MXPA98004716A - Complementary systems of adenoviral vectors and cell lines - Google Patents

Abstract

The present invention provides adenoviral vectors deficient in multiple replication having a spacer in at least one adenoviral region deficient in replication, as well as cell lines complementary thereto. Means are also provided for constructing the adenoviral vectors with multiple deficiency in replication and methods for using same, for example, in gene therapy.

Description

COMPLEMENTARY SYSTEMS OF ADENOVIRAL VECTORS AND CELLULAR LINES TECHNICAL FIELD OF THE INVENTION The present invention relates to recombinant adenoviral vectors with multiple deficiency in replication, having a spacer in at least one of the adenoviral regions deficient in replication, and to the therapeutic use of such vectors.

BACKGROUND OF THE INVENTION During the winter-summer period from 1952 to 1953, Rowe and his colleagues from The National Institutes of Health (NIH), obtained and put into tissue cultures, adenoids that had been surgically excised from young children, in the Washington, DC area (Rowe et al., Proc. Soc. Exp. Biol. Med., 84, 570-573, 1953). After a period of several weeks, many of the cultures began to show signs of progressive degeneration, characterized by the destruction of the epithelial cells. This cytopathic effect could be transmitted in series to tissue cultures of already established human cell lines, by means of filtered culture fluids. The cytopathic agent was called "adenoid degenerating agent" u (Ad). Eventually, the name "adenovirus", P1384 / 98MX became common to designate these agents. The discovery of many prototype adenovirus strains, some of which caused respiratory ailments, was a result of these early discoveries (Rowe et al., Supra; Dingle et al., Am. Rev. Respir. Dis., 97, 1-65. , (1968), reviewed in Horwitz, "Adenoviridae and Their Replication", in Virology (fields et al., Eds., Raven Press Ltd., New York, NY, 2d de., 1990), pp. 1679-1721) . More than 40 adenoviral subtypes have been isolated from humans, and more than 50 additional subtypes have been isolated from other mammals and birds (reviewed in Ishibashi et al., "Adenoviruses of animáis", in The Adenoviruses, Ginsberg, ed., Plenum Press, New York, NY, pp. 497-562 (1984); Straus, "Adenoviruses infections in humans", in The Adenoviruses, Ginsberg, by: Plenum Press, New York, NY, pp. 451-596 (1984). All these subtypes belong to the Adenoviridae family, which is currently divided into two genera, namely, Mastadenovirus and Aviadenovirus.All adenoviruses are morphologically and structurally similar.In humans, however, adenoviruses have developed different immunological properties and, Therefore, they are divided into several serotypes, two serotypes of human adenoviruses, that is, Ad2 and Ad5, have been intensively studied.

P1384 / 98MX provided most of the information about adenoviruses in general. The complete sequence of the genomes of the Ad2 and Ad5 serotypes has been obtained and, similarly, the sequences of selected regions of the genome of other serotypes are available. The general organization of the adenoviral genome is conserved among the different serotypes, in such a way that certain specific functions are placed in similar positions. In general, adenoviruses are regular, non-encapsulated icosahedra, 65 to 80 nanometers in diameter, consisting of an outer capsid and an inner core. The capsid is composed of 20 surfaces or facets of triangular shape and 12 vertices (Horne et al., J ^ _ Mol. Biol., 1, 84-86, 1959). The facets are composed of hexamers and the vertices are composed of pentamers. A fiber is projected from each of the vertices. In addition to hexamers and fibers, there are eight minor structural polypeptides, most of which have exact, unclear positions. A minor polypeptide component, that is, polypeptide IX, binds in the positions in which it can stabilize hexamer-hexamer contacts, so it is known as the center of the "group of nine" of each facet (Furcinitti et al. ., EMBO, 8, 3563-3570, 1989). It is believed that polypeptides P1384 / 98MX minors VI and VIII stabilize hexameter-hexamer contacts between adjacent facets. As for the minor IIIA polypeptide, which is known to be in the apex regions, it has been suggested that it binds the capsid and the nucleus (Stewart et al., Cell, 67, 145-154, 1991). The viral core contains a linear molecule of DNA, double-stranded, with inverted terminal repeats (ITR), which have been observed to vary in length from 103 base pairs to 163 base pairs, in different isolates (Garon et al., Proc. Nati. Acad.

Sci. USA, 69, 2391-2394, (1972); Wolfson et al., Proc.

Nati Acad. Sci. USA, 69, 3054-3057 (1972); Arrand et al., J. Mol. Biol., 128, 577-594 (1973); Steenberg et al., Nucleic Acids Res., 2nd ed., Cold Spring Harbor, New York, Cold Spring Harbor Laboratory, pp. 943-1054, 1981). The origin of DNA replication is found in the RTIs (Garon et al., Supra, Wolfson et al., Supra, Arrand et al., Supra, Steenberg et al., Supra). Viral DNA is associated with four polypeptides, namely, V, VII, μ, and the terminal polypeptide (TP). The TP of 55 kilodaltons is bound by means of covalent binding to the 5 'ends of the DNA, by means of a dCMP (Rekosh et al., Cell, 11, 283-295, (1977); Robinson et al., Viroloqy , 56, 54-96, 1973). The other three P1384 / 98MX polypeptides are bound non-covalently to DNA, and bend it in such a way that it can adjust to the reduced volume of the capsid. DNA appears to be wrapped within a structure similar to cellular nucleosomes, as observed on the basis of nuclease digestion patterns (Corden et al., Proc. Nati, Acad. Sci. USA, 73, 401-404 (1976 ), Tate et al., Nucleic Acids Res., 6, 2769-2785 (1979), Mirza et al., Biochem Biophys. Acta, 696, 76-86, 1982). An adenovirus infects a cell by attaching the fiber to a specific receptor on the cell membrane (Londberg-Hol et al., J. Virol., 4, 323-338 (1969); Morgan et al., J. Virol., 4, 777-796 (1969; Pastan et al., "Adenoviruses entry into cells: some new observations on an eye problem", in Concepts in Viral Pathogenesis, Notkins et al., Eds., Springer-Verlag, New York, NY, pp. 141-146, 1987.) Then, the base of the pentamer binds to an integral adenoviral receptor, then the virus bound to the receptor migrates from the plasma membrane to the clathrin-coated pores, which form the endocytic vesicles, or receptosomes, where the pH drops to 5.5 (Pastan et al., Concepts in Viral Pathogenesis, Notkins and Oldstone, eds., Springer-Verlag, New York, pp. 141-146, 1987). that the decrease in pH alters the configuration of the P1384 / 98MX surface of the virus, resulting in the breakdown of the receptosome and the release of the virus into the cell cytoplasm. The viral DNA is partially discovered, that is, partially released from the associated proteins, inside the cytoplasm, while it is transported to the nucleus. When the virus reaches the nuclear pores, the viral DNA enters the nucleus, leaving behind most of the remaining proteins in the cytoplasm (Philipson et al., J. Virol., 2, 1064-1075, 1968). However, the viral DNA is not completely free of proteins, so that at least a portion of the viral DNA is associated with at least four viral polypeptides, namely V, VII, TP, and μ, and is converted into a cellular viral-histone DNA complex (Tate et al., Nucleic Acids Res., 6, 2769-2785, 1979). The cycle from the viral infection to the production of the viral particles lasts at least one or two days, and results in the production of up to 10,000 infectious particles per cell (Green et al., Virology, 13, 169 -176, 1961). The process of adenovirus infection is divided into the early (E), and late (L) stages, which are separated by viral DNA replication, although some of the events that take place during the early stage also take P1384 / 98MX instead during the late stage, and vice versa. Additional divisions have been made in order to fully describe the temporal expression of the viral genes. During the early stage, the viral mRNA, which constitutes a smaller proportion of the total RNA present in the cell, is synthesized from both strands of viral DNA present in the nucleus of the cell. At least five regions, designated as El, E2, E3, E4, and MLP-L1, are transcribed (Lewis et al., Cell, 7, 141-151 (1976)).; Sharp et al., Virology, 75, 442-456 (1976); Sharp, "Adenovirus transcription", in The Adenoviruses, Ginsberg, de., Plenum Press, New York, NY, pp. 173-204, 1984). Each region has at least one different promoter, and is processed to generate multiple mRNA species. The products of the early stage regions (E) have: (1) regulatory roles for the expression of other viral components, (2) they participate in the general interruption of cellular DNA replication and protein synthesis and (3) ) are necessary for the replication of viral DNA. The intricate series of events that regulate early mRNA transcription begins with the expression of certain immediate early regions, including ElA, Ll, and the 13.5 kilodalton gene (reviewed in Sharp, (1984), supra; Horwitz (1990), supra). ). The expression of delayed early regions ElB, E2A, P1384 / 98MX E2B, and E4, is dependent on the genetic products of ElA. Three promoters, the E2 promoter in the mapping units (mu) 72, the protein IX promoter, and the IVa promoter, are increased from the start of DNA replication, but do not depend on it (Wilson et al., Virology, 94, 175-184, 1979). Its expression characterizes an intermediate stage of the expression of the viral gene. The result of the cascade of early expression of the gene is the initiation of viral DNA replication. The start of viral DNA replication seems to be essential to enter the late stage. The late stage of the viral infection is characterized by the production of large amounts of viral structural polypeptides, as well as the non-structural proteins related to the capsid coupling. The major late promoter (MLP) becomes fully active and produces transcripts that originate in mu 16.5, and end near the end of the genome. The post-transcription processing of this long transcript gives rise to five families of late mRNA, designated respectively as Ll to L5 (Shaw et al., Cell, 22, 905-916, 1980). The mechanisms that control the change from the early stage to the late stage, and that result in a dramatic change in transcriptional use, are still not very clear. The requirement P1384 / 98MX for DNA replication may be a cis property of the DNA template, because late transcription is not carried out as a result of the presence of a superinfectious virus, at the time when the late transcription of the virus Primary infecting agent is active (Thomas et al., Cell, 22, 523-533, 1980). Certain recombinant adenoviral vectors have been used in gene therapy. The use of a recombinant adenoviral vector to transfer one or more recombinant genes, allows the directed sending of a gene or genes, to an organ, tissue or cells, that require treatment, thus overcoming the problem of sending found in most of the forms of somatic gene therapy. In addition, recombinant adenoviral vectors do not need the proliferation of host cells for the expression of adenoviral proteins (Horwitz et al., In Virology, Raven Press, New York, 2, 1679-1721, (1990); and Berkner, BioTechniques, 6, 616, 1988). Furthermore, if the diseased organ that needs treatment is the lung, the use of an adenovirus as a vector of genetic information has the additional advantage that adenoviruses are usually tropic for the respiratory epithelium (Straus, in Adenoviruses, Plenum Press, New York, pp. 451-496, 1984). Other advantages of adenoviruses as vectors P1384 / 98MX potential for gene therapy in humans, are the following: (i) recombination is rare; (ii) despite the common infection of humans with adenoviruses, associations of malignant diseases in humans with adenoviral infections are not known; (iii) currently, the adenoviral genome (which is double-stranded linear DNA), can be manipulated in order to accommodate foreign genes of varying size up to 7.0-7.5 kb in length; (iv) an adenoviral vector does not insert its DNA into the chromosome of a cell, so that its effect is permanent and unlikely to interfere with the normal functions of the cell; (v) the adenovirus can infect cells that are not in the process of dividing, or that have already finished differentiating, such as cells in the brain and lungs; and (vi) living adenoviruses, which have as an essential characteristic the ability to replicate, have been used safely as vaccines in humans (Horwitz et al., supra, Berkner et al., J. Virol., 61, 1213- 1220 (1987), Straus supra, Chanock et al., JAMA, 195, 151 (1966), Haj-Ahmad et al., J. Virol., 57, 267 (1986), and Ballay et al., EMBO, 4 , 3861, 1985). The foreign genes have been inserted in the two main regions of the adenoviral genome for use as expression vectors, that is, in the El, and E3 regions, also providing adenoviruses and deficient vectors Simple P1384 / 98MX derived from them. The insertion in the region results in obtaining a defective progeny that needs either growth within complementary cells, or the presence of an intact helper virus, either serving to replace the function of the damaged region, or absent (Berkner et al., supra; Davidson et al., J. Virol., 62, 1226-1239 (1987); and Mansour et al., Mol. Cell Biol., 6, 2684-2694, 1986). This region of the genome has been used very frequently for the expression of foreign genes. The genes inserted in the El region have been placed under the control of several promoters, and most produce large amounts of the foreign gene product, depending on the expression set. However, these adenoviral vectors will not grow in non-complementary cell lines. Currently, there are only a few cell lines that complement the essential missing functions of an adenovirus with simple deficiency. Examples of such cell lines include HEK-293 (Graham et al., Cold Spring Harbor Symp. Quant.

Biol., 39, 637-650, 1975), W126 (Weinberg et al., Proc.

