MXPA98001583A - Formulations for capsomers vaccines of papillomavirus. - Google Patents

Abstract

The present invention depicts formulations for vaccines which comprise viral capsomers along with methods thereof. Herein are also depicted therapeutic and prophylactic methods of the present formulations use as vaccines.

Description

* FORMULATIONS FOR CAPSOMER VACCINES OF PAPILLOMA VIRUS FIELD OF THE INVENTION The present invention relates to formulations for vaccines comprising papilloma virus proteins, either as fusion proteins, truncated proteins or truncated fusion proteins. The invention also encompasses methods for producing capsomers of the formula ions, as well as prophylactic and therapeutic methods for their use. • BACKGROUND OF THE INVENTION 10 Infections with certain high-risk strains of human genital papillomavirus (HPV) - for example HPV 16, 18 or 45 - are considered the main risk factor for the formation of malignant tumors of the human papillomavirus. anogenital tract. Among the possible diseases, carcinoma 15 cervical is by far the most frequent, according to an estimate by the World Health Organization (WHO), almost 50,000 new cases of the disease occur annually. Due to the frequency with which this condition occurs, the relationship between HPV infection and cervical carcinoma has been 20 examined extensively, leading to numerous gener ions. For example, it is known that precursor lesions of intraepi-tel cervical neoplasia (CIN) are caused by papillomavirus infections (Crura, New Eng., Ed. 310: 880-883 (1984)). 25 The DNA coming from the genomes of some types of HPV, including, for example, strains 16, 18, 33, 35 and 45, have been detected in more than 95 *? of tumor biapsies of patients with this disease, as well as in primary cell lines cultured from tumors. Approximately 50 to 70X of the biopsied CIN tumor cells have DNA derived only from HPV 16. The protein products of the initial genes of HPV 16 • and HPV 18, E6 and E7, have been detected in cervical carcinoma cell lines as well as in unacceptable 10 human transformed in vivo (Wettstein, et al., In PAPILLOMA VIRUSES AND HUMAN C NCER, Pfister <Ed.>, CRC Press: Boca Raton, FL 1990 pp. 155-179) and a significant percentage of patients with carcinoma cervical has anti-E6 or anti-E7 antibodies. It has been shown that 15 E6 and E7 proteins participate in the induction of cellular DNA synthesis in human cells, transform human and other cell types, and tumor formation in transgenic mice (Arbelt, et al., J. Virol., 68: 4358-4364 (1994): Aue? Ara ul, et al., Mol. Cell. 20 Biol. 14: 8250-8258 (1994)? Barbosa, et al., J. Virol. 65: 292-298 (199D? Kaur, et al., J. Gen. Viral., 70: 1261-1266 (1989): Schlegel, et al., EMBO J., 7: 31.81-3187 (1988) > The constitutive expression of E6 / E7 proteins seems to be necessary to maintain the transformed condition of tumors 25 positions for HPV.

Despite the ability of some HPV strains to induce neolastic phenotypes in vivo and in vivo, other types of HPV cause benign genital warts such as condylomata acutata and are only rarely associated with malignant tumors (5). Ikenberg, In Trass, et al., (Eds.) GENITAL PAPILLLQMA VIRUS INFECTIONS, Springer Verlag: Berlin, pp. 87-112). Low risk strains of this type include, for example, HPV 6 and 11. More frequently, genital papilloma viruses are 10 transmit between human beings during sexual intercourse that in many cases lead to a persistent infection of the anogenital mucous membrane. While this operation suggests that either the primary infection indicates an inadequate immune response or that the virus has developed the 15 capacity of. avoid the surveillance of the immune system, others observe ions suggest that the immune system is active during the primary manifestation as well as during the malignant advance of infections by papilloma virus (Altmann et al., in VIRUSES AND CANCER, M'inson et al., (eds.) 20 Cambridge University Press, (1994) p. 71-80). For example, the clinical manifestation of primary infection with rabbit and bovine papilloma virus can be prevented by vaccination with wart extracts to good viral structural proteins (Al'tmann, et al., 25 above? Field, Curr. Top. In Microbiol and Immunal. 186: 255- 266 (1994); Yindle and Frazer, Curr. Top. In Microbiol. and Im unal. 186; 217-253 (1994)). Rodents previously vaccinated with vaccinia recombinants that encode initial proteins of HPV 16, E6 or E7, or with 5 synthetic E6 or E7 peptides, are protected in the same way against the formation of tumors after inoculation of autologous transformed HPV cells 16 (Alt an, et al., Supra, Campo, et al., Supra, Yíndle and Frazer, et al., Supra). The regression of warts can be induced by 10 the transfer of lymphocytes from animal restores after infection with animal papilloma virus. Finally, in immunosuppressed patients, such as patients who received organ transplants or people infected with HIV, the incidence of 15 genital warts, CIN, and anogenital cancer is elevated. To date, no HPV I vaccine comprising the late Li pratein of human papillomavirus in the form of capsomes suitable for both prophylactic and therapeutic purposes has been described. Since the Ll protein 20 is not present in malignant genital lesions, vaccination with Ll proteins does not have any therapeutic potential for these patients. Lina construction of chimeric proteins, comprising amino acid residues of the Li protein and, for example protein E6 or E "that 25 provides chimeric capsomeros, combines the functions prophylactic and therapeutic of a vaccine. A method for a high level of production of chimeric caps would therefore be par- ticularly desirable, taking into consideration the possible advantages offered by said vaccine for a prophylactic and therapeutic intervention. Accordingly, there is a need in the art to provide formulations for vaccines that can prevent or treat an infection caused by HPV. Methods to produce formulations for vaccines that exceed 10 problems known in the art associated with a recombinant HPV pratein expression and purification would be useful to treat the population already infected with P > and also useful to immunize the population of people susceptible to an infection with HPV. COMPENDIUM OF THE INVENTION The present invention comprises therapeutic and prophylactic formulations for vaccines comprising chimeric human papilloma capsomeres. The invention also offers therapeutic methods for the treatment of patients 20 infected with HPV as well as prophylactic methods to avoid infection by HP1 ^ in a susceptible person ,, also contemplated method for the production and purification of capsomeres and proteins of the invention. In one aspect of the invention, vaccines are considered «They incorporate the structural proteins Ll and L2 of the papilloma virus. The development of such a vaccine faces significant obstacles because the papillomavirus can not be propagated in suitable titrations in cell cultures or other experimental systems to provide the viral proteins in an amount sufficient for an economical production of the vaccine. Adema; Recombinant methodologies to express proteins are not always easy to obtain and result 10 often in a low protein yield. Recently, virus-like particles have been described (VLPs), similar in the constitution of viral capsule structures, which are formed in Sf- insect cells when expressing viral Rl and R2 proteins (or 15 alone) using baculovirus at either recombinant vaccinia. The purification of VLPs can be achieved very easily by means of centrifugation in gradients of sucrose or CsCl (Ki Bauer, et al., Proc. Nati, Acad. Sci (USA), 99: 12111180- 12814 (1992); Kimbaurer, et al., J. Virol. 67: 6929-6936 20 (1994); Prosa, et al Vira. 6714: 1936-1944 (1992) Sasagawa et al., Virology 2016: 126-195 (1995); Valpers, et al., J. Virol. 69: 3258-3264 (1995); Zhou, et al., J. Gen. Viral. 74: 762-769 (1993); Zhau, et al., Virolagy 185: 251-257 (1991)). WO 93/02184 describes a method in 25 where particles similar to papilloma virus (VLPs) are They are used for diagnostic applications or as a vaccine against infections caused by the papilloma virus. WO 94/00152 describes the recombinant production of pratein Ll illustrating the neutralization epitope 5 confrrmation in human and animal papilloma virions. In another aspect of the invention, therapeutic vaccines are provided to ameliorate complications, for example, of cervical carcinoma or precursor lesions resulting from one. infection by papilloma virus and represent by Consequently, an alternative to prophylactic intervention. Vaccines of this type may comprise initial proteins of papillomavirus, pincluding E6 or E7, which are expressed in persistently infected cells. It is considered that, after the administration of a vaccine In this type, cytotoxic T cells can be activated against persistently infected cells in genital lesions. The target population for pharmaceutical intervention in patients with malignant or premalignant genital lesions associated with HPV. The patent application WO 93/20844 discloses that the initial E7 protein and antigenic fragments thereof of papilloma virus probably from HPV to BPV is therapeutically effective in the regression, but not in the prevention of tumors caused by papilloma virus in mammals. While there have been 25 HPV proteins by means of racombinant expression in E. coli or suitable eukaryotic cell types, the purification of the providing proteins has proved difficult due to low inherent solubility and complex purification procedures that generally require a combination of steps, including ion exchange chromatography, filtration in gel and affinity chromatography. In accordance with the present invention, formulations are provided for vaccines comprising caps? of the papilloma virus comprising either: (i) a first pratein which is a low viral protein expressed as a fusion protein comprising in part amino acid residues of a second pratein; (ii) a truncated viral protein; (iii) a truncated expressed viral protein or fusion protein comprising in part amino acid residues of a second protein, to either (iv) any combination of the three types of proteins. In accordance with the present invention, formulations are provided for vaccines comprising capsids of bovine papilloma virus (BPV) and human papillomavirus. The bovine virus capsomeres comprise bovine papilloma virus type I proteins. Preferred human virus capsomeres comprise proteins from any of the human papilloma virus strains HPV6, HPV11, HPV16, HPV18, HPV33, HPV35, and HPV45. The most preferred formulations for • The vaccine comprises capsomeres that comprise HPV16 proteins. In one aspect, capsomere formulations for vaccines of the invention comprise a first intact viral protein expressed as