure 1. A. Diagram representation of the DNA genomic structure of HIV-1. Viral proteins are encoded in each of the reading frames by the genes gag, pol, vif, vpr, tat, rev, vpu, env and nef. The RNA is transcribed from viral DNA and is processed by cellular and viral enzymes giving rise to both RNA and genomic viral mRNA. The elements U3, R and U5 of the long viral terminal repeat (LTR) are indicated.

B. The generalized diagramatic representation of the HIV genomic viral vector which contains the following elements in the 5 'to 3' orientation: 1) an HIV-LTR U3 region, 2) an HIV-LTR R region, 3) an HIV-1 region LTR U5, 4) the HIV coding regions gag-pol, vif, vpr, tat, rev, vpu, deleted env, and nef genes, and 5) a 3 'HIV-LTR.

C. Generalized diagramatic representation of the HIV genomic viral vector which contains the following elements in the 5 'to 3' orientation: 1) a CMV IE promoter-enhancer, 2) an HIV-LTR R region, 3) an HIV-LTR region U5, 4) the HIV coding regions gag-pol, vif, vpr, tat, rev, vpu, deleted env and nef genes, and 5) a 3 'HIV-LTR.

D. Generalized diagramatic representation of the HIV subgenomic viral vector which contains the following elements in the 5 'to 3' orientation: 1) an HIV-LTR U3 region, 2) an HIV-LTR R region, 3) an HIV-LTR region U5, 4) the coding region of the HIV gag-pol gene, 5) a 3 'HIV-LTR.

E. Generalized diagramatic representation of the subgenomic HIV viral vector which contains the following elements in the 5 'to 3' orientation: 1) a CMV IE promoter-enhancer, 2) an HIV-LTR R region, 3) an HIV-LTR region U5, 4) the coding region of the HIV gag-pol gene, and 5) a 3 'HIV-LTR.

Figure 2. A. Diagrammatic representation of the DNA genomic structure of HIV-1.

B. Diagrammatic representation of the resistance test vector comprising a non-functional reporter gene comprising a permuted promoter having the following elements in the 5 'to 3' orientation: 1) an HIV-LTR U3 region (pLG-lucPP-HS and pLG-lucPP-PB) or a CMV IE enhancer promoter (pCG-lucPP-HS and pCG-lucPP-PB), 2) an HIV-LTR R region, 3) an HIV-LTR U5 region containing an RNA polymerase promoter. inserted T7 phage (here mentioned as T7 promoter) with a transcriptional orientation opposite that one of the LTRs, 4) the coding regions of the HIV genes gag-pol, vif, vpr, tat, rev. vpu, env deleted, and nef genes, 5) a segment or segments derived from the patient inserted within the acceptor sites of sequence of the patient, 6) a cassette of reporter gene inserted within the env gene deleted and 7) a 3 'HIV- LTR C. Diagrammatic representation showing the conversion of the non-functional indicator gene (permuted promoter) in the resistance test vector described in 2 (a), to a functional indicator gene by reverse transcriptase. The conversion to a functional indicator gene results from the relocation of the T7 promoter in relation to the indicator gel coding region.

Figure 3. A. Diagrammatic representation of the DNA genomic structure of HlV-1.

B. Diagrammatic representation of the packaging expression vector pLTR-HIV3 'which provides the vif, vpr, tat, rev, vpu and nef genes, each of which is expressed as a subgenomic divided mRNA transcribed from the HIV LTR U3 region .

C. Diagrammatic representation of the packaging expression vector pCMV-HIV3 'which provides the vif, vpr, tat, rev, vpu and nef genes, each of which is expressed as a subgenomic divided mRNA transcribed from the CMV IE promoter-enhancer .

D. Diagrammatic representation of the packaging expression vector pVL-env4070A [pCXAS (4070A env)] which provides the amphotropic MLV env gene product, by transcription of the CMV IE enhancer promoter.

Figure 4. A. Diagrammatic representation of the DNA genomic structure of HIV-1.

B. A generalized diagramatic representation of resistance test vectors comprising a non-functional reporter gene comprising a permuted coding region containing the following elements in the 5 'to 3' orientation: 1) an HIV-LTR U3 region (pLG- lucPC-HS and pLG-lucPC-PB) or a first CMV IE promoter-enhancer (pCG-lucPC-HS and pCG-lucPC-PB), 2) the HIV-LTR R and U5 regions, 3) the coding regions of the genes of HIV gag-pol-vif, vpr, tat, rev, vpu, env deleted, 4) a segment or segments derived from the patient inserted within the acceptor sites of patient sequence, 5) a first cassette of indicator gene containing the 5 'coding region of the luciferase gene, inserted into the deleted env gene, 6) a second reporter cassette containing the 3' coding region of the luciferase gene, inserted into the deleted region 3 'HIV-LTR U3 , and 7) a region 3 'HIV-LTR R and U5.

C. The diagrammatic representation showing the conversion of the non-functional indicator gene (permuted coding region) into the resistance test vector, described in 4 (a) to a functional indicator gene by reverse transcriptase. After reverse transcription and transfer of sepa, the 3 'coding region luciferase is copied 3' (LTR to 5 'LTR, allowing the transcription of mRNA which can be divided to generate a functional luciferase coding region.

Figure 5. A. Diagrammatic representation of the DNA genomic structure of HIV-1.

B. A generalized diagramatic representation of resistance test vectors comprising a non-functional reporter gene comprising an inverted intron containing the following elements in a 5 'to 3' orientation: 1) an HIV-LTR U3 region (pLG-lucII-HS and pLG-lucII-PB) or a first CMV IE promoter-enhancer (pCG-lucII-HS and pCG-lucII-PB), 2 > the HIV-LTR R and U5 regions, 3) the coding regions of the HIV genes gag-pol, vif, vpr, tat, rev, vpu, deleted env and nef, 4) the segment or patient-derived segments inserted within from the patient sequence acceptor site, 5) an indicator gene cassette inserted into the deleted env gene and 5) a 3 'HIV-LTR.

C. Diagrammatic representation showing the conversion of the non-functional indicator gene (inverted intron) in the resistance test vector, described in 5 (a), to a functional indicator gene by reverse transcriptase. The general transcriptional orientation of the reporter gene cassette is opposite to that of the first CMV promoter-enhancer and the viral LTRs, while the orientation of the artificial intron is the same as the last elements. The transcription of the reporter gene by the second CMV enhancer-promoter does not lead to the production of functional transcripts since the inverted intron can not be divided in this orientation. Transcription of the reporter gene by the 5 'viral LTR or the first CMV IE promoter-enhancer, however, leads to the removal of the inverted intron by RNA cleavage, even though the reporter gene is not yet functionally expressed since the resulting transcription It has an antisense orientation. After reverse transcription of this transcript and the integration of the resulting proviral DNA, the reporter gene can be functionally transcribed by the second CMV promoter-enhancer since the inverted intron has been previously removed.

Figure 6. A. Diagrammatic representation of the genomic DNA structure of HIV-1 shown above (a) and (b).

B. A generalized diagramatic representation of the resistant test vectors comprises a functional reporter gene having the following elements in a 5 'to 3' orientation: 1) an HIV-LTR U3 region (pLG-luc-HS-1 and p G-luc -PB-1) or a first CMV IE promoter-enhancer (pCG-luc-HS-1 and pCG-luc-PB-1), 2) the HiV-LTR R and U5 regions, 3) the coding region of the genes HIV gag-pol, vif, vpr, tat, rev, vpu, env deleted, and nef, 4) a functional reporter gene cassette inserted into the deleted env gene, with a transcriptional orientation opposite to the viral LTRs and 5) a 3 'HIV-LTR.

C. A generalized diagramatic representation of resistance test vectors comprising a functional indicator gene cassette (pLG-luc-HS-2, pLG-luc-PB-2, pCG-l? Ic-HS-2 and pCG- luc-PB-2) in which the transcriptional orientation of the indicator gene cassette is the same as the LTRs.

Figure 7. A. Demonstration of drug susceptibility using resistance test vectors, pCG-CXCN (F-lucP) 2-AA and PCG-CXAT (F-lucP) 2-AA. The data are represented as luciferase gene activity in target host cells as Relative Light Units (RLU) in the absence of AZT or in the presence of 5 mM AZT.

B. The susceptibility test and resistance to the drug carried out with the resistance test vector, pCG-CXCN (F-lucP) 2-AA containing segments derived from patient "test" of pre-AZT treatment and post-AZT treatment. The resistance test vectors are derived from the viral genomic indicator gene vector, pGC-CXCN (F-lucP) 2-AA. The data are presented as percent inhibition of luciferase gene activity in target host cells against concentration AZT (log10). PCG-CXCN (F-lucP) 2-AA is drawn as solid boxes. The pCG-CXCN (F-lucP) 2-AA containing the segments derived from the patient before the AZT treatment is drawn as solid circles and the post-AZT treatment as solid triangles.

C. Susceptibility test and resistance to the drug carried out with the resistance test vector, pCG-CXCN (F-lucP) 2-AA containing the reverse transcriptase segment derived from the biologically active proviral clone, pNL4-3. Data are presented as percent inhibition of luciferase gene activity in host target cells against the concentration of nevirapine (log10) and drawn as solid boxes.

D. The drug susceptibility and resistance test carried out with the resistance test vector, pGC-CXCN (F-lucP) 2-AA containing the protease segment derived from the biologically active proviral clone, pNL4-3. The data are presented as percent inhibition of luciferase gene activity in the target host cells against the indinavir concentration (log10) and drawn as solid boxes.

Figure 8 A. Diagrammatic representation of the pregenomic structure of HBV RNA. The pregenomic RNA is shown as a solid line. Direct repeat (DR) sequences are shown as closed rectangles. The positions of the encapsidation signal sequence are shown (() .The genes C, P, S and X are shown as open rectangles.The terminal protein (TP), the spacer, reverse transcriptase / DNA polymerase (pol / RT) , and RNase H regions of the P gene are indicated.The C, P, S, and X translation initiation sites are indicated by shaded triangles.

B. A generalized diagramatic representation of the subgenomic indicator gene viral vector, pCS-HBV (NF-IG) II- (PSAS-), a component of the resistance test vector system, comprising a reporter gene cassette and an inverted intron containing the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome, and DR1 and 5' ((the translation initiation codon ORF pre- C is deleted) (3) a non-functional indicator gene cassette in which the indicator gene ORF contains an inverted intron, (4) the region of the HBV genome containing DR2, DR1 *, 3'e, and the region of polyadenylation signal (pA) 3 'HBV.

C. The diagrammatic representation of the covalently closed circular DNA (cccDNA) form of the viral vector of subgenomic indicator gene pCS-HBV (F-IG) II (PSAS-), containing a cassette of assembled functional indicator gene as a result of the viral application of HBV.

D. The diagrammatic representation of an example of a packaging vector, pPK-CPX, a component of the resistance test vector system comprising a segment derived from the patient containing the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the region of the HBV genome extending from the C initiation translation codon ORF to the 3 'pA signal and including the C, P, S, and X genes. The C gene of the pPK-CPX packaging vector is modified so that it does not contain the pre-C ORF sequences and does not express the S proteins (as shown by the X at the translation initiation sites).

E. Diagrammatic representation of an additional packaging vector, pPK-S, providing the S gene proteins that are cotransfected with the resistance test vector system comprising the indicator gene viral vector, pCS-HBV (NF-IG) II- (PSAS-), and the packaging plasmid, pPK-CPX.

F. A generalized diagramatic representation of the resistance test vector pCS-HBV (NF-IG) II- (PSAS +), comprising a non-functional reporter gene with an inverted intron containing the following elements in a 5 'to 3' orientation: 1 ) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome and the DR1 and 5' ((the pre-C ORF translation start codon is deleted), (3) the reporter gene cassette (containing an inverted intron) within the region of the HBV genome which contains a P gene segment derived from the patient, (4) the HBV genome region containing DR2, DR1 *, the 3'e and the 3 'HBV signal region pA.

G. Diagrammatic representation of the form of Covalently closed circular DNA (cccDNA) of the resistance test vector, pCS-HBV (F-IG) II- (PSAS +), containing a functional reporter gene cassette and a P gene segment derived from the assembled patient as a result of the viral duplication HBV.

H. Diagrammatic representation of a packaging vector, pPK-CSX, providing the C, S, and X gene proteins, which are co-transfected with the resistance test vector, PCS-HBV (NF-IG) II- ( PSAS +).

Figure 9. A. Diagrammatic representation of the pregenomic structure of HBV RNA.

B. Diagrammatic representation of a viral vector of HBV indicator gene containing a non-functional indicator gene cassette. Primer agglutination sites for the amplification of a target DNA sequence are shown. The location and orientation of the primer primer (Pf) and reverse primer (Pr) agglutination sites do not constitute a functional amplification unit in the linear form of the vector that is used to transfect the packaging host cells. The binding site Pr is designed to extend the binding sequence that is generated by the division of pregenomic RNA.

C. Diagrammatic representation of the rc-DNA form of the indicator gene viral vector described in 10B. Primer agglutination sites are shown for the amplification of the target DNA sequence. The location and orientation of the primer binding sites Pf and Pr constitute a unit of functional amplification in the DNA component of sepa plus of the rc-DNA form and the DNA components of sepa plus and minus of the cccDNA form that is generated by the duplication of HBV DNA within the virus particles produced in the packaging host cells. The binding site PR is assembled by the division of the pregenomic RNA.

D. Diagrammatic representation of a HBV indicator gene vector containing a non-functional indicator gene cassette. the primer binding sites for the amplification of the target DNA sequence are shown. The location and orientation of the binding sites Pf and Pr constitute a unit of functional amplification in the linear form of the vector that is used to transfect packaging host cells, but the Pf binding site is not adjacent to the binding site of the Exonuclease detection probe (probe) in the undivided linear form of the vector. This arrangement of Pf, Pr, and probe agglutination sites does not constitute an efficient exonuclease detection unit.

E. The diagrammatic representation of the rc-DNA form of the indicator gene viral vector described in Figure 9D.

Primer agglutination sites for the amplification of a target DNA sequence are shown. The location and orientation of primer binding sites Pf and Pr constitute a unit of functional amplification in the rc-DNA and cccDNA forms of the vector that are generated by the duplication of HBV (DNA in packaging host cells. of the binding site Pf is placed immediately adjacent to the binding site of the exonuclease detection zone (probe) in the rc-DNA and cccDNA forms of the vector.This arrangement of Pf, Pr and probe binding sites constitute a unit of efficient exonuclease detection.

F. Diagrammatic representation of the viral vector of the HBV indicator gene. Primer agglutination sites for the amplification of a target DNA sequence are shown. The location and orientation of the primer primer (Pf) and reverse primer (Pr) agglutination sites do not constitute a functional amplification unit in the linear form of the vector that is used to transfect the packaging host cells.

G. Diagram representation of the rc-DNA form of the viral vector of indicator gene described in 10F. Primer agglutination sites for the amplification of a target DNA sequence are shown. The location and orientation of the primer binding sites Pf and Pr constitute a unit of functional amplification in the DNA component of sepa plus of the rc-DNA form and the DNA components of the know plus and minus of the cccDNA form of the vector which is generated by HBV DNA duplication within the virus particles produced in the packaging host cells.

Figure 10. A. Diagrammatic representation of the pregenomic structure of HBV RNA.

B. A generalized diagramatic representation of the viral vector of subgenomic indicator gene pCS-HBV (NF-IG) PP- (PSAS-), a component of the resistance test vector system comprising a non-functional reporter gene with a permuted promoter containing the following elements in a 5 'to 3' orientation: (1) the promoter region of CMV IE enhancer, (2) the 5 'region of the HBV genome and the DR1 and 5' ((the pre-C ORF pre-C translation start codon) ), (3) a non-functional indicator gene cassette assembled so that the promoter region is placed 3 ', for example downstream of the ORF reporter gene, (4) the 3' region of the HBV genome containing DR2, DR1 *, the 3'e, and the signal region 3 'HBV pA (the pre-C ORF translation initiation codon is deleted.) The packaging vector, pPK-CPX, a component of the resistance test vector system comprising a segment of p gene derived from the patient is shown in Figure 8D and the packaging vector S, p PPK-S, is shown in Figure 8E.

C. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the viral vector of subgenomic indicator gene pCS-HBV (F-IG) PP (PSAS-), containing a functional assembled indicator gene cassette as a result of viral duplication HBV.

D. A generalized diagramatic representation of the pCS-HBV (NF-IG) PP (PSAS +) resistance test vector, comprising a non-functional reporter gene with a permuted promoter containing the following elements in a 5 'to 3' orientation: (1 ) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome and the DR1 and 5' copy of ((the pre-C ORF translation initiation codon is deleted), (3) an enhancer region -promotor (permuted promoter), (4) the P gene containing the segment derived from the patient, (5) the ORF reporter gene, (6) an internal ribosome entry site (IRES) and (7) the 3 'region of the HBV pA genome containing DR2, DR1 *, the 3'e, and the 3' HBV pA signal region (the pre-C ORF translation initiation codon is deleted). The packaging vector, pPK-CSX, providing the genes C, S and X is contrasted with the resistance test vector pCS-HBV (NF-IG) PP (PSAS +) and is shown in Figure 8H.

E. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the resistance test vector, pCS-HBV (F-IG) PP (PSAS +), containing a functional reporter gene cassette and a P-gene segment derived from a patient assembled as a result of HBV viral duplication.

Figure 11 'A. Diagrammatic representation of the pregenomic structure of HBV RNA.

B. Generalized Diagrammatic Representation of the Viral Vector of Subgenomic Indicator Gene pCS-HBV (NF-IG) PPTIS- (PSAS-), a component of the resistance test vector system comprising a non-functional reporter gene with a translational initiation site and promoter containing the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome including DR1 and 5' ((the translation initiation codon) ORF pre-C is deleted), (3) indicator gene ORF lacking a translation initiation site, (4) an enhancer-promoter region (permuted promoter), (5) the 3 'region of the HBV genome containing DR2, the pre-C translation initiation codon ORF, DR1 *, the 3'e, and the 3 'HBV pA signal region The packaging vector pPK-CPX, a component of the resistance test vector system comprising a derived segment of the patient is shown in Figure 8D.The packing vector S, pPK-S, is shown in Figure 8E.

C. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the viral vector of subgenomic indicator gene pCS-HBV (F-IG) PPTIS (PSAS-), containing a cassette of assembled functional indicator gene as a result of duplication viral HBV.

D. A generalized diagramatic representation of the resistance test vector, pCS-HBV (NF-IG) PPTIS (PSAS +), comprising a non-functional reporter gene with a permuted promoter containing the following elements in a 5 'to 3' orientation comprising: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome including DR1 and 5' ((the pre-C ORF translation initiation codon is deleted), (3) an ORF reporter gene lacking translation initiation site, (4) gene P containing the segment derived from the patient, (5) an enhancer promoter region (permuted promoter) (6) the 3 'region of the HBV genome containing DR2, the initiation codon translational pre-C ORF DR1 *, the 3'e, and the 3 'HBV pA signal region The packaging vector, pPK-CSX, providing the C, S and X genes is cotransfected with the resistance test vector , pCS-HBV (NF-IG) PPTIS (PSAS +), and is shown in Figure 8H.

E. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the resistance test vector, pCS-HBV (F-IG) PPTIS) (PSAS +), containing a functional reporter gene cassette and a P gene segment derived from the patient assembled as a result of a viral duplication HBV.

Figure 12 A. The diagrammatic representation of the pregenomic structure of HBV RNA.

B. Generalized Diagrammatic Representation of the Viral Vector of Subgenomic Indicator Gene pCS-HBV (NF-IG) PCR- (PSAS-), a component of the resistance test vector system comprising a non-functional reporter gene with a permuted encoded region containing the following elements in a 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region (2) the 5 'region of the HBV genome including DR1 and 5' ((the pre-C ORF translation initiation codon is removed) , (3) a non-functional indicator gene cassette assembled so that the promoter region and a 5 'part of the coding region are placed 3', e.g., down, of the remaining 3 'part of the coding region , (4) the 3 'region of the HBV genome contains DR2, DR1 *, the 3'e, and the 3' HBV signal region pA (the pre-C ORF translation initiation codon is deleted). The packaging vector pPK-CPX, a component of the resistance test vector system comprising a segment of gene P derived from the patient is shown in Figure 8D and the packaging vector C, pPK-S is shown in Figure 8E.

C. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the subgenomic indicator gene viral vector, pCS-HBV (F-IG) PCR (PSAS-), containing a functional indicator gene cassette assembled as a result of HBV viral duplication.

D. A generalized diagramatic representation of the resistance test vector, pCS-HBV (NF-IG) PCR (PSAS +), s comprising a non-functional reporter gene with a region '9 10 permuted encoder containing the following elements in a 5' to 3 'orientation: (1) the CMV IE promoter-enhancer region, (2) the 5' region of the HBV genome including DR1 and 5 '((the codon of ORF pre-C translation initiation is eliminated), (3) part 3 'of the ORF indicator gene starting with a sequence of acceptor of division in the reverse orientation, (4) the gene P containing the segment derived from the patient, (5) an enhancer-promoter region, (6) the 5 'part of the ORF reporter gene ending in a donor sequence divided into the reverse orientation, (7), the 3 'region of the HBV genome containing DR2, DR1 *, the 3'e and the 3 'HBV signal region pA (the pre-C ORF translation start codon was deleted). The packaging vector pPK-CSX, providing the C, S and X genes was sescotransfected with the pCS-HBV (NF-IG) PCR resistance test vector (PSAS +), and is shown in Figure 8H. 25 E. Grammar representation of the covalently closed circular DNA form (cccDNA) of the resistance test vector, pCS-HBV (F-IG) PCR (PSAS +), containing a cassette of functionally indicated gene and a derived P gene segment of the assembled patient as a result of HBV viral duplication.

Figure 13 A. Diagrammatic representation of the pregenomic structure of HBV RNA.

B. A generalized diagramatic representation of the viral vector component of the subgenomic indicator gene pCS-HBV (F-IG) (PSAS-), a component of the resistance test vector system comprising a functional indicator gene cassette containing the following elements in a 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome including DR1 and 5' ((the pre-C ORF translation initiation codon is deleted) , (3) a cassette of functional indicator gene, (4) the 3 'region of the HBV genome containing DR2, DR1 *, the 3'e, and the 3' HBV pA signal region (the ORF translation initiation codon) pre-C is deleted.) The packaging vector, pPK-CPX, a component of the resistance test vector system comprising a P-gene segment derived from the patient is shown in Figure 8D and the packaging vector S, the pPK- S is shown in Figure 8E.

C. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the subgenomic indicator gene viral vector, pCS-HBV (F-IG) (PSAS-), containing a functional indicator gene.

D. Generalized Diagrammatic Representation of the pCS-HBV (F-IG) Resistance Test Vector (PSAS +), comprising a functional indicator gene containing the following elements in a 5 'to 3' orientation: (1) the promoter region CMV IE enhancer, (2) the 5 'region of the HBV genome including DR1 and 5' ((the pre-C ORF translation initiation codon is deleted), (3) a cassette of functional indicator gene,} the gene P containing the patient-derived segment, (5) the 3 'region of the HBV genome containing DR2, DR1 *, the 3'e, and the 3' HBV pA signal region (the ORF translation initiation codon) pre-C is deleted.) The packaging vector, pPK-CPX, providing the C, S, and X genes that are cotransfected with the resistance test vector, pCS-HBV (F-IG) (PSAS +), and shown in Figure 8H.

E. Diagrammatic representation of the covalently closed circular DNA form (cccDNA) of the resistance test vector, pCS-HBV (F-IG) (PSAS +), containing a functional indicator gene.

Detailed description of the invention In order that the invention described herein be more fully understood, the following description is given.

The present invention provides a novel drug susceptibility and resistance assay comprising the steps of: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene in a host cell; (b) culturing the host cell of step (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the reporter gene from step (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of the antiviral drug is present in steps (a) - (c); in steps (b) - (c); or in step (c).

In one aspect of the invention there is provided a method for determining the susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a segment derived from the patient and a reporter gene into a host cell; (b) culturing the host cell of step (a); (c) measuring an indicator in a target host cell wherein said indicator is a DNA or RNA structure; and (d) comparing the measurement of the indicator from step (c) with the measurement of the indicator when steps (a) - (c) are carried out in the absence of an antiviral drug, where a test concentration of the drug antiviral is present in steps (a) - (c); in steps (b) - (c); or in step (c).

This invention also provides a method for determining resistance to the antiviral drug in a patient comprising: (a) developing a standard curve of drug susceptibility for an antiviral drug; (b) determining an antiviral drug susceptibility in the patient using either the susceptibility tests described above; Y (c) compare the susceptibility of the antiviral drug in step (b) with the standard curve determined in step (a) wherein a decrease in antiviral susceptibility indicates a development of resistance to the antiviral drug in the patient.

This invention also provides a method for determining resistance to the antiviral drug in a patient comprising: (a) determining the susceptibility to the antiviral drug in the patient at first in accordance with any of the methods indicated above, wherein the segment derived from the patient is obtained from the patient at about said time; (b) determine the susceptibility to the antiviral drug of the same patient at a later time; and (c) comparing the susceptibility of the antiviral drug determined in step (a) and (b) wherein a decrease in antiviral drug susceptibility at a later time compared to a first time indicates the development or progression of resistance to the antiviral drug in a patient.

The assay of this invention can be used for a viral disease wherein the susceptibility and resistance to the antiviral drug is a concern including, for example, the human immunodeficiency virus, the simplex herpes virus, the cytomegalovirus virus, the varicella zoster virus , other human herpes viruses (HIV), influenza A virus, respiratory syncytial virus, hepatitis A, B and C viruses, rhinovirus and human papillomavirus. The above are representative of certain viruses for which antiviral chemotherapy is currently available, and represent the viral families retroviridae, herpesviridae, orthomyxoviridae, pneumoviruses and hepadnaviridae. The assay of this invention can be used with other viral infections arising from infections due to other viruses within these families as well as viral infections arising from viruses in other viral families. In addition, the susceptibility of the drug and resistance test of this invention is useful for analyzing compounds for treating viral diseases for which there is currently no available therapy.

The structure, life cycle and genetic elements of the viruses that can be tested in the drug susceptibility and resistance test of this invention are known to one of ordinary skill in the art. It is useful for the practice of this invention, for example, to understand the life cycle of a retrovirus, as well as the viral genes required for the rescue and ineffectiveness of the retrovirus. The retrovirally infected cells discard a membrane virus containing a diploid RNA genome. The virus, placed in an envelope glycoprotein (which serves to determine the range of ineffectiveness of the host), binds to a cellular receptor in a plasma membrane of the cell to be infected. After agglutination of the receptor, the virus is internalized and is discovered by passing through the cytoplasm of the host cell. either on its way to the nucleus or in the nucleus, the reverse transcriptase molecules resident in the viral nucleus push the synthesis of the double strain DNA provirus, a synthesis that is primed by agglutinating the tRNA molecule to the genomic viral RNA. The double strain DNA provirus is subsequently integrated into the genome of the host cell, where it can serve as a transcriptional tempering for both viral proteins encoding mRNAs and a genomic virion RNA, which will be packaged within the viral core particles. At the exit of the infected cell, the core particles move through the cytoplasm, bind to the interior of the plasma membrane of the newly infected cell, and germinate, taking these membrane tracts containing the glycoprotein gene product from over virally encoded. This cycle of infection-reverse transcription-translation, transcription, virion assembly, and germination repeats itself again and again as the infection spreads.

Viral RNA and, as a result, proviral DNA encode several cis-acting elements that are vital to successfully complete the viral life cycle. RNA virion carries the viral promoter at its 3 'end. The acrobatic duplicates place the viral promoter at the 5 'end of the viral genome when the genome is reverse transcribed. just close to the 3 'to 3' retroviral LTR lies the viral packaging site. The retroviral life cycle requires the presence of virally encoded transaction factors. The DNA polymerase dependent on viral RNA (pol) - reverse transcriptase is also contained within the viral nucleus and is vital for the viral life cycle in the sense that it is responsible for the conversion of genomic RNA to intermediate integrative proviral DNA. The envelope viral glycoprotein env is required for viral attachment to the uninfected cell and for viral spread. There are also transcriptional transcriptional factors, called transactivators, which can serve to modulate the level of transcription of the integrated parent provirus. Typically, duplication-component (non-defective) viruses are self-contained in the sense that they encode all trans-acting factors. Their defective counterparts are not self-contained.

