MXPA98004480A - Constructions and methods to increase the levels of proteins in photosinteti organisms - Google Patents

Abstract

This invention provides new constructs of genes that increase the efficiency of plant cells, and cells of other photosynthetic organisms. In the same way seeds and transgenic plants are provided that over express proteins. Methods for raising the amount of plastid proteins in plants and photosynthetic organisms are exemplified

Description

CONSTRUCTIONS AND METHODS TO INCREASE THE LEVELS OF PROTEINS IN PHOTOSYNTHETIC ORGANISMS BACKGROUND OF THE INVENTION All photosynthetic organisms depend on the reactions of photosynthesis that collect light so that energy produces compounds important for growth and metabolism. The carbohydrates rich in energy, fatty acids, sugars, essential amino acids and other compounds synthesized by photosynthetic organisms are the basis of the food chain on which the existence of all animal life depends. Photosynthetic organisms are also the main source of oxygen production in the atmosphere, recycling carbon dioxide in the process. In this way life on earth is based on the productivity of photosynthetic organisms, especially plants. Plant productivity is limited by the amount of resources available and the ability of plants to take advantage of these resources. The conversion of light into chemical energy requires a complex system that combines the light collection device of pigments and proteins. The value of the light energy for the plant can be understood only when it is efficiently converted into chemical energy by photosynthesis and introduced into various biochemical processes. The protein apparatus of the thylakoids responsible for the photosynthetic conversion of light into chemical energy is one of the most complex mechanisms of the chloroplast and remains one of the most difficult biological systems to study. The photosynthetic organisms that produce oxygen, such as cyanobacteria, algae and plants, have two photosystems, PSI and PSII, that cooperate in series to acquire electrons from H20 and distribute them energetically in an ascending gradient up to NADP +. The photosynthetic production of NADPH and ATP is then introduced, in turn, in all biochemical pathways. The force that drives the upward flow of these electrons comes from the light energy absorbed by the 100-300 chlorophyll molecules associated with the two photosystems. An important pair of chlorophyll a molecules at the center of each photosystem modulates the movement of electrons. The remaining chlorophyll molecules are associated with proteins which in turn are organized into light-collecting antennas that surround the reaction centers and transfer light energy to them (Green et al (1991) TIBS 15: 181). The ability to absorb light, especially in the shade, depends mainly on the size and organization of the complexes that collect the light (Lhc) of the thylakoid membranes. The light collection complex LhcII is the main set of proteins that bind to chlorophyll a / b (Cab) that acts as an antenna for photosystem II (PSII) and plays a key role in the collection of light for photosynthesis ( Kuhlbrandt, W. (1984) Nature 307: 478). The plants are able to adjust the size of the antennas according to the light intensity available for growth. In the shade, the nitrogen distribution is displaced from the stroma polypeptides, by a decrease in the levels of ribulose 1,5-bisphosphate carboxylase (Rbc or Rubisco), towards the proteins of the thylakoids. The redistribution of nitrogen is a compensating response to low irradiation, balancing the collection of light and the fixation of C02 (Evans, JR (1989) Oecologia 78: 9; Stitt, M. (1991) Plant, Cell and Environment 14: 741). In addition to the displacement of the use of nitrogen to different proteins, photosynthetic organisms can adapt to low light conditions by means of the molecular reorganization of the complexes that collect light (Chow et al (1990) Proc. Natl. Acad. Sci. USA 87: 7502; Horton et al (1994) Plant Physiol. 105: 415; Melis, (1991) Biochim. Biophys. Minutes 1058: 87). The ability to reorganize a plant to compensate for changes in the characteristics of light limits its productivity. Although there is a mechanism to adapt to low light conditions, photosynthesis in plants grown under suboptimal illumination remains significantly lower due to a limited ability to produce ATP and NADPH through electron transport (Dietz, KJ and Heber, U. ( 1984) Biochim Biophys. Acta. 767: 432; ibid (1986) 848: 392). Under such conditions the ability to generate ATP and NADPH, the assimilating force, will dictate the ability to reduce C02. When light is limiting, plants reorganize to maximize their photosynthetic capacity; however, the ability to adapt is limited by molecular parameters that vary from gene expression to the assembly of the complex to the substrate and the availability of cofactors. If the productivity of a plant or other photosynthetic organism is to be increased, methods should be developed to increase the ability to collect light without restricting C02 fixation. SUMMARY OF THE INVENTION The present invention provides a chimeric gene construct containing a promoter region, a 5 'untranslated region containing a translational enhancer, DNA encoding a transit peptide specific for plastids that increases the importation of proteins, a gene encoding a plastid protein and a 3 'untranslated region containing a functional polyadenylation signal. This construction produces a high level of expression and import of the functional protein to the place of its function. In one embodiment of the present invention the promoter is a promoter of the cauliflower mosaic virus (CaMV) of 35S. In another embodiment, the translational enhancer is from the 5 'untranslated region of the small subunit of ribulose-1, 5-bisphosphate carboxylase of the pea. In another embodiment, the transit peptide is from the small subunit of ribulose-1, 5-bisphosphate carboxylase of the pea. In a further embodiment, the gene encoding a protein is the pea cab gene, which encodes a chlorophyll a / b binding protein. In still another embodiment, the 3 'untranslated region containing a functional polyadenylation signal is from the ca-b gene of the pea. This invention also provides a method for increasing the light collecting capacity of a photosynthetic plant or organism comprising: the preparation of a gene construct containing a promoter, a 5 'untranslated region containing a translation enhancer, DNA encoding a plastid-specific transit peptide that increases the importation of proteins, DNA encoding a protein, preferably a structural gene encoding a chlorophyll a / b binding protein and a 3 'untranslated region containing a functional polyadenylation signal; the insertion of the gene construct into a vector for suitable cloning and the transformation of a photosynthetic plant or another photosynthetic organism with the recombinant vector. Alternatively, the gene construct is coated directly on biolistic particles with which the cells are bombarded. This invention provides a DNA construct that can increase the amount of one or more proteins of a plastid, especially of a chloroplast, or of the cells of the photosynthetic prokaryotes. These constructions can alter the photosynthetic apparatus in order to increase the ability of the plant to collect light, especially under low lighting conditions.

This invention also provides methods for increasing the light collection efficiency of photosynthesis and the production of photosynthetic products (such as carbohydrates) in plants and in other photosynthetic organisms. These methods can be used to increase the commercial value of plants and seeds, and can be used to increase the yields of products produced from fermentation operations and plant tissue culture. This invention also provides a transgenic photosynthetic plant or organism (TR) containing the construction described above. These transgenic photosynthetic plants and organisms have an increased photosynthetic capacity and increased growth capacities useful for increased production, tissue culture, fermentation and regeneration purposes. Compared to wild-type (WT) plants, the transgenic plants of this invention demonstrate increased production, intensified pigmentation, increased carbohydrate content, increased biomass, more uniform growth, larger seeds or fruits, increased stem perimeter, intensified photosynthesis , faster germination and an increased capacity to withstand the shock of transplants. Seeds produced from these plants are also provided by this invention, as well as parts of the plants useful for the production of regenerated plants and other derived products. Brief Description of the Figures Figure 1A-1B is the nucleotide sequence of AB80 (Pea type I LhcIIb gene) (SEQ ID NO: 1) and the amino acid sequence (SEQ ID NO: 2) encoded by SEQ ID NO: 1. Figure 2 shows the construction of the vector pSSTP.

Figure 3 shows the construction of the pRBCS-CAB vector. Figure 4 shows the construction of the pCAMV-RBCS-CAB vector. Figure 5 shows the construction of the binary vector of Agrobacterium (pEND4K-CAMV-RBCS-CAB). Figure 6 is a restriction map of the binary vector pEND4K of Agrobacterium. Figures 7A-7C show the levels of transc transcript in stable state of transformed and wild-type tobacco plants. Figure 7A shows the levels of transc plant mRNA derived from the IT seeds of the primary transformants. Figure 7B shows the transc mRNA levels of selected IT plants with high levels of transc transcript that were self-cross-linked and subjected to a segregation analysis. The resulting homozygous lines were examined in the same manner as in Figure 7A. The figure 7C shows the steady-state Cab protein levels of transformed (TR) and wild-type (WT) tobacco plants. Figures 8A-8C show the growth and morphological characteristics (Figure 8A) of tobacco plants WT and TR (left and right, respectively). The respective fully developed sheets of WT and TR are compared as full leaf diagrams (Figure 8B) and cross sections (Figure 8C). Figure 9 is a comparison of transgenic seedlings (upper row) and control seedlings (lower row) after four days of germination in solid MS media. Figure 10 is a comparison of transgenic (TRA) and control (WT) tobacco calluses grown during the same time period. Figure 11 shows electron micrographs of mesophilic tissues (on the left) and chloroplasts (at right) of wild-type (WT) and transgenic (TR) tobacco leaves. Figure 12 is a comparison of light response curves of WT (_) and TR (•) by the photosynthetic oxygen production of plants grown at two different light intensities: (A) 50 μmoles-m ^ -s "1 (referred to as low); and (B) 500 μmol-m ~ 2 -s ^ (referred to as elevated). Figures 13A-13D show the light response curves for qP (Figure 13A), qN (Figure 13B), Fv / Fm (Figure 13C) and 0PSII (Figure 13D) measurements in air for plants WT (_) and TR (•). Detailed Description of the Invention This invention relates to a DNA construct that, when incorporated into a plant or cell of a photosynthetic organism, increases the efficiency of plastids or a photosynthetic cell, and to methods for increasing or improving products. of plastid metabolism by increasing the expression and import of proteins. The present invention also relates to transgenic plants, seeds, cells and plant tissues and to other photosynthetic organisms that incorporate these constructions. A DNA construct of this invention contains a promoter, a 5 'untranslated region containing a translational enhancer, DNA encoding a plastid-specific transit peptide that can enhance and direct the import of a gene product into a plastid or photosynthetic apparatus , a gene encoding a plastidic protein and a 3 'untranslated region containing a functional polyadenylation signal. The insertion of this construction results in an expression and import of increased proteins in the plastids and in the photosynthetic apparatus. This elements they are normally provided as components operatively linked in the 5 'to 31 direction of transcription. A preferred embodiment of the invention is a construct containing a 5 'constitutive promoter (such as the 35S promoter of cauliflower mosaic virus), the 5' untranslated region of the small subunit of ribulose-1, 5- Pea bisphosphate carboxylase containing a translational enhancer having a nucleotide sequence consisting of residues 1 to 29 of SEQ ID NO: 3, DNA encoding a transit peptide that comes from the small subunit of ribulose-1, Pea 5-bisphosphate carboxylase, a structural gene encoding a chlorophyll a / b binding protein and a 3 'untranslated region containing a functional polyadenylation signal that is derived from the pea cab gene. This new gene construction scheme simultaneously allows a high level of transcription, a high level of translation, greater stability of the mRNA and a high level of import of proteins to the plastid or photosynthetic apparatus of an organism, producing an overproduction of the selected protein (in in this case, a protein Cab light picker) in plants and other photosynthetic organisms. Multilevel gene construction, especially the increase in protein importation, can be widely used to increase the import and expression of any protein. The exemplified gene construct achieves a high level of expression and import of the functional protein (chlorophyll a / b binding protein) to the site of its function. The activity of many different proteins and polypeptides involved in the process of photosynthesis can be increased by the methods of this invention. In addition to the increased levels of endogenous proteins, the DNA constructs of this invention can be used to import and express foreign proteins in the photosynthetic apparatus of plants and other photosynthetic organisms. In addition, the DNA construct can contain a coding region of a single protein, or it can contain additional coding regions so that several proteins can be imported and expressed. Thus, the plastids of plants and cells of photosynthetic organisms can be altered to intensify the reactions of photosynthesis that collect light and / or to vary the level and type of products of photosynthetic reactions in the dark. To produce the chimeric constructs provided in this invention, an efficient Rbcs-Cab chimeric coding region was created by combining coding sequences from the appropriate portions of Rbcs and Cab of type I LhcIIb. The transgenic tobacco plants containing the gene construct of this invention they overproduce LhcIIb Cab type I and possess a photosynthetic activity in low illumination and increased growth capacities. Transgenic plants also demonstrate one or more morphological, developmental, biochemical and physiological modifications. These modifications have a commercial value in forage plants in which faster germination and growth, higher yields and improved appearance are greatly preferred. The desired modifications are achieved through gene expression and import of high proteins through this new gene construct. Enhanced expression at the level of de novo transcription was facilitated by the binding of the Rbcs-Cab gene construct to the potent 35S promoter of CaMV. Additional intensifications were obtained by increasing the stability of the mRNA, thus increasing the magnitude of the set of transgenic transcripts in stable state. This was done by the inclusion of the sequence of functional 3 'untranslated nucleic acid of the cab gene and the nucleic acid sequence encoding the transit peptide Rbcs. Both nucleic acid sequences have a role in increasing the stability of the mRNA. Higher levels of translation or protein synthesis were achieved by including the 5 'untranslated sequence of Rbcs containing a translational enhancer, thereby increasing the set of protein precursors for import into the plastid compartment. The level of Cab bound to the thylakoid membranes and to the LhcIIb complexes was further elevated using a more efficient transit peptide. Changing the transit peptide of Cab from LhcIIb type I with that from the small subunit of ribulose-1, 5-bisphosphate carboxylase increased the level of chloroplast importation. The increase in the content of Cab of LhcIIb type I within the chloroplast allowed the LhcIIb antennas to incorporate the extra proteins and as a result the size of the antennas was increased. Any transit peptide that causes an increase in type I LhcIIb Cab in the chloroplast by substitution of the Cab transit peptide can produce a similar elevation effect. It is also possible to achieve lower import levels by using less efficient transit peptides and thereby regulating the amount of protein expression. The experiments described herein show that the presence of the transit peptide Rbcs increases the importation of a wide range of protein precursors intended for plastids and probably represents the transit peptide with the highest efficiency to date. The term "promoter" or "promoter region" refers to a DNA sequence, usually upstream (5 ') to the coding region of a structural gene, which controls the expression of the coding region providing recognition and binding sites for the RNA polymerase and other factors required for the transcription to start in the right place. There are generally two types of promoters, inducible and constitutive promoters. The term "constitutive" as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but rather that the gene is expressed in a wide range of cell types, although some variation of cell types is often detected. abundance. An inducible promoter is a promoter that is capable of directly or indirectly activating the transcription of one or more DNA sequences or genes in response to an inducer. In the absence of an inducer the DNA sequences or genes will not be transcribed. Typically a protein factor (or factors), which binds specifically to an inducible promoter to activate transcription, is present in an inactive form that is subsequently converted directly or indirectly into an active form by the inducer. The inducer can be a chemical agent such as a protein, metabolite, growth regulator, herbicide or a phenolic compound, or a physiological stress imposed directly by heat, cold, salt or toxic elements or indirectly through the action of a pathogen or disease agent such as a virus. The inductor can also be a lighting agent such as light, dark and different aspects of light, including wavelength, intensity, fluence, direction and duration. A plant cell containing an inducible promoter can be exposed to an inducer by externally applying the inducer to the cell or plant such as by spraying, watering, heating or the like. If it is desirable to activate the expression of a gene at a particular time during the development of the plant, the inducer can be applied at that time.

