MXPA98001277A - Artificial environment of nucleic acids for the expression of structural genes regulated by the celu cycle - Google Patents

Abstract

The present invention relates to an artificial entity or nucleic acid construct comprising at least one activating sequence, at least one chimeric promoter module, comprising a nucleotide sequence that binds to a protein of the E2F family and a family protein CDF-1, and at least one structural gene, in which said chimeric promoter module produces up-regulation of gene expression in the cell cycle later than the B-myb promoter but before the cdc25C promoter, and the CDF protein

Description

Artificial nucleic acids for the expression of structural genes regulated by the cell cycle.

The invention relates to an artificial nucleic acid entity comprising at least one activating sequence, at least one promoter module comprising a nucleotide sequence that binds to a protein of the E2F family and to a protein of the CDF-1 family , and at least one structural gene. One of the factors involved in the repression regulated by the cell cycle is E2F, which can form complexes of DNA binding repressors through its interaction with "pocket" or "pocket" proteins, such as pRb (eintraub et al. , Nature 358, 259 (1992), Helin and Harlow, Trends Cell Biol. 3, 43 (1993), Zamanian and La Thangue, Mol. Biol. Cell 4, 389 (1993)). E2F is a heterodimer transcription factor composed of members of the E2F and DP multi-gene families (Ne-vins, Science 258, 424 (1992), Müller, Trends Genet, 11, 173 (1995), La Thangue, Transactions 24 , 54 (1996)). Another transcription factor belonging to the E2F gene family is, p. ex. , E2F-5 (WO 96/25494). Activation of transcription by E2F is modulated during the cell cycle by "pocket" proteins of the pRb family. E2F is repressed in G0 and G-, early, but during cell cycle progression both the DP / E2F moiety and the associated "pocket" proteins are hyperphosphorylated by Gx-specific cyclin-dependent kinases that lead to the dissociation of the ternary complex inhibitor (DeCaprio et al., Proc. Nati, Acad. Sci. USA 89, 1795 (1992), Fagan et al., Cell 78, 799 (1994), Hatakeyama et al., Genes Dev. 8, 1759 (1994) Weinberg, Cell 81, 323 (1995)). This dissociation generates trans-cryptically active "free E2F" and leads to the activation of genes regulated by E2F. Therefore, p. ex. a vector that co-comprises a nucleic acid encoding an E2F regulator and / or ElA regulator, has already been used to transfect a differentiated neuron that induces DNA synthesis (WO 95/16774). Among the promoters controlled by the repression of transcription by E2FBSs, are E2F-1, orc-1 and B-myb (Lam and Watson, EMBO J. 12, 2705 (1993), Hsiao et al., Genes Dev. 8424, 1526 (1994), Johnson et al., Genes Dev. 8424, 1514 (1994), Ohtani et al., Mol.Cell. Biol. 16, 6977 (1996)). The role of E2F, however, is not exclusively activating. This has been demonstrated for the first time for the mouse B-myb gene (Lam and Watson, EMBO J. 12, 2705 (1993), Lam et al., EMBO J. 13, 871 (1994); Lam et al., Gene 160, 277 (1995); Zwicker et al., Science 271, 1595 (1996)). The uptake of the E2F binding site (E2FBS) in the B-myb promoter leads to a drastically increased activity selectively in G0 and consequently to a loss of regulation of the cell cycle. Other examples in this context are the E2F, pl07, histone H2A and orcl promoters, in which mutations of E2FBSs also abolish cell cycle repression and regulation (Hsiao et al., Genes Dev. 8424, 1526 (1994); et al., Genes Dev 8424, 1514 (1994), Zhu et al., Mol Cell. Biol 15, 3552 (1995), Ohtani et al., Mol. Cell. Biol. 16, 6977 (1996); Oswald et al., Mol Cell Cell Biol. 16, 1889 (1996)). The identification of several genes that are repressed by E2FBSs suggests that the repression of E2F-mediated transcription is a frequent mechanism of transcription regulated by the cell cycle. However, the repression mechanism of the B-myb gene deviates from all the proposed models for the action of E2F in that it requires a second element located directly downstream of the E2FBS (Bennet et al., Oncogene 13, 1073 (1996); Zwicker et al., Science 271, 1595 (1996)).

In addition, the occupation in the E2FBS cell of B-myb is regulated by the cell cycle and is observed only during repression phases (Zwicker et al., Science 271, 1595 (nineteen ninety six) ) . These observations are very similar to those made with other promoters, such as cdc25C, cdc2 and cycl ± n A, which are periodically repressed by two cooperating elements, the CDE similar to E2FBS and the adjacent CHR (Zwicker et al., EMBO J. 14, 4514 (1995)). The mechanism of transcription regulated by the cell cycle was discovered through the analysis of genes that are expressed in late stages of the cell cycle. When the cdc25C promoter was studied, which is regulated "up" in late S / G2, by mutational analysis and trending in vivo, a new repressor element was identified, the "dependent element of the cell cycle" (CDE) (Lucibello et al. al., EMBO J-14, 132 (1995)). The CDE is occupied in GQ-G-1 and its occupation is lost in G2, when cdc25C is expressed. Such CDE-mediated repression plays a role in the regulation of other promoters as demonstrated by the presence of functional CDEs in the cyclin A and cdc2 promoters that are derepressed in late G./S (Zwicker et al., EMBO J. 14, 4514 (1995)). These studies also led to the discovery of an additional element contiguous to the CDE, which is identical in the three promoters. This element was called "cell cycle gene homology region" (CHR) (Zwicker et al., EMBO J. 14, 4514 (1995)). Mutation of CDE or CHR in the cdc25C, cdc2 or cyclin A promoter largely abolishes repression in G2. These functional data were supported by the demonstration of G0-G specific protein binding; to the CDE and the CHR in the genomic tracing. Interestingly, the CDE is contacted in the greater cleft of the DNA while the binding to the CHR occurs in the minor cleft (Zwicker et al., EMBO J. 14, 4514 (1995)). The nucleotide sequence of CDE-CHR and its use for diagnosis, screening and gene therapy has already been claimed in WO 96/06943. The discovery that CHR cooperates with a CDE in the repression of promoters and the identification of CHR-like sequences adjacent to E2FBS in the B-i77y-b promoter, inspired detailed investigations into the mechanism of repression of B-myb. These studies indicated that the region similar to CHR is indispensable for repression and acts as a co-repressor element together with E2FBS (Bennett et al., Oncogene 13, 1073 (1996)). This region has been called Bmyb-CHR (Bennett et al., Oncogene 13, 1073 (1996)) or DRS (Bennett et al., Oncogene 13, 1073 (1996)). In addition, the genomic tracing clearly indicated a loss of occupation of the E2F site that is parallel to the derepression of B-myb in G. media (Zwicker et al., Science 271, 1595 (1996)). These observations indicated that E2F-CHR sites regulate gene transcription induced in late G1, similarly to how CDE-CHR sites lead to derepression of genes in S or G2. In addition, these findings indicate that the E2F repression sites differ from the sites of E2F activation by the absence of a contiguous CHR co-repressor element. Taken together, both E2F-mediated and CDE-mediated repression, which act at different stages in the cell cycle, depend on promoter-specific CHR elements (Liu, N. et al., Nucleic Acids Res. 24, 2905, No. 15). (nineteen ninety six) ) . The CDE is identical to the core sequences of E2FBS, as in the B-myb promoter (GGCGG) (Zwicker et al., EMBO J. 14, 4514 (1995)), but it is still escaping what determines the distinction of an E2FBS from a CDE. Furthermore, up to now no CDE or CDE-CHR binding activities have been identified, and the relationship of the factor or factors of CDE binding to the E2F family of transcription factors is unclear. Both repressor modules repress activation sequences located upstream of E2FBS-Bymb-CHR or CDE-CHR. The Bmyb-CHR element inhibits an upstream activating sequence in the early phase (phase G0 to Gx media), the CDE-CHR to a late phase (phase G0 to S) of the cell cycle. This finding led to the construction of genes that contain a non-cell-specific, cell-specific, virus-specific and / or metabolically-specific activating sequence, a cell-cycle specific promoter module such as CDE-CHR or E2FBS-Bmyb-CHR that controls the activation of the activating sequence, and a structural gene that encodes a therapeutic protein. Such artificial gene entities have been claimed for gene therapy of various diseases (see eg WO 96/06943, D196.05274.2, D196.17851.7, WO 96/06940, WO 96/06938, WO 96/06941 and WO). 96/06939). An objective of the present invention was to find new artificial nucleic acid entities with a different gene expression dependent on the cell cycle. Surprisingly it has been found that the factors involved in the repression of B-myb and the regulated promoters CDE-CHR are different. It is demonstrated that the B-myb gene is repressed by E2F complexes together with a CHR binding factor, while the cdc25C promoter is repressed by a new activity identified in the present invention and called CDE-CHR binding factor-l ( CDF-1). Subsequently, the interaction of CDF-1 with the repressor elements in several genes regulated by the cell cycle was analyzed. Using treading of DMS in vivo and in vitro, EMSA and functional assays of artificial luciferase promoters, it was possible to identify the following CDF-1 activity: (a) CDF-1 interacts cooperatively with CDE and CHR in the promoter cdc25C, which is in accordance with the occupation of the CDE dependent on CHR observed in the cell. (b) CDF-1 interacts with G residues in the CDE (major cleft) and with A residues in the CHR (minor cleft). This protection pattern is identical to that found by treading in vivo (Zwicker et al., EMBO J. 14, 4514 (1995)). (c) The binding of CDF-1 to sequences containing imitated CDE or CHR motifs correlates precisely with the function of such mutated elements in repression regulated by the cell cycle. (d) CDF-1 binds with efficacy similar to all known CDE-CHR regulated promoters, ie, cdc2? C, cdc2 and cyclin A, but only weakly with B-myb. (e) It could be demonstrated that CDF-1 binds CDE-CHR promoters of the cdc25C, cdc2 and cyclin A genes with equally high affinity, while the interaction with the E2FBS-CHR module of the B-myb promoter was comparatively weak . (f) E2F can not mediate repression through the CDE-CHR element of cdc25C and, vice versa, CDF-1 is unable to measure repression through E2FBS-Bmyb-CHR.