a fusion protein with additional amino acid residues of a second protein. The preferred chemical viral proteins are the structural papilloma viral proteins Ll and L2. Capsomers that consist of intact viral protein fusions can 10 produced using the proteins Ll and L2 together or the protsin Ll alone. Preferred capsids consist entirely of Ll fusion proteins, whose amino acid sequence is given in SEQ ID NO: 2, and which is encoded by the sequence of polynucleotides of SEQ ID NO: 1. The 15 amino acids of the second pratein can be derived from numerous sources (including amino acid residues of the first protein) insofar as the addition of the amino acid residues of the second pratein to the first protein allows the formation of capsomeres. Preferably, The addition of the amino acid residues of the second protein inhibits the ability of the intact viral protein to form viral-like particle structures; more preferably, the amino acid residues of the second pratein promote the formation of capsomeres. In a In the embodiment of the invention, the second protein can be any human tumor antigen, viral antigen, or bacterial antigen that is important to stimulate an immune response in neoplastic or infectious diseases. In a preferred embodiment, the second protein is also a papilloma virus protein. It is also preferred that the second protein be the product of the initial papilloma virus gene expression. It is also preferred, however, that the second protein be selected from the group of El, E2, E3, E4, E5, E6 and E7 - genetic products 10 early encoded in the genome of strains HPV6, HPV11, HPV18, HPV33, HPV35, to well HPV45. Any further route is preferred than the second protein is encoded by the HPV16 E7 gene, whose open reading frame is set forth in SEQ ID NO: 3. Capsomers assembled from subunits of 15 fusion proteins are known herein as chimeric capsomers. In one embodiment, the vaccine formulation of the invention consists of chimeric capsules where amino acid residues of Ll protein constitute approximately 50 to 9% of the amino acid residues. 20 of total fusion pratein. In another embodiment, amino acid residues of Ll constitute approximately 60 to 90 '/ * of the total fusion protein amino acid residues; in a particularly preferred embodiment, the amino acids Ll comprise approximately 80% of the residues ds 25 amino acids of fusion protein. In another aspect of the invention, formulations of capsomeres for vaccines, "comprising truncated viral proteins that have the removal of one to several amino acid residues necessary for the formation of a virus-like particle, are provided. inhibit the formation of capsomeres by truncated pratein, and it is especially preferred that the removal favors the formation of capsomeres Formulations for preferred vaccines of this type include capsomeres consisting of truncated Ll with and without viral protein L2 Particularly preferred capsids comprise truncated Ll proteins The truncated proteins contemplated by the invention include those that have one or more amino acid residues removed from the extreme carboxy of the protein, either 1 or more amino acid residues removed from the amino terminus of the pratein, or one or more amino acid residues. removed from an internal region (that is, not from no end) of the protein. Preferred capsomere formulations for vaccines comprise proteins truncated at the carboxy terminus. In formulations that include Ll protein derived from HPV16, it is preferred that they be removed from i to 34 carboxy-terminal amino acid residues. Relatively shorter removals are also contemplated which offer the advantage of a minor modification of the antigenic properties of the proteins Lí and the capsometers formed from there. However, it is still more preferred that 34 amino acid residues of sequence Ll, corresponding to amino acids 472 to 505 in HPV16 presented, are removed in SEQ ID NO: 2, and encoded by the polynucleotide sequence corresponding to the nuclei. 1414 to 1416 in the human HPV16 Ll coding sequence presented in SEQ ID NO: 1. When a formulation of capsomeres for vaccine is replaced by protein carrying an internal clearance, it is preferred that the removed amino acid sequence comprises the region of nuclear localization of the prateina. In the HPV16 Ll protein, the nuclear localization signal is found from approximately amino acid residue 499 to approximately 505 amino acid residue. After the expression of Rl proteins where the NLS has been removed, the structure assembly of capsomeres acurre in the cytoplasm of the host cell. Accordingly, the purification of the capsomeres is possible from the cytoplasm instead of from the core where the intact Ll proteins are assembled into capsomeres. Capsomers that result from the assembly of truncated proteins where adycotic amino acid sequences do not replace the removed pratein sequences are necessarily non-chimeric in nature.

In another aspect of the invention. ion, capsomere formulations are provided for vaccines comprising a truncated protein expressed vi or a fusion protein adjacent to amino acid residues of a second protein. The preferred truncated viral proteins of the invention are the viral papilloma viral proteins Ll and L2. Capsomers comprising truncated viral protein fusions can be produced using components of pratein Ll and L2 together or protein l 'room. Preferred caps are those formed from amino acid residues of pratein Ll. The truncated viral protein components of the fusion proteins include those having 1 or more amino acid residues removed from the carboxy terminus of the protein or one or more amino acid residues removed from the amino terminus of the protein, or one or more amino acid residues removed from an internal region (ie, not from one end) of the pratein. Preferred concentrations of capsomere for vaccine are formed from proteins truncated at the carboxy terminus. In these formulations that include Ll protein derived from HPV16, the removal of 1 to 34 carbaxy end amino acid residues is preferred. Relatively shorter removals are also contemplated, which offer the advantage of a minor modification of the antigenic properties of the pratein component Ll of the fusion pratein and the capsomeres formed from there. However, it is especially preferred that the 34 amino acid residues are removed from the sequence Ll, corresponding to amino acids 472 to 505 in HPV16 presented in SEQ ID NO: 2, and encoded by the palinucleotide sequence corresponding to nucleotides 1414 to 1516 in the human HPV16 Ll coding sequence presented in SEQ ID NO: 1. When the vaccine formulation consists of capsomeres consisting of proteins that carry an internal clearance, it is preferred that the removed amino acid sequence comprises the nuclear localization region, or else pratein sequences. Amino acids of the second pratein can be derived from numerous sources insofar as the addition of the amino acid residues of the second protein to the first pratein allows the formation of caps? ages. Preferably, the addition of the amino acid residues of the second pratein promotes or promotes the formation of capsomeres. Residues of amino acids from the second protein may be derived from numerous sources, including amino acid residues of the first protein. In a preferred embodiment, the second protein is also a papilloma virus protein. It is also preferred that the second protein be the product of the expression of the early papilloma virus. It is more preferred, however, that the second protein be selected from the group of early gene products encoded by the El, E2, E3, E4, E5, E6 and E7 genes of papilloma virus. In one embodiment, the vaccine formulation of the present invention is comprised of chimeric capsomeres where the amino acid residues of pratein Ll constitute approximately 50 to 99 * / »of flK the total fusion pratein amino acid residues. In another modality, the amino acid residues Ll constitute 10 approximately 70 to 90 *? of the amino acid residues of ~ total fusion protein; in a particularly preferred embodiment, the amino acids of Ll comprise approximately 80%! of the amino acid residues of the fusion protein. In a preferred embodiment of the invention, proteins of the vaccine formulations are produced by recombinant methodologies, but in formulations comprising intact viral protein, the proteins can be isolated from natural sources. Intact proteins isolated from natural sources 20 can be modified in vitro to include additional amino acid residues to provide a fusion protein of the invention employing well-known cavalry modification techniques routinely practiced in the art. Similarly, in formulations comprising 25 truncated viral proteins, the proteins can be isolated from natural sources co to intact proteins and hydrolyzed in vitra, employing chemical hydrolysis or enzymatic digestion with any of several general proteases or biep specific for sites, the truncated protein is subsequently modified to include additional amino acid residues in accordance with the above described to provide a truncated fusion protein of the invention. In the production of capsomeres, recombinant molecular biology techniques can be employed to produce DNA encoding either the desired intact protein, the truncated protein, or the truncated fusion protein. Recombinant methodologies required to produce a DNA encoding a desired protein are well known in the art and practiced routinely. Laboratory manuals, for example Sambrook et al., (Eds.), MOLECULAR CLONSNG: A LABORATORY MANUAL, Cold Spring Harbor, NY (1989) and Ausebel et al., (Eds.). PROTOCOLS IN MOLECULAR BIOLOGY. John Wiely Zr. Sons. Inc. (1994-1997), describe in detail the techniques necessary to carry out the required DNA manipulations. For a large-scale production of chimeric capsomers, protein expression can be carried out using viral vectors to eukaryotic vectors. Preferred vectors include any of the well known proca tic expression vectors, recombinant baculoviruses, vectors specific for COS cells, vaccinia receptors or specific expression proteins for yeast. When recombinant proteins are used to provide capsomeres of the invention, the proteins can first be isolated from the host cell of their expression and then incubated under conditions that allow for self-priming to provide caps. Eros. Alternatively, the proteins can be expressed under conditions that allow self-assembly to provide capsomeres. Al ernatively, the proteins can be expressed under conditions in which capsomeres are formed in the host cell. The invention also contemplates processes for the production of capsomeres of vaccine formulations. In one method, Ll proteins are expressed from DNA encoding six additional histidines at the extreme carboxy of the Ll prstein coding sequence. Ll proteins expressed