MXPA98001603A - Genetic alterations related to the disease of alzheimer heredita - Google Patents

Abstract

Isolated molecules of nucleic acids encoding human PS1 gene products are provided. The PS1 mutant polypeptides are also provided as well as the vectors, host cells and recombinant methods to produce them. The invention furthermore relates to methods of examination for identifying agonists and antagonists of PS1 polypeptide activity and mutants thereof. Diagnostic methods are also provided to detect Alzheimer's disease and therapeutic methods for treating it.

Description

GENETIC ALTERATIONS RELATED TO THE DISEASE OF ALZHEIMER HEREDITARIA Field of the Invention The present invention relates generally to Alzheimer's disease, and more specifically to methods and compositions for use in the diagnosis and treatment of Alzheimer's disease.

BACKGROUND OF THE INVENTION Alzheimer's disease (AD) is a devastating progressive neurodegenerative disorder, which is the leading cause of dementia in people over 65 years of age. The prevalence of AD is estimated to be as high as 18.7% between the age groups of 75-84 years of age and 47.2% among those over 85 years old, affecting a significant portion of the population in most of the countries of the world. world.

The clinical symptoms of the disease typically begin with subtle short-term memory problems. As the disease progresses, the difficulty with language, memory and orientation worsens, to the point of interfering with the person's ability to function independently. Other symptoms that are variable include involuntary contraction of the REP: 26987 muscles (myoclonus) and attacks. The duration of AD from the first symptoms of memory loss to death is 10 years on average, but it can be in the range of 6-8 years to more than 20 years. AD always ends with death, often from respiratory diseases.

The pathology in AD is limited exclusively to the central nervous system (CNS). The brain in AD is characterized by the presence of amyloid deposits and neurofibrous tissue (NFT).

Amyloid deposits are associated with the vascular system of the CNS and as focal deposits in the parenchyma. The main molecular component of an amyloid deposit is a highly hydrophobic peptide called Aβ peptide. This peptide is added in filaments in an anti-plaque-ß laminated structure resulting in the birefringent nature of amyloid AD. Although Aβ is the major component of amyloid AD, other proteins associated with amyloid have been found, eg, a-1-anti-chymotrypsin (Abraham, et al., Cell 52: 487-501 (1988), cathepsin D (Cataldo et al., Brain Res. 513: 181-192 (1990)), protein of the non-amyloid component (Ueda et al., Proc. Nati, Acad. Sci. USA 90: 11282-11286 (1993)), apolipoprotein E (apoE) (Namba et al., Brain Res. 541: 163-166 (1991); Wisnie ski & Frangione, Neurosci. Lett. 135: 235-238 (1992); Strittmatter et al. , Proc. Nati Acad. Sci. USA 90: 1977-1981 (1993)), apolipoprotein J (Choi-Mura et al., Acta Neuropathol., 83: 260-264 (1992); McGeer et al., Brain Res. 579: 337-341 (1992)), Heat shock protein 70 (Hamos et al., Neurology 41: 345-350 (1991)), complement components (McGeer &Rogers, Neurology 43: 447-449 (1992)), a2-macroglobin (Strauss et al., Lab. Invest. 66: 223-230 (1992)), interleukin-6 (Strauss et al., Lab.

Invest. 66: 223-230 (1992)), proteoglycans (Snow et al., Lab. Invest. 58: 454-458 (1987)) and serum amyloid P (Coria et al., Lab. Invest. 58: 454-458 (1988)).

The plaques are often surrounded by astrocytes and activated microglial cells that express immune-related proteins, such as the glycoproteins of the MHC II class, HLA-DR, HLA-DP and HLA-DQ as well as MHC class I glycoproteins, Interleukin-2 (IL-2) and IL-1. Also surrounding various plaques are the dystrophic neurites, which are nerve endings that contain abnormal filamentous structures.

The characteristic NFTs of Alzheimer's consist of abnormal filaments tied together in neuronal cell bodies. NFT "ghosts" are also seen in AD brains, which presumably marks the location of dead neurons. Other neuropathological features include granulovascular changes, neuronal loss, gliosis, and the variable presence of Lewy bodies.

The destructive process of the disease is evident at a coarse level in the AD brain to the extent that in the final stages of AD, ventricular growth and shrinkage of the brain can be observed by magnetic resonance imaging. The cells that remain in autopsy however, are grossly different from those of a normal brain, characterized by extensive gliosis and neuronal loss. Neurons that were possibly involved in the initial events are absent; and other cell types, such as cells and activated microglial astrocytes have gene expression patterns that are not observed in a normal brain. Thus, the structures of amyloid plaque and the NFT observed at autopsy are more likely the final products of a long disease process, well separated from the initial events of AD.

In this way, efforts to use biochemical methods to identify key proteins and genes in the early stages of the disease are hampered by the fact that these initial critical events can not be observed at present. In addition, the biochemical dissection of the AD brain at autopsy is a kind of molecular archeology, which attempts to reconstruct the pathogenic trajectory by comparing the normal brain with the brain of the disease in its final phase.

Substantial evidence has suggested that inherited genetic defects are involved in AD. Numerous affinities have been described in the literature, which have an early onset of AD (defined as beginning before the age of 65). Bird et al. , Ann. Neurol. 23: 25-31 (1988); Bird et al. , Ann. Neurol, 25: 12-25 (1989); Cook et al. , Neurology 29: 1402-1412 (1979); Feldman et al. , Neurology 13: 811-824 (1960); Goudsmit, J. Neurol. Sci. 49:79 (1981); Heston & White, Behavior Genet 8: 315-331 (1978); Martin eü al. , Neurology 41: 62-68 (1991); Nee et al. , Arch. Neurol. 40: 203-208 (1983); van Bogaeert et al. , Mschr. Psych. Neurol. 102: 249-301 (1940); Wheelan, Ann. Hum. Genet 23: 300-309 (1959)). Families with multiple cases of late onset of AD have also been described (Bird et al., Ann. Neurol. (1989), supra; Heston & White, Behavior Genet. (1978), aupra; Pericak-Vance et al. , Exp. Neurol. 102: 271-279 (1988)). In addition, studies of twins have documented that monozygotic twins are more concordant in their AD phenotype than dizygotic twins (Nee et al., Neurology 37: 359-363 (1987).) Also, families of concordant twins have more cases secondary AD compared to non-concordant twin families (Rapoport et al., Neurology 41: 1549-1553 (1991)).

The genetic dissection of AD has been complicated by the complexity and overall accuracy of its diagnosis. Because AD is relatively common in the elderly, the clustering of cases can happen by chance, representing a possible confusion of non-allelic genetic heterogeneity, or etiological heterogeneity with genetic and non-genetic cases coexisting in the same relatives. In addition, the clinical diagnosis of AD is confused with other common demential disorders in later life.

Regardless of these problems, mutations in the gene of the amyloid precursor protein (APP) on chromosome 21 have been associated with the dominant autoantibody AD at the early onset (<65 years) (Goate et al., Nature 349 : 704 (1991)). In addition, mutations in two newly identified genes, S182 on chromosome 14 and STM-2 on chromosome 1, which encode presenilin 1 (PS1) and presenilin 2 (PS2) respectively, have also been associated with autosomal dominant AD Early onset (Schellenberg et al., Science 258: 668 (1992); Sherrington et al., Nature 375: 754-760 (1995); Levy-Lahad / Wasco et al., Science 269: 973-977 (1995) ).

For late-onset AD, the APOE gene has been identified as a genetic modifier (Strittmatter et al., Proc. Nati, Acad. Sci. USA 90: 1977 (1993), Corder et al., Science 261: 921 ( 1993), Corder et al., Nat. Genet 7: 180-184 (1994), Benjamin et al., Lancet 344,473 (1994), Smith et al., Lancet 344: 473-474 (1994)).

However, the genetic sites known for AD do not count for all AD cases. For example, in late-onset AD, approximately half of AD cases do not have the APOE e4 allele found in several other families with a high incidence of AD, including the Volga Germanic congeners (VG). Brousseau et al. , Neurology 342 (1994); Kuusisto et al. , Brit. Med. J. 309: 363 (1994); Tsai et al. , Am. J. Hum.

Genet 54: 643 (1994); Liddel et al. , J. Med. Genet. 31: 197 (1994); Cook et al. , Neurology (1979), supra; Bird et al. , Ann. Neurol. (1988), supra; Bird et al. , Ann. Neurol. 25:12 (1989). The known AD positions have been excluded as possible causes of discrepancy. Schellenberg et al. , Science (1992), supra; Lannfelt et al. , Nat. Genet. 4: 218-219 (1993)); van Duijn et al. , Am. J Hum. Genet 55: 714-727 (1994); Schellenberg et al. , Science 241: 1507 (1988); Schellenberg et al. , Am. J. Hum. Genet 49: 511-517 (1991); Kamino et al. , Am. J. Hum. Genet 51: 998 (1992); Schellenberg et al. , Am J. Hum. Genet 53: 619 (1993); Schellenberg et al. , Ann. Neurol. 31: 223 (1992); Yu et al. , Am. Hum. Genet 54: 631 (1994)). Thus, the identification of new genes and alterations that modify the risk of existing genes, will help considerably for an understanding of the genetic determinants of AD, and will allow biochemical and genetic approaches for diagnosis and therapeutic treatment.

The present invention provides novel, previously unidentified and apparent pathogenic mutations of the chromosomal positions for hereditary AD (FAD), methods and compositions for the diagnosis and treatment of AD, and other related advantages.

Brief Description of the Invention Briefly defined, the present invention provides isolated nucleic acid molecules that encode a product of the PS1 gene. A representative nucleic acid molecule is provided in Figure 2, while in other embodiments, nucleic acid molecules encoding a PS1 mutant gene product are provided which increases the likelihood of eimer's disease (statistically significant). A representative illustration of said mutant is an amino acid substitution at residue 263 wherein, for example, an arginine can be replaced by a cysteine (C263R). Another representative illustration of said mutant is an amino acid substitution at residue 264, where for example, a leucine can be replaced by a proline (P264L). A third representative illustration of said mutant is a substitution of amino acid at residue 269 where, for example, a histidine can be substituted by an arginine (R269H).

Other aspects of the present invention include isolated nucleic acid molecules, selected from the group consisting of: a) an isolated nucleic acid molecule as set forth in Figure 2, or a complementary sequence thereof, b) an acid molecule isolated nucleic acid that hybridizes specifically to the nucleic acid molecule of (a) under conditions of high scarcity; and c) an isolated nucleic acid encoding a gene product of PS1. As used herein, it should be understood that a nucleic acid molecule hybridizes "specifically" to a PS1 gene (or related sequence) if it detectably hybridizes to said sequence, but does not hybridize usually to the PS2 gene sequence under the same conditions. terms. The invention also provides methods for obtaining nucleic acid molecules, fragments thereof or functional derivatives thereof.

The present invention also provides expression vectors comprising a promoter operably linked to one of the nucleic acid molecules described above. Within the related aspects, viral vectors are provided which are capable of directing the expression of a nucleic acid molecule as described above. Also supplied are the host cells carrying the vectors described above.

The present invention also provides isolated proteins comprising a PS1 gene product as well as PS1 peptides with more than 12, 13 or 20 amino acids. Within one embodiment, a protein having the amino acid sequence set forth in Figure 2 is delivered. Within another embodiment, the protein is a product of a PS1 mutant gene that increases the likelihood of eimer's disease. Such mutants include those with an amino acid substitution at residue 263 (eg, a substitution of arginine: cysteine) or at residue 264 (eg, a leucine: proline substitution) or at a residue 269 ( eg, a histidine-arginine substitution). In addition, the PS1 peptides which are composed of 13 to 20 amino acids derived or selected from hydrophilic N-terminal, internal or terminal carboxyl regions are supplied.

Within yet another embodiment of the present invention, methods of treating or preventing eimer's disease are provided, comprising the step of administering to a patient a vector that contains or expresses a specific nucleic acid, protein or antibody molecule for a PS1 protein as described above, thereby reducing the likelihood or delay of the onset of eimer's disease in the patient: within certain embodiments, the above methods can be carried out by in vivo administration.

Also provided by the present invention are pharmaceutical compositions comprising a molecule of a nucleic acid, vector, host cell, protein or antibody as described above, together with a pharmaceutically acceptable carrier or diluent.

In addition, the present invention provides antibodies that specifically bind to a PS1 protein or to unique peptides, immunological equivalents derived from the N-terminal, internal or carboxyl-terminal hydrophilic regions. As used herein, it should be understood that an antibody is specific for a PS1 protein if it binds detectably, and with a KA of 10"7 M or less, but does not bind detectably (or with an affinity of more than 10"). M) to the PS2 protein. Hybridomas are also provided which are capable of producing said antibodies.

The antibodies of the present invention include monoclonal and polyclonal antibodies, as well as fragments of these antibodies and humanized forms.

The present invention further provides nucleic acid probes that are capable of specifically hybridizing (as defined below) to a PS1 gene under conditions of high scarcity. Within a related aspect, said probes comprise at least a portion of the nucleotide sequence shown in Figures 1 or 2, or their complementary sequence, wherein the probe is capable of specifically hybridizing to a mutant PS1 gene under conditions of high scarcity. . Within a particularly preferred aspect, probes are provided which are capable of specifically hybridizing to a mutant PS1 gene encoding a protein in which the amino acid residue 263 is changed from cysteine to arginine, or in which the amino acid 264 is changes from proline to leucine, or in which the amino acid 269 is changed from arginine to histidine, each under conditions of very high scarcity. Representative probes of the present invention are generally at least 12 nucleotide bases in length, although they may be longer. Main pairs capable of amplifying them specifically to all, or to a portion of, any of the nucleic acid molecules described herein are also provided.

Moreover, in the present invention, methods and kits are provided for diagnosing a patient who is more likely to contract Alzheimer's disease and who comprises the steps of: a) obtaining from the patient a biological sample containing nucleic acid, b ) incubating the nucleic acid with the probe that is capable of specifically hybridizing to a mutant PS1 gene under conditions and for sufficient time to allow hybridization to occur, and c) detecting the presence of the hybridized probe and thereby determining that the patient has an increasing likelihood of contracting Alzheimer's disease.

Within another embodiment, methods are provided comprising the steps of a) obtaining a biological sample containing nucleic acid from the patient, b) amplifying the selected nucleic acid sequence associated with a PS1 mutant gene, and c) detecting the presence of a sequence. amplified nucleic acid and thus determine that the patient has an increased likelihood of contracting Alzheimer's disease.

Within yet another embodiment, methods are provided comprising the steps of: a) contacting a biological sample obtained from the patient with an antibody that specifically binds to a PS1 mutant protein under conditions and for a sufficient time to allow binding of the antibody to the protein and b) detect the presence of the bound antibody.

The invention also extends to products useful for carrying out a detection method, such as DNA probes (labeled or unlabeled), kits and the like. And the invention also provides a method for detecting a DNA segment within the Alzheimer's disease region of chromosome 14.

This invention further provides a diagnostic kit for the detection of the expression of PS1, or its immunological equivalents, which contains all the reagents necessary to carry out the previously described detection methods.

In addition, the invention provides an assay and method of detecting the gene expression product of a region of Alzheimer's disease of chromosome 14, which can be used prenatally to examine a fetus, or presymptomatically to examine a subject that is generally predisposed for Alzheimer's disease based on your family's history. In this way, the invention provides a diagnostic kit for the detection of the expression of PS1 or its immunological equivalents.

Within another embodiment of the present invention, peptide vaccines comprising a portion of a mutant of the gene product PS1 containing a mutation are supplied in combination with a pharmaceutically acceptable carrier or diluent.

Within yet another aspect of the invention, transgenic animals are provided whose germ cells and somatic cells contain the PS1 gene which is operably linked to an effective promoter of gene expression, introducing the gene into the animal or an animal ancestor into a gene. embryonic stage.

In addition, other embodiments provide for the expression of the PS1 gene from a vector as described above. While in yet another embodiment, the PS1 gene encodes a mutant gene product.

These and other aspects of the present invention will be apparent upon reference to the following detailed description and the accompanying drawings. In addition, various references are set forth herein which describe in more detail certain procedures or compositions (eg, plasmids) and are therefore incorporated by reference in their entirety.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 describes a nucleotide sequence of the normal gene S182, position PS1. Within the coding region, below each line of the nucleotide sequence are the corresponding putative amino acid residues encoded by the gene.

Figure 2 details the mutations identified (shown by arrows) at nucleotide sequence positions 1035, 1039 and 1054 of gene S182, position PS1. Within the coding region, below each line of the nucleotide sequence are the corresponding putative amino acid residues encoded by the gene.

Definitions In the following description, various terms used in recombinant DNA technology (rDNA) are widely used. In order to provide a clear understanding of the specification and claims, including the scope given to such terms, the following definitions are provided.

Abbreviations: AD, Alzheimer's disease, APP, amyloid precursor protein gene; APLP1 and APLP2, proteins as amyloid precursors; DNA, deoxyribonucleic acid; DS, Down syndrome; EST, expression sequence tag; FAD, hereditary AD; PS1, the designation given to the early-start FAD gene of chromosome 14 (S182); PS2, the designation given to the FAD gene of early onset on chromosome 1 at position 14q24.31; NFTs, neurofibrous frames; PCR, polymerase chain reaction; RT-PCR, PCR process in which RNA is first transcribed into DNA in a first stage using a reverse transcriptase (RT); RNA, ribonucleic acid; SSCP, single filament conformation polymorphism analysis; STRP, polymorphism repeated short tandem; Or, recombinant fraction; YAC, artificial yeast chromosome; Zmax, maximum record of LOD.

A "DNA segment" refers to a molecule comprising a linear extension of nucleotides wherein the nucleotides are present in a sequence encoding through the genetic code, a molecule comprising a linear sequence of amino acid residues referred to as a protein, a protein fragment or a polypeptide.

A "gene" is a DNA sequence related to a single polypeptide or protein chain, and as used herein includes the 5 'and 3' termini. The polypeptide can be encoded by a full-length sequence or any portion of the coding sequence, provided that the functional activity of the protein is maintained.

A "complementary DNA" or "cDNA" gene includes recombinant genes synthesized by reverse transcription of the RNA messenger ("mRNA") that lacks intervening sequences (introns).