The CDF-1 protein can be isolated from nuclear extracts of HeLa suspension cultures by extraction with high salt content and purification by affinity chromatography, in the presence of motifs of the CDE-CHR sequence. Therefore, a first embodiment of the present invention concerns the CDF-1 protein obtainable by the following steps: (a) preparing a nuclear extract of HeLa cells, and (b) purifying the extract from step (a) by affinity chromatography in the presence of an oligonucleotide containing a motif of the CDE-CHR sequence, in particular in the presence of a motif containing the sequence GGCTG GCGGA AGGTT TGAAT, and in particular in the presence of a motif containing the sequence GGCTG GCGGA AGGTT TGAATGGCTG GCGGA AGGTT TGAAT.

In a particularly preferred embodiment, the oligonucleotide containing the sequence motif of CDE-CHR is coupled with agarose, e.g. ex. through streptavidin. In general, the nuclear extract according to step (a) is prepared by saline extraction of HeLa cells, in particular by extraction with high salt concentration, e.g. ex. according to Dignam, J.D. (1983) Nucleic Acids Res., 11, 1475-1489. The CDF-1 protein can be eluted from the chromatography column by stepwise increase of the salt concentration, e.g. ex. increasing the KCl concentration to 1 M. The CDF-1 protein is useful in particular for the identification of inhibitors or stimulators of CDF-1, in particular of the repressor function of CDF-1. Another result of the isolation and functional characterization of CDF-1 was the identification of nucleotides that are essential for the binding and repressor function of E2F / DP and CDF-l. In general, the binding was dependent on the presence of intact versions of the -CDE and CHR. The CDE consensus sequence could be defined as G / CGC / TGG / C (GGCGG in cdc25C; (Zwic-kler et al., EMBO J. 14, 4514 (1995)) and the CHR sequence of cdc25C as the TTTGAA sequence. Unlike the nucleotides in this region, the nucleotides between the CDE and the CHR (AAGG, see Tables 1, 2) and the nucleotides downstream from the CHR (TGG, see Tables 1, 2) can be altered without detectable effects on repressor function A similar pattern of specific interaction of the binding site was observed with partially purified CDF-1, the nucleotides in the E2FBS of B-myb and the CDE of cdc25C that are responsible for the discrimination between the binding of E2F and CDF-I are the nucleotides directly adjacent to the E2FBS / CDE nucleus (GGCGG), so the two nucleotides upstream (CT in B-myb) and one nucleotide downstream (G in B- and-) generally cause the binding of E2F, but not the binding of CDF-1, based on this finding, it was possible to test the unction of a mutant B-myb promoter with an intensely reduced E2F binding but with normal interaction with CDF-I, and demonstrate that the repression of this artificial entity is impaired. This data indicates that the interaction with E2F is in general essential, and that the binding of CDF-1 is insufficient to confer any regulation of the cell cycle in the B-myb promoter. The situation is very different for the cdc25C promoter repressed with CDE-CHR. In this case, no E2F binding is observed, and the intense interaction with CDF-I generally depends on the CHR. Thus, the E2F binding site is larger (i.e., at least 9 nucleotides) than the 5 nucleotide CDE (Zwickler et al., EMBO J. 14, 4514 (1995)), but does not include the CHR, whereas the CDF-1 binding site consists of the 5-nucleotide CDE and the 6-nucleotide CHR contiguous. So, it was possible to create promoters that possess the ability to interact with both E2F and CDF-I with high efficiency, either by changing the Bmyb-CHR to a cdc25C CHR (B-C4 see table 2) or by changing the flanking nucleotides of CDE of cdc25C to its counterparts of B-myb (see table 2, C-Bl, 2). Interestingly, these promoters showed new properties with respect to the timing of derepression during the cell cycle, in which a half-maximal activity was observed later than with B-myb but earlier than with cdc25C, that is, in the S early average. These observations indicate that the differential binding of E2F and CDF-1 contributes to regulation timing. In agreement with this observation, it was found that a mutant of the B-myb promoter showing preferential and intense binding of CDF-1 (see Table 2, B-C1,3,4) shows expression kinetics similar to cdc25C. Accordingly, another embodiment of the present invention is an artificial nucleic acid entity comprising: a) at least one activating sequence, b) at least one chimeric promoter module comprising a nucleotide sequence that binds to a protein of the E2F family and to a protein of the CDF-1 family; and c) at least one structural gene. wherein said chimeric promoter module produces an up-regulation of gene expression in the cell cycle later than the B-myb promoter but before the cdc25C promoter. In a preferred embodiment, the activating sequence is located upstream of the chimeric promoter module.