In the case of the DNA virus, such as a hepadnavirus, the understanding of the life cycle and the viral genes required for the infection is useful for the practice of this invention. The HBV entry process has not been defined very well. The duplication of HBV uses an intermediate RNA tempering. In the infected cell the first step in the duplication is the conversion of the relaxed asymmetric circle DNA (rc-DNA) to the circle covalently closed DNA (cccDNA). This process, which occurs within the nucleus of infected liver cells, involves completing the synthesis of DNA positive strain and ligation of DNA ends. In the second step, the cccDNA is transcribed by the host RNA polymerase to generate a temperate RNA of 3.5 kB (the pre-genome). This pregenome is complexed with protein in the viral nucleus. The third step involves the synthesis of the first sense-negative DNA strain by copying the pregenomic RNA using the virally encoded protein P reverse transcriptase. Protein P also serves as the DNA primer of strain minus. Finally, the synthesis of the second positive sense DNA strain occurs by copying the first DNA strain using the protein P DNA polymerase activity and a viral RNA oligomer is primed. The pregenome also transcribes mRNA for the major native core proteins.

The following flow diagram illustrates certain of the vectors and host cells that can be used in this invention. This is not intended to be inclusive.

Vector Plaster Vector Viral gene (functional / non-functional genomic or subgenomic indicator gene) Vector Viral Gen Indicator (functional / non-functional indicator gene) + Acceptor sites of patient sequence + Segments derived from patient Resistance Test Vector (patient derived segments + indicator gene) Host Cells Host cell packaging - transfected with packaging expression vectors.

Host cell resistance test vector - host cell packaging transfected with a resistance test vector.

Target host cell - a host cell to be infected by a viral particle resistance test vector produced by the host cell resistance test vector.

Resistance Test Vector The "resistance test vector" means one or more vectors which taken together contain DNA or RNA comprising a segment derived from the patient and a reporter gene. In the case where the resistance test vector comprises more than one vector, the patient-derived segment can be contained in one vector and the reporter gene in a different indicator. Such a resistance test vector comprising more than one vector is referred to herein as a resistance test vector system for purposes of clarity but is nonetheless understood to be a resistance test vector. The DNA or RNA resistance test vector can therefore be contained in one or more DNA or RNA molecules. In a modality, the resistance test vector is made by inserting a patient-derived segment into a viral vector of the reporter gene. In another embodiment, the resistance test vector is made by inserting a patient-derived segment into a packaging vector while the reporter gene is contained in a second vector, e.g., a viral vector of the reporter gene. As used herein, the "patient-derived segment" refers to one or more viral segments obtained directly from a patient using various means, for example, molecular cloning or polymerase chain reaction (PCR) amplification of a population of segments derived from patient using viral DNA or complementary DNA (cDNA) prepared from viral RNA, present in cells (e.g., peripheral blood mononuclear cells, PBMC), serum or other body noises of infected patients. When a viral segment is obtained directly from a patient this is obtained without the passage of the virus through the culture, or if the virus is cultured, then by means of a minimum number of passes to essentially eliminate the selection of mutations in the culture. The term "viral segment" refers to any functional viral sequence or viral gene encoding a gene product (eg protein) that is the target of the antiviral drug. The term "functional viral sequence" as used herein refers to any nucleic acid sequence (DNA or RNA) with a functional activity such as enhancers, promoters, polyindentation sites, sites of action of acting factors, such as tartar and RRE, packaging sequences, integration sequences or division sequences. If a drug was the target of more than one functional viral sequence or a viral gene product, then the patient-derived segments corresponding to each viral gene could be inserted into the resistance test vector. In the case of combination therapy where two or more antivirals target two different functional viral sequences or viral gene products are being evaluated, the patient derived segments corresponding to each functional viral sequence or to each viral gene product would be inserted. in the resistance test vector. The patient-derived segments are inserted into unique restriction sites or specified sites, called patient sequence acceptor sites, in the indicator gene viral vector or for example, a packaging vector depending on the particular constructs being used as describe here.

As used herein, the "patient-derived segment" encompasses segments derived from humans and various species of animals. Such species include, but are not limited to chimpanzees, horses, cattle, cats and dogs.

Segments derived from the patient can also be incorporated into the resistance test vectors using any of several alternative cloning techniques. For example, cloning through introduction into restriction sites class II within both the plasmid column and patient-derived segments or by cloning of glycosylase priming DNA uracil (refs).

The patient-derived segment can be obtained by any method of molecular cloning or gene amplification or modifications thereof by introducing patient sequence acceptor sites, as described below, at the ends of the patient-derived segment that are going away. to enter within the resistance test vector. For example, in a gene amplification method such as PCR, the restriction sites corresponding to the patient sequence acceptor sites can be incorporated into the ends of the primers used in the PCR reaction. Similarly, in a molecular cloning method such as cDNA cloning, said restriction sites can be incorporated at the ends of the primers used for the first or second strain cDNA synthesis, or in a method such as DNA primer-repair. , whether cloned or non-cloned DNA, said restriction sites can be incorporated into the primers used for the repair reaction. Patient sequence acceptor sites and primers are designed to improve the representation of patient-derived segments. The sets of resistance test vectors having designated patient sequence acceptor sites provide the representation of the patient derived segments that would be overpresented in a resistance test vector alone.

The resistance test vectors are prepared by modifying a viral gene vector indicator (described below) by introducing patient sequence acceptor sites, amplifying or cloning the patient-derived segments and inserting the amplified or cloned sequences precisely into the viral gene vectors at the patient sequence acceptor sites. The resistance test vectors are constructed from the viral vectors of the reporter gene which in turn are derived from genomic viral vectors or from subgenomic viral vectors and a cassette from an indicator gene, each of which is described below. The resistance test vectors are then introduced into the host cell. Alternatively, a resistance test vector (also referred to as a resistance test vector system) is prepared by introducing the patient sequence acceptor sites into a packaging vector, amplifying or cloning the patient-derived segments and inserting the sequences cloned or amplified precisely within the packaging vector at the patient sequence acceptor sites and co-transfecting this packaging vector with a viral vector of reporter gene.

In a preferred embodiment, the resistance test vector can be introduced into the packaging host cells together with the packaging expression vectors, as defined below, to produce the resistance test vector viral particles that are used in the tests of resistance and susceptibility to the drug that are referred to here as a "particle-based test". In an alternative embodiment, the resistance test vector can be introduced into a host cell in the absence of packaging expression vectors to carry out a resistance and drug susceptibility test that is referred to herein as a "base test". without particle. " As used herein, "a packaging expression vector" provides factors, such as packaging proteins (e.g., structural proteins such as core and envelope polypeptides), transaction factors or genes required by retroviruses or doubling-defective hepadnavirus. In such a situation, a competent duplicating viral genome is weakened in such a way that it can not be duplicated with those of its kind. This means that, even when the packaging expression vector can produce the trans-acting or missing genes required to rescue a defective viral genome present in a cell containing a weakened genome, the weakened genome can not be rescued itself.

Indicator or Indicator Gene The "reporter or indicator gene" refers to a nucleic acid encoding a protein, a DNA or RNA structure that is either directly or through a reaction yields a measurable or remarkable aspect, e.g., a color or light of a measurable wavelength or in the case of DNA or RNA used as an indicator a change or generation of specific DNA or RNA structure. Preferred examples of a reporter gene are the E. coli lacZ gene which encodes beta-galactosidase, the luc gene which encodes luciferase either from, for example, Photonis pyralis (the firefly) or Renilla reniformis (the thought of the sea ), the E. coli phoA gene which encodes phosphatase haze, green fluorescent protein and the bacterial CAT gene which codes for chloramphenic acetyltransferase. Additional preferred examples of a reporter gene are secreted proteins or cell surface proteins that are easily measured by an assay, such as a radio immunoassay (RIA), or a fluorescent activated cell (FACS) draw, including, for example, factors of growth, cytokines and cell surface antigenes (for example growth hormone, 11-2 or CD4, respectively). The "gene indicator" is understood to also include a gene selection, also referred to as a selectable marker. Examples of suitable selectable markers for mammalian cells are reductase dihydrofolate (DHFR), thymidine kinase, hygromycin, neomycin, zeocin or E. coli gpt. In the case of the above examples of reporter genes, the reporter gene and the patient-derived segment are discrete, for example, separate and distinct genes. In some cases a segment derived from the patient can also be used as a reporter gene. In a modality in which the segment derived from the patient corresponds to more than one viral gene which is the target of an antiviral, one of the viral genes also serves as the indicator gene. For example, a viral protease gene can serve as a reporter gene by virtue of its ability to unfold a chromogenic substrate or its ability to activate an inactive zymogen which in turn unfolds a chromogenic substrate, giving rise in each case to a reaction color. In all the above-mentioned examples of indicator genes, the reporter gene may be either "functional" or "non-functional" but in each case the expression of the reporter gene in the target cell will ultimately depend on the action of the patient-derived segment.

Functional Indicator Gene In the case of the "functional indicator gene" the reporter gene may be capable of being expressed in a "host cell of resistance test / packaging host cell" as defined below, independent of the segment derived from the patient, however the Functional indicator gene may not be expressed in the target host cell as defined below, without the production of functional resistance test vector particles and their effective infection of the target host cell. In one embodiment of a functional indicator gene, the indicator gene cassette, comprising control elements and a gene encoding an indicator protein, is inserted into the reporter gene viral vector with the same or opposite transcriptional orientation as the promoter / enhancer. native or foreign viral vector. An example of a functional indicator gene in the case of HIV or HBV, places the reporter gene and its promoter (a promoter / enhancer CMV IE) in the same transcriptional or opposite orientation as that of the promoter or enhancer HIV-LTR or HBV, respectively, or the CMV IE promoter / promoter associated with the viral vector.

Non-Functional Indicator Gene Alternatively, the indicator gene may be "functional" in the sense that the reporter gene is not efficiently expressed in a packaging host cell transfected with the resistance test vector, which is then referred to as a host cell resistance test vector, until it becomes in a functional indicator gene through the action of one or more of the segment products derived from the patient. A reporter gene is made non-functional through genetic manipulation according to this invention. 1. Promoter Permuted. In one embodiment, a reporter gene is mentioned as non-functional due to the location of the promoter, in the sense that even though the promoter is in the same transcriptional orientation as the reporter gene, it follows rather that it precedes the coding sequence of reporter gene . This misplaced promoter is mentioned as a "permuted promoter". In addition to the promoter permuted to the orientation of the non-functional reporter gene is opposite to that of the native or foreign promoter / enhancer of the viral vector. Therefore, the coding sequence of the non-functional reporter gene can neither be transcribed by the permuted promoter nor by the viral promoters. The non-functional reporter gene and its permuted promoter becomes functional by the action of one or more of the viral proteins. An example of a non-functional reporter gene with a permuted promoter in the case of HIV, places a T7 phage RNA polymerase promoter (referred to herein as a T7 promoter) in the 5 'LTR in the same transcriptional orientation as that of the reporter gene. The reporter gene can not be transcribed by the T7 promoter since the indicator gene cassette is positioned upstream of the T7 promoter. The non-functional reporter gene in the resistance test vector is converted to a functional reporter gene by reverse transcriptase with the infection of the target cells resulting from the replacement of the T7 promoter, by copying the 5 'LTR to the 3' LTR, in relation to the coding region of the indicator gene. After integration of the repaired reporter gene into the target cell chromosome by HIV integrase, a nuclear T7 RNA polymerase expressed by the target cell transcribes the reporter gene. An example of a non-functional reporter gene with a permuted promoter in the case of HBV places a promoter-enhancer region downstream or 3 'of the reporter gene both having the same transcriptional orientation. The reporter gene can not be transcribed by the promoter / enhancer since the indicator gene cassette is placed upward. The non-functional reporter gene in the resistance test vector is converted into a functional indicator gene by transcription and inverse circularization of the HBV reporter gene viral vector by rearranging the promoter-enhancer upward relative to the reporter coding region .

A permuted promoter can be any eukaryotic or prokaryotic promoter which can be transcribed in the target host cell. Preferably the promoter will be small in size to allow insertion into the viral genome without disrupting viral duplication. More preferably, a promoter that is small in size and capable of transcription by a subunit RNA polymerase introduced into the target host cell, such as the bacteriophage promoter, will be used. Examples of such bacteriophage promoters and their RNA polymerases include those of phages T7, T3 and Sp6. A nuclear localization sequence (NLS) can bind to the RNA polymerase to localize the expression of the polymerase. RNA to the nucleus where it may be needed to be transcribed to the repaired reporter gene. Such NLS can be obtained from any nuclear-transported protein, such as the SV40 T antigen. If a phage RNA polymerase is employed, an internal ribosome entry site (IRES) such as the untranslated region of EMC virus can be added ( UTR) on the front of the reporter gene, for the translation of the transcripts which are not usually covered. In the case of HIV, the permuted promoter itself can be introduced into any position within 5 'LTR that is copied to 3' LTR during reverse transcription as long as the LTR function is not interrupted, preferably within parts U5 and R of the transcript. LTR, and more preferably outside the functionally important and highly conserved regions of U5 and R. In the case of HBV, the permuted promoter can be placed in any position that does not interrupt cis acting elements that are necessary for HBV DNA duplication.

Blocking sequences can be added at the ends of the resistance test vector in case of finding an inappropriate expression of the non-functional reporter gene due to transfection artifacts (DNA concatenation). In the HIV example of the permuted T7 promoter given above, such a blocking sequence may consist of a T7 transcriptional terminator, placed to block the reading transcript resulting from the DNA concatenation, but no transcription resulting from the repositioning of the permuted T7 promoter of 5 'LTR at 3 'LTR during reverse transcription. 2. Permuted Coding Region. In a second embodiment, the reporter gene becomes non-functional due to the relative location of the 5 'and 3' coding regions of the reporter gene in the sense that, the 3 'coding region precedes rather than follows the region. of coding 5 '. This misplaced coding region is referred to as a "permuted coding region". The orientation of the non-functional reporter gene may be the same or one opposite to that of the native or foreign promoter / enhancer of the viral vector, since an mRNA encoding a functional reporter gene will occur in the case of any orientation. The non-functional reporter gene and its permuted coding region becomes functional by the action of one or more of the segment products derived from the patient. A second example of a non-functional reporter gene with a permuted coding region in the case of HIV, places a coding region of a 5 'reporter gene with an associated promoter in the 3' LTR U3 region and a 3 'region indicator gene coding at an upstream location of the HIV genome, with each coding region having the same transcriptional orientation as the viral LTRs. In both examples, the 5 'and 3' coding regions may also have associated donor and split acceptor sequences, respectively, which may be heterologous or artificial dividing signals. The reporter gene can not be functionally transcribed either by the associated promoter or the viral promoters, since the permuted coding region prevents the formation of functionally divided transcripts. The non-functional reporter gene in the resistance test vector is converted to a functional reporter gene by reverse transcriptase with the infection of the target cells, resulting from the relocation of the 5 'and 3' indicator gene coding regions in relation to one another, by copying from the 3 'LTR to the 5' LTR. After transcription by the promoter associated with the 5 'coding region, the RNA division can bind the 5' and 3 'coding regions to produce a functional reporter gene product. An example of a non-functional reporter gene with a permuted coding region in the case of HBV places a coding region of the 3 'reporter gene upstream or 5' of the enhancer / promoter and the 5 'coding region of the reporter gene. the transcriptional orientation of the 5 'and 3' coding regions of the reporter gene are identical to one another, and the same as those of the indicator gene viral vector. However, when the 5 'and 3' coding regions of the reporter gene are permuted in the resistance test vectors (for example, the 5 'coding region is downstream of the 3' coding region) the mRNA is not transcribed of the body must be divided to generate a functional indicator gene coding region. After transcription and reverse circularization of the indicator gene vector viral, the 3 'coding region of the reporter gene is placed downstream or 3' high enhancer motor and the 5 'coding regions thus allowing transcription of mRNA that can be divide to generate a functional indicator gene coding region. 3. Intron inverted. In a third embodiment, the reporter gene becomes non-functional through the use of an "inverted intron" for example an intron inserted into the coding sequence of the reporter gene with a transcriptional orientation opposite that of the reporter gene. The general transcriptional orientation of the indicator gene cassette includes its own linked promoter, this opposite to that of the viral control elements while the orientation of the artificial intron is the same as that of the viral control elements. Indicator gene transcription by its own linked promoter does not lead to the production of functional transcripts since inverted intron can not be divided in this orientation. The transcription of the reporter gene by the viral control elements leads, however, to the removal of the inverted intron by the RNA division, even though the reporter gene is not yet functionally expressed since the resulting transcript has an antisense orientation. After the reverse transcription of this transcript and the integration of the resulting retroviral DNA, or the circularization of hepadnavirus DNA, the reporter gene can be functionally transcribed using its own linked promoter since the intron invert has been previously removed. In this case, the reporter gene itself may contain its own functional promoter with the complete transcriptional unit oriented opposite to the viral control elements. Therefore, the non-functional indicator gene is in the wrong orientation to be transcribed by the viral control elements and can not be functionally transcribed by its own promoter, since the inverted intron can not be cut properly by division. However, in the case of a retrovirus and HIV specifically and hepadnaviruses, and HBV specifically, transcription by viral transcriptionists (HIV LTR or HBV enhancer-promoter) results in the removal of inverted intron by division. As a consequence of the reverse transcription of the resulting divided transcript and the integration of the resulting provirus into the host cell chromosome or circularization of the HBV vector, the reporter gene can now be functionally transcribed through its own promoter. The inverted intron, consisting of a divided donor and an acceptor site for removing the intron, is preferably located in the coding region of the reporter gene in order to interrupt the translation of the reporter gene. The divided donor and acceptors can be any divided donor and acceptor. A preferred divided donor-donor is the divided donor CMV IE and the divided acceptor of the second exon of the human alpha globin gene ("intron A").

Viral Vector of Gen Indicator - Construction As used herein, "indicator gene viral host" refers to a vector or vectors comprising a reporter gene to its control elements and one or more viral genes. The indicator gene viral vector is assembled from a cassette of reporter gene and from a "viral vector" defined below. The indicator gene viral vector may additionally include an enhancer, cleavage signals, polyadenylation sequences, transcriptional terminators, or other regulatory sequences. Additionally, the viral vector of the reporter gene may be functional or non-functional. In the case that the viral segments which are the target of the antiviral drug are not included in the viral vector of the indicator gene these are promoted in the second vector. A "reporter gene cassette" comprises a reporter gene and control elements. The "viral vector" refers to a vector comprising some or all of the following: viral genes encoding a gene product, control sequences, viral packaging sequences, and in the case of a retrovirus, integration sequences. The viral vector may additionally include one or more viral segments one or more of which may be the target of an antiviral drug. Two examples of a viral vector which contain viral genes are referred to herein as a "genomic viral vector" and a "subgenomic viral vector". A "genomic viral vector" is a vector which can comprise a deletion of one or more viral genes to be a duplication of incompetent virus, but which otherwise preserves the mRNA expression and the processing characteristics of the whole virus. In a modality for the HIV drug resistance susceptibility test, the genomic viral vector comprises the HIV genes gag-pol, vif, vpr, tat, rev, vpu, and nef (some, most or all of env can be deleted). A "subgenomic viral vector" refers to a vector that comprises the coding region of one or more viral genes which can encode the proteins that are the target or targets of the antiviral drug.In the case of the human immunodeficiency virus, a preferred is a subgenomic viral vector comprising the HIV gag-pol gene.In the case of HBV a preferred embodiment is a subgenomic viral vector comprising HBV P. gene In the case of HIV, two examples of pro-viral clones used for the construction of the vector are: HXB2 (Fisher et al., (1986) Nature 320, 367-371) and NL4-3, (Adachi et al., (1986) J. Virol, 59, 284-291.) In the case of HBV, a A large number of full-length genomic sequences have been characterized and can be used for the construction of the viral vectors HBV GenBank Nos. M54923, M38636, J02203 and X59795. The viral coding genes can be under the control of a native enhancer / promoter or of a better designer / viral or foreign cell promoter. A preferred embodiment for an HIV drug susceptibility and resistance test is to place the genomic or subgenomic viral coding regions under the control of the native enhancer / promoter of the HIV-LTR U3 region or the immediate-initial CMV enhancer / promoter. (IE) A preferred embodiment for a HBV drug susceptibility and resistance test is to place the genomic or subgenomic coding regions under the control of the immediate-initial CMV promoter / enhancer (IE). In the case of a viral vector of indicator gene that contains one or more viral genes which are targets or encode proteins which are the targets of a drug or antiviral drugs then said vector contains the acceptor sites of patient sequence. Patient-derived segments are inserted into the patient sequence acceptor site in the indicator gene viral vector which is then referred to as the resistance test vector as described above.

The "patient sequence acceptor sites" are sites in a vector for the insertion of patient-derived segments and said sites can be: 1) unique restriction sites introduced by site-directed mutagenesis within a vector; 2) unique restriction sites that occur naturally in the vector; or 3) selected sites within which a patient-derived segment can be inserted using alternative cloning methods (e.g., UDG cloning). In one embodiment, the patient sequence acceptor site is introduced into the viral vector of the reporter gene. The patient sequence acceptor sites are preferably located within or near the coding region of the viral protein which is the target of the antiviral drug. The viral sequences used for the introduction of the patient sequence acceptor sites are preferably chosen so that no change or conservative change is made in the amino acid coding sequence found in that position. Preferably the patient sequence acceptor sites are located within a relatively conserved region of the viral genome to facilitate the introduction of the patient-derived segments. Alternatively, the acceptor sites of the patient sequence are located between important genes or functionally regulatory sequences. The patient sequence acceptor sites can be located at or near regions in the viral genome that are relatively conserved to allow the primer to be primed used to introduce the corresponding restriction site into the patient-derived segment. To improve the representation of the patient-derived segments additionally, such primers may be designed to degenerate ponds to accommodate a viral sequence of heterogeneity or may incorporate residues such as deoxylosin (I) which may have multiple base pair capacities. The sets of resistance test vectors having patient sequence acceptor sites that define the same restriction site or overlapping ranges can be used together in resistance and drug susceptibility tests to provide representation of patient-derived segments that they contain internal restriction sites identical to a given patient sequence acceptor site, and would therefore be underrepresented in any single resistance test vector.

Host Cells The resistance test vector is introduced into a host cell. Suitable host cells are mammalian cells. Preferred host cells are derived from human tissues and cells which are the main targets of viral infection. In the case of HIV these include human cells such as human T cells, monocytes, macrophages, dendritic cells, Langerhans cells, hematopoieic stem cells or precursor cells, and other cells. In the case of HBV, suitable host cells include the hepatoma cell lines (HepG2, Huh 7), the primary human hepatocytes, the mammalian cells which can be infected by pseudotyping HBV, and other cells. The human-derived host cells ensure that the antiviral drug will enter the cell efficiently and will be converted by the cellular enzymatic machinery in the metabolically relevant form of the antiviral inhibitor. Host cells are referred to herein as "packaging host cells", "resistance test vector host cells" or "target host cells". A packaging host cell refers to a host cell that provides the transactuating factors and viral packaging proteins required for the duplication of the defective viral vectors used herein., such as the resistance test vectors, such as to produce the viral particles of resistance test vector. Packing proteins can be provided by the expression of the viral genes contained within the resistance test vector itself, a packaging expression vector or vectors, or both. A packaging host cell is a host cell which is transfected with one or more packaging expression vectors and when transfected with a resistance test vector is then referred to herein as a "host cell resistance test vector" and is sometimes referred to as a resistance test vector / packaging cell host cell. Preferred host cells for use in packaging host cells for HIV include 293 human embryonic kidney cells (293, Graham, FL et al., J. Gen Virol. 36: 59, 1977), BOSC23 (Pear et al., Proc. Nati, Acad.Sci.90, 8392, 1993), ts54 and tsa201 cell lines (Heinzel et al., J. Virol. 62, 3738.1988), for HepG2 HBV (Galle and Theilmann, L. Arzheim.-Forschy Drug Res. (1990) 40, 213-216). An "objective host cell" refers to a cell that has been infected by the viral particles of resistance test vector, produced by the host cell vector of resistance test and in which the expression or inhibition of the reporter gene has place. Preferred host cells for use as target host cells include leukemia cell lines, including human T cell (ATCC T1B-152), H9 (ATCC HTB-176), CEM (ATCC CCL-119), HUT78 (ATCC T1B -161), and derivatives thereof.

Evidence of Susceptibility and Drug Resistance The resistance and drug susceptibility tests of this invention can be carried out in one or more host cells. The susceptibility to the viral drug was determined as the concentration of the antiviral agent at which a given percentage of the reporter gene expression is inhibited (for example the IC50 for an antiviral agent is the concentration at which 50% of the gene expression indicator is inhibited A standard curve for the drug susceptibility of a given antiviral drug can be developed for the viral segment which is either a standard laboratory viral segment or an innocent drug patient (for example a patient who has not received no antiviral drug) using the method of this invention Correspondingly, resistance to the viral drug is a decrease in the susceptibility to the viral drug for a given patient already by comparing the susceptibility to the drug with such a given standard or by means of the make a measurement in sequence in the same patient over time, as determined by the increased inhibition of gene expression in dicator (for example, decreased indicator gene expression).

In the first type of drug susceptibility and resistance test the viral particles of the resistance test vector are produced by a first host cell (the host cell resistance test vector) was prepared by transfecting a packaging host cell with the resistance test vector and the packaging expression vector or vectors. The viral particles of resistance test vector are then used to infect a second host cell (the target host cell) in which the expression of the reporter gene is measured. Such a two cell system comprises a packaging host cell which is transfected with a resistance test vector, which is then referred to as a resistance test vector host cell, and a target cell is used in the case of either a functional or non-functional indicator gene. Functional reporter genes are efficiently expressed with transfection of the packaging host cell and will require infection of a target host cell with host cell supernatant of resistance test vector to carry out the test of this invention. Nonfunctional reporter genes with a permuted promoter, a permuted coding region, or an inverted intron are not efficiently expressed with the transfection of the packaging host cell and thus the infection of the target host cell can be achieved either by co- Cultivation using the host cell vector for resistance testing and the target host cell or infection through the target host cell using the host cell supernatant of the resistance test vector. In the second type of subtest of susceptibility and drug resistance, a single host cell (the host cell of the resistance test vector) also serves as a host target cell. The packaging host cells are transfected and produce viral particles of resistance test vector and some of the packaging host cells also become the target of infection by the vector particles of resistance test. Tests for susceptibility and drug resistance using a single host cell type are possible with viral resistance test vectors comprising a non-functional reporter gene with a permuted promoter, a permuted coding region, or an inverted intron. Such reporter genes are not efficiently expressed with the transfection of a first cell, but are expressed only efficiently with the infection of a second cell, and therefore provide an opportunity to measure the effect of the antiviral agent under evaluation. In the case of a drug susceptibility and resistance test using a resistance test vector comprising a functional indicator gene, none of the co-cultivation procedure nor the resistance and susceptibility test using a single cell type can be used for the infection of target cells. A resistance test vector comprising a functional reporter gene requires a two-cell system using filtered supernatants from the resistance test vector host cells to infect the target host cell.

In one embodiment of the invention in the case of human immunodeficiency virus, particle-based resistance tests are carried out with resistance test vectors derived from genomic viral vectors for example, pLG-lucPP-HS, pCG-lucPP -HS, pLG-lucPP-PB, pCG-lucPP-PB, pLG-lucPC-HS, pCG-lucPC-HS, pLG-lucPC-PB, pCG-lucPC-PB, pLG-lucPC-HS, pCF-lucII-HS , pLG-lucII-PB, pCG-lucII-PB, and pCG-CXCN (F-lucP) 2-AA which are cotransfected with the expression vector of pVL-env 070A (also referred to as PCXAS-4070Aenv). Alternatively, a particle-based resistance test can be carried out with resistance test vectors derived from subgenomic viral vectors, eg, PLS-lucPP-HS, pCS-lucPP-HS, pLS-lucPP-PB, pCS-luc -PP-PB, pLS-lucPC-HS, pCS-lucPC-HS, pLS-lucPC-PB, pCS-luc-PC-PB, pLS-lucII-HS, pCS-lucII-HS, pLS-lucII-PB, and pCS-luc-II-PB) which are cotransfected with the packaging expression vector pVL-env4070A and any PLTR-HIV3 'or pCMV-HIV3. In another embodiment of the invention in the case of non-HIV particle-based resistance tests are carried out using each of the resistance test vectors described above by transfection of selected host cells in the absence of packaging expression vectors.