with additional histidines (His Li proteins) san expressed most preferably in E. coli and His Ll proteins can be purified using nickel affinity chromatography. His Ll proteins in cell lysing are suspended in a denaturation regulator, for example 6 M guanidine hydrochloride, or a regulator of equivalent denaturation capacity, and are then subjected to chromatography on nickel. The protein eluted from the nickel chromatography step is renatured, for example in 150 mM NaCl, 1 mM CaC12,. * * /, Of Tritan-X 100, 10 M of HEPES (acid'N-2-hydroxy-1-piperazione-N'-2-etansulonic), pH 7.4. According to a preferred method of the invention, the assembly of capsomeres is carried out after the dialysis of the purified proteins, preferably after dialysis against 150 M NaCl, 25 M Ca ++, 10 * /. of DMSO (dimet ilsul fox ido),. IV »Triton-X 100, lO sM Tris acid (tris- (hydraximet i 1) aminamethane) acetic with a value of pH of 5.0. The formation of caps? erss can be monitored by electron microscopy, and, in cases in which the capsomeres are made up of fusion proteins, the presence of several protein components in the capsule was assembled can be confirmed by Western blot analysis using specific antisera. In accordance with the present invention, methods are provided for the therapeutic treatment of persons infected with P f, comprising the step of administering to a patient in need thereof, an amount of a vaccine formulation of the present invention effective in reducing the level of HPV infection. The invention also provides methods for the prophylactic treatment of individuals susceptible to HPV infection, which comprises the step of administering to an individual susceptible to being affected by an HPV infection a quantity of formulation of vaccine of the present invention effective to avoid HPV infection. While infected people can be easily identified using standard diagnostic techniques, susceptible individuals can be identified, for example as those who carry out sexual relations with an infected individual. However, due to the high frequency of infection with HPV, all sexually active persons are at risk of infection by papilloma virus. The administration of a vaccine formulation can include one or more additional components such as pharmaceutically acceptable carriers, diluents, auxiliaries, and / or regulators. The vaccines can be administered once or several times. The vaccine formulation of the present invention can be delivered in several ways, including, for example, oral, intravenous, intramuscular, nasal, rectal, transdermal, vaginal, subcutaneous, and intraperitoneal administration. Formulations for vaccine of the present invention offer numerous advantages compared to conventional vaccine preparations. As part of a therapeutic vaccination, capsomeres can promote elimination of cells persistently infected for example in patients with CIN or cervical carcinoma. Aditionally, therapeutic vaccinations of this type can also serve as prophylactic purposes to protect patients with CIN lesions against a new infection. As an additional advantage, the capsomeres can escape neutralization by preexisting anti-capsid antibodies and therefore have a longer half-life of circulation compared to virus-like chimeric particles. Formulations for vaccines comprising chimeric capsomeres may provide a further advantage of an increased antigenicity of both protein components of the fusion protein from which the capsomer is formed. For example, in a VLP, protein components of the underlying capsomere may be within the overall structure as a result of an internalized positioning within the VLP itself. Similarly, epitopes of the pratein components may exhibit a steric obstruction as a result of capsomere to capsomere contact, and therefore may be inaccessible to elicit an immune response. Preliminary results using LÍ / E7 fusion protein to produce VLPs support this position according to which no antibody response against the E7 component was detected. This observation is consistent with previous results that they indicate that the carboxy-terminal region of Ll forms inter-pentameric arm structures that allow the assembly of capsomeres into capsules (Barcia, et al., J. Virol. 71: 2988-2995 (1997)). Supposedly in a chimeric capsome structure, both protein components of the fusion protein substructure are accessible to elicit an immune response. Capsomer vaccines should therefore offer the additional advantage of an increased antigenicity against any protein component, including, for example, the neutralization of epitopes from other virus proteins, narrowed as a fusion with Ll amino acid sequences. DETAILED DESCRIPTION OF THE INVENTION The present invention is illustrated in the following examples. Example 1 describes a construction of expression vectors to produce viral, fusion or chimeric proteins. Example 2 refers to the generation of recombinant baculoviruses for the expression of viral proteins. Example 3 focuses on the purification of capsomeres. Example 4 describes an immunization protocol for the production of antisera and monoclonal antibodies. Example 5 provides an ELISA for peptide to quantify the formation of capsomes. Example 6 describes an antigen capture ELISA to quantify the % formation of capsomeres. Example 7 provides an inina hemagglut assay to determine the induction of neutralizing antibodies. EXAMPLE 1 Construction of Chimeric Ll Genes The DNA encoding the open reading frame of HPV 16 Ll was plasmid 16-114 / k-Ll / L2-pSynxtVI (Kimbauer et al., J. Viral 67: 6929- 6936 (1994)) using Bill and the resulting fragment was subcloned into pUC19 (New England 10 Biolabs, Beverly, MA) previously linearized on the unique Ba HI restriction site. Two basic expression bores were generated first to allow subsequent insertion of DNA to allow expression of fusion protein. A construct encoded HPV 16 Lldelta310 that has 15 a removal of nine amino acids; It was known that the Á region removed had a low level of homology with other Ll proteins of papilloma virus. The second csnstructo, HPV 16 Ll delta C, encoded a pratein with a 34 amino acid removal of the carboxy-terminal Ll residues.

Other constructs include a restriction site EcoP.V at the position of removal to facilitate the insertion of DNA encoding other protein sequences. The addition of the EcaRV site encodes two amino acids of na Ll protein, aspartate and isoleucine. 25 A. Generation of an expression construct V 16 # Lldelta310 Two primers (SEQ ID NOs: 5 and 6) were designed to amplify the vector of pUC19 and the complete coding sequence of HPV 16 Ll, except for nucleotides 916 to 942 in 5 SEQ ID NO: 1. The primers were synthesized for also introduce a unique restriction site EcaRV (underlined in SEQ ID NOs: 5 and 6) at the ends of the amplification product. CCCCGATATCGCCTTTAATBTATAAATCGTCTGG 10 SEQ ID NO: 5 CCCCGATATCTCAAATTATTTTCCTACACCTAGTG SEQ ID NO: 6 The resulting pyrazole reaction chain reaction was digested with EcaRV to provide extremes 15 complementary and the digestion product was circularized by ligation. The ligated DNA was transformed into E. coli using standard techniques and plasmids from the resulting colonies were screened for the presence of an EcoRV restriction site. A clone called HPV 1.6 Ll 20 of a310 was identified co or having the appropriate removal of 26 nucleotides and this construct was used to insert DNA fragments encoding other HPV 16 proteins in the EcoRV site as discussed below. -25 B. Generation of expression construct of HPV 16 Ll deltaC Two primers (SEQ ID NOs; 7 and 8) were designed complementary to the open reading frame of HPV 16 Ll in such a way that the primers supported each other to allow amplification in reverse directions in the DNA tempering comprising the HPV 16 Ll coding sequences in pUC19 described above. AAAGATATCTTGTAGTAAAAATTTGCSTCCTAAASSAAAC SEQ ID NO: 7 AAABATATCTAATCTACCTCTACAACTGCTAAACGCAAAAAACG SEQ ID NO; 8 Each primer introduced an EcoRV restriction site at the extreme of the amplification product. In the downstream initiator (SEQ ID NO: 8), the EcoRV site was followed by a TAA translational suspension codon positioned in such a way that the amplification product, at the time of the ligation of the EcoRV ends to form a circle, will include the removal of the 34 amino acids of Ll of extreme carbaxi. It took away out a polymerase chain relationship to amplify the open reading frame partial Ll and the complete vector. The amplification product was dissociated with EcoRV, circular! It was ligated with T4 DNA ligase, and transformed into E.coli DH5 alpha cells. Variable clans plasmids were analyzed to determine the presence of a SiR EcoRV that would isolate the plasmid. A positive construct called pUCHPV16Lldel taC was identified and used to insert the DNA of other HPV 16 proteins using the EcaRV site. C. Insertion of DNA fragments in HPV 16 Ll delta310 and HPV16LldeltaC 5 HPV 16 E7 DNA fragments encoding amino acids lS -160, 1-98, 25-75, 40-98, 50-98 in SEQ ID NO: 4 were amplified using primers that introduced restriction sites 5 'EcaRV terminals in order to facilitate insertion of fragments in HPV 16 Ll deltaSlO and 10 modified sequence HPV16Lldel taC. In the various amplification reactions, the E7.1 primer (SEQ ID NO: 9) was prepared in combination with the E7.2 primer (SEQ ID NO: 10) to generate a DNA fragment encoding amino acids 1-50 of E7; or with an "E7.3 initiator (SEQ ID NO; 11) for 15 generates a DNA fragment encoding amino acids 1-60 of E7; or else can an E7 initiator. (SEQ ID NO; 12); which generates a DNA fragment encoding amino acids 1-98 of E7. In other oxidation reactions, pairs of primers E7.5 (SEQ ID N0: 3) and E7.6 (SEQ ID NOs 14) were used for 20 amplifying a DNA fragment encoding the amino acids of E7 25-75; E7.7 (SEQ ID NO: 15) and E7.4 (SEQ ID NO: 12) were used to amplify a DNA fragment encoding amino acids 40-98 of E7; and E7.8 (SEQ ID NO: 16) and E7.4 (SEQ ID NO: 12) were used to amplify a DNA fragment encoding amino acids 50-98 of E7.

Initiator E7.1 SEQ ID NO: 9 AAAAG ^ 2 &J ATGCATGGAGAtACACCTACATTGC ~ Initiator E7.2"SEQ ID NO: lO TTTG ^ T ^ i? GGC CTGTCCGGTTCTGCrrrGTCC Initiator E7.3 SEQ ID NOi 11 Initiator E7.4 SEQ ID NO: 12 AAAAeATAT? TGGTTTCTGAGAACAGÁTGGGGCAC Initiator E7.5 ~ SEQ ID NO: 13 TITTG ^ IAi? GAT ATGAG ^ AATrAAATGACAGCTCAG Initiator E7.6 SEQ ID NOt 14 TT? TG ^^ ICGtCTACGTGtGTGCTTrGTACGCAC Initiator E7.7 SEQ ID NO: 15 TI ATCGATAICGGtCCAGCtGGACAAGCAGAACCGsAC Initiator E7.8 SEQ ID NO: 16 TITTGAIATCGATGCCCAT ACAATATTGTAACCtpTG Similarly, DNA nucleotides encoding the influenza matrix protein (SEQ ID NO: 17) were amplified using the first pair presented in SEQ ID NO; 19 and SEQ ID NO: 20. Both primers introduced an EcoRV restriction site into the amplification product.