It has been found that the E2FBS-Bmyb-CHR promoter module of the B-myb gene (the positions of the mutations are underlined) ACTTGGCGGGAGATAGGAAA (Zwicker et al., Science 271: 1595 (1996)) mutated to ACTTGGCGGGAGATTTGAAT (SEQ ID NO: 1) comprises a high affinity E2F, as well as a CDF-1 binding site. The binding of E2F as well as that of CDF-1 to this nucleotide sequence in vivo (within the cell) is confined to the G0 and G- phases, and is undetectable in the S, G2 and M phases, and the nucleotide of ID. SEC. DO NOT. : 1 is very capable of repressing in the phase G0 and G. of the cell cycle the activity of an activating sequence (located upstream of SEQ ID NO: 1) to activate the transcription of a structural gene (located downstream) of SEQ ID NO: 1). It has also been found that the CDE-CHR promoter module of the cdc25C gene (the positions of the mutations are underlined) GGCTGGCGGAAGGTTTGAAT (EMBO J. 14, 4514 (1995)) mutated to GCTTGGCGGGAGGTTTGAAT (SEQ ID NO: 2) comprises a High affinity CDF-1 as well as an E2F binding site. The binding of CDF-I as well as E2F to this nucleotide sequence in vivo (within the cell) is confined to the G0 and Gx phases and is undetectable in the S, G and M phases and the ID. SEC. DO NOT. : 2 is very capable of repressing, in the G0 and Gx phase of the cell cycle, the activity of an activating sequence (located upstream of SEQ ID NO: 2) to activate the transcription of a structural gene (located in waters). below SEQ ID NO: 2). Accordingly, a preferred embodiment of the present invention relates to an artificial nucleic acid entity with a chimeric promoter module comprising at least one nucleotide sequence that is selected from the group consisting of ACTTGGCGGGAGATTTGAAT (SEQ ID NO: 1). ) and ACTTGGCGGGAGGTTTGAAT (SEQ ID NO: 2). In general, the promoter module interacts with the activating sequence, and said interaction affects the expression of the structural gene. The activator generally functions by means of non-specific, cell-specific, virus-specific and / or metabolic-specific activation of the basal transcript. The structural gene is generally expressed in a cell-specific manner, cell-specific and cell-cycle dependent, virus-specific and cell-cycle dependent and / or metabolically specific and cell-cycle dependent. The artificial nucleic acid entity according to the present invention preferably consists of DNA. The term "artificial nucleic acid entity", as used in the present text, means an artificial nucleic acid structure that can be transcribed in the target cells. Such an artificial entity can be inserted into a vector. Non-viral vectors, such as plasmid vectors, or viral vectors can be used. The type of vectors and the technique for inserting the artificial nucleic acid entity according to this invention are known to the person skilled in the art. An artificial nucleic acid body according to the invention does not occur in nature in the arrangement described by the present invention. In other words, the structural gene of the artificial nucleic acid entity does not combine naturally with the activating sequence and the chimeric promoter module. Another embodiment of the present invention relates to a cell comprising an artificial nucleic acid entity or a vector of the present invention. An artificial nucleic acid body according to the invention makes it possible for a structural gene to experience specific expression of the cell cycle or specific expression of the cell and the cell cycle, or specific to the virus and the cell cycle, or specific metabolic and cell cycle. In a preferred embodiment, the structural gene is a gene encoding a pharmacologically active substance. In another preferred embodiment, the structural gene encodes an enzyme that cleaves an inactive precursor of a pharmaceutical product to a pharmaceutical product ("prodrug" in drug). Examples of such pharmaceutical pharmaceutical precursor are described in Sedlacek et al., Contrib. to Oncol. 43, Karger Verlag (1992); Hay et al., Drugs of the Future 21, 917 (1996). The "activating sequence" means a sequence of nucleotides that is part of a gene and to which regulatory proteins, called transcription factors, can bind and, as a result of that binding, activate the transcription of the structural gene that is located downstream. . The regions designated as "downstream" sequences are those located in the direction of the transcript, while the sequences arranged in the opposite direction are referred to as "upstream" sequences. In one embodiment of the present invention, the activating sequence may be non-specific, cell-specific or virus-specific or metabolic specific. As used herein, "cell-specific" means that the activating sequence is chosen from a gene that encodes a protein that is specifically expressed in a given cell, and "virus-specific" means that the activating sequence it is chosen from a viral gene; "Metabolic specific" means that the activating sequence is chosen from a gene that encodes a protein that is specifically expressed under defined metabolic conditions. Thus, in another preferred embodiment, the activating sequence is chosen from the group of promoters or enhancers that activate transcription in endothelial cells, serous cells, smooth muscle cells, synovial cells, hematopoietic cells, macrophages, lymphocytes, leukemic cells , tumor cells or keratinocyte cells, glial cells, or promoter sequences or intensifying sequences of the HBV, HCV, HSV, HPV, EBV, HTLV, CMV, SV40 O HIV viruses. Examples of cell-specific, virus-specific activating sequences and metabolic specific sequences are described in WO 96/06940, WO 96/06938, WO 96/06941 and WO 96/05994. The activating sequence can be a promoter or an enhancer. The chimeric promoter module according to this invention comprises a binding site for a protein of the E2F family as well as CDF-I. Examples for such promoter modules are ID. SEC. NO .: 1 and ID. SEC. NO .: 2. In a preferred embodiment of this invention, this chimeric promoter module is located downstream of the activating sequence. In another preferred embodiment of this invention, the promoter module can be combined with the activator sequence according to the technology described in D196.17851.7. In this patent application several examples are described for combining several promoters. An example is the promoter response unit to the activator. It consists of two different activating subunits, A and B. The expression products of A and B are fused together and thus form a transcription factor that activates a promoter response to the activator. The expression of the activating subunits A and B is under the control of a promoter for A and a promoter for B. These promoters can be identical or different. In another preferred embodiment of this invention, the chimeric promoter module can be combined with a second promoter to be chosen from a series of promoters, comprising non-specifically activatable, strong promoters such as the RNA polymerase III promoter, RNA polymerase II promoter, promoter e CMV intensifier and / or SV40 promoter; or a viral and / or activating promoter sequence such as the activating sequence of HBV, HCV, HSV, HPV, EBV, HTLV and / or HIV; or metabolically activatable enhancer or promoter sequences, e.g. ex. an enhancer or promoter inducible by hypoxia; or another specific promoter of the cell cycle, p. ex. the promoter of the cdc25C gene, cyclin A gene, cdc2 gene, the B- and b gene, the DHFR gene or the E2F-1 gene; or a promoter activatable by tetracycline, e.g. ex. the tetracycline operator in combination with the corresponding repressor; or a cell-specific activatable promoter; to these promoters belong activation sequences upstream of such genes that encode proteins expressed predominantly or exclusively in the type of cell chosen. The artificial nucleic acid entities of the present invention can be used in genetic engineering and, in particular, in gene therapy. In gene therapy, the genes that are intended to be expressed in the body are introduced into the body. The regulation of the expression of these genes is important for the therapeutic effect of gene therapy. The present invention therefore also relates to artificial nucleic acid entities that can be used in gene therapy. Gene therapy techniques are well known to those skilled in the art. For example, WO 93/24640 and WO 95/11984 describe methods and compositions for gene therapy in vivo with a viral or non-viral vector technology. In another example, WO 95/06743 describes a method by which therapeutic artificial nucleic acid bodies are introduced into epithelial cells of the respiratory tract isolated from a patient, by transformation with a viral vector (AAV) containing a artificial entity. The transformed cells are then administered to the patient. In addition, FR 2735789 discloses pharmaceutical compositions containing a recombinant adenovirus. The technologies for the various non-viral vectors that can be used as vehicles for the artificial entities of this invention and applied to cells in vitro, or injected or applied in vivo to patients, are equally well known to the experts. In a preferred embodiment, the artificial nucleic acid entity can be used for cell-specific expression and regulated by the cell cycle of at least one structural gene. In another preferred embodiment, the artificial nucleic acid entity can be used for virus-specific expression and regulated by the cell cycle of at least one structural gene. In yet another preferred embodiment, the artificial nucleic acid entity can be used for a specific metabolic expression and regulated by the cell cycle of at least one structural gene. The artificial nucleic acid entity or the cell according to the present invention is preferably used in the treatment of a disorder that is characterized by, or associated with, cell proliferation. Such treatment comprises, e.g. ex. , the introduction of said artificial nucleic acid entity into a target cell. Examples of disorders characterized by or associated with cell proliferation are tumor diseases, leukemias, cardiovascular diseases, inflammatory reactions, autoimmune reactions, allergies, arthritis, psoriasis, imminent rejection of transplanted organs, damage to the CNS, infectious diseases, disorders of blood coagulation and chronic viral infections. Such diseases can be treated by systemic or local application of the artificial entities or cells of the present invention. The expression of such artificial entities in the corresponding proliferating cell population can be controlled by the cell-specific, metabolic-specific or virus-specific activating sequence and the cell cycle-specific promoter module. The expression product of the artificial body of the invention can directly or indirectly inhibit the proliferation of the cell or kill the proliferating cells. By virtue of the structure of the artificial entity, it can be expressed during the stage of cellular proliferation.

For the treatment of other disorders, the activating sequence and the structural gene for the active substance in the artificial nucleic acid entities according to the present invention are chosen depending on their intended end use. In general, the structural gene encodes a substance that is selected from the group consisting of a cytokine, a growth factor, a cytokine receptor, a growth factor receptor, a protein that has an anti-proliferative effect, a protein that it has an apoptotic effect, a protein that has a cytostatic effect, a protein that has a cytotoxic effect, a protein that has an inflammatory effect, a protein that has an anti-inflammatory effect, a protein that has an immunosuppressive effect, an antibody, an antibody fragment, an inhibitor of angiogenesis, a coagulation factor, a fibrinolytic compound and an anticoagulant, a blood protein, a viral antigen, a bacterial antigen and a tumor antigen and a fusion protein between a ligand such as a factor of growth, a cytokine or an antibody, and one of the substances mentioned above. In this aspect, the invention comprises the following artificial entities and therapeutic methods. 1. Tumor therapy and chronic inflammation by inhibiting the proliferation of endothelial cells.