In the case of the particle-based susceptibility and resistance test, the viral particles of the resistance test vector are produced by a first host cell (the host cell of a resistance test vector) that was prepared by transfecting a cell Hostess of packaging with the vector of resistance test and the vector or packaging expression vectors. The viral particles of resistance test vector are then used to infect a second host cell (the target host cell) in which the expression of the reporter gene is measured. In a second type of particle-based susceptibility and resistance test, a single host cell type (host cell resistance test vector) serves both purposes: some of the packaging host cells in a given culture are transfected and produce viral particles of resistance test vector some of the host cells in the same culture are the object of infection by the resistance test vector particles thus produced. Resistance tests employing a single host cell type are possible with resistance test vectors comprising a non-functional reporter gene with a permuted promoter since such reporter genes are efficiently expressed with the infection of a permissive host cell, these are not Efficiently expressed with transfection of the same host cell type, and thus provide an opportunity to measure the effect of the antiviral agent under evaluation. For similar reasons, resistance tests using two cell types can be carried out by co-cultivating two cell types as an alternative to infect the second cell type with viral particles obtained from the supernatants of the first cell type.

In the case of the non-particle base susceptibility and resistance test, resistance tests are carried out by transfecting a single host cell with the resistance test vector in the absence of the packaging expression vectors. Non-particle based resistance tests are carried out using resistance test vectors comprising non-functional reporter genes with either permuted promoters, permuted coding regions or inverted introns. These non-particle base resistance tests are carried out by transfecting a single host cell type with each resistance test vector in the absence of packaging expression vectors. Even when these non-functional indicator genes contained within these resistance test vectors are not efficiently expressed with the transfection of the host cells, there is a detectable indicator gene expression resulting from non-viral particle base reverse transcription. Strain transfer and reverse transcription results in the conversion of the nonfunctional reporter gene permuted to a non-permuted functional indicator gene. Since reverse transcription is completely dependent on the expression of the pol gene contained within each resistance test vector, antiviral agents can be tested for their ability to inhibit the pol gene products encoded by the patient-derived segments contained within the vectors. of resistance test. In the case of HIV, strain transfer and reverse transcription result in the conversion of the non-functional reporter gene to a functional indicator gene. Since reverse transcription is completely dependent on the expression of the patient-derived segment contained within each resistance test vector, antiviral agents can be tested for their ability to inhibit the gene products encoded by the patient-derived segments contained within the resistance test vectors.

The packaging host cells are transfected with the resistance test vector and the appropriate packaging expression vectors to produce the resistance test vector host cells. Individual antiviral agents, including the reverse transcriptase inhibitors AZT, ddI, ddC, d4T and 3TC and the protease inhibitors saquinavir, ritonavir and indinavir, as well as combinations thereof are added to the individual plates of the packaging host cells. at the time of transfection, to an appropriate range of concentrations. Twenty-four to forty-eight hours after transfection, the target host cells are infected by co-cultivation with the host cell vectors of the resistance test or with the viral particles of the resistance test vector obtained from filtered supernatants of host cells. of resistance test vector. Each antiviral agent, or combinations thereof, is added to the target host cells before or at the time of infection to achieve the same final concentration of the given agent, or agents, present during transfection.

Determination of the expression or inhibition of the reporter gene in the target host cells infected by cocultivation or filtered viral supernatants is done by means of the assay of the expression of the reporter gene, for example in the case where the gene indicator is the luc gene of the firefly, by measuring the activity of luciferase. The reduction in luciferase activity observed for target host cells infected with a given preparation of viral particles of resistance test vector in the presence of a given antiviral agent, or agents, compared to a control run in the absence of the antiviral agent, generally refers to the log of the concentration of the antiviral agent as a sigmoidal curve. This inhibition curve is used to calculate the apparent inhibitory concentration (IC) of that agent, or of that combination of agents, for the viral target product encoded by the patient-derived segments present in the resistance test vector.

In the case of a cell resistance and susceptibility test, the host cells are transfected with the resistance test vector and the appropriate packaging expression vector (s) to produce the resistance test vector host cells. The individual antiviral agents, or combinations thereof, are added to the individual plates or to the transfected cells at the time of their transfection, to an appropriate range of concentrations. Twenty-four to seventy-two hours after transfection, the cells are harvested and assayed for the firefly luciferase activity. As the cells in the culture are transfected, they do not efficiently express the reporter gene, the transfected cells in the culture, as well as the superinfected cells in the culture, can serve as the target host cells for the expression of the reporter gene. The reduction in luciferase activity observed for the infected cells in the presence of a given antiviral agent or agents compared to a control run in the absence of antiviral agents, generally refers to the log of antiviral agent concentration in a curve sigmoidal This curve inhibition is used to calculate the apparent inhibitory concentration (IC) of an agent, or of a combination of agents, for the viral target product encoded by the patient-derived segments present in the resistance test vector.

Anti-Viral Drug / Drug Candidates The antiviral drugs that are applied to the test system are added at selected times depending on the purpose of the antiviral drug. For example, in the case of HIV protease inhibitors, including saquinavir, ritonavir, indinavir, and nelfinavir, these are added to the individual plates of the packaging host cells at the time of transfection with a resistance test vector , at an appropriate concentration range. HIV protease inhibitors are also added to target host cells at the time of infection to achieve the same final aggregate concentration during transfections. HIV reverse transcriptase inhibitors, including AZT, ddI, ddC, d4T, 3TC and nevaripine, are added to the individual 'plaques of the target host cells at the time of infection by the viral particles of resistance test vector, at a test concentration.

Alternatively, antiviral drugs may be present throughout the trial. The test concentration is selected from a concentration range in which they are typically between about 0.1 nM and about 100 (M and more specifically for each of the following drugs: AXT, from about InM to about 5 (M; ddl, from from about InM to about 25 (M; 3TC, from about InM to about 50 (M; d4T, from about InM to about 25 (M; and nevaripine, from from around InM to around 100 (M.

In another embodiment of this invention, a candidate antiviral compound is tested in the drug susceptibility and resistance test of this invention. The candidate antiviral compound is added to the test system at an appropriate concentration and at selected times depending on the protein target of the candidate antiviral. Alternatively, more than one candidate antiviral compound can be tested or a candidate antiviral compound can be tested in combination with an appropriate antiviral drug such as AZT, ddI, ddC, d4T, 3TC, saquinavir or a compound which is undergoing clinical trials such as ritonavir or the indinovir. The effectiveness of the candidate antiviral will be evaluated by measuring the expression or inhibition of the reporter gene. In another aspect of this invention, the susceptibility and resistance test of the drug can be used for the examination of viral mutants. After identification of mutants resistant to any known antivirals or candidate antivirals, the resistant mutants are isolated and the DNA is analyzed. A library of viral resistant mutants can therefore be assembled allowing the screening of candidate antivirals, alone or in a combination. This will allow one with an ordinary skill to identify effective antivirals and design effective therapeutic regimens.

General Materials and Methods Most of the techniques used to construct the vectors, and to transfect and infect the cells are widely practiced in the art, and most practitioners are familiar with the standard resource materials which describe the specific conditions and procedures. However for convenience, the following paragraphs serve as a guideline.

"Plasmids" and "vectors" are designated by a lower case p followed by letters and / or numbers. The starting plasmids here are commercially available, publicly available on a restricted basis or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to those described are known in the art and will be apparent to an artisan with ordinary skill.

The construction of the vectors of the invention employs standard ligation and restriction techniques which are well understood in the art (see Ausubel et al., (1987) Current Protocols in Molecular Biology, Wiley-Interscience or Maniatis et al., (1992). in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratyro, New York). The isolated plasmids, the DNA sequences or the oligonucleotides synthesized are unfolded, made and relegated in the desired form. The sequences of all the DNA constructs incorporating the synthetic DNA were confirmed by DNA sequence analysis (Sanger et al. (1977) Proc. Nati, Acad. Sci. 74, 5463-5467).

"Digestion" of DNA refers to the catalytic cleavage of DNA with a restriction enzyme that acts only at certain restriction sites and sequences in DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements are known to a craftsman with ordinary skill. For analytical purposes, typically 1 (plasmid g or a DNA fragment is used with about two enzyme units and about 20 (1 buffer solution., an excess of restriction enzyme was used to ensure complete digestion of the DNA substrate. Incubation times of about 1 hour to two hours at around 37 ° C are workable, although variations can be tolerated. After each incubation, the protein is removed by extraction with phenol and chloroform and can be followed by extraction of ether, and the nucleic acid recovered from the aqueous fractions by ethanol precipitation. If desired, the size separation of the split fragments can be carried out by polyacrylamide gel or agarose gel electrophoresis using standard techniques. A general description of size separations is found in the work "Methods of Enzymology 65: 499-560 (1980).

The split fragments of restriction can be blunt by treating them with large fragment of E. coli DNA polymerase I (Klenow) in the presence of four deoxynucleotide triphosphates (dNTPs) using incubation times of about 15 to 25 minutes at 20 ° C in 50 mM Tris (ph7.6) 50mM NaCl, 6mM MgCl2, 6 M DTT and 5-10 mM dNTPs. The Klenow fragment is filled at the sticky ends 5 'but it chews again the unique 3' overhanging strains even when all four dNTPs are present. If desired, selective repair can be carried out by supplying only one of the dNTPs, or with selected dNTPs, within the limitations dictated by the nature of the sticky ends. After treatment with Klenow, the mixture was extracted with phenol / chloroform and precipitated ethanol. Treatment under appropriate conditions with SI nuclease or Bal-31 results in the hydrolysis of any single strain part.

Ligations are carried out at 15-50 (1 volume under the following standard conditions and temperatures: 20 mM Tris-Cl pH 7.5, 10 mM MgCl 2, 10 mM DTT, 33 mg / ml BSA, 10 mM -50 mM NaCl and either 40 mM ATP, 0.01-0.02 (Weiss) units of T4 DNA ligase at 0 ° C (for a "sticky end" ligation) or 1 mM ATP, 0.3-0.6 (Weiss) Tl DNA ligase units at 14 ° C (for a "blunt end" ligation) Intermolecular sticky end ligations are usually carried out at 33-100 (g / ml total DNA concentrations (5-100 M concentration total end). Intermolecular blunt end ligations (usually employing a 10-30 fold excess of linkers) were carried out at a concentration of total mM ends.

"Transient expression" refers to an unamplified expression within about 1 day to 2 weeks of transfection. The optimal time of transient expression of a particular desired heterologous protein may vary depending on several factors including, for example, any transaction factors which may be employed, the translational control mechanisms and the host cell. The transient cell occurs when the particular plasmid having transfected functions, for example, is transcribed and moved. During this time the plasmid DNA which has entered the cell is transferred to the nucleus. The DNA is in a non-integrated, free state within the nucleus. The transcription of the plasmid taken by the cell occurs during this period. After transfection the plasmid DNA can be degraded or diluted by cell division. Random integration within the cell chromatin occurs.

In general, vectors containing promoters and control sequences which are derived from the species compatible with the host cell are used with the particular host cell. Promoters suitable for use with prokaryotic hosts illustratively include the lactose and lactamase-beta promoter systems, alkaline phosphatase, the tritofan promoter system (trp) and the hybrid promoters such as the tac promoter. However, other functional bacterial promoters are suitable. In addition to prokaryotic or eukaryotic microbes such as yeast cultures can also be used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used eukaryotic microorganism even when a number of other strains are commonly available. Promoters controlling the transcription of vectors in mammalian host cells can be obtained by several sources, for example, the genomes of the viruses such as: polyoma, simian virus 40 (SV40), adenovirus, retrovirus, hepatitis B virus and cytomegalovirus preferably or of heterologous mammalian promoters, for example b-actin promoter. The initial and late promoters of the SV 40 virus are conveniently obtained as an SV 40 restriction fragment which also contains the viral SV 40 duplication origin. The immediate initial promoter of human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment. Of course, promoters of the host cell or related species are also useful here.

The vectors used herein may contain a selected gene, also called a selectable marker. A selection gene encodes a protein, necessary for the survival or growth of the host cell transformed with the vector. Examples of suitable selectable markers for mammalian cells include the reductase dihydrofolate (DHFR) gene, the ornithine carboxylase gene, the multiple drug resistance gene (mdr), the adenosine deaminase gene, and the glutamine synthase gene . When such suitable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under a selective pressure. There are two widely used different categories of selective regimes. The first category is based on a cell metabolism and the use of a mutant cell line that lacks the ability to grow independently of a complemented medium. The second category is mentioned as a dominant selection which refers to a selection scheme used in any type of cell and does not require the use of a mutant cell line. These schemes typically use a drug to counteract the growth of a host cell. Those cells which have a novel gene will express a protein leading a resistance to the drug and will survive the selection. Examples of such dominant selection use the drugs neomycin (Southern and Berg (1982) J. Molec, Appl. Genet, 1, 327), mycophenolic acid (Mulligan and Berg (1980) Science 209, 1422), or hygromycin (Sugden et al. others (1985) Mol Cell Cell Biol. 5, 410-413). The three examples given above employ bacterial genes under eukaryotic control to bring about resistance to the neomycin of the appropriate drug (G418 or genticin), xgpt (mycophenolic acid) or hygromycin, respectively.

The means of "transfection" by introducing DNA into a host cell so that the DNA is expressed, whether expressed functionally or otherwise. DNA can also be duplicated either as an extrachromosomal element or by chromosomal integration. Unless otherwise provided, the method used here for the transformation of * the host cells is the calcium phosphate co-precipitation method of Graham and van der Eb (1973) Virology 52, 456-457. Alternative methods for transfection and electroporation, the DEAE-dextran method, lipofection and biolistics (Kriegler (1990) Transfer and Gene expression: a Laboratory Manual, Stockton Press).

The host cells can be transfected with the expression vectors of the present invention and cultured in modified conventional nutrient media as appropriate to induce promoters, select transformants or amplifying genes. The host cells are grown in F12: DMEM (Gibco) 50:50 with added glutamine and without antibiotics. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the artisan with ordinary skill.

The following examples are merely illustrative of the best mode now known for carrying out the invention, but should not be considered as limiting the invention. All references to the literature are expressed and incorporated by reference.

EXAMPLE 1 HIV Drug Resistance and Susceptibility Test using Resistance Test Vectors Comprising Patient Derivative Segment (s) and a Non-Functional Indicator Gene with a Permuted Promoter.

Construction-Viral Vector of Gen Indicator The viral vectors of the reporter gene containing a non-functional reporter gene with a permuted promoter were designed using both viral subgenomic and genomic HIV vectors comprising viral genes which are the target or targets of the antiviral drugs. The viral vectors of the reporter gene pLG-lucPP and pCG-lucPP are based on the PLG and PCG genomic viral vectors; each one sustains a deletion in the HIV env gene. Resistance test vectors derived from the viral genomic indicator gene vectors, pLG-lucPP and pCG-lucPP, contain a patient sequence acceptor site for patient-derived segment insertion and are used in conjunction with the expression vector of packaging coding the MLV 4070A amphotrophic env gene product. The viral vectors of the reporter gene pLS-lucPP and pCS-lucPP are based on viral or genomic vectors pLS and PCS each encoding only the gag-pol HIV gene. Resistance test vectors derived from subgenomic reporter gene viral vectors, pLS-lucPP and pCS-lucPP, contain a sequence acceptor site for insertion of the patient-derived segment and are used in conjunction with the first expression vector of packaging encoding the HIV vif, vpr, tat, rev, vpu and nef genes, and a second packaging vector encoding the 4070A MLV amphotrophic env gene product.

Virales HIV - Genomic and Subgenomic Viral HIV vectors were designed using the sequences of the biologically active proviral clone, HSB2 (Fisher et al. (1986) Nature 320, 367-371). Two types of viral vector were designed: genomic viral vectors with deletions in a single gene such as env, but which otherwise conserved the mRNA expression and processing characteristics of the whole virus, and subgenomic viral vectors which include only one or few genes that are typically the specific targets of the susceptibility and resistance test, such as gag-pol, or which may lack viral genes at all. Both types of vectors have a unique restriction site within the viral genome for the insertion of an indicator gene cassette, as well as patient sequence acceptor sites, for example the additional single restriction sites near or within the antiviral target gene ( for example pol) to allow the insertion of HIV sequences derived from the patient. In addition, both vector types were designed to incorporate either the native promoter-enhancer of the HIV-LTR U3 region or a foreign promoter-enhancer of the immediately initial (IE) CMV region. The standard methods are used for the construction of plasmid DNAs (Ausubel et al. (1987) Current Protocols in Molecular Biology, Wiley-Interscience). The sequences of the DNA constructs incorporating synthetic DNA are confirmed by a DNA sequence analysis (Sanger et al. (1977) Proc Nati Acad. Sci. 74, 5463-5467).

The HIV sequences are obtained from pBS-HIV plasmid (Page et al. (1990) J. Virol 64, 5270-5276) which contain the proviral DNA sequence HXB2 on a Hbal to Xbal restriction fragment inserted into the polylinker of the cloning vector of plasmid (+) KS pBluescript (Stratagene, San Diego, California). As this proviral clone contains the uncharacterized flanking human DNA of the proviral integration site, two steps of site-directed mutagenesis were employed to remove such sequences using the pBS-HIV plasmid as a template. In one step, the human sequences adjacent to the 5 'LTR are removed using oligonucleotide 1, which contains the following sequences in the 5' to 3 'direction: 1) a sequence complementary to the first 18 nucleotides of the integrated provirus, within the left U3 region, 2) a Smal site of 6 nucleotides, and 3) a nucleotide sequence 18 complementary to the region in pBluescript KS (+) just beyond the polylinker and the T3 phage promoter. In step 2, human sequences adjacent to the 5 'LTR are removed using oligonucleotide 2 which contains the following sequences (5' to 3 '): 1) a sequence of 18 nucleotides complementary to the region in pBluescript KS (+) just beyond the Pvul site, within the LacZ gene, 2) a Xbal site of six nucleotides, and 3) a complementary sequence for the last 18 nucleotides of the integrated provirus, within the right U5 region. The resulting plasmid is called pBS-HXB2.

The genomic and subgenomic viral vectors employing the HIV-LTR U3 region as a promoter-enhancer for the expression of the antiviral target genes (Figure 1) are each derived from the plasmid pBS-HXB2 by a single step of a site-directed mutagenesis. . The genomic viral vector pLG, which is deleted for the env gene, was prepared using oligonucleotide 3 which contains the following sequences (5 'to 3'): 1) a sequence of 18 complementary nucleotides for positions 7626 to 7643 of the HXB2 within the env gene (all coordinated for HXB2 are by reference to GenBank, accession number K03455), 2) a Notl site of 8 nucleotides and 3) a sequence of 18 nucleotides complementary to positions 6384 to 6401 of HXB2 within the gene env. The subgenomic viral vector pLS, which is deleted for env, tat, rev, vif, vpr and vpu genes, was prepared using oligonucleotide 4 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 7626 to 7643 of HXB2 within the env gene, 2) a Notl site of 8 nucleotides, and 3) a sequence of 18 nucleotides complementary to positions 5109 to 5126 of HXB2 within the vif gene.Viral subgenomic vectors which employ the CMV IE region as a promoter-enhancer for the expression of the antiviral target genes are derived from the pLG and pLS plasmids, and are called pCG and pCS, respectively (Figure 1). The genomic viral vector pCG was prepared in two steps. In the first step, an intermediate plasmid of two DNA fragments was prepared: 1) an 11.2 kB vector fragment prepared from plasmid pLG of Smal digestion and treating the vector with alkaline phosphatase, and 2) a DNA fragment of 0.9 kB containing the enhancer-CMV IE promoter prepared by pVL-1 digestion plasmid (described below) with Smal. Plasmids containing the CMV IE region in the same transcriptional orientation as the viral LTRs were identified by restriction mapping. In the second step, plasmid pCG was prepared from this intermediate plasmid by site-directed mutagenesis to bind the CMV IE promoter-enhancer to the 5'-LTR R region to a position that allows transcription initiation to occur at the beginning of the R region, using oligonucleotide 5 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 455 to 472 of HXB2 at the beginning of the R region, and 2) a sequence of 18 complementary nucleotides for positions -18 to -1 of the CMV IE promoter-enhancer (coordinates referred to Boshart et al. (1985) Cell 41, 521-530). The subgenomic viral vector pCS is derived from the pCG plasmid and was prepared from two DNA fragments: 1) a 9.1 kB DNA vector prepared by pLS plasmid of Smal and Clal digestion, and 2) a 1.3 kB DNA fragment prepared by a plasmid pCG digestion with Smal and Clal.

The Viral Vector of Genomic Indicator Gene - Permuted Promoter The viral vectors of reporter gene pLG-lucPP and pCG-lucPP, and the resistance test vectors derived therefrom, contain the following elements in a 5 'to 3' orientation (Figure 2B): 1) an HIV-LTR region U3 (pLG-lucPP) or a CMV IE promoter-enhancer (pCG-lucPP), 2) an HIV-LTR R region, 3) a U5 HIV-LTR region containing an inserted T7 promoter with a transcriptional orientation opposite to that of the LTRs , 4) the coding regions of the HIV genes gag-pol, vig, vpr, tat, rev, vpu, deleted env, and nef, 5) a reporter gene cassette inserted into the deleted env gene, and 6) a HIV-LTR 3 '. The indicator gene cassette itself is inserted into the pLG-lucPP and pCG-lucPP and contains the following elements: 1) an EMC region 5'-UTR which allows the entry of internal ribosome, 2) the complete coding region of the gene of luciferase (luc), and 3) a T7 transcriptional terminator. The reporter gene has a transcriptional orientation opposite to that of the promoter-enhancer HIV-LTR or CMV IE and therefore can not be functionally transcribed by these elements. The reporter gene can also not be transcribed by the T7 promoter since the reporter gene cassette is placed upstream of the T7 promoter. After reverse transcription and strain transfer, the T7 promoter is copied from the 5 'LTR to the 3' LTR, allowing functional transcription of the newly created T7 promoter reporter gene by T7 RNA polymerase (Figure 2C).

Plasmid PlucPP, which contains the reporter gene cassette was prepared in three steps. In the first step, the plasmid pVL-EMC / T7 which contains a cassette flanked by the unique NotI sites comprising the EMC 5 '-UTR element and the T7 transcriptional terminator, was prepared from two DNA fragments: 1) a DNA vector from 3.0 kB prepared by the pVL digestion plasmid (described below) with Notl and treating the vector with alkaline phosphatase, and 2) a 0.8 kB DNA fragment containing the EMC 5 'UTR and the T7 terminator prepared by PCR using plasmid pTMl (Moss and others. (1990) Nature 348, 91-92) as an annealing and oligonucleotides 6 and 7 as primers, followed by digestion with Notl. Oligonucleotides 6 and 7 each incorporate a Notl restriction site. In the second step, the plasmid pVL-luc, which contains the coding region of the firefly luciferase gene inserted into the mammalian expression vector pVL-1 (described below), is prepared from two DNA fragments: a DNA vector 4.1 kB prepared by digestion of plasmid pVL-1 with NruI and BglII, and 2) a 1.7 kB DNA fragment containing the entire luciferase coding region, prepared by PCR using pGEM-luc plasmid (Promega, Madison, Wisconsin) as a temperate and oligonucleotides 8 and 9 as primers followed by digestion with NruI and BglII. Oligonucleotides 8 and 9 incorporate the restriction sites NruI and Ncol, and BglII and Xhol, respectively. In the third step, the plucPP plasmid, which contains the coding region of the luciferase gene inserted between the EMC 5'-UTR element and the T7 transcriptional terminator, was prepared from two DNA fragments: 1) a DNA vector of 3.8 kB prepared by digesting plasmid pVL-EMC / T7 with Ncol and Sali, and 2) a 1.7 kB DNA fragment containing the complete luciferase coding region, prepared by digesting plasmid pVL-luc with Nocí and Xhol.

Plasmid pLG-lucPP was prepared in two steps. In the first step, plasmid pLG-T7 was prepared by inserting a T7 phage promoter into the HIV-LTR U5 region in the pLG plasmid by directed site mutagenesis using oligonucleotide 10 which contains the following sequences (5 'a 3 '): 1) a sequence of 18 nucleotides complementary to positions 552 to 569 of HXB2 within the U5 region, 2) a sequence of 20 nucleotides complementary to the T7 promoter, and 3) a sequence of 18 nucleotides complementary to the positions 534 to 551 of HXB2 within the U5 region. In the second step, plasmid pLG-lucPP was prepared from two DNA fragments: 1) an 11.2 kB DNA vector prepared by digesting plasmid pLG-T7 with Notl and treating the resulting vector with alkaline phosphatase, and 2) a fragment of 2.5 kB DNA containing the luciferase reporter gene cassette prepared by digesting the plasmid pluc-PP with Notl. The clones corresponding to pLG-lucPP, containing the reporter gene cassette inserted into the viral vector with a transcriptional orientation opposite that of the viral LTRs were identified by restriction mapping.

Plasmid pCG-lucPP was prepared in two steps. In the first step, the plasmid pCG-T7 was prepared by inserting a T7 phage promoter into the U5 HIV-LTR region up into the pCG plasmid by directed site mutagenesis using the oligonucleotide. In the second step, the plasmid pCG-lucPP was prepared from two DNA fragments: 1) an 11.7 kB DNA vector prepared by digesting plasmid pCG-T7 with Notl and treating the resulting vector with alkaline phosphatase, and 2) a fragment of 2.5 kB DNA containing the luciferase reporter gene cassette prepared by digesting the plasmid pluc-PP with Notl. Clones corresponding to pCG-lucPP, containing the reporter gene cassette inserted into the viral vector with a transcriptional orientation opposite to that of CMV IE promoter-enhancer and viral LTRs were identified by restriction mapping.

Vector Viral of Gen Subgenomic Indicator - Permuted Promoter The viral vectors of reporter gene pLS-lucPP and pCS-lucPP, and the resistance test vectors derived therefrom, contain the following elements in a 5 'to 3' orientation (Figure 2B): 1) an HIV-LTR region U3 (pLS-lucPP) or a CMV IE promoter-enhancer (pCS-lucPP), 2) an HIV-LTR R region, 3) a U5 HIV-LTR region containing an inserted T7 promoter with a transcriptional orientation opposite to that of the LTRs , 4) the coding regions of the HIV gag-pol genes, 5) an indicator gene cassette, 6) an RRE element of the HIV env gene containing a viral packaging sequence, and 7) a 3-HT HIV-LTR . The reporter gene cassette of pLS-lucPP and pCS-lucPP is the same as in PLG-lucPP and PCG-lucPP. Regarding the last vectors, the PLS-lucPP and pCS-lucPP reporter genes can not be transcribed functionally until reverse transcription and strain transfer results in the copying of the T7 promoter from the 5 'LTR to the 3' LTR (Figure 2C ).

Plasmid pLS-lucPP was prepared in two steps. In the first step, the plasmid pLS-T7 which contains a T7 phage promoter inserted into the HIV-LTR U5 region upstream of the pLS plasmid was prepared from two DNA fragments: 1) a 9.1 kB DNA vector prepared by digesting pLS plasmid with SmalO and Clal, and 2) a DNA fragment of 0.8 containing the HIV-LTR with an R5 region containing an inserted T7 promoter, prepared by digesting plasmid pLG-T7 with Smal and Clal. In the second step, the plasmid pLS-lucPP was prepared from two DNA fragments: 1) a 9.9 kB DNA vector prepared by digesting plasmid pLS-T7 with Notl and treating the resulting vector with alkaline phosphatase, and 2) a DNA fragment of 2.5 kB containing the luciferase reporter gene cassette prepared by digesting the plasmid pluc-PP with Notl. The clones corresponding to pLS-lucPP, which contain the reporter gene cassette inserted into the viral vector with a transcriptional orientation opposite that of the viral LTRs, were identified by restriction mapping.