A "structural gene" is a DNA sequence that is transcribed into the mRNA that is then translated into a sequence of amino acids characteristic of a specific polypeptide. Typically, the first nucleotide of the first translated codon is numbered +1, and the nucleotides are consecutively numbered with positive integers throughout the translated region of the structural gene and within the 3 'untranslated region. The numbering of the nucleotides in the promoter and the 5 'regulatory region to the translated region proceeds consecutively with negative integers with the 5' nucleotide that follows the first translated nucleotide that is numbered -1.

A "restriction endonuclease" (also "restriction enzyme") is an enzyme that has the ability to recognize a specific base sequence (usually 4.5 or 6 base pairs in length) in a double-stranded DNA molecule, and of penetrating both strands of the DNA molecule in each place where the sequence appears. For example, EcoRI recognizes the GAATTC / CTTAAG base sequence.

A "restriction fragment" comprises the DNA molecules produced by digestion with a restriction endonuclease referred to as restriction fragments. Any given genome will be digested by a particular restriction endonuclease within a discrete set of restriction fragments.

The "agarose gel electrophoresis" is an analytical method for fractionating double-stranded DNA molecules based on the size that is required. The most commonly used technique (although not the only one) to achieve said fractionation is the electrophoresis of agarose gel. The principle of this method is that DNA molecules migrate through the gel as if they were a mesh that retards the movement of major molecules to the greatest degree and the movement of minor molecules to the smallest degree. Note that the smaller the DNA fragment, the greater the mobility under electrophoresis of the agarose gel.

DNA fragments fractionated by agarose gel electrophoresis can be visualized directly by a decolorization procedure if the number of fragments included in the pattern is small. The DNA fragments of the genomes can be visualized successfully. However, most genomes, including the human genome, contain too many DNA sequences to produce a simple pattern of restriction fragments. For example, the human genome is digested within approximately 1,000,000 different fragments of the DNA by EcoRI. In order to visualize a small subset of these fragments, a methodology referred to as the South hybridization procedure can be applied.

"Southern blotting" or "Southern blotting" (Southern blotting) is a technique for physically transferring fractionated DNA by agarose gel electrophoresis onto a nitrocellulose filter paper or other appropriate surface or method, while maintaining relative positions of the DNA fragments that result from the fractionation process. The methodology used to carry out the transfer of the agarose gel to nitrocellulose involves removing the DNA from the gel on the nitrocellulose paper by capillary action.

The "hybridization" of the nucleic acid depends on the principle that two simple filament nucleic acid molecules having complementary base sequences will reform the thermodynamically favored double filament structure if they are mixed in solution under the appropriate conditions. The double-stranded structure will be formed between the two complementary single-stranded nucleic acids even if one is immobilized on a nitrocellulose filter. In the southern hybridization procedure, the subsequent situation occurs. As previously observed, the DNA of the individual to be tested is digested with a restriction endonuclease, fractionated by agarose gel electrophoresis, converted to the single filament form and transferred to the nitrocellulose paper, making it available for annealing for the second time in the hybridization probe.

A "hybridization probe" (or simply a "probe") is used to visualize a particular DNA sequence in the Southern hybridization process, a labeled DNA molecule or hybridization probe, reacts with the fractionated DNA that binds to the nitrocellulose filter. The areas on the filter that carry the DNA sequences complementary to the labeled probe are themselves labeled as a consequence of the annealing reaction. Filter areas that show such labeling are displayed. The hybridization probe is generally produced by the molecular cloning of a specific DNA sequence from the human genome.

The "oligonucleotide" or "oligomer" refers to a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three. Its excato size will depend on many factors, which in turn depends on the final function or use of the oligonucleotide. An oligonucleotide can be derived synthetically or by cloning.

"Sequence amplification" (or simply "amplification") is a method for generating large quantities of a target sequence. In general, one or more primers of the amplification are annealed to a nucleic acid sequence. Using the appropriate enzymes, the sequences that are adjacent or between the primaries are amplified.

An "amplification primer" is an oligonucleotide capable of annealing adjacent to an objective sequence and serve as a starting point for DNA synthesis when placed under conditions in which the synthesis of a primary extension product is complementary to a Nucleic acid strand starts.

A "vector" (also a "cloning vector" or a "cloning vehicle") refers to an assembly that is capable of directing the expression of the PS1 gene as well as some additional sequence (s) or gene (s) of interest. The vector must include transcriptional promoter elements that are operably linked to the genes of interest. The vector can be composed of a plasmid, phage DNA or other DNA sequence, an RNA sequence or a combination of the two (eg, a DNA-RNA chimer) that is used to "carry" foreign DNA inserted. for the purpose of producing more protein material or product. The vector can be replicated autonomously in a host cell, and can be characterized by one or a small number of endonuclease recognition sites at which point, the DNA sequence can be cut in a certain way without losing an essential biological function of the vehicle , and within which the PS1 DNA can be spliced in order to produce its replication and cloning.

"Expression" is the process by which a structural gene produces a polypeptide. Involves the transcription of the gene in mRNA and the translation of said mRNA into polypeptide (s).

An "expression vector" is a cloning vector or vehicle designed so that a cloned gene or coding sequence is inserted into a particular site that will be transcribed and translated into a protein. The cloned gene is placed under the control of certain control sequences (ie, "operatively linked to"), such as promoter sequence (s), a polyadenylation sequence, one or more restriction sites, as well as one or more markers selected, such as neomycin phosphotransferase or proteins that provide resistance to tetracycline or ampicillin.

Expression control sequences will vary depending on whether the vector is designed to express the gene operably linked in a prokaryotic or eukaryotic host, and may additionally contain an origin of replication, additional nucleic restriction sites, transcriptional elements such as amplifying elements, sequences of termination, elements of tissue specificity and / or termination or translational initiation sites, sequences that confer inductibility of transcription and other selectable markers.

The present invention relates to the expression of a PS1 gene and to the expression of the product of that gene, as well as to the functional derivatives thereof.

A "functional derivative" of a PS1 sequence is a molecule that possesses a biological activity that is substantially similar to the biological activity of a non-recombinant PS1 protein, or a nucleic acid encoding it. The protein may or may not contain post-translational modifications such as a covalently linked carbohydrate, depending on the need for such modifications for the performance of a specific function. The term "functional derivative" is intended to include the "fragments", "segments", "variants", "analogs" or "chemical derivatives" of the molecule.

As used herein, a molecule is said to be a "chemical derivative" of another molecule when it contains additional chemical moieties that are normally part of the molecule. Said portions can improve the molecule's solubility, absorption, biological half-life and the like. The portions may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effects of the molecule and the like. Portions capable of mediating such effects are described in Remington's Pharmaceutical Sciences (1980). Methods for coupling said portions to a molecule are well known in the art.

A "fragment" of a protein or nucleic acid molecule means referring to any portion of a natural amino acid PS1 or a genetic nucleotide sequence.

A "variant" of the PS1 protein or nucleic acid means referring to a molecule substantially similar in structure and biological activity to a natural PS1 protein or a fragment thereof. Thus, as long as two molecules have a common activity and can be substituted with one another, variants are considered as that term is used here, even if the composition or secondary, tertiary or quaternary structure of one of the molecules is not identical which is in the other; or if the amino acid or nucleotide sequence is not identical.

An "analogue" of a PS1 protein or genetic sequence means that it refers to a protein or genetic sequence that is substantially similar in function of the PS1 sequence described herein. For example, the PS1 protein analogs described herein include isozymes and analogs of the PS1 protein or genetic sequences described herein, including alleles of the PS1 protein molecule.

An "allele" is an alternative form of a gene. In most organisms there are two alleles of some gene (one of each parent) which occupy the same relative position on the homologous chromosomes. The homozygous organisms have two identical alleles that control a particular characteristic (these can be dominant or recessive). Heterozygous organisms have two different alleles that control a particular characteristic. The appearance of the characteristic displayed by the organism will be determined by the dominant allele.

A "substantially pure" PS1 protein is a preparation that generally lacks other cellular components, especially other peptides or nucleic acids linked to non-Alzheimer's diseases.

A "genetic marker" is any segment of a chromosome that is distinctly unique in the genome and polymorphic in the population to provide information about the inheritance of sequences, genes and / or other linked DNA markers.

The "autosomal dominant" means that a feature is encoded in one of the chromosomes different from sex (autosomes) and is dominant by the phenotype that dictates for an individual who has a heterozygous state.

The "LOD record" is a standard measurement in genetics of the probability that a characteristic is located in the interval being recorded. It is the logarithm of a calculated probability.

"Early-onset Alzheimer's disease" is commonly understood to mean the onset before age 65 (the patient shows recognized clinical symptoms indicating AD). In comparison, "hereditary Alzheimer's disease" (ADF) is a sub-category of early-onset AD, in which the genetic relationship is established because at least two of the patient's first-degree relatives have had confirmed clinical symptoms of AD at about the same age as the early start as a patient.

Detailed description of the invention The present invention relates to novel methods and compositions for the detection and treatment of Alzheimer's disease. These methods and compositions are based on the discovery that certain mutations of the S182 gene for AD on chromosome 14 increase the probability of Alzheimer's disease.

I. Winged Ai Nucleic Acid Molecules that Code for PS1 Polypeptides. In its broadest concept, the invention comprises a nucleic acid sequence comprising at least one mutation of the PS1 (S182) gene for AD in the human chromosome 14. In particular, the isolated DNA segment encodes useful expression products in determining the normal role of the PS1 gene (S182), and to develop the experimental and animal models that direct the mechanisms by which PS1 alterations influence or cause AD.

A. Isolation of the Nucleic Acid Although one embodiment of the PS1 mutant gene is described in Figure 2, it should be understood that the present invention is thus not limited. In particular, within the context of the present invention, the reference to the PS1 gene should be understood to include derivatives, analogs or allelic variants of the gene described in Figure 1 which is substantially similar. As used herein, a nucleic acid molecule is estimated to be "substantially similar" if (a) the nucleotide sequence is derived from the coding region of the described gene and includes portions of the sequence of the allelic variations of the sequences discussed above.; (b) the nucleotide sequence is capable of hybridizing the nucleotide sequences of the present invention under high or very high scarcity (see Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)); or (c) the DNA sequences degenerate as a result of the genetic code to the DNA sequences defined in (a) or (b).

In addition, the PS1 gene includes complementary and non-complementary sequences, provided that the sequences otherwise satisfy the criteria set forth herein. Within the context of the present invention, high scarcity means standard hybridization conditions (eg, 5xSSPE, 0.5% SDS at 65 ° C, or the equivalent), such that an appropriate nucleotide sequence is capable of electively hybridizing the nucleotide sequences of the gene related to the AD and the mutant nucleotide sequences. Very high shortage means that the nucleotide sequence is capable of selectively hybridizing to a single allele of the gene related to AD.

The PS1 gene is isolated from the DNA or genomic cDNA. The ASN segment can be isolated from a biological sample, preferably a biological sample containing nucleated cells. More preferably nucleated cells are obtained from a human. Genomic collections of DNA constructed in vectors such as YACs (yeast artificial chromosomes), bacteriophage vectors such as? EMBL3,? gtlO, cosmids or plasmids, are suitable for examining, as are the cDNA libraries constructed in bacteriophage vectors, plasmids or the like. Such collections can be constructed using methods and techniques known in the art (see Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY (1989)) or purchased from commercial sources (eg. , Clontech).

Alternatively, the PS1 gene can be isolated by PCR methods of the genomic cDNAs and DNAs or collections, or by probe hybridization of DNA collections or genomic cDNA. The PCR primers and probes for hybridization screening can be designed based on the sequence of the PS1 DNA presented herein. The DNA sequence of PS1 and the predicted corresponding amino acid sequence of PS1 is presented in Figure 1. PCR primaries must be derived from the sequences in the 5 'and 3' untranslated region in order to isolate a length cDNA complete The primaries must not have self-complementary sequences or have complementary sequences at their 3 'end (to avoid primary-dimer formation). Preferably the GC content of the primaries is around 50% and contains restriction si The primaries are annealed to the cDNA and sufficient PCR cycles are carried out to produce a product easily visualized by gel electrophoresis and discoloration. Mutations can be visualized by simple strand conformation polymorphism analysis (SSCP). The amplified fragment is purified and inserted into a vector, such as? GtlO or pBS (M13 +) and propagated.

Suitable biological samples that have nucleated cells that can be used in this invention, include but are not limited to, peripheral blood, buccal milkweed or brain tissue. The method of obtaining the biological sample will vary depending on the nature of the sample. Said cells may be normal or neoplastic.

B. Synthesis of Nucleic Acid The DNA segment of the present invention can be chemically synthesized in accordance with methods and techniques known to those skilled in the art. For example, a DNA fragment with the nucleotide sequence encoding the modified expression product of the PS1 gene can be designed and, if necessary, divided into smaller, appropriate fragments. Then, an oligomer corresponding to the DNA fragment or to each of the divided fragments can be synthesized. Said synthetic oligonucleotides can be prepared for example, by the triester method of Matteucci et al. J. Am. Chem. Soc. 103: 3185-3191 (1981) or by the use of an automated DNA synthesizer.

An oligonucleotide hybridization probe suitable for the examination of genomic or cDNA libraries can be designed based on the sequence provided herein. Preferably, the oligonucleotide is 20-30 bases larger. Said oligonucleotide can be synthesized by automated synthesis. The oligonucleotide can be conveniently labeled at a 5 'end with a reporter molecule such as a radionuclide (e.g., P) or biotin. The collection is placed on plaas colonies or phages, depending on the vector and the recombinant DNA is transferred to nylon or nitrocellulose membranes. Following the denaturation, neutralization and fixation of the DNA to the membrane, the membranes are hybridized with the labeled probe. The membranes are washed and the reporter molecule is detected. The colonies or hybridizing phages are isolated and propagated. Candidate clones or amplified PCR fragments can be verified as containing PS1 DNA by any of several means. For example, mutations can be visualized by a simple filament conformation polymorphism (SSCP) analysis. Alternatively, the candidate clones can be hybridized with a second non-overlapping probe or subjected to a DNA sequence analysis. In this manner, clones containing PS1 genes, which are suitable for use in the present invention are isolated.

II. Substantially Pure PS1 Polypeptides In another embodiment, the present invention relato a substantially pure polypeptide having an amino acid sequence corresponding to PS1 or a mutant thereof. In a preferred embodiment, the polypeptide has specific mutation (s) in which the amino acid residue 263 is changed from cysteine to arginine, or in which the amino acid 264 is changed from proline to leucine, or in which the amino 269 acid is changed from arginine to histidine. The present invention also relato PS1 polypeptide fragments and mutants thereof that exhibit activity similar to that shown by PS1 as measured in a particular biological assay.

A variety of methodologies known in the art can be used to obtain the peptide of the present invention. The structure of the proteins encoded by the nucleic acid molecules described herein can be predicted from the primary translation products using the function of the hydrophobicity plane of, for example, P / C Suite Gene or Intelligenetics (Intelligenetics, Mountain View, Calif.) Or in accordance with the methods described by Kyte and Doolittle (J. Mol. Biol. 157: 105-132. (1982)).

There is a variety of sources that encode a peptide. The peptide can be isolated as described herein from any source having the PS1 peptide. Preferably the peptide can be isolated from a mammalian source, more preferably from a human source. In the alternative, the coding sequence of the peptide can be synthesized by methods known in the art or expressed by the methods described herein.

As used herein, a cell is said to be "altered to express a desired peptide," when the cell, through genetic manipulation, is made to produce a protein that it does not normally produce or whose cell normally produces at low levels. One skilled in the art can readily adapt procedures for introducing and expressing either genomic, cDNA or synthetic sequences within eukaryotic or prokaryotic cells in order to generate a cell that produces a peptide, in particular the PS1 peptide.

The PS1 proteins of the present invention may be in the form of acidic or basic salts or in neutral form. In addition, individual amino acid residues can be modified by oxidation or reduction. In addition, various substitutions, deletions or additions can be made to the amino acid or nucleic acid sequences, the net effect of which is to retain or further increase or decrease the biological activity of the mutant or wild-type protein. Furthermore, due to the degeneracy in the genetic code, there can be considerable variation in the nucleotide sequences encoding the same amino acid sequence.

Guides for the manner of making substitutions for phenotypically silent amino acids are provided in J.U. Bowie et al. , "Deciphering the Message in the Protein Sequences: Tolerance to Amino Acid Substitutions", Science 247: 1306-1310 (1990), where the authors indicate that there are two main approaches to study the tolerance of an amino acid sequence to change. The first method relies on the process of evolution in which mutations are accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selections or screening to identify sequences that maintain functionality. As established by the author, these studies have revealed that proteins are surprisingly tolerant to amino acid substitutions. The authors also indicate which changes of amino acids are likely to be allowed in a certain position of the protein. For example, the most hidden amino acid residues do not require non-polar side chains, while few characteristics of surface side chains are generally observed. Other such phenotypically silent substitutions are described in Bowie, J.U. et al. , supra, and the references cited here.

Other derivatives of the PS1 proteins described herein include conjugates of the proteins together with other proteins or polypeptides. This can be carried out for example, by the synthesis of the N-terminal or C-terminal fusion proteins that can be added to facilitate the purification or identification of the Alzheimer's Disease Proteins (see US Pat. No. US Pat. 4,851,341, see also, Hopp et al, Biotechnology 6: 1204 (1988)). Alternatively, fusion proteins such as PS1 β-galactosidase or PS1-luciferase can be constructed in order to aid in the identification, expression and analysis of PS1 proteins.

The PS1 proteins of the present invention can be constructed using a wide variety of techniques, including those set forth in the Examples. In addition, mutations can be introduced at particular positions by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites that allow binding to fragments of the original sequence. After binding, the resulting reconstructed sequence encodes a derivative having the desired insertion, substitution or elimination of the amino acid.

Alternatively, site-specific mutagenesis procedures of oligonucleotide-directed sites (or specific segments) can be employed to provide an altered gene having particular codons altered in accordance with the substitution, deletion or insertion required. Exemplary methods for making the above-described alterations are described by Walder et al. , (Gene 42: 133 (1986)); Bauer et al. (Gene 37:73 (1985)); Craik (BioTechniques, January 1985, page 12-19); Smith et al.

(Genetic Engineering: Principles and Methods, Plenum Press, New York, NY (1981); and Sambrook et al. , Cloning Molecular: A Laboratory Manual, supra. . Truncated derivatives or removal of PS1 proteins (eg, an extracellular soluble portion) can also be constructed by using convenient endonuclease restriction sites adjacent to the desired deletion. After the restriction, the projections can be filled and the DNA relegated. Exemplary methods to elaborate the above-described alterations are described by Sambrook et al. , Molecular Cloning: A Laboratory Manual, supra.