Nati Acad. Sci. USA, 80, 5383-5386, 1093), and gMDBP (Klessig et al., Mol Cell Biol., 4, 1354-1362, (1984); Brough et al., Viroloqy, 190, 624-634, 1992). In comparison, the E3 region is not essential for P1384 / 98MX the growth of the virus in tissue culture (ie, for viral production), and the replacement of this region with a set of expression of a foreign gene leads to a virus that can grow productively in a non-cellular line. complementary For example, the insertion and expression of the surface antigen of hepatitis B in the E3 region has been reported with the subsequent inoculation and antibody formation in the hamster (Morin et al., Proc. Nati. Acad. Sci. USA, 84 , 4626-4630, 1987). A problem associated with the use of adenoviral vectors with simple deficiency, is that they limit the amount of useful space within the viral genome, for the insertion and expression of a foreign gene. Moreover, due to the existence of similarities or phenomena of superposition, in the viral sequences contained in the adenoviral vectors with simple deficiency and the cell lines that currently exist, the recombination events can take place and create competent viruses for replication in the strain of a vector propagated in this way. This fact can produce a useless vector strain for the purposes of gene therapy. Adenoviral vectors with multiple deficiency in replication (ie, vectors deficient in at least two of the regions necessary for P1384 / 98MX viral production), have been derived in an effort to overcome this problem (PCT patent application, WO 94/28152, Imler et al.). However, said vectors, which have at least one deletion in the E2 or E4 regions, show reduced expression of the fiber and reduced viral growth in complementary cell lines. In particular, it is suspected that the E4 region has a role in viral DNA replication, late synthesis of mRNA, disruption of host cell protein synthesis, and viral coupling. Recently, in an attempt to correct the reduced viral growth of the vectors deficient in the E4 regions, in complementary cell lines, adenoviral vectors were designed having deletions from the E4 region, and retaining the open reading frames (ORF), essential for region E4, specifically ORF 6 and ORF3 (PCT patent application, WO 94/12649, Gregory et al.). While the open reading frame 3, or 6, is capable of supplying the functions of the E4 region necessary for the in vitro propagation, the product of the ORF 3 does so with limited efficiency (Armentano et al., Human gen Therapy , 6, 1343-1353, 1995). Furthermore, several properties associated with ORFs that could function in vivo have been described (see, for example, Armentano et al.

P1384 / 98MX al., Supra). For example, the ORF6 / 7 product participates in the activation of the E2A promoter, through the formation of a complex with the cellular transcription factor E2f and the stimulation thereof. Similarly, both 0RF3 and 0RF6 participate in the regulation of inclusion / exclusion of the intron in the coupling of the leading late triple triplet. However, even the ORF 6 is not capable of generating the production of an adenoviral mutant with deletion of E4 from a viral strain in the wild state. Specifically, an adenoviral mutant with deletion of El, and E4, containing an ORF 6, showed a 10-fold reduction in fiber synthesis, delay in virus replication, and slower plaque formation in vitro, and similarly reduced and delayed viral replication in vivo, compared to an adenovirus that does not have the deletion of E4 (Armentano et al., supra). In accordance with the foregoing, it is an object of the present invention to provide adenoviral vectors with multiple deficiency in replication, which can support the insertion and expression of relatively large portions of foreign DNA, while being able to satisfactorily perform replication in vitro, that is, viral production. It is also an object of the present invention to provide recombinants of such P1384 / 98MX adenoviral vectors with multiple deficiency in replication, as well as therapeutic methods, particularly related to gene therapy, vaccination, and similar procedures, including the use of said recombinants. These and other objects and advantages of the present invention, as well as additional features of the invention, will become apparent from the following detailed description.

BRIEF SUMMARY OF THE INVENTION The present invention offers adenoviral vectors with multiple deficiency in replication, as well as complementary cell lines. Adenoviral vectors with multiple deficiency in replication have a spacer in at least one of the deficient replication adenoviral regions. These adenoviral vectors with multiple replication deficiency may allow the insertion and expression of larger foreign DNA fragments than is possible in the case of adenoviral vectors with simple deficiency for replication, and also provides fiber expression levels and of viral growth similar to those found in the case of adenoviral vectors with simple deficiency for replication. The present invention also provides recombinant adenoviral vectors with deficiency P1384 / 98MX replicates multiple, and therapeutic methods, for example, related to gene therapy, vaccination, and similar procedures, which include the use of such recombinants.

BRIEF DESCRIPTION OF THE DRAWINGS OR FIGURES Figure 1 is a set of schematic diagrams of the viral vectors AdGVCFTR.10L and AdGVCFTR.10R. Figure 2 is a schematic diagram of the viral vector AdGVCFTR.ll. Figure 3 is a schematic diagram of the viral vector AdGVCFTR.13. Figure 4 is a schematic diagram of an E2A expression vector. Figure 5 is the representation of immunoagglutination used to detect the level of DBP expression induced in certain clonal 293 / E2A cell lines. Figure 6 is the representation of immunoagglutination used to analyze the accumulation of BPD by certain clonal 293 / E2A cell lines during the first 24 hours of induction. Figure 7 is a set of schematic diagrams of the viral vectors AdGVCFTR.10L and AdGVCFTR.12B. Figure 8 is a photograph of a DNA gel P1384 / 98MX stained with ethidium bromide, and provides data referring to the detection of the viral vector AdGVCFTR.12B from the transferred vectors by means of transfection. Figure 9 is a schematic diagram of the AdGVLUC viral vector; E2GUS. Figure 10 is a schematic diagram of an E4-ORF6 expression vector. Figure 11 is a photograph of a DNA gel stained with ethidium bromide, and provides data relating to the detection of PCR of the E4 deletion region in the used ones transferred from AdGVßgal.ll. Figure 12 is a graph showing the amount of virus produced (PFU / cell, y-axis) of an E4 deletion virus that retains El function after infection of different cell lines. Figure 13 is a schematic diagram of the viral vector AdGvßgal.ll. Figures 14 AC, are schematic diagrams comparing the fiber / E4 region of the vectors in which: the E4 sequences are completely erased and the L5 fiber sequence is attached to the right-hand ITR (Figure 14A), E4 coding sequences are deleted and the L5 fiber sequence is linked to the E4 promoter and the ITR P138 / 98MX on the right side to generate an AdGv.ll vector (Figure 14B), and the E4 coding sequences are deleted and the sequences (including an SV40 polyadenylation sequence), have been added between the L5 fiber region and the right-side ITR to generate the vector AdGVCFTR.llS based on AdGV.llS (Figure 14C). Acronyms: ITR, inverted terminal repetition; Mfe I (an isoschizomer of Mun I), Pac I, Eag I, palindromic recognition sites for these enzymes; GUS, ß-glucuronidase coding sequence; SV40 polyA, polyadenylation site of simian virus 40; E4p, promoter E4. Figure 15 is the representation of the immunoagglutination of several Used 293 / ORF6 cells infected with either no vector (ie, pseudoinfection) (lane 1), with the AdGvßgal.lO vector with El deficiency (lane 2), or with AdGVßgal.ll vector with El deficiency and E4 (lane 3). Immunoaglutination was carried out using rabbit serum which recognizes all the structural proteins of the adenoviral capsid. Figure 16 is the immunoaglutination representation of the purified capsids obtained from several Used 293 / ORF6 cells infected with either the AdGVßgal.lO vector with El and E3 deficiency (lane 1), or P1384 / 98MX with AdGvßgal.ll vector with El deficiency and E4 (lane 2). Immunoaglutination was carried out using an antibody sensitized against the adenoviral fiber protein. Figure 17 is the representation of the immunoagglutination of several Used 293 / ORF6 cells infected with either vector (ie, pseudoinfection) (lane 1), with the vector AdGvßgal.lO with deficiency of El and E3 (lane 2) , with the vector AdGVßgal.ll with deficiency of El and E4 (lane 3), or with the vector AdGVCFTR.llS deficient in El, E3, and E4 based on AdGv.llS, comprising a spacer in the deletion region of E4 (lane 4) Immunoaglutination was carried out using an antibody sensitized against the adenoviral fiber protein. Figure 18 is a graph of the amount of active vector (focus-forming units, ffu), per cell, versus post-infection hours for A232 cells infected with an AdGvßgal.lO vector deficient in El and E3 based on AdGv.10 (squares solids), with the vector AdGVßgal.ll deficient in El and E4 based on AdGV.ll (open diamonds), or with the vector AdGVCFTR.llS deficient in El, E3, and E4 based on AdGV.llS, comprising a spacer in the region of the deletion of E4 (open circles).

P1384 / 98MX Figure 19 is a schematic diagram of the E2A gene as seen once substituted in the wild-type E2A protein, and the corresponding substitute regions in the adenoviral deletion vectors dl801, dl802, and dl803, and the effect of said substitution on growth behavior. Abbreviations and Acronyms: Nt, the product region of the E2A gene involved in nuclear localization and the late expression gene; Ct, the product region of the E2A gene involved in DNA replication, the ssDNA binding, and the mRNA binding; DBP, product of the E2A gene (ie, single-stranded DNA binding protein); straight line, region of the E2A coding sequence that is substituted within the framework of the deletion vectors; dentate line, region of the E2A coding sequence that is extracted from the frame in the deletion vectors as a consequence of the deletion of the E2A sequences; +++, growth behavior in the natural state; + reduced viral growth; - / +, more severely reduced viral growth as evidenced by the existence of small plates.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides, among other things, adenoviral vectors with multiple deficiency in replication, for the cloning and expression of genes. The P1384 / 98MX Adenoviral vectors with multiple deficiency in the replication of the present invention differ from the currently available replication-deficient adenoviral vectors currently available, in that they are deficient in at least two regions of the adenoviral genome, especially the two regions necessary for viral production, thus allowing said vectors to accept and express large portions of foreign DNA. The term "foreign DNA," or "passenger gene," is used in the present to refer to any DNA sequence inserted into a vector (ie, a transfer vector) of the present invention that is foreign to the genome. adenoviral Said foreign DNA may constitute genes, portions of genes, or any other DNA sequence, including, but not limited to, the sequences encoding RNA, reverse RNA, and / or polypeptides. The adenoviral vectors with multiple deficiency in the replication of the present invention also differ from the newly discovered replication-deficient adenoviral vectors in replication, in that they are able to achieve fiber expression and viral growth in a cell line complementary to other forms. similar to what happens in the case of an adenoviral vector with simple deficiency for replication, by virtue of the presence of a spacer in at least one of the P1384 / 98MX deficient adenoviral regions, which can cause a transcriptional block, thus preventing complete transcriptional reading. A region of the adenoviral genome comprises one or more genes. These genes encode the genetic products that mediate, facilitate, cause, or are the various components or activities of the adenovirus, such as fixation, penetration, loss of the envelope, replication, nuclear protein, hexamer, fiber, protein associated with a hexamer, and similar. One effect of the existence of a deficient region may be the inability of the adenovirus to propagate and which, for example, may include the participation of any of the components or activities mentioned above. The aforementioned components or activities are referred to herein as functions of the gene. The existence of a deficiency in a gene, or in a genetic function, that is, a deficient gene, a region of the gene, or a region, in the way they are used in the present, is defined as a deletion of the genetic material of the viral genome, which serves to damage or hinder the function of the gene whose DNA sequence was completely or partially erased, and to provide space in the viral genome, or to enable it, for the insertion of DNA that is foreign to the viral genome. Such deficiencies can P1384 / 98MX found in genes that are essential or non-essential for the propagation of the adenoviral vector in tissue culture in a non-complementary host cell; preferably, at least one, and more preferably, at least two of the deficient genes of the viral vectors of the present invention are deficient for a gene that is essential for viral propagation. Any subtype, mixture of viral subtypes, or any chimeric virus, can be used as a source of the DNA necessary for the generation of adenoviral vectors with multiple deficiency. However, since the Ad5 genome has been completely sequenced, the present invention is described in relation to the Ad5 serotype. It is desirable that the adenoviral vector of the present invention be multiply deficient in replication, that is, that it be deficient in at least two regions necessary for viral production (i.e. viral replication in vitro). Said regions include the early region 1 (El), the early region 2A (E2A), the early region 2B (E2B), the early region 4 (E4), the late region 1 (Ll), the late region 2 (L2) , late region 3 (L3), late region 4 (L4), and late region 5 (L5). Even though the early El region can be considered as a constituent part of the early region IA (ElA), and of the early IB region (ElB), a deficiency P1384 / 98MX in any of them, or in both, that is, in the ElA and / or ElB regions, is considered as a simple deficiency in the context of the present invention. In addition, the aforementioned vector may be deficient in one or more of the regions that are not necessary for viral production, for example, the vectors may be additionally deficient in the early region 3 (E3). It will be desirable that the adenoviral vector of the present invention be deficient in the E4 region and in one or more additional regions necessary for viral production (especially other early regions necessary for viral production), preferably, with the E4 region completely erased from the adenoviral vector, with the possible exception of the existing polyadenylation sequence between the conserved L5 fiber region and the right-side ITR. More preferably, the additional deficient region necessary for viral production will be the El region and / or the E2A region, and even more preferably, the E3 region being also removed. In addition, preferred embodiments of the adenoviral vector of the present invention include the adenoviral vectors "E2A", the ~ E2A "E4", the "E4", and E2A "E4", and which may also be E3. "More preferably , all the early regions are removed from the adenoviral vector (removing or not the late regions, preferably while conserving at least the region P1384 / 98 X of L5 fiber), with the exception, possibly, of the aforementioned E4 polyadenylation sequence between the conserved L5 fiber region and the right-side ITR. The adenoviral vector of the present invention includes a spacer to allow viral growth in a complementary cell line similar to that achieved through the use of adenoviral vectors with simple deficiency for replication, particularly an adenoviral vector with simple deficiency for replication that is deficient in The El region. In the preferred E4"adenoviral vector of the present invention, wherein the L5 fiber region is conserved, it is desirable that the spacer be located between the L5 fiber region and the right-side ITR. said adenoviral vector, the polyadenylation sequence of E4 alone, or more preferably, in combination with another sequence, exists between the L5 fiber region and the right-side ITR, in order to sufficiently separate the conserved L5 fiber region and the ITR on the right side, in such a way that the level of viral production of said vector approaches that obtained in the case of a vector adenoviral with simple deficiency for replication, particularly an adenoviral vector with simple deficiency for replication, which is deficient in El.