Examples of such inducible promoters include heat shock promoters, such as the hsp70 heat shock inducible promoter from Drosophila melanogaster (Freeling, M. et al (1985) Ann. Rev. of Genetics 15: 297-323); a trio-inducible promoter, such as the cold-inducible promoter of B. napus (White, T.C. et al (1994) Plant Physiol. 106: 317); and the alcohol dehydrogenase promoter that is induced by ethanol (Nagao, RT et al., Miflin, BJ, Ed. Oxford Surveys of Plant Molecular and Cell Biology, Vol. 3, pp. 384-438, Oxford University Press, Oxford 1986). Among the sequences known to be useful for providing the expression of constitutive genes are the regulatory regions associated with the Agrobacterium genes, such as nopaline synthase (Nos), mannopine synthase (Mas) or octopine synthase (Oes), as well as the regions that regulate the expression of viral genes such as the 35S and 19S regions of cauliflower mosaic virus (CaMV) (Brisson et al (1984) Nature 310: 511-514), or the envelope promoter of the TMV (Ta amatsu et al. (1987) EMBO J. 5: 307-311). Other useful plant promoters include promoters that are highly expressed in the phloem and vascular tissue of plants such as the glutamine synthase promoter (Edwards et al (1990) Proc. Natl. Acad. Sci. USA 87: 3459- 3463), the promoter of corn sucrose synthetase 1 (Yang et al (1990) Proc. Natl. Acad. Sci. USA 87: 4144-4148), the promoter of the Rol-C gene of the ADNTL of the Ri plasmid (Sagaya et al., Plant Cell Physiol., 3: 649-653) and the phloem-specific region of the pRVC-S-3A promoter.

(Aoyagi et al., Mol. Gen. Genet. 213: 179-185 (1988)).

Alternatively, plant promoters such as the small subunit of the Rubisco promoter (Rbcs) may be used.

(Coruzzi et al., EMBO J. 3: 1671-1679 (1984); Broglie et al., Science 224: 838-843 (1984)), or the blow promoters of heat, for example, HPS17.5-E or HPS17.3-B from soybean (Gurley et al (1989) Mol. Cell. Biol. 5: 559-565 (1986)). Other useful promoters that can be used in accordance with the present invention include: Kinl promoter, low temperature cord, and ABA responder (Wang et al (1995) Plant Mol. Biol. 28: 605; Wang and Cutler ( 1995) Plant Mol. Biol. 28: 619); the ABA-inducible promoter of the wheat EM gene (Marcotte Jr. et al (1989) Plant Cell 1: 969); the promoter of the phloem-specific sucrose synthase, ASUS1, from Arabidopsis (Martin et al (1993) Plant J. 4: 367); the promoter of the root and shoots, ACS1 (Rodrigues-Pousada et al (1993) Plant Cell 5: 897); the promoter of the 22 kDa zein protein specific to maize seed (Unger et al (1993) Plant Cell 5: 831); the lectin psl promoter of the pea (from Pater et al (1993) Plant Cell 5: 877); the Phaseolus vulgaris phasor promoter (Frisch et al (1995) Plant J. 7: 503); the late promoter reads abundantly in the embryo (Thomas, T.L. (1993) P2ant Cell 5: 1401); the promoter of the E8 gene specific to the fruit from the tomato (Cordes et al. (1989) Plant Cell 1: 1025); the PCNA promoter specific to the meristematic tissue (Kosugi et al (1995) Plant J. 7: 877); the pollen-specific NTP303 promoter (Weterings et al. (1995) Plant J. 8:55); the late OSEM promoter specific to the embryogenesis stage (Hattori et al (1995) Plant J. 7: 913); the tissue-specific ADP-glucose phosphorylase promoter for guard cells and for tuberous parenchyma cells (Muller-Rober et al (1994) Plant Cell 5: 601); the Myb promoter specific for the conductive tissue (Wissenbach et al (1993) Plant J. 4: 411) and the plastocyanin promoter from Arabidopsis (Vorst et al (1993) Plant J. 4: 933). The construction of the present invention also includes a 5'-untranslated leader sequence, which acts as a translational enhancer. Signs may be required specific initiation for efficient translation of the coding sequences. These signals include the ATG initiation codon and adjacent sequences. The initiation codon must be in phase with the reading frame of the coding sequence to ensure translation of the sequence. The control signals of the translation and the initiation codon can be from a variety of origins, natural and synthetic. The translation control signals and the initiation codon can be provided from the source of the transcription initiation region, or from the structural gene. This sequence can also be derived from the promoter selected to express the gene, and can be specifically modified to increase translation of the mRNA. An example of a translational enhancer of the present invention is the 5 'untranslated region of the small subunit of ribulose-1, 5-bisphosphate carboxylase of the pea. Other nucleic acid sequences demonstrating a translational enhancer activity have been reported for leader or untranslated sequences such as that of the ferrodoxin binding protein gene psaDb (Yamamoto et al (1995) J. Biol. Chem. 270: 12466), ferredoxin (Dickey et al (1994) Plant Cell 5: 1171), the leader of 68 bases of tobacco mosaic virus (TMV) (Gallie et al (1987) Nucleic Acids Res. 25: 3257) and the 36-base leader of the alfalfa mosaic virus (Jobling et al (1987) Nature 325: 622). These translational enhancers can be used in place of the enhancing translational signals of Rbcs of the present invention. Translational enhancer activity is very likely to be present in the 5 'untranslated nucleic acid sequence of most other genes and their corresponding transcripts and can vary in potency and efficacy (see Gallie's review, 1993, Ann. Plant Physiol. Plant Mol. Biol. 44, 77). Such nucleic acid sequences, if proven to contain translational enhancer effects, can also be used in the present invention. A translational enhancer that demonstrates appropriate levels of intensification can be selected to obtain an adequate level of translational intensification in the constructions of the invention. The construction of the present invention also includes a transit peptide. A "transit peptide" refers to a peptide that is capable of directing the intracellular transport of a protein bound thereto to a plastid in a plant host cell. The transient protein can be homologous or heterologous with respect to the transit peptide. Chloroplasts are the primary plastids of photosynthetic tissues, although it is likely that plant cells have other types of plastids, including amyloplasts, chromoplasts and leucoplast. The transit peptide of the present invention is a transit peptide that will provide intracellular transport to chloroplasts as well as to other types of plastids. In many cases, the transit peptides may also contain additional information for intraorganellar vectorization in the plastid to function sites such as the outer and inner membranes of the envelope, stroma, thylakoid membrane or thylakoid lumen. Depending on the origin of the transit peptide, the precursor proteins may show differences in import behavior and import activity such as efficacy. These differences in the importing behavior are attributed not only to the function of the transit peptide but also to the transient protein and are most likely due to interactions between the two portions (Ko and Ko, 1992 J. Biol. Chem. 267, 13910). In photosynthetic prokaryotes, such as cyanobacteria, the proteins can be vectorized towards the photosynthetic and plasma membranes or towards biochemical routes that involve the reduction of sugars and the formation of photosynthetic products. The transit peptide for the polypeptide constituent of the chlorophyll a / b-protein light collecting complex is rich in serine, especially near the NH 2 terminus, in which 7 of the first 13 residues are serine. An abundance of serine also occurs near the NH 2 terminus of the transit peptide for the small pea Rbc subunit (Cashmore, AR, Genetic Engineering of Plants, Eds. Kosuge, T. et al. (Plenum Press, New York, pp. 29-38 (1983)), soybean (Berry-Lowe, SL et al (1982) J. Mol. Appl. Genet., 1: 483-498) and Chlamydomonas (Schmidt, GW et al (1989) J. Cell Biol. 83: 615-623) The transit peptides for the chlorophyll-to-b-protein light collecting complex and for the small Rbc subunit both function in the specific translocation of polypeptides through the chloroplast envelope. , the final destination of these polypeptides is quite different, residing the complex chlorophyll light a / b-protein as integral proteins of the chloroplast thylakoid membrane and the small subunit of Rbc residing as a component of a soluble protein of the chloroplast stroma In a realization, the transit peptide comes from the small subunit of Rbc. The level of Cab bound to the thylakoid membrane and the LhcIIb complex was subsequently elevated using a more efficient heterologous transit peptide. The change of the transit peptide of Cab from LhcIIb type I to that from the small subunit of ribulose-1, 5-bisphosphate carboxylase increased the level of Cab import into the chloroplast. The increase in the content of Cab of LhcIIb type I within the chloroplast allowed the LhcIIb antennas to incorporate the extra proteins and as a result increased the size of the antennas. The gene encoding the protein that is to be transcribed and incorporated into a plastid or a cell of a photosynthetic organism is not particularly limited. Those skilled in the art will recognize that other genes that encode pigments (such as phycobiliproteins) or pigment-binding proteins (such as carotenoid binding proteins) could be used to increase the efficiency of light collection reactions. Many processes of photosynthesis could be increased in a similar way. For example, genes encoding the ATP synthase and ferredoxin subunits involved in electron transport could be incorporated into the constructs of this invention to enhance electron transport. Alternatively, expression and import of pyruvate kinase, acetyl-CoA carboxylase and acyl carrier proteins could be increased, thereby amplifying a biosynthetic pathway, such as carbon / lipid metabolism. Any gene encoding a chlorophyll a / b binding protein (Cab) can be selected as a structural gene. Chlorophyll a / b binding proteins include Lhcl of four different types, LhcII of types I to III, CP29, CP26, CP24 and early light-induced proteins (Green, BR (1991) Trends Biochem, Sci. 16: 181-186). These include genes or cDNAs encoding chlorophyll a / b binding proteins that may belong to the LhcIIa, LhcIIb, LhcIIc, LhcIId, LhcIIe complexes and any other sub-complex of uncharacterized LhcII. The same gene construction scheme can also be applied to genes or cDNAs that encode Lhcl chlorophyll a / b binding proteins that include the chlorophyll a / b binding proteins of Lhcla, Lhclb and Lhclc from photosystem I.

LhcII is the main complex that contains the most abundant members of the family of chlorophyll a / b binding proteins, accounting for approximately 50% of the total chlorophyll of the biosphere and of most chlorophyll b from plants green. Thus, a gene encoding a chlorophyll a / b binding protein of LhclI would be a preferred gene to be targeted to increase the amount of chlorophyll a / b binding proteins. In all plant species examined to date, the chlorophyll a / b binding proteins of LhcII are encoded by a family of multigenes, comprising at least five genes in Arabidopsis, six genes in Nicotiana tabacum, eight genes in N plumbag ini folia and up to 15 genes in tomato (Jansson, S., et al. (1992) Plant Mol. Biol. Rep. 10: 242-253). Thus, any of these genes would be a suitable target to increase the amount of chlorophyll a / b binding protein. Table 1 provides a more complete list of genes encoding chlorophyll a / b binding proteins, including those that are currently in the nucleic acid sequence data banks such as that depicted and listed in Table 2 of the publication from Jansson et al. (1992) supra. TABLE 1 Genes that encode chlorophyll a / b binding proteins, and their relation to the Denominations for chlorophyll-protein complexes Gene Product / Complex Pigment - Protein Gen Green and Thorn Bassi References References col. ber Y (genes) (proteins) * Because many genes of these types have been cloned and sequenced, a review article is given as a reference.