TG? SAIAICGATATGGAATGGCTAAAGACAAGACCAATC SEQ ID NO: 19 TTTTGATATCGTTGpTGGATCCCCATTCCCATrG SEQ ID NO: 20 The products obtained by polymerase chain reaction from each amplification reaction were dissociated with EcoRV and inserted into the EcoRV site of HPV 16 Ll delta310 and HPV16LldeltaC sequences previously linearized with the same enzyme. In order to determine the orientation of the inserts in the plasmids encoding amino acids 25-75 and 50-98 of E7 and plasmid including influenza matrix protein, Clal digestion was used, taking advantage of a restriction site that splices the new newly created restriction site EcoRV (GATATCGAT) and included in the upstream initiator. For all three expression constructs including the HPV16 E7 start methionine, insertion orientation was determined using an Nsll restriction site, within the E7 coding region. Once the expression constructs with appropriate inserts were identified, the coding region of pratein for Ll and inserted amino acids was removed as a unit using restriction enzymes Xba? and Smal and the isolated DNA was ligated into the plasmid pVL1393 (? nvitrogen) to generate recombinant baculoviruses. D. Removal of EcoRV Restriction Sites in Expression Constructs The HPV 16 Lí deltaC sequence includes DNA from the EcoRV site that results in amino acid translation. normally found in wild type Ll polypeptides. Accordingly, a series of expression constructs were designed where the artificial EcoRV site was removed. The sequence Ll for these series of expression constructs was called HPV 1611deltaC *. To generate an expression strain containing the HPV 16LldeltaC * sequence, two polymerase chain reactions were performed to amplify two splice fragments of pUC-HPV16LldeltaC encoding amino acids 1-50 of E7. The resulting DNA fragments were spliced at the position of the L1 / E7 boundary but did not contain the two EcoRV restriction sites. Fragment 1 was generated using primers Pl (SEQ ID NO: 21) and P2 (SEQ ID NO: 22) and fragment 2 was generated using primers P3 (SEQ ID NO: 23) and P4 (SEQ ID NO: 24) ). Initiator Pl SEQ ID NO; 21 GTGATGACATACATACATTCTATG Initiator P2 SEQ ID NO: 22 CCATGCATrCCp, GCtTGTAGTAAAAAT? TGCGTCC Initiator P3 SEQ ID NO: 23 CTACAAGCAGGAATGCATGGAGATACACC Initiative * P4 SEQ ID NO: 24 CATCTGAAGCTGAGTAATGGGCTCTGTCCGGTTCTG Following the first two amplification reactions, the two purified products were used as hardened in another polymerase chain reaction using Pl and P4 primers only. The resulting amplification product was digested with EcoNI and HindIII enzymes inserted in the HPV 16LidelitC expression strain described above after digestion with the same enzymes. The resulting expression harvests were different from the HPV16LI construct of the original taC with the DNA encoding amino acids 1-50 of Ll and E7 pair loss of the two internal EcoRV restriction sites. The first EcoRV site was replaced by DNA encoding the alanine and glycine amino acids of native Ll in this position and the second site was replaced by a translation retention signal. In addition, the expression construct, called HPV 16 LldeltaC * E7 1-52, contained the first 52 amino acids of HPV 16 E7 as a result of the use of the P4 primer that also encodes the amino acid residues of E7 histidine at position 51 and tyrosine in position 52. HPV 16 LldeltaC * E7 1-52 was then employed to generate additional HPV 16 LldeltaC expression constructs that further include DNA encoding amino acids 1-55 of E7 using primer Pl (SEQ ID NO: 21) in combination with the primer P5 (SEQ ID NO: 25), amino acids 1-60 of E7 with a first pair Pl and P6 (SEQ ID NO: 26), and amino acids 1-65 of E7 with a first pair of P7 (SEQ ID NO: 27). The DNA sequences encoding additional amino acids in the products of Amplification arise from the design of the primers to include additional nucleotides for the desired amino acids. Initiator P5 SEQ ID NO: 25 CATCTGAAGCTGAACAATATGGTAATGGGCTCTGTCCG Initiator P6 SEQ ID NO: 26 CATCTGAAGCTGACTTGCAACAAAAGGTGA- CAATATGGTAATGGGCTCTGTCCG Initiator P7 SEQ ID NO: 27 CATCTGAAGCTTAAAGCGTAGAGTCACACTTGCAAC- AA GGTrACAATATGGTAATGGGCTCTGTCCG. Similarly, HPV 16Ll from taC * E7 1-70 was generated using the DNA temp coding HPV 16 Lldel taC * E7 1-66 and the pair of primers Pl and P8 (SEQ ID NO: 28). Initiator P8 SEQ ID NO; 28 CATCTGAÁGC? RATTGTACGCACÁAC- CGAAGCGTAGAGTCACACTGG After each polymerase chain reaction, the amplification products were digested with EcaNI in HindIII and inserted in HPV16LldeltaC previously digested with the same enzymes. The sequences of each construct were determined using a Prism 377 sequencing instrument from Applied Biosystems with fluorescent chain termination dideoles (Prober et al., Science 238: 336-341 (1987)). Example 2 Generation of Recombinant Baculoviruses Spodoptera frugiperda (Sf) cells were cultured in suspension or cultured in onocaps from 27 ° in a medium of TNMFH (Sigma) supplemented with lOX of fetal calf serum and 2 mM of glutamine. For the construction of recombinant baculaviruses based on HPV 16 Ll, Sf9 cells were transfected with 10 μg of transfer plasmids along with 2 μg of linearized Baculo-Gold DNA (PharMingen, San Diego, CA). Recombinant viruses were purified according to the protocol suggested by the manufacturer. To test the expression of pratein HPV 16 Ll, 100,000 Sf9 cells were infected with recombinant bacula virus in a multiplicity of infections (.oi) from 5 to 10. After incubation for 3 to 4 days at a temperature of 28 ° C, The medium was removed and the cells were washed with PBS. Cells were lysate in a SDS sample regulator and analyzed by SDS-PASE and Western Tinsion using anti-HPV16 Lí and anti-HPV16 E7 antibodies. With the object of determining which of the protein expression constructs of chimeric Ll could preferentially produce capsomeres, extracts of transfected cells were subjected to gradient centrifugation. The fractions obtained from the gradient were analyzed to determine the Ll protein content by Western tinsiin and for the formation of VLP by electron microscopy. The results appeared in the Table # 1. The intact HPV Ll protein, as well as the expression products of HPV 16Lldelta310 and HPV 16LdeltaC produced capsomes and particles similar to virus ep equal proportions. When the E7 coding sequences were inserted into the HPV 16Lidel ta310 vector, only the fusion proteins including the E7 amino acids 1 to 50 produced caused a detectable formation of capsomeres. When the DNA encoding E7 was inserted into the HPV 16 LldeltaC vector, it was found that all the fusion prateins produced capsomeres; the chimeric proteins that included the amino acid residues 40-98 of E7 produced the highest levels of capsamic structure exclusively.

The chimeric proteins including amino acids 1-98 and 25-75 of E7 both produced predominantly capsomeres, even though a formation of virus-like particles was also observed. The chimeric protein that includes amino acids 1-6 of E7 resulted in almost equal levels of 20 production of capsomeres and virus-like particles. When the E7 sequences were inserted into the HPV 16 Lidelta * C vector, it was shown that all the fusion proteins produced capsomeres. The insertion of DNA encoding residues 1-52, 1-55, and 1-60 of E7 produced the highest 25 of capsomeres, but equal levels of production of virus-like particles. While the insertion of DNA encoding E7-DNA for residues 1-65, 1-70, 25-75, 40-98, and 1-98 resulted in comparatively lower levels or detectable levels of capsule, capsomeres were produced in high amounts. TABLE 1 Capsomer Formation Capacity and HPV Chimeric Protein Capsules Ll Insert Builder Yield Yield 10 L Expression Capsomer Capsule HVP 16 Ll Ni nguno +++++ +++++ HPV 16 Lldelta310 None +++ ++ HPV 16 LldeltaC None ++++ ++++ HPV 16 Lldelta310 E7 1-98 15 HPV 16 Lldelta310 E7 1- 50 HPV 16 Lldelta310 E7 25-75 HPV 16 Lldelta310 E7 50-98 HPV 16 LldeltaC E7 1-98 +++ HPV 16 LldeltaC E7 25-75 ++ - + - 20 HPV 16 LldeltaC E7 50-98 + HPV 16 LldeltaC E7 1-60 +++++ +++++ HPV 16 LldeltaC E7 40-98 ++++ HPV 16 LldeltaC Influenza +++ HPV 16 Lldelta # C E7 1-52 +++++ +++++ 25 HPV 16 Lldelta * C E7 1-55 • ^ -H + -? - + +++++ HPV 16 Lldelta * C E7 1-60 +++ ++++ HPV 16 Lldelta * C E7 1-65 ++ HPV 16 Lídelta * C E7 1-70 ++ Example 3 Purification of capsomeres Trichopulsia cells ni (TN) High Five were cultured at a density of approximately 2 x 1,000,000 cells / ml in a serum-free Ex-Cell 405 medium (JRH Biosciences). Approximately 2 x 100,000,000 cells were pelleted by centrifugation at 1000 x g for 15 minutes, resuspended in 20 ml of medium, and infected with replenishing baculovirus at m.o.i. from 2 to 5 for 1 hour at room temperature. After the addition of 200 ml of medium, the cells were placed in dishes and incubated for 3 to 4 days at a temperature of 27 ° C. After incubation, the cells were harvested, pelleted, and resuspended in 10 ml of extraction buffer. The following steps were carried out at a temperature of 4 ° C. The cells were zoned for 45 seconds at 60 watts and the resulting cell lysate was centrifuged at 10,000 rpm in a Sorval SS34 rotor. The supernatant was removed and said supernatant was retained while the resulting pellet was resuspended in 6 ml of extraction buffer, z.onified for an additional 3 seconds at 60 watts, and centrifuged again. The two supernatants were combined, formed in layers in a two-stage gradient containing 14 ml of sucrose at 40 * 4 above 8 ml of a solution of CsCl (4.6 g of CsCl per 8 ml in extraction buffer), and centrifuged in a rotor of 5 oscillating vessel Sorval AH629 for 2 hours at 27,000 rpm at a temperature of 10 ° C. The interface region between CsCl and sucrose together with the CsCl campleta layer were collected in 13.4 ml Quickseal (Beckman) tubes and a regulator was added to adjust the volume to 10 13.4 ml. The samples were centrifuged overnight at 50,000 rpm at a temperature of 20 ° C in a Beckman 70 TI rotor. The gradients were fractionated (1 ml per fraction) by perforating tubes in the upper part and in the lower part with a needle of size 21.