Mutations that are made in the nucleic acid molecules of the present invention, preferably preserve the reading frame of the coding sequences. In addition, the mutations will not preferably create complementary regions that could hybridize to produce secondary structures of mRNA, such as curls or hairpins that would adversely affect translation of the mRNA. Although a mutation site can be predetermined, it is not necessary that the nature of the mutation per se be predetermined. For example, in order to select the optimal characteristics of the mutants at a given site, random mutagenesis can be conducted at the target codon and the expressed mutants screened for indicative biological activity. Alternatively, mutations can be introduced at particular positions by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites that allow binding to fragments of the original sequence. After binding, the resulting reconstructed sequence encodes a derivative having the desired insertion, substitution or elimination of the amino acid.

PS1 proteins can also be constructed using PCR mutagenesis techniques, chemical mutagenesis (Drinkwater and Klinedinst, Proc. Nati. Acá, Sci USA) 83: 3402-3406 (1986)), by a forced de-incorporation of nucleotides (eg, Liao and Wise, Gene 88: 107-111 (1990)), or by the use of randomly mutagenized oligonucleotides (Horwitz et al. , Genome 3: 112-117 (1989)). Particularly preferred methods for building proteins related to Alzheimer's disease are set forth in greater detail in the Examples.

In another aspect, the present invention provides a peptide or polypeptide comprising a portion that supports an epitope of the PS2 polypeptide or a mutant thereof. The epitope of this polypeptide portion is an antigenic or immunogenic epitope of a polypeptide of the invention. An "immunogenic epitope" is defined as the part of a protein that elicits a response to antibodies when the entire protein is the immunogen. These immunogenic epitopes are believed to be confined to a few positions in the molecule. On the other hand, a region of a protein molecule to which an antibody binds is defined as an "antigenic epitope". The number of antigenic epitopes of a protein is generally less than the number of antigenic epitopes. See, eg, Geysen et al. , Proc. Nat. Acad. Sci. USA 81: 3998-4002 (1983).

As for the selection of peptides or polypeptides that support an antigenic epitope (that is, they contain a region of a protein molecule to which an antibody can bind) it is well known in the art, that relatively short synthetic peptides that mimic part of a protein sequence, they are routinely able to elicit an antiserum that reacts with the partially mimicked protein. See, e.g., Sutcliffe, J.G., Shinnick, T.M. Green, N. and Learner, R.A. , Science 219: 660-666 (1983). Peptides capable of eliciting protein-reactive sera are frequently represented in the primary sequence, can be characterized by a set of simple chemical rules, and are not confined to immunodominant regions of intact proteins (ie, immunogenic epitopes) or terminals amino or carboxyl. Peptides that are extremely hydrophobic and those of six or less residues are generally inefficient to induce antibodies that bind to the mimicked protein; Longer peptides, especially those containing proline residues, are usually effective. Sutcliffe et al. , supra, at 661. For example, from 18 to 20 peptides designed in accordance with these guidelines, containing 8-39 residues that cover 75% of the polypeptide chain sequence of influenza virus HA1 haemagglutinin, induced antibodies that reacted with the HAI protein or the intact virus; and peptides 12/12 of the MuLV polymerase and 18/18 of the rabies glycoprotein induced antibodies that precipitated the respective proteins.

The antigenic peptides that support epitopes and polypeptides of the invention, are therefore useful for raising antiperspirants, including monoclonal antibodies, that specifically bind to a polypeptide of the invention. Thus, a high proportion of the hybridomas obtained by fusion of spleen cells from donors immunized with an antigen peptide that supports the epitope, generally secrete antibodies reactive with the original protein. Sutcliffe et al. , supra, at 663. Antibodies that grew by peptides or polypeptides that support epitopes are useful for detecting the mimicked protein, and antibodies for different peptides can be used to track the fate path of the different regions of a protein precursor which , undergoes post-translational processing. Peptide and anti-peptide antibodies can be used in a variety of quantitative and qualitative assays for the mimicked protein, for example, in competitive assays since it has been shown that even short peptides (eg, about 9 amino acids) ) can bind and displace the major peptides in immunoprecipitation assays. See p. ex. , Wilson et al. , Cell 37: 767-778 (1984). The antipeptide antibodies of the invention are also useful for the purification of the protein mimicked, for example, by adsorption chromatography using methods well known in the art.

The antigenic peptides and polypeptides that support epitopes of the invention, designed in accordance with the above guidelines, preferably contain a sequence of at least seven, more preferably at least nine and more preferably between about 15 and about 30 amino acids contained within the amino acid sequence of a polypeptide of the invention. However, peptides and polypeptides that comprise a larger portion of an amino acid sequence of a polypeptide of the invention, containing about 30 to about 50 amino acids, or of some length up to and including the complete amino acid sequence of a polypeptide of the invention are also considered peptides or polypeptides that support epitopes of the invention and are also useful for inducing antibodies that react with the mimicked protein. Preferably the amino acid sequence of the peptide that supports the epitope is selected to provide substantial solubility in aqueous solvents (ie, the sequence includes relatively hydrophilic residues and highly hydrophobic sequences are preferably avoided); and proline-containing sequences are particularly preferred.

Peptides and polypeptides of the invention that support epitopes can be produced by any conventional means to make peptides or polypeptides including recombinant means using nucleic acid molecules of the invention. For example, a short sequence of epitope-supporting amino acid can be fused with a larger polypeptide that acts as a carrier during recombinant production and purification, as well as during immunization to produce anti-peptide antibodies. Peptides that support epitopes can also be synthesized using known methods of chemical synthesis. For example, Houghten has described a simple method for the synthesis of a large number of peptides, such as 10-20 mg of 248 different peptides from residue 13 representing simple amino acid variants of a segment of HAl polypeptide that was prepared and characterized ( through ELISA-type link studies) in less than four weeks. Houghten R.A. (1985). The general method for rapid solid-phase synthesis of large numbers of peptides: specificity of the antigen-antibody interaction at the level of individual amino acids. Proc. Nati Acad. Sci. USA 82: 5131-5135. This process of "Simultaneous Synthesis of Multiple Peptides" is further described in U.S. Pat. No. 4,631,211 to Houghten et al. (1986). In this process, the individual resins for the solid phase synthesis of various peptides are contained in separate solvent-permeable packages, allowing the optimal use of many identical repetitive steps involved in solid-phase methods. A completely manual procedure allows 500-1000 or more synthesis to be conducted simultaneously. Houghten et al. , supra, at 5134. Immunogenic peptides that support epitopes of the invention, for example, those portions of a protein that elicit a response to antibodies when the entire protein is the immunogen, are identified in accordance with methods known in the art. For example, Geysen et al. , supra, describes a procedure for concurrent rapid synthesis on solid supports of hundreds of peptides of sufficient purity to react in an enzyme-linked immunosorbent assay. The interaction of the peptides synthesized with antibodies is then easily detected without removing them from the support. In this manner, a peptide that supports an immunogenic epitope of a desired protein can be routinely identified by one of ordinary skill in the art. For example, the immunologically important epitope on the coat protein of a foot and mouth disease virus was located by Geysen et al. , with a resolution of seven amino acids by synthesis of an overlapping set of all 208 possible hexapeptides covering the complete amino acid sequence 213 of the protein. Then a complete peptide replacement set was synthesized, in which all the 20 amino acids are themselves replaced at each position within the epitope, and the particular amino acids which confer specificity for the reaction with the antibody were determined. Thus, peptide analogs of the peptides that support epitopes of the invention can be routinely made by this method. The U.S. No. 4,708,781 to Geysen (1987) further describes this method for identifying a peptide that supports an immunogenic epitope of a desirable protein.

Still further, the U.S. No. 5,194,392 to Geysen (1990) describes a general method of detecting or determining the sequence of monomers (amino acids or other components) which is a topological equivalent of the epitope (ie, a "mimitope") that is complementary to a paratope. particular (antigen binding site) of an antibody of interest. More generally, the U.S. No. 4,433,092 to Geysen (1989) describes a method of detecting or determining a monomer sequence that is a topographic equivalent of a ligand which is complementary to the ligand binding site of a particular receptor of interest. Similarly, the U.S. No. 5,480,971 to Houghten, R.A. et al. (1996) on Peralquilate Oligopeptide Mixtures describes linear peralkylated oligopeptides of C1-C7 alkyl and sets and collections of said peptides, as well as methods for using said sets and collections of oligopeptides to determine the sequence of a peralkylated oligopeptide that preferentially binds to a accepting molecule of interest. Thus, non-peptide analogs of the peptides that support epitopes of the invention can also be routinely prepared by these methods.

III. Recombinant Expression of PS1 The present invention also provides for the manipulation and expression of the genes described above, by culturing host cells containing a vector capable of expressing the genes described above. Such vectors or vector constructs include synthetic nucleic acid or cDNA-derived nucleic acid molecules that encode PS1 proteins that are "operably linked" to the transcriptional or translational regulatory elements.

The precise nature of the regulatory regions needed for the expression of the gene sequence can vary from organism to organism, but should generally include a promoter region which in the prokaryotes, contains the promoter (which directs the initiation of transcription of the RNA) and DNA sequences, which when transcribed in the RNA will signal the start of the synthesis. Said regions will normally include those 5 'non-coding sequences involved with the initiation of transcription and translation, such as the TATA box, cover sequence, CAAT sequence and the like.

Proper expression in a prokaryotic cell also requires the presence of a ribosome binding site upstream of the coding sequence of the gene sequence. Such ribosome binding sites are described, for example, by Gold et al. , (Ann Rev. Microbiol. 35: 365-404 (1981)).

The appropriate regulatory elements can be derived from a variety of sources, including bacterial, fungal, viral, mammalian, insect or plant genes. The selection of the appropriate regulatory elements depends on the chosen host cell, and can be easily achieved by one skilled in the art. Examples of regulatory elements include: a transcriptional promoter and amplifier or an RNA polymerase linker sequence, a transcriptional terminator and a ribosome linker sequence, including a translation initiation signal.

A PS1 protein encoded by any of the nucleic acid molecules described above, can be readily expressed by a wide variety of eukaryotic and prokaryotic host cells including bacterial, mammalian, insect, yeast or other fungal, viral or plant cells. Methods for transforming or transfecting said cells to express the external DNA are well known in the art.

The genetic coding sequence, eg, PS1 and an operably linked promoter, can be introduced into a prokaryotic or eukaryotic recipient cell either as a non-replicating DNA (or RNA) molecule that can be a linear molecule or, more preferably, a covalent closed circular molecule. Since these molecules are incapable of autonomous replication, gene expression can occur through the transient expression of the introduced sequence. Alternatively, permanent expression may occur through the integration of the introduced DNA sequence within the host chromosome.

In one embodiment, a vector is used that is capable of integrating the desired sequences of genes within the chromosome of the host cell. Cells that have stably integrated the DNA introduced into their chromosomes can be selected by also introducing one or more markers that allow selection of the host cells that contain the expression vector. The label can provide the prototrophy to an auxotropic host, resistant to biocides, e.g., antibiotics, or heavy metals such as copper or the like. The selectable marker gene sequence can be ligated directly to the DNA gene sequences to be expressed, or inserted into the same cell by co-transfection. Additional elements may be needed for the optimal synthesis of the single chain binding protein mRNA. These elements may include splicing signals, as well as transcription promoters, amplifiers and termination signals.

If desired, the 3 'non-coding region to the sequence encoding a PS1 gene can be included by its regulatory transcriptional termination sequences, such as termination and polyadenylation. Thus, by retaining the 3 'region naturally contiguous to the DNA sequence encoding the gene, transcriptional termination signals can be delivered. Where the transcriptional termination signals are not satisfactorily functional in the expression host cell, then a 3 'functional region in the host cell can be substituted.

A. Vectors Bacterial expression vectors preferably comprise a promoter which functions in the host cell, one or more selectable phenotypic markers and a bacterial origin of replication. Representative promoters include β-lactamase (penicillinase) and a lactose promoter system (see Chang et al., Nature 275: 615 (1978)), the T7 RNA polymerase promoter (Studier et al., Meth., Enzymol 185: 60-89 (1990)), the lambda promoter (Elvin et al., Gene 87: 123-126 (1990)), the trp promoter (Nichols &Yanofsky, Meth. in Enzymology 101: 155 (1983)) and the tac promoter (Russell et al., Gene 20: 231 (1982)). Representative selectable markers include various markers with resistance to antibiotics such as genes resistant to kanamycin or ampicillin.

Many plasmids suitable for the transformation of host cells are well known in the art, including among others, pBR322 (see Bolivar et al., Gene 2:95 (1977)), the pUC plasmids pUC18, pUC19, püCllβ, pUC119 (see Messing , Meth. In Enzymology 101: 20-77, 1983) and Vieira & Messing, Gene 19: 259-268 (1982)), and pNH8A, pNH16a, pNHlda and Bluescript M13 (Stratagene, La Jolla, Calif.).

Suitable expression vectors for yeast and fungi include, among others, YCp50 (ATCC No. 37419) for yeast and pV3 vectors (Turnbull, Bio / Technology 7: 169 (1989)), YRp7 (Struhl et al., Proc. Nati. Acad. , Sci. USA 76: 1035-1039 (1978)), YEpl3 (Broach et al., Gene 8: 121-133 (1979)), pJDB249 and pJDB219 (Beggs, Nature 275: 104-108 (1978)), and derived from them.

Preferred promoters for use in yeast include promoters of yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255: 12073-12080 (1980); Alber & Kawasaki, J. Mol. Appl. Genet 1: 419-434 (1982)) or alcohol dehydrogenase genes (Ammerer, Meth.

Enzymol. 101: 192-201 (1983). Examples of promoters useful for fungal vectors include those derived from the glycolytic genes of Aspergillus nidulans, such as the adh3 promoter (McKnight et al., EMBO J. 4: 2093-2099 (1985)). The expression units may also include a transcriptional terminator. An example of an appropriate terminator is the adh3 terminator (Me. Knight et al., EMBO J. 4: 2093-2099 (1985)).

As with bacterial vectors, yeast vectors generally include a selectable marker that can be one of any number of genes that display a dominant phenotype for which a phenotypic assay exists that allows transformants to be selected. Preferred selectable markers are those that complement the auxotropia of host cells, provide resistance to antibiotics or allow a cell to use specific sources of carbon, and include leu2 (Broach et al., Gene 8: 121-133 (1979)), ura3 (Botstein et al., Gene 8:17 (1979)) or his3 (Struhl et al., Proc. Nati. Acad. Sci. USA 76: 1035-1039 (1978)). Another suitable selectable marker is the gene that confers resistance to chloramphenicol in yeast cells.

Fungal transformation techniques are well known in the literature, and have been described for example by Beggs (Nature 275: 104-108 (1978)), Hinnen et al. , (Proc. Nati, Acad. Sci. USA 75: 1929-1933 (1978)), Yelton et al. (Proc. Nati, Acad. Sci. USA 81: 1740-1747 (1984)), and Russell (Nature 301: 167-169, 1983)). The genotype of the host cell may contain a genetic defect that is complemented by the selected marker present in the expression vector. The choice of a particular guest and a selected marker is well within the ordinary level of those skilled in the art.

Viral vectors include those that comprise a promoter that directs the expression of an isolated nucleic acid molecule, which encodes an Alzheimer's disease protein. A wide variety of promoters can be used within the context of the present invention, including for example, pormotors such as MoMLV LTR, RSV LTR, friendly MuLV LTR, adenoviral promoter (Ohno et al., Science 265: 781-784 (1994)). ), promoter / amplifier of neomycin phosphotransferase, late parvovirus promoter (Koering et al., Hum The Gene 5: 463 (1994)), tk herpes promoter, SV40 promoter, promoter / metallothionein enhancer , immediate early promoter of cytomegalovirus, and the immediate late promoter of cytomegalovirus.

Within particularly preferred embodiments of the invention, the promoter is a tissue-specific promoter (see, e.g., WO 91/02805, EP 0,415,731, and WO 90/07936). Representative examples of the appropriate tissue-specific promoters include enolase-specific neural promoter, promoter of platelet-derived growth factor-ß, bone morphogenetic protein promoter, human a-1 -erminerin promoter, synapsin promoter I and promoter. II of synapsin.

In addition, other specific viral promoters (eg, retroviral promoters including those observed above and others, such as HIV promoters), hepatitis, herpes, (eg, EBV) and bacterial, fungal or specific parasitic promoters (eg. .ej, of malaria), can be used in order to attack a specific cell or tissue that is infected with a virus, bacteria, fungus or parasite. Thus, the PS1 proteins of the present invention can be expressed from a variety of viral vectors. Within various embodiments, the viral vector itself or a viral particle containing the viral vector can be used in the methods and compositions described below.

Mammalian expression vectors for use in carrying out the present invention will include a promoter capable of directing the transcription of a cloned gene or cDNA.

Preferred promoters include viral promoters and cellular promoters. Viral promoters include the cytomegalovirus immediate early promoter (Boshart et al., Cell 41: 521-530 (1985)), cytomegalovirus immediate late promoter, SV40 promoter (Subramani et al., Mol. Cell. Bio. 1: 854 -864 81981)), MMTV LTR, RSV LTR, metallothionein-1, Adenovirus Ela.

Cell promoters include the mouse metallothionein-1 promoter (palmiter et al., US Patent No. 4,579,821), a mouse Vk promoter (Bergman et al., Proc. Nati. Acad. Sci. EUA 81: 7041-7045 ( 1983), Grant et al., Nucí Acids Res. 15: 5496, 1987) and a mouse VH promoter (loh et al., Cell 33: 85-93 (1983)). The choice of promoter will depend at least in part on the level of expression desired or on the cell line of the receptor to be transfected.