Tumors, like chronic inflammations, are characterized by the formation of new blood vessels by proliferating endothelial cells. In one embodiment, such proliferating endothelial cells are the target cells to be transduced by the artificial entities of this invention to express a protein that directly or indirectly inhibits the proliferation of endothelial cells and / or kills proliferating endothelial cells and cells. adjacent tumor cells. 1. Activated sequences activated in endothelial cells. In one embodiment, activating sequences activated in endothelial cells include the regulatory sequences of genes and promoter elements for genes encoding proteins that are detectable in particular in endothelial cells. Examples of these endothelial cell-specific proteins and promoter sequences of their genes are described in WO 96/06940. These promoters include promoter or promoter sequences of genes that encode the brain-specific endothelial glucose-1 transporter, Endoglin, VEGF receptor-l (flt-1), VEGF receptor-2 (flk-1, KDR), -l or tie-2, B6l receptor (Eck receptor), B61, Endothelin, p. ex. Endothelin B or Endothelin-1, Endothelin receptor, especially the Endothelin B receptor, mañosa-6-phosphate receptors, von Willebrand factor, IL-la receptor, IL-lß, Il-l, vascular cell adhesion molecule ( VCAM-1), synthetic activating sequences, p. ex. activating sequences comprising and / or binding 5'-TTATCT-3 'the transcription factor GATA-2 1. 2 Activated sequences activated in cells adjacent to activated endothelial cells. When the endothelial cells are proliferating, the adjacent cells become accessible to macromolecules of the blood due to "tight junctions". These functional and anatomical interrelationships mean that cells in the vicinity of activated endothelial cells are target cells for the purpose of this invention. Examples of activating sequences that are activated in adjacent cells are described in WO 96/06940. Activators or promoters belong to promoters or activating sequences of genes that encode VEGF. The gene regulatory sequences for the VEGF gene are the 5 'flanking region or the 3' flanking region or the c-Src gene or the v-Src gene. Other examples are receptors for steoroid hormone and its promoter elements (Truss and Beato, Enocrin, Rev. 14, 459 (1993)), especially the murine mammary tumor virus promoter. 1. 3 Structural genes for substances with anti-tumor or anti-inflammatory activity. An "anti-inflammatory" substance may have one or more of the following characteristics: inhibition of endothelial cell proliferation, inhibition of angiogenesis, thrombus formulation, cytostatic or cytotoxic properties, ability to induce apoptosis or the ability to convert a prodrug into an active drug with cytotoxic, cytostatic or anti-inflammatory properties. As used in this application, an "antitumor" substance may have one or more of the preceding properties. In addition, an "antitumor" substance can be a substance that induces inflammation. Examples of these substances and their genes are described in WO 96/06940, WO 96/06941 and D19617851.7. The genes encoding these substances are, for example, structural genes for inhibitors of cell proliferation, e.g. ex. for the retinoblastoma protein (pRB = pll0) or the related protein pl07 and pl30, the p53 protein, the p21 protein (WAF-1), the p66 protein, other cdk inhibitors, the GADD45 protein or the bak protein. The retinoblastoma protein (pRb = 110) and related proteins pl07 and p30 are deactivated by phosphorylation; the genes of these cell cycle inhibitors containing mutations for the inactivation sites of the expressed proteins are preferred, but without impairing the function of these inhibitors. Other examples are structural genes of factors that induce thrombosis and / or angiogenesis inhibitors, e.g. ex. for plasminogen activator inhibitor-1 (PAI-1), PAl-2, PAI-3, angiostatin, interferons, p. ex. iFNa, iFNβ, IFN ?, platelet factor 4, IL-12, TIMP-1, TIMP-2, TIMP-3, leukemia inhibitory factor (LIF) or tissue factor (TF) and its active fragments. Other examples are structural genes for cytostatic or cytotoxic proteins, e.g. ex. for perforin, granzyme, IL-2, IL-4, IL-12, interferons, p. ex. iFNa, IFNß, iFN ?, TNF, TNFa, TNFβ, oncostatin M, sphingomyelinase or magainin and magainin derivatives. 1. 4 Structural genes for cytostatic or cytotoxic antibodies, fragments of antibodies and for fusion proteins between antigen-binding antibodies or fragments of antibodies and enzymes or cytostatic, cytotoxic or inflammatory proteins.