REFERENCES: Green et al. 1991, Trends Biochem. Sci. 16, 181. Thornber et al. 1991, In: Chlorophylls. Scheer, H. (ed.) CRC Press pp. 549-585. Bassi et al. 1990, Photoche. Phototbiol. 52, 1187. Hoffman et al. 1987, Proc. Natl. Acad. Sci. USA 84, 8844.

Jansson and Gustafsson, 1991. Mol. Gen. Genet. 229, 67. Palomares et al. 1991, J. Photochem. Photobiol. B: Biol. 11, 151. Ikeuchi et al. 1991, Plant Cell Physiol. 32, 103. Knoetzel et al. 1992, Eur. J. Biochem. 206, 209. Stayton et al. 1987, Plant Mol. Biol. 10, 127. Pichersky et al. 1988, Plant Mol. Biol. 11, 69. Pichersky et al. 1989, Plant Mol. Biol. 12, 257. Schwartz et al. 1991a, FEBS Lett. 280, 229. Zhang et al. 1991, Plant Physiol 96, 1387. Chitnis and Thornber, 1988, Plant Mol. Biol. 11, 95. Jansson et al. 1990, Bíoc í-n. Biophys. Minutes 1019, 110 Green et al. 1992, FEBS Lett. 305, 18. Schwartz et al. 1991b, Plant Mol. Biol. 17, 923. Brandt et al. 1992, Plant Mol. Biol. 19, 699. Bassi and Dainese, 1990, In: Current Research in Photosynthesis. Vol. II, Baltscheffsky, M. (ed.) Pp. 209-216. Morishige and Thornber, 1991, FEBS Lett. 293, 183. Bassi and Dainese, 1992, In: Regulation of chloroplast biogenesis. Argyroudi-Akoyonoglou, J. (ed.), Pp. 511-520. Morishige and Thornber, 1992, Plant Physiol. 98, 238. Henrysson et al. 1989, Biochim. Biophys. Acta. 977, 301.

Pic ersky et al 1991, Mol. Gen Ger-et. 227, 2/7. Sorensen et al. 1992, Plant Physi .ol. 9Ei, 1538. Schwartz and Pichersky, 1990. Plant Mol. Biol. 15, 157. Morishige et al 1990, FEBS Lett. 264, 239. Spangfort et al 1990. In: (Zurrent Research in Pho tosyn thesis, Vol II / Baltscheffsky, M. (ed.) Pp. 253- 256.

The PSII Cab protein encoded by ICABPSII is the main light collecting antenna associated with PSII and contains 40-60% of the total chlorophyll of the mature chloroplast (Boardman et al (1978) Current Topics in Bioenergeti cs, 8: 35- 109). In addition, in PSII, there is a very high sequence homology between the Cab proteins of type I and type II (Pichersky et al (1989) Plant Mol. Biol. 12: 257). Thus, the target conversion of this gene will significantly alter the chlorophyll content. Useful genes encoding a chlorophyll a / b binding protein, which may be used in accordance with the present invention, include: a) the complexes of the light collection complex I of photosystem I, such as Lhcal of type I, proteins Main PSI Cab, for example Lhcal * l (Hoffman et al (1987) Proc. Natl. Acad. Sci. USA 84: 8844); Lhca2; Lhca3 of type III, the main Cab proteins of the PSI, for example Lhca3 * l (Pichersky et al (1989) Plant Mol. Biol. 12: 257); Lhca4; and b) the complexes of the light collection complex II of photosystem II, such as Lhcbl; Lhcb2 type II, the main Cab proteins, for example Lhcb2 * l (Pichersky et al (1987) Plant Mol. Biol. 9: 109); Lhcb3 of type III, the main Cab proteins, for example Lhcb3 * l (Schwartz et al (1991) FEBS Let t .. 208: 229); Lhcb4; Lhcb5 and Lhcb6.

In one embodiment of the present invention, a nuclear gene encoding a polypeptide constituent of the light-collection complex chlorophyll a / fo-protein (LhclIb type I), which had been isolated from the pea (Pisum sativum) (Cashmore, AR (1984) Proc. Natl. Acad. Sci. USA 81: 2960-2964). In other embodiments, the selected cab genes may represent the two remaining proteins of LhcIIb or other major proteins of Lhclb. In addition to type I, there are two other Cab proteins of LhcIIb: type II and type III. Because these two proteins are constituents of the main light collection complex LhclIb, they can also play an important role in low light and may also be preferred. The Lhclb complex is the main complex for photosystem I and consists of two Cab proteins, Cab Lhclb type I and III. The construction of the present invention also contains a 3 'untranslated region. A 3'-untranslated region refers to that portion of a gene comprising a DNA segment that includes a polyadenylation signal and which may include other regulatory signals capable of affecting mRNA processing, mRNA stability or gene expression . The polyadenidation signal is typically characterized by effecting the addition of a polyadenylic acid region to the 3 'end of the mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology with the canonical form 5'-AATAAA-3 'although variations are not uncommon. Examples of suitable 3 'regions are the 3' transcribed untranslated regions containing a polyadenylation signal of tumor inducing plasmid genes (Ti) of Agrobacterium, such as that of nopaline synthase (Nos gene) and plant genes such as protein storage genes of the soybean and the gene for the small subunit of ribulose-1, 5-bisphosphate carboxylase.