The expression vectors may also contain a set of RNA splice sites located downstream of the promoter and upstream of the DNA sequence encoding the peptide or protein of interest. Preferred RNA splice sites can be obtained from adenovirus and / or immunoglobulin genes. Also contained in the expression vectors is a polyadenylation signal located downstream of the coding sequence of interest. Suitable polyadenylation signals include the early or late polyadenylation signals of the SV40, the polyadenylation signal of the adenovirus 5 ElB region and the terminator of the human growth hormone gene (DeNoto et al., Nuc Acids Res. : 3719-3730 (1981)). Expression vectors may include a non-coding viral leader sequence, such as the tripartite leader of adenovirus-2, located between the promoter and the RNA splice sites. Preferred vectors may also include amplifier sequences, such as the SV40 amplifier and the mouse amplifier I (Gillies, Cell 33: 717-728, 1983)). Suitable expression vectors can be obtained from commercial sources (eg Stratagene, La Jolla, Calif.) The vectors of the present invention may contain or express a wide variety of additional nucleic acid molecules in place of or in addition to a PS1 protein as described above, either from one or several separate promoters. For example, the viral vector can express a lymphokine or a lymphokine receptor, antisense or ribozyme sequence or toxins. Representative examples of lymphokines include 1L-1 through 1L-15, GM-CSF, G-CSF, M-CSF, α-, β- or gamma interferon and tumor necrosis factors, as well as their respective receptors. Representative examples of antisense sequences include antisense sequences that block the expression of PS1 protein mutants. Representative examples of the toxins include: ricin, abrin, diphtheria toxin, cholera toxin, gelonin, sack herb antiviral protein, tritin, Shigella toxin and Pseudomonas exotoxin A.

B. Host Cells. 1. Prokaryotic Host Cells Preferred prokaryotic host cells for use within the present invention include E. coli, Salmonella, Bacillus, Shigella, Pseudomonas, Streptes and Staphy lococcus, as well as many other bacterial genera or species well known to someone with skill in art. Techniques for transforming these hosts and expressing external DNA sequences cloned therein are well known in the art (see, eg, Maniatis et al., Supra). Vectors used to express cloned DNA sequences in bacterial hosts will generally contain a selectable marker, such as a gene for resistance to antibiotics and a promoter that functions in the host cell. Suitable promoters include the trp promoter systems (Nichols &Yanofsky, Meth. Enzymol. 101: 155-164 (1983)), lac (Casadaban et al., J. Bacterio., 143: 971-980 (1980)), and phage? (Queen, J. Mol, Appl. Genet, 2: 1-10 (1983)).

Plasmids useful for transforming the bacteria include the pUC plasmids (Messing, Meth, Enzymol, 101: 20-78 (1983), Vieira &Messino, Gene 19: 259-268 (1982)), pBR322 (Bolivar et al. ., Gene 2: 95-113 (1977)), pCQV2 (Queen, J. Mol.Appl. Genet., 2: 1-10 (1983)) and derivatives thereof. The plasmids can contain viral and bacterial elements. 2. Culture Conditions The host cells containing vector constructs of the present invention are then cultured to express a DNA molecule as described above. The cells are cultured in accordance with standard methods in a culture medium containing nutrients required for the growth of the chosen host cells. A variety of suitable means are known in the art and generally include a source of carbon, a source of nitrogen, essential amino acids, vitamins and minerals as well as other components, eg, growth factors or serum, which may be required by the particular host cells. The growth medium will generally select cells containing the DNA constructs for example, the selection of drugs or deficiency in an essential nutrient that is complemented by the selectable marker on the DNA construct or is co-transfected with the DNA construct.

Suitable growth conditions for yeast cells for example, include culture in a chemically defined medium, comprising a nitrogen source which may be a source of nitrogen that is not amino acid or a yeast extract, inorganic salts , vitamins and essential amino acid supplements at a temperature between 4 ° C and 37 ° C with 30 ° C being particularly preferred.

The pH of the medium is preferably maintained at a pH greater than 2 and less than 8, more preferably pH 5-6. Methods to keep the pH stable include damping and constant pH control. Preferred agents for pH control include sodium hydroxide. Preferred buffering agents include succinic acid and Bis-Tris (Sigma Chemical Co., St. Louis, MO).

Because of the tendency of yeast host cells towards heterologous hyperglycosylate proteins, it may be preferable to express the nucleic acid molecules of the present invention in yeast cells having a defect in a gene required for glycosylation linked with asparagine. Said cells preferably grow in a medium containing an osmotic stabilizer. A preferred osmotic stabilizer is sorbitol supplemented in a medium at a concentration between 0.1 M and 1.5 M, preferably at 0.5 M or 1.0 M. 3. Host Eukaryotic Cells Preferred host eukaryotic cells include cultured cell lines of mammals (eg, rodent or human cell lines) and fungal cells, including yeast species or filamentous fungi. In general, a host cell will be selected on the basis of its ability to produce the protein of interest at a high level or its ability to carry out at least some of the processing steps necessary for the biological activity of the protein. In this way, the number of cloned DNA sequences that must be introduced into the host cell can be minimized and the overall yield of the biologically active protein can be maximized.

Some of the series of yeast gene sequence expression systems can be used, which incorporates the promoter and terminator elements of actively expressed gene sequences that encode glycolytic enzymes and are produced in large quantities when yeast It grows in glucose rich media. Glycolytic sequences of known genes can also provide very efficient transcriptional control signals.

Yeast provides substantial advantages in that it can also carry translational modifications to the peptides. There are a variety of recombinant DNA strategies, which use strong sequences of promoters and a high copy number of plasmids which can be used for the production of the desired proteins in the yeast. The yeast recognizes the leader sequences on the sequence products of cloned mammalian genes and secreted peptide sequences that support the leader (eg, pre-peptides).

Yeast host cells and fungi suitable for carrying out the present invention include, among others, Saccharomyces pombe, Saccharomyces cerevisiae, the genera Pichia or Kluyveromyces and various fungal species (eg, genera Aspergillus or Neurospora).

The protocols for the transformation of the yeast are well known to those skilled in the art. For example, the transformation can be carried out easily either by the preparation of yeast spheroplasts with DNA (see Hinnen et al., Proc, Nat. Acad.

Sci. USA 75: 1929 (1978)) or by treatment with alkali salts such as LiCl (see Itoh et al., J.

Bacteriology 153: 163 (1983)). Mushroom transformation can also be carried out using polyethylene glycol as described by Cullen et al. (Bio / Technology 5: 369 (1987)).

In the alternative, the nucleic acid molecules encoding the PS1 proteins of the present invention (or vectors containing them and / or expressing related mutants) can be easily introduced into the cells of a vertebrate or warm-blooded animal such as cells of a human, macaque, dog, cow, horse, pig, sheep, rat, hamster, mouse or fish or any hybrid thereof.

Mammalian cells that may be useful as hosts include among others: PC12, neuroblastoma NIE-115, neuroblastoma SK-N-BE (2) C, adrenergic neuroblastoma SHSY5, cholinergic murine cell lines NS20Y and NG108-15, or rat dorsal root ganglia lines F2, COS (eg, deposited with the American Type Culture Collection (ATCC) No. CRL 1650 or 1651 ), BHK (eg ATCC No. CRL 6281; cell line BHK 570 (ATCC) under accession number CRL 10314), CHO (ATCC No. CCL 61), HeLa (eg, ATCC No. CCL 2), 293 (ATCC No. 1573); Graham et al. , J. Gen. Virol. 36:; 59-72 (1977)) and NS-1 cells. Other cell lines can be used within the present invention, including rat Hep I (ATCC No. CRL 1600), rat Hep II (ATCC No. CRL 1548), TCMK (ATCC No. CCL 139), human lung ( ATCC No. CCL 75.1), human hepatoma (ATCC No. HTB-52), Hep G2 (ATCC No. HB 8065), mouse liver (ATCC No. CCL 29.1), NCTC 1469 (ATCC No. CCL 9.1), SP2 / 0-Agl4 (ATCC No. 1581), HIT-TI15 (ATCC No. CRL 1777) and RINm 5AHT2B (Orskov &Nielson, FEBS 229 (I): 175-178 (1988)).

Cultured cells of mammals are generally cultured in commercially available media containing serum or serum free. The selection of a medium and the appropriate growth conditions for the particular cell line used are well within the level of ordinary skill within the art.

Protocols for the transfection of mammalian cells are well known to those of ordinary skill in the art. Vector constructs comprising cloned DNA sequences can be introduced into cultured cells of mammals for example, by calcium phosphate-mediated transfection (Wigler et al., Cell 14: 725 (1978); Corsaro &Pearson, Somatic Cell Genetics 7: 603 (1981), Graham &Van der Eb, Virology 52: 456 (1973), electrophoresis (Neumann et al., EMBO J. 1: 841-845 (1982)) or transfection mediated with dextran-DEAE (Current Protocols in Molecular Biology, Ausubel et al., Eds. John Wiley and Sons, Inc. New York, NY (1987).) In order to identify cells that have cloned DNA stably integrated, a selectable marker is generally introduced within The cells, together with the gene or cDNA of interest, Preferred selectable markers for use in cultured mammalian cells include genes that confer resistance to drugs such as neomycin, hygromycin and methotrexate. an amplifiable selectable marker. Preferred amplifiable selectable markers are the DHFR gene and the neomycin resistance gene.

Mammalian cells containing an appropriate vector are allowed to grow for a period of time, typically 1-2 days, to begin expressing the DNA sequence of interest. The drug selection is then applied to select the growth of cells that are expressing the selectable marker in a stable form. For cells that have been transfected with an amplifiable selectable marker, the concentration of the drug can be increased in a stepwise fashion to select an increasing number of copies of the cloned sequences, thereby increasing the levels of expression. The cells expressing the introduced sequences are selected and examined for the production of the protein of interest in the desired form or at the desired level. Cells that meet these criteria can then be cloned and scaled for production.

In addition, plant cells are also available as hosts and control sequences compatible with plant cells are available, such as the nopaline synthase promoter and the polyadenylation signal sequences. see eg, Czako & Marton, Plant Physiol. 104: 1067-1071 (1994); and Paszkowski et al. , Biotech. 24: 387-392 (1992). For example, the use of Agrobacterium rhizogenes as a vector to express genes in plant cells has been reviewed by Sinkar et al. (J. Biosci. (Bangalores) 11: 47-58 (1987)).

Another preferred host is an insect cell, for example, the larva Drosophila. By using the insect cells as hosts, the Drosophila alcohol dehydrogenase promoter can be used. Rubin, Science 240: 1453-1459 (1988). In the alternative, baculovirus vectors can be engineered to express large amounts of PS1 in insect cells (Jasny, Science 238: 1653 (1987); Miller et al., In: Genetic Engineering (1986), Setlow, JK et al., eds. Plenum, Vol. 8, pp 277-297); Atkinson et al. (Pestic. Sci. 28: 215-224 (1990)).

The PS1 gene can also be expressed in non-human transgenic animals such as mice, rats, rabbits, sheep, dogs and pigs (see Hammer et al., Nature 315: 680-683 (1985); Palmiter et al., Science 222 : 809-814 (1983), Brinster et al., Proc. Nati, Acad. Sci. USA 82: 4438-4442 (1985), Palmiter &Brinster, Cell 41: 343-345 (1985) and US Pat. . 5, 175,383, 5,087,571, 4,736,866, 5,387,742, 5,347,075, 5,221,778 and 5,175,384). Briefly, an expression vector, including a nucleic acid molecule to be expressed together with the expression control sequences appropriately positioned, are introduced into pronuclei of eggs fertilized for example, by microinjection. The integration of the injected DNA is detected by an analysis of DNA spots from tissue samples. It is preferred that the introduced DNA be incorporated into the animal's germ line so that it is passed on to the progeny of the animal. Tissue-specific expression can be achieved through the use of a tissue-specific promoter or through the use of an inducible promoter, such as the promoter of the metallothionein gene (Palmiter et al., Science 222: 809-814). (1983)) which allows the regulated expression of the transgene.

C: Protein Isolation Proteins can be isolated by, among other methods, culturing an appropriate host and vector systems to produce the recombinant translation products of the present invention. Supernatants of said cell lines or protein inclusions or whole cells in which the protein is not excreted into the supernatant can then be treated by a variety of purification methods in order to isolate the desired proteins. For example, the supernatant may be first concentrated using commercially available protein concentration filters. Then, the concentrate can be applied to an appropriate purification matrix such as for example, an anti-protein antibody bound to an appropriate support. Alternatively, cation exchange resins or anions can be used in order to purify the protein. As a further alternative, one or more high performance liquid chromatography (RP-HPLC) steps can be employed to further purify the protein. Other methods of isolating the protein of the present invention are well known in the skill of the art.

A protein is considered "isolated" within the context of the present invention if no other (undesirable) protein is detected according to the SDS-PAGE analysis followed by staining with Coomassie blue. Within other embodiments, the isolated protein can be isolated so that no other (undesirable) protein is detected according to the SDS-PAGE analysis followed by silver staining.

IV. Antibodies Antibodies to PS1 proteins can be easily prepared given the description provided herein. Within the context of the present invention, the antibodies are understood to include monoclonal antibodies, polyclonal antibodies, anti-ideotropic antibodies, fragments of antibodies (eg, Fab and F (ab ') 2 / variable regions Fv or complementary determining regions ). As discussed above, it is understood that the antibodies are specific against the Alzheimer's disease protein if it binds with a Ka greater than or equal to 10"7 M, preferably greater than or equal to 10" 8 M. The affinity of A monoclonal antibody or binding partner can be easily determined by one of ordinary skill in the art.

Briefly, polyclonal antibodies can be easily generated by someone skilled in the art from a variety of warm-blooded animals such as horses, cows, various birds, mice or rats. Typically, a PS1 protein or PS1 unique peptide of 13-20 amino acids (preferably conjugated to lame hemocyanin by crosslinking with glutaraldehyde), is used to immunize the animal through intraperitoneal, intramuscular, intraocular or subcutaneous injections, an adjuvant such as the complete or incomplete Freund's adjuvant. Following various bootstrap immunizations, serum samples are collected and tested for reactivity to the PS1 protein. Particularly preferred polyclonal antisera will give a signal in one of these assays that is at least three times greater than the background. Once the assessment of the animal has reached a stability in terms of its reactivity to the protein, greater quantities of antisera can be easily obtained either by weekly bleeding or by bloodlessing the animal.

Monoclonal antibodies can also be easily generated using conventional techniques (see US Pat. Nos. RE 32,011, 4,902,614, 4,543,439 and 4,411,993 which are incorporated herein by reference; see also, Antibodies: A Laboratory Manual, Harlow &Lane eds., Cold Spring Harbor Press, Cold Spring Harbor, NY (1988) also incorporated herein by reference).

Briefly, within one embodiment, a subject animal such as a rat or mouse is injected with a PS1 protein or a portion thereof as described above. The protein can be administered with an adjuvant such as Freund's complete or incomplete adjuvant, in order to increase the resulting immune response. Between one and three weeks after the initial immunization, the animal can be reinmunized with another bootstrapping immunization, and tested for reactivity to the protein using the assays described above. Once the animal has stabilized in its reactivity to the mutant, it is sacrificed, and organs that contain a greater number of B cells such as the spleen and lymph nodes are harvested.

Cells obtained from the immunized animal can be immortalized by transfection with a virus such as Epstein-Barr virus (EBV) (see Glasky &Reading, Hybridoma 8 (4): 377-389 (1989)). Alternatively within a preferred embodiment, suspensions of cells harvested from the spleen and / or a lymph node are fused with an appropriate myeloma cell in order to create a "hybridoma" that secretes the monoclonal antibody. Appropriate lines of myeloma include, for example, NS-1 (ATCC No. TLB 18) and P3X63-Ag 8.653 (ATCC No. CRL 1580).

After fusion, the cells can be placed in culture plates containing an appropriate medium, such as RPMI 1640 or DMEM (Modified Dulbecco's Eagles Medium), as well as additional ingredients such as fetal bovine serum. Additionally, the medium should contain a reagent which selectively allows the growth of melted myeloma and spleen cells such as HAT (hypoxanthine, aminopterin and thymidine) (Sigma Chemical Co. St. Louis, MO). After about seven days, the resulting fused cells or hybridomas can be examined in order to determine the presence of antibodies that are reactive against the PS1 protein. A wide variety of assays can be used to determine the presence of antibodies that are reactive against the proteins of the present invention, including, for example, immunoelectrophoresis (IEP), radioimmunoassays and radioimmunoprecipitations, Immuno-Sorbent Enzyme-Linked Assays (ELISA), spot testing, western spots, immunoprecipitation, inhibition or competition tests and interlaminar structure tests. Following the various clonal relutions and reassays, a hybridoma that produces reactive antibodies against PS1 can be isolated.

Other techniques known in the art can be used to construct monoclonal antibodies. In the alternative, a commercial system available from Stratacyte, La Jolla Ca. allows the production of antibodies through recombinant techniques. Briefly, the mRNA can be isolated from a population of B cells and used to create collections of light chain immunoglobulin cDNA expression in the vectors lnmunoZap (H) and lnmunoZap (L). These vectors can be individually examined or coexpressed to form Fab fragments or antibodies. Positive plaques can subsequently be converted to a non-lytic plasmid that allows a high level of expression of monoclonal E. coli antibody fragments.

Similarly, portions or fragments such as Fab and Fv antibody fragments can also be constructed using recombinant DNA techniques or conventional enzyme digestion to incorporate the variable regions of a gene encoding a specifically binding antibody. In one embodiment of the present invention, the genes encoding the variable region of a hybridoma that produces a monoclonal antibody of interest, are amplified using nucleotide primers for the variable region. These primaries can be synthesized by someone of ordinary skill in the art, or can be purchased from commercially available sources. The primaries for human and mouse variable regions include, among others, primaries for the VHa, VHb, HCV, CH1, VL and CL regions that are available from eg, Stratacyte (La Jolla CA). The primaries can be used to amplify variable regions of light or heavy chains that can then be inserted into vectors such as ImmunoZAP ™ H or ImmunoZAP ™ L (Stratacyte), respectively. These vectors can be introduced into E. coli for expression. Using these techniques, large amounts of a single chain protein containing a fusion of VH and VL domains can be produced (see Bird et al., Science 242: 423-426 (1988)). In addition, such techniques can be used to change a "murine" antibody to a "human" antibody, without altering the binding specificity of the antibody.

Once the appropriate antibodies have been obtained, they can be isolated or purified by various techniques well known to one of ordinary skill in the art (see Antibodies: A Laboratory Manual, Harlow and Lane (eds.).) Cold Spring Harbor Laboratory Press , 1988). Appropriate techniques include affinity columns of proteins or peptides, HPLC or RP-HPLC, purification on protein A or G protein columns or any combination of these techniques.