Cytostatic or cytotoxic antibodies belong to those directed against membranous structures or endothelial cells or in tumor cells or leukemia. Such antibodies were described, for example, by Sedlacek et al., Contrib. to Oncol. 32, Karger Verlag, Munich (1988) and Contrib. to Oncol. 43, Karger Verlag, Munich (1992). Other examples are antibodies specific for Sialyl Lewis, peptides in tumors that are recognized by T lymphocytes, proteins expressed by oncogenes, gangliosides, e.g. e. GD3, GD2, GM, 9-0-acetyl GD3, fucosyl GMl, blood group antigens and their precursors, antigens in polymorphic epithelial mucin, antigens in heat shock proteins or CD13, CD15, CD33, CAMAL, CD5, CDlc, CD23 , idiotypes and isotypes of membrane immunoglobulins, CD33, M38, IL-2 receptors, cell-T receptors, CALLA, CD19 or non-Hodgkin's lymphoma. 1. 5 Structural genes for fusion proteins between target cell binding ligands and cytostatic or cytostatic enzymes or proteins. To such ligands belong all the proteins that bind to the cell membrane of endothelial cells, e.g. ex. growth factors or fragments of growth factors such as PDGF, bFGF, VEGF, TGFβ. In addition, such ligands include adhesion molecules that bind to activated and / or proliferating en-endothelial cells, e.g. ex. , Slex, LFA-1, MAC-1, LECAM-1, VLA-4 or vitronectin. In addition, such ligands include compounds that bind to the cell membrane or membrane receptors of tumor or leukemic cells, e.g. ex. growth factors or fragments of growth factors. Such growth factors were already described by Cross et al., Cell 64, 271 (1991), Aulitzky et al., Drugs 48, 667 (1994), Moore, Clin. Cancer Res. 1, 3 (1995), Van Kooten et al., Leuk. Ly ph. 12, 27 (1993)). 1. 6 Structural genes for inflammation inducers. The structural genes for inflammation inducers belong such as RANTES (MCP-2), monocyte activating and qui-myotactic factor (MCAF), IL-8, macrophage inflammatory protein-1 (MIP-1, -β), protein -2 neutrophil activator (NAP-2), IL-3, IL-5, human leukemia inhibitory factor (LIF), L-7, IL-11, IL-13, GM-CSF, G-CSF , M-CSF, Cobra venu factor (FVC) or FVC sequences that functionally corresponds to the human complement factor C3b, human complement factor C3 or C3b sequences, segmentation products of human complement factors C3 that are functionally and structurally similar to FVC or bacterial proteins that activate the complement or induce inflammation, e.g. ex. porins of Salmonella typhi murium, factors of "agglutination" of Staphylococcus aureus, modulins of gram-negative bacteria, "major outer membrane protein" of legionella or of haemophilius influenza type B or of Klebsiella, or M molecules of Streptococcusm group G. i .7 Structural genes for enzymes that convert a prodrug into a drug. A structural genes for enzymes that p. ex. convert or segment prodrugs by giving active cytostatic substances belong, for example, enzymes such as Herpes simplex virus thymidine kinase, varicella zoster virus thymidine kinase, bacterial nitroreductase, bacterium-β-glucuronidase, Sécale cereale β-glucuronidase, human β-glucuronidase, carboxy Human peptide (CB), p. ex. CB-A from ceda cells, CB-B from the pancreas, bacterial carboxy peptidase, bacterial β-lactamase, bacterial cytosine deaminase, phosphatase, p. ex. human alkaline phosphatase, human prostate acid phosphatase, acid phosphatase type 5, p. ex. human lysyl oxidase, human D-amino oxidase, peroxidase, p. ex. glutathione human peroxidase, human eosinophil peroxidase, human thyroid peroxidase or galactosidase. 2. Active substance to remedy the deficient production of blood cells. 2. 1 Selection of the activating sequence for hematopoietic cells. The activator sequence used for hematopoietic cells can be a gene regulatory sequence or an element of a gene that encodes a protein that is expressed in a particularly intense or selective manner in hematopoietic cells. Regulatory sequences of genes of this type include promoter sequences for genes of a cytokine or its receptor, which expression in immature hematopoietic cells or in adjacent cells, such as, for example, stromal cells of the bone marrow, precedes the subsequent cytokine that acts on the hematopoietic cells and is required as an active substance. Cytokines of this type that act on immature hematopoietic cells are, for example, such as the stem cell factor, IL-1, IL-3, IL-6, GM-CSF or thrombocytopoietin or receptors of these cytokines. References for such cytokines are given in WO 96/06941. To these activating sequences belong the promoter sequence of the p gene. ex. the stem cell factor receptor, stem cell factor, IL-la, IL-1 receptor, IL-3, IL-3 receptor (a subunit), IL-3 receptor (beta subunit), IL-6 , IL-6 receptor, GM-CSF, GM-CSF receptor (a chain), interferon-regulating factor-1 (IRF-1), erythropoietin or erythropoietin receptor. In another preferred embodiment, the activating sequence may be metabolic specific. Examples of metabolically activatable activator sequences (e.g., by hypoxia) were described by Semenza et al., PNAS 88, 5680 (1991) or Me Burney et al., Nucí. Acids Res. 19, 5755 (1991). 2. 2 Selection of structural genes for active substance for hematopoietic cells. An "active substance for hematopoietic cells" generally means a protein that effects proliferation and / or differentiation of blood cells. Examples of genes for such a substance are disclosed in WO 96/06941. To these belong structural genes for the therapy of anemia, p. ex. for erythropoietin, structural genes for the therapy of leukopenia, p. ex. for G-CSF, GM-CSF, structural genes for the therapy of thrombocytopenia, p. ex. for IL-3, leukemia inhibitory factor (LIF), IL-11 or thrombopoietin. 3. Active substance for the therapy of autoimmune diseases, allergies, inflammations and to prevent the rejection of organs. 3. 1 Selection of the activating sequence. Activating sequences that can be used are the promoter sequences of strongly activated genes in macrophages or lymphocytes or of genes for proteins that are produced extensively during the immune response in acrophages and / or in lymphocytes. Examples of gene promoter sequences encoding such proteins are described in WO 96/06941. These proteins include the IL-1 receptor, IL-Ia, IL-Iß, IL-2, IL-2 receptor, IL-3, IL-3 receptor (subunit a), IL-3 receptor (subunit) ß), IL-4, IL-4 receptor, IL-5, IL-6, interferon regulatory factor 1 (IRF-1), IFN response promoter, IL-7, IL-8, IL-10, IL-11, GM-CSF, GM-CSF receptor (a chain), IL-13, LIF, macrophage colony stimulation factor receptor (M-CSF), type I and II macrophage eliminating receptors , MAC-l (leukocyte function antigen), LFA-la (leukocyte function antigen) or pl50.95 (leukocyte function antigen). 3. 2 Selection of genes for active substances. The active substance for this purpose may be the DNA sequence for a cytokine, a chemokine, a growth factor or one of its inhibitors, the extracellular portion of a receptor for a cytokine or growth factor, an antibody, an antibody fragment. , an enzyme inhibitor or an enzyme. The choice of the active substance depends on the basic disorder to be treated and on the promoter sequence chosen. Examples for the selection of a structural gene suitable for the treatment of autoimmune diseases, allergy, inflammation, or for the prevention of organ rejection are given in WO 96/06941. To these examples belong p. ex. structural genes for allergy therapy, p. ex. encode IFNβ, FN ?, IL-10, antibodies or fragments of antibodies specific for IL-4, soluble IL-4 receptors, IL-12 or TGFβ. Structural genes to prevent rejection of transplanted organs, p. ex. encode IL-10, TGFβ, soluble IL-1 receptors, soluble IL-2 receptors, IL-1 receptor antagonists, soluble IL-6 receptors, immunosuppressive antibodies or fragments containing VH and VL fragments of these antibodies or VH fragments. and VL conjugated by a linker. The antibodies are specific for the T cell receptor or its CD3 complex, against CD4 or CD8, against the IL-2 receptor, IL-1 receptor or IL-4 receptor or against adhesion molecules CD2, LFA-1 , CD28 or CD40. Structural genes for the therapy of autoimmune diseases mediated by antibodies, p. ex. encode TGFβ, iFNα, iFNβ, iFNα, IL-12, soluble IL-4 receptors, soluble IL-6 receptors or immunosuppressive antibodies or their fragments containing VH and VL.

Structural genes for the therapy of cell-mediated autoimmune diseases, p. ex. they encode IL-6, IL-9, IL-10, IL-13, TNFa, IL-4, TNFβ or an immunosuppressant antibody or its fragments containing VH and VL. The structural genes encode inhibitors of cell proliferation, cytostatic or cytotoxic proteins or enzymes for the conversion or activation of prodrugs in cytostatic or fusion proteins may be the same as the structural genes for tumor therapy. 4. Active substance for the treatment of arthritis. 4. 1 Selection of the activating sequence for arthritis. The activating sequence generally means a promoter or enhancer sequence with which transcription factors are formed or actively interacts, e.g. ex. , in synovial cells and inflammatory cells. For the purposes of this invention, preferred promoter sequences include gene regulatory sequences and gene elements that encode proteins that are expressed in particular in synovial cells and inflammatory cells. Examples of such proteins are outlined in WO 96/06941. These proteins belong to p. ex. MMP-1 (interstitial collagenase), MMP-3 (estrus elisine / transin) or tissue inhibitors of me-taloproteinases (TIMP), p. ex. TlMP-1, TIMP-2 or TIMP-3. 4. 2 Selection of structural genes for active substances for arthritis. The active substance for this purpose generally means a DNA sequence whose expressed protein directly or indirectly inhibits inflammation, for example in the joint, and / or promotes the reconstitution of the extracellular matrix such as cartilage and / or connective tissue in the joint. Examples of such proteins are given in WO 96/06941. These proteins belong to p. ex. the IL-1 receptor antagonist, soluble? L-l receptor, IL-6, soluble TNF receptor, IL-4, IL-10, insulin-like growth factor, TGFβ, superoxide dismutase or TIMP, p. ex. TIMP-1, TIMP-2 OR TIMP-3.