Plasmid pCS-lucPP was prepared from two DNA fragments: 1) an 11.6 kB DNA vector prepared by digesting plasmid pLS-lucPP with Smal and Clal, and 2) a 1.3 kB DNA fragment containing the CMV IE promoter fused to the R5 region with an inserted T7 promoter, prepared by digesting the plasmid pCG-T7 with Smal and Clal.

Resistance Test Vectors - Construction The resistance test vectors are prepared by 1) modifying the viral vectors of reporter gene pLG-lucPP, pCG-lucPP, pLS-lucPP and pCS-lucPP by introducing unique restriction sites, called patient sequence acceptor sites in, or near the pol gene, 2) amplify the patient-derived segments corresponding to the reverse transcriptase and HIV protease coding regions by PCR using complementary DNA (cDNA) prepared from viral RNA or DNA present in the serum or cells of infected patients , and 3) inserting the amplified sequences precisely into the viral vectors of indicator gene in acceptor sites of patient sequence (figure 2D). Two sets of patient sequence acceptor sites are introduced by site-directed mutagenesis within each of the four viral gene vector indicators. The first set of patient sequence acceptor sites consists of a Hpal site and a SalI site which defines a range comprising the entire protease coding region and the majority of the reverse transcriptase coding region, resulting in pLG plasmids -lucPP, pCG-lucPP, pLS-lucPP, and pCS-lucPP. The second set of patient sequence acceptor sites consists of the Pvul site and the BamHI site which define the same range resulting in plasmids pLG-lucPP, pCG-lucPP, pLS-lucPP, and pCS-lucPP, respectively. The inbreeding pairs of resistance tests which define the same range of restriction site (for example those derived from pLG-lucPP and pLG-lucPP-PB) are used together in some resistance tests to improve the representation of the segments derived from the patient containing internal restriction sites identical to a given patient sequence acceptor site, and would be underrepresented in any single resistance test vector.

Plasmid pLG-lucPP-HS is prepared by three consecutive steps of site-directed mutagenesis using the plasmid pLG-lucPP as a template. The first two steps are for the purpose of introducing two new restriction sites, one of which (Hpal) is unique to, and one of which (Sali) is already present once in each indicator gene viral vector. The third step is for the purpose of deleting the preexisting Sali site in each vector to make the site Sali introduced only. In step 1, a Hpal site is introduced immediately upstream of the mature coding region of the HIV protease at position 2243 using oligonucleotide 11 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 2249 to 2266 of HXB2, 2) a Hpal site of six nucleotides which leaves the GAG protein sequence in this position without alteration and introduces a change conservative amino acid (Phe a Val) within the sequence of the precursor pal, and 3) a sequence of 18 nucleotides complementary to positions 2245 to 2242 of HXB2. In step 2, a Sali site is introduced into the carboxy-terminal coding region of the HIV reverse transcriptase at position 4190 using oligonucleotide 12 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to 'positions 4196 to 4213 of HXB2, 2) a SalI site of 6 nucleotides which leaves the reverse transcriptase protein sequence in this position unaltered, and 3") a sequence of 18 nucleotides complementary to positions 4172 at 4189 of HXB2 In step 3, the preexisting Sali site within the vpr coding region at position 4785 of HXB2 is deleted using oligonucleotide 13 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 5791 to 5808 of HXB2, 2) the 6-nucleotide sequence GCCGAC which removes the Sali site but leaves the vpr protein sequence in this unaltered position; 3) a sequence of 18 nucleotides complementary to positions 5767 and 5784 of HXB2.

Plasmids pCG-lucPP-HS, pLS-lucPP-HS and pCS-lucPP-HS are derived from pLG-lucPP-HS as follows. Plasmid pCG-lucPP-HS was prepared from two DNA fragments: 1) a 12.9 kB DNA vector prepared by digesting plasmid pLG-lucPP-HS with Smal and Clal, and 2) a 1.3 kB DNA fragment prepared by the digest the plasmid pCG-lucPP with Smal and Clal. Plasmid pLS-lucPP-HS was prepared from two DNA fragments: an 11.1 kB DNA vector prepared by digesting the plasmid pLG-lucPP-HS with Ndel and Xhol, and 2) a 1.3 kB DNA fragment prepared by digesting the Plasmid pCL-lucPP with Ndel and Xhol. The pCS-lucPP-HS plasmid was prepared from two DNA fragments: 1) an 11.6 kB DNA vector prepared by digesting the plasmid pLS-lucPP-HS with Smal and Clal and 2) a 1.3 kB DNA fragment prepared by digesting the pCS-lucPP plasmids with Smal and Clal.

Plasmid pLG-lucPP-PB was prepared by four consecutive steps of site-directed mutagenesis using the plasmid pLG-lucPP as a template. The first two steps are for the purpose of introducing two new restriction sites (Pvul and BamHI), each of which is already present in each indicator gene viral vector. The third and fourth steps are for the purpose of deleting the pre-existing sites Pvul and BamHI in each vector to make the newly introduced sites unique. In step 1, the Pvul site is introduced immediately upstream of the mature coding region of the HIV protease at position 2221 using oligonucleotide 14 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 2227 to 2244 of HXB2, 2) a Pvul site of 6 nucleotides which leaves the gag and pol protein sequences in this unaltered position; 3) a sequence of 18 nucleotides complementary to positions 2203 to 2220 of HXB2. In step 2, the BamHI site is introduced into the carboxy-terminal coding region of HIV reverse transcriptase at position 4212 using oligonucleotide 15 which contains the following sequences (5 'to 3'): 1) a sequence of 18 nucleotides complementary to positions 4218 to 4235 of HXB2, 2) a BamHI site of 6 nucleotides which leaves the reverse transcriptase protein sequences in this unaltered position, and 3) a sequence of 18 nucleotides complementary to positions 4194 to 4211 of HXB2. In step 3, the pre-existing Pvul site within the b-lactamase coding region at position 2413 coordinates references to GenBank accession number X52331) is deleted using oligonucleotide 16 which contains the following sequences (5 'to 3 '): 1) a sequence of 18 nucleotides complementary to positions 2395 to 2412 of pBluescript KS (+), 2) the sequence of 6 nucleotides CAATCG which removes the Pvul site but leaves the b-lactamase protein sequence in this position unaltered and 3) a sequence of 18 nucleotides complementary to positions 2419 to 2436 of pBluescript KS (+). In step 4, the pre-existing BamHI site within the rev coding region of HIV at position 8474 of HXB2 was deleted using 17 oligonucleotides containing the sequences (5 'to 3'): 1) a sequence of 18 complementary nucleotides to positions 8480 to 8497 of HXB2, 2) the 6-nucleotide sequence GGATTC that removes the BamHI site but leaves the rev HIV protein sequence in this unaltered position, and 3) a sequence of 18 nucleotides complementary to positions 8456 to 8473 of HXB2.

Plasmids pCG-lucPP-PB, pLS-lucPP-PB and pCS-lucPP-PB are derived from pLG-lucPP-PB as follows. Plasmid pCG-lucPP-PB is prepared from two DNA fragments: 1) a 12.9 kB DNA vector prepared by digesting plasmid pCG-lucPP with Smal and Clal, and 2) a DNA fragment of 1.3 kB prepared by digesting the plasmid pCG-lucPP with Smal and Clal. Plasmid pLS-lucPP-PB was prepared from three DNA fragments: an 11.1 kB DNA vector prepared by digesting the plasmid pLG-lucPP-PB with Ndel and Xhol, and 2) a 0.5 kB DNA fragment prepared by digesting the plasmid pLC-lucPP with Ndel and Xhol, and 3) a DNA fragment of 0.8 kB prepared by digesting the plasmid pLG-lucPP-PB with HindIII and Xhol. The pCS-lucPP-PB plasmid was prepared from two DNA fragments: 1) an 11.6 kB DNA vector prepared by digesting the plasmid pLS-lucPP-PB with Smal and Clal, and 2) a 1.3 kB DNA fragment prepared by the digest pCS-lucPP plasmids with Smal and Clal.

The patient-derived segments corresponding to the reverse transcriptase and HIV protease coding regions were amplified by the polymerase-reverse transcription chain reaction (RT-PCR) method, using the viral RNA isolated from the sera of HIV-infected patients. . Two RT-PCR protocols are used as described. In the first method (Piatak et al. (1993) Science 259, 1749-1754), the separate enzymes, reverse transcriptase from Moloney rat leukemia virus (BRL from Bethesda, Maryland) and taq DNA polymerase (Roche Molecular Diagnostics, Ontario , Canada), were used for the preparation of cDNA and for the PCR reaction, respectively. In the second method (Mulder et al. (1994) J. Clin. Microbiol., 32, 292-300), a unique enzyme, Thermus thermophilus (Tth) DNA polymerase, is used to carry both the cDNA synthesis and the PCR reaction. Two first pairs, consisting of oligonucleotides 18 and 19, and oligonucleotides 20 and 21, are employed for the amplification of patient-derived segments that can be inserted precisely within the viral vectors of reporter gene containing the patient acceptor sites Hpal / SalI and Pvul / Bapáíl, respectively.

A first set of resistance test vectors incorporating the first primer pair is constructed of the following two DNA preparations: 1) a DNA vector prepared from plasmid pLG-lucPP-HS, pCG-lucPP-HS, pLS-lucPP-HS or pCS -lucPP-HS, digested with Hpal and Salí, and 2) a 2.0 kB amplified DNA product prepared by RT-PCR using viral RNA isolated from the serum of an HIV-infected individual as a template and oligonucleotides 18 and 19 as primers, followed by digestion with Hpal and Salí. A second set of four resistance test vectors and comparing the second primer pair are constructed from the following two DNA preparations, 1) a DNA vector prepared from plasmid pLG-lucPP-PB, pCG-lucPP-PB, pLS-lucPP-PB or pCS-lucPP-PB, digested with Pvul and BamHI, and 2) a 2.0 kB amplified DNA product prepared by RT-PCR using viral RNA isolated from the serum of an individual infected with HIV as a template and oligonucleotides 18 and 19 as primers, followed by digestion with pvul and BamHI. The oligonucleotides, 18, 19, 20 and 21 incorporate the restriction sites Hpal, Salí, Pvul and BamHI, respectively. To ensure that the plasmid DNA corresponding to each of the eight resulting resistance test vectors comprises a representative sample of the HIV viral quasi-species present in the serum of a given patient, at least 100 independent E. coli transformants are used. obtained in the construction of a given resistance test vector for the preparation of the DNA plasmid.

To improve the representation of the patient-derived segments, a third and a fourth set of resistance test vectors were prepared using partially degenerate PCR primer pools called oligonucleotides 22, 23, 24 and 25, which are based on the sequences of oligonucleotides 18, 19, 20 and 21, respectively. Each primer pool is synthesized in a manner that incorporates more than one nucleotide base (G, A, T or C) at each of the 18 nucleotide positions located at the 3 'end of the parent primer that exhibits sequence variations between the different patient isolates cataloged in the HIV Los Alamos sequence database (Myers et al. (1993) Human Retrovirus and AIDS 1993, Los Alamos National Laboratory, Los Alamos, New Mexico). The third set of four resistance test vectors is constructed using vectors prepared from plasmids pLG-lucPP-HS, pCG-lucPP-HS, pLS-lucPP-HS or pCS-lucPP-HS with the amplified patient sequences prepared with the oligonucleotides 22 and 23; the fourth set of four resistance test vectors is constructed using vectors prepared from the plasmid pLG-lucPP-PB, pCG-lucPP-PB, pLS-lucPP-PB or pCS-lucPP-PB, with the amplified patient sequences prepared with the oligonucleotides 24 and 25. Oligonucleotides 22, 23, 24 and 25 incorporate the Hpal, Sali, Pvul and BamHI restriction sites, respectively.

Preparation - Host Cells Host Packing and Cell Resistance Cells Test Vector Hostesses Resistance test vectors are used to prepare the host cell vectors of resistance test of packaging host cells expressing viral packaging proteins. Packing proteins can be provided for the expression of viral genes containing within the resistance test vector itself, a packaging expression vector or vectors, or both. Stable or transient transfection of the packaging host cell can be used to produce packaging proteins. A packaging vector encoding an amphotrophic MLV env gene product allows production in a host cell of resistance test vector of viral particles of resistance test vector that can efficiently infect human target cells. Resistance test vectors derived from the pLG-lucPP-HS plasmids, pGG-lucPP-PB, pCG-lucPP-HS and pCG-lucPP-PB, encode all HIV genes with the expression of env, and are used to produce Host cell resistance test vector. The packaging expression vector pVL-env4070A which encodes the amphotrophic MLV4070A env gene product is used with the above genomic base resistance test vectors to allow reproduction in the host cell of viral particle resistance test vector of resistance test vector. The resistance test vectors derived from the plasmids pLS-lucPP-HS, pLS-lucPP-PB, pCS-lucPP-HS and pCS-lucPP-PB encode only the gag-pol HIV gene products and are used to prepare the cells host of resistance test vector. The pVL-env4070A which provides the env, and either the pLTR-HIC3 'or the pCMV-HIV3' packaging expression vectors, each of which provides the HIV genes vif, vpr, tat, rev, vpu and nef are used with the above subgenomic base resistance test vectors to allow production in the host cells of resistance test vector of the viral particles of the resistance test vector.

Plasmids pLTR-HIV3 'and pCMV-HIV3' are each derived by removing the majority of the gag-pol coding region from the genomic viral vectors pLG and pCG, respectively. Plasmid pLTR-HIV3 '(Figure 3B) was prepared by site-directed mutagenesis using the pLG plasmid as an annealing with oligonucleotide 26 which contains the following sequences (5' to 3 '): 1) a complementary 18 nucleotide sequence to positions 4712 to 4729 of HXB2 with the pol gene, and 2) a sequence of 18 nucleotides complementary to positions 925 to 942 of HXB2 within the gag gene. Plasmid pCMV-HIV3 '(Figure 3C) was prepared from two DNA fragments: 1) a 6.8 kB vector fragment prepared by digesting plasmid pLTR-HIV3' with Smal and Clal, and 2) a fragment DNA of 1.3 kB prepared by digesting the pCG plasmid with Smal and Clal.

Plasmid pVL-env4070A (figure 3D) was constructed of two DNA fragments: 1) a 4.3 kb vector fragment prepared by digestion of the mammalian pVL-2 expression vector with NruI and BglII, and 2) a DNA fragment from 2.0 kB containing the complete coding region of the MLV4070A env gene product (nucleotides 37 to 2001, coordinates given in GenBank, accession number M33469, Ott et al. (1990) J. Virol. 64, 757-766) prepared by PCR using Plasmid pCRIPamgag-2 (Danos and Mulligan (1988) Proc. Nati, Acad Sci 85, 6460) as an annealing with oligonucleotides 27 and 28 as primers, followed by digestion with NruI and BglII. Oligonucleotide 27 incorporates a unique NruI site followed by a consensus sequence for mammalian translation initiation (eg Kozak (1991) J. Biol. Chem, 266, 19867-19870), while oligonucleotide 28 incorporates a BglII site only.

The mammalian expression vector pVL-2 contains the following elements in a 5 'to 3' direction: the CMV IE promoter / enhancer, the first exon CMV IE split donor, the human (1 exon globin split acceptor, a cloning site polylinker, polyadenylation site of the SV40 T antigen gene and the origin of duplication SV40. Plasmid pVL-2 is constructed in four steps as follows: In the first step, plasmid pVL was prepared by replacing the polylinker cloning site and the T7 and T3 promoters phage of the plasmid pBluescript II KS (+) with a cloning site polylinker containing restriction sites BssHII, Notl, Smal, EindIII, Sphl, Smal, EcoRI, NruI, Apal, BglII, Nhel, Notl, Xhol, and BssHII.PVL is constructed of two DNA fragments: 1) a 3.0 kB vector fragment prepared by cutting the plasmid pBluescript II KS (+) with BssHII, and treating the resulting vector with alkaline phosphatase, and 2) a DNA fragment prepared This was done by tempering overlapping oligonucleotides 29 and 30 by spreading Klenow DNA polymerase and digesting with BssHII. In the plasmids containing the HindIII to Xhol sites in a 5 'to 3' order relative to the pBluescript II KS (+) plasmid map (access number GenBank X52327) are identified by restriction mapping analysis. In the second step, an intermediate plasmid is prepared from a pVL plasmid by inserting the CMV IE promoter-enhancer and a first exon-dividing donor, and the human (a second exon-division acceptor globin.) This intermediate plasmid is prepared from three DNA fragments: 1) a 3.0 kB vector fragment prepared by digesting the pVL plasmid with HindIII and EcoRI, 2) a 0.9 kB DNA fragment containing a CMV IE promoter-membrand and a first exon-dividing donor (the nucleotides -674 to -19, coordinates referred toBoshart et al. (1985) Cell 41, 521-530), prepared by PCR using plasmid pCM5027 containing the PstI m-fragment of strain HCMV AD169 (Boshart et al., Ibid) as annealed with oligonucleotides 31 and 32, primers, followed by digestion with HindIII and Aphl, and 3) a DNA fragment of 0.1 kB containing the human (a globin second acceptor of division exon (nucleotides 6808 to 6916, coordinated by reference to GenBank, num. or access J00153) prepared by PCR using the ppSVaHP plasmid (Treisman et al. (1983) Proc. Nati Acad. Sci. 80, 7428-7432) as an annealing with two oligonucleotides 33 and 34 as primers, followed by digestion with Sphl and EcoRI. Oligonucleotides 31, 32, 33 and 34 incorporate the restriction sites HindIII, Sphl, Sphl and EcoRi at their respective ends. In the third step, plasmid pVL-1 is prepared by inserting the SV40 T antigen polyadenylation site into the intermediate plasmid. Plasmid pVL-1 was prepared from two DNA fragments: 1) a 4.0 kB vector fragment prepared by cutting the intermediate plasmid with BglII and Nhel, and 2) a 0.2 kB DNA fragment containing the SV40 antigen T polyadenylation site; (nucleotides 2770 to 2533 of SV40, coordinated by reference to Reddy et al. (1978) Science 200, 494-502), prepared by PCR using plasmid pSV2 (Southern and Berg (1982) J. Mol. Appl. Gen. 1, 327-341) as annealed with oligonucleotides 35 and 36 as primers, followed by digestion with BglII and Nhel. Oligonucleotides 35 and 36 incorporate the unique BglII and Nhel restriction sites at their respective ends. In the fourth step, plasmid bVL-2 was prepared by inserting the duplication origin SV40 into plasmid pVL-1. Plasmid pVL-2 was prepared from two DNA fragments: 1) a 4.2 kB vector fragment prepared by the digested plasmid pVL-1 with Nhel and Xhol, and 2) a 0.2 kB DNA fragment containing the duplication origin SV40 (nucleotide 5725 to 5578 of SV40, Ibid) prepared by PCR using plasmid pSV2 as annealed with oligonucleotides 37 and 38, primers, followed by digestion with Nhel and Sali. Oligonucleotides 37 and 38 incorporate the unique Nhel and Sali restriction sites at their respective ends.

Host Host Cells Objective host cells used for resistance tests carried out with resistance test vectors derived from the plasmids pLG-lucPP-HS, pLG-lucPP-PB, pCG-lucPP-HS, pCG-luc-PP-PB, pLS-lucPP-HS, pLS-lucPP-PB, pCS-lucPP-HS or pCS-lucPP-PB are prepared from the human embryonic kidney cell line 293 and from the leukemic Jurkat T cell line (culture collection of type American, Rockville, MD). Each cell line is stably transfected with an expression vector encoding a variant T7 RNA polymerase phage. This variant contains an SV40 70 nuclear antigen localization signal (NLS) fused in the N-terminus box of the T7 RNA polymerase, allowing its transport in, depending on the cell nucleus (Lieber et al. (1989) Nucleic acid res. 17, 8485-8493). The non-functional reporter gene in the resistance test vector is converted into a functional indicator gene by reverse transsriptase with the infection of the target cells, resulting in the relocation of the T7 promoter in relation to the coding region of the reporter gene. After integration of the repaired reporter gene into the target cell chromosome by HIV integrase, the nuclear T7 RNA polymerase expressed by the target cell is capable of functionally transcribing the reporter gene.

Plasmid pVL-T7RNAP-NLS was used to direct the expression of variant T7 RNA polymerase linked to an NLS in human and other mammalian cells and cell lines. PVL-T7RNAP-NLS was prepared from three DNA fragments: 1) a 4.3 kB vector fragment prepared by digestion of plasmid pVL-2 with EcoRI and BglII, 2) a 2.6 kB DNA fragment encoding the amino acid residues of 7TRNA 34883 polymerase (nucleotides 267 to 2817, coordinated by reference to GenBank, accession number M38308, Grachev and Pletnev (1984) Bioorg, Khim, 10, 824-843) prepared by PCR using the plasmid pT7-Gl (Deng et al. 1994) Gene 143, 245-249) as an annealing with oligonucleotides 39 and 40 as primers, followed by digestion with NruI and BglII, and 3) a synthetic DNA fragment encoding the first three amino acids of the SV40 T antigen followed by the amino acids 118 to 133 of the antigen T SV40 containing the NLS gene (Lieber et al., Ibid), prepared by annealing the overlapping oligonucleotides 41 and 42 extending with the Klenow DNA polymerase and digesting with EcoRI and Nrul. Oligonucleotides 39, 40, 41 and 42 incorporate the restriction sites NruI, BglII, EcoRI and NruI, respectively.

Plasmid pVL-Neo is used as a selectable marker for the establishment of stable transfectants of human and other mammalian cells and line cells by co-transfection. PVL-Neo directs the expression of neomycin phosphotransferase and confers resistance to the antibiotic G418. The pVL-Neo plasmid was prepared from two DNA fragments: 1) a 4.3 kB vector fragment prepared by digesting plasmid pVL-2 with EcoRI and BglII, and 2) a 0.8 kB DNA fragment containing the complete Neo coding region (nucleotides 1551 to 2345 of the transposon sequence Tn5, coordinate given in accession number GenBank U0004, Beck et al. (1982) gene 19, 327-336) prepared by PCR using the pSV2neo plasmid (Southern and Berg (1982) J. Mol. Appl. Gen 1, 327-341) as an annealing with oligonucleotide 43 and 44 as primers, followed by digestion with EcoRI and BglII. Oligonucleotide 43 incorporates a unique EcoRI site followed by a consensus sequence for mammalian translation initiation while oligonucleotide 44 incorporates a unique BglII site.

PVL-T7RNAP is introduced by stable transfection into 293 cells by means of the calcium phosphate coprecipitation method (Wigler et al. (1979) Cell 16, 777) and in Jurkat cells by electroporation (Irving et al. (1991) Cell 64, 891-901). 293 cells are maintained in the DMEM medium (JRH Biosciences) supplemented with 1 g / L of glucose, 10 percent of donor calf serum (Tissue Culture Biologics). Jurkat cells are maintained in RPMl 1640 medium supplemented with 10 percent fetal bovine serum (Irving Scientific), glutamine, penicillin and streptomycin. The transfection cocktails for 293 cells and the Jukart cells each contain a mixture of 10 micrograms of pVL-TRNAP and the selectable marker pVL-Neo in a mass ratio of 10: 1 to 20: 1. 24 hours to 48 hours after transfection, the cells are refolded in the same medium containing the antibiotic G418 (GIBCO, Grand Island, New York). The independent 293 cell clones resistant to G418 are picked directly from the selection plates after two weeks and expanded for analysis. Clones of independent Jurkat cells resistant to G418 were obtained by limiting dilution after 2 or 3 weeks of drug selection and are expanded for analysis.

The G418-resistant 293 and Jurkat cell clones are activated by their expression period T7 polymerase RNA by determining the stable state level of mRNA for specific polymerase RNA T7 steady state synthesized by cells using the stain hybridization method from the north (Ausubel et al. (1987), current protocols in molecular biology, Wiley-Interscience). The 293 and Jurkat cell clones expressing optimal levels of the T7 RNA polymerase are identified by determining their ability to support transcription-specific T7 RNA polymerase in transient transfections with the plasmid pEMCLucbgAn (Deng et al. (1991) gene 109, 193 -201) in which the transcription of the luciferase gene is driven by a T7 promoter. Jurkat 293 clones holding the highest level of luciferase gene expression are chosen for further use; these are referred to as 293 / T7 RNAP-NLS cells and Jurkat / T7RNAP-NLS cells, respectively.

Evidence of Susceptibility and Drug Resistance Resistance tests were carried out with resistance test vectors based on viral vectors of reporter gene pLG-lucPP-HS, pLG-lucPP-PB, pCG-lucPP-HS, pCG-luc-PP-PB, pLS-lucPP -HS, pLS-lucPP-PB, pCS-lucPP-HS or pCS-lucPP-PB, using either two host cell types or one type of host cell. In the first type of resistance test, viral particles of resistance test vector are produced by a first host cell (the resistance test vector host cell) that was prepared by transfecting a host cell packing with the vector of resistance test and packaging expression vectors. The viral particles of resistance test vector are then used to infect a second host cell (the target host cell) in which the expression of the reporter gene is measured. In the second type of resistance test, a single type of host cell unique to a host cell resistance test vector) serves both purposes: some of the packaging host cells in a given culture are transfected and produce vector viral particles of resistance test and some of the host cells in the same culture are the target of infection by the resistance test vector particles thus produced. Resistance tests employing a single host cell type are possible with resistance test vectors comprising a non-functional reporter gene with a permuted promoter: while such reporter genes are efficiently expressed with the infection of a permissive host cell, these do not they are efficiently expressed with transfection of the same type of host cell, and thus provide an opportunity to measure the effect of the antiviral agent under evaluation. For similar reasons, resistance tests using two cell types can be carried out by co-cultivating the two cell types as an alternative to infecting the second cell type with viral particles obtained from supernatants of the first cell type.

Susceptibility and Resistance Test - Two Cells The resistance test vector host cells were prepared by co-transfection of a resistance test vector and the appropriate packaging expression vectors using either the 293 cell line, the tsa54 or tsa201 cell lines (Heinzel et al. 1988) J. Virol., 62, 3738), or the cell line BOSC 23 (Pear et al. (1993) Proc. Nati, Acad. Sci. 90, 8392) as packaging host cells. The resistance test vectors constructed by inserting the patient-derived segment into pLG-lucPP-HS, PCG-lucPP-HS, pLG-lucPP-PB and pCG-lucPP-HS are cotransfected with the packaging expression vector pVL -env4070A, while the resistance test vectors prepared by inserting the patient-derived segments in pLS-lucPP-HS, pCS-lucPP-HS, pLS-lucPP-PB and pCS-lucPP-PB are cotransfected with the vectors of packaging expression pVL-env4070A, and any pLTR-HIV3 'or pCMV-HIV3' cells. Jurkat / T7RNAP-NLS are extended as the target host cells.

Packing host cells are cultured in a DMEM medium, 1 g / L glucose, 10 percent donor calf serum and passed to a dilution of 1:10 every three days. The cells are folded 48 hours before transfection to cells 1 x 106 by 10 centimeters of plaque. The cells are transfected by the calcium phosphate coprecipitation method using 5 to 10 mg each of the resistance test vector and the appropriate packaging expression vectors to produce the resistance test vector host cells. Individual antiviral agents including the reverse transcriptase inhibitors AZT, ddI, ddC, d4T and 3TC, and the protease inhibitors saquinavir, ritonavir, and indinavir, as well as combinations thereof are added to the individual plates of the transfected cells. moment of its transfection, to an appropriate range of concentrations. 24 to 48 hours after transfection, the target host cells are infected by co-cultivation with the resistance test vector host cells or with the viral particles obtained from the filtered supernatants or from the test vector host cells. resistance. Each antiviral agent, or combinations thereof, is added to the target host cells at the time of infection to achieve the same final concentration of the given agent or agents present during transfection.