Fractions were collected from each tube and 2.5 μl of each fraction was analyzed by SDS-polyacrylamide gel 10 * / »and Western staining using an anti-HPV16 Ll antibody. Virus-type particles and capsomeres were separated from 20 the above fractions identified by sedimentation in sucrose gradients of 10 to 50 * 4. The peak fractions of CsCl gradients were combined and dialed for 2 hours against 5 mM HEPES (pH 7.5). Half of the dialysate was used to produce capsomeres by dismembering 25 of VLPs intact overnight adding EDTA * (final concentration: 50 mM), EGTA (50 M), DTT (30 M), NaCl (100 mM), and Tris / HCl, pH 8.0, (10 M). Control bed, only NaCl and Tris / HCl were added to the other half. For the analysis of the capsomeres produced from 5 dismembered VLPs, EDTA, EGTA, and DTT (final concentration 5 mM each) were added to the sucrose cushions which were centrifuged at 250,000 xg for 2 to 4 hours at a temperature of 4 ° C. Fractions were recovered by perforating tubes through the bottom. A 10:10 dilution of each fraction was then analyzed by antigen capture ELISA. EXAMPLE 4 Immunization protocol for the production of polyclonal antisera and monoclonal antibodies 15 Balb / c mice were immunized subcutaneously three times, every four weeks, with approximately 60 μg of chimeric HPV capsomeres mixed 1: 1 with Freund's Adjuvants campletos or inapplicable in a total volume of 100 μl. Six weeks after the third immunization, the 20 mice were sacrificed and blood was collected by cardiac perforation. Example 5 Peptide ELISA to Quantify the Formation of Capsomers Micro-itation plates (Dynatech) are covered during the 25 night with 50 μl of peptide E701 (Muller et al., 1982) in a 10 μg / ml concentration in PBS. The wells are blocked for 2 hours at a temperature of 37 ° C with 100 μl of buffer containing 5 * 4 of BSA and 0.05 * of Tuteen 20 in PBS, and washed three times with PBS with a content of 0.05 * 4 of 5 Tween 20. After the third wash, 50 μl of serum diluted 1: 5000 in BSA / Tween 20 / PBS is added to each well and the incubation is carried out for 1 hour. The dishes are * wash again as before and add 50 μl of goat anti-mouse peroxidase conjugate at a dilution of 1: 5000. 10 After 1 hour, dishes are washed and stained using an ABTS substrate (O.2 mg / ml acid 2.2 '- Azino-bis (3- e-ylbenz-iazole-beta-sulphonic acid in an acetate buffer 0.1 M sodium-phosphate (pH 4.2) with 4 μl of 30% H202 per 10 ml) Extinction is measured after 1 hour at 490 n in a 15 automated Dynatech plate reader. EXAMPLE 6 Antigen Capture ELISA for Quantifying Capsomer Formation To allow a relative quantification of particle size. 20 virus and capsomeres in fractions of CsCl gradients, an ELISA was used to capture antigens. Microtiter plates were coated overnight with 50 μl / well of a 1: 500 dilution (final concentration of 2 μg per ml, in P.BS) with a mouse monoclonal antibody Purified Protein A Immunospecific Protein for HPV 16 Ll (antibodies 25 / C, MM07 and Ritt 1 were obtained from mice immunized with HPV 16 VLPs). Plates were blocked with 5 * 4 milk / PBS for 1 hour and 50 μl of gradient fractions of CsCl were added for 1 hour to a 5 perature of 37 ° C using a dilution I; 30O (in 5 * 4 milk / PBS). After three washes with PBS / 0.05'4 Tween 20, 50 μl of a polyclonal rabbit antiserum (1: 3000 dilution) §- sn milk / PBS), prepared against HPV 16 VLPs was added and the dishes were incubated at a temperature of 37 ° C for 1 10 hours The dishes were again washed and further incubated with 50 μl of a goat anti-rabbit peroxidase conjugate (Sigma) diluted 1: 5000 in PBS containing 5 * 4 milk for 1 hour. After a final wash, the dishes were stained with ABTS substrate 15 for 30 minutes and the extinction was measured at 490 nn in an automated Dynatech plate reader. As a negative control, the assay also included wells coated only with PBS. To test hand-held antibodies for speci fi city 20 capsomeres, VLPs with EDTA / DTT to dismember particles. Preparations of treated particles were assayed in the antigen capture ELISA and the readings were compared with treated cantrals. To disarm, 40 μl of VLPs will be incubated overnight at a temperature 25 of 4 ° C in 500 μl of a fracturing regulator that "Contained 30 mM DTT, 50 mr1 EGTA, 60 mM EDTA, 100 mM NaCl, and 10.0 mM Tris / HCi, p'H 8.0. Aliquots of treated and untreated particles were used in the previous capture ELISA at a 1: 20-1: 40 dilution. 5 E jemp1o 7 Innate Hemaglut Inhibition Assay In order to determine the magnitude with which vaccines '9- of chimeric capsomeres cause the production of neutralizing antibodies, an assay of 10 inhibition of hemagglutination in accordance with that briefly described below. This test is based on previous observations according to which particles similar to the virus can hemagluize red blood cells. Mice were immunized with a capsome vaccine Chimeric samples were collected and the serum was collected in accordance with that described in example 4. As positive controls, virus-like particles (VLPs) of HPV16 Ll and VLPs of PV1 (BPV) were tested in parallel with a preparation of chimeric capsomers To establish a In the positive baseline, the HPV16 or BPV1 VLPs are first incubated with or without sera collected from immunized mice after which the red blood cells are added. The extent to which preincubation with mouse serum inhibits the hemagglutination of cells 25 red blood cells is an indication of the capacity of neutralization of mouse sera. The experiments are then repeated using chimeric capsomeres in order to determine the neutralizing effect of the mouse sera on the vaccine. A brief protocol for the hemagglutin ination inhibition assay is described below. One hundred heparin microarrays are added (100 usp '- units / ml) to 1 ml of fresh mouse blood. Red blood cells are washed three times with PBS after 10 which is applied centrifugation and resuspension in a volume of 10 ml. Afterwards, the erythrocytes were suspended again in 0.5 ml of PBS and stored at a temperature of 4 ° C for up to three days. For the inina hemagglut assay, 70 μl of the suspension per well is used in a 96-well plate. 15 wells Aliquots of chimeric capsomers from CsCl gradients are dialysed for 1 hour cantra 10 mM Hepes (pH 7.5) and 100 μl of serial double dilutions in PBS are added to the mouse erythrocytes in dishes of 20 icrot i ulation of 96 round bottom wells which are additionally incubated for 3-16 hours at a temperature of 4 ° C. For the inhibition of hemagglutination, the capsules were incubated with dilutions of antibodies in PBS for 60 minutes at room temperature. 25 environment and then added to the erythrocytes. The level of Hemagglutination of erythrocytes and, consequently, the presence of neutralizing antibodies, is determined by standard methods. In preliminary results, mouse sera generated against chimeric capsomeres comprising HPV16LdeltaC protein in association with residues 1-98 of amino acids of E7 are observed to inhibit hemagglutination by HPV16 VLPs, but na by BVP of VLPs. The mouse sera were therefore positive to neutralize antibodies against human VLPs and this differential neutralization was probably the result of specificity of antibodies to epitopes against which the antibodies were prepared. It is considered that numerous modifications and variations to the intention presented in the above illustrative examples will come to the mind of those skilled in the art. Accordingly, the invention is limited only by the limitations set forth in the appended claims.