Other suitable 3 'sequences may be derived from any gene characterized from plants as well as from other organisms such as animals, if it is believed that they are functionally appropriate in the environment of a transgenic plant cell or a cell of a photosynthetic organism. In one embodiment of the invention, the 3 'untranslated region is derived from the structural gene of the present construct. When referring to specific sequences in the present invention, it is understood that these sequences include within their scope sequences that are "substantially similar" to the specific sequences. The sequences are "substantially similar" when at least about 80%, preferably at least about 90%, and more preferably at least about 95% of the nucleotides are equal along a defined length of the molecule. Sequences that are "substantially similar" include any sequence that is altered to contain a substitution, deletion or addition of nucleotides compared to the sequences of this invention, especially substitutions that are based on the degeneracy of the genetic code, and that have similar characteristics ( this is, function). DNA sequences that are substantially similar can be identified and isolated by hybridization under conditions of high or moderate severity, for example, which are chosen to not allow the hybridization of nucleic acids having non-complementary sequences. "Severity conditions" for hybridization is a term of the art that refers to the conditions of temperature and concentration of the buffer that allow the hybridization of a particular nucleic acid to another nucleic acid in which the first nucleic acid can be perfectly complementary the second, or the first and the second can share a degree of complementarity that is less than perfect. The "conditions of high severity" and the "conditions of moderate severity" for nucleic acid hybridizations are explained on pages 2.10.1-2.10.16 and on pages 6.3.1-6 in Current Protocols in Molecular Biology (Ausubel, FM et al., eds., Vol. 1, containing supplements up to Supplement 29, 1995), the descriptions of which are incorporated herein by reference. To facilitate the identification of transformed plant cells, the constructs of this invention can be fur manipulated to include genes encoding selectable plant markers. Useful selectable markers include enzymes that provide resistance to an antibiotic such as gentamicin, hygromycin, kanamycin or the like. Similarly, enzymes that provide the production of a compound identifiable by color change such as GUS (β-glucuronidase), or by luminescence, such as luciferase are useful. The constructions of the present invention can be introduced into plant cells by infection with viruses or bacteria or by direct introduction by physical or chemical means. Examples of indirect (infection) and direct methods include Ti plasmids, Ri plasmids, plant viral vectors, microinjection, microprojectiles, electroporation and the like. For reviews of such techniques see, for example, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, New York, Section VII, pp. 421-463 (1988); and Grierson and Corey, Plant Molecular Biology, 2nd Ed., Blackie, London, Cap. 7-9 (1988). The term "transformation" as used herein, refers to the insertion of a construct into a plant cell or into a cell of a photosynthetic organism by any of the above methods. The methods to regenerate whole plants to plant cells are known in the art (See, for example, Plant Molecular Biology Manual, Eds. S.G. Gelvin and R.A. Schilperoort, Kluwer Acad. Publishers, Amsterdam (1988 and supplements until 1993)), and the method for obtaining transformed and regenerated plants is not critical to this invention. In general, the transformed plant cells are cultured in an appropriate medium, which may contain selective agents such as antibiotics, in which selectable markers are used to facilitate the identification of the transformed plant cells. Once the callus is formed, shoot formation can be stimulated using the appropriate plant hormones according to known methods, and the shoots transferred to a rooting medium for regeneration of the plants. Plants can then be used to establish repetitive generations, either from seeds or using vegetative propagation techniques. Also considered as part of this invention are plants and other photosynthetic organisms that contain the nucleic acid construct of this invention. Suitable plants include monocotyledons and dicots, as well as gymnosperms and lower plants (e.g., ferns, bryophytes) included in the Plantae kingdom, and lichens. Examples of preferred monocots include rice, corn, wheat, rye and sorghum. Examples of preferred dicots include cañola, pea, soybeans, sunflower, tobacco, cotton, sugar beet, petunia, tomato, broccoli, lettuce, apple, plum, orange, lemon and rose. Other photosynthetic organisms may also be used as hosts for the construction of the present invention. These include unicellular and multicellular eukaryotic algae, such as Porphyra species, Chondrus crispus, Gigartina species, Eucheuma species, Laminaria species, Macrocystis species, Nereocystis leutkeana, Chlamydomonas reinhardtii, Chlamydomonas moewusii, Euglena gracilis, Cryptomonas Á and Ochromonas sinensis. This invention also includes prokaryotes lacking plastids but having a photosynthetic apparatus, such as cyanobacteria (blue-green algae) and photosynthetic microbes, including, for example, Anacystis nidulans, Spirulina species, Synechococcus species, Rhodobacter sphaeroides, Rhodobacter capsulatus, Chloroflexus aurantiacus and Heliobacterium chlorum. Those skilled in the art can recognize that the examples given above are not limiting. Transgenic plants can be used to provide plant parts according to the invention for the regeneration or for the cultivation of tissues of cells or tissues containing the constructions described herein. Parts of plants for these purposes may include leaves, stems, roots, flowers, tissues, epicotyl, meristems, hypocotyls, cotyledons, pollen, ovaries, cells and protoplasts, or any other portion of the plant that can be used to regenerate plants, cells, protoplasts, or additional transgenic tissue culture. The seeds of transgenic plants are provided by this invention and can be used to propagate more plants containing the constructions of this invention. These descendants are intended to be included in the scope of this invention if they contain the constructions of this invention, whether or not these plants are crossed or crossed with different plant varieties. The constructions of this invention provide materials and methods by which genetic improvements can be made in crop crops to produce a substantial increase in the productivity and economic value of the crops. Most strategies Experiments in the agrobiotechnology and agriculture industries are aimed at increasing the productivity of the crop plants to maximize profits per unit of cultivated land. Although the preferred approach is to directly increase yield, productivity can also be increased by indirect means, such as reducing input costs (for example, fertilizers and water) or by reducing losses due to diseases, insects and competition. These indirect results can be accomplished by incorporating new traits to the crop plants that will decrease the need for fertilizers, confer resistance to the diseases, repel the harmful insects or support the herbicides. Increases in productivity can also result from the improvement of the plant's adaptability to other unfavorable environmental conditions. Additional increments can be achieved by the combination of these traits, by using molecular procedures and producing hybrids. Most of the molecular attempts to alter photosynthesis, direct and indirect, have resulted in the inhibition of photosynthesis. These studies are reviewed by Furbank and Taylor (1995) Plan t Cell 7: 797 and Stitt and Sonnewald (1995) Ann. Rev. Plant Physiol. Plant Mol. Biol. 46: 341. The methods used primarily involved the reduction, by means of antisense transgenes, of the enzymes involved in the processes related to photosynthesis. Ko et al. (1992 Research in Photo synthesis Vol. III: Proceedings of the IXth International Congress on Photosynthesis, Ed. N. Murata, Kluwer Academic Press, pp. 445-448) demonstrated a positive functional change in tobacco. The diversity of organization of the complexes that collect the light and of the Cab proteins involved suggests that the variations of the molecular relationships between the Different complexes that collect light / proteins is one of the key mechanisms of the plant's adaptability to changing light conditions. For example, a possible reorganizing event to produce adaptation to low light conditions could simply be the enlargement of the complexes that collect the light to collect more light by virtue of the size of the antennas or the area of the surface. Larger antennas would capture more light for conversion into chemical energy. So, the increased flexibility of the plant to reorganize the light collection machinery in response to varying light conditions can benefit the plant. Limitations of flexibility may be due to limiting levels of functional Cab proteins expressed in plants; therefore, the elevations of Cab protein levels will suppress the limitations. The suppression of these molecular limitations can result in significant changes in photosynthesis and interrelated activities and processes, resulting in changes in productivity and yield and in improvements in the commerciality and value of the plant and other products of the crop plants. For example, genetic modifications aimed at increasing photosynthesis are especially important in situations in which the production of the crop should be profitable despite the limitations imposed by the various environmental conditions, for example, limiting lighting conditions. The increase of photosynthesis and relative activities can also have a significant impact on crops manipulated to produce non-vegetable products, for example, health products, providing the energy to drive the production of such products. The implications of this type of approach for directed genetic modification are diverse and can not be listed individually or estimated as an individual economic benefit. The impact of this The work can be significant, from an improved crop productivity to indirect savings due to the reduction of the light requirements of the plants grown in the greenhouse. The technology applies not only to crop plants but also to horticultural plants, from indoor plants to orchids or ornamentals. Due to the universality of the photosynthetic process that is being increased, the technology is very likely to be beneficial and applicable to all photosynthetic organisms and plant varieties. In addition to the advancement of knowledge of photosynthesis and related activities, there are four main categories of benefits for agriculture and horticulture provided by this invention: 1) Improved marketability of plant products (eg, greener plants; 2) Improved productivity under conditions low lighting; 3) Improved sowing density; and 4) Improved returns. The development of technologies for the transfer of genes to plant cells and the regeneration of intact and fertile plants from the transformed cells provides methods to modify some of these molecular parameters in order to provide flexibility for the increase of the photosynthetic capacity of a plant in low lighting. The overproduction and elevation of the functional Cab proteins of the light collection antennas of photosystem II allows a plant to reorganize and collect more light for photosynthesis. Modifications that cause a positive effect on photosynthesis can give rise to new desirable traits that have broad benefits in agriculture and horticulture. These new traits in the form of plants produced by genetic engineering can provide plants with advantages in the field, in the greenhouse or in any other form of cultivation practice compared to their normal unaltered equivalents. Advantageous traits can also be introduced by traditional culture strategies to provide any desirable recombinant plant line, for example, elite lines, with the new beneficial traits as well as important agronomically desirable phenotypes established. In particular, the increase of the chlorophyll binding proteins of the plastids can produce a higher chlorophyll content in the plastids. The greenest plants have a commercial value in horticulture, in the production of plants for pots for the house and the garden and for the purpose of artistic reform of the landscape. The improved color and growth resulting from the incorporation of the constructions of this invention can provide superior phenotypes in all plant varieties, including grass grasses, soil coverings, flowers, legumes, trees and shrubs. In addition, high levels of chlorophyll will produce color retention after harvest for fresh produce or dried plant products. The increased levels of carotenoid pigments and phycobiliproteins may also have a commercial value for the same purposes. In addition, increased levels of carotenoids can lead to an increased nutritive value of foods such as carrots, and can increase the resistance of plants to the damaging effects of ultraviolet light. The transgenic plants of this invention demonstrate many other improved properties. Transgenic plants are larger than their wild type counterparts, even under high illumination conditions. After the inclusion of a gene that encodes the protein of Cab union, are greener and show a more robust growth than wild type plants. The constructions of this invention can also provide plants with a means to withstand the shock of transplants. Transgenic transplanted plants recover from setbacks of transplantation more rapidly than wild-type plants. The seeds of transgenic plants are larger and germinate more quickly than seeds produced by wild-type plants, forming more robust seedlings. Faster germination results in larger shoots and larger roots that are less susceptible to fungal and bacterial pathogens that attack germinating seeds and seedlings. In addition, seedlings that quickly establish extensive and deep root systems are more resistant to drought stress. In this way, transgenic seeds and seedlings are more commercially valuable than varieties that exist naturally. In addition, the constructions and methods of this invention can be used to increase the diameter of the stem, thereby increasing the plant support. This is especially valuable for crops that bear fruits such as tomatoes, pears, apples, oranges, lemons and the like. Larger and more robust trunks will allow the development of varieties that can carry and resist more fruit. In addition, newly transplanted ornamental plants, including trees and small shrubs subjected to the wind, can benefit from an increased stem diameter to be maintained until they establish powerful root systems. The growth benefits provided to the transgenic plants and plant cells of this invention can be reproduced by incorporating the constructs of this invention into photosynthetic organisms unicellular and vegetable tissue cultures. In this way, faster production of plant products that are not easily synthesized, such as taxol and other products of the cell wall, which are produced in plants and in slow-growing tissue culture, can be performed. In addition, increased photosynthesis and the subsequent increase in growth under low light intensities means that plant regeneration can be accelerated and illumination can be reduced for tissue culture and plant production. In fact, the reduced luminance requirement of the plants described in this invention may allow these plants to be grown at lower cost in low light facilities such as caves (currently used in the flower industry) and under denser awnings. Much more developed technological uses include cameras associated with life support systems for space travel. Space agencies would like to increase the growth of photosynthetic organisms, and the lower luminance requirements of such organisms would make such a system easier and less expensive to manufacture and operate. A particularly useful embodiment of this invention is the production of shade tolerant herb varieties. These varieties can be planted where the current varieties do not grow due to reduced lighting levels. These include, for example, portions of prairies overshadowed by trees, as well as covered stadiums where Astroturf is currently required due to light limitations. The NFL soccer teams are currently changing the fields of the outdoor stadiums of Astroturf for live grass due to injuries related to Astroturf. However, the fields of the covered stadiums are under domes that limit light, and the grass can not grow in these fields unless a shade tolerant variety is provided. In another aspect of this invention, the constructions of this invention can be used to produce plants with less variability of their growth pattern. The transgenic plants provided by this invention grow more uniformly than wild-type plants under both greenhouse conditions and under field conditions because the available light is efficiently used by all parts of the plant. This characteristic can produce yield advantages in commercially grown plants such as corn or soybeans, in which lower shaded leaves can grow more vigorously, producing an increased biomass that not only contributes to the production of seeds but also eliminates the bad herbs giving them shade. The DNA construct provided by this invention can be used as a transformation marker of a plant, based on the differences in coloration, responses to shade / low illumination and growth and / or faster development, especially under low conditions illumination. The use of naturally occurring DNA sequences of plants allows the detection of the integration of exogenous DNA constructs in cells and photosynthetic organisms without the regulatory problems associated with foreign selectable markers. In particular, there is provided a method for detecting transformation in plants, plant tissue or in a photosynthetic organism consisting of: preparation of a DNA construct containing a promoter region, a 5 'untranslated region containing a translational enhancer, a peptide of specific transit of plastids, a gene that encodes a plastidic protein whose expression is detectable and a 3 'untranslated region containing a signal from functional polyadenylation; insertion of the DNA construct into a vector for cloning and transformation of a plant, tissue culture or photosynthetic organism with the cloning vector for the protein to be expressed, where the expression of the protein is indicative of transformation. Preferably, the expression and import of the protein to the plastids or to the photosynthetic apparatus of the cells are increased in relation to the plastids and wild-type cells. In one embodiment, the encoded protein is the chlorophyll a / b binding protein. The marker gene that is expressed can provide a visibly reactive response, that is, cause a distinctive appearance or growth pattern relative to the plants or cells of photosynthetic organisms that do not express the selectable marker gene, allowing them to be distinguished from other plants, plant parts and cells of photosynthetic organisms for identification purposes. Such a characteristic phenotype (for example, greener cells) allows the identification of protoplasts, cells, groups of cells, tissues, organs, parts of plants or complete plants that contain the constructions. The green pigmentation of the cells can be easily measured and selected using techniques such as FACS (fluorescence activated cell sorting). Galbraith, D.W. (1990) Methods Cell Biol. 33: 547-547. If another gene has been incorporated with the construct, the detection of the marker phenotype makes it possible to select cells that have a second gene to which the marker gene has been linked. This second gene typically comprises a desirable phenotype that is not readily identifiable in transformed cells, but which is present when the plant cell or a derivative thereof is cultured to maturity, even under conditions in which the phenotype of the selectable marker it does not manifest The following examples describe specific aspects of the invention to represent the invention and provide a description of the methods used to provide the constructions of the invention and to identify their function in organisms. The examples should not be construed as limiting the invention in any way. Exemplification Example 1: In vitro Analysis of the Translation and Importation of Proteins A variety of different gene fusions were prepared which demonstrate that the 5 'untranslated region of Rbcs (5'UTR) and the transit peptide Rbcs confer higher levels of translation and import, respectively, of chimeric gene constructs. These in vitro import and translation assay data are summarized in Table 2. In many cases, the transit peptide Rbcs conferred higher levels of importation of the transient chloroplast protein. The enhancing effect of the 5'UTR translation of the Rbcs gene was demonstrated in a wheat germ translation system in vi tro. These data show that the 5'UTR of Rbcs is a translational intensifier by definition. Analysis of protein import and related aspects, such as efficacy, was carried out using radiolabeled proteins in vi tro and in vi tro import tests. Radiolabelled proteins were synthesized from the corresponding DNA templates by transcription and are shown in Table 2. All the transcription plasmids represented were propagated in strains of Escherichia coli HB101 or in the series of strains JM101-109. The transformation of the different bacterial strains was performed using standard protocols (see, for example, Molecular Cloning: A Laboratory Manual, Sambrook et al., 1989, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY). The plasmid DNA was isolated from the bacterial strains harboring the corresponding plasmids using standard protocols (Sambrook et al 1989, supra). A variety of transcription plasmids containing different fusions (Table 2) were linearized at the appropriate restriction sites 3 'to the DNA template of the gene fusion. The buffers for digestion with the restriction enzymes and the conditions of the digestion were used according to the protocols provided by the supplier of each particular enzyme. Molds for gene fusion can be created, inserted and propagated in a variety of commercially available transcription plasmids such as the pBLUESCRIPT series (Stratagene), the pBS series (Stratagene), the pGEM and pSP series (Promega) and the pT7 series / T3 (Pharmacia). Plasmids for transcription normally contain multiple cloning regions for cloning manipulations and at least one of the viral RNA polymerase promoters. These promoters can be, for example, T7, T3 or SP6, which use the corresponding RNA polymerase. Restriction enzyme was added to give 5-10 units per microgram of DNA and the reaction mixture was adjusted to the appropriate final volume with water. The final volumes were usually 200 μl and contained 10 μg of plasmid DNA. The digestions were thoroughly mixed and carried out for 1-3 hours at the appropriate suggested temperature. The digested templates were repurified by extraction with phenol and chloroform: isoamyl alcohol, centrifugation (usually in a microfuge) and the aqueous layer containing the digested DNA concentrated by precipitation in two volumes of 100% ethanol in the presence of sodium acetate 0.3 M, pH 7.0. The phenol used was saturated with 0.1 M Tris-HCl, pH 8.0 plus 0.1% (w / v) of hydroxyquinoline before being used. He chloroform: isoamyl alcohol consisted of 24 volumes of chloroform and 1 volume of isoamyl alcohol. Equal volumes of the aqueous reaction mixture and phenol or chloroform: isoamyl alcohol were used in each of the extraction steps with organic solvents. The DNA precipitates were collected by centrifugation, washed once with 70% (v / v) ethanol, dried and redissolved in a volume of 20 μl of water before transcription in vi tro. The templates were transcribed in vi tro using the appropriate RNA polymerase corresponding to the type of promoter according to Melton et al. (1984) Nucí. Acids Res. 12: 7035. A non-methylated cap analogue (GpppG), normally at a concentration of 0.5 mM (Pharmacia), was included in the reactions. A typical transcription reaction (200 μl total volume) consisted of DNA template (5 μg), RNA polymerase (40 units of SP6, T3 or T7), buffer for the transcription reaction (final concentration of 40 mM Tris-HCl pH 7.5, 6 mM MgCl2, 2 mM spermidine, 10 mM NaCl), dithiothreitol (DTT, 5 mM), 40 units of RNAin and 0.25 mM of ATP, GTP, CTP and UTP. The transcripts were repurified by extraction with phenol and chloroform: isoamyl alcohol, centrifugation and the aqueous layer containing the RNA transcripts concentrated by precipitation with 750 μl of 100% ethanol in the presence of 0.3 M potassium acetate pH 7.0. The transcripts (330 μl of the reaction) were concentrated after precipitation in ethanol by centrifugation, washed with 70% (v / v) ethanol / water, dried and redissolved in 34 μl of water in the presence of 20-40 units of RNAin. Alternatively, the transcript precipitates were stored at -70 ° C until used. The transcripts were then translated into a system of wheat germ extract containing radiolabeled methionine with 35S (New England Nuclear or Amersham) or TRAN 35S-Label (ICN) containing both radiolabeled methionine and cysteine. The wheat germ extracts were prepared according to Erickson and Blobel (1983) Methods in Enzymol. 96: 38 with some modifications. The wheat germ extract was prepared by grinding 3 g of wheat germ without toasting (General Mills, Inc., Minneapolis, MN) using a mortar and a hand of starch in the presence of liquid nitrogen. The grinding continued until a fine powder was obtained. The powdered wheat germ was then transferred to a second pre-cooled mortar in which grinding continued in the presence of 12 ml of homogenization buffer (100 mM potassium acetate, 40 mM Hepes-KOH pH 7.6, 4 mM DTT, 2 mM CaCl 2, 1 mM magnesium acetate) until the mixture had a thick paste consistency. The homogenate was then transferred to 30 ml Corex tubes and centrifuged for 10 minutes at 31,000 x g at 4 ° C. The supernatant was recovered and centrifuged in a 15 ml Corex tube for another 10 minutes at the same strength of g. The final supernatant was carefully removed and its volume determined (typically 8-9 ml). The supernatant was loaded on a Sephadex G-25 Fino (Pharmacia) column (2.5 X 20 cm) which was pre-sterilized by autoclaving. The column consisted of 20 g (giving a column bed of 2.5 X 18 cm) of Sephadex G-25 Fino (Pharmacia, Sigma) pre-soaked overnight with cold water, sterilized and equilibrated with column buffer (sodium acetate). 100 mM potassium, 40 M Hepes-KOH pH 7.6, 4 mM DTT, 5 mM Magnesium Acetate) before use. The wheat germ extract was eluted at a rate of 1-1.5 ml / min with buffer for the column and the fractions were collected when the advancing brown band migrated two thirds down the column. The protein content of each fraction was monitored by measuring the absorbance at 280 nm in a spectrophotometer. The fractions that included the first peak were grouped and mixed. Aliquots of this First peak eluids were rapidly frozen in liquid nitrogen and stored at -70 ° C until use. A typical translation reaction consisted of a transcript from 330 μl of precipitate in ethanol dissolved in 34 μl of water, 20-40 units of RNAin, 5-6 mM ATP, 0.4 mM GTP, 64 mM creatine phosphate, 0, 08.0.09 mM of each amino acid, except that methionine or methionine plus cysteine were not added, depending on the type of amino acid (s) labeled (s) with 35S used, 4-8 units of creatine phosphokinase, buffer of compensation (final concentration: 100 mM potassium acetate pH 7.0, 2 mM DTT, 0.3 mM magnesium acetate, 0.8 mM spermidine) and wheat germ extract (80 μl in a 200 μl reaction) . The amount of radiolabelled amino acid used in the translations was based on the radiolabeled methionine alone in an amount of 200 μCi per reaction. The translation reactions were carried out for 1.5 hours at 26-27 ° C and normally the products of the translation were analyzed before the import tests or other related experimentation by SDS-polyacrylamide gel electrophoresis (SDS-). PAGE) and fluorography. The amount of incorporation of the radiolabel was determined by counting the radioactive beads precipitated by TCA from samples of 1 μl of each translation reaction. The intact chloroplasts used in the import trials were purified from pea seedlings (cv Progress de Laxton Mejorado) as described by Bartlett et al. (1982) Methods in Chloroplast Molecular Biology, (eds. Edelman et al.) Pp. 1081-1091 or Cline et al. (1985) J. Biol. Chem. 260: 3691). The growth conditions were identical to those previously described (Ko and Cashmore (1989) EMBO J. 8: 3187). Pea seedlings from 200 g of seeds were grown for 9-11 days in growth chambers set at 21 ° C under fluorescent lighting with a light photoperiod: darkness of 16: 8 hours. The pea seedlings were collected and homogenized in cold trituration buffer (50 mM Hepes-KOH pH 7, 6, 0.33 M sorbitol, bovine serum albumin (BSA) 0.05% (w / v), 0.1% ascorbate (w / v), 1 mM MgCl 2, 1 mM MnCl 2, 2 mM Na 2 EDTA) for 2- 3 brief mixes of 5-10 seconds to a position of 5-6 in a Polytron Homogenizer. All stages were performed at approximately 4 ° C. The homogenate was then filtered through three layers of Miracloth and the crude chloroplasts were collected by centrifugation at 2800 x g for 3 minutes at 4 ° C. The crude chloroplast pellet was resuspended in 4 ml of crushing buffer and placed on a 10-80% Percoll gradient (50 mM Hepes-KOH pH 7.6, 0.33 M sorbitol, 0.05% BSA (p. / v), ascorbate 0.1% (w / v), polyethylene glycol 0.15% (w / v), Ficoll 0.05% (w / v), glutathione 0.02% (w / v), MgCl2 1 mM, 1 mM MnCl2, 2 mM Na2EDTA and Percoll). The gradients were centrifuged in a tilting rotor at 10,000 x g for 10 minutes at 4 ° C and the band of intact chloroplasts was collected close to the bottom of the gradient and diluted at least five times with HS buffer 1 x (50 mM Hepes-KOH pH 8.0, 0.33 M sorbitol). The intact plastids were collected by centrifugation at 4,350 x g for 2 minutes. This stage was repeated with the agglutinated chloroplasts resuspending in HS 1 x. The final pellet was resuspended in 5 ml of HS 1 x and an aliquot was subjected to the chlorophyll analysis. The chlorophyll assays were performed as described by Arnon (1949) Plant Physiol. 24: 1. The samples were extracted with acetone 80% (v / v) / water 20%. The insoluble material was removed by centrifugation in a microfuge for 1 minute at high speed. The supernatant was collected for the spectrophotometric analysis of chlorophyll according to the equation of Arnon conversion. The in vitro import tests were carried out in volumes of 0.3 ml as described by Bartlett et al. (1982) Methods in Chloroplast Molecular Biology, eds. Edelman et al., Pp. 1081-1091. The reactions typically contained an equivalent of 100 μg of chloroplast chlorophyll; translation products radiolabeled with 35S adjusted to HS 1 x, 10 mM methionine, 10 mM cysteine (when TRAN35S-Label was used) and import buffer (HS 1 x). The samples were shaken gently for 30 minutes at room temperature under fluorescent lights. Import tests can be performed alternatively using exogenously added ATP instead of the light-directed synthesis of ATP. Typically, amounts such as 1 mM-3 mM ATP can be added. Intact chloroplasts were reisolated for subsequent treatment and subfractionation according to the scheme described by Smeekens et al. (1986) Cell 46: 365. After the reaction, the chloroplasts from the import tests were collected by centrifugation at 686 x g for 3 minutes, resuspended in 500 μl of HS 1 x, treated with thermolysin (final concentration 1 μg / μl) and reisolated through 40% Percoll bands by centrifugation at 1940 x g for 4 minutes. The intact chloroplasts were collected in the lower part of the tube and resuspended in 500 μl of HS 1 x, washed once by centrifugation at 686 x g for 3 minutes and resuspended in 50 μl of solution A (0.1 M Na2C03, 0.1 M β-mercaptoethanol). Samples of 5 μl were withdrawn from each import reaction for chlorophyll analysis as described above. The chlorophyll content was used to normalize the samples before loading them into protein gels. The resuspended chloroplast pellets were then prepared for SDS-PAGE by the addition of 30 μl of solution B (SDS 5% (w / v), sucrose 30% (w / v), bromophenol blue 0.1% (w / v)) and boiled for 30 minutes. seconds. Aliquots from translations of the wheat germ in vi tro and from the different import reactions were analyzed by SDS-PAGE using appropriate gel density percentages (Laemmli, (1970) Nature 227: 80). After electrophoresis, the gels were prepared for fluorography using ENHANCE ™ (New England Nuclear) according to the manufacturer's instructions and exposed to a Kodak XAR ™ X-ray film. The import levels and the distribution of the imported products were calculated from the fluorograms using a densitor etro Laser LKB ULTRASCAN XL. The results of protein fusions are summarized in Table 2. TABLE 2. Summary of import results and translation in vi tro for various constructions. A) Plants B) Studies in test tube Example 2: Construction of the Rbcs-Cab Gene Construction To produce transgenic tobacco plants with photosynthetic capacity at low illumination increased by raising the levels of the Cab protein of LhcIIb type I, an increase in transcription was achieved. AR? m stability, translation and import of proteins. The coding portion of the gene construct was a fusion of a sequence of AD? (Figure 1, SEQ ID ?: l) that codified the mature portion of the LhcIIb type I Cab protein (Figure 1, SEQ ID No. 2) of the pea. The coding sequence of the native transit peptide was deleted and replaced by a sequence for the transit peptide from the small subunit of pea Rbc (AR Cashmore, in Genetic Engineering of Plants, T. Kosugi, CP Meredith, A. Hollaender, Eds. (Plenum Press, New York, 1983) pp. 29-38). The 5 'and 3' ends of the LhcIIb type I gene sequence used in the present construct are shown in Figure 1. The transit peptide Rbcs (SEQ ID NO: 4), and the corresponding gene sequence (SEQ ID NO: 3), are shown in Table 3, together with a short adapter sequence that binds the transit peptide to the Cab peptide. A 29 'base pair (5'UTR) untranslated 5' DNA sequence originating immediately upstream of the coding region of the pea Rbcs transit peptide was used as a translation enhancer. This sequence is shown in Table 3 and is included within SEQ ID NO: 3 (nucleotides 1 to 29). The expression of the gene construct was facilitated by the potent 35S CaMV promoter (Odell, J.T. et al. (1985) Nature 313: 810) and by the transcription termination signals originated from the pea cab gene (A. R. Cashmore (1984) Proc. Natl. Acad. Sci. USA 81: 2960). A summary of the gene construct is shown in Table 3. TABLE 3. Summary of Gene Construction 35SCaMV-Rbcs-Cab Key structural parts: Rbcs (5 'untranslated sequence) -peptide peptide Rbcs pea-body protein Pea Cab Genetic names of published key parts: SS3. 6 (5 'untranslated sequence) -Rbcs transit peptide SS3.6-Cab AB80 protein body Sequence of key parts: ACGTTGCAATTCATACAGAAGTGAGAAAA ATG GCT TCT ATG ATA TCC M A S M I S TCT TCC GCT GTG ACA ACA GTC AGC CGT GCC TCT AGG GGG CAA TCC GCC S S A V T T V S R A S R G N S A GCA GTG GCT CCA TTC GGC GGC CTC AAA TCC ATG ACT GGA TTC CCA GTG A V A P F G G L K S M T G F P V AAG AAG GTC AAC ACT GAC ATT ACT TCC ATT ACA AGC AAT GGT GGA K K V Q T E I T S I T S Q G G AGA GTA AAG TGC ATG GAT CCT GTA GAG AAG TCT R V K C M D P L E K S Rbcs < -? Cab Promoter: 35S CaMV Terminator: Cab termination sequences (Cashmore (1984) Proc. Nati. Acad. Sci. USA 81: 2960-2964) Binary vertor: -E-coRI-PvuII CaMV-Rbcs-Cab on the site of - BamHI / ext roe of pE? D4K (kanamycin resistance) (Klee et al. (1985) Biotechnology 3: 637-642). Agrobacterium strain: LBA4404 Agrobacterium transformation: Freeze-thaw method (Holsters et al. (1978) Mol. Gen. Genet. 163: 181-187) Transformation protocol: Leaf disc procedure (Horsch et al. (1985) Science 227: 1229-1231) The cloning was initiated by the construction of the pSSTP vector containing a sequence of AD? what encoded the 5'UTR of Rbcs and the transit peptide (Figure 2). The DNA fragment containing the required components was recovered from the plasmid pSSNTP (A. R. Cashmore, Univ. Pennsylvania, Philadelphia, PA) by digestion with HindIII. An extraction with phenol and chloroform: isoamyl alcohol and a precipitation with ethanol in the presence of 0.1 M NaCl followed by a wash with 70% ethanol were applied after each step of DNA manipulation as described in Example 1 to inactivate the enzymes and concentrate the DNA. The DNA precipitate was collected by centrifugation, dried and redissolved in 10 μl of water. The HindIII terminus became blunt using the Klenow fragment of E. coli DNA polymerase I (Promega). The reaction consisted of 1 unit of Klenow, dATP, dCTP, dGTP and 0.1 mM dTTP each, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 5 mM DTT and the DNA from the previous step, and was incubated at 37 ° C for 1 hour. After repurification by extractions with organic solvents, the DNA was digested with Ba-mHI, separating the required DNA fragment from the rest of the plasmid pSSNPT. The HindIII-BamHI DNA fragment was gel purified and ligated into the Smal and BamHl sites of pGEM4 (Promega) which had been subsequently cut and dephosphorylated by calf intestinal alkaline phosphatase (Pharmacia). DNA purification was carried out using the standard method in low melting point agarose gel and phenol extraction (Sambrook et al 1989, supra). Low melting point agarose was purchased from BRL (Gaithersburg, MD, USA). He DNA was recovered from the appropriate low-melting agarose sections by heating at 65 ° C followed by extraction with phenol, preheated initially at 37 ° C, and centrifugation. The phenol extraction was repeated and the aqueous DNA layer was then adjusted to 0.1 M NaCl and centrifuged for 10 minutes in a microfuge. He The supernatant was subjected to extraction with chloroform isoamyl alcohol followed by ethanol precipitation as described above. The DNA pellet was collected by centrifugation, washed with 70% ethanol, dried and resuspended in water. The DNA sequence encoding mature Type I LhcIIb Cab (Pea AB80), contained in a Xbal-Ps1 DNA fragment, was recovered by digestion of plasmid pDX80 (AR Cashmore, Univ. Pennsylvania, Philadelphia, PA) with Xbal and Ps ti (Figure 3). The DNA fragment was also gel purified and inserted into the plasmid vector pSSTP (Figure 2) through the Xbal and Psti sites. Prior to ligation, these sites had been dephosphorylated by adjusting the restriction digestion reaction with 3.5 μl of 1 M Tris-HCl, pH 8.0 and adding 0.5 units of calf intestinal alkaline phosphatase. After a 30 minute incubation at 37 ° C, the dephosphorylated vector was repurified by extraction with organic solvents and ethanol precipitated. The resulting plasmid was designated pRBCS-CAB (Figure 3). The chimeric Rbcs-Cab gene was fused to the 35S constitutive promoter of CaMV by inserting a gel-purified ScoRI-Hindlll fragment carrying the CaMV 35S promoter from the pCAMV plasmid (AR Cashmore, Univ. Pennsylvania, Philadelphia, PA) at the sites from BcoRI-Asp718 from pRBCS-CAB (Figure 4). The corresponding restriction sites of HindIII and? Sp718 were made blunt using the Klenow fragment of DNA polymerase I. The 35S CaMV-Rbcs-Cab construct was then transferred as an EcoRI-PvuII DNA fragment to the BamH1 site of the binary vector pEND4K (Figures 5 and 6) (Klee, H. et al (1985) Biotechnology 3: 637). All the ends generated by the restriction enzymes were made blunt by the Klenow fragment at this stage.