For infection co-cultivation, the media are removed from a 10-centimeter plate of host cell resistance test vector and prepared by transfection 24 to 48 hours before, and target cells from 0.5 to 1.0 x 106 Jurkat / T7RNAP-NLS are added to the plate in a Jurkat cell medium containing the antiviral agent at the appropriate concentration. The target cells are co-cultured with the host cells of the resistance test vector for 24 hours, and then they are removed and added to the freshly prepared resistance test vector host cells for a second co-cultivation in a medium of Jurkat cell containing the antiviral agent or agents at the appropriate concentration. 24 hours later, the target host cells are harvested from the second co-culture harvested by centrifugation, washed three times with phosphate buffered salt water and ice cold (PBS), and assayed for luciferase activity. By insertion with the filtered supernatants, the media is removed from a 10-centimeter plate of resistance test vector host cells prepared by transfection 24 to 48 hours before. The medium is filtered through a 0.45 mm filter at the time of harvest, frozen to minus 70 degrees Celsius and thawed before transduction. Jurkat / T7RNAP-NLS cells (0.5 to 1.0 x 106) are added to 5 ml of an equal mixture of Jurkat cell media and filtered supernatant, made up to 8 mg / ml polybrene (Sigma, St. Louis, MI. ) and the appropriate concentration of the antiviral agent (s). 24 to 48 hours after infection the target host cells are harvested by centrifugation, washed three times with phosphate buffered salt water and ice cold and assayed for reporter gene expression. Target host cells by cocultivation or with filtered viral supernatants are assayed for firefly luciferase activity as described (Ausbel et al. (1987) current molecular biology protocols, Wiley-Interscience). The reduction of luciferase activity observed for target host cells infected with the given viral particle preparation and resistance test vector in the presence of a given antiviral agent or agents, compared to a control run in the absence of the agent antiviral, generally refers to the log of the concentration of the antiviral agent as a sigmoidal curve. This inhibition curve was used to calculate the inhibitory concentration (IC) of that agent, or combinations of agents, for the target viral test encoded by the patient derived segments • V present in the resistance test vector.

Susceptibility and Resistance Test - A Cell 5 Host cell resistance test vectors are prepared by cotransfection of a resistance test vector and the appropriate packaging expression vector (s) using either 293 / T7RNAP-NLS cells or Jurkat / T7RNAP-NLS cells as packaging host cells. The resistance test vectors constructed by inserting patient-derived segments into pLG-lucPP-HS, pCG-lucPP-HS, pLG-lucPP-PB and pCG-lucPP-PB are cotransfected with the packaging expression vector pVL -env4070A, while the resistance test vectors prepared by inserting the patient-derived segments into pLS-lucPP-HS, pCS-lucPP-HS, pLS-lucPP-PB and pCS-lucPP-PB are co-transfected with the packaging expression vectors pVL-env4070A and either pLTR-HIV3 'or pCMV-HIV3'. The cells are co-transfected using 5 to 10 mg each of the resistance test vectors and the appropriate packaging expression vectors to produce the resistance test vector host cells. The 293 / T7RNAP-NLS cells are transfected by the calcium phosphate coprecipitation method and Jurkat / T7RNAP-NLS cells are transfected by electroporation. The individual antiviral agents, or combinations thereof, are added to the individual plates of the transfected cells at the same time as their transfection, at an appropriate range of concentrations. 24 to 72 hours after transfection, cells are harvested by centrifugation, washed three times with phosphate buffered salt water and ice cold, and assayed for firefly luciferase activity as described. Since the transfected cells in the culture do not efficiently express the reporter gene, the cells transfected in the culture, as well as the super infected cells in the culture, can serve as target host cells for the expression of the reporter gene. The reduction in luciferase activity observed by the transfected cells in the presence of a given antiviral agent or agents is compared to a control run in the absence of the antiviral agent or agents, generally related to the log of the concentration of the antiviral agent as a sigmoidal curve This inhibition curve was used to calculate the apparent inhibitory concentration (IC) of that agent, or combinations of agents for the viral target product encoded by the patient-derived segments present in the resistance test vector.

EXAMPLE 2 HIV Drug Susceptibility and Resistance Tests Using Resistance Test Vectors Comprising Segments Derived from the Patient and a Non-Functional Indicator Gene with a Permuted Coding Region Viral Vector of Gen Indicator - Construction Genomic indicator gene viral vectors with patient sequence acceptor sites, pLG-lucPC-HS, pLG-lucPC-PB, pCG-lucPC-HS and pCG-lucPC-PB, and resistance test vectors derived therefrom , each contains the following elements in a 5 'to 3' orientation (Figure aB): 1.}. an HIV-LTR U3 region (pLG-lucPC-HS and pLG-lucPC-PB) or first a CMV IE promoter-enhancer (pCG-lucPC-HS and pCG-lucPC-PB), 2) the HIV-LTR R regions and U5, 3) the coding regions for the HIV genes gag-pol, vif, vpr, tat, rev, vpu, env deleted, and nef, 4) a first cassette indicator of the gene containing the 5 'coding region luciferase gene inserted into the deleted env gene, 5) a second indicator gene cassette containing the 3 'coding region of the luciferase gene, inserted into a deleted 3' HIV-LTR U3 region, and 6) a 3 'HIV-LTR region R and U5. PLG-lucPC-HS and pCG-lucPC-HS contain unique Hpal and SalI patient sequence acceptor sites at nucleotides 2243 and 4190 of HXB2, respectively; pLG-lucPC-PB and pCG-lucPC-PB contain unique Pvul and BamHI patient sequence acceptor sites at nucleotides 2221 and 4212 of HXB2, respectively (See Example 1 for details). The first indicator gene cassette contains: 1) a second CMV enhancer-promoter, 2) the 5 'coding region of the luciferase gene (amino acids 1 to 446.), and 3) a CMV IE donor. The second cassette of indicator gene contains: 1) a second exon acceptor of the globin gene, 2) the 3 'coding region of the luciferase gene (amino acids 447 to 550), and 3) a SV40 polyadenylation site. The transcriptional orientation of the 5 'and 3' luciferase coding regions are identical to one another, and opposite to that of the first CMV promoter-enhancer and the viral LTRs. However, when the 5 'and 3' coding regions luciferase are permuted in the resistance test vectors (eg, the 5 'coding region is downstream of the 3' coding region), no mRNA is transcribed that can be divided to generate a coding region of functional luciferase. After reverse transcription and strain transfer, the 3 'luciferase coding region is copied from the 3' LTR to the 5 'LTR, allowing transcription of the mRNA that can be divided to generate a functional luciferase coding region (FIG. 4C).

The indicator gene viral vectors are genomic with patient sequence acceptor sites pLS-lucPC-HS, pLS-lucPC-PB, pCS-lucPC-HS and pCS-lucPC-PB, and the resistance test vectors derived therefrom. , each contains the following elements in a 5 'to 3' orientation (Figure 4B): 1) an HIV-LTR U3 region (pLS-lucPC-HS and pCS-lucPC-PB) or a first CMV IE promoter-enhancer ( pCS-lucPC-HS and pCS-lucPC-PB), 2) the HIV-LTR R and U5 regions, 3) the coding region of the HIV gag-pol gene, 4) a first cassette of indicator gene containing "the region 5 'coding of the luciferase gene, 5) an RRE element of the HIV env gene containing a viral packaging sequence, 6) a second reporter gene cassette containing the 3' coding region of the luciferase gene, inserted into a region 3 'HIV-LTR U3 deleted, and 7) a region 3' HIV-LTR R and U5.PLS-lucPC-HS and pCS-lucPC-HS contain acceptor sites of patient sequence Hpal and Sa unique in nucleotides 2243 and 4190 of HXB2, respectively; pLS-lucPC-PB and pCS-lucPC-PB contains the unique Pvul and BamHI patient sequence acceptor sites at nucleotides 2221 and 4212 of HXB2 respectively. The first indicator gene cassette contains: 1) a second CMV enhancer-promoter, 2) the 5 'coding region of the lucifersa gene (amino acids 1 to 446), and 3) a CMV IE division donor. The second indicator gene cassette contains: 1) a second gene-globin exon cleavage acceptor, 2) the 3 'coding region of the luciferase gene (amino acids 447 to 550), and 3) a SV40 polyadenylation site . As the 5 'and 3' coding regions of luciferase are permuted into the resistance test vectors, strain transfer and reverse transcription must occur to generate the 5 'and 3' coding regions of non-permuted luciferase, allowing the transcription of the mRNA that can be divided to generate a functional luciferase coding region (Figure 4C).

Plasmid pVL-luc5 ', which contains the first cassette of reporter gene, was prepared in three steps. In the first two steps, the artificial intron contained in pVL-1 consisted of the CMV IE division donor and the gene-splitting acceptor (-globin underwent site-directed mutagenesis to create the restriction sites with which to digestion gave a DNA fragment whose 5 'and 3' terms correspond precisely to the start and end of the artificial intron In step one, site-directed mutagenesis was carried out with pVL-1 using oligonucleotide 45 which contains the following sequences (5 'to 3'): 1) the sequence of 18 nucleotides preceding the CMV IE division donor, 2) a TAC trinucleotide sequence corresponding to the first half of the SnaBI restriction site and 3) the sequence of 18 nucleotides at the beginning of the artificial intron. As the sequence of the first 3 nucleotides the intron is GTA, the resulting plasmid pVL-SnaBI contains a SnaBI restriction site which upon digestion releases the 5 'sequence of the intron as a blunt DNA end. In step two, site-directed mutagenesis is carried out with pVL-SnaBI using oligonucleotide 46 which contains the following sequences (5 'to 3'): 1) the sequence of 18 nucleotides at the end of the artificial intron, ) the CTG trinucleotide sequence corresponding to the last half of the PvuII restriction site, and 3) the 18 nucleotide sequence following the division-globin acceptor. Since the sequence of the last three nucleotides of the intron is CAG, the resulting plasmid pVL-SnaBI / PvuII contains a PvuII restriction site on which digestion releases the 3 'sequence of the intron as a blunt DNA end. In the third step, plasmid pVL-luc5 'was prepared from two DNA fragments: 1) a 5.3 kB vector DNA prepared by digesting plasmid pVL-luc with EcoRV and Nhel, and treating the resulting vector with Klenow DNA polymerase and alkaline phosphatase, 2) a 0.1 kB DNA fragment containing the CMV IE division donor, prepared by digesting the plasmid pVL-SnaBI / PvuII with SnaBI and Smal. Clones corresponding to pVL-luc5 ', which contain the CMV IE split donor inserted in the correct orientation within the luciferase coding region, are identified by restriction mapping.

Plasmid pVL-luc3 ', which contains the second reporter cassette, was prepared in three steps. In one step, the plasmid pBS-LTR as in which the 3 'LTR of pBS-HXB2 is subcloned, was prepared from two DNA fragments: 1) a DNA vector of 3.0 kB prepared by digesting the plasmid pBluescript II KS (+ ) with Xhol and Xbal, and 2) a DNA fragment of 0.8 kB containing the 3 'LTR, prepared by digestion of pBS-HXB2 with Xhol and Xbal. In step 2, the plasmid pBS-LTR-luc3 ', which contains the 3' coding region of luciferase followed by an SV40 polyadenylation site inserted into the deleted 3 'LTR, was prepared from two fragments: 1) a vector 3.5 kB DNA prepared by digestion of pBS-LTR with EcoRV and treatment of the resulting vector with alkaline phosphatase, and 2) a 0.5 kB DNA fragment containing the 3 'luciferase coding region and the SV40 polyA site, prepared by the digest the pVL-luc plasmid with EcoRV and Nhel, followed by treatment of the resulting fragment with Klenow DNA polymerase. The canvases having the 3 'luciferase coding region inserted in the correct orientation (eg, opposite to the direct transcription in 3' LTR) were identified by restriction mapping. In step three, plasmid pVL-luc3 'was prepared from two DNA fragments: 1) a 4.0 kB DNA vector prepared by digesting plasmid pBS-LTR-luc3' with EcoRV followed by treatment of the resulting vector with alkaline phosphatase , and 2) a 0.1 kB DNA fragment containing the second gene splitting exon acceptor (-globin, prepared by digesting plasmid pVL-SnaBI / PvuII with PvuII and Smal.) The clones corresponding to pVL-luc3 ', which contain the second acceptor of division exon (-globin inserted in the correct orientation within the coding region luciferase are identified by restriction mapping.

Plasmids pL'G-lucPC-HS, pLG-lucPC-PB, pLS-lucPC-HS are prepared by the same three-step procedure. In step one, the plasmids pLG-lucDP-HS, pLG-lucDP-pB, pLS-lucDP-HS and pLS-lucDP-PB are prepared from two DNA fragments: 1) a DNA vector prepared by digesting the pLG- plasmids lucPP-HS, pLG-lucPP-PB, pLS-lucPP-HGS, pLS-lucPP-PB, respectively with Smal and Clal, and 2) a DNA fragment of 0.8 kB prepared by digesting the pLG with Smai and Clai. In step two, the plasmids pLG-luc5 '-HS, pLG-luc5' -PB, pLS-luc5'-HS and pLS-luc5'-PB are separated from two DNA fragments: 1) a DNA vector prepared by digesting the plasmids pLG-lucDP-HS, pLG-lucDP-PB, pLS-lucDP-HS and pLS-lucDP-PB, respectively, and treat the resulting vectors with alkaline phosphatase, and 2) a 2.5 kB DNA fragment containing the cassette of Indicator gene prepared by digesting pVL-luc5 'with Notl. The clones containing the first reporter gene cassette inserted into the viral vector with the transcriptional orientation opposite to that of the viral LTRs were identified by restriction mapping. In step three, the plasmids pLG-lucPC-HS, pLG-lucPC-PB, pLS-lucPC-HS and pLS-lucPC-PB are repaired from two DNA fragments: 1) a DNA vector prepared by digesting the pLG- plasmids luc5 '-HS, pLG-luc5' -PB, pLS-luc5'-HS and pLS-Iuc5'-PB, respectively with Xhol and Xbal, and 2) a 1.1 kB DNA fragment containing the second reporter cassette, prepared by digesting plasmid pVL-luc3 'with Xhol and Xbal.

Plasmids pCG-lucPc-HS, pCG-lucPC-PB, pCS-lucPC-HS and pCS-lucPC-PB are each prepared from two DNA fragments: 1) a DNA vector prepared by digesting any plasmids pLG-luc-HS , pLG-lucPC-PB, pLS-lucPC-HS and pLS-lucPC-PB, respectively, with Smal and Clal, and 2) a DNA fragment of 1.3 kB prepared by digesting the plasmid pCG with Smal and Clal.

Resistance Test Vector - Construction Resistance test vectors containing a non-functional reporter gene with a permuted coding region were designed using the HIV genomic and subgenomic viral vectors comprising antiviral targeting genes described in Example 1.

The resistance test vectors are prepared from plasmids pLG-lucPC-HS, pLG-lucPC-PB, pCG-lucPC-HS, pCG-lucPC-PB, pLS-lucPC-HS, pLS-lucPC-PB, pCS-lucPC- HS, pCS-lucPC-PB (Figure 4B) by the procedure described in Example 1. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-lucPC-HS, pCG-lucPC-HS, pLS-lucPC -HS or pCS-lucPC-HS using the amplified patient sequences prepared with oligonucleotides 18 to 19 and with oligonucleotides 22 and 23. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-lucPC-Pb, pCG-lucPC-PB, pLS-lucPC-PB or pCS-lucPC-PB using the amplified patient sequences prepared with the oligonucleotides 20 and 21, and with the oligonucleotides 24 and 25.

Test of Susceptibility and Drug Resistance The resistance tests are carried out by the procedures described in Example 1 as follows. The resistance test vectors prepared from the plasmids pLG-lucPC-HS, pLG-lucPC-PB, pCG-lucPC-HS and pCG-lucPC-PB lack a functional HIV env gene and are used in conjunction with the vector of packaging expression pVL-env4070A. The resistance test vectors prepared from the pLS-lucPC-HS, pLS-lucPC-PB, pCS-lucPC-HS and pCS-lucPC-PB plasmids encode only the gag-pol HIV gene products, and are used in conjunction with pVL-env4070A, and any of the packaging expression vectors LTR-HIV3 'or pCMV-HIV3'. In resistance tests carried out using two types of host cells, the 293 cell line, the tsa54 cell line, the tsa201 cell line, or the BOSC 23 cell line are employed as packaging host cells, and the Unmodified Jurkat cells are employed as the target cells. As the non-functional reporter genes with permuted coding regions contained within these resistance test vectors are not efficiently expressed with the transfection of the packaging host cells, the infection of the target host cells is carried out either by -cultivation with packaging host cells or by using packaging supernatant host cell virus. For similar reasons, resistance tests carried out with these resistance test vectors can employ a single host cell type. Resistance tests using a single host cell type are carried out using either 293, tsa54, tsa201, BOSC 23 or Jurkat cells.

EXAMPLE 3 HIV Drug Susceptibility and Resistance Test Using Resistance Test Vectors Comprising Segment or Patient Derived Segments and a Non-Functional Indicator Gene with an Intron Intron Resistance test vectors containing a nonfunctional reporter gene with an inverted intron were designed using the genomic and subgenomic viral vectors HIV comprising the antiviral target genes described in Example 1.

Viral Indicator Gen-Inverted Rum Viral vectors of genomic indicator gene with patient sequence acceptor sites, pLG-lucII-HS, pLG-lucII-PB, pCG-lucII-HS 'and pCG-lucII-PB, and resistance test vectors derived from the Each one contains the following elements in a 5 'to 3' orientation (Figure 5B): 1) an HIV-LTR U3 region (pLG-lucII-HS and pLC-lucII-PB) or a first CMV IE promoter-enhancer ( pCG-lucII-HS and pCG-lucII-PB). 2) the HIV-LTR R and U5 regions, 3) the coding regions of the HIV genes gag-pol, vif, vpr, tat, rev, vpu, deleted env and nef, 4) an inserted reporter gene cassette gene within the env gene deleted, and 5) a 3 'HIV-LTR. PLG-lucII-HS and pCG-lucII-HS contain unique Hpal and SalI patient sequence acceptor sites at nucleotides 2243 to 4190 of HXB2, respectively; pLG-lucII-PB and pCG-lucII-PB contain unique Pvul and BamHI patient sequence acceptor sites at nucleotides 22 21 and 42 12 of HXB2, respectively (see Example 1 for detail). The reporter gene cassette contains: 1) a second promoter enhanced CMV, 2) the coding region of the luciferase gene interrupted by an inverted artificial intron and 3) a SV40 polyadenylation sequence. The general transcriptional orientation of the indicator gene cassette is opposite to that of the first CMV enhancer-promoter and the viral LTRs, while the orientation of the artificial intron is equal to the last elements.

Transcription of the reporter gene by the second CMV promoter-enhancer does not lead to the production of functional transcripts since the inverted intron can not be divided in this orientation. The transcription of the reporter gene by the 5 'viral LTR or the first CMV IE promoter-enhancer, however, leads to the removal of the inverted intron through the RNA division, even though the reporter gene is not yet functionally expressed since the resulting transcript has an antisense orientation. After reverse transcription of this transcript and the integration of the resulting proviral DNA, the reporter gene can be functionally transcribed by the second CMV promoter-enhancer since the inverted intron has been previously removed (Figure 5C).

Viral vectors of subgenomic reporter gene with patient sequence acceptor sites pLS-lucII-HS, pLS-oucII-PB, pCS-lucII-HS and pCS-lucII-PB, and resistance test vectors derived therefrom each contains the following elements in a 5 'to 3' orientation (Figure 5B): 1) an HIV-LTR U3 region (pLS-lucII-HS and PLS-lucII-PB) or a first CMV IE promoter-enhancer (pCS) -lucII-HS and PCS-lucII-pB, 2) the HIV-LTR R and U5 regions, 3) the coding region of the gag-pol HIV gene, 4) the indicator gene cassette, 5) a RRE element of the gene env HIV containing a viral packaging sequence and 6) a 3 'HIV-LTR. PLS-lucII-HS and pCS-lucII-HS contain the unique patient sequence acceptor sites Hpal and SalI at nucleotides 2243 and 4190 of HXB2 respectively; pLS-lucII-PB and pCS-lucII-PB contain unique patient sequence acceptor sites Pvul and BamHI at nucleotides 2221 and 4212 of HXB2 respectively. The reporter gene cassette contains 1) a second CMV promoter-enhancer, 2) the coding region of the luciferase gene interrupted by an inverted artificial intron, and 3) an SV40 polyadenylation sequence. As is the case for the genomic viral vectors pCG-lucII and pCG-lucII, the pLS-lucII and pCS-lucII reporter genes can not be functionally transcribed until the inverted intron is removed and the reverse transcription and proviral integration occurs (Fig. 5C).

Plasmid pVL-lucII, which contains the reporter gene cassette, in which the artificial intron of pVL-SnaBI / PvuII was inserted into the luciferase coding region in an inverted orientation, was prepared from two DNA: 1 fragments. ) a 5.8 kB vector fragment prepared by digestion of pVL-luc with EcoRV and treating the resulting vector with alkaline phosphatase, and 2) a 0.2 kb DNA fragment corresponding precisely to the artificial intron sequence prepared by digesting the pVL- SnaBI / PvuII with Snal and PvuII. Clones corresponding to pVL-lucII which contain the artificial intron inserted within the luciferase coding region in an inverted orientation are identified by restriction mapping.

Plasmids pLG-lucII-HS, pLG-lucII-PB, pLS-lucII-HS and pLS-lucII-PB are prepared from two DNA fragments: 1) a preparad DNA vector by digestion of plasmids pLG-luCP-HS, pLG- lucDP-PB, pLS-lucDP-HS and pLS-lucDP-PB, respectively, and treating the resulting vectors with alkaline phosphatase and 2) a 3.2 kB DNA fragment containing the luciferase reporter gene cassette prepared by the digestion of pVL-lucII with Notl. Clones with a certain correct plucll indicator gene cassette inserted into the viral vector with a transcriptional orientation opposite to that of the viral LTRs are identified by restriction mapping and used for the preparation of the resistance test vectors.

The plasmids pGC-lucII-HS, pCG-lucII-PB, pCS-lucII-HS and pCS-lucII-PB are repaired each of two DNA fragments: 1) a DNA vector prepared by digesting the plasmids pLG-lucII-HS , pLG-lucII-PB, pLS-lucII-HS and pLS-lucII-PB, respectively, with Smal and Clal and 2) a DNA fragment of 1.3 kB prepared by digesting the plasmid pCG with Smal and Clal.

Resistance Test Vector - Construction The resistance test vectors are prepared from the plasmids pLG-lucII-Hs, pLG-lucII-PB, pCG-lucII-HS, pCG-lucII-PB, pLS-lucII-HS, pLS-lucII-PB, pCS-lucII -HS and pCS-lucII-PB (Figure 5B) by the procedure described in Example 1. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-lucII-HS, pCG-lucII-HS, pLS- lucII-HS or pCS-lucII-HS using the amplified patient sequences prepared with the oligonucleotides 18 and 19, and with the oligonucleotides 22 and 23. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-lucII- PB, pCG-lucII-PB, pLS-lucII-BP or pCS-lucII-PB, using the amplified patient sequences prepared with the oligonucleotides 20 and 21, and with the oligonucleotides 24 and 25.

Test of Susceptibility and Drug Resistance The resistance tests are carried out through the procedures described in Example 1 as follows. Resistance test vectors prepared from the plasmids pLG-lucy-HS, pLG-lucII-PB, pCG-lucII-HS and pCG-lucII-PB lack a functional HIV env gene, and are used in conjunction with the vector of packaging expression pVL-env4070A. The resistance test vectors prepared from the plasmids pLS-lucII-HS, pLS-lucII-PB, pCS-lucII-HS and pCS-lucII-pB encode the gag-pol HIV gene products, and are used in conjunction with the pVL-env4070A, and any of the packaging expression vectors pLTR-HIV3 'or pCMV-HiV3'. In resistance tests carried out using two types of host cell, cell line 293, cell line tsa54 and cell line tsa201, or cell line BOSC 23 are employed as packaging host cells, and Unmodified Jurkat cells are used as the target cell.

As the non-functional indicator genes with inverted instrons contained within these resistance test vectors are not efficiently expressed with the transfection of the packaging host cells, the infection of the target host cells is already carried out by co-cultivation with the packaging host cells, or by using viruses with the packaging host cell supernatant. For similar reasons, resistance tests carried out with these resistance test vectors can employ a unique host cell type. Resistance tests using a single host cell type are carried out using either 293, tsa54, tsa201, BOSC 23 or Jurkat cells.

EXAMPLE 4 HIV Susceptibility and Resistance Test Based Without Particle Using Resistance Test Vectors Comprising Segments Derived from the Patient and a Non-Functional Indicator Gene Test of Susceptibility and Drug Resistance Particulate-based resistance tests are carried out using the resistance test vectors comprising the non-functional reporter genes with either permuted promoters, permuted coding regions or inverted introns, described in Examples 1, 2 and 3. These tests of non-particle-based resistance are carried out by transfection of a single host cell type with each resistance test vector in the absence of packaging expression vectors. Even when the non-functional reporter genes contained within these resistance test vectors are not sufficiently expressed with the transfection of the host cells, there is a detectable reporter gene expression that results from non-viral particle-based reverse transcription. The transfer of sepa and reverse transcription results in the conversion of the non-functional reporter gene permuted to a non-permuted functional indicator gene. As the reverse transcription is completely dependent on the expression of the POL gene contained within each resistance test vector, antiviral agents can be tested for their ability to inhibit the pol gene products encoded by the patient derived segments contained within the resistance test vectors. The non-particulate base resistance tests are carried out by the general procedures described in Example 1 with the following modifications: 1) resistance test vectors are transfected into the appropriate host cells, 2) antiviral agents or combinations of they are added at the appropriate concentrations to the individual cultures or transfected host cells immediately after transfection, 3) the host cells are harvested 24 to 72 hours after transfection and tested for luciferase activity. The reduction in luciferase activity observed for the transfected host cells with a given resistance test vector in the presence of a given antiviral agent, or agents, compared to a control run in the absence of the antiviral agent or agents was used for calculating the apparent inhibitory content (Ki) of the agent, or the combination of agents for the viral target gene product encoded by the patient-derived segments present in the resistance test vector.

Resistance Test Vector - Construction For non-particle base resistance tests comprising a non-functional reporter gene with a permuted promoter, the resistance test vectors are prepared as described in Example 1 using the plasmids pLG-lucPP-HS, pLG-lucPP-PB, pCG-lucPp-HS, pCG-lucPP-PB, pLS-lucPP-HS, PLS-lucPP-PB, pCS-lucPP-HS or PCS-lucPP-PB. Each resistance test vector is transfected into the host cells by expressing a T7 RNA cytoplasm polymerase (e.g., 293 / T7RNAP cells or Jurkat / T7RNaP cells).

Such host cells are prepared by stable transfection of the 293 cells and Jurkat cells as described in Example 1, using the plasmid pVL-T7RNAP, which directs the expression of the cytoplasmic phage T7 RNA polymerase in human cells and of other mammals and cell lines. The pVL-T7RNaP was constructed from the following two DNA fragments: 1) a 4.3 kB vector fragment prepared by digestion of the mammalian expression vector pVL-2 with EcoRI and BglII, and 2) a 2.6 kB DNA fragment containing the region of complete coding of T7 RNA polymerase (nucleotides 166 to 2815, coordinated given in accession number GenBank M38308, Grachev and Pletnet (1984) Bioorg, Khim, 10, 823-843) prepared by PCR using plasmid pT7-Gl as a tempered with oligonucleotides 47 and 40, primers, followed by digestion with EcoRI and BglII. Oligonucleotide 47 incorporates a unique EcoRI site followed by the consensus sequence for initiation of eukaryotic translation (eg, Kozak (1991) J. Biol. Chem, 266, 19867-19870), while oligonucleotide 40 incorporates a BglII site only.

For non-particle based resistance tests with resistance test vectors comprising a non-functional reporter gene with a permuted coding region or an inverted intron, the resistance test vectors are prepared as described in Example 1 using the plasmids pLG-lucPC-HS, pLG-lucPC-PB, pCG-lucPC-HS, pCG-lucPC- = PB, pLS-lucPC-HS, pLS-lucPC-PB, pCS-lucPc-HS, pCS-lucPC-PB, pLG-lucII-YS, pLG-lucII-PB, pCG-lucII-HS, pCG-lucII-PB, pLS-lucII-HS, pLS-lueli-pB, pCS-lucII-HS or pCs-lucII-PB. Each resistance test vector is transfected into any 293, tsa54, 5sa201, BOSC 23 or Jurkat cells.