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i ") APPLICANT: iii) TITLE OF THE INVENTION: 5 FORMULATIONS FOR CAPSOMER VACCINES OF PAPILLOMA VIRUS (iii) SEQUENCE NUMBER: 27 (iv) ADDRESS FOR CORRESPONDENCE: (A) ADDRESS : Marshall, O'Toole, Gerstein, Murray &Borum * (B) STREET: 233 South Wacker Drive, 6300 Sears Tower 10 (C) CITY: Chicago (D) STATE: Illinois (E) COUNTRY; United States of America (F) POSTAL CODE: 60606-6402 (v) COMPUTER LEGIBLE FORM: 15 (A) TYPE OF MEDIUM: Soft disk (B) COMPUTER: IBM computer with PC (C) SYSTEM OPERATION: PC- DOS / MS-DOS (D) PROGRAM: Patentln Release No. 1.0, Version No. 1.30 (vi) DATA OF CURRENT SCIENCE: 20 (A) NUMBER OF APPLICATION: - (B) DATE OF PRESENTATION: - (C) CLASSIFICATION: -. { viii) ATTORNEY / AGENT INFORMATION: (A) NAME: Williams Jr., Joseph A. 25 (B) REGISTRATION NUMBER: 38,659 «(OR REFERENCE NUMBER / CERTIFICATE: 27013/34028 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 312-474-6300 (B) TELEFAX: 312-474-0448 (2) INFORMATION FOR SEQ ID N0: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1518 base pairs (B) TYPE: nucleic acid ÍC) FABRIC CONFORMATION: simple 10 (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE; DNA (genomic) (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..1418 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NOsl: ATG TCT CTT tsa re CCT AG GAO GCC ACT GTC TAC TTG CCT CCT GTC 48 Met Ser Leu Trp Leu Pro Be Glu Al * Thr Val Tyr Leu Pro Pro Val 1 5 10 15 CCA GTA TCT AAG GTT GTA AGC GAT GAA TAT GTT GCA CGC ACA AAC 96 Pro V * l Ser Lvs Val val Ser Thr Asp Glu Tyr Val Ala Arg Thr Asn 20 25 30 ATA TAT TAT CAT GCA GGA ACÁ TCC AGA CTA CTT GCA GTT GGA AT Crf 2? Llißa xTyvrr TTVyTr HHiißs AAll * a GGly TThhrr sS.err-? g Leu Leu Wing Val Gly vS Pro 1 * 4 35 40 45 TAT TTT CCT ATT AAA AAA CCT AAC AAT AAC AAA ATA TTA GTT CCT AAA Tyr Phe Pro lie Lys Lys Pro Asn Asn Lys II * Leu Val Pro Lys 192 50 55 60 GTA TCA GGA TTA CAA TAC AGG GTA TTT AOA ATA CAT TTA CCT GAC CCC 240 Val Ser Gly Leu Gln Tyr Arg Val Phe Arg lie His Leu Pro Asp Pro 65 70 t 7e5 »g0 AAT AAG TTT GGT 'TTT CCT GAC ACC TCA TTT TAT AAT CCA GAT ACÁ CAG 28S Asn Lys Phe Gly Phe Pro Asp Thr Ser Phe Tyr Asp Pro Asp Thr Oln 85 90 95 CGG CTG GTT TGG GCC TGT GTA GGT GT GAG GTA GGT CGT GGT CAG CCA 336 Arg Leu Val Trp Ala Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro 100 IOS 110 TTA GGT GTG GGC ATT AGT GGC CAT CCT TTA TTA AAT AAA TTG GAT GAC 384 Leu Gly Val Glv lie Ser Gly His Pro Leu Leu Asn Lys Leu Asp Asp 115 • "120 125 ACÁ GAA AAT GCT AGT GCT TAT GCA GCA AAT GCA GGT GTG GAT AAT AGA 432 Thr Glu Handle Wing Be Wing Tyr Wing Wing Asn Wing Gly Val Aßp Asp Arg 130 135 140 GAA TGT ATA TCT ATG GAT TAC AAA CAÁ ACÁ CAÁ TTG TGT TTA ATT GGT 480 Glu Cys lie S * r Met Aßp Tyr Lys Gln Thr Gln Leu Cys Leu He Gly 145 150 '1SS 160 * ACC 528 Thr AAT STT SCA GTA AAT CCA GGT GAT TGT CCA CCA TTA GAG TTA ATA AAC 576 Asn Val Wing Val Asn Pro Gly Asp Cys Pro Pro Leu Glu Leu lie Asn 130 -85 190 ACÁ GTT ATT CAG GAT GGT GAT ATG GTT GAT ACT GGC TTT GGT GCT ATG 624 • Thr Val lie Gln Asp Gly Asp Met Val Aßp Thr Gly Phe Gly Wing KßC 195 200 205 GAC TTT ACT ACTA TTA CAG GCT AAC AAA AGT GAA GTT CCA CTG GAT ATT 672 Asp Phe Thr Thr Leu Gln Ala Aßn Lys Ser Glu Val Pro Leu Asp lie 210 215 220 15 TGT ACÁ TCT ATT TGC AAA TAT CCA GAT TAT ATT AAA ATG GTG TCA GAA 720 Cyß Thr Ser lie Cys Lys Tyr Pro Asp Tyr He Lys Met Val Ser Glu 225 230 235 240 CCA TAT GGC GAC AGC TTA ITT TTT TAT TGA CGA AGG GAA CAA ATG TTT 768 Pro Tyr Gly Asp Ser Leu Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe 245 250 255 GTT AGA CAT TTA TTT AAT AGG GCT GGT GCT GTT GGT GAA AAT GTA CCA 816 al Arg Kiß Leu Phe Asn Arg Ala Gly Allah val Gly Glu Asa Val Pro 260 265 270 20 GAC GAT TTA TAC ATT AAA GGC TCT GGG TCT ACT GCA AAT TTA GCC AGT 864 Aap Asp Lau Tyr lie Lys Gly S er Gly Ser Thr Ala Asn Leu Ala Ser 27S 280 285 TCA AAT TAT TTT CCT ACA CCT AGT GGT TCT ATG GTT ACC TCT GAT GCC Ser Asn Ty Phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala 912 CAA ATA TIC AAT AAA CCT TAT TGG TTA CA CGA GCA CAG GGC CAC AAT 960 25 ??? Ilß Phe A * p Lys Pro ^ ^ Leu G1 * ArS Wing Glp Gly Hia Asn 305 3 0 3l5 320 AAT GGC ATT TGT TGG GGT AAC CAA CTA TTT GTT ACT GTT GTAT GAT ACT 1008 Asn Gly He Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val Asp Thr 325 330 335 ACÁ CQC AGT ACÁ AAT ATG TCA TTA TGT GCT GCC ATA TCT ACT TCA GAA 1056 Thr Arg Ser Thr? Sn Mett Ser Leu Cys Ala Al * II * Ser Thr. Ser Glu 340 '345 350 5 ACT ACAT TAT AAA AAT ACT AAC TTT AAG GAG TAC -CTA COA CAT GGG GAG 1104 Thr Thr Tyr Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu 355 360 365 GAA TAT GAT TTA CAG TTT ATT TTT CAA CTG TGC AAA ATA ACC? TA ACT 1152 Glu Tyr Asp Leu Gln Phe He Ph * Gln Leu Cys Lys He Thr Leu Thr 370 * 375 380 Ü- GCA GAC GTT ATG ACÁ TAC ATA CAT TCT ATG AAT TCC ACT ATT TTG GAG 1200 Wing Asp Val Het Thr Tyr Ha His Ser Mßt'Asn Ser Thr He Leu Glu 385 390 395 400 10 GAC TGG AAT TTT GGT CTA CAA CCT CCC CCA GGA GGC ACA CTA GAA GAT '1248 Asp Trp Aßn Phß Gly Leu Gln Pro Pro G? And Gly Thr Leu Glu Asp 405 - 410 415 ACT TAT AGG TTT GTA ACC TCC CAG GCA ATT GCT TGT CA AAA CAT ACÁ "1296 Thr Tyr A rg Phß Val Thr Ser Gln. Ala? Le Ala Cys Gln Lys Hi? Thr 420 «25 430 CCT CCA GCA .CCT AAA GAA GAT CCC CTT AAA AAA TAC ACT TTT TGG GAA" 1344 Pro Pro Pro Wing Lys Glu Asp Pro Leu Lyß Lyß Tyr Thr Ph * Trp Glu 43S 440 445 15 GTA AAT 'TTA AAG GAA AAG TTT TCT GCA GAC TA GAT CAG TTT CCT TTA 1392 Val Asn L * u Lys Glu Lys Phe Ser Wing Asp Leu Aßp Gln Phe Pro Leu ^ í * 450 455 460 GGA CGC AAA TTT TTA CTA CAÁ GCA GGA TTG AAG GCC AAA CCA *? TTT 1440 Gly Arg Lys Phe Leu Leu Gln Wing Gly Leu Lys Wing Lys Pro Lys Phe 465 470 475 480 ACÁ TTA GGA AAA CGA AAA GCT ACÁ CCC ACC ACC TCA TCT ACC TCT ACÁ 1488 Thr Leu Gly Lys Arg Lys Wing Thr Pro Thr Thr Ser Ser Thr Ser Thr 485 490 495 ACT GCT AAA CGC AAA AAA CGT AAG CTG TAA 1S18 Thr Wing Lys Arg Lys Lys Arg Lys Leu * 500 505 (2) INFORMATION FOR SEQ ID NO ? 