P1384 / 98MX In the absence of a spacer, the production of the fiber protein and / or the viral growth of the adenoviral vector with multiple deficiency in replication is reduced compared to what happens in the case of the use of a vector with simple deficiency for replication. However, the inclusion of the spacer in at least one of the deficient adenoviral regions, preferably in the E4 region, counteracts said defect in growth and fiber expression. The function of the deficient region for replication is obtained through the use of a complementary cell line. As a result, the spacer does not need to provide the poor function and can be any sequence, limited only by the size of the insert that the vector will receive. By itself, the spacer can exert its function to repair the growth defect and correct the decrease in fiber expression found in the adenoviral vectors with multiple deficiency in replication. It is desirable that the spacer may be of adequate size, ie, of at least about 15 base pairs (e.g., between about 15 base pairs and about 12,000 base pairs), preferably, of about 100 base pairs to about 10,000 base pairs, more preferably from about 500 base pairs to about 8,000 pairs of bases P1384 / 98MX bases, and even more preferably from about 1,500 base pairs to about 6,000 base pairs, and more preferably, from about 2,000 to about 3,000 base pairs. The spacer may contain any sequence, or sequences, that have the desired length. The sequence of the spacer can be coding or non-coding, and native, or non-native, with respect to the adenoviral genome, but which does not restore the replication function of the deficient region. In addition, the spacer may contain a variable expression promoter-set. More preferably, the spacer comprises an additional polyadenylation sequence and / or a passenger gene. Preferably, in the case of a spacer inserted in a region deficient for E4, both the polyadenylation sequence of E4 and the E4 promoter of the adenoviral genome, or any other promoter (cellular or viral), remain in the vector. The spacer is located between the polyadenylation site of E4 and the E4 promoter or, if the E4 promoter is not present in the vector, the spacer is proximal to the right-side ITR. The spacer can comprise any suitable polyadenylation sequence. Examples of suitable polyadenylation sequences include sequences Optimized synthetic P1384 / 98MX, BGH (Bovine Growth Hormone), polyoma virus, TK (Thymine kinase), EBV (Epstein Barr Virus), and papillomaviruses, including human papillomavirus and BPV (Bovine papillomavirus). Preferably, particularly in the case of the deficient region E4, the spacer includes a SV40 polyadenylation sequence. The SV40 polyadenylation sequence allows to obtain higher levels of virus production by adenoviral vectors with multiple replication deficiency. Although conventionally, a passenger gene is inserted into the deficient region of an adenoviral genome, a passenger gene can also function as a spacer in the deficient E4 region of the adenoviral genome. The passenger gene is limited only by the size of the fragment that can receive the vector, and it can be any suitable gene. Examples of suitable passenger genes include gene marker sequences such as pGUS, secretory alkaline phosphatase, luciferase, β-galactosidase, and human antitrypsin; the therapeutic genes of interest, such as the transmembrane regulatory gene of cystic fibrosis (CFTR); and potential immunological modifiers such as B3-19K, E3-14.7, ICP47, fas ligand gene (linkage in chains), and the CTLA4 gene.