All ligation steps were carried out at 15 ° C overnight using T4 DNA ligase. The ligation reactions consisted of the two appropriate target DNA molecules, ligase buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl 2, 1 M DTT, 1 mM ATP) and 1-3 units of enzyme. All the appropriate steps of the gene construction process were introduced into bacteria using the standard bacterial transformation protocol with CaCl2 (Sambrook et al 1989, supra) and the host strain of E. coli HB101. All recombinant plasmids were propagated in HB101 and isolated using standard techniques (Sambrook et al 1989, supra). The resolution of the DNA fragments was facilitated using standard agarose and polyacrylamide gel electrophoresis techniques. Example 3: Transformation and Plant Selection Plasmid pEND4K-CAMV-Rbcs-Cab was introduced into Agrobacterium using the freeze-thaw method. (Holsters et al (1978) Mol. Gen. Genet 163.-181-187). Competent LBA4404 cells were obtained by inoculating 50 ml of LB broth (50 μg / ml rifampicin) with 500 μl of a one-night culture, followed by incubation at 28 ° C with vigorous stirring until the cell density measured 0.78 to 650 nm. The cells were harvested by centrifugation at 2000 x g for 5 minutes at 4 ° C, washed in ice-cold 0.1 M CaCl 2 and resuspended in 1 ml of mM CaCl2 cooled in ice. An aliquot of 150 μl of competent LBA4404 cells was mixed with 1 μg of plasmid DNA in a microfuge tube, and immediately frozen in liquid nitrogen. These cells were incubated at 37 ° C in a water bath or in a thermostated block for 5 minutes, 1 ml of LB broth was added and the mixture was incubated at 28 ° C with shaking for 3 hours. The cells were recovered by centrifugation at 2000 x g for 5 minutes and resuspended in 100 μl of LB broth. The cells were plated on LB plates containing 100 μg / ml kanamycin and 50 μg / ml rifampicin and incubated for 2 days at 28 ° C. The presence of plasmid pEND4K-CAMV-Rbcs-Cab was confirmed by transfer analysis Southern of plasmid preparations obtained from individual colonies resistant to kanamycin. 3 ml of YEB broth containing 50 μg / ml of rifampin and 100 μg / ml of kanamycin were inoculated with a kanamycin resistant colony and incubated overnight at 28 ° C with shaking. The overnight culture (1.5 ml) was centrifuged for 30 seconds in a microfuge. The cells were resuspended in 0.1 ml of GTE solution (50 mM glucose, 10 mM Na2EDTA, 25 mM Tris-HCl pH 8.0) with 4 mg / ml lysozyme and incubated at room temperature for 10 minutes. Phenol (30 μl) previously equilibrated with 2 volumes of 1% SDS (w / v), 0.2 N NaOH was added. The mixture was vortexed gently until it became viscous and incubated at room temperature for 10 minutes. The lysed cells were neutralized with 3 M sodium acetate, pH 4.8 (150 μl) and incubated at -20 ° C for 15 minutes before the mixture was centrifuged for 3 minutes in a microfuge. The supernatant was transferred to a new microfuge tube, two volumes of ethanol were added and the mixture was incubated at -80 ° C for 15 minutes to precipitate the DNA. After centrifugation, the DNA pellet was resuspended in 90 μl of water. 10 μl of 3 M sodium acetate pH 7.0 was added, followed by an equal volume of phenol / chloroform, and the mixture was vortexed. After centrifugation for 5 minutes in a microfuge, the supernatant was transferred to a new tube and the DNA was precipitated by adding 2 volumes of ethanol 100% After centrifugation, the pellet was washed with 70% ethanol, dried and resuspended in 50 μl TE (10 mM Tris-HCl pH 8.0, 1 mM Na2EDTA). The integrity of the pEND4K-CAMV-Rbcs-Cab plasmid in Agrobacterium was verified by restriction analysis and Southern blotting of the isolated plasmid as described above and in Sambrook et al. 1989, supra. One of the selected colonies of Agrobacterium that contained an intact pEND4K-CAMV-Rbcs-Cab was used for the transformation of plants. Tobacco plants were transformed with the pEND4K-CAMV-Rbcs-Cab plasmid following the sheet disc transformation protocol essentially as described by Horsch et al. (1985) Science 227: 1229). Only young leaves, not fully developed, 3-7"long, of one-month-old plants were used, the excised leaves were sterilized on their surface in 10% sodium hypochlorite (v / v), 0.1 Tween. % (v / v) and washed 4 times with sterile deionized water From this point forward, standard aseptic techniques were used for material handling and sterile media. The aid of a sterile paper driller was incubated for 10-20 minutes in a 1: 5 dilution of an overnight culture of Agrobacterium that harbored the construction pEND4K-CAMV-Rbcs-Cab After inoculation, the excess bacteria was removed from the discs by briefly drying them on sterile filter paper and the discs were transferred to Petri dishes containing "shoot medium" (Horsch et al. (1988) in Plant Molecular Biology Manual, (Eds. SB Gelvin, RA Schilperoort) Kluwer Acad. Publishers, A5: 1-9) Petri dishes were sealed with parafilm and incubated in a growth chamber (24 ° C and equipped with mixed fluorescent tubes for "increase"). After two days, the Agrobacterium growing on the discs were destroyed by washing in 500 mg / ml of Cefotaxime in liquid "medium for shoots" and the discs were transferred to fresh "bud medium" containing 500 mg / ml of Cefotaxime and 100 mg / ml of kanamycin to select for the growth of transformed tobacco cells. Leaf discs were incubated under the same growth conditions described above for 3-5 weeks, and were transferred to fresh medium weekly. During this time period, approximately 40 green shoots that emerged from the 60 discs were cut and transferred to a "root medium" (Horsch et al (1988) supra) containing 100 μg / ml kanamycin. The shoots that took root in the presence of kanamycin and that were found to possess high levels of NptII activity (McDonnell, R.E. et al. (1987) Plant Mol. Biol. Rep. 5: 380) were transferred to land. The selected transformants were autocrossed and the seeds were collected. The TI seeds from seven transgenic tobacco lines that showed high levels of NptII activity were propagated in low light parameters (50-100 μmolSSpf2 ^ 1) to determine which lines contained high levels of transgenic mRNA in steady state. The same construction has been introduced in two crops of Arabidopsis, in three crops of Brassica, tomato, lettuce and alfalfa. All these species demonstrated an increased growth in culture compared to their wild-type equivalents, especially under low light intensities. These plants had a better avoidance response in the shade. They grew faster, larger, and sought light with more sensitivity than their wild-type counterparts. This is evident at 65 μmoles / meter2 / second of lighting in tobacco and lettuce, and at 5 μmoles / meter2 / second of illumination for Arabidopsis Example 4: RNA Analysis Isolation of total RNA and subsequent analyzes of blot hybridization were carried out as described in A.R. Cashmore, 1982 in Methods in Chloroplast Molecular Biology, M. Edelman, R.B. Hallick, N.H. Chua, Eds. (Elsevier Biomedical Press, pp. 533-542) and Maniatis, T., Fritsch, E.F. and Sambrook, J., Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1982)). The total RNA was isolated from twenty individual IT plants of each primary transformant. Samples of the leaves were collected between 11:00 a.m. and 1:00 p.m. Denaturing gels with formaldehyde were used to resolve the RNA and transfer it to nitrocellulose as described (Sambrook et al 1989, supra). The RNA transfer (Figure 7A) was probed with the Pea CaJb DNA probe (labeled SONDA 1), cut into strips and re-hybridized with the DNA probe specific for the pea Rbcs transit peptide. (marked SONDA 2). The numbers 1-7 indicate the primary transformants that carry the transgene -Rbcs-Ca and that show high levels of NptII activity. Plants 7-12 represent plants that have been transformed with a Cab construction of the control pea. Plant 13 represents a non-transformed wild type tobacco plant (Nicotiana tabacum cv Petit Havana SR1). The levels of transcripts detected by the Cab DNA probe of the pea were normalized and quantified by laser densitometry. Plants that were produced from transformant lines 3 and 5 contained the lowest amount of pea cab mRNA, while lines 1, 2 and 7 contained the highest levels. The same results were obtained with the DNA probe specific for the pea Rbcs transit peptide (Figure 7A). The total RNA of wild-type plants (WT) not hybrid with any of the DNA probes. Individual TI plants of the lines with the highest levels of transgenic mRNA observed were autocrossed and subjected to segregation analysis. The transgenic mRNA levels of the subsequent homozygous lines were analyzed in the same manner as the primary transforming lines (Figure 7B). The numbers indicate the derivation of the homozygous lines. The seeds were germinated at 24 ° C on moistened filter paper, transferred to pots containing a mixture of soil and vermiculite (1: 1) and propagated in growth chambers placed at 50-100 μmoles-m "2-s_1 of illumination With a photoperiod of 14 hours of light / 10 hours of darkness and 24 / l8 ° C of day / night temperature, the pots were irrigated daily with a complete nutrient solution containing 10 mM nitrate and 2 mM ammonium. Elevated transgenic mRNA and showed the same phenotype Example 5: Analysis of Proteins and Chlorophyll The protein profiles of the thylakoids of the homozygous lines derived from the transgenic line 2 (TR) were compared with the wild type (WT) to determine if additional transgenic transcripts resulted in an overall increase in Cab levels in steady state, nine discs from different leaves of the homologous transgenic lines were collected. ocigotes derived from primary transformant 2 (labeled TR) and from wild type plants (labeled WT). Samples were collected between 11:00 a.m. and 1:00 p.m. Thylakoids were isolated (K. E. Steinback et al., In Methods in Chloroplast Molecular Biology, M. Edelman, R.B. Hallick, N.H. Chua, Eds.