The antibodies of the present invention have many uses. For example, the antibodies can be used in the flow cytometry of drawn cells that support said PS1 protein. Briefly, in order to detect the protein or peptide of interest in the cells, the cells are incubated with a labeled monoclonal antibody that specifically binds to the protein of interest, followed by detection in the presence of bound antibodies. These steps can also be carried out with additional steps such as washes to remove the unbound antibodies. Appropriate labels for use within the present invention are well known in the art, including among others, fluorescein isothiocyanate (FITC), phycoerythrin (PE), horseradish peroxidase (HRP) and colloidal gold. Particularly preferred for use in flow cytometry is FITC, which can be conjugated to a purified antibody in accordance with known methods.

Of special interest for the present invention are antibodies to PS1, which are produced in humans or "humanized" (ie, non-immunogenic in a human) by recombinant or other technology. Humanized antibodies can be produced, for example, by replacing an immunogenic portion of an antibody with a corresponding but non-immunogenic portion (ie, chimeric antibodies) (Robinson, RR et al., PCT / US 86/02269; Akira, K. et al., EP-A 184,187; Taniguchi, M. EP-A 171,496; Morrison, S.L., et al., EP-A 173,494; Neuberger, MS et al., PCT Application WO 86/01533; Cabilly, S. et al., EP-A 125,023; Better, M. et al., Science 240: 1041-1043 (1988); Liu, AY et al., Proc. Nati. Acad. Sci. USA 84: 3439-3443 (1987); Liu, AY et al., J. Immunol., 139: 3521-3526 (1987); Sun, LK et al., Proc. Nati, Acad. Sci. USA 84: 214-218 (1987); Nishimura , Y et al., Canc. Res. 47: 999-1005 (1987); Wood, CR et al., Nature 314: 446-449 (1985)); Shaw et al. , J. Nati.

Cancer Inst. 80: 1553-1559 (1988). General reviews of humanized chimeric antibodies are provided by Morrison, S.L. (Science, 229: 1202-1207 (1985)) and by Oi, V.T. et al. , BioTechniques 4: 214 (1986)). Suitable "humanized" antibodies may alternatively be produced by substitution of CDR or CEA (Jones PT, et al., Nature 321: 552-525 (1986); Verhoeyan et al., Science 239: 1534 (1988); Beidler, CB et al., J. Immunol., 141: 4053-4060 (1988)).

V. Methods for Detecting the Presence of PS1 in a Sample Useful assays within the context of the present invention include those assays for detecting agonists or antagonists of PS1 protein activity. Other assays are useful for the examination of collections of organic molecules or peptides. Still other assays are useful for the identification and / or isolation of nucleic acid molecules and / or peptides within the present invention or for diagnosis of a patient with an increased likelihood of contracting Alzheimer's disease.

A. Diagnostic Tests Based on Nucleic Acid Briefly, the present invention provides probes and primaries for detecting PS1 genes and / or mutants thereof. For example, probes are provided that are capable of specifically hybridizing to the PS1, DNA or RNA genes. For purposes of the present invention, the probes are "capable of hybridizing" to PS1, DNA or RNA genes if they hybridize to a PS1 gene under conditions of high or moderate shortage (see Sambrook et al., Molecular Cloning: A Laboratory Manual, supra), but typically not the PS2 gene. Preferably, high lean conditions would be used, such as SSPE 5x, Denhardt lx solution (Sambrook et al., Supra), 0.1% SDS at 65 ° C and at least one wash to seprate the probe in excess in the presence of 0.2x SSC, Denhardt lx solution, 0.1% SDS at 65 ° C. Except where otherwise provided herein, the probe sequences are designed to allow hybridization to PS1 genes, but not to DNA or RNA sequence from other genes. The probes are used, for example, to hybridize to the nucleic acid that is present in a biological sample isolated from a patient. The hybridized probe is then detected thereby indicating the presence of the desired cellular nucleic acid. Preferably, the cellular nucleic acid is subjected to an amplification procedure, such as PCR prior to hybridization. Alternatively, the PS1 gene can be amplified and the amplified product is subjected to a DNA sequence.

PS1 mutants can be detected by DNA sequence analysis or hybridization with allele-specific oligonucleotide probes under conditions and for sufficient time to allow hybridization of the specific allele. Typically, the buffer for hybridization and washing will contain tetramethyl ammonium chloride or the like (see Sambrook et al., Molecular Cloning: A Laboratory Manual, supra).

The probes of the present invention can be composed of DNA, RNA, nucleic acid analogs (eg, nucleic acids / peptides) or any combination thereof. They can be as small as about 12 nucleotides in length, usually around 14 to 18 nucleotides in length, but can be as large as the complete sequence of a PS1 gene. The selection of the size of the probe depends in some way on the use of the probe and is within the skill of the art.

Appropriate probes can be constructed and labeled using techniques that are well known in the art. Shorter probes for example can be synthetically generated 12 bases and labeled with 32P using a T4 polynucleotide kinase. Larger probes of about 75 bases or less than 1.5 kb are preferably generated by for example, PCR amplification in the presence of labeled precursors such as [-32P] dCTP, digoxigenin-dUTP, or biotin-dATP. Probes greater than 1.5 kb are generally easier to amplify by transfecting a cell with a plasmid containing the relevant probe, growing the transfected cell in large quantities, and purifying the relevant sequence of the transfected cells (See Sambrook et al. , supra).

The probes can be labeled by a variety of labels, including for example, radioactive labels, fluorescent labels, enzymatic labels and chromogenic labels. The use of P is particularly preferred for labeling or labeling a particular nucleic acid probe.

Illustrative examples of appropriate enzyme labels include malate dehydrogenase, staphylococcal nuclease, delta-5-esteroidisomerase, - alcohol-yeast dehydrogenase, alpha-glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholine esterase.

Illustrative examples of radiosyiotropic labels include 3H, X11ln, 125I, 131I, 32P, 35S, 14C, 51Cr, 57To, 58Co, 59Fe, 75Se, 152Eu, 90Y, 67Cu, 217Ci, 211At, 212Pb, 47Sc, 109Pd, etc. LlxIn is a preferred isotope where imagination is used in vivo as it avoids the problem of dehalogenation of the monoclonal antibody labeled as 125I or? 1 for the liver. In addition, this radionucleotide has a more favorable gamma emission energy for images (Perkins et al., Eur, J. Nucí, Med. 102: 296-301. (1985); Carasquillo et al. , J. Nucí. Med. 28: 281-287 (1987)). For example, lxlIn coupled to monoclonal antibodies to 1- (P-isothiocyanatobenzyl) -DPTA has shown low incorporation in non-tumorous tissues, particularly in the liver and therefore allows a specificity of tumor location (Esteban et al. , J. Nucí, Med. 28: 861-870 (1987)).

Illustrative examples of non-radioactive isotopic labels include Gd, Mn, Dy, Tr and Fe.

Illustrative examples of suitable fluorescent labels include a 152Eu label, a fluorescein label, an isothiocyanate label, a rhodamine label, a phycoerythrin label, a phycocyanin label, an allophycocyanin label, an o-phthaldehyde label and a label of fluorescamine.

Illustrative examples of the appropriate toxin labels include diphtheria toxin, ricin and cholera toxin.

Illustrative examples of chemiluminescent labels include a luminal label, an isoluminal label, an acridinium aromatic ester label, an imidazole label, an acridinium salt label, an oxalate ester label, a luciferin label, a luciferase label and an aequorin label.

Illustrative examples of nuclear magnetic resonance contrast agents include heavy metal cores such as Gd, Mn and iron.

Typical techniques for linking the above described labels to antibodies are provided by Kennedy et al. , Clin. Chim. Acta 70: 1-31 (1976) and Schurs et al. , Clin. Chim. Act 81: 1-40 (1977). The coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, the ester method of m-maleimidobenzyl-N-hydroxy-succinimide, all of which methods are incorporated herein by reference .

The probes of the present invention can be used to detect the presence of PS1, mRNA or DNA within a sample. However, if the nucleic acid is present only in a limited amount, then it may be beneficial to amplify the relevant sequence so that it can be detected or obtained more easily.

In the alternative mutations, it can be visualized by a simple filament conformation polymorphism analysis (SSCP).

A variety of methods can be used in order to amplify a selected sequence including, for example, RNA amplification (see Lizardi et al., Bio / Technology 6: 1197-1202 (1988); Kramer et al., Nature 339: 401 -402 (1989), Lomeli et al., Clinical Chem. 35 (9): 1826-1831 (1989), US Pat. 4,786,600) and amplification of the DNA using CSF or a polymerase chain reaction ("PCR") (see U.S. Patent Nos. 4,683,202, 4,683,195 and 4,800,159) (see also U.S. Patent Nos. 4,876,187 and 5,011,769 which describe an amplification detection system comprising the use of sisyl ligatures) or other nucleic acid amplification methods that are well within the level of ordinary skill in the art.

With respect to PCR for example, the method can be modified as is known in the art, eg, PCR Protocols, A Guide for Methods and Applications, edited by Michael et al. , Academic Press, 1990, using the appropriate chromosomal or cDNA library, to obtain the fragment of the present invention. The transcriptional amplification of the PCR can be carried out by incorporating the bacteriophage T7 RNA polymerase promoter sequences into one of the primary oligonucleotides, and the immunoenzymatic detection of the amplification emitter products can be carried out using anti-viral antibodies. RNA: DNA (Blais, Appl. Environ.Microbiol.60: 4348-352) (1994)). PCR can also be used in combination with dot-spot reverse hybridization (Iida et al., FEMS Microbiol., Lett 114: 167-172 (1993)). The PCR products can be analyzed quantitatively by the incorporation of dUTP (Duplaa et al., Anal. Biochem 212: 229-236 (1993)), and the samples can be filtered sampled by detection of PCR gene probe (Bej et al. , Appl. Environ Microbiol. 57: 3529-3534 (1991)).

In a particularly preferred embodiment, the PCR amplification is used to detect the PS1 gene of the DNA. Briefly, as described in more detail below, a DNA sample is denatured at 95 ° C in order to generate a single strand DNA. The specific primaries are then annealed to single strand DNA at 37 ° C to 70 ° C depending on the ratio of AT / GC in the primary ones. The primaries extend to 72 ° C with Taq DNA polymerase in order to generate the opposite filament to the temper. These steps constitute a cycle that can be repeated in order to amplify the selected sequence.

In a preferred alternative embodiment, the LCR amplification is used for amplification. The LCR primers are synthesized so that the 5 'base of the upstream primary is capable of hybridizing to a single base pair in a desired gene to specifically detect a PS1 gene. Whereas in another preferred embodiment, the probes are used in an automated non-isotopic strategy wherein the target nucleic acid sequences are amplified by PCR, and then the desired products are determined by a calorimetric oligonucleotide (OLA) ligation assay (Nickerson et al. al., Proc. Nati, Acad. Sci, USA 81: 8923-8927 (1990)).

The primaries for the amplification of a selected sequence should be selected from sequences that are highly specific and form stable doubles with the target sequence. The primaries must also be non-complementary, especially at the 3 'end, they must not form dimers with themselves or with other primary ones and they should not form secondary or double structures with other DNA regions. In general, primers from about 18 to 20 nucleotides are preferred and can be easily synthesized using techniques well known in the art. PCR products and other nucleic acid amplification products can be quantified using techniques known in the art, e.g., SSCP analysis.

B. Diagnostic kits that include Nucleic Acid Probes for PS1. In another embodiment, the present invention relates to a kit for detecting the presence of PS1 in a sample comprising at least one container means having disposed therein the nucleic acid probe described above. In a preferred embodiment, the kit comprises other containers comprising one or more of the following: washing reagents and reagents capable of detecting the presence of a linked nucleic acid probe. Examples of detection reagents include but are not limited to radiolabelled probes, labeled enzyme probes (horseradish peroxidase, alkaline phosphatase) and affinity labeled probes (biotin, avidin, esteptavidin).

In detail, a case with compartments includes any case in which the reagents are contained in separate containers. Such containers include small glass containers, plastic containers or plastic or paper strips. Such containers allow the efficient transfer of the reagents from one compartment to the other compartment so that the samples and reagents do not cross-contaminate and the agents and solutions of each container can be added in a quantitative form from one compartment to the other. Such containers will include a container that will accept the test sample, a container that contains the probe or primaries used in the assay, containers that contain wash reagents (such as phosphate buffer, Tris buffer solutions and the like), and containers that they contain the reagents used to detect the hybridized probe, bound antibody, amplified product and the like.

The types of detection reagents include labeled secondary probes or in an alternative, if the primary probe is labeled, the enzyme reagents or antibody binding agents that are capable of reacting with the labeled probe. One skilled in the art will readily recognize that the described probes and amplification primaries of the present invention can be easily incorporated into one of the established case formats that are well known in the art.

C. Tests and Diagnostic Cases based on Antibodies The present invention furthermore provides antibodies as discussed above, for the detection of PS1 gene products in diagnostic tests and kits. A variety of assays can be used in order to detect antibodies that specifically bind to the desired protein or peptide. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane, supra. Representative examples of such assays include IEPs, redioimmunoassays, radioimmunoprecipitations, ELISA, spot and spot assays, inhibition and competition assays and interlayer structure assays, immunostatic assays (dipstick), simultaneous immunoassays, immunochromatographic assays, immunofiltration assays, assays of agglutination of latex beads, immunofluorescent assays, biosensing assays and low light detection assays and the like (see, eg, Antibodies: A Laboratory Manual, supra).

A fluorescent antibody test (FA test) uses a fluorescently labeled antibody capable of binding to one of the proteins of inevitability. Visual determinations using fluorescence microscopy produce a qualitative result. In a preferred embodiment, this assay is used for the examination of tissue samples and histological sections.

In latex bead agglutination assays, the antibodies of one or more of the proteins of the present invention are conjugated to latex beads. The antibodies conjugated to the latex beads are then contacted with a sample under conditions that allow the antibodies to bind the desired proteins in the sample if there is one. The visual results produce a qualitative result. This method is preferred in the field for on-site testing.

Enzyme immunoassays (EIA) include a variety of different assays capable of using the antibodies supplied by the present invention. For example, a heterogeneous indirect EIA uses a solid phase coupled with an antibody of the invention and an affinity preparation of purified anti-IgG immunoglobulin. Preferably, the solid phase is a microtitre polystyrene plate. The antibodies and the immunoglobulin preparation are then contacted with a sample under conditions that allow the binding of antibodies, the conditions of which are well known in the art. The results of said assay can be read visually but are preferably read using a spectrophotometer such as an ELISA plate reader, to produce a quantitative result.

An alternative solid phase EIA format includes ferrous metal beads coated with plastic, capable of moving during the assay procedures by means of a magnet. Still another alternative is a low light detection immunoassay format. In this highly sensitive format, the light emission produced by the appropriately labeled bound antibodies is quantified automatically, preferably using microtiter plates.

In an enzyme-binding interlaminar enzyme assay, the desired protein is bound between an antibody placed on the solid phase, preferably a polystyrene microtiter plate and a labeled antibody. Preferably, the results are measured using a spectrophotometer such as an ELISA plate reader. In an alternative embodiment, a radioactive tracer is replaced by the mediated detection of enzymes in an EIA to produce a radioimmunoassay (RIA).

In a sequential development format, reagents are allowed to incubate with the capture antibody in a stepwise fashion. The test sample is first incubated with the capture antibody. Following a washing step, incubation occurs with the labeled antibody. In a simultaneous assay, the two incubation periods described in the sequential assay are combined. This eliminates an incubation period plus a washing step. An immunostatic / submerged stake format is essentially an immunoassay except that the solid phase, instead of being a polystyrene microtiter plate, is a submerged stake or polystyrene paddle. The reagents are the same and the format can be simultaneous or sequential.

In a chromatographic strip test format, a capture antibody and a labeled antibody are dried on a chromatographic strip, which is typically high porosity nitrocellulose or nylon bonded to cellulose acetate. The capture antibody is usually dried by atomization at one end of the strip. At this end there is an absorbent material which is in contact with the strip. At the other end of the strip, the labeled antibody is deposited in a manner that prevents it from being absorbed into the membrane. Usually, the label placed on the antibody is a latex bead or colloidal gold. The assay can be started by applying the sample immediately in front of the labeled antibody.

The immunofiltration / immunoconcentration formats combine a large solid phase surface with the directional sample / reagent flow, which concentrates and accelerates the binding of the antigen to the antibody. In a preferred format, the test sample is pre-incubated with a labeled antibody and then applied to a solid phase such as fiber filters or nitrocellulose membranes or the like. The solid phase can also be pre-coated with latex or glass beads coated with the capture antibody, followed by detection by standard immunoassay techniques. The sample / reagent flow can be modulated either under vacuum or by the wicking action of the support absorbent material.

A threshold biosensor assay is a sensitive instrumented assay responsible for screening a large number of samples at low cost. In one embodiment, said assay comprises the use of steerable potentiometric sensors wherein the reaction involves the detection of a change in pH due to the binding of the desired protein by capture antibodies, bridging antibodies and urease-conjugated antibodies. When linked, a change is made in the pH that is measurable by translation in electric potecnial (μvolts). The test typically occurs in a very small reaction volume and is very sensitive. Moreover, the reported detection limit of the assay is 1,000 urease molecules per minute.

A type of test sample that can be used in the present invention is derived from fluid or amniotic cells. Said test sample is used to identify fetuses carrying a human gene or mutation for FAD.

D. Diagnostic Cases Comprising Antibodies to the PS1. In another embodiment of the present invention, a kit is provided which contains all the reagents necessary to carry out the previously described detection methods. The kit can comprise: i) a first container medium containing an antibody described above, and ii) a second container medium containing a conjugate comprising a binding partner of the antibody and a label. In another preferred embodiment, the kit further comprises one or more other containers comprising one or more of the following: wash reagents and reagents capable of detecting the presence of binding antibodies. Examples of detection reagents include, but are not limited to, labeled secondary antibodies or in the alternative, if the primary antibody is labeled, the chromophoric, enzymatic or antibody binding reagents that are capable of reacting with the labeled antibody. One of skill in the art will readily recognize that the antibodies described in the present invention can be easily incorporated into one of the established case formats that are well known in the art.

E. Anti-Peptide Antibodies In another embodiment, the peptide, in particular the PS1 peptide, is used to generate an antibody that is capable of binding to the peptide (e.g., anti-PS1 peptide antibodies). The anti-peptide antibodies of the present invention can include monoclonal and polyclonal antibodies, as well as fragments of these antibodies and humanized forms. The humanized forms of the antibodies of the present invention can be generated using one of the methods known in the art such as CDR chimerization or grafting.

Moreover, the invention also provides hybridomas that are capable of producing the antibodies described above.