P1384 / 98MX Preferably, an adenoviral vector with multiple replication deficiency of the present invention that is deficient in the E2A region, further comprises a portion of the E2A region of the adenoviral genome in the deficient region E2A, which is of a length less than about 230 base pairs. In general, the E2A region of the adenovirus codes for the production of DBP (DNA binding protein), a polypeptide necessary for DNA replication. DBP is composed of 473 to 529 amino acids, depending on the viral serotype. It is thought that DBP is an asymmetric protein that exists in the form of an ellipsoidal prolate consisting of a globular Ct with an extended Nt domain. Studies indicate that the Ct domain is responsible for the ability of DBP to bind nucleic acids, bind to zinc, and act during DNA synthesis at the level of elongation of the DNA strand. However, it is thought that the Nt domain acts on the late function of the gene both at the transcriptional level and at the posttranscriptional level, which is responsible for the efficient nuclear localization of the protein, and which may also play a role in increasing its own expression. Deletions in the Nt domain between amino acids 2 to 38 indicate that this region is important for the function of DBP. (Brough et al., Virology, 196, 269-281, 1993). While P1384 / 98MX Deletions in the E2A region coding for the Ct region of DBP have no effect on viral production, deletions made in the E2A region that codes for amino acids 2 to 38 of the Nt domain of BPD, affect the viral production. Therefore, it is preferable that any adenoviral vector with multiple replication deficiency contain this portion of the E2A region of the adenoviral genome. In particular, for example, the desired portion of the E2A region to be conserved is the portion of the E2A region of the adenoviral genome that is defined by the 5 'end of the E2A region, specifically, Ad5 positions are necessary ( 23816) to Ad5 (24032) of the E2A region of the adenoviral genome of serotype Ad5, to render the vector competent to replicate in a complementary cell line. This portion of the adenoviral genome must be included in the adenoviral vector, because it is not complemented in the E2A cell lines that currently exist, and in its absence, the required levels of viral production and fiber expression can not be obtained in lines complementary cell phones Any of the deleted regions can be replaced with a variable expression promoter-set, to obtain the product of a foreign gene, which is foreign to the adenovirus. For example, the P1384 / 98MX insertion of a foreign gene into the E2A region can be facilitated by the introduction of a single restriction site, such that the foreign gene product can be expressed from the E2A promoter. The present invention is not limited to adenoviral vectors that deficient in genetic functions only in the early region of the genome. Also included are adenoviral vectors that are deficient in the late region of the genome, adenoviral vectors that are deficient in the early and late regions of the genome, as well as vectors which, essentially, the entire genome has been removed, in Whose case, it is preferable that at least any of the reverse viral terminal repeats, and some of the promoters or reverse terminal repeats and a wrapping signal, are left intact. Anyone with ordinary skill in the art will appreciate how large the adenoviral genome region is that is removed as is the piece of exogenous DNA that can be inserted into the genome. For example, given that the adenoviral genome is 36 kb, leaving the viral reverse terminal repeats and some of the promoters intact, the adenovirus capacity is approximately 35 kb. Alternatively, one could generate an adenoviral vector with multiple deficiency what P1384 / 98 X contains only the ITR and a wrapping signal. This could then allow the expression of 37-38 kb of foreign DNA from this vector to be effectively carried out. Of course, the inclusion of a spacer sequence in either, or all deficient adenoviral regions will reduce the ability of the adenoviral vector to a corresponding extent with the dimensions of the spacer sequence. In general, the construction of the viral vector lies in the high level of recombination between the fragments of the adenoviral DNA in the cell. Two or three fragments of adenoviral DNA, containing regions of similarity (or superposition), between the fragments, and constituting the total length of the genome, are transfected into a cell. The recombination machinery of the host cell constructs a full-length viral vector genome by means of the recombination of the aforementioned fragments. Other suitable methods for the construction of viruses containing alterations in several individual regions have been previously described (Berkner et al., Nucleic Acids Res., 12, 925-941 (1984), Berkner et al., Nucleic Acids Res., 11 , 6003-6020 (1983), Brough et al., Virol., 190, 624-634, 1992), and can be used to construct viruses with multiple deficiency; some other procedures P1384 / 98MX include, for example, recombination and in vitro binding. The first step in the construction of a viral vector is to construct the deletion or modification (such as adding a spacer to a deleted region) of a particular region of the adenoviral genome in a plasmid set, using conventional molecular biology techniques. After a thorough analysis, this altered DNA (containing the deletion or modification) is transported into a much larger plasmid, which contains up to half of the adenoviral genome. The next step is to transfect the plasmid DNA (containing the deletion or modification), and a large portion of the adenoviral genome in a recipient cell. Together, these two pieces of DNA encompass the entirety of the adenoviral genome plus a region of similarity. Within this region of similarity, a recombination event will take place to generate a recombined viral genome that includes the deletion or modification. In the case of adenoviral vectors with multiple deficiency in replication, the recipient cell will provide not only the recombination functions, but also all the missing viral functions not contained in the transfected viral genome, complementing further any deficiency of the recombined viral genome. The vector P1384 / 98MX adenoviral with multiple deficiency in replication can be modified later, for example, by means of the alteration of the ITR and / or the envelope signal, in such a way that the adenoviral vector with multiple deficiency in the replication only works or grow in a complementary cell line. In addition, the present invention also provides complementary cell lines for the propagation or growth of the multiple deficient adenoviral vectors of the present invention. The preferred cell lines of the present invention are characterized in that they complement at least one genetic function of the genetic functions comprising the El, E2, E3, and E4 regions of the adenoviral genome. Other examples of cell lines include those that complement adenoviral vectors that are deficient in at least one of the genetic functions that comprise the late regions, those that complement the combination of early and late genetic functions, and those that complement all adenoviral functions . A person with conventional experience in the art will appreciate that the cell line of choice is one that specifically complements those missing functions of the recombinant adenoviral vector with multiple deficiency of interest, and that are generated through the use of techniques P1384 / 98MX of conventional molecular biology. The cell lines are also characterized because they contain the complementary genes in a non-overlapping disposition form, which minimizes, practically eliminating, the possibility that the genome of the vector is recombined with the cellular DNA. In accordance with the foregoing, replication competent adenoviruses are removed from vector strains, which, therefore, are suitable for certain therapeutic purposes, especially for the purposes of gene therapy. This also eliminates the replication of adenoviruses in non-complementary cells. The complementary cell line should be one that is capable of expressing the products of two or more functions of the deficient adenoviral gene at an appropriate level for such products, in order to generate a high titer of the recombinant adenoviral vector strain. For example, it is necessary to express the E2A product, DBP, at stoichiometric levels, that is, at relatively high levels, for the replication of the adenoviral DNA, but the E2B product, Ad pol, is only necessary at catalytic levels, ie , at relatively low levels, for the replication of adenoviral DNA. Not only should the level of the product be appropriate, the temporary expression of the product should be consistent with that observed during the P1384 / 98MX normal viral infection of a cell, to ensure a high titre of the recombinant adenoviral vector strain. For example, the components necessary for the replication of viral DNA must be expressed before those necessary for the coupling of virions. In order to avoid cellular toxicity, which often accompanies the presence of high levels of expression of the viral products, as well as to regulate the temporary expression of the products, inducible promoter systems are used. For example, the inducible sheep metallothionine promoter system can be used to express the entire E4 region, the open reading frame 6 of the E4 region, and the E2A region. Other examples of suitable inducible promoter systems include, but are not limited to, the lac bacterial operon, the tetracycline operon, the T7 polymerase system, and combinations of chimeric constructs of prokaryotic and eukaryotic transcription factors, repressors, and others. components. In cases where the viral product to be expressed is highly toxic, the use of a bipartite inducible system is desirable, wherein the inducer is transported in a viral vector and the induced product is transported within the chromatin of the cells. cells the complementary cell line. Repressible / inducible expression systems, such as P1384 / 98MX as the tetracycline expression system and the lac expression system. The DNA that enters a small proportion of the transfected cells can be kept in stable condition in an even smaller fraction. The isolation of a cell line that expresses one or more transfected genes is achieved through the introduction of a second gene (marker gene), within the same cell, which, for example, confers resistance to an antibiotic, drug, or another compound. This selection is based on the fact that, in the presence of the antibiotic, drug or other compound, the cell that does not have the transferred gene dies, while the cell containing the transferred gene survives. Subsequently, the surviving cells are isolated by means of cloning, and expanded as individual cell lines. Within these cell lines, there are those that express both the marker gene and the gene, or genes, of interest. The propagation of the cells depends on the progenitor cell line and the selection method. The transfection of the cell also depends on the cell type. The most common techniques used for transfection are calcium phosphate precipitation, liposomes, or DNA transfer mediated by dextran DEAE. Many modifications and variations of the P1384 / 98MX illustrative DNA and plasmid sequences of the present invention are possible. For example, the degeneracy of the genetic code allows the substitution of nucleotides along entire polypeptide coding regions, as well as in the translation stop signal, without any alteration of the encoding sequence of the encoded polypeptide. The above-mentioned substitutable sequences can be deduced from a known amino acid, or from the DNA sequence of a given gene, and can be constructed by the use of conventional synthetic methods, or site-specific mutagenesis methods. Methods for DNA synthesis can be carried out in substantial accordance with the procedures of Itakura et al., Science, 198, 1056 (1977), and Crea et al., Proc. Nati Acad. Sci. USA, 75, 5765 (1978). Site-specific mutagenesis procedures are described in Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (2nd ed., 1989). Based on the foregoing, the present invention is not limited in any way to the DNA sequences and plasmids specifically exemplified herein. The exemplified vectors are for gene therapy of cystic fibrosis and, therefore, contain and express the transmembrane regulatory gene of cystic fibrosis (CFTR), P1384 / 98MX however, the vectors described are easily converted for the treatment of other diseases, including, but not limited to, other chronic lung diseases, such as emphysema, asthma, respiratory distress syndrome in adults, and chronic bronchitis, as well as cancer, coronary heart disease, and other conditions that can be adequately treated or prevented through gene therapy, vaccination, and similar procedures. In accordance with the foregoing, any gene or DNA sequence can be inserted into an adenoviral vector with multiple deficiency. By choosing a gene, or a DNA sequence, a therapeutic and / or prophylactic effect is achieved, for example, in the context of gene therapy, vaccination, and similar procedures. a person skilled in the art will appreciate that suitable methods for administering an adenoviral vector with multiple deficiency of the present invention to an animal, for therapeutic or prophylactic purposes, eg, gene therapy, vaccination, and similar procedures (See, for example, Rosenfeld et al., Science, 252, 431-434 (1991), Jaffe et al., Clin. Res., 39 (2), 302A (1991), Jaffe et al., Clin. Res. ., 39 (2), 311A, (1991), Berkner, BioTechniques, 6, 616-619, 1988), are available and, although P1384 / 98MX use more than one route for the administration of the vector, a particular route can provide a more immediate and effective reaction than another route. The pharmacologically acceptable excipients are also well known to those skilled in the art, and may be readily available. The choice of excipient will be determined in part by the particular method used to administer the composition. According to the above, there is a wide variety of suitable formulations of the pharmaceutical composition of the present invention. The following formulations and methods are mere examples, and in no way represent a limitation. However, oral, injected and aerosol formulations are preferred. Formulations suitable for oral administration may consist of (a) liquid solutions, such as an effective amount of the compound dissolved in diluents such as water, saline, or orange juice; (b) capsules, tablets, or tablets, each containing a predetermined amount of the active ingredient, in the form of solid particles or granules; (c) suspensions in appropriate liquids; and (d) suitable emulsions. The presentation in tablet form may include one or more of the following excipients: lactose, mannitol, corn starch, potato starch, P1384 / 98MX microcrystalline cellulose, acacia (gum arabic), gelatin, colloidal silicon dioxide, croscarmellose sodium, talcum, magnesium stearate, stearic acid, and other excipients, colorants, diluents, buffers, wetting agents, preservatives, flavoring agents, and pharmacologically compatible excipients. The formulations in the form of tablets or tablets may include the active ingredient in a flavor, generally sucrose and acacia or tragacanth gum, as well as tablets comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acacia, emulsions. , gels, and similar substances containing, in addition to the active ingredient, excipients of the type known in the art. The vectors of the present invention, by themselves or in combination with other suitable components, can be integrated into aerosol solutions to be administered by inhalation. These aerosol formulations can be integrated into acceptable pressurized impellents, such as dichlorodifluoromethane, propane, nitrogen, and the like. They can also be formulated as pharmaceutical compositions for non-pressurized preparations, such as those used in a nebulizer or an atomizer. The formulations suitable for P1384 / 98MX parenteral administration include sterile, aqueous and non-aqueous isotonic injection solutions, which may contain antioxidants, buffers, bacteriostats, and solutes that render the solution isotonic in the blood of the tentative recipient, and suspensions aqueous and non-aqueous sterile which may include suspending agents, solubilizers, viscosity imparting agents, stabilizers, and preservatives. The formulations can be presented in sealed single-dose or multi-dose containers, such as ampoules and flasks, and can be stored under freeze drying (freeze-dried) conditions, requiring only the addition of a sterile liquid excipient, for example, water, for injections, immediately before use. Extemporaneous injection and suspension solutions can be prepared from sterile powders, granules, and tablets of the type previously described. In addition, the vectors used in the present invention can be integrated into suppositories, by mixing them with a variety of bases, such as emulsifying bases, or water-soluble bases. Formulations suitable for vaginal administration may be presented in the form of pessaries, tampons, creams, gels, pastes, foams, or P1384 / 98MX containing aerosol formulas, in addition to the active ingredient, appropriate vehicles of the types already known in the art. In the context of the present invention, the dose administered to an animal, particularly a human being, will vary according to the gene, or other sequence of interest, the composition used, the method of administration, and the particular organism site. who is being treated. The dose should be sufficient to generate a desirable response, for example, a therapeutic or prophylactic response, within a desirable period of time. The adenoviral vectors with multiple deficiency and the complementary cells of the present invention also have in vitro utility. For example, they can be used to study adenoviral function and coupling, or the expression of foreign DNA in a suitable target cell. One of ordinary skill in the art can identify a suitable target cell by selecting one that can be transfected by the adenoviral vector of the present invention and / or infected by adenoviral particles, resulting in the expression of the inserted adenoviral DNA complement. by these means. Preferably, a suitable target cell is selected by having receptors for attachment and penetration of the adenovirus to the P1384 / 98MX inside the cell. Such cells include, but are not limited to, those cells originally isolated from a mammal. Once the suitable target cell has been selected, the target cell is contacted with a foreign DNA containing a recombinant adenoviral vector with multiple deficiency, or a viral particle of the present invention, in order to effect transfection or infection, respectively . The levels of expression, toxicity, and other parameters relating to the insertion and activity of the foreign DNA within the target cell, are measured using conventional methods well known in the art. By doing so, researchers can learn and elucidate the phenomenology concerning adenoviral infection, as well as the efficacy and effect of the expression of several foreign DNA sequences introduced through the vector of the invention into several cell types that are explanted from various organisms, and studied in tissue cultures. Moreover, cells explanted or removed from a patient having a disease that is adequately treated by means of gene therapy, in the context of the present invention, are usefully manipulated in vitro. For example, the cells of said individuals that are cultured in vitro are contacted with an adenoviral vector of the present invention, under P1384 / 98MX suitable conditions for carrying out transfection, which are easily determined by a person with conventional experience in the art, wherein the vector includes suitable foreign DNA. Such contact results in the transfection of the vector into the cultured cells, where the transfected cells are selected for the use of a suitable marker and selective culture conditions. By doing so, that is, using conventional methods to test the vitality of the cells and also measure the toxicity and detect the presence of genetic products of the gene or foreign genes of the vector of interest and also measure the expression, the cells of the subject are tested to determine their compatibility with the vector of interest that contains a foreign gene, its expression in said vector and its toxicity, thus providing information regarding the property and efficacy of the treatment of the subject with the vector / foreign DNA system tested in the manner described above. In addition to serving to test the potential efficacy / toxicity of a given gene therapy regimen, the explanted cells and the aforementioned transfected cells can also be returned to an in vivo position within the body of the subject. The cells thus returned to the subject can be returned without any alteration or modification, to P1384 / 98MX except for the in vitro transfection thereof, or they can be encapsulated by means of, or embedded in, a matrix that keeps them separate from other tissues and cells of the subject's organism. Said matrix may be of any suitable biocompatible material, including collagen, cellulose, and similar materials. Of course, alternatively, or additionally, once a positive response to the in vitro test has been observed, the transfection can be implemented in situ, using the means described above. The following examples also illustrate the present invention and, of course, in no way should be considered as limiting the scope thereof. Enzymes referenced in the examples are available, unless otherwise indicated, at Bethesda Research Laboratories (BRL), Gaithersburg, MD 20877, New England Biolabs inc, (NEB), Beverly, MA 01915, or Boehringer Manheinm Biochemicals (BMB), 7941 Castleway Drive, Indianapolis, IN 46250, and are used in substantial accordance with the manufacturer's recommendations. Many of the techniques used in the present invention are well known to those skilled in the art. Molecular biology techniques are described in detail in the appropriate laboratory manuals, such as Maniatis et al., P1384 / 98MX Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, NY (2nd ed., 1989), and Current Protocols in Molecular Biology (Ausubel et al., Eds., 1987). One of ordinary skill in the art will recognize that alternative methods may be used to replace the procedures described below. Although the examples and figures refer to AdGv.10, AdGV.ll, AdGv.llS, AdGv.12, and AdGV.13, which contain, for example, a marker gene, or a therapeutic gene, such as the gene Transmembrane cystic fibrosis regulator (CFTR), to understand, for example, AdGV. CFTR.10, AdGv.CFTR.il, AdGv.GUS.llS, AdGV.CFTR.12, and AdGV.CFTR.13, these vectors are not limited to the expression of the CFTR gene, and can be used to express other genes and DNA sequences. Therefore, and for example, the present invention groups the vectors comprising any suitable DNA sequence, which may be by means of a foreign gene, a fragment thereof, or any other DNA sequence. Said suitable DNA sequence can find use in gene therapy for the treatment of diseases that are adequately treated by means of gene therapy. Alternatively, a suitable DNA sequence may also have a prophylactic use, such as when the DNA sequence is capable of being expressed in a mammal, resulting, for example, in the production of a P1384 / 98MX polypeptide capable of producing an immune response to the polypeptide, as is the case with its use in vaccination. Another alternative use of a suitable DNA sequence capable of being expressed in a mammal is that of providing any other suitable therapeutic and / or prophylactic agent, such as a reverse molecule, particularly a reverse molecule selected from a group consisting of mRNA and synthetic oligonucleotide.

Example 1 This example describes the generation of a modality that includes the participation of AdGv.10, that is, AdGV.CFTR.10, which is deficient in the El and E3 regions.

The vector AdGV.CFTR.10 expresses the CFTR gene from the cytomegalovirus early promoter (CMV). Two generations of this vector have been built, and the vectors AdGV.CFTR.10L, and AdGV have been designed. CFTR.10R, depending on the direction in which the CFTR expression set is placed in the El region, relative to the vector genome, as shown in Figure 1, which is a set of schematic diagrams of AdGv .CFTR.10L and AdGV. CFTR.10R. The CFTR expression set was constructed in the following manner. The vector pRK5 (Genetech Inc., P1384 / 98MX South San Francisco, CA), was digested with Kpn I (New England Biolabs (NEB), Beverly, MA), blunted with Mung Bean nuclease (NEB), and an Xho I binding medium (NEB) was ligated into place of the Kpn I site. The resulting vector was called pRK5-Xho I. Subsequently, the vector pRK5-Xho I was digested with Sma I (NEB) and Hin dlll (NEB) and blunted with Mung Bean nuclease. A plasmid containing the CFTR gene, pBQ4.7 (Dr. Lap-Chee Tsui, Hospital for Sick Children, Toronto, Canada), was digested with Ava I (NEB) and Sac I (NEB), and blunted with Mung Bean nuclease. These two fragments were isolated and ligated to produce pRK5-CFTR1, the expression set of CFTR. The vector pRK5-CFTR1 was digested with Spe I (NEB) and Xho I, and blunted with Klenow (NEB). Vector pAd60.454 (Dr. L. E. Babiss, The Rockefeller University, New York, NY), which contains Ad5 sequences of 1-454 / 3325-5788, was digested with Bgl II (NEB), and blunted with Klenow. These two fragments were purified from vector sequences by means of the low melting agarose technique (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (2nd ed., 1989 ), and joined to produce the plasmids of the left arm pGVCFTR.IOL and pGVCFTR.lOR The plasmid of the left arm derived from P1384 / 98MX pGVCFTR.IOL, or pGVCFTR.lOR, was digested with Nhe I (NEB). The left arm of the viruses was produced by digestion of Ad5dl324 (Dr. Thomas E. Shenk, Princeton University, Princeton, NJ), with Cía I (NEB). The two fragments, a small fragment of 918 bp, and a large fragment of approximately 32,800 bp, were separated by centrifugation of the sucrose gradient (Maniatis et al., Supra). The large fragment was mixed with the fragments of the plasmid of the left arm, and transfected into the cells of line 293, by means of the conventional calcium phosphate protocol (Graham et al., Virology, 52, 456, 1973). The resulting recombinant viruses were plaque purified on the 293 line cells, and the viral strains were established using conventional virological techniques (for example, de Berkner et al., (1983), and (1984), supra).

Example 2 This example describes the generation of an AdGv.ll mode, ie AdGv.CFTR.11, which is deficient in the El, E3, and E4 regions.