. Anti-infective substance In general, the active substance can be prepared in two fundamentally different ways: for the therapy of viral infections and invasions by parasites or for the prophylaxis of infectious diseases due to viruses, bacteria or parasites. Vaccines are generally used for the prophylaxis of infectious diseases. However, the possibilities of preparing effective vaccines by conventional means are limited. Thus, DNA vaccine technology has been developed. However, these DNA vaccines raise questions about safety and side effects (Fy-nan et al., Int. J. Immunopharm., 17, 79 (1995); Donnelly et al., Immunol., 2, 20 (1994). ). The following artificial entities for the prophylaxis of infectious diseases can be distinguished from prior art substances by their cellular specificity and cell cycle regulation which provides a high degree of safety to these substances. . 1 Selection of the activating sequence. . 1.1 Therapy of infectious diseases. The activating sequence that can be chosen for the therapy of infectious diseases comprises promoter sequences of cellular genes whose activity is altered in particular by infections with bacteria or parasites, or the promoter sequences to be chosen are those of viruses that transform the infected cells by they and stimulate proliferation. These viruses include, for example, HBV, HCV, HSV, HPV, HIV, EBV and HTLV. Examples of such activating sequences are described in WO 96/06941. . 1.2 Prophylaxis of infectious diseases. The activating sequence that can be chosen for the prophylaxis of infectious diseases comprises promoter sequences that are generally strongly activated in endothelial cells, muscle cells, lymphocytes or macrophages or that belong to cellular genes that encode proteins that are generally highly expressed in endothelial cells , muscle cells, macrophages or lymphocytes. Examples of these activating sequences are given in the preceding and following chapters. . 2 Selection of structural genes for active substances. . 2.1 Infectious disease therapy. The active substance that can be selected is the DNA for a protein that has cytostatic, cytotoxic, antibacterial or antiviral effects, or that can be an enzyme that transforms the inactive precursor into a cytostatic, cytotoxic, antibacterial or antiviral drug. Examples of cytotoxic or cytostatic proteins and cytokines and growth factors with antiviral activity were described in WO 96/06941. These substances include, for example, active antiviral cytokines and growth factors, e.g. ex. IFNa, IFNß, IFN ?, TNFβ, TNFα, IL-1 or TGFβ. Other examples are antibodies that deactivate a specific virus or fragments thereof containing VH and VL or their VH and VL fragments conjugated by a linker. Examples of antiviral antibodies are antibodies specific for HBV, HCV, HSV, HPV, HIV, EBV, HTLV, Coxsackie virus or Hantaan virus. Other examples are a rev binding protein, e.g. ex. , RBP9-27, RBP1-8U, RBP1-8D or pseudogene of RBP1-8. These substances also belong to p. ex. a ribozyme that catalyzes the mRNA of genes for control proteins of the cell cycle or the mRNA of the respective virus or structural genes for antibacterial proteins, p. ex. anti-bodies that neutralize bacterial toxins or opsonize bacteria, p. ex. specific antibodies for meningococcal C or B, E. coli, borrelia, pseudomonas, Helicobacter pylori or Staphylococcus aureus. Antibodies or antibody fragments are exemplary antibacterial or antiviral proteins. As noted above, for some substances the enzymatic conversion of a precursor in the active form may be required. In such a case, the antibacterial, antiviral, cytotoxic or antiparasitic substance is added after an artificial entity according to the invention has already been administered. Examples for enzymes converting such prodrugs and genes for such enzymes were described in WO 96/06940 and WO 96/06941 and in the preceding chapter. . 2.2 Prophylaxis of infectious diseases. In one embodiment, the active substance can be an antibody or an antibody fragment specific for the pathogen. In another embodiment, the active substance can be a protein that is formed by the pathogen and that leads, through an immune response, ie by binding of antibody and / or by cytotoxic lymphocytes, to neutralization and / or death of the pathogen. Neutralizing agents of this type are already being used as immunization antigens (see review by Ellis, Adv. Exp. Med. Biol. 327, 263 (1992)). The DNA sequences encoding such proteins are used to prepare artificial bodies according to the invention. Examples of those genes were described in WO 96/06941, p. ex. , genes encoding the influenza A virus antigen, HIV antigens, rabies virus antigen, HSV antigen (Herpes simplex virus), RSV antigen (respiratory syncytial virus), parainfluenza virus antigen, antigen of rotavirus, VZV antigen (varicella zoster virus), CMV antigen (cytomegalovirus), measles virus antigen, HPV antigen (human papilloma virus), HBV antigen (hepatitis B virus), HCV antigen ( hepatitis C virus), HDV antigen (hepatitis D virus), HEV antigen (hepatitis E virus), HAV antigen (hepatitis A virus), vibrio cholera antigen, Borrelia antigen Burgdorferi, Helicobacter pylori antigen, antigen of malaria or an anti-idiotype antibody or its antibody binding fragments, whose complementary determining regions are copies of the protein or carbohydrate structure of the neutralizing antigen of the infectious organism. 6. Active substance for the treatment of leukemias and tumors. 6. 1 Selection of the activating sequence for leukemia and tumors. The activating sequence provided may be a promoter or enhancer sequence with which active or active transcription factors interact in leukemic or tumor cells. However, for the purposes of this invention, the preferred activating sequences include regulatory sequences of genes and gene elements that encode proteins formed in particular in tumor cells or leukemic cells. Examples are cited in WO 96/06941, p. ex. promoters of genes encoding c-myc, HPS-70, bcl-1 / cyclin D-1, bcl-2, IL-6, IL-10, NFa, TNFβ, HOX-11, BCR-Abl, E2A-PBX- 1, PML-RATA (promyelocytic leukemia receptor - retinoic acid), c-myc, N-CAM proteins, hepatitis growth factor receptor, L-plastin or polymorphic epithelial mucin (PEM). 6. 2 Selection of structural genes for active substances for leukemia and tumor cells. The active substance for this purpose generally means a protein that inhibits the proliferation of cells, in particular also of tumor cells or leukemic cells. These inhibitors of cell proliferation include, for example, DNA sequences for inhibitory, cytostatic, apoptotic and cytotoxic proteins and enzymes for cleavage of prodrugs that have already been described. An inhibitor of cell proliferation further means a DNA sequence that expresses a protein that, directly or indirectly, has a cytostatic or cytotoxic effect on leukemias or tumors. Such proteins have already been described in the preceding chapters. The DNA sequences encoding such proteins can be used to prepare artificial bodies according to the present invention. An inhibitor of cell proliferation, furthermore, generally means a DNA sequence encoding proteins or peptides that induce a humoral or cellular, cytotoxic or cytostatic immune response to the tumor. To such proteins or peptides belong p. ex. structural genes for tumor vaccines. They belong to antigens in tumor cells. For example, such antigens were reviewed by Sedlacek et al. , Contrib. to Oncol. 32, Karger Verlag, Munich (1988) and Contrib. to Oncol. 43, Karger Verlag, Munich (1992). Additional examples are antigens or genes encoding Sialyl Lewis, peptides in tumor cells recognizable by T cells, proteins expressed by oncogenes, blood group antigens and their precursors, polymorphic epithelial mucin antigens or heat shock proteins. 7. Active substance to inhibit the proliferation of smooth muscle cells in vascular occlusions. 7. 1 Selection of the activating sequence for smooth muscle cells. In one embodiment, the activating sequences may be regulatory sequences of genes or gene elements that encode proteins that are formed particularly in smooth muscle cells. Examples of promoters of genes encoding such proteins are described in WO 96/06938 and WO 96/06940. These include tropomyosin, α-actin, α-myosin, receptor for PDGF, receptor for FGF, MRF-4, phosphofructokinase A, troponin C, iogenin, receptors for endothelin A, desmin, VEGF or artificial promoters. In addition, factors of the Helix-Loop-Helix family (HLH) (helix-loop-helix) (MyoD, Myf-5, MRF4 myogens) and the Zinkfinger protein GATA-4 are described as muscle-specific transcriptional activators. The HLH proteins as well as GATA-4 show muscle-specific transcription not only with promoters of muscle-specific genes but also in a heterologous context, e.g. ex. with artificial promoters. Such artificial promoters are for example: multiple copies of (eg 4x) 5 '-AGCAGGTGTTGGGAGGC-3' (SEQ ID NO: 3) or multiple copies of 5'-GGCCGATGGGCAGATAGAGGG-GGCCGATGGGCAGATAGAGG-3 '(ID. SEC. NO .: 4). 7. 2 Selection of structural genes for active substances for smooth muscle cells. The active substance for this purpose means gene-rally a protein that inhibits the proliferation of smooth muscle cells. Examples of these proliferation inhibitors were already described in the preceding chapters. 8. Active substance to inhibit or activate coagulation. 8. 1 Selection of the activating sequence to inhibit or activate coagulation. The activating sequences to be used for this purpose can generally be gene regulatory sequences or gene elements encoding proteins detectable in smooth muscle cells, in activated endothelial cells, in activated macrophages or in activated lymphocytes. 8. 1.1 Cells of the smooth muscle. Examples of promoter sequences for genes in smooth muscle cells have already been mentioned in WO96 / 06938 and in the preceding chapter. 8. 1.2 Activated endothelial cells or cells adjacent to activated endothelial cells. Examples of proteins that are formed particularly in activated endothelial cells have already been described in documents O 96/06938 and WO 96/06940 and in the preceding chapters. 8. 1.3 Activated macrophages and / or activated lymphocytes. An activating sequence for this purpose generally means a promoter sequence from a gene encoding a protein that is formed extensively during the immune response in macrophages and / or lymphocytes. Examples have already been described in WO96 / 06941 and WO96 / 06938 and in the preceding chapters. 8. 2 Selection of structural genes for active substances to inhibit or activate coagulation or to modulate the cardiovascular system. In one embodiment, the active substance to be used for this purpose may be a protein that inhibits, directly or indirectly, platelet aggregation or a clotting factor, or stimulates fibrinolysis. Thus, an active substance of this type is called an anticoagulant. The anticoagulants to be used are genes, for example, for plasminogen activators (PA), for example tissue PA (tPA) or urokinase-like PA (uPA) or hybrids of tPA and uPA or protein C, antithrombin III, C-1S inhibitor , antitrypsin, the tissue factor route inhibitor (TFPI) or hirudin. In another embodiment, the active substance to be used for this purpose may also be a protein that promotes blood coagulation. Examples of such proteins are, for example, blood plasma proteins such as factor VIII, factor IX, von Willebrand factor, F XIII, PAI-1 or PAI-2.