2? U> CHARACTERISTICS OF SECUENC IA S < A > LONBITUDE: 506 ami nocides 25 (B &TYPE! Am i nocide (D) TOPOLOGY: l i nea l i i) TYPE OF MOLECULE! prote í na < xi > SEQUENCE DESCRIPTION: SEQ ID NO: 2s Met Ser Leu Trp Leu Pro Ser Glu Ala Thr Val Tyr Leu Pro Pro Val 1 '5 10 15 Pro Val Ser Lys Val Val Ser Thr Asp Glu Tyr Val Ala Arg Th Aap. 20 25 30 He Tyr Tyr His Wing Gly Thr Ser Arg Leu L «u Wing Val Gly Hiß Pro 1S 40 45 * > Tyr Phe Pro He Lys Lys Pro AS? I Handle Handle Lys He Leu Val Pro Lys 50 55 60 Val Ser Gly Leu Glh Tyr Arg Val Phe Arg II * HÃ s Leu Pro Aßp Pro 65 70 7S 80 10 Asn Lys Phß Gly Phe Pro Asp Thr Ser Phe Tyr Asn Pro Asp Thr Gla 85 90 95 Arg Leu Val T Ala Cys Val Glv Val Glu Val Gly Arg Gly Gln Pro 100 105 110 Leu Gly Val Gly He Ser Gly His Pro Leu Leu Asn Lyß Leu Asp Asp 115 120 125 Thr Glu Asa Ala Sar Ala Tvr Ala Ala Asa Ala Gly al Asp Asa Arg 130"" 135 140 15 Glu Cys lie S * r Met Asp Tyr Lys Gla Thr Gln Leu Cys Leu He Gly 145 150 155 180 Cys Lys Pro Pro He Glv Glu Hiss Trp Gly Lys Gly Ser Pro Cys Thr 165 170 175 Handle Val Wing Val Asn Pro Gly Asp Cvs Pro Pro Leu Glu Leu H «Asn 180 185 190 Thr VaT He Gln Asp Gly Asp Mee Val Asp Thr G? And Phß Gly Alae-t "195 200 205 20 Asp Phe Thr Thr Leu Gln Ala Asa Lys Ser Glu Val Pro Leu Asp He 210 * 215 220 Cys Thr Ser He Cye Lys Tyr Pro Asp Tyr He Lys Met Val Ser Glu 225 230 235 240 Pro Tyr Gly Asp Ser Leu Phß Phe Tyr Leu Arg Arg Glu Gl? Mee Phe 245 250 255 Val Arg His Leu'íhe Asn Arg Ala Gly Ala Val Gly Glu Asp Val Pro 25 260 265 270 * Asp Asp Leu Tyr He Lys Gly Ser Gly Ser Thr Wing Asa Leu Wing Ser 275 280 285 Ser Asa Tyr phe Pro Thr Pro Ser Gly Ser Met Val Thr Ser Asp Ala 290 295 300 Gln Xl «Phe Asn Lys Pro Tyr Trp Leu Gla Arg Ala Glp ßly Hiß Asa 305 310 315 320 Asn Gly He Cys Trp Gly Asa Gln Leu Phe Val Thr Val Val Asp Thr 325 330 335 Thr Arg Ser Thr Asp. Mee Ser Leu Cys Wing Wing He Ser Thr Ser Glu 340 345 350 Thr Thr Tyr Lys Asn Thr Asn Phe Lys Glu Tyr Leu Arg His Gly Glu 355 360 365 Glu Tyr Asp Leu Gla Phe Ilß Phe Gln Leu Cys Lys He Thr Leu Thr 370 375 380 Wing Asp Val Msc Thr Tyr He His S * r Mee Asn Ser Thr He Leu Glu 10 385 390 395 400 Asp Trp Asn Phe Gly Leu Gln Pro Pro Pro Gly Gly Thr Leu Glu Asp 405 410 415 Thr Tvr 'Arg Phß Val Thr Ser Glp Ala He Wing Cys Gla Lys His Thr 4-20 425 430 Pro Pro Wing Pro Lys Glu Asp Pro Leu Lys Lys Tyx Thr Phe Trp Glu 435 440 445 15 Val Asn Leu Lys Glu Lys Phe Ser Wing Asp Leu Asp Gln Phe Pro Leu 450 455 460 Gly Arg Lys Phe Leu Leu Gln Wing Gly Leu Lys Wing Lys Pro Lys Phe 465 470 475 480 Thr Leu Glv Lys Arg Lys Wing Thr Pro Thr Thr Ser Ser Thr Ser Tnr 485 490 495 Thr Wing Lys Arg Lys Lys Arg Lys Leu * 500 505 20 < 2 > INFORMATION FOR SEQ ID N0? 3 Í < i) CHARACTERISTICS OF SECUENC IA! < A > LQNBSTUD: 297 base pairs (B> TSPO nucl ic acid (C) FABRIC CONFORMATION «simple 25 (D) TOPOLOGY: linear (i?) TYPE OF MOLECULE! DNA (i: <CHARACTERISTICS! (A) NAME / KEY: CDS <B> LOCATION! 1.297 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 »ATG CAT GGA GAT ACÁ CCT ACÁ TTG CAT GAA TAT ATG TTA GAT TTG CAA 48 Met His Gly Asp Thr Pro Thr Leu Kis Glú Tyr Met L * u Asp Leu Gln 1 5 10. 15 * t CCA GAG ACÁ ACT GAT CTC TAC TGT TAT GAG CA TTA AAT GAC AGC TCA 96 Pro Glu Thr Thr Asp Leu Tyr Cyß Tyr Glu ßlp Leu Asn Asp Ser Ser 20 2S 30 GAG GAG GAT GAA ATA GAT GGT CCA GCT GGA CA GCA GAA CCß GAC 144 lO Glu Glu Glu Glu Asp Glu Asp Gly Pro Ala Gly Glp Wing Glu Pro Asp 35 40 45 AGA GCC CAT TAC AAT ATT GTA ACC TTT TGT TGC AAG TGT GAC TCT ACG 192 Ara Ala His * Tyr Asn He Val Thr Phe Cys Cys Lys Cys Aßp Ser Thr 50 55 60 CTT CGG TTG TGC GTA CAA AGC ACA GTA GAC ATT CGT ACT TTG GAA 240 Leu Are Leu Cys Val Gla Ser Thr Hiß Val Asp He Arg Thr Leu Glu 65 70 75 80 GAC CTG TTA ATG GGC ACÁ CTA GGA ATT GTG TGC CCC ATC TGT TCT CAG 288 15 Asp Leu Leu Ket Gly Thr L * u Gly He Val Cys Pro 11 * Cys S * r Gl. 85 90 SS AAA CCA TAA 297 Lys Pro * (2) INFORMATION FOR SEQ ID NO:: (i) SEQUENCE CHARACTERISTICS: 20 (A) LENGTH! 98 amino acids (B) TYPE: amino acid (D) TOPOLOGY! linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO * 4? 25 '* Met His Gly Asp Thr Pro Thr Leu His * Glu Tyr Met Leu Asp -Leu ßlo 1 5 10 15 Pro ßlu TJir Thr Asp Leu Tyr Cys .Tyr Glu Gln Leu Handle Aßp S * r Ser 20 25 30 Glu Glu Glu As? Glu Lie Asp Gly Pro Wing Qly. Gln Ala Glu Pro Asp 35 40: 4S Arg Ala Hiß Tyr Asn He Val Thr Phe Cyß "Cyß Lyß Cys Aßp Ser Thr 50 55 60 Leu Arg Leu "Cys Val Glp Ser Thr Kis Val Asp He Arg Thr Leu Glu 65 70 75 80 Asp Leu Leu Met Glv Thr Leu Giy He Val Cyß Pro He Cys Ser Gln 85 90 95 10 Ly * Pro * _ - < 2 > INFORMATION FOR SEQ ID NOISÍ (i) SEQUENCE CHARACTERISTICS: (A) LENGTH! 34 base pairs (B> TYPE: nucleic acid 15 (C) FABRIC CONFORMATION! simple (D) TOPOLOGY! linear (ii) TYPE OF MOLECULE: DNA (? I) DESCRIPTION OF SEQUENCE! SEQ ID NO? 5! CCCCGATATC GCCTTTAATG TATAAATC6T CTG6 34 20 (2) INFORMATION FOR SEQ ID NO! 6: (i) SEQUENCE CHARACTERISTICS! (A> LENGTH! 35 pairs of bases (B) TYPE: nucleic acid (C) CONFORMATION OF HEBR? simple 25 (D) TOPOLOGY: linear '(ii) TYPE OF MOLECULE: DNA ix) SEQUENCE DESCRIPTION: SEQ ID NO:?: CCCCGATATC TCAAATATT TTCCTACACC TAGTG (2) INFORMATION FOR SEQ IP NO: 7: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 pairs of bases (B) TYPE: á gone nucleic (C) CONFORMATION OF HEBRA: simple ÍD) TOPOLOGY: line l 10 (ii) TYPE OF MOLECULE! DNA (xi) DESCRIPTION OF SEQUENCE! SEQ ID NO: 7: AAAGATATCT TGTAGTAAAA ATTT6CGTCC TAAAGGAAAC 40 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (C) HEBREW CONFORMATION: sim le (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA 20 Cxi) SEQUENCE DESCRIPTION: SEQ ID NO: 8Í AAAGATATCT AATCTACCTC TACAACT6CT AAACGCAAAA AACG 44 (2 > INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 amino acids 25 (B) TYPE: nucleic acid * (OR HEBREW CONFORMATION: imple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: 5 AAAAGATATC ATGCATGGAG ATACACCTAC ATTGC (2) INFORMATION FOR SEQ ID NO: 10. (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs * (B) TYPE: nucleic acid 10 (C) HEBREW CONFORMATION: imple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: TTTTGATATC G6CTCTGTCC GBTTCTGCTT GTCC 15 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 44 base pairs (B) TYPE: nucleic acid (OR SHAPE CONFORMATION: yes ple 20 (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: TTTTGATATC CTTGCAACAA AAGGTTACAA TATTGTAATG GGCC 44 (2) INFORMATION FOR SEQ ID NO: 12: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) FABRIC CONFORMATION: simple (D) TOPOLOGY: linear 5 (ii) TYPE OF MOLECULE: DNA (? I) DESCRIPTION OF SEQUENCE: SEQ ID NO : 12: AAAAGATATC TG6TTTCTGA GAACAGATGG 66CAC (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: 10 (A) LENGTH: 38 base pairs (B) TYPE: nucleic acid (C) HEBREW CONFORMATION! simple (D) TOPOLOGY: linear (i i) TYPE OF MOLECULE: DNA 15 (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 13: TTTTGATATC 6ATTATGAGC AATTAAATGA CAGCTCAG 38 (2) INFORMATION FOR SEQ ID NO: 1 i (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs 20 (B) TYPE: nucleic acid IC) HEBREW CONFORMATION: sim le CD > TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: 25 TTTTGATATC GTCTAC6T6T GTGCTTT6TA CGCAC 35 (2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) HEBREW CONFORMATION: imple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: TTTATCGATA TCGGTCCAGC TGGACAAGCA GAACCGGAC .9 (2) INFORMATION FOR SEQ ID NO: i (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 pairs of bases (B) TYPE: nucleic acid (C) HEBREW CONFORMATION: imple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) DESCRIPTION OF SEQUENCE! SEQ ID NO: 16: TTTTGATATC GAT6CCCATT ACAATATTGT AACCTTTTG (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 294 base pairs (B) TYPE: nucleic acid (C) HEBREW CONFORMATION : sim le (D) TOPOLOGY: linear (ix) TYPE OF MOLECULE: DNA (ix) FEATURES: (A) NAME / CLAVEi CDS (B) LOCATION »1..294 (xi) SEQUENCE DESCRIPTION! SEQ ID NO! 17s ATG AGT CTT CTA ACC GAG GTC GAA ACG CTT ACC AGA AAC GGA TGG GAG 48 Met Sñt Leu Leu Thr Glu Val Glu Thr L * u Thr Arg Asn Gly Trp Glu 1 5 10 15 TGC AAA TGC AGC GAT TCA AGT GAT CCT CTC ATT ATC GCA GCG AGT ATC 96 Cys Lys Cyß Ser Asp Ser Ser Asp Pro Leu H * He Ala Wing Ser II * 20 25 30 ATT GGG ATC TTG CAC? TG ATA TTG TGG ATT TTT TAT CGT CTT TTC TTC 144 lie Gly He Leu His Leu He Leu Trp He Phe Tyr Arg Leu Phe Phe 35 40 45 10 AAA TGC ATT TAT CGT CTT AAA TAC GGT TTG AAA AGA GGG CCT TCT 192 Lys Cyß He Tyr Arg Arg Leu Lyß Tyr Gly Leu Lyß Arff Gly Pro S * r 50 55 60 ACG GAA GGA GCG CCT GAG TCT ATG AGG GAA QAA TAT CGG CAO GAA CAG Tbr ßlu Gly Wing Pro Glu S * r Met Arg Glu Glu Tyr Arg Gla Glu Gn 240 65 70 7g 80 CAG AGT GCT GTG GAT GTT GAC GAT GTT CAT TTT GTC AAC ATA GAG CTG Glp Ser Ali Val Asp Val Asp Asp val Hiß Ph * Val Asa II * ßiu L * u 288 85 15 90 95 GAG TAA Glu * 294 (2) INFORMATION FOR SEQ ID NOilßí (i) SEQUENCE CHARACTERISTICS! (A) LENGTH! 