The vector AdGv.ll is characterized by the complete elimination of the E4 region. This large deletion allows the insertion of exogenous DNA up to 10 kb. Plus P1384 / 98MX important still is the fact that another region of the genome is accessible for the introduction of sets of foreign DNA expression, using the AdGV vectors. CFTR.11. this deletion allows the incorporation of larger expression sets for other products. For example, soluble receptors, ie, TNF or IL-6 without a transmembrane domain, so that they are not bound to the membrane, and reverse molecules, for example, those directed against the cell cycle regulatory products, such such as cdc2, cdk kinases, cyclins, ie, cyclin E, or cyclin D, and transcription factors, i.e., E2F, or s-myc, to eliminate inflammatory and immune responses. The vector AdGv.CFTR.ll was constructed by means of simple recombination in vivo between 1-27082, that is, the left arm of AdGv.CFTR.10, and a plasmid (pGVHA, pGVHB, pGCHC, or pGVllD, described in detail below), containing 21562-35935, ie, the right arm of Ad5 aligned with Bam Hl (NEB) and Sal I (NEB), within which the various modifications of E3 and E4 were introduced, as described below . The left arm of AdGVCFTR.10 was isolated in a concave sucrose gradient of 10-40%, where% of the total solution was 40%, after the intact AdGv.CFTR.10 was digested with Spe I (NEB) and Srf I (Stratagene, P1384 / 98MX La Jolla, CA), to produce the 1-270820 bp fragment. The right arm was obtained by digestion of Bam Hl-Sal I on a modified pGEM vector (pGBS). The vector pGBS was generated in the following manner. The pGeml vector (Promega, Madison, Wl), was digested with Eco Rl, and blunted with Klenow, and a Sal I binding agent was ligated into the vector. The resulting DNA was subsequently digested with Sal I, and religated, thus replacing the Eco Rl site with a Sal I site, and deleting the existing sequence between the two Sal I sites, to generate the vector pGEMH / P / S, which was digested with Hin dlll, and blunted with Klenow, and a binding agent Bam Hl was ligated into the vector to generate the vector pGEMS / B. The vector pGEMS / B was digested with BAM Hl and Sal I, and ligated with a BAM Hl-Sal I fragment of "14 kb (21562-35935 of Ad5), from a pBR plasmid called p50-100 (Dr. Paul Freimuth, Columbia University, NY), to generate the vector pGBS.The vector pGBS? E3 is altered to produce a right arm plasmid in which the entire E4 region is deleted.The resulting plasmid, in which regions E3 and E4 are completely erased, it is called pGVll (O), which is done through the introduction of a Pac I restriction site in the Afl III site in 32811 and the Bs I site in 35640.

P1384 / 98MX deletion of the Pac I fragment existing between these two sites, effectively eliminates all of the E4 sequences, including the E4 TATA element within the E4 promoter and the E4 polyA site. Three different versions of the right arm plasmid were constructed in order to introduce them into the two Ad E3 gene products of the adenoviral vector that have anti-inflammatory and anti-inflammatory properties. The major deletion of E3 in pGBS? E30RF6, designated pGVll (O) (Example 7), was essentially replaced with three different versions of an expression set containing the long terminal repeat promoter of Rous sarcoma virus (RSV-). LTR), directing the expression of a bicistronic mRNA containing the anti-immune gene product Ad2 E3 19 kDa at the 5 'end, and the product of the anti-inflammatory gene Ad5 E3 14.7 kDa at the 3' end. An additional virus was constructed by deletion of the 19 kDa cDNA fragment by deletion of the Bst Bl fragment (NEB). This AdGVCFTR.11 (D) designed virus contains the RSV-LTR promoter directing the expression of a monocistronic mRNA containing only the product of the anti-inflammatory gene E3 14.7 kDa. The Spe I fragment (27082) - Nde I (31089) from pGBS? E3 (Example 4) was subcloned in PUC 19 by means of the first cloning of the Eco Rl fragment.

P1384 / 98MX (27331) - Nde I (31089), in identical sites of the PUC 19 polylinker. Subsequently, a Hin dlll fragment (26328) - Eco Rl (27331), generated from the pGBS vector, was cloned in the Eco site Rl of this clone, to generate pHN? E3. Using the appropriate primers, a PCR fragment with Xba I side sites was generated containing the RSV-LTR promoter, the Ad2 E3 19 kDa gene product, and the Ad5 E3 14.7 kDa gene product. The amplified fragment was digested with Xba I, and subcloned into pUC 19 to generate pXA. After analysis of the Xba I fragment, the fragment was ligated into pNH? E3 to generate pHNRA. Using the appropriate primers, two PCR fragments with lateral Bst Bl sites were generated to encode internal ribosomal entry sites (IRES), which are known to enhance the translation of the mRNAs that contain them (Jobling et al., Nature, 325 , 622-625 (1987); Jang et al., Genes and Development, 4, 1560-1572, 1990). One fragment (version B) contains a 34 bp IRES of an untranslated indicator of the envelope protein mRNA of the alfalfa mosaic virus (indicator AMV RNA 4) (Jobling et al., Supra): The other fragment (version C), contains an IRES of 570 bp from the 5 'untranslated region of the encephalomyocarditis virus (EMCV) mRNA (Jang et al., Supra). Each Bst Bl fragment of version B or version C was cloned in place of the Bst Bl fragment.

P1384 / 98MX in pXA. The resulting plasmids, called pXB, and pXC, respectively, were transported to pNH? E3 to generate pHNRB and pHNRC, respectively, after analysis of the sequence of the Xba I fragments. The Spe I fragment (27082) - Nde I (31089 ) of pGBS? E30RF6 was replaced with the Spe I - Nde I fragments of pHNRA, pHNRB, pHNRC, and pHNRD, to generate pGVll, pGVHB, pGVHC, and pGVHD, respectively. The plasmid pGVx DNA was aligned with Bam Hl and Sal I, and mixed with the purified left arm DNA fragment, in varying concentrations to give approximately 20 μg of total DNA, using salmon sperm or bovine thymus DNA (Life Technologies, Gaithersburg, MA), to provide an amount of DNA of about 20 μg, as needed. Subsequently, the mixed fragments were transfected into cells of line 293 using conventional calcium phosphate techniques (Graham et al., Supra). Either the 293 / E4 cell line, or the 293 / ORF6 cell line can be used. Five days after transfection, the cell monolayer was harvested by performing the freeze-thaw method three times. The resulting hybrid virus was titrated on the cells of line 293, and the isolated plates were harvested. The plate isolation process was repeated twice more for P1384 / 98MX ensure that only one recombinant virus existed in the initial plaque strain. The isolated strain in the plate was amplified to a larger viral strain according to the conventional virological techniques described in Burlseson et al., Virology: A Laboratory Manual, Academic Press Inc., (1992). Since the E4 region contains essential genetic products necessary for viral growth, the mutant virus resulting from the deletion of E4 can not grow in the absence of E4 expressed exogenously. Therefore, all manipulations performed for viral construction are carried out in the new cell line 293 / E4, or in the cell line 293 / ORF6 (described in example 6). The resulting virus is AdGVCFTR.ll, which is represented schematically in Figure 2, together with AdGVCFTR.10L, to make the comparison.

Example 3 This example describes the generation of an AdGv.13 modality, ie AdGVCFTR.13, which is deficient in the El, E2A, E3, and E4 regions.

The vector AdGV.13 is characterized not only by the total elimination of El and E4 (as in AdGv.ll), but also by the complete elimination of E2A. The region P1384 / 98MX complete coding of E2A is eliminated by means of the DNA binding of two E2A mutant viruses, ie H5in800 and H5in804, containing insertions of Cia I restriction sites at both ends of the open reading frame (Vos et al. ., Virology, 172, 634-342 (1989), Brough et al., Virology, 190, 624-634, 1992). The Cia I site of H5in800 is located between codons 2 and 3 of the gene, and the Cia I site of H5in804, is located within the E2A gene termination codon. The resulting virus contains an open reading frame consisting of 23 amino acids that have no similarities to the E2A reading frame. More important is the fact that this set offers another region of the virus genome in which a single gene can be introduced. This can be done by inserting the gene of interest into the appropriate reading frame of the existing mini-ORF, or by introducing another expression set containing its own promoter sequences, polyadenylation signals, and termination sequences, in addition to the interest. Adenovirus DNA is prepared from H5in800 and H5in804. After digestion with the restriction enzyme Hin dlll (NEB), the Hin dlll A fragments of both H5in800 and H5in804 are cloned into pKS + (Stratagene). The resulting plasmids are called pKS + H5in800 Hin dlIIA and pKS + H5in804 Hin dlIIA, P1384 / 98MX respectively. Subsequently, the Cia I fragment (NEB) of pKS + H5in800 Hin dlIIA is isolated and cloned in place of the identical Cia I fragment of pKS + H5in804 Hin dlIIA. This chimeric plasmid, pHin dIIIA_E2A, effectively removes the entire E2A reading frame, as described above. At this point, the E2A deletion is transported to the restriction sites Bam Hl (NEB) and Spe I (NEB), to replace the wild-type sequences present in pGV12 (0) to construct pGV13 (0). The AdGVCFTR.13 virus (see Figure 3) is constructed in the manner described above through the use of the left arm DNA of AdGVCFTR.10, and the DNA of the right arm plasmid of pGV13 (0). However, the recipient cell line for this virus construct is the triple complementary cell line 293 / E4 / E2A. Figure 3 is a schematic diagram of the viral vector AdGVCFTR.13. The diagram is aligned with that of AdGVCFTR.10L, for comparison purposes.

Example 4 This example describes the generation of pGBS? E3. This plasmid was generated to remove most of the E3 region of pGBS, including the E3 promoter and the existing E3 genes, to make room for other constructs and facilitate the introduction of E3 expression sets.

P1384 / 98MX This plasmid contains a deletion of 28331 to 30469. One PCR fragment was generated with Ad5s (27324) and A5a (28330) X as primers and pGBS as a template. The resulting fragment was digested with Eco RI (27331) and Xba I (28330), and gel purified. Subsequently, this fragment was introduced into pGBS in the Eco Rl sites (27331) and Xbs I (30470).

Example 5 This example describes the generation of pGBS? E3? E4. A large deletion of the Ad5 E4 region was introduced into pGBS? E3 to facilitate the displacement of additional exogenous sequences within the viral genome. The coding sequence 32830-35556 E4 was deleted. A Pac I site was generated in place of the Mun I site at 32830 by treating the digested DNA of pGBS Mun I with Klenow, to blunt the fragment, and by linking a Pac I binding agent thereto. Subsequently, the modified DNA was digested with Nde I and the resulting fragment of 1736 bp (Nde I 31089 - Pac I 32830), was gel purified. A PCR fragment was prepared using A5 (35564) P (IDT, Coralville, IA), and T7 primers (IDT, Coralville, IA), and pGBS as a template. The resulting fragment was digested with Pac I and P1384 / 98MX Sal I to generate Pac I 35556 - Sal I 35935. A Sma I site within the polylinker region of pUC 19 was modified to a Pac I site by binding to a Pac I binding agent. The Pac fragment I 35556 - Sal I 35935 was displaced into the modified vector pUC 19 at sites Pac I and Sal I, respectively, in the polylinker region. The modified fragment Nde I 31089 - Pac I 32830 was displaced into the plasmid pUC 19, within which the fragment Pac I 35556 - Sal I 35935 had already been inserted, at the Nde I and Pac I sites, respectively. The Nde I 31089-Sal I 35935 fragment of plasmid pUC 19 was purified by means of the gel purification process, and cloned in place of the respective Nde I and Sal I sites in pGBS? E3, to produce pGBS? E3? E4.

Example 6 This example describes the generation of the cell line 293 / E4. The vector pSMT / E4 was generated in the following manner. A Mun I fragment (site 32825 of Ad2) - Sph I (polylinker site), was isolated from pE4 (89-99), which is a pUC 19 plasmid in which the region 32264-35577 of Ad2, blunted with Klenow, and treated with phosphatase (NEB) was subcloned. The Mun I fragment of 2752 bp - Sph I P1384 / 98MX was then ligated into pMT010 / A + (McNeall et al., Gene, 76, 81-89, 1989), which had been aligned with Bam Hl, blunted with Klenow, and treated with phosphatase, to generate the plasmid of the expression set, pSMT / E4. The 293 cell line (ATCC CRL 1573; American Type Culture Collection, Rockville, MD), was cultured in Dulbecco's modified Eagle medium with 10% fetal bovine serum (Life Technologies, Gaithersburg, MA). 293 cells were transfected with pSMT / E4 aligned with Eco Rl by means of the calcium phosphate method (Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989). Approximately 24 to 48 hours after infection, the medium (as described above), containing 100 μM of methotrexate and ametopterin (Sigma Chemical Co., St. Louis, MO), was added. The presence of methotrexate in the medium serves to select the elements for the expression of the dihydrofolate reductase (DHFR) gene, which is a selectable marker present in the plasmid pSMT / E4. The normal cellular gene DHFR is inhibited by means of a given concentration of methotrexate (cell-type specific), causing the death of the cell. Expression of the additional DHFR gene in transfected cells containing pSMT / E4 provides resistance to methotrexate. Therefore, the transfected cells P1384 / 98MX containing the new genes are the only ones that grow under such conditions (to review the above, see Sambrook et al., Supra). When small cell colonies were formed from an individual cell having the selectable marker, they were clonally isolated, and propagated (for review, see Sambrook et al., Supra). These clones were expanded to produce cell lines that were subjected to observation to detect the expression of the product, in this case, E4, and subjected to observation and study to determine its functionality in terms of the complementation of defective viruses, in this case, virus defective in both the El region and the E4 region. The result of this process produced the first 293 / E4 cell lines capable of complementing defective adenoviral vectors in the functions of both the El region and the E4 region, such as AdGVCFTR.ll.