In a third embodiment the active substance to be used for this purpose can also be a protein that modulates the cardiovascular system by inducing angiogenesis or lowering blood pressure. Examples of genes encoding such proteins are factors of angiogenesis, e.g. ex. VEGF or FGF or peptides to reduce blood pressure, p. ex. ca-lyrein or "nitric oxide synthetase" of the endothelial cell.

In a further embodiment the active substance to be used for this purpose may be a gene encoding a blood protein. Examples of such blood proteins are albumin, Cl inactivator, serum cholinesterase, transferrin or 1-antitrypsin. 9. Active substance for protection against CNS damage. 9. l Activating sequences for an active substance for protection against CNS damage. 9. 1.1 Activated sequences activated in endothelial cells. In one embodiment, this type of activator may include the promoter sequences for specific protein genes for endothelial cells. Examples of these promoter sequences are set forth in WO 96/06939 and have already been described in the preceding chapters. 9. 1.2 Activated sequences activated in glial cells. A preferred activating sequence is a promoter or enhancer sequence with which transcription factors formed or active to a particular degree interact in glial cells. Examples of these activating sequences are disclosed in WO 96/06939. They belong to pro-motors of genes that encode the specific protein of the Schwann cells periaxin, glutaminsintetase, the glial cell-specific protein (glial fibrillary acidic protein = GFAP), the glial cell protein SlOOb, IL-6 (CNTF) , receptor of 5-HT, TNFa, IL-10, receptor I and II of the insulin-like growth factor or VEGF. 9. 2 Choice of structural genes for neuro-specific factors. A "neurospecific factor" for the purpose of the present invention may be a DNA sequence encoding a neuronal growth factor or an inhibitor or suppressor of TNFa. Examples of these genes are disclosed in WO 96/06939. These include genes encoding FGF, nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), ciliary neurotrophic factor (CNTF), TGFβ, soluble TNF receptors, IL-10, soluble II-1 receptors, IL-1 receptor I, IL-1 receptor II, IL-1 receptor antagonist or soluble IL-6 receptors. The artificial entities according to the present invention are applied or injected preferably into damaged tissues, in the area of damaged nerves or in the spinal cord or in the brain to transduce endothelial cells or glial cells to express the therapeutic protein.

. Therapeutic use.

As an example, an artificial entity of those described in the sections set forth above may be administered to a patient in need of treatment of a disease, for example a tumor, a leukemia, an inflammatory disorder, a disorder characterized by an excess of cell proliferation. endothelial cells, a deficient production of blood cells, an autoimmune disease, an allergy, an imminent rejection of a transplanted organ, an arthritis, an infection, a coagulation disorder or damage to the CNS.

For administration, the described artificial entity can be inserted into a plasmid vector or viral vector according to the technology well known to the expert. The vector can be applied to the patient locally or be injected. In the cardiovascular system, by intrapleural, intraperitoneal, intracerebroespinal, intravesical, intrabronchial, intragastrointestinal, or injected into one of the different tissues or organs. In case the structural gene of the artificial entity encodes an enzyme that cleaves or transforms a non-toxic prodrug and is not effective to give an effective drug, this prodrug is applied to the patient after injection of the artificial entity of this invention. The present invention is explained in more detail by means of the examples and tables that follow, which illustrate the scope of the invention, without limiting it.

Description of the Tables.

Table i Structure-function analysis of the CHR of cdc25. Mutations of the artificial entities of the cdc25C promoter (based on C290; Zwicker et al., EMBO J. 14, 4514 (1995)) in the CHR region were analyzed for cell cycle regulation in NIH3T3 cells. The positions -16 to -12 represent the CDE defined above (Zwicker et al., EMBO J. 14, 4514 (1995)). The results of transient luciferase assays are expressed as the ratio of RLUs observed with growing cells relative to activity in resting cells. The results shown in the table summarize the data from 4 independent experiments using at least two independent plasmid DNA preparations. The values represent averages; in all cases the typical deviations were not greater than ± 1.5. A SV40 reporter plasmid was included in each experiment to standardize the induction factor (the SV40 reporter typically gave a 1.5-fold higher value in growing cells compared to resting cells).

Table 2 Effects of specific nucleotide exchanges between the E2FBS-CHR module of B-myb and the CDE-CHR motif of cdc2? C on cell cycle regulation and DNA binding of E2F complements and CDF-1. The repressor modules B-myb and cdc25C are shown at the top. Five positions in which the sequences differ from each other were designated region 1-5. Each of the mutants indicated below hosts specific exchanges between the two promoters on a pro-motor base B-myb (upper block) or cdc25C (lower block). The "B" and "C" indicate whether the particular mutant contains nucleotides of cdc25C (C) or B-myb (B) in regions 1-5 (eg B-Cl is a B-myb sequence). containing the nucleotides of cdc25C in region 1). Regulation of the cell cycle was first measured by comparing the activity of wild-type and mutant artificial entities in resting NIH3T3 cells. The column designated "repression" summarizes the results of this analysis, (ratio +: wild-type mutant: <2: ratio - wild-type mutant:> 3. The artificial entities of the functional promoter were then analyzed for the timing of cell cycle regulation in NIH3T3 cells stimulated with serum and half-maximal activity times were determined.Hollow arrows indicate kinetics that clearly differ from both wild-type promoters B-myb and cdc25C. -l and E2F by EMSA with wild-type and mutated B-myb E2FBS-CHR probes and with CDE-CHR probes of wild-type and mutated cdc25C using nuclear extract of partially purified HeLa or CDF-I cells. of specific nucleotide changes on the timing of transcription regulated by the cell cycle from the B-myb and cdc25C promoters, NIH3T3 cells were transfected nsitoriamente with the indicated artificial entities, synchronized in G0 by serum deprivation and stimulated by adding 10% FCS. The data are based on 12 different experiments, except for the graph C-Bl, 2 which is based on 4 experiments. The data were normalized to 100 to 20 hours for each artificial entity in order to facilitate the comparison of the half-maximum expression values.

Examples i. Materials and methods. 1. 1 Cell culture, DNA transfection and luciferase assays. Cells were cultured in Eagle's medium modified by Dulbecco-Vogt (DMEM) supplemented with 10% fetal calf serum, penicillin and streptomycin. HeLa cells were grown in DMEM plus 5% newborn calf serum. NIH3T3 cells were transfected by the DEAE dextran technique (Lucibello et al., EMBO J. 14, 132 (1995)). For synchronization in G0, cells were maintained in serum-free medium for 2 days 12 hr after transfection and restimulated with 10% FCS. The determination of luciferase activities and the standardization of results using artificial reporter entities driven by SV40 promoter were performed as published (Lucibello et al., EMBO J. 14, 132 (1995)). 1. 2 Analysis of the sequence and artificial luciferase entities. Artificial luciferase entities driven by cdc25C and B-myb promoters have been described by Lucibello et al., EMBO J. 14, 132 (1995) and Zwicker et al., EMBO J. 14, 4514 (1995). Mutations were introduced by PCR strategies as described above (Good and Nazar, Nucí Acids Res. 20, 4934 (1992), Lucibello et al., EMBO J. 14, 132 (1995)). All fragments amplified by PCR were identified by DNA sequencing using the dideoxynucleotide chain termination method using Sequenasa (USB) or Tth polymerase (Pharmacia). 1. 3 EMSA Electrophoretic mobility shift analysis (EMSA) was performed as described (Zwicker et al., Science 271, 1595 (1996)). When partially purified CDF-1 was used, EMSA was performed in the absence of sodium deoxycholate and NP-40. The following double-stranded probes were used: -cdc25C-wt: 5: -ACTGGGCTGGCGGAAGG-T-TT? -iAaTGGTCAA (SEQ ID NO: 5) (CDE in bold; CHR in italics). TI, T4, T7 (also referred to as cdc25C-mCDE), A8 and C9 are mutated (Zwicker et al., Nucleic Acids Res. 23, 3822 (1995)) at positions -19, -16, -13, -12 and -11 (Table 1), respectively, as described. cdc25C-10 / - 7: 5'-ACTGGGCTGGCGGAc ttgTTGAATGGTCAA (SEQ ID NO: 6) cdc25C- & -3 (also referred to as cdc25C-mCHR): 5'-ACTGGGCTGGCGGAAGGTggrtcATGGTCAA (SEQ ID NO: 7) cdc25C-1 / + 2: 5 '-ACTGGGCTGGCG5AAGGTTTGAA7cttTCAA (SEQ ID NO: 8) cdc25C-2: 5'-ACTGGGCTGGCGGAAGGTT ^ TGAcTGGTCAA (SEQ ID NO: 9).