EXAMPLE 5 HIV Drug Susceptibility and Resistance Testing Using Resistance Test Vectors Comprising Segment or Patient Derived Segments and a Functional Indicator Gene Viral Vector of Gen Indicator - Functional Indicator Gene Genomic indicator gene vectors with patient sequence acceptor sites, plasmids pLG-lucHS-1, pLG-luc-Hs-2, pLG-luc-PB-1, pLG-luc-PB-2, pCG-luc- HS-1, pCG-luc-HS-2, pCG-luc-PB-1 and pCG-luc-PB-2, and the resistance test vectors derived therefrom, each contain the following elements in an orientation. 'a 3' (figure 6): 1) an HIV-LTR U3 region (pLG-luc-HS-1, pLG-luc-HS-2, pLG-luc-PB-1 and pLG-luc-PB-2) or a first CMV IE promoter-enhancer (pCG-luc-HS-1, pCG-luc-HS-2, pCG-luc-PB-1 and PCg-luc-PB-2), 2) the HiV-LTR R regions and U5, 3) the coding regions of the Hiv gag-pol, vif, vpr, tat, rev, vpu, env deleted and nef genes, 4) a reporter gene cassette inserted within the deleted env gene, and 5) a 3 'HiV-LTR. The pLG-luc-HS-1, pLG-luc-HS-2, pCG-luc-HS-1 and pCG-luc-HS-2 contain unique patient sequence acceptor sites Hpal and Sali at nucleotides 2243 and 4190 of HXB2, respectively; pLG-luc-PB-1, pLG-luc-PB-2, pCG-luc-PB-1 and pCG-luc-PB-2 contain unique Pvul and BamHI patient sequence acceptor sites at nucleotides 2221 and 4212 of HXB2, respectively (see Example 1 for details). The reporter gene cassettes of each plasmid contain 1) a second CMV promoter-enhancer, 2) the coding region of the luciferase gene, and 3) an SV40 polyadenylation sequence. The reporter gene cassettes of pLG-luc-HS-1, pLG-luc-PB-1, pCG-luc-Hs-1 and pCG-luc-PB-1 are inserted into the vector with the transcriptional orientation opposite to the viral LTRs or to the first CMV promoter-enhancer (Figure 6B) while the reporter gene cassettes of pLG-luc-HS-2, pLG-luc-PB-2, pCG-luc-HS-2 and pCG-luc-PB-2 they are inserted into the vector with the same orientation (Figure 6C).

Viral vectors of subgenomic reporter gene with patient sequence acceptor sites, plasmids pLS-luc-HS-1, pLS-luc-HS-2, pLS-luc-PB-1, pLS-luc-PB-2, pCS -luc-HS-1, pCS-luc-HS-2, pCS-luc-PB-1 and pCS-luc-PB-2, and the resistance test vectors derived therefrom each contain the following elements in a 5 'to 3' orientation (figure 6): 1) an HIV-LTR U3 region (pLS-luc-HS-1, pLS-luc-HS-2, pLS-luc-PB-1 and pLS-luc-PB-2) or a first enhancer -promotor CMV IE (pCS-luc-HS-1, pCS-luc-HS-2, pCS-luc-PB-1 and pCS-luc-PB-2), 2) the regions HIV-LTR and U5, 3) the region of encoding the gag-pol HIV gene, 4) the reporter gene cassette, 5) an RRE element of the HIV env gene containing a viral packaging sequence, and 6) an HIV-LTR. The pLS-luc-HS-1, pLS-luc-HS-2, pCS-luc-Hs-1 and pCS-luc-HS-2 contain the Hpal and Sali patient sequence acceptor sites unique in nucleotides 2243 and 4190 of HXB2, respectively; pLS-luc-PB-1, pLS-luc-PB-2, pCs-luc-PB-1 and pCS-luc-PB-2 contain the unique Pvul and BamHI patient sequence acceptor sites at nucleotides 2221 and 4212 of HXB2, respectively. The reporter gene cassettes of each plasmid contain 1) a second CMV promoter-enhancer, 2) the complete coding region of the luciferase gene, and 3) an SV40 polyadenylation sequence. The indicator gene cassettes of pLS-luc-HS-1, pLS-luc-PB-1, pCS-luc-HS-1 and pCS-luc-PB-1 are inserted into the vector with the opposite transcriptional orientation of the viral LTRs of the first CMV enhancer-promoter (Figure 6B), while the indicator gene cassettes of pLS-luc-HS-2, pLS-luc-PB-2 pCS-luc-HS-2 and pCS-luc-PB-2 are inserted inside the vector with the same orientation (figure 6C).

The plasmids pLG-luc-HS-1 and pLG-luc-HS-2, pLG-luc-PB-1 and pLG-lucPB-2, PCG-luc-HS-1 and pCG-luc-HS-2, pCG- luc-PB-1 and pCG-luc-PB-2, pLS-luc-HS-1 and pLS-luc-HS-2, pLS-luc-PB-1 and pLS-Iuc-PB-2, pCS-luc- HS-1 and pCS-luc-HS-2, pCS-luc-PB-1 and pCS-luc-PB-2 are each prepared from two DNA fragments: 1) a DNA vector prepared by digesting either pLG-lucII -HS, pLG-lucIi-pB, pCg-lucIi-HS, pCG-lucII-PB, pLS-luc-HS, pLS-lucII-PB, pCS-lucII-HS and pCS-lucII-pB, respectively with Notl and treat the resulting factors with alkaline phosphatase; and 2) a 3.0 kB DNA fragment containing the luciferase reporter gene cassette prepared by digesting pVL-luc with Notl. Clones containing the reporter gene cassette inserted into a given viral vector in both transcriptional orientations relative to the viral LTRs are identified by restriction mapping (e.g., pLG-luc-HS-1 and pLG-luc-HS-2 ).

Resistance Test Vector - Construction Resistance test vectors containing a functional reporter gene were designed using the genomic and subgenomic HIV viral vectors comprising the antiviral target genes described in Example 1. The resistance test vectors are prepared from the above-mentioned plasmids (FIG. 6) through the procedure described in Example 1. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-luc-HS-1, pLG-luc-HS-2, pCG-luc-HS-1, pCG -luc-Hs-2, pLS-luc-HS-1, pLS-luc-HS-2, pCS-luc-Hs-1 or pCS-luc-HS-1, using the amplified patient sequences prepared with the oligonucleotides. and 19, and with oligonucleotides 22 and 23. The resistance test vectors are constructed with the vectors prepared from the plasmids pLG-luc-PB-1, pLG-luc-PB-2, pCG-luc-PB-1, pCG-luc-PB-2, pLS-luc-PB-1, pLS-luc-PB-2, pCS-luc-PB-1 or pCS-luc-PB-1 using the amplified patient sequences prepared with Oligonucleotides 20 and 21, and with oligonucleotides 24 and 25.

Drug Susceptibility and Resistance Test The resistance tests are carried out by the procedures described in Example 1 as follows. The resistance test vectors prepared from the plasmids pLG-luc-HS-1, pLG-luc-HS-2, pLG-luc-PB-1, pLG-luc-PB-2, pCG-luc-HS-1, pCG-luc-HS-2, pCG-luc-PB-1, pCG -luc-PB-2, lack a functional HIV env gene and are used in conjunction with the packaging expression vector pVL-env4070A. The resistance test vectors prepared from the plasmids pLS-luc-HS-1, pLS-luc-HS-2, pLS-luc-PB-1, pLS-luc-PB-2, pCS-luc-HS-1, pCs-luc-HS-2, pCS-luc-PB-1 and pCS-luc-PB-2 encode HIV gag-pol gene products alone, and are used in conjunction with pVL-env4070A, and any vectors of packaging expression pLTR-HIV3 or pCMV-HTV3 '. Resistance tests are carried out with two host cell types using the 293 cell line, the tsa54 cell line, the tsa201 cell line or the BOSC 23 cell line as the packaging host cells, and using Jurkat cells. not modified as target cells. Infection of the target cells with these and other resistance test vectors containing the functional indicator genes is carried out using the procedure for infection with the viral particles of the resistance test vector of the filtered supernatants obtained from the host cells. of resistance test vector indicator as described in Example 1. In contrast to resistance test vectors comprising non-functional reporter gene vectors with a permuted promoter or inverted intron, those comprising functional indicator genes are typically capable of expressing the reporter genes in the transfected packaging host cells. Neither the co-cultivation procedure nor the resistance test using a single cell type can therefore easily adapt for infection of the target cells using the resistance test vectors with the functional indicator genes, as would be difficult to distinguish between expression of the reporter gene in the infected target host cells and the transfected packaging host cells.

All publications and patent applications cited in that description are hereby incorporated by reference in their entirety as if each of the individual publications or patent applications were specifically and individually indicated as incorporated by reference.

As will be apparent to those skilled in the art of which the invention pertains, the present invention may be involved in ways other than those specifically described above, for example, to carry out the susceptibility and resistance test on other viruses, without departing from the spirit or the essential characteristics of the invention. The particular modalities described above are therefore considered as illustrative and not restrictive. The scope of the present invention is as set forth in the appended claims rather than being limited to the examples contained in the foregoing description.

EXAMPLE 6 Susceptibility Test and Drug Resistance H V using Resistance Test Vectors Comprising Segment or Patient Derived Segments and a Functional Indicator Gene Evidence of Susceptibility and Drug Resistance The resistance tests were carried out with the resistance test vectors based on the viral vectors of the reporter gene pCG-CXCN (F-lucP) 2, and pCVG-CXAT (F-lucP) 2, both of which are similar to the PCG-luc-2 described in Example 5, using two types of host cell. In the case of pCG-CXCN (Fl? CP) 2 the viral vector of the reporter gene was modified in the sense that the indicator gene cassette lacked intron A (CMV / a-globin intron described above), with a signal containing of polyadenylation and the sequence 3 'U5 downwards was omitted in the construction. The downward U5 was replaced with an SV40 poly A signal and origin of duplication regions. The viral vector gene indicator pCG-CXAT (F-lucP) 2 differed from pCG-CXCN (f-lucP) 2 in that the indicator gene cassette contained in the artificial intron downstream of the CMV promoter-enhancer and the TK polyadenylation signal region. Viral particles of resistance test vector were produced by a first host cell (the host cell resistance test vector) which was prepared by transfecting a packaging host cell with the resistance test vector and the vector packaging expression. Viral particles of resistance test vector were then used to infect a second host cell (the target host cell) in which expression of the reporter gene was measured.

Susceptibility Testing / Drug Resistance AZT The resistance test browser pCG-luc-2 containing a functional luciferase gene cassette was constructed and the host cells were transfected with the DNA resistance test vector. The resistance test vectors contained reverse transcriptase sequences derived from "test" patient that were either susceptible or resistant to the nucleoside reverse transcriptase inhibitor, AZT (Sigma). Resistance test vector viral particles produced by transfecting the DNA resistance test vector into the host cells were used to infect the target host cells cultured either in the absence of AZT or in the presence of the concentrations in increase in the drug (ranging from approximately O.OOlμM to OOOμM). The amount of luciferase activity produced in the target host cells infected in the presence of the drug was compared to the amount of luciferase produced in the infected target cells in the absence of the drug. Drug resistance was measured as the amount of drug required to inhibit the luciferase activity detected in the absence of the drug by 50% (50% inhibitory concentration, IC 50). The IC50 values were determined by drawing the drug division percent against the concentration of drug log10.

Host cells (293) were plated in 10 cm diameter dishes and transfected several days after coating with the DNA resistance test vector plasmid and the envelope expression vector pCXAS (4070A-env). The transfections were carried out using a calcium phosphate precipitation process. The cell culture medium containing the DNA precipitate was replaced with fresh medium, from one to 24 hours, after transfection. the cell culture medium containing the test vector viral particles were harvested from one to four days after transfection and passed through a 0.45 mm filter before being stored at -80oc at protein levels (p24). of HIV capsid in the harvested cell culture media were determined by the EIA method as described by the manufacturer (SIAC, Frederick, MD). Six to forty-eight hours after infection, the target cells 293 and 293 / T) were coated in cell culture medium containing non-AZT or two-fold serial dilutions of AZT beginning at 100 / xM and terminated at 0.00005 / zM. AZT concentrations were maintained through infection. The target host cells were inoculated with 90μl of the transfected resistance test vector host cell supernatant. Control infections were carried out using the cell culture medium of the imitation transfections (without DNA) or the transfections containing the plasmid DNA resistance test vector without the envelope expression DNA plasmid (pCXAS (4070A-env). )). One to 24 hours after the inoculation, the fresh medium was added to each well. Twelve to thirty-six hours later, the medium was completely replaced with fresh medium. One to three days after infection, the medium was removed and the cell lysis buffer (Promega) was added to each well. The cell lysates were diluted 100-fold in the lysis buffer and each diluted cell lysate was assayed for luciferase activity (Figure 7A). The inhibitory effect of AZT was determined using the following equation: % inhibition of luciferase = 1 - (RLUluc [AZT] - = - RLUluc) where RLUluc [AZT] is the Relative Light Unit of the luciferase activity in the infected cells in the presence of AZT and RLUluc is the Relative Light Unit of luciferase activity in infected cells in the absence of AZT. The ICS0 vectors were targets for the sigmoidal curves that were generated from the data by drawing the percent inhibition of luciferase activity against the concentration of drug log10. The AZT inhibition curves are shown in Figure 7B.

Susceptibility Test / Drug Resistance Nevirapine The resistance vector based on the indicator gene viral vector pCG-CXCN (F-lucP) 2, contained the reverse transcriptase sequence derived from the biologically active proviral clone, pNL4-3, which is susceptible to the reverse transcriptase inhibitor without nucleoside, nevirapine (BI-RG-587, Boehringer Ingleheim). Transfection of the host packaging cells and infection of the host target cells were carried out as described for the AZT drug susceptibility / resistance tests as described above. The susceptibility / resistance of nevirapine was evaluated using concentrations of nevirapine ranging from O.OOOlμM to lOOμM. The inhibition curve nevirapine was determined as described above for AZT and is shown in Figure 7C.

Drug Resistance / Susceptibility Tests Indinavir The resistance test vector, based on the indicator gene viral vector pCG-CXCN (F-lucP) 2, contained the protease sequence derived from the biologically active proviral clone pNL4-3, which is susceptible to the protease inhibitor, indinavir ( MK-639, Merck). Transfection of the host packaging cells and infection of the host target cells were carried out as described for the AZT drug susceptibility / resistance test except for the protease inhibitor, indinavir, was present in the transfected packaging host cell cultures as well as in the infected target host cell cultures, as described above. Indinavir susceptibility / resistance was evaluated using indinavir concentrations ranging from 1.5 pM to 3 pM. The indinavir inhibition curve was determined as described above for AZT and was shown in Figure 7D.

, EXAMPLE 7 Hepatitis Drug Susceptibility and Resistance Test Using Resistance Test Vectors Comprising Segment or Patient Derived Segments and a Non-Functional Indicator Gene Containing an Intron Intron Viral Vector of Gene Indicator - Construction The viral vectors of indicator gene containing a nonfunctional indicator gene with an inverted intron were designed using HBV subgenomic viral vectors comprising the viral genes which are the object or objects of antiviral drugs. The viral gene vectors pCS-HBV (NF-IG) II- (PSAS-), are based on the subgenomic viral vector pCS-HBV. The indicator gene viral vector contains a cassette of non-functional indicator gene containing an inverted intron and all the cis-acting regulatory elements that are necessary for HBV DNA duplication for example (DR1, 'e DR2, DR1 *, 3'pA) but lacks the HBV gene sequences (for example the C, P, S and X genes) that provide the enzymatic and structural and transactuating functions that are necessary for the duplication of HBV DNA and the formation of virus particles (Figure 8B). The C, P, S and X genes and the patient sequence acceptor sites are contained within a packaging vector pPK-CPX (described below, Figure 8D) and pPK-S (described below, Figure 8E). In this embodiment, the viral vector of the reporter gene pCS-HBV (NF-IG) II- (PSAS-) and the packaging vector pPK-CPX constitute a resistance vector vector system. The non-functional indicator gene viral vector pCS-HBV (NF-IG) II- (PSAS-) contains the following elements in the 5 'to 3' orientation: (1) the promoter region of CMV IE enhancer, (2) the 5 'region of the HBV genome and the DR1 and the 5' copy of the encapsidation signal region (e) (the pre-C ORF translation initiation codon is deleted), (3) a non-functional indicator gene cassette in which the reporter ORF contains an inverted intron, (4) the region of the HBV genome containing DR2, DR1 *, the 3'e, and the 3 'HBV polyadenylation (pA) signal region. The non-functional reporter gene expression cassette is comprised of some or all of the following arranged elements in the 5 'to 3' orientation: (1) a transcriptional promoter-enhancer region, (2) an intron,. (3) a reporter gene containing an inverted intron, (4) a transcriptional polyadenylation signal sequence (eg SV40), (thymidine kinase gene HSV-1). The indicator gene expression cassette has a transcriptional orientation opposite to the HBV sequence elements (Figure 8B). However, the intron within the ORF reporter gene has the same transcriptional orientation as the HBV sequence elements.

In a second embodiment, the non-functional indicator gene viral vector, pCS-HBV (NF-IG) II (PSAS +), contains a non-functional indicator gene cassette containing an inverted intron, all the cis-acting regulatory elements that are necessary for HBV DNA duplication, and some or all of the HBV gene sequences (eg C, P, S, X genes) that provide the transacting structural and enzymatic functions that are necessary for HBV DNA duplication and particle formation. virus (Figure 8F). Resistance test vectors derived from the reporter gene vector pCS-HBV (NF-IG) II (PSAS +) contain the patient sequence acceptor sites (PSAS) and are used in conjunction with the packaging vector pPK-CSX ( Figure 8H). In this embodiment, the viral vector of the reporter gene can also provide some or all of the packaging functions such as P. The structural and enzymatic activities that are not provided by the viral vector of the reporter gene, but that are necessary for the duplication of HBV DNA and Virus particle formation, are provided using additional packaging vectors pPK-CSX (described below, Figure 8H). In this modality, the non-functional indicator gene viral vector, pCS-HBV (NF-IG) II (PSAS +) contains the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome and the DRl and 5'e (the pre-C ORF translation initiation codon is deleted), (3) an indicator gene cassette, containing an inverted intron, placed within the region of the HBV genome which may contain some or all of the genes C, P, S and X as well as a segment of P gene derived from patient, (4) the region of the HBV genome containing DR2, DR1 *, 3'e, and the pA signal region of HBV 3'e. Within the non-functional reporter gene vector pCS-HBV (NF-IG) II (PSAS +) the indicator gene expression cassette has a transcriptional orientation opposite to the HBV sequence elements (Figure 8F). However, the intron within the ORF reporter gene has the same transcriptional orientation as the HBV sequence elements.

In transfected cells the packaging vectors (Figures 8D, 8E and 8H) provide, in trans, the structural and enzymatic functions that are necessary for virus particle formation and HBV DNA duplication, but are not provided by the vector of resistance test or the viral vector of indicator gene. In the embodiment in which the indicator gene viral vector such as pCS-HBV (NF-IG) PP- (PSAS-) is co-transfected with a packaging vector, such as pPK-CPX, the combination of those vectors constitutes a resistance test vector system, this is the packaging vector containing the patient sequence acceptor sites for insertion of the patient derived P-gene segment (described above). The packaging vector pPK-CPX contains the following elements in a 5 'to 3' orientation: (1) the CMV IE enhancer-promoter region, (2) the HBV genome region spanning from the translation initiation codon C ORF to the 3 'pA signal including the C, P, S and X genes. The C gene of the packaging vectors is modified so that it does not contain and / or expresses the pre-C ORF sequences and does not express the S proteins ( described below).

In HBV, RNA encoding C and / or P proteins is preferably packaged in cis and consequently can interfere with the efficient packaging of the resistance test vector containing a non-functional reporter gene or a non-functional reporter gene vector viral RNA that does not encode the C and P proteins. Two steps are taken to avoid encapsidation of RNA produced by the packaging vectors and to improve the efficiency of encapsidation of the resistance test vector or a non-functional RNA reporter gene vector. First, the RNA produced by the packaging vectors does not contain the 5 'encapsidation signal region (e) (Figures 8D, 8E and 8H). Secondly, in cases where either the packaging functions of the C gene and / or the P gene are provided by the resistance test vector or the non-functional reporter gene viral vector, the packaging vectors, such as pPK-S or pPK-CSK that do not express the gene C and / or P products are used (Figures 8E and 8H).

Resistance Test Vectors - Construction Resistance test vectors are prepared by 1) modifying the pCS-HBV (NF-IG) II (PSAS-) reporter gene viral vector by introducing unique restriction sites, called patient sequence acceptor sites (PSAS) in the P gene region, 2) amplify the patient-derived segments corresponding to the target of the HBV drug, eg, reverse transcriptase or DNA polymerase, by amplifying the viral DNA present in the serum or cells of the infected patients, and ) insert the amplified sequences precisely into the viral vectors of the reporter gene at the patient sequence acceptor sites (Figure 8F). Alternatively, the resistance test vector systems are prepared by 1) modifying the packaging vectors, pPK-CPX, by introducing the patient sequence acceptor sites in the P gene, 2) amplifying the patient-derived segments corresponding to the HBV drug target, for example reverse transcriptase or DNA polymerase, by amplification using the viral DNA present in the serum or cells of infected patients, and 3) inserting the amplified sequences precisely into the packaging vectors at the acceptor sites of patient sequence (Figure 8D). In one embodiment, the 5 'PSAS is located near the border of the spacer and the RT domains of the P protein (immediately downstream of the S protein translation initiation site) and the 3' PSASs are located near the C terminus of the RNase H domain of the P protein. The insertion of a patient derived P gene segment within the patient sequence acceptor sites results in the formation of a chimeric P gene sequence in which the spacer domains and the TP they are encoded by the vector P gene sequence while the reverse transcriptase / polymerase and the RNase H domains are encoded by the patient derived segments (Figures 8D and 8F).

In HBV, the complete ORF gene S overlaps the P gene ORF but is expressed using a different reading frame (Nassal, M and Schaller, H. (1993) streams in microbiology 1, 221-228). Thus, the HBV P gene sequences (reverse transcriptase and RNase H domains) obtained from patients also contain the corresponding patient S gene sequences. Expression of the S-gene region derived from the overlapping S-gene ORF patient is prevented by eliminating the three S-gene ORF translation initiation sites (pre-Sl, pre-S2 and S) and / or introducing the stop codons in the vectors pCS-HBV (NF-IG) II- (PSAS +) or pPK-CPK (Figures 8F and 8D). S gene expression is provided, in trans, using a separate packaging vector that provides well characterized S gene products (Figures 8E and 8H). Modifications that eliminate S gene expression are carried out without introducing changes to the overlapping amino acid sequences that are encoded by the terminal protein (TP) or spacer domains of the P gene.

Evidence of Susceptibility and Drug Resistance Drug susceptibility and resistance tests are carried out with a resistance test vector based on the viral vectors of indicator gene pCS-HBV (NF-IG) II- (PSAS +) or with a resistance test vector system based on a viral vector of the reporter gene, pCS-HBV (NF-IG) II- (PSAS-) and a packaging vector, pPK-CPX, using either one type of host cell or two host cell types. Co-transfection of the packaging host cells with either a resistance test vector, such as pCS-HBV (NF-IG) II- (PSAS +) and a packaging vector, pPK-CSX, or with a vector Indicator gene viral, such as pCS-HBV (NF-IG) II- (PSAS-) and a segment derived from patient containing packaging vector, such as pPK- • CPX, (for example resistance test vector system) HBV viral particles containing a "pregenome" RNA encapsidated indicator gene which, as a result of the division of the inverted intron, contains a functional indicator gene (Figures 8B and 8C).

Duplicate transfections are carried out on a series of packaging host cell cultures maintained either in the absence of the antiviral drug or in increasing concentrations of the anti-HBV drug (e.g. a reverse transcriptase of HBV P protein or polymerase inhibitor). After maintaining the packaging host cells for several days in the presence or in the absence of the anti-HBV drug the level of susceptibility or resistance to the drug can be established either directly in the host cell packaging lysates, or in the isolated HBV particles obtained by harvesting the host packaging cell culture medium. Alternative approaches can be used to assess drug susceptibility and resistance in cell lysates and isolated HBV particles.

In one embodiment, referred to as a cell assay, the susceptibility to drug resistance is established by measuring the expression of the reporter gene, for example the luciferase activity in the transfected packaging host cells in the presence or in the absence of a antiviral drug. A reduction in the luciferase activity observed for the transfected cells in the presence of a given antiviral agent or a combination of agents compared to a control run in the absence of the antiviral agent or agents, generally refers to the log of the concentration of the agent antiviral as a sigmoidal curve.

In a second embodiment, referred to as the two-cell assay, the susceptibility or resistance to the drug is established by measuring the expression of the reporter gene, eg, the luciferase activity, in the target host cells after infection or transfection. with HBV particles or HBV particle DNA respectively. The HBV viral particles obtained from the packaging host cells are used to infect the target host cells or DNA from those particles is used to tranfect the target host cells. At the time of infection or transfection, the appropriate concentration of the antiviral drug is added to the cell culture. After several days of infection or transfection, the target host cells are lysed and the expression of the reporter gene is measured. A reduction in the expression of the reporter gene will be observed for cells transfected or infected in the presence of drugs that inhibit HBV duplication, for example by inhibiting either reverse transcriptase (- DNA strain) or DNA polymerase (+ DMA strain) ) activities of the P HBV protein compared to a control current in the absence of the drug.

In a third modality, referred to as the DNA structure indicator assay, susceptibility to drug resistance is established by measuring the level of DNA HBV duplication that has occurred within the transfected packaged host cells or within the virus particles. produced by means of packaging host cells. In the transfected host cells the HBV subgenomic viral vector is transfected and the RNA transcript is packaged as a "pregenomic" RNA. During the maturation of the virus, pregenomic RNA is converted to the relaxed circular form of genomic DNA (rc-DNA) consisting of a complete minus strain and a DNA copy of plus partial strain. In a subsequent step, rc-DNA is converted to a covalently closed circular DNA form (cccDNA). To measure HBV DNA duplication, the amplification primers are designed to amplify an HBV DNA structure that is formed by the division of the pregenomic RNA and the conversion of this divided RNA into rc-DNA and cccDNA forms.

The formation of the correct amplification target structure within the HBV particles requires a successful termination of DNA HBV duplication resulting in the formation of rc-DNA and cccDNA. Antiviral drugs that inhibit DNA HBV duplication (reverse transcription and DNA polymerase activities) will limit the formation of the target DNA sequence, which in turn can be measured as a decrease in the amplified DNA product using a number of amplification assays quantitative In one example (Figure 10B) the binding site of the reverse primer (Pr) was separated into two components by an intron sequence that is inserted into the ORF reporter gene in the same transcriptional orientation as the HBV sequences. The priming binding site of the front primer (Pf) is located within the region of the viral vector that is flanked by the DR2 and DR1 * sequences. In the linear HBV vector the primers Pf and Pr direct the DNA synthesis in opposite directions and are oriented outwardly with respect to each other. In this case, the Pr primer directs the DNA synthesis in an upward direction (towards the 5 'copy of (e) and the Pf primer directs the DNA synthesis in the downward direction (towards 3 '(e).) This priming and tempering arrangement does not constitute a unit of functional amplification in the linear indicator gene viral vector.In addition, the binding site Pr is not in contact in the linear unsplit vector and In contrast, the Pf and Pr primers assume an inward orientation with respect to each other in the relaxed circle form of the HBV DNA found in the mature virions and the division of the assembled RNA pre-genome. Pr intact prim primer binding site Both primers now direct DNA synthesis towards the single copy of the DRl within the rc-DNA plus strain copy in either the plus or minus strain or cccDNA. a functional amplification unit (Figure 10C).

In an alternative embodiment of DNA sequence indicator assay (Figure 9D) the 5 'exonuclease activity of the amplification enzyme (eg Taq polymerase) was measured rather than the production of the amplified DNA (C. Heid et al., 1996 , Genome Research 6: 986-994). The 5 'exonuclease activity is measured by monitoring the nucleolytic cleavage of a fluorescently labeled oligonucleotide probe that is capable of agglutinating to the amplified amplified DNA region flanked by the binding sites Pf and Pr. The operation of this assay depends on the close proximity of the 3 'end of the primer up (Pf) to the 5' end of the oligonucleotide probe. When the primer Pf extends it displaces the 5 'end of the oligonucleotide probe so that the 5 'activity of the polymerase exonuclease unfolds the oligonucleotide probe. The purpose of the intron is to distance the binding site Pf sufficiently far from the 5 'end of the exonuclease probe sequence to essentially eliminate the detectable exonuclease digestion of the probe oligonucleotide in the undivided target annealing. The removal by intron to divide serves to place the 3 'end of the binding site Pf immediately upstream of the 5' agglutination site of the probe. This latter rearrangement allows quantitative detection of the exonuclease activity of the amplified target annealing (Figure 1E).