Example 7 This example describes the generation of the cell line 293 / E4 / E2A. The cell line 293 / E4 / E2A allows the growth of defective viral vectors in the El, E4, and E2A regions. The E2A expression set (see Figure 4), P1384 / 98MX for its introduction into the cells of line 293 / E4, is produced in the following manner. The first step is to alter the surrounding bases of the E2A ATG to make a perfect Kozak consensus (Kozak, J. Molec, Biol., 196, 947-950, 1987), in order to optimize the expression of E2A. Two primers are designed to alter the 5 'region of the E2A gene. The Ad5s element (23884), an 18 bp oligonucleotide (5'GCCGCCTCATCCGCTTTT3 ') (SEQ ID NO: 3), is designed to prepare the internal region flanking the Sma I site of the E2A gene. DBP (ATG) Rl, a 32 bp oligonucleotide (5'CCGGAATTCCACCATGGCGAGTCGGGAAGAGG3 ') (SEQ ID NO: 4), is designed to introduce the transfer consensus sequence around the ATG triplet of the E2A gene, modifying it to obtain a perfect extended Kozak consensus sequence, and to introduce a site Eco Rl just in 5 'to facilitate its cloning. The resulting PCR product after using the aforementioned primers is digested with Eco RI and Sma I (NEB), and cloned into the identical polylinker sites of pBluescript IIKS + (Stratagene, La Jolla, CA). The resulting plasmid is called pKS / ESDBP. A Sma I-Xba I fragment is isolated from pHRKauffman (Morin et al., Mol Cell Biol., 9, 4372-4380, 1980), and cloned in the Sma I and Xba I sites P1384 / 98MX corresponding from pKS / ESDBP, to complete the reading frame of E2A. The resulting plasmid is called pKSDBP. In order to eliminate all homologous sequences of the vector contained in the expression set, the Kpn I to Dra I fragment of pKSDBP is shifted towards the corresponding Kpn I and Pme I sites in PNEB193 (NEB) in which the Eco Rl sites at the pollen-link site they have been destroyed (GenVec, Rockville, MD). The resulting clone, pE2A, contains the entire E2A reading frame without any extra homologous sequence with respect to the vector to which the E2A region was deleted, in Example 3. Subsequently, a 5 'coupling set is shifted to pE2A, to allow the proper nuclear processing of mRNA, and also to enhance the expression of E2A. To do this, the element pRKEco Rl, described in Example 1, is digested with Sac II (NEB), blunted with Mung Bean nuclease (NEB), and digested with Eco Rl (NEB). The resulting fragment of interest, approximately 240 bp, containing the coupling signals, is cloned in the Cía I site (blunted with Klenow), for the Eco Rl sites of pE2A, to generate p5'E2A. the fragment blunted (with Klenow), Sal I to Hin dlll of p5'E2A containing the E2A sequences, is shifted to the blunted site (with Klenow), Xba I of pSMT / pure and pSMT / neo. The resulting E2A region is called P1384 / 98 X pKSE2A. The Xba I fragment of pSKE2A containing the entire E2A gene is shifted to the Xba I site of pSMT / pure pSMT / neo. The resulting expression plasmids, pSMT / E2A / pure and pSMT / E2A / neo, are transfected into the cells of lines 293 / E4 and 203 / ORF6, respectively. Cells transfected with pSMT / E2A / pure are selected for growth in conventional media with puromycin, and cells transfected with pSMT / E2A / neo, are selected for growth in conventional media with Geneticin (G418; Life Technologies, Gaithersburg, MD ). The clonal expansion of the isolated colonies is in the manner described in Example 6. The resulting cell lines are subjected to observation to determine their ability to complement the defective viral vectors in the El, E4, and E2A regions. These cell lines are suitable for the complementation of vectors that are deficient in the El, E4, and E2A regions of the virus, such as those described in the viral vector series AdGVCFTR.13.

Example 8 This example describes the generation of complementary cell lines using the A549 cell line P1384 / 98MX (ATCC) as progenitor line. Ad2 virus DNA is prepared by means of the techniques described above. Genomic DNA is digested with Ssp I and Xho I, and the 5438 bp fragment is purified and cloned into the Eco RV / Xho I sites of pKS + (Stratagene), to produce pKS341-5778. After the diagnostic determination of the clone, a fragment of Xho I (blunted with Klenow) to Eco Rl, is displaced towards the interior of Nru I (blunt), for the Eco Rl sites in pRC / CMVneo, to produce pElneo. The transformation of A549 cells with this clone produces a complementary cell line (similar to 293), where additional expression sets can be introduced, similar to that described for the cells of line 293, to produce multiple complementary cell lines with an excellent plaque formation potential.

Example 9 This example establishes a protocol for the generation of 293 / E2A cell lines, and the use thereof to construct an adenoviral vector that is defective in both the El region and the E2A region. An E2A expression set vector was obtained in the manner described in Example 7 and shown in Figure 4. The E2A expression set vector P1384 / 98MX includes the gene that confers resistance to neomycin, as a marker for transfected cells. As also described in Example 7, 293 cells were transfected with pSMT / E2A / neo, and the transfected cells were selected for growth in conventional media with G418. The clonal expansion of the selected cells was carried out in the manner described in Example 6. The resulting cell lines were observed for their ability to express the DNA binding protein (DBP, the product of the E2A gene), from of induction, and its ability to complement defective viral vectors in El and E2A. To test the capacity of the neomycin-positive clonal isolates (neo +, ie, resistant to neomycin), of the 293 / E2A cell lines, in order to determine their ability to express DBP, the cells were cultured in the presence of G418, to maintain the selection. The established monolayers derived from the independent clonal isolates were induced with 100 μM of ZnCl2 for 24 hours, and the expression of the DBP gene was detected by means of immunoagglutination, using a conventional method. Of the 62 lines tested, 42% of the neo + cell lines were positive for the expression of DBP (DBP +), and all the DBP + cell lines P1384 / 98MX showed expression of inducible DBP. The following table shows the data obtained from the observation of DBP expression: Table 1. Line Expre ssiióónn DDBBPP LLíneeneea DBP Expression Cellular Phone 3 - 202 6 - 203 9 - 207 10 + 208 12 + 210 13 + 211 16 - 212 17 + 213 19 + 215 21 + 216 32 + 219 35 + 3 30011 + 36 - 302 39 + 305 41 - 307 42 - 309 43 - 311 52 - 313 54 + 314 55 - 315 57 + 316 58 + 317 60 - 3 32211 + 61 + 323 62 - 324 104 + 325 107 - 326 108 + + 3 32277 + 111 - 3 32288 + 112 + + 3 32299 + 201 + + 3 33300 + P1384 / 98MX Subsequently, the clonal cell lines 293 / E2A were observed to determine the level of expression of DBP induced by immunoaglutination, using the method of Brough et al., Supra, whose results are shown in the autoradiograms marked in the Figures 5 and 6. Those cell lines that accumulated a level of DBP similar to that of the gmDBP2 cells based on HeLA, were also analyzed. As seen in Figure 5, based on the Used of the induced cells, the level of expression of DBP induced varied widely among the clonal isolates. For example, cell lines 104, 112, and 216, produced a substantial amount of DBP from the induction, as described above, while cell lines 19 and 61 produced no more than produced by gmDBP2 cells. The clonal 293 / E2A cell lines were also analyzed for their ability to accumulate DBP throughout the first 24 hours of induction, again, using the method of Brough et al., Supra. As seen in Figure 6, based on the Used cells harvested at hours 0, 2, 16, and 24, after induction, it was observed that several lines accumulated progressively DBP throughout the incubation period, in a manner congruent with the growth of P1384 / 98MX virus. To test the complementation by means of the resulting 293 / E2A cell lines, a virus with E2A suppression was tested to observe its growth in said cell lines, using conventional techniques. As is well known in the art, viral growth can be measured semiquantitatively, by simply observing the formation of plaque in a monolayer of host cells, which was done in this case. The same lines were tested to determine their relative level of expression of the E2A gene, that is, the relative expression of DBP was measured by means of immunoagglutination techniques, according to Brough et al., Virology, 190, 624-634 (1992). The relative level of expression, or growth, with respect to the aforementioned parameters (minimum +/- to maximum +++++), of each of the cell lines subject to approval, is established in Table 2: P1384 / 98MX Table 2 Relative Level Line of Capacity to Support Cellular Expression of DBP an E2A deletion virus for plaque formation 54 ++++++ +++++ 61 ++ + 104 +++++ 112 ++++ ++++++ 201 +++ + ++ 208 212 +++ + 216 ++++ +/- 325 + 327 +++ 328 +++ 330 +++++ As shown in Table 2, the result of this study showed that the two 293 / E2A cell lines (ie, 54 and 112), support the plaque formation of the E2A-deleted virus and, in addition, its growth. It was also shown that the selected cell lines complement the vectors that are deficient in the El and E2A regions of the virus, using cell culture methods that are routine in the art. Said double deficient vector was generated using the methods described in Examples 1 and 2. Figure 7 shows the structure of AdGVCFTR12. B, which is a deficient adenoviral vector for the El and E2A regions.

P1384 / 98 X The presence of vector AdGVCFTR12.B in three different Used transfected cells, after passing the cells, was observed by detecting the DNA sequences associated with the vector, by means of a conventional test of PCR The three different Uses were tested separately to detect the presence of CFTR sequences (Columns with the heading "A" in Figure 8), the absence of E2A sequences, ie, deletion tests (columns with the header "B"), and the presence of wild type E2A sequences (columns with the heading "C"). The experiment can be analyzed based on the inverse contrast photograph of the DNA fragments stained with ethidium bromide separated in gel, which are shown in Figure 8, which was achieved using conventional methods. The results show that the three used contain CFTR and E2A deletion sequences, which agrees with the structure of AdGVCFTR12 vector. B. No sequence of wild type E2A could be detected in these used ones. In Figure 8, "M" means a DNA marker to verify 1 product size, "+" designates a sample in which the positive template for a given set of initiator was used, "-" designates a negative initiator used for each given initiation game and, as noted P1384 / 98MX formerly, A, B, and C, are used to designate the three viral Wearers tested. In accordance with the above, an adenoviral vector having deletions of the El and E2A regions has been generated, and cell lines that have the ability to complement a doubly deficient vector have been identified.

Example 10 This example shows the use of an E2A deletion plasmid for the expression of foreign DNA. The E2A deletion plasmid, pGVl3 (0), as described in Example 3, was used to construct a series of GV12B vectors. Modifications made to the plasmid pGV13 (0) included the substitution of a unique Sce I restriction site for the Cía I site, and the change of the surrounding region of ATG of the E2A gene, to achieve an optimal Kozak consensus sequence. A marker gene, (β-glucuronidase), having side restriction sites Sce I, was inserted in place of the E2A gene, so that the marker gene is expressed in response to all of the signals used to express the most abundant early gene , that is, DBP. The resulting plasmid, (pGBSE2GUS), was tested for its functionality, by transfection and the subsequent evaluation of the P1384 / 98MX activity of ß-glucuronidase; all the transfected cell lines showed high levels of β-glucuronidase expression, which is detected by means of the generation of a blue color, when the β-glucuronidase catalyses a reaction with the X-glu substrate. Another viral vector (AdGVLuc; E2GUS), which is shown in Figure 9, was constructed to demonstrate the utility of the deleted E2 region for the placement of a foreign DNA for the purposes, for example, of gene therapy. The viral vector AdGVLuc; E2GUS contains the CMV marker luciferase in the El region and the E2 β-glucuronidase in the E2A region. The predecessor vector (AdGVLuc.10) was used to transfect the cells of line 293 / E2A; the subsequent staining of the resulting viral plaques to determine the activity of the β-glucuronidase using X-glu, virtually did not reveal the presence of blue color, ie no activity of the β-glucuronidase was detected. The plates formed from the cells of line 293 / E2A, transfected with the vector AdGVLuc; E2GUS, generated a substantial amount of blue color after the addition of X-glu. According to the above, a foreign DNA inserted in the E2A region of an adenoviral vector can function.

P1384 / 98MX Example 11 This example establishes a protocol for the generation of 293 / ORF6 cell lines and the use thereof to construct an adenoviral vector that is defective in the El region and the E4 region.