(Elsevier Biomedical Press, Amsterdam, 1982) pp. 863-872; Vernon, L.P. (1960) Anal. Chem. 32: 1144) and analyzed using standard immunoblot techniques. The Cab / Oeel ratios were determined by laser densitometry of the corresponding immunostained bands. The bands corresponding to Oeel and Cab are indicated. Increases in global levels of Cab protein were detected by simultaneously probing the transferences with antibodies against the 33 kDa protein of the oxygen producer complex of PSII (Oeel) and Cab (Figure 7C). Cab's relation to Oeel was used to determine Cab levels in relation to PSII units using Oeel as an internal marker of PSII levels. The results of the densitometry indicated that the level of the Cab protein was increased 2-3X in relation to Oeel, suggesting that there is more Cab protein per PSII. The parallel increase in the chlorophyll content became evident when the LhcII complexes were isolated (K.E. Steinback, (1982) supra).; L.P. Vernon (1960) supra). Approximately 1.5X plus chlorophyll and approximately 2-3X plus LhcII complexes were recovered per gram of fresh leaf weight, indicating that additional Cab proteins are functionally binding to chlorophyll. Example 6: Morphological and Development Analysis The TR plants, the primary transformants and the subsequent self-cross homozygous lines, exhibit growth and morphological differences in relation to the WT under all conditions tested, for example, in greenhouses or in culture chambers. All the plants shown were in the same age of development and were propagated as described above. The TR plants show a higher level of vigor under low illumination regimes (50-80 μmoles-m ^ -s "1) (Figure 8A) The responses of TR plants to high illumination are increased, producing more biomass and more robust growth patterns, depending on the intensity of lighting conditions during propagation. TR plants are larger than their WT equivalents under high light intensities, such as those in greenhouses. Among other characteristics, the TR plants, compared with the WT plants, show an increased stem diameter and less variability in the growth pattern. In addition, field trials show that TR plants grow as well as WT plants under field conditions with full sunlight in terms of biomass and size. No harmful effects were observed in TR plants under these conditions. The elevation of Cab seems to induce a series of changes, the most prominent being wider leaves with a soft limb, a continuous border around the leaves, greater vegetative biomass and a delayed flowering time. In addition to the overall enlargement of the leaf size, the base of the petiole is more extended in relation to the leaves of WT (the 7th fully developed leaf of WT and TR was compared) (Figure 8B). The TR sheets are thicker with relatively larger intercellular spaces (Figure 8C). The optical micrographs (Figure 8C) represent samples of the intermediate area of leaf limb. The leaf pieces were fixed in FAA50 and examined using an optical microscope (D.A. Johansen, Plant Mi ero technique, (McGraw-Hill Book Co., New York, 1940)). Leaf samples were selected as above and processed for electron microscopy by fixation in 2.5% glutaraldehyde buffered with 0.1 M phosphate buffer (pH 7.5) and post-fixation with 1% osmium tetroxide for 2 hours. After dehydration in a series of ethanol, the leaf samples were included in Spurr resin, sectioned and further stained in uranyl acetate and lead citrate (Spurr, AR (1969) J. "Ul trastr Res. 26: 31; Reynolds, ES (1963) J. Cell Biol. 17: 208; Watson, M.L. (1958) J. "Biophys., Biochem. Cytol., 4: 475.) The same scale is applied for the photos of mesophilic tissue of WT and TR.The cells of the TR leaves contain a higher number of chloroplasts on a per-cell basis. Cell and plastids are larger with a noticeably more round shape (Figure 11) No differences were detected in the internal organization of the plastids, for example stacking of the thylakoids, at the resolution level used No differences were detected at any level with respect to mitochondria, vacuoles or nuclei The germination rate of the TR seeds was markedly different from that of the WT seeds.The TR seeds germinate 1-3 days on average before the WT seeds in solid MS media (Figure 9) ), and the newly introduced TR seedlings are already green and grow faster after their appearance than WT seedlings.The WT seedlings emerge yellowish and begin to green in the day. ne TR cells grow 2-3X faster than callus containing WT cells (Figure 10). The transplants of the TR plants also support the transplant shock better than the transplants of the WT plants. They recover and establish normal growth patterns more quickly. Example 7: Physiological and Biochemical Analysis Functionality and increase in photosynthetic activity as a result of extra Cab protein were determined using four different criteria: 1) Characteristics of gas exchange; 2) Changes in the level of metabolites; 3) Carbohydrate content; and 4) Efficiency of electron transport in the PSII. The photosynthetic rates of TR and WT plants propagated under limiting lighting conditions were compared. The plants were cultivated under two different intensities of light, 50 μmoles-m "2-s_1 (referred to as low, (Figure 12A)) and 500 μmoles-m "2-s-1 (referred to as high (Figure 12B)). Photosynthesis was measured using an oxygen electrode for leaf discs (LD2 / 2).