Drug Exasen The drug test is carried out using an indicator gene viral vector containing a non-functional indicator gene cassette with an inverted intron and a packaging vector or packaging vectors. In the transfected packaging host cells, the indicator gene viral vector produces a competent RNA (e +) transcript containing the reporter gene. The vector or packaging vectors provide, in trans, the structural and / or enzymatic viral functions that are not provided by the resistance test vector, but are necessary for DNA duplication and particle formation. With the co-transfection of the packaging host cells, the viral vector of the reporter gene and the packaging vectors give rise to the HBV viral particles containing a viral vector of indicator gene encapsidated "pregenome" RNA, which as a result of the division of the inverted intron, contains a functional indicator gene.

The drug examination is carried out as follows: the viral vector of the reporter gene and the packaged vector DNA was used to transfect the packaging host cells. Duplicate transfections are carried out on a series of packaging host cell cultures maintained either in the absence or in the presence of potential antiviral compounds (e.g., polymerase inhibitors or reverse transcriptase protein P HBV). After maintaining the packaging host cells for up to several days in the presence or in the absence of the candidate antiviral drugs the level of inhibition of DNA duplication was established either directly in the host cell lysates of packaging or in the HBV particles. isolates obtained by harvesting the host packaging cell culture medium. Any of the reporter gene or DNA detection activity methods, described above, can be used to evaluate potential anti-HBV drug candidates.

EXAMPLE 8 Hepatitis Drug Susceptibility and Resistance Test Using Resistance Test Vectors Comprising Patient Derivative Segments and a Non-Functional Indicator Gene Containing a Permuted Promoter.

Viral Vector of Gen Indicator - Construction The viral vectors of the reporter gene containing a non-functional indicator gene with a permuted promoter were designed using a subgenomic viral vector HBV comprising viral genes which are the target or targets of antiviral drugs. The viral vectors of the reporter gene, pCS-HBV (NF-IG) PP- (PSAS-), are based on the subgenomic viral vector pCS-HBV. The viral vector of the reporter gene, pCS-HBV (NF-IG) PP- (PSAS-), contains a cassette of a non-functional indicator gene with a permuted promoter and all the cis-acting regulatory elements that are necessary for the duplication of HBV DNA (eg DRl, 5'e DR2, DRl *, 3'pA) but lacks the HBV gene sequences (eg C, P, S and X genes) that provide the transacting structural and enzymatic functions that are necessary for duplication of HBV DNA and formation of virus particles (Figure 10B). The patient sequence acceptor sites and C, P and X are contained within the packaging vector pPK-CPX (described in Example 7, see Figure 8D). The S gene is contained within a packaging vector pPK-S (described in Example 7, see Figure 8E). In this embodiment, the viral vector of the reporter gene pCS-HBV (NF-IG) PP- (PSAS-) and the packaging vector pPK-CPX constitutes a vector resistance test system. The non-functional reporter gene viral vector pCS-HBV (NF-IG) PP- (PSAS-) contains the following elements in a 5 'to 3' orientation: (1) the promoter region of CMV IE enhancer, (2) the 5 'region of the HBV genome and the DRl and 5'e (the pre-C ORF translation initiation codon is deleted), (3) a cassette of assembled non-functional reporter gene so that the promoter region is placed in place. ', for example downstream of the reporter gene ORF (4) the 3 'region of the HBV genome containing DR2, DR1 *, the 3'e, and the 3' HBV signal pA region (the pre-ORF translation initiation codon). -C is eliminated). The non-functional indicator gene expression cassette is composed of some or all of the following elements arranged in the 5 'to 3' orientation: (1) an internal ribosome entry site (IRES), (2) an indicator gene, which may contain an inverted intron, and (3) a transcriptional polyadenylation signal sequence (e.g., the thymidine kinase gene HSV-1, SCV40) (4) a promoter-enhancer region. Within the non-functional reporter gene viral vector, the indicator gene expression cassette has a transcriptional orientation either opposite or equal to the HBV sequence elements. In cases where the ORF reporter gene contains an intron, the intron has the same transcriptional orientation as the elements of the HBV sequence.

In a second embodiment, the non-functional reporter gene viral vector contains a cassette of non-functional reporter gene containing a permuted promoter region, all the cis acting regulatory elements that are necessary for the duplication of HBV DNA, and some or all of the sequence of HBV gene (for example C, P, S, X genes) that provide the transacting structural and enzymatic functions that are necessary for HBV DNA duplication and in the formation of virus particles, pCS-HBV (NF-IG) PP- ( PSAS +) (Figure 10B). Resistance test vectors derived from the indicator gene viral vector pCS-HBV (NF-IG) PP- (PSAS +), contain patient sequence acceptor sites and are used in conjunction with the packaging vector pPK-CSK (FIG. 8H). In that embodiment the viral gene vector indicator can also provide some or all of the packaging functions. In addition, in this embodiment structural and enzymatic activities that are not provided by the indicator gene viral vector, but which are necessary for HBV DNA duplication and virus particle formation, are provided using the additional packaging vectors. In this embodiment, the non-functional reporter gene viral vector pCS-HBV (NF-IG) PP- (PSAS +), contains the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region , (2) the 5 'region of the HBV genome and DRl and 5'e (the pre-C ORF translation start codon is deleted), (3) an enhancer-promoter region (permuted promoter), (4) the segment derived from the patient containing the P gene (5) the ORF reporter gene (6) an internal ribosome entry site (IRES), and (7) the 3 'region of the HBV genome containing DR2, DRl *, 3'e, and the pA 3' HBV signal region (the pre-C ORF translation start codon is deleted). Within the non-functional reporter gene viral vector, the indicator gene expression cassette has a transcriptional orientation either in the reverse direction or forward with respect to the HBV sequence elements. In cases where the reporter gene contains an inverted intron, the intron has a transcriptional orientation equal to the HBV sequence elements.

Resistance Test Vector - Construction Resistance test vectors containing a non-functional reporter gene with a permuted promoter are designed using a HBV subgenomic viral vector comprising antiviral target genes as described in Example 8. The reporter gene viral vector or the packaging vector is modified to include patient sequence acceptor sites (PSAS) for the insertion of P-gene-containing patient-derived segments (PDS) (described in Example 7, see Figures 8D and 8F). The expression of the S gene derived from the patient is eliminated as described in Example 7 (Figure 8D). S uniform gene expression is provided, in trans, using a separate packaging vector that provides highly characterized S gene products (Figure 8E).

Evidence of Susceptibility and Drug Resistance The susceptibility and drug resistance tests are carried out with a resistance test vector based on viral vectors of the indicator gene pCS-HBV (NF-IG) PP- (PSAS +) or with a vector resistance test system comprising a viral vector of reporter gene pCS-HBV (NF-IG) PP- (PSAS-) and a packaging vector of pPK-CPX using either a host cell type or two host cell types. With the co-transfection of the packaging host cells, either with the resistance test vector and a packaging vector or with a viral vector of indicator gene and the packaging vectors (for example the resistance test vector system ) HBV viral particles are produced containing a "pregenome11" of an encapsidated reporter gene containing a non-functional reporter gene Within the transfected host cells, the non-functional reporter gene with the permuted promoter is converted to a functional indicator gene during the process of duplication of HBV DNA (Figures 10B and 10C).

The tests for susceptibility and resistance to the drug are carried out as described in Example 7 (above) . The susceptibility or resistance of reverse transcriptase activities derived from patient and / or DNA polymerase to various antiviral drugs can be measured by measuring the expression gene expression levels in the transfected or infected host cells. Alternatively, resistance or susceptibility can be measured by quantifying the amount of DNA HBV duplication that occurs. The latter can be carried out using quantitative DNA amplification assays. In an example of this type of test, (Figures 9F and 9G) the priming binding site of the reverse primer (Pr) is located in the downstream region of 5'e. The primer binding site of the front primer. { Ff) is located within the region flanked by the DR2 and DR1 * sequences. In the linear HBV vector the primers Pf and Pr direct the DNA synthesis in opposite directions. In this case, the primer Pr directs the DNA tapes in the upward direction (towards 5'e and the Pf primer directs the DNA synthesis in the downward direction (towards the 3'e) This priming configuration does not constitute a unit of Functional amplification in the linear copy of the viral vector that is used for transfection In contrast, the Pf and Pr primers assume an orientation towards each other in the form of rc-DNA found in the mature virions Both primers now direct the DNA synthesis towards the single copy DRl within the copy of strain plus of rc-DNA This arrangement of primers and tempering constitutes a unit of functional amplification.

Drug Test Drug testing using an indicator gene viral vector containing a non-functional reporter gene with a permuted promoter is carried out essentially as described in example 7 given above.

EXAMPLE 9 Evidence of Hepatitis Drug Resistance and Susceptibility Using Resistance Test Vectors Comprising Patient Derivative Segments and a Non-Functional Indicator Gene Containing Translational Initiation Sites and a Permuted Promoter Viral Vector of Gen Indicator The viral vectors of the reporter gene containing a non-functional reporter gene with a permuted promoter and an initiation and translation site, pCS-HBV (NF-IG) PPTIS were designated using the subgenomic viral vector HBV comprising the viral genes which are the target u objectives of antiviral drugs. The viral vectors of indicator gene pCS-HBV (NF-IG) PPTIS- (PSAS-), are based on the subgenomic viral vector pCS-HBV. The indicator gene viral vector contains a cassette of non-functional reporter gene with translational initiation and permuted promoter regions and all the cis-acting regulatory elements that are necessary for HBV DNA duplication (eg DRl, 5'e). , DR2, DRl *, 3'pA) but lacks the HBV gene sequences (for example the C, P, S and X genes) that provide the transactuating enzymatic and structural functions are necessary for the duplication of HBV DNA and virus particle formation (Figure 11B). The C, P and X genes and the patient sequence acceptor sites are contained within a pPK-CPX package vector (Example 7, Figure 8D). The S gene is contained in the packaging vector pPK-S, (Example 7, Figure 8E). In this embodiment, the viral vector of the reporter gene pCS-HBV (NF-IG) PPTIS- (PSAS-) and the packaging vector pPK-CPX constitute a vector resistance test system. The non-functional reporter gene viral vector pCS-HBV (NF-IG) PPTIS- (PSAS-), contains the following elements in a 5"to 3 'orientation: (1) the CMV IE promoter-enhancer region, (2) ) the 5 'region of the HBV genome including the DRl and 5'e (the pre-C ORF translation initiation codon is deleted), (3) an ORF reporter gene lacking a translation initiation site, (4) an enhancer-promoter region (permuted promoter) (5) the 3 'region of the HBV genome containing DR2, a functional pre-C ORF translation initiation codon, DRl *, the 3'e and the signal region 3 'HBV pA. The non-functional indicator gene cassette is composed of some or all of the following arranged elements in the 5 'to 3' orientation: (1) an ORF reporter gene that does not contain a translational initiation site in frame (2) a sequence of transcriptional polyadenylation signal (for example the HSV-1 thymidine kinase gene, SV40), (3) an enhancer-promoter region. Within the viral non-functional indicator gene vector pCS-HBV (NF-IG) PPTIS- (PSAS-) the transcriptional orientation of indicator gene expression cassette is the same as that of the HBV sequence elements. In cases where the indicator ORF gene contains an intron, the intron has a transcriptional orientation equal to the HBV sequence elements.

In a second embodiment, the non-functional reporter gene viral vector contains a non-functional reporter gene cassette containing a permuted promoter and translational initiation regions, all of the cis-acting regulatory elements that are necessary for HBV DNA duplication, and some or all of the HBV gene sequences (eg C, P, S, X genes) that provide the transacting structural and enzymatic functions that are necessary for the duplication of HBV DNA and the virus particle formation, pCS-HBV (NF-IG) PPTIS- (PSAS +) (Figure 11D). Enzymatic and structural activities that are not provided by the indicator vector, but which are necessary for the formation of virus particles and the duplication of HBV DNA, are provided using additional packaging vectors pPK-CSX (described in the Example 7, see Figure 8E). The C, S and X are contained within the packaging vector pPK-CSX (described in Example 7, see Figure 8H). In this embodiment, the non-functional indicator gene viral vector, pCS-HBV (NF-IG) PPTIS- (PSAS +) contains the following elements in a 5 'to 3' orientation (Figure 11D): (1) the promoter region -improved CMV IE, (2) the 5 'region of the HBV genome including the DRl and the 5'e (the pre-C ORF translation initiation codon is deleted), (3) an ORF indicator gene lacking a site of translation initiation, (4) the P gene containing the patient-derived segment, (5) an enhancer promoter region (permuted promoter) (6) the 3 'region of the HBV genome containing DR2, the pre-ORF translation initiation codon -C, DRl *, the 3'e and the signal region 3 'HBV pA. Within the non-functional indicator gene viral vector, the indicator gene expression cassette has a transcriptional orientation that is the same as that of the HBV sequence elements. In cases where the reporter gene contains an inverted intron, the intron has a transcriptional orientation equal to that of the HBV sequence elements.

Resistance Testing-Construction Vectors Resistance test vectors containing a non-functional reporter gene with a permuted promoter were designed using the HBV subgenomic viral vector comprising antiviral target genes as described in Example 7. The reporter gene vector or packaging vector was modified to include patient sequence acceptor sites (PSAS) for the insertion of the P gene containing the patient-derived segments (PDS) (described in Example 7, see Figures 8D and 8F). Expression of the S gene derived from the patient was eliminated as described in Example 7 (Figure 8D). S uniform gene expression was provided, in trans, using a separate packaging vector that provides well characterized S gene products (Figure 8E).

Drug Susceptibility and Resistance Test Drug susceptibility and resistance tests are carried out by the procedures described in Example 7 and 8. The non-functional reporter gene is converted to a functional reporter gene during HBV duplication (Figures 11B and 11C).

Drug Test Drug testing using an indicator gene viral vector containing a non-functional reporter gene with a permuted promoter and translation initiation regions is carried out essentially as described in examples 7 and 8 (above).

EXAMPLE 10 Hepatitis Drug Resistance and Susceptibility Test Using Resistance Test Vectors Comprising Segments Derived from the Patient and a Non-Functional Indicator Gene with Permuted Coding Regions.

Viral vector of the Indicator Gene - The viral vectors of the indicator gene containing a non-functional indicator gene with a permuted coding region were designed using HBV subgenomic viral vectors comprising viral genes which are the target or targets of the antiviral drugs. Viral vectors of reporter gene pCS-HBV (NF-IG) PCR (PSAS-), are based on the subgenomic viral vector pCS-HBV. The indicator gene viral vector contains a non-functional indicator gene cassette with a permuted coding region, and all the eos-acting regulatory elements that are necessary for DNA HBV duplication (eg DRl, 5'e DR2, DRl *, 3'pA) but lack the HBV gene sequences (eg the C, P and X genes that provide the transacting structural and enzymatic functions that are necessary for the duplication of HBV DNA and virus particle formation (Figure 12B) The C, P and X genes and the patient sequence acceptor sites are contained within a packaging vector, pPK-CPX and the S gene is provided by the packaging vector pPK-S (described in Example 7, see Figures 9D and 8E.) In this embodiment, the viral vector of the reporter gene (pCS-HBV (NF-IG) PCR (PSAS-) and the packaging vector pPK-CPX constitute a resistance vector vector system. of non-functional indicator gene pCS-HBV (NF-IG) PCR (PSAS-), co It contains the following elements in the 5 'to 3' orientation: (1) the CMV IE promoter-enhancer region, (2) the 5 'region of the HBV genome including the DRl and the 5'e (the ORF translation initiation codon). pre-C is deleted), (3) a non-functional indicator gene cassette assembled so that the promoter region and the 5 'part of the coding region are placed 3', for example downstream of the remaining 3 'part of the coding region. the coding region, (4) the 3 'region of the HBV genome containing DR2, DRl *, the 3'e and the signal region 3? BV pA (the pre-C ORF translation initiation codon is deleted). The non-functional indicator gene cassette is composed of some or all of the following elements arranged in the 5 'to 3' orientation: (1) the 3 'region of an intron terminating in a divided acceptor sequence (2) region 3 'of an indicator (reporter) ORF or a selectable ORF marker, (3) a transcriptional polyadenylation signal sequence (HSV-1 thymidine kinase gene, SV40), (4) a promoter-enhancer region, (5) the 5 'region of the gene ORF indicator (6) the 5 'region of an intron beginning in a split donor sequence. With the non-functional reporter gene viral vector, the reporter gene expression cassette has a transcriptional orientation either the same or opposite of the HBV sequence elements. In cases where the ORF reporter gene contains an intron, the intron is oriented in the same orientation with respect to the HBV sequence elements.

In a second embodiment, the non-functional reporter gene viral vector contains a non-functional indicator gene cassette containing a permuted coding region, all the cis-acting regulatory elements that are necessary for the duplication of HBV DNA, and some or all of HBV gene sequences (eg, C, P, S, X genes) that provide the transacting structural and enzymatic functions that are necessary for the duplication of HBV DNA and the particle formation of pCS-HBV (NF-IG) virus PCR (PSAS +) (figure 12D). Resistance test vectors derived from the indicator gene vector pCS-HBV (NF-IG) PCR (PSAS +) contain patient sequence acceptor sites (PSAS) and are used in conjunction with the packaging vector pPK-CSK (described in Example 7, see Figure 8H). In this embodiment, the viral vector of the reporter gene can also provide some or all of the packaging functions. In this embodiment structural and enzymatic activities that are not provided by the indicator gene viral vector, but which are necessary for the duplication of HBV DNA and virus particle formation are provided using the additional packaging vectors. In this embodiment, the non-functional reporter gene viral vector contains the following elements in a 5 'to 3' orientation: (1) the CMV enhancer promoter region IE (2) the HBV genome region immediately downstream of the codon initiation of pre-C ORF translation and the DRl and 5'e, (3) the indicator gene cassette containing a region of the HBV genome which contains some or all of the genes C, P, S and X, (4) the HBV genome region containing DR2, DRI *, 3'e, and the pA 3 'HBV signal region (the pre-C ORF start codon has been deleted). Within the non-functional reporter gene viral vector, pCS-HBV (NF-IG) PCR (PSAS +) the reporter gene expression cassette has a transcriptional orientation either the same or opposite the HBV sequence elements. In cases where the indicator gene contains an inverted intron, the intron is oriented in the same orientation with respect to the HBV sequence elements.

Resistance Test Vectors - Construction Resistance test vectors containing a nonfunctional reporter gene with a permuted coding region were designed using the HBV subgenomic viral vector comprising the antiviral target genes as described in example 7. The reporter viral vector or the vector The packaging is modified to include patient sequence acceptor sites (PSAS) for insertion of the P gene containing the patient-derived segments (PDS) (described in Example 7, see "Figures 8D and 8F). S derived from the patient is removed as described in Example 7 (see Figure 8D). S uniform gene expression is provided, in trans, using a separate packaging vector that provides highly characterized S gene products (Figure 8E) .

Evidence of Susceptibility and Drug Resistance The tests for susceptibility and drug resistance are carried out by procedures described in Examples 7 and 8. The non-functional reporter gene is converted to a functional reporter gene during HBV duplication (Figures 12B and 12C).

Drug Test Drug testing using a reporter gene viral vector containing a non-functional reporter gene with a permuted promoter and translational initiation regions was carried out essentially as described in Examples 7 and 8 (given above).

EXAMPLE 11 Hepatitis Drug Resistance and Susceptibility Test using the Resistance Test Vector Understanding the Segment or Patient Derived Segments Comprising a Resistance Test Vector and a Functional Indicator Gene Viral Vector of Gen Indicator - Construction The viral vectors of indicator gene containing the functional indicator gene were designed using the subgenomic viral vectors comprising the viral genes which are the target of the antiviral drugs. The viral gene vectors pCS-HBV (F-IG) (PSAS-) are based on the subgenomic viral vector pCS-HBV. The viral vector of indicator gene pCS-HBV (F-IG) (PSAS-) contains a cassette of functional indicator gene and all cis-acting regulatory elements that are necessary for HBV DNA duplication (eg DRl, 5'e, DR2, DRl *, 3'pA) but lacks the HBV gene sequences (eg the C, P, S and X genes) that provide the transacting structural and enzymatic functions that are necessary for virus particle formation and duplication of HBV DNA (Figure 14B). The C, P and X genes and the sequence acceptor sites are contained within a packaging vector pPK-CPX and the S gene is contained within the packaging vector, pPK-S (described below see Figures 8D and 8E). In this embodiment, the viral vector of the reporter gene pCS-HBV (F-IG) (PSAS-) and the packaging vector pPK-CPX constitute a vector resistance test system. The functional indicator gene viral vector pCS-HBV (F-IG) (PSAS-) contains the following elements in a 5 'to 3' orientation: (1) the promoter region of CMV IE enhancer, (2) region 5 'of the HBV genome including DRl and 5'e (the pre-C ORF translation initiation codon is deleted), (3) a functional indicator gene cassette, (4) the 3' region of the HBV genome containing DR2, DRl * , the 3'e and the 3 'HBV signal region pA (the pre-C ORF translation initiation codon is deleted). The reporter gene expression cassette is composed of some or all of the following elements arranged in the 5 'to 3' orientation: (1) a transcriptional enhancer-promoter region, (2) an intron, (3) an ORF reporter gene or a selectable ORF marker gene, (4) a transcriptional polyadenylation signal (eg SV40), or unidirectional (HSV-1 thymidine kinase gene) signal sequence. The reporter gene expression cassette has a transcriptional orientation equal to or opposite to the HBV sequence elements.

In a second embodiment, the indicator gene viral vector contains a functional indicator gene cassette, all the cis-acting regulatory elements that are necessary for the duplication of HBV DNA, and some or all of the HBV gene sequences (e.g. C, P, S, and X) that provide the transacting structural and enzymatic functions that are necessary for the duplication of HBV DNA and the virus particle formation of pCS-HBV (F-IG) PCR (PSAS +) (Figure 13D). Resistance test vectors derived from the indicator gene viral vector pCS-HBV (F-IG) PCR (PSAS +) contain patient sequence acceptor sites (PSAS) and are used in conjunction with the packaging vector pPK-CSK. In this embodiment, the viral vector of the reporter gene can also provide some or all of the packaging functions. Structural and enzymatic activities that are not provided by the indicator gene viral vector, but are necessary for the duplication of HBV DNA and virus particle formation are provided using the additional packaging vectors pPK-CSX (described in example 7, see figure 8H). In this embodiment, the functional indicator gene viral vector contains the following elements in a 5 'to 3' orientation: (1) the CMV IE enhancer promoter region, (2) the genome region HBV immediately downstream of the pre-C ORF translation initiation codon and the DRl and 5'e, '(3) the functional indicator gene cassette within the region of the HBV genome which contains some or all of the C genes, P, S and X, (4) the region of the HBV genome containing DR2, DRl *, the 3'e, and the signal region pA 3 'HBV. Within the indicator gene viral vector, the reporter gene expression cassette has a transcriptional orientation either the same or opposite the HBV sequence elements.

Resistance Test Vectors - Construction Resistance test vectors containing a non-functional reporter gene with a permuted promoter were designed using the subgenomic viral vector HBV comprising the antiviral target genes as described in example 7. The reporter vector viral vector or the packaging vector is modified to include patient sequence acceptor sites (PSAS) for insertion of the P gene containing the patient-derived segments (PDS) (described in Example 7, see Figures 8D and 8F). Expression of the S gene derived from the patient is eliminated as described in Example 7 (see Figure 8D). S uniform gene expression is provided, in trans, using a separate packaging vector that provides highly characterized S gene products (Figure 8E).

Evidence of Susceptibility and Drug Resistance The drug susceptibility and resistance tests are carried out with a resistance test vector based on a functional indicator gene viral vector, pCS-HBV (F-IG) (PSAS +) or with a test vector system. resistance based on a viral vector of indicator gene pCS-HBV (F-IG) (PSAS) and a vector of packaging or vectors. In the transfected packaging host cells, the indicator gene viral vector produces an RNA competent transcription (e +) containing a cassette of functional reporter gene. The vector of packaging or vectors provide in trans, structural and / or enzymatic viral functions that are not provided by the functional indicator gene viral vector, but which are necessary for viral DNA duplication and particle formation. With the co-transfection of the packaging host cells, the reporter vector viral vector and the packaging vectors are capable of forming HBV particles containing a viral vector of the "pregenome" RNA encapsulated reporter gene containing a cassette of functional reporter gene.

In this example, the indicator gene viral vector contains a cassette of functional reporter gene and therefore can produce reporter gene activity in the transfected cells in the absence of duplication of HBV DNA (Figure 13). In the case of a functional indicator gene, the inhibition of duplication of HBV DNA by drugs can be assessed by harvesting the virus particles produced in the packaging host cell and using the particles (or DNA particle) to infect (or transfect) a target host cell. Alternatively, DNA duplication can be measured directly on virus particles isolated from packaging host cells by using DNA as an indicator. A drug which inhibits HBV DNA duplication will reduce the formation of virus particles containing the "mature" rc-DNA form of the functional indicator gene viral vector. Consequently, the functional indicator gene will not be efficiently transferred to the target host cells during infection / transfection and the amount of the cccDNA reporter gene vector and the reporter gene activity in these cells will be reduced. Detection of reporter gene expression in target host cells in a two-cell assay was carried out as described in Example 7. Detection of rc-DNA in virus particles was carried out using DNA as a indicator as described in Example 8 and illustrated in Figures 9F and 9G.

Drug Test Drug testing using an indicator gene viral vector containing a non-functional reporter gene with a permuted promoter and translational initiation regions was carried out essentially as described in examples 7 and 8 (given above).