The E4-ORF6 expression set shown in Figure 10 was constructed using primers A5s (33190) P and Ad5s (34084) P, in a polymerase chain reaction (PCR) (PCR Protocols, A Guide to Methods and Applications, Innis et al., eds., Academic Press, Inc., 1990), to amplify the ORF-6 gene of Ad5 E4, and generate Pac I sites at the ends for cloning. the amplified fragment was blunted with Klenow, and cloned into pCR-Script SK (+) (Stratagene, La Jolla, CA). The resulting plasmid, pCR / ORF-6 was sequenced, and then, the insert of ORF-6 was transferred into the pSMT / pure expression vector, which was generated by binding with a blunted fragment Eco Rl-Hin dlll containing the SMT promoter in the blunted Mlu I-Hin dlll site in pCRpuro, to generate pSMT / ORF-6. Transfection of 293 cells was carried out with pSMT / ORF6 / pure, and the transfected cells were selected for culture in conventional puromycin media. The clonal expansion was done in the way P1384 / 98MX described in Example 6. The resulting cell lines were observed for their ability to express E2-ORF6 after induction, as well as their ability to complement viral vectors deficient in El and E4. The clonal isolates resistant to puromycin (pure +, ie resistant to puromycin), of the 293 / ORF6 cell lines were observed for their ability to express 0RF6. The cells were cultured in the presence of puromycin to maintain selection. The monolayers established from the independent clonal isolates were induced with 100 μM of ZnCl2 for 24 hours. The expression of the ORF6 gene was detected by means of the Northern blotting test, thus identifying RNA transcription. The relative level of expression (minimum (+) to maximum +++++) of each of the cell lines tested is shown in Table 3: P1384 / 98MX Table 3 Line Expression ORF6 Line E Exxppression ORF6 Cellular Phone A2 +++ B8 ++ A2-1 (+) B8-1 (+) A2-2 (+) B8-2 +++ A2-3 - B8-3 + A2-4 (+) B8-4 + A2-5 (+) B8-5 (+) A2-6 - B8-6 - A2-7 (+) B8-7 + A2-8 - B8-8 ++ A2-9 (+) B8-9 + + A2-10 - B8-10 (+) A2-11 - B8-14 (+) A2-12 + B8-16 - A2-13 - B8-18 - A2-14 +++++ B8-19 - A2 -24 - B8-20 - A2-32 ++++ B8-21 - A2-59 - B8-23 - B8-22 - B8-27 - B8-24 - B8-27 _ P1384 / 98MX The result of the test to determine the expression of the 0RF6 gene was that 53% of puromycin-resistant cell lines were positive for 0RF6 transcripts, and all cell lines positive to ORF 6, proved to be inducible for the expression of 0RF6. PCR was also used to detect the insertion of a gene in the E4 deletion region of an adenoviral vector, and its results are shown in Figure 11. The Used ones subjected to passage of cells transfected with AdGVßgal.ll, were subjected to PCR that amplified certain gene sequences associated with wild-type E4, ie fragments of 3087 bp and 367 bp. The DNA of the pseudoinfected cells of line 293 / ORF6 (lane 1), cells infected with AdGVßgal.10 (lane 2), and cells infected with AdGVßgal.ll (lane 3), were subjected to gel electrophoresis and staining with ethidium bromide. The photograph shown in Figure 11, which is of the resulting stained gel, indicates that the AdGvßgal.lO vector lacks the portion of the E4 region that includes the 367 bp sequence, and that the vector AdGvßgal.ll lacks the portion of the E4 region which includes the 3087 bp sequence. The growth of a vector with deletion of E4 was observed in the cell lines 293 / ORF6. The cells P1384 / 98MX were infected with a multiplicity of infection (moi) level of 10, and the amount of virus in growth was monitored by means of complementary plaque analysis after 5 days of culture. The results are shown in Figure 12, which is a bar graph indicating the plaque forming units (PFU) per cell on the x axis. For the cultivation of the positive control, the W162 cell line was used, which is a cell line that is known to complement the E4 function. For the negative control, cell line 293 was used, which is known to complement only the El function. Cell lines A2, B8, 216, and 406, are isolated independent of the 293 / ORF6 cell lines, which show variations quantitative data regarding the complementation of the virus with deletion of E4 (dl366). Specifically, 293 / ORF6 cells complement the E4 function. In accordance with the above, it has been discovered that the cell lines complement the E4 function, thus allowing the growth of an E4 deleted virus, which has been shown to be capable of harboring active foreign DNA. These cell lines are suitable for the complementation of vectors that are doubly deficient for the El and E4 regions of the virus, such as those described above in the series of vectors P1384 / 98MX AdGVCFTR.ll, or as shown in Figure 13, which is a schematic representation of the vector AdGvßgal.ll. The AdGVßgal.ll vector has the β-galactosidase gene inserted in the El region and a deleted E4 region.

Example 12 This example illustrates the uses of adenoviral vectors having deletions of the El and E4 regions. The deletion plasmid, pGBS? E4, has been modified to contain several unique restriction sites. These sites are used to clone any foreign DNA in this region, using the E4 adenoviral promoter for its expression. As noted above, the presence of ß-glucuronidase in this region resulted in the obtaining of a perfectly functional adenoviral vector expressing the foreign DNA. According to the above, a suitable foreign DNA, placed in the El region, and other foreign DNA placed in the E4 region, both in the same viral vector, can express the respective foreign DNAs using the control of the El and E4 promoters or , if desired, other promoters. A second modification of the E4 region allows the expression of a suitable foreign DNA from a variety of heterologous control elements. The construction of the plasmid was made in such a way that P1384 / 98MX can be carried out multiple changes conveniently. The multiplasmid pGV.llS has the following characteristics that can be conveniently exchanged: 1. An adenoviral segment used for homologous recombination, the link to place the foreign DNA at either the El or the E4 end of the vector. 2. A promoter segment. 3. A coupling signal segment. 4. A segment of foreign DNA. 5. A polyadenylation segment. 6. The sequence of adenoviral involvement. 7. The adenoviral ITR. 8. All plasmid DNA sequences necessary to select and culture the plasmid in a bacterium, as well as in a mammalian tissue culture.

Example 13 This example describes the generation of a modality that includes the participation of AdGv.llS, ie AdGVCFTR. US, which comprises a sequence of spacer inserted in the deletion of E4 present in AdGV.ll. Similarly, the spacer can be incorporated into the E4 deletion of, for example, AdGV.12S and AdGV.13S, to derive P1384 / 98MX AdGVCFTR.12S and AdGVCFTR.13S, respectively. The recombinant virus AdGVCFTR.llS was constructed, isolated, and cultured, using the procedures described for the generation of AdGVCFTR.ll, as described in Example 2. The vector AdGVCFTR.llS was constructed by means of a simple recombination in vivo between 1-27082, that is, the left arm of AdGVCFTR.10 and the plasmid pGVHS, the right arm, aligned with Bam Hl (NEB) and Sal I (NEB). In accordance with the above, the resulting vector AdGVCFTR.llS is deficient in El and E4, and incorporates a spacer between the deleted region E4, as well as a SV40 polyadenylation sequence. Of course, the vector also contains the polyadenylation sequence E4 and the E4 promoter of the E4 region of the adenoviral genome. The fiber / E4 region of the AdGVCFTR vector. US, is shown in Figure 14C. For comparison purposes, other vectors in accordance with the present invention are shown in Figures 14A and 14B. The vector of Figure 14A is a complete deletion linking the L5 fiber to the right-side ITR. Said vector comprises a deletion of approximately 2.5 kb from the E4 region, compared to the wild-type adenovirus. The various characteristics of the vector AdGVCFTR.llS (Figure 14C), compared to vectors based on AdGv .ll (Figure 14B), and other vectors, are described in the following examples. P1384 / 98MX Example 14 This example describes a characterization of the growth and production behavior of the fiber protein of a vector deficient in El and E4, compared to a vector that is deficient in El and preserves the E4 region of wild type . For these experiments, the AdGvßgal.lO vector deficient in El and E3, and the vector AdGvßgal.ll deficient in El and E4, were employed. The vectors were inoculated in complementary cell lines 293 / ORF-6. Immunoaglutination analysis was carried out on the used ones of the 293 / ORF-6 cell lines, in the manner described in Example 9. In this experiment, sensitized rabbit serum against the complete adenoviral capsid was used. This antibody recognizes all the structural proteins of the adenoviral capsid. As shown in Figure 15, the adenoviral vectors with multiple deficiency for "E4" replication showed reduced fiber expression and reduced viral growth compared to adenoviral vectors with simple deficiency for El deletion replication. , that there is a deficit in the production of several late proteins, particularly fiber proteins, in cells infected with a vector P1384 / 98MX comprising deletions in El and E4 (ie, an AdGVßgal.ll vector, lane 3), compared to cells infected with an "E4 +" vector (ie, an AdGVßgal.lO vector, lane 2). The reduction of the production of fiber proteins in the vector The "E4" corresponds to about 50. The effect of this deficit in terms of production of mature virions was examined by evaluating the level of fiber protein present in the purified capsids The viral particles (capsids) were isolated by means of three sequential gradients of cesium chloride, using a conventional protocol for the production of a vector.The immunoagglutination analysis using an antibody sensitized against the adenovirus fiber protein was carried out After fragmentation of the capsids by boiling, and SDS / polyacrylamide gel electrophoresis, the results of these experiments are shown in Figure 16. seen on the basis of Figure 16, similar levels of fiber protein are produced in cells inoculated with an El-deficient vector (ie, AdGVßgal.lO, lane 1), as compared to cells infected with a vector "E4" "(that is, AdGvßgal.ll, lane 2). Because the vector "E4 ~" failed to produce nearby fiber protein levels P1384 / 98MX to those produced by the vector with simple deficiency for replication (in this case, the vector "), these results suggest that the reduction in fiber protein production causes a decrease in the total number of capsids that can occur in an infected cell.

EXAMPLE 15 This example describes the production of fiber protein observed from the infection of a cell with an E4 deficient vector comprising a spacer in the E4 region, as compared to the infection of a cell with an E4 deficient vector lacking of said spacer in the adenoviral genome. For these experiments, the vectors used, and the characterization thereof, were carried out in the manner described in Example 14. In addition, the vector AdGVCFTR was examined. US, deficient in El and E4 and based on AdGV.llS. this vector further comprises a deletion of E3 and a spacer inserted into the deletion region of E4 present in AdGv.ll, as described in Example 13. The results of these studies are shown in Figure 17. As can be seen in the Figure 17, the incorporation of the spacer in the deletion region E4 makes it possible to have protein production levels of P1384 / 98MX fiber L5 that approximate those obtained with the use of an adenoviral vector with simple deficiency for replication. Specifically, while the production of fiber was nullified in a cell infected with the vector AdGVßgal.ll deficient in El and E4 (lane 3), the fiber levels observed for the cell infected with the vector The "E4" with deficiency Multiple replication comprising a spacer, ie, vector AdGVCFTR.llS (lane 4), approximated the fiber levels observed for the cell infected with the vector "with simple deficiency for replication AdGvßgal.lO (lane 2) In addition, these results confirm that the incorporation of a spacer in the vector The "E4", particularly in the deletion region of E4, provides adequate fiber production, which is similar to that observed from the infection of a cell with a vector that has only the El deletion.

Example 16 This example describes the growth behavior of an E4 deficient vector comprising a spacer in the E4 region, as compared to an E4 deficient vector lacking said spacer in the viral genome.

P1384 / 98MX In these experiments, the ability to repair growth defects of adenoviral vectors with multiple deficiency was explored through the addition of a spacer in at least one of the suppressed regions, that is, the production of active viral particles (focussing units, ffu), per cell, was examined as a function of the time elapsed after the infection of A232 cells with either the AdGV.10 vector deficient in El and E3 based on AdGvßgal.lO, with vector AdGVLacZ.ll deficient in El and E4 based on AdGV.ll, or with vector AdGVCFTR.llS deficient in El, E3, and E4, based on AdGv.llS, comprising a sequence of spacer in the deletion region of E4. A232 cells were used based on the ability of the cells of this line to produce El and E4 deletion viruses. The a232 cells are cells of the 293 / ORF6 line that grow in conventional media and that are induced to produce ORF6 after infection with 100 μM of ZnCl2. The focus forming units were determined by serial dilution and the strain of the infecting virus on the monolayers of complementary cells. The number of infected cells was counted by means of immunochemical detection methods, using an antibody for DBP or the E2A gene product. The production of active viral particles was examined approximately 20, 40, 60, and P1384 / 98MX 80 hours after infection. The results of these experiments are shown in Figure 18. There seems to be no kinetic difference between the vector AdGv.10 deficient in El and E3 (solid frames), and the vector AdGV.llS deficient in El, E3, and E4 comprising a spacer in the deletion region of E4 (open circles). The worst level of virion production was found with the vector AdGv.ll deficient in El, E3, and E4, which does not include a spacer (open diamonds), as can be seen based on the difference of 100 times at 16 a 20 hours after the infection. Additionally, the production achieved was determined. This included the use of three gradients of cesium chloride to purify the capsids of the vector. The virus must undergo a rigorous purification protocol to achieve purification of vector capsids. As in the case of any purification procedure, this results in a loss in terms of total production. Therefore, the critical data, in terms of the present experiments, do not refer to the plateau point of the growth curves of Figure 18, but rather to the level of production. The production yield (in active viral particles per cell), for the cells P1384 / 98MX infected with the various vectors, is set forth in Table 4.