Hansatech, R.U.) under 5% saturating C02 at 25 ° C. The C02 5% was supplied from 200 μl of a 2 M KHC03 / K2C03 mixture (pH 9.3) on a felt at the base of the sheet disc electrode (Walker, DA (1987) The use of the oxygen electrode and fluorescence probes in simple measurements of phot or syn thesis, University of Sheffield, Sheffield, UK). Lighting was provided by a Novomat 515 AF slide projector (Braun, Germany).

The data are means of 5 plants of each phenotype. The standard deviations were less than 10% of the means. The photosynthetic response curves of the TR plants show a different behavior from those of the WT plants (Figure 12A). With low illumination (between 20-100 μmoles-pf2-s), the TR plants show a higher rate of photosynthesis than the WT plants; while the opposite situation occurs with higher light intensities (Figure 12A). As the light intensity increases, the response curves are more similar, intersecting approximately 300 μmoles-m "2-s_1, where the TR tissue reaches saturation at a lower rate, at the same luminous intensity, the increase in photosynthesis is higher and has not reached saturation in WT tissue.

Saturation in the WT fabric takes place at 450 approximately . The same response was shown for plants grown with higher irradiation (500 μmoles-m ^ -s "1) (Figure 12B) .The rate in the TR tissue is higher than in the WT tissue in the range of 20-500 μmoles- m ^ -s "1, reaching saturation at higher light intensities, while WT remains unsaturated at 1000 μmoles-m" 2-sx.

Increased photosynthetic capacity in low illumination of the TR tissue was also evident in the C02 levels of the air and at a luminous intensity of 100 μmoles-m "2-s_1, in which the TR tissue exhibited an average photosynthetic rate 50% higher than WT tissue (3.3 + 0.8 vs 2.2 + 0.8 μmoles 02-m "2-s" 1, respectively) Alterations in metabolite and adenylate levels are also indicators of changes in Photosynthetic capacity In low illumination, photosynthesis is mainly limited by the ability of electron transport to generate ATP and NADPH, the assimilating force FA (Heber, U. et al. (1986) Biochim. Biophys. Acta. 852: 144; Heber et al., In Progress in Pho tosyn thesis Research, J. Biggins, Ed., (Martinus Nijhoff, Dordrecht) Vol 3 (1987) pp. 293-299) The power of FA can be estimated by the relationship of PGA (3-phosphoglyceric acid) with respect to TP (triose phosphate) (Dietz, KJ and Heber, U. (1984) Biochim. iophys, Acta. 767: 432; ibid 848: 392 (1996)). The measurements were obtained under 100 and 1000 μmoles-m ^ -s "1 of illumination, and in a concentration of External C02 of 850 μbar to minimize the effects of photorespiration (Table 4). When photosynthesis reached steady state, the leaves were fixed by freezing and prepared for the extraction of metabolites. The assimilation rate of C02 of the TR sheets in an illumination of 100 μmoles-m ~ 2-s_1 was 53% higher than that of the WT sheets. The PGA levels were similar between the TR and WT plants, however, the level of TP was 33% higher in TR. Thus, the PGA / TP ratio is higher in the WT plants, indicating a limitation of the reduction of PGA to TP by the supply of ATP and NADPH in the WT plants. Changes in adenylates indicate that the ATP content in the TR leaves was twice the value observed in the WT leaves, while the ADP content in both plants It was similar. The ATP / ADP ratio in the chloroplast is lower than in cytosol, typically having been estimated to be between 1.5 and 3.0 (Stitt, M. et al (1982) Plant Physiol.70: 971; Giersch, C. et al (1980) Biochim, Biophys, Acta, 590: 59, Neuhaus, NE and Stitt, M. (1989), Plant 179: 51). As the light intensity increases, the proportion decreases even more (Dietz and Heber, supra). The ATP / ADP ratio is higher in the TR plants than in the WT plants (2.2 versus 0.8). These results indicate that TR plants have an increased capacity to generate ATP in low light, which leads to an increase in the reduction of PGA and a higher photosynthetic rate. Changes in the level of hexose phosphate were also observed, with more hexose phosphate in the WT plants than in the TR plants. The G6P / F6P ratio is an indicator of the distribution of hexoses in a cell, indicating values of 1-2 a chloroplast compartmentalization and predominantly the synthesis of starch, and ratios of 3-5 indicating a cytoplasmic localization, the synthesis of sucrose being dominant ( Gerhardt, R. et al (1987) Plant Physiol. 83: 399). In this way, low G6P / F6P values for WT and TR plants grown in low light indicate that the fixed carbon is being distributed mainly towards starch. The increased capacity to absorb light has a negative effect on the photosynthetic metabolism of TR plants in high irradiation regimes. On the other hand, the photosynthetic rate of the WT plants was 37% higher than that of the TR plants. Changes in the levels and proportions of the metabolites indicate that important alterations have taken place in the mechanisms regulating photosynthesis in TR plants to compensate for the increased capacity to absorb light at high illumination. The PGA / TP ratio was identical in both plants and the ATP / ADP ratio was lower in the TR plants, indicating that photophosphorylation was limiting photosynthesis. The change in the distribution indicated by the increase in the G6P / F6P ratio (2.9 versus 3.9 in WT and TR plants, respectively) points to an increase in sucrose synthesis to compensate for the high demand for inorganic phosphate ( Pi) in the TR plants. TR plants appear to be less effective in recycling Pi through synthesis of sucrose in high illumination.

Table 4. Photosynthesis and content of metabolites of plants grown under an illumination of 50 μmoles - trr2 - s 1. 100 jimoles' i "2 ^ '1 Proportion of Metabolitog Content of Hetabolites (moles / itols) (np? Oles' ing" ClQ.) 1 t '1"1 -C Plant Type CER PGA P ATP ADP G6P P6P G1P PGA / TP ATP / ADP G6P / F6P (l-Boles'ii ^' S) lo Wild type 1.7 + 0.1 364+ UO 46 + 21 74 + 27 89 + 51 92 + 39 98 + 40 69 + 48 8.4 0.4 0.9 Transgenic 2, 6 + 0.6 353 + 47 61 + 8 181 * 38 85 + 32 43 + 9 65 + 38 61 + 9 5.8 2.2 0.7 1000 liioles'i ^ 'S "1 Wild type 8.8 + 0.7 320 + 174 92 + 49 112 * 43 86 + 37 174 + 62 59 + 7 40 + 9 3.5 1.2 2.9 Transgenic 6.4 + 1.8 259 + 54 73 + 17 89 + 32 150 + 49 217 + 66 56 + 27 40 + 23 3.5 0.6 3.9 twenty TABLE 4. Continuation The external concentration of C02 was 850 μl- "1 and the temperature of the sheet was 25 ° C. The data presented are the means of 4 plants + SD The assimilation rates of C02 were measured in a open gas exchange system using a Binos 100 infrared gas analyzer (Rosemount, Germany) The chamber for the blade was designed and constructed with an aluminum alloy to allow rapid acquisition of the leaf disc samples and rapid freezing The lower side of the chamber was sealed with Parafilm, through which a frozen copper rod could enter a pneumatically driven liquid N2.The upper side of the chamber contained a clear acrylic ring to stop the blade disc cutter. The frozen leaf disks (8 cm2) were stored in liquid N2 until they were used Actinic illumination was supplied by two branches of the optical fiber. of a cold light source KL 1500 (Schott, Maiz Germany) directed towards the top of the chamber at an angle of 45 °. The temperature of the chamber was controlled by circulating water through the chamber cavity. The deficit of water vapor from the incoming air was readjusted to 18 mbar by passing the air current through a coil submerged in a water bath maintained at 15 ° C. The leaf samples were extracted in 10% HC104 (v / v) and the indicated metabolites were determined using a Hitachi U-3300 spectrophotometer (Tokyo, Japan) (Labate, CA and RC Leegood, RC (1989) Plant Physiol. : 905; Lowry, OH and Pasonneau, JV (1972) A flexible system of enzymatic tic analysis (Academic Press, New York).

Changes in photosynthetic activity were also reflected in the carbohydrate content. The contents of starch and sucrose were relatively balanced without important distribution changes in young leaves of TR or WT plants under both lighting regimes (50 and 500 μmoles-m ^ -s "1) (Table 5A) Sucrose and starch were produced in equal quantities except in that the total carbohydrate content in TR plants was 2-3X higher than in WT plants. The seeds of the TR plants contained 2X more starch than the WT seeds when they were grown under low light and then displaced to high light in the late stages of growth. The total carbohydrate level of the TR and WT plants seemed unaffected by the changes in lighting in the young leaves. A similar situation occurs in the fully developed WT sheets (Table 5B), with starch and sucrose levels remaining fairly balanced and largely independent of illumination. Global carbohydrate levels, however, were higher than in young leaves. The leaves of TR in the same stage of development react differently to the two lighting regimes varying the levels of starch and sucrose. Sucrose levels were higher in low light, whereas the starch was higher with high irradiation. Although the total carbohydrate levels increased substantially in high illumination in the leaves of TR and WT, the level of the TR leaves was approximately 49% higher than that of the WT leaves.

TABLE 5. Carbohydrate content in young and fully developed leaves (A) Content of starch and sucrose in young leaves. The data are the means of 4 pl < untas ± SD. Sucrose Sucrose Total Carbohydrates Plant Type μmoles of hexose-mg equivalents " ^ lo.

Plants grown under 50 μmoles-m ^ -s "1 Wild type 0.6 ± 0, 2 0.8 ± 0.1 1.4 ± 0.3 Transgenic 1.3 ± 0.2 1.6 ± 0.4 3.0 ± 0.6 Plants grown under 500 μmoles-m "2-s_1 Wild type 0.6 ± 0, 3 0.4 ± 0.1 1.0 ± 0.4 Transgenic 1.8 ± 0.5 1.4 ± 0.4 3 , 2 ± 0.9 (B) Totally developed starch and sucrose content in leaves The data are the means of 6 plants ± SD. Sucrose Sucrose Total Carbohydrates Plant Type μmoles of hexose-mg equi-valent " ^ lo.