Additionally, one skilled in the art can easily adapt the currently available methods, as well as the techniques, methods and kits described above with respect to antibodies, to generate peptides capable of binding to a specific sequence of peptides, in order to generate peptides. rationally designed antipeptides, for example, see Hurby et al. , "Application of Synthetic Peptides: Antisense Peptides" in Synthetic Peptides, A User's Guide, W.H. Freeman, NY, pp 289-307 (1992) and Kaspczak et al. , Biochemistry 28: 9230-8 (1989).

The antipeptide peptides can be generated in one of two ways. First, anti-peptide peptides can be generated by substituting the basic amino acid residues found in a peptide sequence, eg, the sequence of IT-11 peptides with acid residues, while keeping the polar groups discharged and hydrophobic. For example, lysine, arginine and / or histidine residues are substituted with aspartic acid or glutamic acid and the glutamic acid residues are replaced with lysine, arginine or histidine.

Alternatively, the anti-peptide peptides of the present invention can be generated by synthesizing and expressing a peptide encoded by the antisense strand of the DNA encoding the peptides, preferably peptide IT-11.

The peptides produced in this manner are generally similar to those described above since the codons complementary to those coding for the basic residues generally code for acidic residues.

One skilled in the art will readily recognize that the antibodies described in the present invention can be easily incorporated into one of the established case formats that are well known in the art.

F. Other assays Transmembrane receptors are involved in various cell communication processes, and have been the target of various pharmacological examination trials for the identification and development of new therapeutic agents. Many of these screening assays look for changes induced by a ligand in cell lines that express a recombinant receptor. In some cases, the second messengers are tested directly with others, the receptor is transfected into a cell line carrying a reporter gene construct whose level of expression can be influenced (positively or negatively) by functional activation of the receptor. A common result of the stimulation of different secondary messenger systems are the transient changes in intracellular calcium homeostasis. This may be the result of the release of Ca + 2 from various intracellular compartments or the influx of extracellular calcium.

Calcium transients offer a highly sensitive and selective method for the characterization of the PS1 gene function. Expression of recombinant PS1 in cell lines previously transfected with an aequorin reporter construct can be used to examine and identify a PS1 ligand. Aequorin is a 21 kDa photoprotein that, with the Ca + 2 bond, undergoes an irreversible reaction with the production of light in a visible range. Because the fractional rate of consumption of aequorin is proportional to the physiological [Ca + 2], it has been used for many years as a sensitive indicator of intracellular calcium. More recently, different aequorin cDNAs have been engineered which allows a selective attack of aequorin expression to different intracellular compartments, including the cytoplasm, the nucleus and the endoplasmic reticulum. This allows a variety of second messengers coupled in trajectories / compartments to be examined. The identification of the ligand and determination of its signaling path will be a first step in the functional characterization of the PS1 gene. A cell line expressing a PS1 mutant can be established and examined in parallel in order to identify compounds which modify the function of the mutant protein in a manner that mimics the activity of the wild-type PS1.

SAW. Methods of Treatment and Prevention of Alzheimer's Disease The present invention also provides methods for treatment or prevention of Alzheimer's disease, comprising the step of administering a vector to a patient (eg, an expression vector, viral vector or viral particle containing a vector) as described above, thereby reducing the likelihood or delay in the onset of Alzheimer's disease.

Similarly, therapeutic peptides, peptide mimetics or small molecules can be used to delay the onset of Alzheimer's disease, decrease symptoms or stop or delay the progression of the disease. Such a therapy can be tested in a transgenic animal model that expresses the mutant, mutant or wild-type protein or in an in vitro assay system.

One such test system in vi tro measures the amount of amyloid protein produced. Briefly by way of illustration, a cell expressing the product of the PS1 gene and the amyloid is cultured in the presence of a candidate therapeutic molecule. The PS1 protein expressed by the cell can be a wild-type or mutant protein. In any case, the amount of amyloid protein that is produced is measured from the cells incubated with or without (controlling) the candidate therapeutic. Briefly by way of example, the cells are labeled in a medium containing S-methionine and incubated in the presence (or absence) of a candidate therapeutic. The myloid protein is detected in the culture supernatant by immunoprecipitation and electrophoresis of SDS-PAGE or by ELISA. A statistically significant reduction of the amyloid protein compared to the control means an appropriate therapeutic for its use in the prevention or treatment of Alzheimer's disease.

Alternatively, transgenic animals expressing the Alzheimer's disease protein can be used to test candidate therapeutics. The myloid protein is measured or, if the animals show other symptoms of disease, such as suppressing memory or learning, an increase in memory or learning is measured. Memory and learning are tested in rodents using the Morris water mallet (Stewart and Morris in Behavioral Neuroscience, R. Saghal De. (IRLPress, 1993, p.107) and the Y-deck (Brits et al., Brain Res. , Bull 6:71 (1981)) The therapeutic is administered to the animals before the tests The response time in attempts is measured and an improvement in the memory and learning is demonstrated by a statistically significant decrease in the programmed attempts .

As noted above, the present invention provides methods for the treatment or prevention of Alzheimer's disease through the administration to a patient of a therapeutically effective amount of an antagonist or pharmaceutical composition as described herein. These patients can be identified through clinical diagnoses based on the symptoms of dementia or loss of learning or memory that are not attributable to other causes. In addition, patients are also identified through the diagnosis of brain atrophy as determined by magnetic resonance imaging.

In another embodiment of the present invention, methods for decreasing the expression of PS1 peptide described herein are presented. Specifically, the antisense expression of RNA is used to break the translation of the genetic message. In detail, a cell is modified using the routine procedures so that they express an antisense message, a message that is complementary to the PS1 message. By constitutively or indistinctly expressing the antisense RNA, the translation of PS1 mRNA can be regulated.

Cognitive behavior in AD can be measured by one of several tests (see Gershon et al., Clinical Evaluation of Psychotropic Medications: Principles and Guidelines, Prien and Robinson (eds.), Raven Press, Ltd., New York, 1994). , p.467). One such test, BCRS, is designed to only measure cognitive functions: concentration, recent memory, past memory, orientation, performance and self-care. This test, as well as the Weschler Memory Scale and the Scale Associated with Alzheimer's Disease, can be used to determine the improvements that follow therapeutic treatment. An "Improvement" in Alzheimer's disease is present if there is a statistically significant difference in the direction of normality in the Weschler Memory Scale test. For example, the performance test results of the treated patients are how they compare with the members of the placebo group or between subsequent tests given to the same patient. The improvement within the present invention also encompasses a delay in the age of onset of Alzheimer's disease.

A. Pharmaceutical Compositions The present invention also provides a variety of pharmaceutical compositions comprising one of the pS1 proteins, nucleic acid molecules, vectors, antibodies, host cells, agonists or antagonists or diluents. Generally, such carriers must be non-toxic to the recipients at the doses and concentrations employed. Ordinarily, the preparation of said composition causes the combination of a therapeutic agent with buffering solutions, antioxidants such as ascorbic acid, low molecular weight polypeptides (less than about 10 amino acid residues), proteins, amino acids, carbohydrates which include glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral buffered saline or saline mixed with nonspecific serum albumin are suitable exemplifying diluents.

In addition, the pharamceutical compositions of the present invention can be prepared by administration by a variety of different routes, although intracranial routes are typically preferred. In addition, the pharmaceutical compositions of the present invention can be placed into containers, along with packaging material that supplies the instructions with reference to the use of said pharmaceutical compositions. Generally such instructions will include a tangible expression describing the concentration of the reagent, as well as within certain modalities, the relative amounts of ingredients or diluents of the excipient (eg, water, saline or PBS) that may be necessary to reconstitute the pharmaceutical composition.

As will be apparent to one skilled in the art, the amount and frequency of administration will, of course, depend on such factors as the nature and severity of the indication being treated, the desired response, the condition of the patient, and so forth. Typically the compositions can be administered by a variety of techniques, although intracranial routes are often preferred.

More specifically, the pharmaceutical compositions of the present invention will be formulated and dosed in a manner consistent with good medical practice, taking into account the clinical condition of the individual patient, the delivery site of the polypeptide composition, the method of administration, the administration schedule and other factors known to practitioners. The "effective amount" of the pharmaceutical composition for the purposes herein is then determined by such considerations.

As a general proposition, the pharmaceutically effective amount of the active ingredient administered parenterally per dose will be in the range of about 1 μg / kg / day to 10 mg / kg / day of the patient's body weight, although as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg / kg / day and more preferably for humans, between about 0.01 and 1 mg / kg / day for the hormone. If given continuously, the composition is typically administered at a dose of about 1 μg / kg / hour to about 50 μg / kg / hour, either in 1-4 injections per day or by continuous subcutaneous infusions for example, using a mini pump. An intravenous bag solution may also be employed. The key factor in selecting the appropriate dose is the result obtained. The duration of treatment required to observe changes and the interval that treatment follows for responses seems to vary depending on the desired effect.

The pharmaceutical compositions containing the PS1 proteins, nucleic acid molecules, vectors, antibodies, host cells, agonists or antagonists of the invention, can be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (through powders, ointments, drops or transdermal patches), buccally or as a nasal or oral spray. By "pharmaceutically acceptable carrier" is meant a non-toxic liquid, solid or semi-solid auxiliary filler, diluent, encapsulating material or auxiliary formulation of any type. The term "parenteral" as used herein, refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, and intraarticular injection and infusion.

The pharmaceutical composition is also appropriately administered for prolonged release systems. Suitable examples of sustained release compositions include semi-permeable polymer matrices in the form of formed articles, eg, films or microcapsules. Prolonged-release matrices include polylactides (U.S. Patent No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman U. et al., Biopolymers 22: 547-556 (1983)), poly (2-hydroxyethyl methacrylate) (R. Langer et al., J. Biomed, Mater. Res. 15: 167-277 (1981), and R. Langer, Chem. Tech. 12: 98- 105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.) Or poly-D- (-) -3-hydroxybutyric acid (EP 133,988). Sustained-release compositions also include PS1-entrapped liposomally proteins, nucleic acid molecules, vectors, antibodies, host cells, agonists or antagonists. Said liposomes are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Nati Acad. Sci. (USA) 82: 3688-3692 (1985); Hwang et al., Proc. Nati Acad. Sci. (USA) 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Patent Application 83-118008; U.S. patents Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small unilamellar type (about 200-800 Angstroms) in which the lipid content is greater than about 30 mol percent cholesterol, the selected proportion being adjusted for optimal therapy.

For parenteral administration, in one embodiment, the composition is generally formulated by mixing in the desired degree of purity, in an injectable unit dosage form (solution, suspension or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is not toxic to the containers at the doses and concentrations used and that is compatible with other ingredients of the formulation. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the polypeptides.

Generally the formulations are prepared by contacting the PS1 proteins, nucleic acid molecules, vectors, antibodies, host cells, agonists or antagonists uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is formed within the desired formulation.

Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carriers include water, saline, Ringer's solution and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful here, as well as liposomes.

The carrier suitably contains minor amounts of additives such as substances that amplify isotonicity and chemical stability. Said materials are non-toxic to the containers at the doses and concentrations employed, and include buffer solutions such as phosphate, citrate, succinate, acetic acid and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight polypeptides (less than about ten residues), eg, polyarginine or tripeptides; proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamic acid, aspartic acid or arginine, monosaccharides, disaccharides or other carbohydrates including cellulose or its derivatives, glucose, mannose or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and / or nonionic surfactants such as polysorbates; poloxamers or PEG.

PS1 proteins, nucleic acid molecules, vectors, antibodies, agonist host cells or antagonists are generally formulated in such vehicles at a concentration of about 0.1 mg / ml to 100 mg / ml, preferably 1-10 mg / ml at a pH from about 3 to 8. It will be understood that the use of certain of the above excipients, carriers or stabilizers will result in the formation of polypeptide salts.

The pharmaceutical compositions to be used for therapeutic administration must be sterile. Sterility is easily achieved by filtration through sterile filtration membranes (eg, 0.2 micron membranes). Therapeutic compositions are generally placed in a container having a sterile access port eg, a bag or vial of intravenous solution having a penetrable holder by a hypodermic injection needle.

The pharmaceutical compositions will ordinarily be stored in single or multi-dose containers for example, sealed vials or ampules, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10 ml vials are filled with 5 ml of a sterile-filtered 1% (w / v) aqueous PS1 protein solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized PS1 polypeptide using water for bacteriostatic injection.

The invention also provides a pharmaceutical package or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such containers, there may be a notice in the form prescribed by the governing governmental agency of the manufacture, use or sale of the biological or pharmaceutical products, whose notice reflects the approval of the agency for the manufacture, use and sale for human administration. .

In addition, the polypeptides of the present invention can be used in conjunction with other therapeutic compounds.

Within other embodiments of the invention, vectors containing or expressing nucleic acid molecules and encoding a PS1 protein, or even the nucleic acid molecule per se, can be administered by a variety of alternative techniques, including for example administration of asialoosomucoid (ASOR) conjugated to poly (L-lysine) DNA complexes (Cristano et al., Proc. Nati, Acad. Sci. USA 92122-92126 (1993)), DNA linked to killed adenovirus (Curiel et al., Hum. Gene Ther. 3 (2): 147-154 (1992)), the introduction of mediated cytofectin (DMRIE-DOPE, Vical, Calif.) Direct DNA injection (Acsadi et al., Nature 352: 815-818 ( 1991)); DNA ligands (Wu et al., J. Biol. Chem. 264: 16985-16987, 1989), lipofection (Felgner et al., Proc. Nati, Acad. Sci. USA 84: 7413-7417 (1989)); liposomes (Pickering et al., Circ 89 (1): 13-21 (1994); Wang et al., Proc. Nati Acad. Sci. USA 84: 7851-7855 (1987)); bombardment with microprojectiles (Williams et al., Proc. Nati Acad. Sci. USA 88: 2726-2730 (1991)); and direct delivery of nucleic acids encoding the PS1 protein only (Vile and Hart, Cancer Res. 53: 3860-3864 (1993)), or using PEG nucleic acid complexes.

All the patents and publications mentioned up to here are hereby expressly incorporated in their entirety as references.

In order that those skilled in the art may more fully understand this invention, the following examples are set forth. These examples are given only for the purpose of illustration and should not be construed as expressing limitations unless so stated in the appended claims.

EXAMPLES In the following examples and protocols, restriction enzymes, ligase and all commercially available reagents are used in accordance with the manufacturer's recommendations. The standard methods and techniques for cloning and molecular analysis, as well as the preparation of the normal reagents, were carried out essentially in accordance with Molecular Cloning: A Laboratory Manual, second edition, edited by Sambrook, Fritsch & Maniatis, Cold Spring Harbor Laboratory, 1989).

Example 1. Review of the Gene SI 82 Although early onset AD is less common than late onset AD, the position of PS1 is associated with the most aggressive form of the disease (beginning at 30-60 years), suggesting importance of mutations in the PS1 position with respect to the causative effects of AD. Position PS1 has been isolated to a region between D14S53 and D15S58 of human chromosome 14. Within that region, Sherrington et al., Nature 375: 754-760 (1995) reported the cloning of a novel S182 gene, with five nonsense mutations in seven aces segregating the autosomal dominant of early onset AD.

To confirm differences in the nucleotide sequence and to evaluate segregation in each FAD ancestry and frequency in the general population (age> 65 years), the S182 exon containing the L286V mutation reported by Sherrington et al. , supra, was examined as follows: first the PCR-amplified exon containing the L286V mutation was digested with restriction by Pvu II as described by Sheerington et al. , supra, then the fragments were analyzed by means of a simple filament conformation polymorphism analysis (SSCP). The analysis was carried out on 29 relatives of early-onset FADs (which are also negative for the five mutations in S182 reported by Sherrington et al.) And of 12 late-onset families. Each relationship was represented by two patients in the analysis. We also included samples of equivalent controls from 53 years of relatives of the FAD to ensure the validity of the results.

The genomic DNA from the peripheral blood samples were amplified by PCR to speed up the examination process.

The PCR mixture was prepared for each sample according to the following protocol. Each reaction mixture of 10 μl of PCR contained: 1 μl of Tag ™ buffer; 1.25 mM dNTPs (10 μl d [A, T, G, C] TP each batch, 760 μl of HPLC water); 1 μl of diluted primary mixture (primary of 8ml 7672 * and 7673 * in 200 μ of HPLC water); 0.1 μl of Taq ™ DNA polymerase; 0.1 μl of a 32P-dATP; 1 μl 1:50 Genomic DNA (approximately 40 ng, diluted with HPLC water); 5.2 μl HPLC water. The reaction conditions for each reaction volume of 10 μl were: 94 ° C for 4 min; followed by 30 cycles of (94 ° C for 1 min; 58 ° C for 1 min; 72 ° C for 1 min); then 72 ° C for 10 min; followed by rinsing at 4 ° C until it was separated and stored at -20 ° C.

Primary KM 7672 Sequence: CACCCATTTACAAGTTTAGC (SEQ ID NO: 5) Primary KM 7673 Sequence: GATGAGACAAGTGCCGTGAA (SEQ ID NO: 6).

After amplification, 3 μl of each PCR reaction mixture were separated from under the oil and transferred to a new plate containing 30 μl of SSCP dilution mixture in each corresponding well. (The SSCP dilution mixture: 250 μl 20% SDS, 1 mL 0.5 M EDTA, Millipore ™ water at 50 mL). 30 μl of a 95% mixture of dye and formamide were then added to each sample of 33 μl diluted SSCP. (Formamide dye mixture: 0.25% bromophenol blue, 0.25% FF cyanol xylene, 95% formamide).

After 30 μl of the diluted and stained sample were separated and placed on ice for later use as a non-denaturing control, the samples were denatured at 90 ° C for 10 min and then placed on ice. The denatured samples were loaded onto a Mutation Detection Amplification (MDE ™) gel (FMC Bioproducts, Rockland ME) in a 0.6X TBE buffer and running at 15 watts for 20 hours, (MDE ™ gel) : 25% 2X gel concentrate, 10% glycerol, 0.6X TBE, up to one volume with HPLC water). The positive, negative and non-denatured controls were run with each gel and a water control was run on a gel. The dyes allowed the visualization and rapid comparison of the genetic mutations and polymorphisms in contrast to the normal samples (wild type).

Using the SSCA analysis, the sequence obtained from a patient carrying a mutation within the exon S182 can be potentially distinguished from that of an individual normal control. One or more mutations in exon S182 that make a conformational change in the secondary / tertiary structure can be quickly visualized in the simple filamentous molecule. The MDE ™ gel is designed to allow more compact molecules to run more rapidly through the pores of the size differentiating gel, so that a mutant species is revealed as a band in the gel at a different point to that observed consistently in normal (control) samples coded by the same region of exon S182.