Oligonucleotides 1) 5 '-AGTGAATTAGCCCTTCCACCCGGGTCGAGCTTG3CGTAATCA-3' (42-mer) (SEc ID NO: l) 2) S '-CT3TTGGGAAGGGCGATCTCTAGATGCTAGAGATTTTCCACA-3' (42-mer) (SEQ ID NO: 2) 3) 5 '-CTCCTCCTCCAAGTCTGAsCGGCCGCCTTTAGCATCTGATGCAC-3 '(44-mer) (SEQ ID NO: 3)) 5' -CTCCTCCTCCAAGTCTGAGCGGCCGCCATATGGTGTTTTACTAA-3 '(44-mer). { SEQ ID NO: 4) 5) 5 '-G3TCTAACCAGAGAGACCCGGTTCACTAAACGAGCT-3' (36-mer). { SEC ID NO: 5.}. 6) 5 '-G ^ ATTCGCGGCCGCAATTCCGCCCCTCTCCCT-3' (32-mer) (SEQ ID NO: 6) 7) 5 '-GT7AACGCGGCCGCGATATAGTTCCTCCTTTC-3' (32-mer) (SEQ ID NO: 7) 8) 5 '-GAATTCTCGCGACCATGGAAGACGCCAAAAAC -3 '(32-mer). { SEQ ID NO: 8) s) 5 '-GTGAACAGATCGCGCGAGTTACLAATTTG ^ 3 • (36 -mer). { SBC ID NO: 9) 10) 5 '-AG? CGGGCACAC ^ CTACITAATA SAC CACrATAGGG TGAAGCACTCAAGGCAAG-3' (56 -mer). { SEC ID NO. 10) 11) 5 '-AAGAGTGACCGGAGGGAAGTTAA03GATAC ^ GTTCCGTGTCT-3' (42 -mer). { SEQ ID NO: ll) 12) 5 '-TCCAGCA TGACTAATTTGTCGACITGTTCATTTCC ^ CCLAAT- 3' (42-raer). { SEQ ID NO: 12) 13) 5 '-TAACGCCTATTCTGCTATGCCGACACCCAATTCTGAAAATGG-3' (42-mer) (SEQ ID NO: 13) 1) 5 '-AAGGATAI ^ GTTCCTTGTCGATCGGCTCCGGCTGCGGAGGGG-3' (42-mer) (SEQ ID NO: 14) 15) 5 '- C? T? AAATAGTACGTTCCCÍGATCCC? GCACTGACTAATTTAT - 3' (42-mer). { SEQ ID NO: 15) 16) 5 '- TTAGCGCCITCGGTCCTCCAATCGTTGTCAGAAGTAAGTTGG-3'. { 42-mer } (SBC ID NO: 16) 17) 5 '-GTCCCAGATAAGTGCa ^ GGATTCGTTCACTAATCGAATGGA-3' (42-mer) (SEQ ID NO: 17) 18) 5 '-GAATTCGTTAACTTCCCTCAGATCACTCTTTGG-3' (33-mer) (SEQ ID NO.lβ ) 19) 5 '- GTTAACGTCGACGTGTTCATTTCCTCCAAT - 3' (30-mer) (SEc ID NO: 19) 20) 5 * - GAATTCCGATCGACAAGGAACTGGTATCC TTAACTTCCC TCAGATCACTCTTTGG-3 '(55-mer) - (SEc ID NO: 20) 2i) S'-GTGAACGGATCCCAGCZACTGACTAATTTATCTACGTGTTC ATTTCCTCCAAT-3M52-mer) (SEc ID NO: 21) 22) 5 '-GAATTCGTTAACTTCCCTCA (G / A) ATC (A / C) CTCTTTGG-3' (33-mer pool) (SBC ID NO : 22) 23) 5'-GTTAACGTCGACTT (G / T) (T / C) TCATTTCCTCC (A / T) AT-3 '(30-mer pool) (SEQ ID NO: 23)) 5 * - GAATTCCGATCGAa ^ GGAACTGTATCCTTTAACTTCCC TCA . { G / A) ATC ÍA / C) qrcTTTGG-3 '. { 55-mer pool) (SEQ ID NO: 24) 5) 5 »-G GAACGGATCC ^ GCACTGACGAATTTATCTACTT (G / T). { T / C > TCATTTCCTCC. { A / T) AT- 3 '(52-mer pool). { SEQ ID NO: 25) 6) 5 '- ATCGCI ACC GTCCTATCTAAC-AGGCCAGGATTAA-3' (36-raer) (SEQ ID NO: 26) 7) 5 • -GA T CTCGC ^ CCACCATG < 3C? Xnta? SK-tC-3 '(35-p? Er) (SEQ ID NO: 27) 8) 5 • - GTTAA < ^ GATCTTCATGGCTCGTACTCTAT-3 '(30-ser) (SEQ ID NO: 28) 9) 5'-GAATTCG03CG ^? GCG ^ CCGCAACCCGG3AAAAGCT AAGCATGCAACCCGGGAAGAATTCAATCGCGAAA- 3' (72-mer). { SEQ ID NO: 29) 0) 5 '-GTGAACXSCGCGCTTCTCGAGTTGCGGCCGCGT ^^ AGATCI IOGGCCC rTCsCGATTGAATTCrT-3' (72-raer). { SEQ ID NO: 30) i) s * - GAATTC ?? GCTTGGCCATTGCATACGTTGT - 3 * (30-mer). { SEQ ID NO: 31) 2) 5 '-GTTAACGCATGCATAAGAAGCCAA-3' (24-uer). { SEQ ID NO: 32) 33) 5 '-GAATTCGCATGCTCCCCTGCTCCGACCCGG-3' (30-mer) (SSC ID NO: 33) 4) 5 '-GTTAACGAATTCTCCTGCGGGGAGAAGCAG-3' (30-mer) (SEQ ID NO: 34) 5) 5'-GAATTCAGATCTGCCATACCACATTTGTAG-3 '(30-mer) (SEQ ID NO: 35) ^ > 6) 5 '-GTTAACGCTAGCTCCAGACATGATAAGATA- 3' (30-mer) (SEQ ID NO: 36) 7) 5 '-GAATTCGCTAGCATCCCGCCCCTAACTCCG-3' (30-mer) (SEQ ID NO: 37) 8) 5'-GTTAACGTCGACGCAAAAGCCTAGGCCTCC-3 '(30-mer) (SEQ ID NO: 38) 9) 5' -GAATTCTCGCGAACAGTTGGCCCT-3 '(2 -mer) (SSC ID NO: 39) 0) 5 * -GTTAACAGATCTTTACGCGAACGCGAAGTC-3' (30-mer) (SEC ID NO: 40) i) 5 * -GTTAACGAATTCGTGCAAAAAGCTTTGCAAGATGGATA AAGTTTTTAGAAACTCCAGTAGGACTCC-3 '(66-mer). { SEQ ID NO: 41)) 5 '-GAATTCTCGCGATCTAGACGTTCTACC ^ TTTCTCTTCTT TTTTG AGGAGTCCTACTGGAGTTT-3' (63-mer) (SEQ ID NO: 42)) 5'-GTTAACGJ? TTCCCACCATGATTGAACAAGATGGA-5 '(35-uer). { SEQ ID NO: 43)) 5 '-GAATTCAGATCT CAGAAGAACTCGTCAAG-3' (30-mer). { SEQ ID NO: 44)) 5 '-CCCCGTGCCAAGAGTGACTACGTAAGTACCGCCTATAGA-3' (39-ae.r) (SEQ ID NO: 45)) 5 '-CTCTGCTTCTa: CCG < ^ GCTGGAGAATTaATs3CGAAA- 3 '(39-aer) (SBC ID NO: 46)) 5' -GTTAACGAATTCCCACCATGAACACGATTAACATC- 5 '(35-aer) (SEQ ID NO: 47) LIST OF SEQUENCE (1) GENERAL INFORMATION: (i) APPLICANTS: Capón, Daniel J. and Christos J.Petropoulous (ii) TITLE OF THE INVENTION: Compositions and Methods for the determination of the susceptibility and resistance to the Antiviral Drug (iii) NUMBER OF SEQUENCES : 47 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: Cooper & Dunham (B) STREET: 1185 Avenue of the Americas (C) CITY: New York (D) STATE: New York (E) COUNTRY: United States of America (F) POSTAL CODE: 10036 (v) READABLE COMPUTER FORM: ( A) MIDDLE TYPE: Soft Disk (B) COMPUTER: IBM PC Compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PROGRAM: PatentIn Relay # 1.0, Version # 1.30 (vi) CURRENT REQUEST DATA: (A) APPLICATION NUMBER: (B) SUBMISSION DATE: (C) CLASSIFICATION: (viii) ATTORNEY / AGENT INFORMATION: (A) NAME: White, John P. (B) REGISTRATION NUMBER : 28,678 (C) REFERENCE / CASE NUMBER: 50130-A-PCT / JPW / AKC (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (212) 278-0400 (B) TELEFAX: (212) 391-0526 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 1: (I) SEQUENCE CHARACTERISTICS: ( A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 1 AGTGAATTAG CCCTTCCACC CGGGTCAGC TTGGCGTAAT CA 42 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: genomic DNA - (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 2: CTGTTGGGAA GGGCGATCTC TAGATGCTAG AGATTTTCCA CA 42 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 44 base pairs (B) TYPE: Nucleic acid (C) ENCOURAGED, unique (D) TOPOLOGY: linear. { ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 3 CGCCTCCTCC AAGTCTGAGC GGCCGCCTTT AGCATCTGAT GCAC 44 (2) INFORMATION FOR SEQUENCE OF ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 44 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 4 CTCCTCCTCC AAGTCTGAGC GGCCGCCATA TGGTGTTTTA CTAA 44 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 36 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID NO: 5 GGTCTAACCA GAGAGACCCG GTTCACTAAA CGAGCT 36 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 32 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (XI) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 6: GAAGGCGCGG CCGCAATTCC GCCCTCTCC CT 32 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 7: (i) CARACT? RISCTICAS SEQUENCE: (A) LENGTH 32 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 7: GTTAACGCGG CCGCGATATA GTTCCTCCTT TC 32 (2) INFORMATION FOR ID SEQUENCE NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 32 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear íii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 8 GAATTCTCGC GACCATGGAA GACGCCAAAA AC 32 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) TOPOLOGY: linear íii) TYPE OF MOLECULE: DNA (genomic). { xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 9: GTTAACAGAT CTCTCGAGTT ACAATTTGGA CTTTCC 36 (2) INFORMATION FOR ID SEQUENCE NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 56 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) TOPOLOGY: lineal ííi) TYPE OF MOLECULE: DNA (genomic). { xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 10 AGACGGGCAC ACACTACT ATACGACTCA CTATAGGGTG AAGCACTCAA GGCAAG 56 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic). { xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 11 AAGAGTGACC TGAGGGAAGT TAACGGATAC AGTTCCTTGT CT 42 (2) INFORMATION FOR ID SEQUENCE NO: 12 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID NO: 12 TCCAGCACTG ACTAATTTGT CGACTTTGTTC ATTTCCTCCA AT 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 13 TAACGCCTAT TCTGCTATGC CGACACCCAA TTCTGAAAA GG 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 14 AAGGATACAG TTCCTTGTCG ATCGGCTCCT GCTTCTGAGG GG 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 15 CTAAAAATAG TACTTTCCGG ATCCCAGCAC TGACTAATTT AT 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 16: TTAGCTCCTT CGGTCCTCCA ATCGTTGTCA GAAGTAAGTT GG 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 17: GTCCCAGATA AGTGCCAAGG ATTCGTTCAC TAATCGAATG GA 42 (2) INFORMATION FOR SEQUENCE OF ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) ) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 18: GAATTCGTTA ACTTCCCTCA GATCACTCTT TGG 33 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID NO: 19: GTTAACGTCG ACTTGTTCAT TTCCTCCAAT 30 (2) INFORMATION FOR ID SEQUENCE NO: 20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 55 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 20: GAATTCCGAT CGACAAGGAA CTGTATCCTT TAACTTCCCT CAGATCACTC TTTGG 55 (2) INFORMATION FOR ID SEQUENCE NO: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 52 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 21: GTTAACGGAT CCCAGCACTG ACTAATTTAT CTACTTGTTC ATTTCCTCCA AT 52 (2) INFORMATION FOR ID SEQUENCE NO: 22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 22 GAATTCGTTA ACTTCCCTCA RATCMCTCTT TGG 33 (2) INFORMATION FOR SEQUENCE OF ID NO: 23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 23ACTTKYTCAT TTCCTCCWAT 30 (2) INFORMATION FOR ID SEQUENCE NO: 24 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 55 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 24: GAATTCCGAT CGACAAGGAA CTGTATCCTT TAACTTCCCT CARATCMCTC TTTGG 55 (2) INFORMATION FOR SEQUENCE OF ID NO: 25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 52 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: single (D) ) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 25: GTTAACGGAT CCCAGCACTG ACTAATTTAT CTACTTKYTC ATTTCCTCCW AT 52 (2) INFORMATION FOR ID SEQUENCE NO: 26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 36 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) DESCRIPTION OF SEQUENCE: SEQUENCE ID NO: 26: ATCTCTTACC TGTCCTATCT AACAGGCCAG GATTA 36 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) ENCODED: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 27: GAATTCTCGC GACCACCATG GCGCGTTCAA CGCTC 35 (2) INFORMATION FOR ID SEQUENCE NO: 28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) GTTAACAGAT CTTCATGGCT CGTACTCTAT 30 (2) INFORMATION FOR ID SEQUENCE NO: 29 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 72 base pairs (B) TYPE: acid nucleic (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 29: GAATTCGCGC GCAAGCGGCC GCAACCCGGG AAAAGCTTAA GCATGCAACC CGGGAAGAAT 60 TCAATCGCGA AA 72 (2) INFORMATION FOR ID SEQUENCE NO: 30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 72 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic). { xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 30: GTTAACGCGC GCTTCTCGAG TTGCGGCCGC TTGCTAGCTT AGATCTTTGG GCCCTTTCGC 60 GATTGAATTC TT '72 (2) INFORMATION FOR ID SEQUENCE NO: 31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 31: GAATTCAAGC TTGGCCATTG CATACGTTGT 30 (2) INFORMATION FOR ID SEQUENCE NO: 32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 32 GTTAACGCAT GCATAAGAAG CCAA 24 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 33 GAATTCGCAT GCTCCCCTGC TCCGACCCGG 30 (2) INFORMATION FOR ID SEQUENCE NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 34 GTTAACGAAT TCTCCTGCGG GGAGAAGCAG 30 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear '(ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 35 GAATTCAGAT CTGCCATACC ACATTTGTAG_30_(2) INFORMATION FOR ID SEQUENCE NO: 36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) COORDINATE: single (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 36:GCTCCAGACA TGATAAGATA 30 (2) INFORMATION FOR SEQUENCE OF ID NO: 37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 37: GAATTCGCTA GCATCCCGCC CCTAACTCCCG 30 (2) INFORMATION FOR ID SEQUENCE NO: 38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 38 GTTAACGTCG ACGCAAAAGC CTAGGCCTCC 30 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 39: (i) SEQUENCE CHARACTERISTICS: (A) ) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 39: GAATTCTCGC GAACAGTTGG CCCT 24 (2) INFORMATION FOR ID SEQUENCE NO: 40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 40 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 40 GTTAACAGAT CTTTACGCGA ACGCGAAGTC 30 (2) INFORMATION FOR THE SEQUENCE OF ID ^ NO: 41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 66 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 41: GTTAACGAAT TCTTGCAAAA AGCTTTGCAA GATGGATAAA GGTTTTTAGAA ACTCCAGTAG_60_GACTCC 66 (2) INFORMATION FOR ID SEQUENCE NO: 42 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 63 base pairs (B) TYPE: nucleic acid (C) CEPA: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA. { genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 42 GAATTCTCGC GATCTAGACG TTCTACCTTT CTCTTCTTTT TTGGAGGAGT CCTACTGGAG TTT 63 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 35 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 43 GTTAACGAAT TCCCACCATG ATTGAACAAG ATGGA 35 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 44 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 30 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 44 GAATTCAGAT CTTCAGAAGA ACTCGTCAAG 30 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 39 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 45: CCCCGTGCCA AGAGTGACTA CGTAAGTACC GCCTATAGA 39 (2) INFORMATION FOR THE SEQUENCE OF ID NO: 46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 39 base pairs (B) TYPE: nucleic acid (C) ENCOUNTERED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 46; CTCTGCTTCT CCCCGCAGCT GGAGAATTCA ATCGCGAA 39 (2) INFORMATION FOR ID SEQUENCE NO: 47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 35 base pairs (B) TYPE: nucleic acid (C) ENCODED: unique (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 47: GTTAACGAAT TCCCACCATG AACACGATTA ACATC 35

Claims (106)

R E I V I N D I C A C I O N S

1. A method for determining susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a patient-derived segment and an indicator gene into a host cell; (b) culturing the host cell of (a); (c) measuring the expression of the reporter gene in the target host cell; and (d) comparing the expression of the reporter gene of (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of the antiviral drug is present in steps (a) - (c); in steps (b) - (c); or in step (c).

2. The method, as claimed in clause 1, characterized in that the resistance test vector comprises DNA from a genomic viral vector.

3. The method, as claimed in clause 1, characterized in that the resistance test vector comprises DNA of a subgenomic viral vector.

4. The method, as claimed in the clause 1, characterized by the resistance test vector comprising DNA of a retrovirus.

5. The method, as claimed in clause 1, characterized in that the resistance test vector comprises HIV DNA.

6. The method, as claimed in clause 1, characterized in that the resistance test vector comprises DNA encoding vif, vpr, tat, rev, vpu, and nef.

7. The method, as claimed in clause 1, characterized in that the patient-derived segment comprises a functional viral sequence.

8. The method, as claimed in clause 1, characterized in that the patient-derived segment encodes a protein that is the target of an antiviral drug.

9. The method as claimed 1, characterized in that the patient-derived segment encodes two or more proteins that are the target of an antiviral drug.

10. The method as claimed 1, characterized in that the patient-derived segment comprises a retroviral gene.

11. The method as claimed 1, characterized in that the patient-derived segment comprises an HIV gene.

12. The method as claimed 1, characterized in that the patient-derived segment comprises a gag-pol HIV gene.

13. The method as claimed 1, characterized in that the reporter gene is a functional indicator gene and the host cell is a resistance test vector host cell, including the additional step of infecting the target host cell with vector viral particles of resistance test using filtered supernatants of said resistance test vector cells.

14. The method as claimed 1, characterized in that the reporter gene is a non-functional reporter gene.

15. The method as claimed 14, characterized in that the host cell is a packaging host cell / host cell resistance test vector.

16. The method as claimed 15, characterized in that the culture is by co-cultivation.

17. The method as claimed in claim 15, characterized in that the target host cell is infected with viral particles of resistance test vector using filtered supernatants of said host test vector cells of resistance / packaging host cell.

18. The method as claimed 1, characterized in that the reporter gene is a luciferase gene.

19. The method as claimed 1, characterized in that the reporter gene is an E. coli lacZ gene.

20. The method as claimed 15, characterized in that the host cell of resistance test / packaging host cell is a human cell.

21. The method as claimed in claim 15, characterized in that the host cell of the resistance test vector / packaging host cell is a human embryonic kidney cell.

22. The method as claimed, characterized in that the host cell of the resistance test vector / packaging host cell is a cell 293.

23. The method as claimed 1, characterized in that the target host cell is a human T cell.

24. The method as claimed 1, characterized in that the target host cell is a human T cell leukemia cell line.

25. The method as claimed 1, characterized in that the target host cell is a Jurkat cell line.

26. The method as claimed 1, characterized in that the target host cell is a cell line H9.

27. The method as claimed 1, characterized in that the target host cell is a line of CEM cells.

28. A resistance test vector comprising a segment derived from a patient and a reporter gene.

29. A resistance test vector as claimed in clause 28, characterized in that the segment derived from the patient is a gene.

30. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment is two or more genes.

31. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment comprises a retroviral gene.

32. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment comprises an HIV gene.

33. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment comprises a gag-pol HIV gene.

34. The resistance test vector as claimed in clause 28, characterized in that the reporter gene is a functional indicator gene.

35. The resistance test vector as claimed in clause 28, characterized in that the reporter gene is a non-functional reporter gene.

36. The resistance test vector as claimed in clause 28, characterized in that the reporter gene is a luciferase gene.

37. A packaging host cell transfected with a resistance test vector.

38. The packaging host cell as claimed in clause 37, characterized in that it is a mammalian host cell.

39. The packaging host cell as claimed in clause 37, characterized in that it is a human host cell.

40. The packaging host cell as claimed in clause 37, characterized in that it is a human embryonic kidney cell.

41. The packaging amphitrid cell as claimed in clause 37, characterized in that they are 293 cells.

42. The packaging host cell as claimed in clause 37, characterized in that it is a human hepatoma cell line.

43. The packaging host cell as claimed in clause 37, characterized in that it is HepG2.

44. The packaging host cell as claimed in clause 37, characterized in that it is Huh7.

45. A method for determining susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a patient-derived segment and a non-functional reporter gene into a host cell, - (b) culturing the host cell of (a); (c) measuring expression of the reporter gene in a target host cell; Y (d) comparing the expression of the reporter gene of (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of the antiviral drug is present in steps (a) - (c); in steps (b) -Ce); or in a step (c).

46. The method as claimed in clause 45, characterized in that the resistance test vector comprises DNA from a genomic viral vector.

47. The method as claimed in clause 45, characterized in that the resistance test vector comprises DNA from a subgenomic viral vector.

48. The method as claimed in clause 45, characterized by the resistance test vector comprising DNA of a retrovirus.

49. The method as claimed in clause 45, characterized in that the resistance test vector comprises HIV DNA.

50. The method as claimed in clause 45, characterized in that the resistance test vector comprises DNA encoding vif, vpr, tat, rev, vpu and nef.

51. The method as claimed in clause 45, characterized in that the patient-derived segment encodes a protein.

52. The method as claimed in clause 45, characterized in that the patient-derived segment encodes two or more proteins.

53. The method as claimed in clause 45, characterized in that the segment derived from the patient comprises a retroviral gene.

54. The method as claimed in clause 45, characterized in that the patient-derived segment comprises an HIV gene.

55. The method as claimed in clause 45, characterized in that the patient-derived segment comprises an HIV gag-pol gene.

56. The method as claimed in clause 45, characterized in that the reporter gene is a luciferase gene.

57. The method as claimed in clause 45, characterized in that the host cell is a packaging host cell.

58. The method as claimed in clause 45, characterized in that the host cell is a human cell.

59. The method as claimed in clause 45, characterized in that the packaging host cell is a human embryonic kidney cell.

60. The method as claimed in clause 45, characterized in that the packaging host cell is a cell 293.

61. The packaging host cell as claimed in clause 45, which is a human hepatoma cell line.

62. The packaging host cell as claimed in clause 45, which is HepG2.

63. The packaging host cell as claimed in clause 45, which is Huh7.

64. The method as claimed in clause 45, characterized in that the non-functional reporter gene comprises a permuted promoter.

65. The method as claimed in clause 45, characterized in that the non-functional reporter gene comprises a permuted coding region.

66. The method as claimed in clause 45, characterized in that the non-functional reporter gene comprises an inverted intron.

67. The method as claimed in clause 45, characterized in that the target cell and the host cell are the same cell.

68. The method as claimed in clause 45, characterized in that the target cell is a human cell.

69. The method as claimed in clause 45, characterized in that the target cell is a human T cell.

70. The method as claimed in clause 57, characterized in that the target host cell is infected with viral particles of resistance test vector using filtered supernatants from the packaging host cell and the host cell vector of the resistance test .

71. The method as claimed in clause 57, characterized in that said cultivation is by co-cultivation.

72. A method for determining a resistance to the antiviral drug in a patient comprising: (a) develop a standard curve of susceptibility to drugs for an antiviral drug; (b) determine the susceptibility to the antiviral drug in the patient according to the method of clause 1; Y (c) comparing the antiviral drug susceptibility in step (b) with the standard curve determined in step (a) wherein a decrease in antiviral susceptibility indicates in the development of resistance to the antiviral drug in the patient.

73. A method for determining resistance to the antiviral drug in a patient comprising: (a) develop a standard curve of a drug susceptibility to an antiviral drug; (b) determining the susceptibility to the antiviral drug in the patient according to the method as claimed in clause 45; Y (c) comparing the susceptibility to the antiviral drug in step (b) with a standard curve determined in step (a), wherein a decrease in antiviral susceptibility indicates the development of resistance to the drug in the patient.

74. A method for determining resistance to the antiviral drug in a patient comprising: (a) determining the susceptibility to the antiviral drug in the patient at first according to the method as claimed in clause 1, characterized in that the segment derived from the patient is obtained from the patient at around the same time; (b) determine the susceptibility to the antiviral drug of the same patient at a later time; Y (c) comparing the susceptibilities to the antiviral drug determined in a step (a) and (b), wherein a decrease in the susceptibility to the antiviral drug at a later time compared to the first time indicates the development or progression of resistance to the antiviral drug in the patient.

75. A method for determining resistance to the antiviral drug in a patient comprising: (a) determining the susceptibility to the antiviral drug in the patient at first according to the method as claimed in clause 45, characterized in that the segment derived from the patient is obtained from the patient at about the same time; (b) determine the susceptibility to the antiviral drug of the patient at a later time; Y (c) comparing the susceptibilities to the antiviral drug determined in steps (a) and (b), wherein a decrease in susceptibility to the antiviral drug at a later time compared to the first moment indicates the development or progression of the resistance to the antiviral drug in the patient.

76. The method as claimed in clause 1, characterized in that the resistance test vector comprises DNA from a hepadnavirus.

77. The method as claimed in clause 1, characterized in that the resistance test vector comprises HBV DNA.

78. The method as claimed in clause 1, characterized in that the resistance test vector comprises DNA encoding C, P and X.

79. The method as claimed in clause 1, characterized in that the segment derived from the patient comprises a P gene.

80. The method as claimed in clause 1, characterized in that the segment derived from the patient comprises an HBV gene.

81. The method as claimed in clause 1, characterized in that the segment derived from the patient comprises an RT gene of HBV.

82. The method as claimed in clause 1, characterized in that the segment derived from the patient comprises a DNA polymerase gene.

83. The resistance test vector as claimed in clause 28, characterized in that it comprises an indicator gene viral vector and a packaging vector, said indicator gene vector comprises a reporter gene and said packaging vector comprises a derived segment of patient.

84. The resistance test vector as claimed in clause 28, characterized in that the segment derived from the patient comprises a hepadnaviral gene.

85. The resistance test vector as claimed in clause 28, characterized in that the segment derived from the patient comprises an HBV gene.

86. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment comprises a P HBV gene.

87. The resistance test vector as claimed in clause 28, characterized in that the patient-derived segment comprises a polymerase RT / DNA gene.

88. A method for evaluating the biological effectiveness of a candidate antiviral drug compound comprising: (a) introducing a resistance test vector comprising a patient-derived segment and a reporter gene into a host cell; (b) culturing the host cell of step (a); , (c) measure the expression of the indicator gene in. a target host cell; Y (d) comparing the expression of the indicator gene of step (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the candidate antiviral drug compound; wherein a test concentration of the candidate antiviral drug compound is present in steps (a) - (c), - and steps (b) - (c), or in a step (c).

89. The method as claimed in clause 88, characterized by the resistance test vector comprising DNA of a retrovirus.

90. The method as claimed in clause 88, characterized in that the resistance test vector comprises HIV DNA.

91. The method as claimed in clause 88, characterized in that the resistance test vector comprises DNA from a hepadnavirus.

92. The method as claimed in clause 88, characterized in that the resistance test vector comprises HBV DNA.

93. The method as claimed in clause 88, characterized in that the resistance test vector comprises DNA encoding HIV gag-pol.

94. The method as claimed in clause 88, characterized in that the resistance test vector comprises protein P of HBV encoding DNA.

95. The method as claimed in clause 88, characterized in that the patient-derived segment encodes a protein.

96. The method as claimed in clause 88, characterized in that the patient-derived segment encodes two or more proteins.

97. The method as claimed in clause 88, characterized in that the patient-derived segment comprises a retroviral gene.

98. The method as claimed in clause 88, characterized in that the patient-derived segment comprises an HIV gene.

99. The method as claimed in clause 88, characterized in that the patient-derived segment comprises a hepadnaviral gene.

100. The method as claimed in clause 88, characterized in that the patient-derived segment comprises an HBV gene.

101. A method for determining susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a segment derived from a patient and an indicator inside a host cell; (b) culturing the host cell; (c) measuring the indicator in a target host cell; Y (d) comparing the measurement of the indicator of (c) with the measurement of the indicator when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of an antiviral drug is present in steps (a) - (c); in steps (b) - (c); or in step (c).

102. The method as claimed in clause 101, characterized in that the indicator comprises a DNA structure.

103. The method as claimed in clause 101, characterized in that the indicator comprises an RNA structure.

104. The method for evaluating the biological effectiveness of a candidate antiviral drug compound comprising: (a) introducing a resistance test vector comprising a segment derived from a patient and an indicator inside a host cell; (b) culturing the host cell of step (a); (c) measuring the indicator in a target host cell; Y (d) comparing the measurement of the indicator of step (c) with the measurement of the indicator measured when steps (a) - (c) are carried out in the absence of the candidate antiviral drug compound, wherein a test concentration of the candidate antiviral drug compound is present in steps (a) - (c); in steps (b) - (c); or in step (c).

105. The method as claimed in clause 104, characterized in that the indicator comprises a DNA structure.

106. The method as claimed in clause 105, characterized in that the indicator comprises an RNA structure. SUMMARY This invention provides a method for determining susceptibility to an antiviral drug comprising: (a) introducing a resistance test vector comprising a patient derived segment and a reporter gene into a host cell; (b) culturing the host cell of (a); (c) measuring expression of the reporter gene in a target host cell; and (d) comparing the expression of the reporter gene of (c) with the expression of the reporter gene measured when steps (a) - (c) are carried out in the absence of the antiviral drug, wherein a test concentration of the antiviral drug is present in steps (a) - (c); in steps (b) - (c), or step (c). This invention also provides a method for determining a resistance to the antiviral drug in a patient. This invention also provides a method for evaluating the effectiveness of a candidate antiviral drug compound. Compositions are provided including resistance test vectors comprising a segment derived from the patient and a reporter gene and the host cells transformed with resistance test vectors.