Plants grown under 50 μmoles-m 2-s_1 Wild type 1.2 ± 0 4 1, 8 ± 1.2 3, 0 ± 1.6 Transgenic 1.2 ± 0 5 2, 1 ± 1.4 3.3 ± 1.9 Plants grown under 500 μmol-m "2-s" 1 Wild type 4.1 ± 1.9 3.8 ± 1.9 7.9 ± 3.8 Transgenic 7.0 ± 2.8 4.8 ± 1, 8 11.8 ± 4.6 The soluble sugars were determined spectrophotometrically after the extraction of the leaves in HC10. For the calculation of the starch, the insoluble leaf extracts were washed with 0.5 M MES-HCl (pH 4.5), resuspended in 0.5 ml of the same buffer and digested with an amylase cocktail (4 ml units). ) -amiloglucosidase (14 units ml "1). After centrifugation, the supernatants were analyzed for glucose (Jones, M.G.K. et al (1977) Plant Physiol.60: 379).

Figure 13 shows the light response curves for qP (Figure 13A), qN (Figure 13B), Fv / Fm (Figure 13C) and 0psn (Figure 13D) measured in air for WT and TR plants grown for 6-8 post-germination weeks. The data are the means of 4 plants each phenotype. The standard deviations were less than 5% of the means. The fluorescence of the chlorophyll was analyzed using a fluorometer with pulse amplitude modulation (PAM101, Heinz Walz, Effeltrich, Germany). Fo (fluorescence in the dark basal) was measured in leaves adapted to darkness (during a period of 30-60 minutes) using a weak modulated light (1 μmoles-m "2-s" 1 approximately) provided by a probe Fiber optic located under the lower window of the chamber of the blade (at 5 mm from the sheet surface approximately), which also collected the fluorescence signal. To determine the maximum fluorescence (Fm), a light-saturating pulse (7500 μmoles-m "2-s" 1), activated by a PAM103 activating control unit, was applied at a frequency of 30 s and a duration of 1 s. The production of fluorescence in the steady state (Fs) was monitored after the start of illumination with actinic light. The parameters of photochemical (qP) and non-photochemical (qN) buffering were determined according to Schreiber et al. (1986) Photosynth. Res. 10: 51. The quantum yield of electron flow through PSII 0psn was determined by the product of qP and the efficiency of the excitation capture by the open reaction centers of PSII (Fv / Fm) (Genty et al (1989) Biochim. Biophys, Acta. 990: 87). The effect of extra Cab protein on the efficiency of electron transport by PSII (opsn) in response to variable irradiation was determined by measuring the fluorescence characteristics of chlorophyll (Genty et al (1989) supra) in air in photosynthesis in steady state (Figure 13). The measurements were carried out with plants propagated in low irradiation (50 μmoles-m "2-s" 1). There was a corresponding decrease in 0PSII as it increased the light intensity (Figure 13D), with a less pronounced decrease in TR plants. The quantum yield of the open PSII reaction centers (Fv / Fm) also decreased as the light intensity increased; however, the TR plants showed a different pattern of 100 to 600 μmoles-m "2-s" 1 (Figure 13C). The decrease in Fv / Fm in TR plants was less substantial than in WT plants in this range of luminous intensities, being more similar to WT plants above this range. The efficacy of 0PSII can be determined by the product of Fv / Fm and the photochemical buffering of chlorophyll fluorescence (qP). The value of qP reflects the oxidized state of the primary acceptor QA (Schreiber, U. et al (1986) supra). A decrease in qP was observed as the light intensity increased (Figure 13A). TR plants remain significantly more oxidized than WTs except at high irradiation. Chlorophyll fluorescence data also indicate that the exposure of TR plants to high irradiation does not lead to photoinhibition since the Fv / Fm ratios were similar for the TR and WT plants. The non-photochemical (qN) buffer was highest in WT of 100 to 600 μmoles-m "2-s" 1 (Figure 13B). It is evident that in TR the regulation of the PSII function was affected by the increased capacity to absorb light. The flow of electron transport with more efficiency in low illumination by PSII in TR seems to be attributable mainly to higher Fv / Fm and lower qN.

Conversely, photochemical buffering (qP) is the main determinant of the greater effectiveness of PSII (< Z > PSII) in TR under light intensities greater than 600 μmoles-m "2-s" 1. These data show that the elevation of Cab protein levels of Lhcl Ib type I by genetic manipulation results in measurable and significant changes for a plant. It is believed that LhcII plays a key role in controlling the proportion of absorbed excitation energy directed to PSII. Typically, photosynthesis would be limited in low light by the ability of electron transport to generate ATP and NADPH for the reduction of C02; however, the increased level of Cab protein allows TR plants to channel more energy through the electron transport system under light-limiting conditions. The presence of elevated LhclIb Cab proteins could also contribute to changes in photosynthesis reduction and excitation pressures. The greater photosynthetic capacity of the TR plants is independent of the light parameters of the crop. Transgenic plants grown in low or intermediate irradiation show similar low-illumination photosynthetic capabilities, as is evident from the higher initial slope of the light response curves shown at saturating C02 and air levels (Figures 12 and 13). This suggests a greater ability to generate ATP and NADPH as reflected by changes in the proportions of metabolites in photosynthesis at steady state. The proportions of lower PGA / TP and higher ATP / ADP in the TR plants indicate that the elevation of the Cab protein resulted in an increased synthesis of ATP, thereby increasing the reduction of PGA. The fluorescence parameters of chlorophyll also suggest more efficient electron transport in TR plants. The efficiency of the excitation energy capture by the open PSII centers (the Fv / Fm ratio) was higher in the TR plants below 500 μmoles-m "2-s" 1 of illumination, with a related decrease in non-photochemical buffering (qN) compared to WT plants under the same conditions. The increased light collecting capacity is associated with anatomical modifications of the leaves, for example, an enlargement of the intercellular spaces, which probably contributes to a diffusion of C02 increased toward the chloroplasts, facilitating higher rates of photosynthetic and carbohydrate synthesis. All citations of this application relating to materials and methods are incorporated herein by reference. Equivalents Those skilled in the art will recognize, or be able to determine using no more than routine experimentation, many equivalents to the specific embodiments of the invention specifically described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Claims (40)

1. CLAIMS 1.- A DNA construct that contains: a) a promoter; b) a 5 'untranslated region containing a translational enhancer; c) DNA encoding a plastid specific heterologous transit peptide that increases the importation of proteins; d) a gene encoding a plastid membrane protein encoded by the core; and e) a 3 'untranslated region containing a functional polyadenylation signal.
2. 2. - The DNA construction according to claim 1, wherein the construction incorporated into a plant cell or a cell of a photosynthetic organism, increases the conversion of light into chemical energy in the plastid of the plant cell or the cell of a photosynthetic organism compared to the conversion of light into chemical energy in the plastid of a wild type cell under the same growth conditions.
3. 3. The DNA construct according to claim 1, wherein the promoter region is a constitutive promoter.
4. 4. - The construction of DNA according to the Claim 3, wherein the constitutive promoter is a 35S cauliflower mosaic virus (CaMV) promoter.
5. 5. - The construction of DNA according to the Claim 1, wherein the translational enhancer is a translational enhancer of the 5 'untranslated region of the small subunit of ribulose-1, 5-bisphosphate carboxylase.
6. 6. - The construction of DNA according to the Claim 5, wherein the translational enhancer has a nucleotide sequence substantially similar to residues 1 to 29 of SEQ ID NO: 3.
7. 7. - The construction of DNA according to the Claim 1, wherein the transit peptide is derived from the small subunit of ribulose-1, 5-bisphosphate carboxylase.
8. 8. The DNA construct according to claim 7, wherein the transit peptide has a nucleotide sequence substantially similar to residues 30 to 215 of SEQ ID NO: 3.
9. 9.- The construction of DNA according to the Claim 1, wherein the gene encodes a pigment or a pigment binding protein.
10. 10.- The construction of DNA according to the Claim 1, wherein the gene encodes a chlorophyll a / b binding protein.
11. 11. The DNA construct according to claim 1, wherein the gene encodes a chlorophyll a / b binding protein selected from the group consisting of Lhcal, Lhca2, Lhca3, Lhca4, Lhcbl, Lhcb2, Lhcb3, Lhcb4, Lhcb5 and Lhcb6.
12. 12. The DNA construct according to claim 10, wherein the gene encoding a chlorophyll a / b binding protein is a pea cab gene.
13. 13.- The construction of DNA according to the Claim 7, wherein the 3 'untranslated region containing a functional polyadenylation signal is from a cab gene.
14. 14. - A transgenic photosynthetic plant or organism containing a DNA construct comprising: a) a promoter; b) a 5 'untranslated region containing a translational enhancer; c) DNA encoding a plastid specific heterologous transit peptide that increases the importation of proteins; d) a gene encoding a plastid membrane protein encoded by the core; and e) a 3 'untranslated region containing a functional polyadenylation signal.
15. 15. Seeds of the transgenic plant according to claim 14.
16. 16. A part of a plant derived from the transgenic plant according to claim 14, wherein the part of the plant contains the DNA construct.
17. 17. The part of a plant of Claim 16 selected from the group consisting of leaves, stems, roots, flowers, tissues, epicotiles, meristems, hypocotyls, cotyledons, pollen, ovaries, cells and protoplasts.
18. 18. Progeny of the photosynthetic plant or organism according to claim 14, wherein the progeny contains the DNA construct.
19. 19. The progeny according to the claim 18, in which the gene encodes a pigment or a pigment binding protein.
20. 20.- The transgenic plant according to the Claim 14, wherein the plant is a monocot.
21. 21. - The transgenic plant according to the Claim 14, wherein the plant is a dicot.
22. 22. - A transgenic photosynthetic plant or organism according to claim 14, wherein the photosynthetic plant or organism further contains an additional exogenous nucleic acid sequence.
23. 23. A transgenic photosynthetic plant or organism containing a DNA construct comprising: a) a promoter; b) a 5 'untranslated region containing a translational enhancer; c) DNA encoding a heterologous transit peptide having a nucleotide sequence substantially similar to nucleotides 30-215 of SEQ ID NO: 3; d) a gene encoding a plastid membrane protein encoded by the core; and e) a 3 'untranslated region containing a functional polyadenylation signal.
24. 24. Seeds of the transgenic plant according to claim 23.
25. 25.- A part of a plant derived from the transgenic plant according to claim 23, wherein the part of the plant contains the DNA construct.
26. 26. The part of the plant of Claim 25 selected from the group consisting of leaves, stems, roots, flowers, tissues, epicotiles, meristems, hypocotyls, cotyledons, pollen, ovaries, cells and protoplasts.
27. 27. Progeny of the photosynthetic plant or organism according to claim 23, wherein the progeny contains the DNA construct.
28. 28. - The progeny according to the Claim 27, in which the gene encodes a chlorophyll a / b binding protein.
29. 29. The transgenic plant according to claim 23, wherein the plant is a monocot.
30. 30. The transgenic plant according to claim 23, wherein the plant is a dicot.
31. 31. A transgenic photosynthetic plant or organism according to Claim 23, wherein the photosynthetic plant or organism further contains an additional exogenous nucleic acid sequence.
32. 32.- A cell or tissue culture containing a DNA construct comprising: a) a promoter; b) a 5 'untranslated region containing a translational enhancer; c) DNA encoding a plastid-specific heterologous transit peptide that increases the importation of proteins; d) a gene encoding a plastid membrane protein encoded by the core; and e) a 3 'untranslated region containing a functional polyadenylation signal.
33. 33. A plant regenerated from the culture of cells or tissues according to Claim 32.
34. 34.- A cell or tissue culture according to Claim 32, which contains an additional exogenous nucleic acid sequence.
35. 35.- A plant regenerated from the culture of cells or tissues according to Claim 34.
36. 36. - A method for increasing the conversion of light energy into chemical energy in a plant, tissue culture or photosynthetic organism comprising: a) preparation of a DNA construct containing a promoter, a 5 'untranslated region containing a translational enhancer, DNA encoding a plastid-specific heterologous transit peptide that enhances the importation of proteins, a gene encoding a plastid membrane protein encoded by the core and a 3 'untranslated region containing a functional polyadenylation signal; b) insertion of the DNA construct into a cloning vector; and c) transformation of a plant, tissue culture or photosynthetic organism with the cloning vector.
37. 37.- A method to detect transformation in plants, plant tissue or photosynthetic organism consisting of: a) preparation of a DNA construct containing a promoter, a 5 'untranslated region containing a translational enhancer, DNA encoding a peptide of specific heterologous transit of plastids that increases the import of proteins, a gene encoding a plastid membrane protein encoded by the nucleus whose expression is detectable and a 3 'untranslated region containing a functional polyadenylation signal; b) insertion of the DNA construct into a cloning vector; and c) transformation of a plant, tissue culture or photosynthetic organism with the cloning vector for the protein to be expressed, where the expression of the protein is indicative of transformation.
38. 38. The method of Claim 37, wherein the protein is a pigment or a pigment binding protein. 39.- The method of Claim 38, wherein the protein is a chlorophyll a / b binding protein. The method according to claim 39, wherein the expression, in comparison with wild-type plants under the same conditions, is manifested by one or more of the following characteristics: increased production, increased pigmentation, increased biomass , increased carbohydrate content, more uniform growth, larger seeds or fruits, increased stem diameter, photosynthesis under conditions of low illumination increased, faster germination and an increased capacity to withstand the shock of transplants.