The SSCP analysis did not identify the L286V mutation reported by Sherrington et al. , supra; however, it revealed three substitutions of heterozygous nucleotides in PS1 in specific probands (see Example 2), which are not found in other ancestries. Moreover, none of the three mutations were observed in the 106 chromosomes from age-matched controls used to verify FAD ancestry tests.

Example 2. Detection of Mutations. Three previously unidentified but apparently pathogenic mutations in the S182 gene on chromosome 14 have been found to appear to cause early onset forms of hereditary Alzheimer's disease (ADF). Specifically, the pathogenic mutations found in exon S182 were: (1) T-C at nucleotide position 1035; (2) C-T at the position of nucleotide 1039; and (3) G-A at nucleotide position 1054. Each of the exonic mutations are nonsense substitutions that occur immediately on the C-terminal side of the predicted sixth transmembrane domain (TMD6) of the PS1 protein.

The first mutation results in an amino acid substitution at residue 263 of an arginine for a cysteine (C263R). The second mutation results in a substitution of amino acid at residue 264 of a leucine for a proline (P264L). The third mutation results in an amino acid substitution at residue 269 of a histidine for an arginine (R269H).

In addition, two polymorphisms in the intronic sequence flanking the S182 exon were found: (1) A - > C, at the position of nucleotide -16 of the intron located 3 'of the exon; and (2) A- > G at the position of nucleotide -20 of the intron located 5 'of the same exon.

The C263R occurs in the proband of MGH12 ancestry. At the beginning the proband was 47 years old. The results of the autopsy confirmed that the proband was affected with Alzheimer's disease. The C263R mutation was also found in all four affected individuals of the same ancestry, MGH12 (average age at the beginning of 50 years).

P264L was observed in the proband of MGH6 ancestry. At the beginning the proband was 45 years old, with a history of thyroid problems. The proband's brother developed AD at the age of 50 and was confirmed by autopsy that he had AD.

R269H was observed in a sporadic case of early onset Alzheimer's disease. Damage to the patient's memory began at the age of 47 and died at the age of 56. Neuropathology discovered during autopsy confirmed the early clinical diagnosis of AD, and the patient was found to have congophilic angiopathy. The patient's father died in his first 60 years of heart attack, but he had presented a clinical picture of memory decline and progressive cognitive degeneration beginning in the mid-50's. The patient's grandfather (of the paternal side) he died in his first 70, but his previous history presented a gradual cognitive damage that could have followed from half of his 60.

No formal clinical or neuropathological diagnosis was established for any member of this family who showed an R269H mutation. At the time of the study, the patient's mother remained alive and healthy, without cognitive damage; while her sister died of cancer at the end of her 50 's at the beginning of her 60' s; the sister's son, however, remained healthy.

The fact that newly identified mutations are presumably pathogenic is strongly supported by the profound effect that substitutions impart on the resulting protein. The mutations C263R, P264L and R269H reside in the predicted domain of the hydrophilic loop, and immediately follow the C terms of the TMD6. Consequently, mutations can extend the length of the transmembrane domain, thus aberrantly affecting the anchoring of the protein in the membrane. Alternatively, the mutations may adversely affect the secondary / tertiary structure of the hydrophilic loop and / or the entire protein.

It is interesting to note that each of the newly identified mutations falls in the region in and around TMD6, which also contains the A246E mutation reported by Sherrington et al. , Nature (1995), supra. Moreover, the average age at the beginning of AD in the three individuals or families characterized by the newly identified mutations is very similar (approximately at the age of 50) to those who have the A246E mutation. This indicates that breaks in the PS1 protein, particularly in and around TMD6, can result in similar pathogenic consequences.

In this way, the newly identified mutations represent the most significant amino acid changes reported in S182 to date, affecting the early onset AD.

SEQUENCE LISTING (1) GENERAL INFORMATION (i) APPLICANT: (A) NAME: The General Hospital Corporation (B) ADDRESS: Thirteenth Street, Bldg. 149, Suite # 1101 (C) CITY: Charlestown (D) STATE: Massachusetts ( E) COUNTRY: USA (F) ZIP CODE: 02129 (ii) TITLE OF THE INVENTION: Genetic Alterations related to Hereditary Alzheimer's Disease (iii) SEQUENCE NUMBER: 6 (iv) ADDRESS FOR CORRESPONDENCE (A) RECIPIENT: STERNE, KESSLER, GOLDSTEIN & FOX, P.L.L.C. (B) ADDRESS: 1100 NEW YORK AVENUE, SUITE 600 (C) CITY: WASHINGTON (D) STATE: DC (E) COUNTRY: UNITED STATES (F) ZIP: 20005-3934 (v) COMPUTER READING FORM (A) TYPE OF MEDIUM: Flexible disk (B) COMPUTER: IBM compatible PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) PACKAGE: Patentln Relay # 1.0, Version30 (EPO) (vi) CURRENT DATA OF THE APPLICATION (A) NUMBER OF THE APPLICATION: To be assigned (B) DATE OF SUBMISSION: 03 -SEP- 96 (c) CLASSIFICATION: (viii) INFORMATION FROM THE AGENT / ATTORNEY (A) NAME: Goldstein, Jorge A. (B) REGISTRATION NUMBER: 29,021 (c) REFERENCE NUMBER / ARCHIVE: 0609.418PCOl (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 202-371-2600 (B) TELEFAX: 202-371-2540 (2) INFORMATION FOR SEC. ID NO. 1: (i) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 2765 base pairs (B) TYPE: nucleic acid (C) FILAMENTOSITY: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 249..1649 (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l: TGGGACAGGC AGCTCCGGGG TCCGCGGTTT CACATCGGAA ACAAAACAGC GGCTGCTCTG 60 GAAOGAACCT GAGCTAD3AG CCGCGGCGGC AGCGGGGCGG CsGGOAAGCG TATACCTAAT 120 CTGGGAGCCT GCAAGTGACA ACAGCCTTTG CGSTCCTTAs ACAGCTTGGC CTGGAGGAGA 180 ACACATGAAA GAAAGAACCT CAAGAGGCTT TGTrTTCTGT GAAACA5TAT TTCTATACAG 240 TTGCTCCA ATG ACA GAG TTA CCT GCA CCG TTG TCC TAC TTC CAG AAT GCA 290 Met Thr Glu Leu Pro Wing Pro Leu Ser Tyr Ph * Gln Asn Wing 1 5? O CAG ATG TCT GAG GAC AAC CAC CTG AGC AAT ACT GTA CGT AGC CAG AAT 338 Gln Met Ser Glu Asp Asn Hiß Leu Ser Asa Thr Val Arg Ser Gln Asn 15 20 2S 30 GAC AAT AGA GAA CGG CAG GAG CAC AAC GAC AGA CGG AGC CTT GGC CAC 386 Asp Asn Arg Glu Arg Gln Glu Bis Asn? Sp Arg Arg Ser Leu Gly His 35 40 45 CCT GAG CCA TTA TCT AAT GGA CGA CCC CAG GGT AAC TCC CGG CAG GTG 434 Pro Glu Pro Leu Ser Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val 50 55 SO GTG GAG CAÁ GAT GAG GAA GAT GAG GAG GG CTG ACA TTG AAA TAT GGC 482 to Glu Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly SS 70 75 GCC AAG CAT GTG ATC ATG CTC TTT GTC CCT GTG ACT CTC TGC ATG GTS 530 Ala Lys His Val He Met Leu Phe Val Pro Val Thr Leu Cys Met Val 80 85 90 GTG GTC GTG GCT ACC ATT AAG TCA GTC AGC TTT TAT ACC CGG AAG GAT S78 Val Val Val Wing Thr He Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp 9S 100 105 110 GGG CAG CTA ATC TAT ACC CCA TTC ACA GAA GAT ACC GAG ACT GTG GGC 62S Gly Gl.-. Leu He Tyr Thr Pro Phe Thr Glu Asp thr Glu Thr Val Gly US 120 125 CAG AGA GCC CTG CAC TCA ATT CTG A? T GCT GCC ATC ATG ATC AGT GTC 674 Gln Arg Ala Leu His Ser He Leu Asn Ala Ala He Mee He be Val 130 135 140 ATT GTT GTC ATG ACT ATC CTC CTG GTG GTT CTG TAT AAA TAC AGG TGC 722 He at Val Met Thr He Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys 145 150 155 TAT AAG GTC ATC CAT GCC TGG CTT ATT ATA TCA TCT CTA TTG TTG CTG 770 Tyr Lys Val He His Wing Trp Leu He He Ser Ser Leu Leu Leu Leu 160 155 170 TTC TTT TTT TCA TTC ATT TAC TTG GGG GAA GTG TTT AAA ACC TAT AAC 818 Phe Phe Phe Ser Phe He Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn 175 180 185 190 GTT GCT GTG GAC TAC ATT ACT GTT GCA CTC CTG ATC TGG AAT TTT GG 866 Val Wing Val Asp Tyr He Thr Val Wing Leu Leu Ilß Trp Asn Phe Gly 195 200 20S GTG GTG GGA ATG ATT TCC ATT CAC TGG AAA GGT CCA CTT CGA CTC CAO 914 Val Val Gly Met He Ser He His Trp Lys Gly Pro Leu Arg Leu Gla 210 215 220 CAG GCA TAT CTC ATT ATG ATT AGT GCC CTC ATG GCC CTG GTG TTT ATC 962 Gln Wing Tyr Leu He Met He Ser Wing Leu Met Ala Leu Val Phe He 225 230 235 AAG TAC CTC CCT GAA TGG ACT GCG TGG CT ATC TTG GCT GTG ATT TCA 1010 Lys Tyr Leu Pro Glu Trp Thr Wing Trp Leu He Leu Wing Val He Ser 240 245 250 GTA TAT GAT TTA GT GCT GTT TTG TGT CCG AAA GGT CCA CTT CGT ATG 1058 Val Tyr Asp Leu Val Wing Val Leu Cys Pro Lys Gly Pro Leu Arg Mßt 255 260 265 270 CTG GTT GAA ACA GCT CAG GAG AGA AAT GAA ACG CTT TTT CCA GCT CTC 1106 Leu Val Glu Thr Ala Gln G u Arg Asn Glu Thr Leu Phß Pro Ala Leu 275 280 285 ATT TAC TCC TCA ACA ATG GTG TGG TTG GTG AAT ATG GCA GAA GGA GAC 1154 He Tyr Ser Ser Thr Met Val Trp Leu Val Asn Met Ala Glu Gly Asp 290 295 300 CCG GAA GCT CA AGG AGA GTA TCC AAA AAT TCC AAG CAT AAT GCA GAA 1202 Pro Glu Wing Gln Arg Arg Val Ser Lys Asn Ser Lys His Asn Wing Glu 305 310 31S AGC ACA GAA AGG GAS TCA CAAC GAC ACT GTT GCA GAS AAT GAT GAT GGC 12S0 Ser Thr Glu Arg Glu Ser Gln Asp Thr Val Wing Glu Asn Asp Asp Gly 320 325 330 GGG TTC AGT GAG GAA TGG GAA GCC CAG AGG GAC AGT CAT CTA GGG CCT 1298 Gly Phe Ser Glu Glu Trp Glu Ala Gln Arg Asp Ser His Leu Gly Pro 335 340 345 3S0 CAT CGC TCT ACA CCT GAG TCA CGA GCT GCT GTC CAG GAA CTT TCC AGC 1346 His Arg Ser Thr Pro Glu S <; go Arg Ala Ala Gl Gln Glu Leu Ser Ser 355 360 365 AGT ATC CTC GCT GGT GAA GAC CCA GAG GAA AGG GGA GTA AAA CTT GGA 1394 Ser He Leu Wing Gly Glu Asp Pro Glu Glu Axg Gly Val Lys Leu Gly 370 37S 380 a 385 390 395 ACA GCC AGT GGA GAC TGG AAC ACA ACC ATA GCC TGT TTC GTA GCC ATA 1490 Thr Wing Ser Gly Asp Trp Asn Thr Thr He Wing Cys Phe Val Wing He 400 40S 410 TTA ATT GGT TTG TGC CTT ACA TTA TTA CTC CTT GCC ATT TTC AAG AAA 1538 Leu He Gly Leu Cys Leu Thr Leu Leu Leu Leu Leu Lhe Phe Lys Lys 415 420 425 30 GCA TTG CCA GCT CTT CCA ATC TCC ATC ACC TTT GGG CTT GTT TTC TAC 1586 Ala Leu Pro Ala Leu Pro He Be He Thr Phe Gly Leu Val Phe Tyr 435 440 445 TTT GCC ACA GAT TAT CTT GTA CAG CCT TTT ATG GAC CAA TTA GCA TTC 1634 Phe Wing Thr Asp Tyr Leu Val Gla Pro Phe Met Asp Gln Leu Wing Phe 450 4S5 460 CAT CAA TTT TAT ATC TAGCATATTT GCGGTTAGAA TCCCATGGAT GT p'CTTCTT 1689 His Gln Phe Tyr He 465 TGACTATAAC CAAATCTGGG GAGGACAAAG GTGATTTTCC TGTGTCCACA TCTAACAAAG 1749 TCAAGATTCC CGGCTGGACT TTTGCAGCTT CCTTCCAAGT CTTCCTGACC ACCTTGCACT 1809 ATTGGACTTT GGAAGGAGGT GCCTATAGAA AACGATTTTG AACATACTTC ATCGCAGTGG 1869 ACTGTGTCCC tCGGTOCAGA AACTACCAGA TTTGAGGGAC GAGGTCAAGG AGATATGATA 1929 GGCCCGGAAG TTGCTGTGCC CCATCAGCAG CTTGACGCGt GGTCACAGGA CGATTTCACT 1989 GACACTGCGA ACTCTCAGGA CTACCGGTTA CCAAGAGGTT AGGTGAAGTG GTTTAAACCA 2049 AACGGAACTC TTCATCTTAA ACTACACGTT GAAAATCAAC CCAATAATTC TGTATTAACT 2109 GAATTCTGAA CTTTTCAGGA GGTACTGTGA GGAAGAGCAG GCACCAGCAG CAGAATGGGG 2169 AATGGAGAGG TGGGCAGGGG TTCCAGCTTC CCTTTGATTT TTTGCTGCAG ACTCATCCTT 2229 TTTAAATGAG ACTTGTTTTC CCCTCTCTTT GAGTCAAGTC AAATATGTAG ATTGCCTTTG 2289 QCAATTCT C TTCTCAAGCA CTGACACTCA TTACCsTCTG TsATTGCCAT TTCTTCCCAA 2349 GGCCAGTCTG AACCTGAGGT TGCTTTATCC TAAAAGTTTT AACCTCAGGT TCCAAATTCA 2409 GTAAATTTTG GAAACAGTAC AGCTATTTCT CATCAATTCT CTATCATGTT GAAGTCAAAT 2469 GTGGATTTTC CACCAAATTC TGAATTTGTA GACATACTTG TACGCTCACT TGCCCCCAGA 2529 TGCCTCCTCT GTCCTCATTC TTCTCTCCCA CACAAGCAGT CTTTTTCTAC AGCCAGTAAG 2589 GCAGCTCTGT CRTGGTAGCA GATGGTCCCA TTATTCTAGG GTCTTACTCT TTGTATGATG S 9 TGAAGC 2765 (2) INFORMATION FOR SEQ IN NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 467 amino acid (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Met Thr Glu Leu Pro Pro Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met 1 5 10 1S Ser Glu Asp Asn His Leu Ser Asn Thr Val Arg Ser Gin Asn Asp Asn 20 25 30 Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu 35 40 45 Pro Leu Ser Asn Gly Arg Pro ßln Gly Asn Ser Arg Gln val Val Glu 50 55 60 Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Wing Lys 65 70 75 80 His Val He Met Leu Phe Val Pro Val Thr Leu Cys Met Val Val Val 85 90 Val Val Wing Thr He Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly ßln 100 105 110 Leu He Tyr Thr Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg 115 120 12S Ala Leu His Ser He Leu Asn Ala Ala He Met He Ser Val He Val 130 135 140 Val Met Thr He Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys 145 150 155 160 Val "le His Wing Trp Leu He He Ser Ser Leu Leu Leu Leu Phe Phe 165 170 175 Phe Ser Phe He Tyr Leu Gly Glu Val Phe Lys Thr Tyr Asn Val Ala 130 185 190 Val Asp Tyr Xlß Thr Val Wing Leu Leu He Trp Asa Phe Gly Val Val 195 200 205 Gly Met lie Ser He His Trp Lys Gly Pro Leu Arg Leu Gin Gln Wing 210 21S 220 Tyr Leu He Met He Ser Wing Leu Met Wing Leu Val Phe He Lys Tyr 225 230 235 240 Leu Pro Glu Trp Thr Wing Trp Leu He Leu Wing Val He Ser Val Tyr 245 250 2SS Asp Leu Val Wing Val Leu Cys Pro Lys Gly Pro Leu Arg Met Leu Val 260 265 270 Glu Thr Wing Gln Glu Arg Asn Glu Thr Leu Phe Pro Wing Leu? Le Tyr 275 280 285 Being Ser Thr Met Val Trp Leu Val Asn Met Wing Glu Gly Asp Pro Glu 290 295 300 Wing Gln Arg Arg Val Ser Lys Asn Ser Lys His Asn Wing Glu Ser Thr 305 310 315 320 Glu Arg Glu Ser Gln Asp Thr Val Wing Glu Asn Asp Asp Gly Gly Phß 325 330 335 Ser Glu Glu Glu Trlu Glu Wing Gln Arg Asp Ser His Leu Gly Pro His Arg 340 345 350 Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Be 355 360 365 Leu Ala Gly Glu Asp Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly 370 375 380 Asp Phe He Phe Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr Ala 385 390 395 400 Ser Gly Asp Trp Asn Thr Thr He Wing Cys Phe Val Wing He Leu He 405 410 415 Gly Leu Cys Leu Thr Leu Leu Leu Leu Wing He Phe Lys Lys Wing Leu 420 425 430 Pro Wing Le Pro Pro He Ser He Thr Phe Gly Leu Val Phe Tyr Phe Wing 435 440 445 Thr Asp Tyr Leu Val Gla Pro Phe Met Asp Gln Leu Ala Phe His G n 450 455 460 Phe Tyr lie 46S (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2765 base pairs (B) TYPE: nucleic acid (ii) TYPE OF MOLECULE: DNA (gßnópuco) (xx) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 249..1649 (xx) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: TGGGACAGGC AGCTCCGGGG TCCGCGGTTT CACATCGGAA ACAAAACAGC GGCTGGTCTß 60 ÜAAGGAACCT GAGCTACGAG CCGCGGCGGC AGCGGGGCGG CGGGGAAGCG TATACCTAAT 120. CTGGGAGCCT GCAAGTGACA ACAGCCTTTG CGGTCCTTAG ACAGCTTGGC CTGGAGGAGA 180 ACACATSAAA GAAAGAACCT CAAGAGGCTT TGTTTTCTGT GAAACAGTAT TTCTATACAG 240 TTGCTCCA ATß ACA GAG TTA CCT GCA CCG TTG TCC TAC TTC CAG AAT-GCA Met Thr Glu Leu Pro Wing Pro Leu Ser Tyr Phe Gla Asn Wing 290 470 * 4"7" 5r 480 CAG ATG TCT GAG GAC AAC CAC CTß AGC AAT ACT GTA CGT AGC CAG AAT Gln Mee Ser Glu Asp Asn His Leu Ser Asn Thr Val Arg Ser Gln Aßn 338 485 - 490 495 GAC AAT AGA GAA CGG CAG GAG CAC AAC GAC AGA CGG AGC CTT GGC CAC Asp Asn Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly Hia 386 500 505 510 CCT GAG CCA TTA TCT AAT GGA CGA CCC CAG GGT AAC TCC CGG CAG GTG Pro Glu Pro Leu Ser Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val 434 515 520 525 GTG GAG CAA GAT GAA GAA GAT GAG GAG GG CTG ACA TTG AAA TAT GGC Val C-lu Gln Asp Glu Glu Glu Aslu Glu Glu Leu Thr Leu Lys Tyr Gly 482 530 535 540 S45 3CC AAG CAT GTG ATC ATG CTC TTT GTC CCT GT ACT CTC TGC ATG GTG Wing Lvs His Val He Met Leu Phe Val Pro Val Thr Leu Cys Met Val 530 550 555 560 GTG GTC GTG GCT ACC ATT AAG TCA GTC AGC TTT TAT ACC CGG AAG GAT at /-.l val Wing Thr He Ly3 Ser Val Ser Phe Tyr Thr A rg Lys Asp S78 565 5 e7n0 57S ATC T? T ACC CCA TTC ACA GAA GAT ACC GAG ACT GTG GGC, Le X Hlee TTyyrr TThhrr PPr: o Phe Th, Glu Asp Thr Glu T? i and 625 585 590 A GCC CTG CAC TCA ATT CTG AAT GCT GCC ATC ATG ATC AGT GTC n? rg Ala Leu His Ser He Leu Asn Ala Ala He Met He Ser Val 674 ATT GTT GTC ATG ACT ATC CTC CTG GTG GTT CTβ TAT AAA TAC AGG TGC 722 He Val Val Met He Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys 610 615 620 625 TAT AAG GTC ATC CAT GCC TGG CTT ATT ATA TCA TCT CTA TTG TTG CTG 770 Tyr Lys at He His Wing Trp Leu He I Ser Ser Leu Leu Leu Leu 630 635 640 TTC TTT TTT TCA TTC ATT TAC TTG GGG GAA GTG TTT- AAA ACC TAT AAC 818 Phe Phe Phe Ser Phe He Tyr Leu Gly Glu Val Phe Lys Thr Tyr Handle 645 650 655 GTT GTG GTG GAC TAC ATT ACT GTT GCA CTC CTG ATC TGG AAT TTT GGT 866 Val Wing Val Asp Tyr He Thr Val Wing Leu Leu He Trp Asn Phe Gly 660 665 670 GTG GTG GGA ATG ATT TCC ATT CAC TGG AAA GGT CCA CTT CGA CTC CAG 914 Val Val Gly Met Be Ser He His Trp Lys Gly Pro Leu Arg Leu Gln 675 680 685 CAG GCA TAT CTC ATT ATG ATT AGT GCC CTC ATG GCC CTG GTG TTT ATC 962 Gln Ala Tyr Leu He Met He Ser Ala Leu Met Ala Leu Val Phe He 690 695 700 705 AAG TAC CTC CCT GAA TGG ACT GCG TGG CTC ATC TTG GCT GTG ATT TCA 1010 Lys Tyr Leu Pro Glu Trp T r Wing Trp Leu He Leu Wing Val He Ser 710 715 720 GTA TAT GAT TTA GTG GCT GTT TTG CGT CTG AAA GGT CCA CTT CAT ATG 1058 Val Tyr Asp Leu Val Wing Val Leu Arg Leu Lys Gly Pro Leu His Met 725 730 735 CTG GTT GAA ACA GCT CAG GAG AGA AAT GAA ACG CTT TTT CCA GCT CTC 1106 Leu al Glu Thr Ala Gln Glu Arg Asn Glu Thr Leu Phe Pro Wing Leu 740 745 750 ATT TAC TCC TCA ACA ATG GTG TGG TTG GTG AAT ATG GCA GAA GGA GAC 1154 lie Tyr Ser Ser Thr Met Val Trp Leu Val Asn Met Wing Glu Gly Asp 755 760 765 CCG GAA GCT CAA AGG AGA GTA TCC AAA AAT TCC AAG CAT AAT GCA GAA 1202 Pro Glu Gla Glare Arg Arg Val Ser Lys Asn Ser Lys His Asn Wing Glu 770 775 780 78S AGC GAA AGG GAG TCA CA CA GAC ACT GTT GCA GAG AAT GAT GAT GAT 1250 Ser Thr Glu Arg Glu Ser Gln Asp Thr Val Wing Glu Asn Asp Asp Gly 790 795 800 GGG TTC AGT GAG GAA TGG GAA GCC CAG AGG GAC AGT CAT CTA GGG CCT 1298 Gly Phe Ser Glu Glu Trp Glu Wing Gln A rg Asp Ser His Leu Gly Pro 805 810 315 CAT CGC TCT ACA CCT GAG TCA CGA GCT GCT GTC CAG GAA CTT TCC AGC 1346 His Arg Ser Thr Pro Glu be Arg Ala Ala Val Gln Glu Leu ser Ser 820 825 830 AGT ATC CTC GCT GGT GAA GAC CGA GAG GAA AGG GGA AAA CTT GGA 1394 Ser He Leu Ala Gly Glu Asp Pro Glu Glu Arg Gly Val Lys Leu Gly 835 840 845 TTG GGA GAT TTC ATT TTC TAC AGT GTT CTG GTT GGT AAA GCC TCA GCA 1442 Leu Gly Asp Phe He Phe Tyr Ser Val Leu Val Gly Lys Wing Wing 850 855 860 865 ACA GCC AGT GGA GAC TGa AAC ACA ACC ATA GCC TGT TTC GTA GCC ATA 1490 Thr Wing Ser Gly Asp Trp Asn Thr Thr He Wing Cys Phe Val Wing He 870 875 880 TTA ATT GGT TTG TGC CTT ACA TTA TTA CTC CTT GCC ATT TTC AAG AAA 1538 Leu He Gly Leu Cys Leu Thr Leu Leu Leu Leu Wing He Phe Lys Lys 885 890 895 GCA TTG CCA GCT CTT CCA ATC TCC ATC ACC TTT GGG CTT GTT TTC TAC 1586 Wing Leu Pro Wing Leu Pro He Be He Thr Phe Gly Leu Val Phe Tyr 900 905 910 TTT GCC ACA GAT TAT CTT GTA CAG CCT TTT ATG GAC CA TTA GCA TTC 1634 Phe Ala Thr Asp Tyr Leu Val Gln Pro Phe Mee Asp Gln Leu Wing Phe 915 920 925 CAT CAA TTT TAT ATC TAGCATATTT GCGGTTAGAA TCCCATGGAT GTTTCTTCTT 1689 His Gln Phe Tyr He 930 TGACTATAAC CAAATCTGGG GAGGACAAAG GTGATTTTCC TGTGTCCACA TCTAACAAAG 1749 TCAAGATTCC CGGCTGGACT TTTGCAGCTT CCTTCCAAGT CTTCCTGACC ACCTTGCACT 1809 ATTGGACTTT GGAAGGAGGT GCCTATAGAA AACGATTTTG AACATACTTC ATCGCAGTGG 1869 ACTGTGTCCC TCGGTGCAGA AACTACCAGA TTTGAGGGAC GAGGTCAAGG AGATATGATA 1929 GGCCCGGAAG ttGCTGTGCC CCATCAGCAG CTTGACGCGT GGTCACAGGA CGATTTCACT 1989 GACACTGCGA ACTCTCAGGA CTACCGGTTA CCAAGAGGTT AGGTGAAGTG GTTTAAACCA 2049 AACGGAACTC TTCATCTTAA ACTACACGTT GAAAATCAAC CCAATAATTC TGTATTAACT 2109 GAATTCTGAA CT? TCAGGA GGTACTGTGA GGAAGAGCAG GCACCAGCAG CAGAATGGGG 2169 AATGGAGAGG TGGGCAGGGG TTCCAGCTTC CCTTTGATTT TTTGCTGCAG ACTCATCCTT 2229 TTTAAATGAG ATTGTTTTC CCCTCTCTTT GAGTCAAGTC AAATATGTAG ATTGCCTTTG 2289 GCAATTCTTC TTCTCAAGCA CTGACACTCA TTACCGTCTG TGATTGCCAT TTCTTCCCAA 2349 GGCCAGTCTG AACCTGAGGT TGCTTTATCC TAAAAGTTTT AACCTCAGGT TCCAAATTCA 2409 TTGGATTTTC CACCAAATTC TGAATTTGTA GACATACTTG TACGCTCACT TGCCCCCAGA 252 TGCCTCCTCT GTCCTCATTC TTCTCTCCCA CACAAGCAGT CTTTTTCTAC AGCCAGTAAG 2589 GCAGCTCTGT CRTGGTAGCA GATGGTCCCA TTATTCTAGG GTCTTACTCT TTGTATGATG 2649 AAAAGAATGT GTTATGAATC GGTGCTGTCA GCCCTGCTGT CAGACCTTCT TCCACAGCAA 2709 ATGAGATGTA TGCCCAAAGC GGTAGAATTA AAGAAGAsTA AAATGGCTGT TGAAGC 2765 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 467 amino acid (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protinin (xi) ) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Met Thr Glu Leu Pro Pro Leu Ser Tyr Phe Gln Asn Ala Gln Met 1 5 10 15 Ser Glu Asp Aßn His Leu Ser Asn Thr Val Arg Ser Gln Asn Asp Asn 20 25 30 Arg Glu Arg Gln Glu His Asn Asp Arg Arg Ser Leu Gly His Pro Glu 3S 40 45 Pro Leu Ser Asn Gly Arg Pro Gln Gly Asn Ser Arg Gln Val Val Glu 50 55 60 Gln Asp Glu Glu Glu Asp Glu Glu Leu Thr Leu Lys Tyr Gly Ala Lys 65 70 75 80 His Val He Met Leu Phe Val Pro Val Thr Leu Cys Met Val Val Val 85 90 95 Val Wing Thr He Lys Ser Val Ser Phe Tyr Thr Arg Lys Asp Gly Gln 100 IOS 110 Leu He Tyr Thr Pro Phe Thr Glu Asp Thr Glu Thr Val Gly Gln Arg US 120 125 Ala Leu His Ser He Leu Asn Ala Ala He Mee He Ser Val He Val 130 135 1 0 Val Met Thr He Leu Leu Val Val Leu Tyr Lys Tyr Arg Cys Tyr Lys 145 150 155 160 Val He His Wing Trp Leu He He Ser Ser Leu Leu Leu Leu Phe Phe 1S5 170 .75 180 185 190 val Asp Tyr He Thr Val Wing Leu Leu He Trp Asn Phß Gly Val Val 195 200 05 Gly Met He Ser He His Trp Lys Gly Pro Leu Arg Leu Gln Gln Wing 2 0 215 220 Tyr Leu He Met Be Wing Wing Leu Met Wing Leu Val Phß He Lvs Tvr 225 230 235"2 ^ Leu Pro Glu Trp Thr Wing Trp Leu He Leu Wing Val He Ser Val Tyr 245 250 255 Asp Leu Val Wing Val Leu Arg Leu Lys Gly Pro Leu His Met Leu Val 260 265 270 Glu Thr Wing Gln Glu Arg Asn Glu Thr Leu Phe Pro Wing Leu He Tyr 275 280 28S Being Ser Thr Met Val Trp Leu Val Asn Met Wing Glu Gly Asp Pro Glu 290 295 300 Wing Gln Arg Arg Val Ser Lys Asn Ser Lys His Asn Wing Glu be Thr 305 310 315 320 Glu Arg Glu Ser Gln Asp Thr Val Wing Glu Asn Asp Asp Gly Gly phe 325 330 335 Ser Glu Glu Glu Trlu Glu Ala ßln Arg Asp Ser His Leu Gly Pro His Arg 340 345 350 Ser Thr Pro Glu Ser Arg Ala Ala Val Gln Glu Leu Ser Ser Be He 355 360 365 Leu Ala Gly Glu Asp Pro Glu Glu Arg Gly Val Lys Leu Gly Leu Gly 370 375 380 Asp Phe He Phe Tyr Ser Val Leu Val Gly Lys Ala Ser Ala Thr Ala 385 390 395 400 Ser Gly Asp Trp Asn Thr Thr He Wing Cys Phe Val Wing He Leu He '405 410 415 Gly Leu Cys Leu Thr Leu Leu Leu Leu Wing He Phe Lys Lys Wing Leu 420 42S 430 Pro Wing Leu Pro He Be He Thr Phe Gly Leu Val phe Tyr Phß Wing 43S 440 445 Thr Asp Tyr Leu Val Gln Pro Phe Met Asp Gln Leu Ala Phe His Gln • 550 455 4S0 Phß Tyr He 465 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) FILAMENTOSITY: simple (D) TOPOLOGY: linear (ii) TYPE OE MOLECULE DNA (gnomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: CACCCATTTA CAAGTTTAGC 20? (2) INFORMATION FOR SEQ ID NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) ONGITUDE: 20 base pairs (B) TYPE: nucleic acid (C) FILAMENTOSITY: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULES DNA (gnomic) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6: GATGAGACAA GTGCCGTGAA 20 It is noted that in relation to this date, the best method known by the Applicant to carry out the present invention is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following