97 amino acids (B) TYPE! amino acid (D) TOPOLOGY: linear (i i) TYPE OF MOLECULE! p rotate Ina (xi) SEQUENCE DESCRIPTION: SEQ ID NO; 18: Met Ser Leu Leu Thr Glu Val Glu Thr Leu Thr Arg Asn Gly Trp Glu 1 ^ 5 10 is 25 Cys Lys Cys Ser Asp Ser Ser Asp Pro Leu He II * Ala Ala Ser He 20 25 30 He Gly He Leu His Leu He Leu Trp ll * Phß Tyr Arg Leu Phe Phe 35 40 45 Lys Cys He Tyr Arg Arg Leu Lyß Tyr Gly Leu Lys Arg ßiy Pro S * r. fifty . 55 60 Thr Glu Gly Wing Pro Giu Ser Met Ring Glu Glu Tyr Arg Gln Glu Gln 5 65 70 75 - 80 Gln Ser Wing Val Asp Val As? Asp Val Kis Phe Val Asa ll * Glu Leu - 85. - "90. 35 Glu * _" "" * 'l - - (2) INFORMATION FOR SEQ ID N0? 19Í (i) SEQUENCE CHARACTERISTICS: 10 (A) ) LENGTH: 40 base pairs (B> TYPE: nucleic acid (OR FABRIC CONFORMATION! Simple f) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA 15 (? I) DESCRIPTION OF SEQUENCE! SEQ ID NOi 19? TTTTGATATC GATATGGAAT GGCTAAAGAC AAGACCAATC 40 (2> INFORMATION FOR SEQ ID N0? 20? (I) SEQUENCE CHARACTERISTICS! (A) LENGTH: 35 base pairs 20 (B) TYPE! Nucleic acid (C) FABRIC CONFORMATION: simple (D) TOPOLOGY! Linear (ii) TYPE OF MOLECULE: DNA ix) SEQUENCE DESCRIPTION: SEQ ID NO: 20: 25 TTTTGATATC GTTGTTTGGA TCCCCATTCC CATTG 35 (2) INFORMATION FOR SEQ ID N0: 21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (OR SHAPE CONFORMATION: simple (D) TOPOLOGY: linear (ii) ) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 21: 6TTAT6ACAT ACTACATTC TATG 24 (2) INFORMATION FOR SEQ ID N0: 22 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B> TYPE: nucleic acid (OR SHAPE CONFORMATION: simple (D) TOPOLOGY: line l (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 22! CCATGCATTC CTGCTT6TAG TAAAAATTTG CGTCC 35 (2) INFORMATION FOR SEQ ID NO: 23 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 29 base pairs (B) TYPE: nucleic acid (C) FABRIC CONFORMATION: simple (D) TOPOLOGY .: linear ( ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 23: CTACAAGCAG GAAT6CATGG AGATACACC 19 (2) INFORMATION FOR SEQ ID N0? 24Í (i) SEQUENCE CHARACTERISTICS: 5 (A) LENGTH: 36 base pairs (B) TYPE: acid nucleic (C) HEBREW CONFORMATION: imple % (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA 10 (xi) SEQUENCE DESCRIPTION! SEQ ID NOi 24: CATCTGAAGC TTAGTAAT6G GCTCTGTCCG GTTCTG 36 (2) INFORMATION FOR SEQ ID NQ: 25i (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 38 base pairs 15 (B) TYPE: nucleic acid (C) CONFORMATION OF HEBRAs im le (D > TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 25: 20 CATCTGAAGC TTATCAATAT TGTAATGGGC TCTGTCCG Q (2) INFORMATION FOR SEQ ID NO: 26: (i) SEQUENCE CHARACTERISTICS: ÍA) LENGTH: 54 base pairs (B) TYPE: nucleic acid 25 (C) FABRIC CONFORMATION: simple (D) TOPOLOGY! l inea l (i i) TYPE OF MOLECULE! DNA (xi) DESCRIPTION OF SECUENC IA! SEQ ID NO! 26: tATCTOAAGC TTACTTGCAA CAAAAGGTTA CAATATTGTA ATO OCGCG 'TCCG 5 < 2) INFORMATION FOR SEQ ID N0? 27? (i) SEQUENCE CHARACTERISTICS (A) LENGTH! 69 base pairs (B) TYPE! nucleic acid (OR SHEPHERD CONFIGNATION 10 simple (D) linear TOPOLOGY (i i) TYPE OF MOLECULES DNA (? i> SEQUENCE DESCRIPTION! SEQ ID NO! 27 * CATCTGAAGC TTAAAGCGTA GAGTCACACT TGCAACAAAA GGTTACAATA TTGTAATGGG CTCTGTCCG 6 (2) INFORMATION FOR SEQ ID N0? 28? 15 < i) SEQUENCE CHARACTERISTICS! (A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) HEBREW CONFORMATION! simple (D) TOPOLOGY! linear 20 (i i) TYPE OF MOLECULE! DNA (xi) DESCRIPTION OF SEQUENCE! SEQ ID NOi 28: CATCTGAAGC TTATTGTACG CACAACCGAA GCGTA6AGTC ACACTT6 47 25

Claims (1)

1. CLAIMS 1. A fusion protein comprising: an amino acid sequence from a first specific protein for papilloma virus (PVS); and an amino acid sequence from a second PVS protein, wherein said fusion protein comprises only amino acid sequences of PVS proteins. 2 »A fusion protein according to claim 1, comprising amino acid sequences of more than two PVS proteins. 3. A fusion protein according to claim 1, wherein at least one of the amino acid sequences from a PVS protein comprises at least one removal of the naturally occurring PVS protein sequence. 4. A fusion protein according to claim 1, wherein said first PVS protein is an L protein or an E protein. 5. A fusion protein in accordance with rei indication 4, where the pratein L is Ll « 6 »A fusion protsin according to claim 1, wherein the E protein is an E7 protein. 7. A fusion protein according to claim 1, wherein the first PVS protein is a • protein L and the second protein of PVS is an E protein. 8. A fusion protein according to claim 7, wherein said protein L is L and said protein E is E7. 9. A fusion pratein according to claim 8, wherein the PVS proteins are human PVS proteins. ÍO. A fusion protein according to the rei indication 9, wherein said amino acid sequence from said Ll protein does not contain the 34 amino acid sequence of the carbsxi terminus. 11. A nucleic acid sequence encoding the fusion protein of claim 1. 12. A nucleic acid sequence according to claim 11 which is a DNA. 13. A therapeutic composition comprising the fusion pratein of the rei-indica tion 1. 14. A prophylactic vaccine formulation comprising the fusion protein of claim 1. A method for preparing the fusion protein of claim 1, which comprises the recombinant expression of a nucleic acid sequence encoding said fusion protein, and the substantial isolation of said fusion protein. 16 16. A therapeutic method for the treatment of an animal] having a papilloma virus infection, comprising administering a pharmaceutical composition comprising the fusion protein of the rei indication 1 in an amount and for a period of time sufficient to reduce the level of infection of the papilloma virus. 17. A therapeutic method according to claim 16, wherein the animal is a human being and the * PVS proteins are human PVS proteins. 18. A prophylactic method to inhibit an infection of The papilloma virus in an animal, comprising the administration of a pharmaceutical composition comprising the fusion protein of claim 1 in an amount and for a period of time sufficient to effectively inhibit an infection of papilloma virus. 19. A therapeutic method according to claim 18, wherein the animal is a human and the PVS proteins are human PVS proteins. twenty 25