Table 4 Production Performance Vector AdGv.10 (ie, AdGvßgal.l0) 650 AdGV.ll (ie, AdGVßgal.ll) 22 AdGv.llS (ie AdGVCFTR .US) 720 As these data show, from the incorporation of the spacer into a vector The "E4" with multiple deficiency in replication, the production of viral particles increases until reaching (and perhaps exceeding) the levels of viral production observed for a vector with simple deficiency for replication with El deletion. According to the above, these results confirm that the sequence of the spacer is able to counteract the growth defect and the reduced expression of fiber observed with an adenoviral vector The "E4" with deficiency Multiple in replication, and considered in toto, the results validate the fact that the incorporation of this spacer into the genome of an adenovirus comprising deletions of El and E4, particularly its incorporation into the deletion region P1384 / 98MX of E4, provides an adequate production of fiber and a greater viral growth, similar to those observed in the case of the use of an adenoviral vector El with simple deficiency for replication.

Example 17 This example shows the characteristics of the vectors comprising deletions in the E2 region, particularly the E2A region of the adenoviral genome. As observed with the E4 mutants, the growth behavior of adenoviruses with simple deficiency and multiple deficiency in replication comprising mutations in the E2A region is affected. Based on the foregoing, the ability of various E2A deletion mutants comprising El-like sequences to be complemented by cell lines in accordance with the present invention was examined. In particular, the previously described adenoviral vectors dldOl, dl802, dl803, and dl807 were studied, comprising deletions in E2 (Rice et al., J. Virol., 56, 767-778 (1985); Vos et al., Virology, 172, 634-632, 1988). The open reading frame E2A comprises from nucleotide Ad5 22,443 to nucleotide 24,032. The product of the E2A gene is a DNA binding protein of P1384 / 98MX single strings (ie, DBP). Virus dl803 comprises a deletion of E2A ORF from nucleotide 22.542 to nucleotide Ad5 23, 816, and comprises E2A ORF from nucleotide Ad5 23, 816 to nucleotide Ad5 24, 032. Accordingly, the genetic product of the region dl801 E2A (and variants thereof), comprises a chimeric protein consisting of a portion of the DBP protein that is the result of the translation of the normal reading frame (i.e., natural type), linked to additional protein sequences that result from the use of an alternative reading frame after the deletion. The region of the DBP protein missing in the chimeric protein due to the deletion (ie, the "Ct" region), has been implicated in DNA replication, the ssDNA binding, and the mRNA binding (Brough et al. ., Virology, 196, 269-281, 1993). In comparison, the region conserved, in part, by the vector (ie, the "Nt" region), has been implicated in nuclear localization and late gene expression (Brough et al., Supra). The dl801 and dl802 viruses, comprise the modifications of the dl803 virus. Specifically, dl802 virus further comprises a deletion of E2A ORF from nucleotide Ad5 23.816 to nucleotide Ad5 23.969, such that the resulting deletion virus comprises E2A ORF from nucleotide Ad5 23.969 to nucleotide P1384 / 98MX Ad5 24,032. Similarly, the dl801 virus further comprises a deletion, in frame, of E2A ORF from nucleotide Ad5 23.816 to nucleotide Ad5 24.011, such that the resulting deletion vector comprises E2A ORF from nucleotide Ad5 24.011 to nucleotide Ad5 24,032. In comparison, the dl807 virus further comprises a deletion in the framework of E2A ORF from nucleotide Ad5 23,882 to nucleotide Ad5 23,954. By studying the growth behavior of said various deletion vectors, it was discovered that certain segments of the E2A region of the adenoviral genome can not be complemented and must be conserved by (or added back to) an adenoviral vector to allow viral growth. The results of these experiments are summarized in Figure 19. Specifically, the dl803 deletion mutant (which retains, in part, the Nt region, and lacks the wild-type Ct region), is fully functional and shows no deficiency of growth in complementary E2A cell lines. In comparison, vectors dl807, dl802 (data not shown), and dl801, show a weakened phenotype, which can not be complemented in E2A expression cell lines. In particular, vector dl801 shows a phenotype of extremely small plaques (- / +). Therefore, these results confirm P1384 / 98MX that the persistent region in dld03, comprising of nucleotide Ad5 23,816 to nucleotide Ad5 24,032, is necessary for the refinement of the E2A deletion and the replication of the E2A deletion vectors, in the currently available cell lines. All references, including publications and patents cited herein, are incorporated by reference to the same extent that they would be if each of them were individual and specifically mentioned and incorporated in its entirety as reference herein. While the present invention has been described with emphasis on preferred embodiments, it will be obvious to those skilled in the art that preferred embodiments may be modified. It is intended that the present invention may be implemented in a manner different from that specifically described. In accordance with the foregoing, the present invention includes all the modifications grouped within the spirit and scope of the following claims.

P1384 / 98MX SEQUENCE LIST (1) GENERAL INFORMATION: (i) APPLICANT: Kovesdi, Imre Brough, Douglas E. McVey, Duncan L. Bruder, Joseph T. Lizonova, Aleña (ii) TITLE OF THE INVENTION: COMPLEMENTARY SYSTEMS OF ADENOVIRAL VECTORS AND CELLULAR LINES (iii) NUMBER OF SEQUENCES: 4 (iv) ADDRESS TO RECEIVE CORRESPONDENCE: (A) RECIPIENT: Leydig, Voit & Mayer, Ltd. (B) STREET: Two Prudential Plaza, Suite 4900 (C) CITY: Chicago (D) STATE: Illinois (E) COUNTRY: United States of America (F) ZIP CODE (ZIP): 60601 (v) COMPUTERIZED READING FORM: (A) TYPE OF MEDIUM: Floppy disk (B) COMPUTER: IBM compatible with PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIn Relay # 1.0, Version # 1.25 P1384 / 98MX (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: WO (B) REGISTRATION DATE: 12-DEC-1996 (C) CLASSIFICATION: (vii) DATA FROM THE PREVIOUS APPLICATION: (A) NUMBER OF APPLICATION: US 08-572126 (B) REGISTRATION DATE: 14-DEC-1995 (C) CLASSIFICATION: (viii) INFORMATION OF THE LEGAL REPRESENTATIVE / AGENT: (A) NAME: Kilyk Jr., John (B) REGISTRATION NUMBER: 30,763 (C) REFERENCE NUMBER / FILE: 75,388 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (312) 616-5600 (B) TELEFAX: (312) 616-5700 (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid P1384 / 98MX (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 1; CACTTAATTA AACGCCTACA TGGGGGTAGA GT (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) BRAIDED STRUCTURE: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 2: CACTTAATTA AGGAAATATG ACTACGTCCG GCGT (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) P1384 / 98MX (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: GCCGCCTCAT CCGCTTTT (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (synthetic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 4 CCGGAATTCC ACCATGGCGA GTCGGGAAGA GG P1384 / 98MX

Claims (32)

1. NOVELTY OF THE INVENTION Having described the present invention, it is considered as a novelty and, therefore, the content of the following CLAIMS is claimed as property: 1. An adenoviral vector that is deficient in one or more essential gene functions of the region E4 of the adenoviral genome, wherein said adenoviral vector comprises a spacer sequence of at least about 15 base pairs in the E4 region of the adenoviral genome.
2. 2. The adenoviral vector according to claim 1, wherein said spacer comprises a polyadenylation sequence.
3. 3. The adenoviral vector according to claims 1 or 2, wherein all of the open reading frames of the E4 region of the adenoviral genome have been deleted.
4. The adenoviral vector according to claims 1 or 2, wherein said E4 region of said adenoviral vector is deleted and said spacer sequence is placed between the right-side ITR and the remaining portion of the genome.
5. 5. The adenoviral vector according to any of claims 1-4, wherein said adenoviral vector is deficient in one or more essential gene functions of the P1384 / 98MX region The adenoviral genome.
6. 6. The adenoviral vector according to any of claims 1-5, wherein said adenoviral vector is deficient in one or more essential gene functions of the E2A region of the adenoviral genome.
7. 7. The adenoviral vector according to any of claims 1-6, wherein said adenoviral vector is deficient in all essential gene functions of the El region of the adenoviral genome.
8. 8. The adenoviral vector according to any of claims 1-7, wherein said adenoviral vector is deficient in all essential gene functions of the El and E2A regions of the adenoviral genome.
9. 9. The adenoviral vector according to any of claims 1-8, wherein said adenoviral vector is deficient in the E3 region of the adenoviral genome.
10. 10. The adenoviral vector according to any of claims 1-9, wherein said adenoviral vector has been deleted all the ORFs from the E2A region of the adenoviral genome other than the ORP coding for DBP, and wherein said adenoviral vector it comprises less than about 230 base pairs of the DBP ORF, and wherein said DBP ORF sequences encode a portion of the Nt domain of the DBP sufficient to allow viral growth in a cell line that does not complement the deficiencies of the P1384 / 98MX DBP ORF.
11. 11. An adenoviral vector to which all ORFs from the E2A region of the adenoviral genome other than the DBP coding ORF have been deleted, and wherein said adenoviral vector comprises less than about 230 base pairs of the DBP ORF, and wherein said DBP ORF sequences encode a portion of the Nt domain of the DBP sufficient to allow viral growth in a cell line that does not supplement the deficiencies of the DBP ORF.
12. 12. The adenoviral vector according to any of claims 1-11, wherein said adenoviral vector has been prepared in a cell line capable of complementing in trans the deficient essential gene functions of said adenoviral vector.
13. The adenoviral vector according to claim 1, wherein said adenoviral vector is AdGV.ll modified by means of the incorporation of a sequence comprising a polyadenylation sequence between the ITR on the right side of the genome and the remaining portion of the genome.
14. 14. The adenoviral vector according to any of claims 1-13, wherein said adenoviral vector comprises a foreign gene.
15. 15. The adenoviral vector according to claim 14, wherein said foreign gene encodes an agent P1384 / 98MX therapeutic.
16. 16. The adenoviral vector according to claim 14, wherein said foreign gene is the regulatory transmembrane gene of cystic fibrosis.
17. 17. The adenoviral vector according to the claim 14, wherein said foreign gene encodes a reverse RNA.
18. 18. The adenoviral vector according to claim 14, wherein said foreign gene encodes a polypeptide capable of producing an immune response.
19. 19. The adenoviral vector according to any of claims 1-18, wherein said adenoviral vector is prepared in a cell in the absence of an auxiliary virus.
20. 20. The use of an adenoviral vector according to any of claims 1-19, in the preparation of a pharmaceutical composition.
21. 21. An adenovirus-free strain competent for the replication of the adenoviral vector of any of claims 1-19.
22. 22. The strain according to claim 21, wherein said adenoviral vector is prepared in a cell line capable of supporting the growth of said adenoviral vector, and wherein the genome of said cell line is free of superposition sequences with said vector. adenoviral, which are sufficient to intervene in a recombinant event that results in a vector Adenoviral P1384 / 98MX competent for replication.
23. 23. The strain according to claim 21 or 22, wherein said adenoviral vector is prepared in a cell line capable of supporting the growth of said adenoviral vector, and wherein said strain is free of adenovirus competent for replication after a simple recombination event between the genome of said adenoviral vector and the genome of said cell.
24. 24. A method for preparing the adenoviral vector of any of claims 1-19, comprising the propagation of said adenoviral vector in a cell line in the absence of an auxiliary virus, wherein said cell line is capable of in transcomplementing said vector adenoviral
25. 25. A method for increasing the propagation of an adenoviral vector that has been deleted from the E4 region of the adenoviral genome in a complementary cell line, wherein said method comprises the incorporation of a spacer sequence between the right-side ITR and the remaining portion of the genome, wherein said spacer sequence is about 15 base pairs.
26. 26. The method according to claim 25, wherein said spacer sequence is a polyadenylation sequence between the right-sided ITR and the remaining portion of the adenoviral genome. P1384 / 98MX
27. 27. A method for genetically modifying a cell, wherein said method comprises contacting said cell with an adenoviral vector according to any of claims 1-19.
28. 28. A composition comprising an adenoviral vector according to any of claims 1-19.
29. 29. A host cell comprising an adenoviral vector according to any of claims 1-19.
30. 30. A method for testing the toxicity in the target cells of any adenoviral vector according to any of claims 1-19, wherein said method comprises putting in culture an aliquot of said target cells, contacting said target cells with said vector and Measure the vitality of cultured white cells.
31. 31. A method for testing the expression of a foreign gene of any adenoviral vector according to claims 14-18 after its transfection in target cells, wherein said method comprises: putting in culture an aliquot of said target cells, contacting said target cells with said vector, and measuring the expression of the passenger gene in the target cells.
32. 32. A method to test the expression of a passenger gene of any adenoviral vector according to the P1384 / 98MX claims 14-18 after transfection in the target cells, wherein said method comprises putting in culture an aliquot of said target cells, contacting said target cells with said vector, and measuring the expression of said passenger gene in said white cells. P1384 / 98MX