Claims (16)

nco CLAIMS

1. An isolated nucleic acid molecule characterized in that it comprises a nucleotide sequence selected from the group consisting of: (a) a sequence of a nucleotide eing a mutant of the PS1 polypeptide, having the amino acid sequence in Figure 1 (SEQ. ID No. 2); (b) a nucleotide sequence eing a mutant of the mature PS1 polypeptide having an amino acid sequence at positions 83-549 in Figure 1 (SEQ ID NO: 2); and (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b).

2. The nucleic acid molecule according to claim 1, characterized in that the polynucleotide has the complete nucleotide sequence in Figure 2 (SEQ ID NO: 3).

3. The nucleic acid molecule according to claim 1, characterized in that the polynucleotide has the complete nucleotide sequence in Figure 2 (SEQ ID NO: 3) eing the mutant PS1 polypeptide having a complete amino acid sequence in Figure 2 (SEQ ID NO: 4).

4. The nucleic acid molecule according to claim 1, characterized in that the polynucleotide has the complete nucleotide sequence in Figure 2 (SEQ ID NO: 3) eing the mature PS1 polypeptide mutant having the amino acid sequence in the positions 83-549 in Figure 2 (SEQ ID NO: 4).

5. An isolated nucleic acid molecule characterized in that it comprises a polynucleotide which hybridizes under conditions of lack of hybridization to a polynucleotide having a nucleotide sequence identical to the nucleotide sequence in (a), (b) or (c) of the claim 1

6. An isolated nucleic acid molecule characterized in that it comprises a polynucleotide eing the amino acid sequence of a portion that supports an epitope of a mutant PS1 polypeptide having an amino acid sequence in (a) or (b) of claim 1.

7. A method for preparing a recombinant vector characterized in that it comprises inserting the isolated nucleic acid molecule of claim 1 into a vector.

8. The recombinant vector produced according to the method of claim 11.

9. A method for making a recombinant host cell, characterized in that it comprises the recombinant vector of claim 8 within a host cell.

10. A recombinant host cell produced according to the method of claim 13.

11. A recombinant method for producing a mutant PS1 polypeptide, characterized in that it comprises culturing a recombinant host cell of claim 10 under conditions in which the polypeptide is expressed and the polypeptide is recovered.

12. An isolated mutant PS1 polypeptide characterized in that it has an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of a PS1 polypeptide mutant having the complete amino acid sequence in Figure 1 (SEQ ID NO. : 2) (b) the amino acid sequence of a mature PS1 polypeptide mutant having the amino acid sequence at positions 83-549 in Figure 1 (SEQ ID NO: 2); and (c) the amino acid sequence of a portion that supports an epitope of any of the polypeptides of (a) or (b)

13. The mutant PS1 polypeptide isolated according to claim 12, characterized in that the mutant has an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of a PS1 polypeptide mutant having the complete amino sequence acids in Figure 2 (SEQ ID NO: 4) (b) the amino acid sequence of a mature PS1 polypeptide mutant having the amino acid sequence at positions 83-549 in Figure 2 (SEQ ID NO: 4) ); and (c) the amino acid sequence of a portion that supports an epitope of any of the polypeptides of (a) or (b)

14. An isolated antibody that specifically binds to a mutant PS1 polypeptide of claim 12 or 13.

15. A method for diagnosing a patient who has an increased likelihood of contracting Alzheimer's disease, characterized in that it comprises the steps of: a) obtaining from the patient a biological sample containing nucleic acid; b) incubating the nucleic acid with a probe capable of specifically hybridizing to a PS1 mutant gene under conditions and for sufficient time to allow hybridization to occur; and c) detect the presence of a hybridized probe and therefore determine that the patient has a high probability of contracting Alzheimer's disease.

16. A method for diagnosing a patient who has a high probability of contracting Alzheimer's disease, characterized in that it comprises the steps of: a) contacting a biological sample obtained from the patient with an antibody as claimed in claim 14, under conditions and for a sufficient time to allow the binding of the antibody to the protein; and b) detecting the presence of the bound antibody.