The sequences of the other oligonucleotides, including B-myb have been described elsewhere (Zwicker et al., Science 271, 1595 (1996)) or are indicated in Table 2. The random oligonucleotide contains an irrelevant sequence (Zwicker et al. al., EMBO J. 14, 4514 (1995)). The following antibodies were used: E2F-1 (Santa Cruz SC-251X), E2F-2 (Santa Cruz SC-632X), E2F-3 (Santa Cruz SC-879X), E2F-4 (Santa Cruz SC-512X), E2F-5 (Santa Cruz SC-999X), DP-1 (obtained from N. La Thangue), DP-2 (Santa Cruz SC-830X). 1. 4 Partial purification of CDF-l. Nuclear extracts were prepared from suspension cultures of HeLa in extraction buffer with high salt content (Dignam et al., Nucí, Nucí, Acids, Res 11, 1475 (1983)) in the presence of the protease inhibitors leupepti -na (50 ng / ml), pepstatin A (5 / xg / ml) and aprotinin (80 ng / ml). A biotinylated olya / nucleotide containing two CDE-CHR motifs of cdcC25 in tandem was coupled to streptavidin agarose and used for affinity chromatography as described (Kadonaga and Tjian, PNAS 83, 5889 (1986)), using the same conditions as for EMSA (see above) except that salmon sperm DNA was used instead of Poly (dA: dT) as a non-specific competitor. Elution was carried out by stepwise increasing the KCl concentration to 1M. 1. 5 Hollado with DMS in vitro. Screening with in vitro DMS of the oligonucleotide coding strand of cdc25C was performed as described (Zwicker et al., Science 271, 1595 (1996)). 1. 6 Genomic latching of stable transfectants. For the generation of stable cell lines, the artificial organism of wild type cdc25C luciferase C290 and the mutant of CHR C290mCHR5 / 6 (TTTGAA mutated to TagGAA) were inserted into the vector pAGLu containing a region of fi-jación to the matrix (SAR) and introduced into NIH3T3 cells by electroporation. Stably transfected clones were isolated under selection G418 and analyzed for luciferase expression in resting and growing cells. The clones with the expected expression pattern were expanded and analyzed by genomic trapping (Pfeifer et al., Science 246, 810 (1989)) as described (Lucibello et al., EMBO J. 14, 132 (1995)) with the exception that the first primer (Pl) was specific for the 5 'luciferase gene-GTAACACAAAGGAATTCAAGC (SEQ ID NO: 10).. 2. Results 2. 1 identification of CDF-l. 2. 1.1 Characterization of the CHR of cdc25C. Recently, the consensus sequence of the CDE was defined as G / CGC / TGG / C (GGCGG in cdc25? (Zwicker et al., EMBO J. 14, 4514 (1995)). However, for the CHR not yet available In order to delineate the limits of the CHR and to identify critical nucleotide positions, several mutations were introduced into the CHR of the cdc25C promoter and the function of these artificial mutant entities was analyzed by measuring their repression in synchronized NIH3T3 cells. in GO The data in Table 1 clearly indicate that the CHR ranges from -7 to -2, and that all nucleotide positions in this region are essential, whereas the nucleotide positions between the CDE and the CHR (-11 to -8; AAGG) and the nucleotides downstream of the CHR (= 1; TGG ...) can be altered without detectable effects on the repressor function.The CHR of cdc25C can then be defined as the sequence TTTGAA . 2. 1.2 The occupation of CDE in vivo depends on an intact CHR. Previous data have clearly indicated that CDE and CHR in different promoters work synergistically since mutations in any of the elements destroy repression in GO (Zwicker et al., EMBO J. 14, 4514 (1995)). This could mean that the interaction factor or factors are cooperatively linked to both elements. This issue was elucidated by genomic trocar of a stably transfected NIH3T3 cell line bearing an artificial Cdc25C promoter entity with a deactivating mutation in the CHR (cyclic-25C-mCHR5 / 6: TTTGAA changed to TagGAA). The expected protection pattern was observed in a control line stably expressing an artificial wild-type cdc25C promoter entity. In contrast, the cell line harboring the cdc25C promoter with the CHR mutation showed no protection in the CDE region and the mutated CHR, while the occupation of two upstream constitutive binding sites for NF-Y (Lucibello et al. ., EMBO J. 14, 132 (1995)) was unchanged in the mutant promoter. Thus, it has been concluded that the occupation of CDE depends on an intact CHR, which indicates cooperative union within the cell. This conclusion is supported by the observation that the 5 bp or 10 bp insertion between the CDE and the CHR in the cdc25C promoter abolishes the repression. 2. 1.3 Identification of the CDF-l. The displacement analysis of the electrophoretic mobility (EMSA) of nuclear extract of HeLa cells led to the identification of an activity that interacts cooperatively with both CDE and CHR of the cdc25C promoter. In addition, the binding of this activity to mutant repressor elements was strongly related to the functional properties of these elements. Mutants (T for G in -19; C for A in -11 or deletion of -1 / + 2) exhibited a wild-type repressor function, showed the same ability to compete in the binding assay as the wild-type sequence (self-competition). In contrast, other mutants in the CDE (T by G in -16, T by G in -13 or A by G in -12) or in the CHR (deletion of -10 / -1, deletion of -6 / - 3 or C by A in -2) that lead to decreased or impaired repression in GO cells, also showed a decreased ability to compete for binding. The observed cooperative union taken together with the correlations established by the structure-function analysis are in agreement with the expected properties of the CDE-CHR binding factor. This activity is called CDF-l. 2 . 1.4 The CDF-l contacts the CDE in the greater slot and with the CHR in the minor slot. To obtain additional evidence that CDF-1 is the activity that interacts with the repressor elements in vivo, the interaction of CDF-1 with DNA was analyzed by treading of methylation protection in vitro. It has previously been shown that in vivo the CDE is contacted in the greater cleft while the CHR is occupied in the minor cleft (Zwicker et al., EMBO J. 14, 4514 (1995)). A very similar result was obtained by treading in vitro the upper strand. The four G residues in the CDE were specifically protected indicating contacts in the major slit (N-7) and the A residues in the CHR were also specifically protected indicating contacts in the minor slit (N-3). The mode of interaction between CDF-1 and CDE-CHR in vitro is thus completely compatible with observations made intracellularly. 2. 1.5 Interaction of CDF-1 with multiple promoters containing CDE-CHR modules. Previous studies have indicated that functional CDE-CHR modules are present in different promoters, including cdc25C, cdc2 and cyclin A (Zwicker et al., EMBO J. 14, 4514 (1995)). In addition, a similar configuration of binding sites is found in the B-myb promoter in which an E2F site with a core sequence identical to the CDE of cdc25C is located immediately upstream of an element similar to the CHR (Bennett et al. al., Oncogene 13, 1073 (1996); Zwicker et al., Science 271, 1595 (1996)). Therefore, it was of obvious interest to investigate whether the CDF-1 activity identified above would interact with the repressor sites in these promoters. It could be observed that both promoters containing CDE-CHR, ie cdc2 and cyclin A, bind to the activity of CDF-I with similar efficacy as the cdc25C promoter. In all three cases the union was dependent on a cooperative union to both CDE and CHR, since the mutation (see Materials and methods) at any site impaired competition with the cdc25C probe. At an identical probe: competitor ratio (1:20), competition for the E2FBS-CHR module of the B-myb promoter was negligible, although some competition could be observed at higher competitor concentrations. The fact that the activity of CDF-1 indicates a specific and intense interaction with the three promoters containing CDE-CHR, provides additional evidence for the relevance of the activity identified in the present study. 2. 1.6 The CDF-1 does not contain any known E2F family members. In view of the similarity of the CDE with an E2FBS, an attempt was made to investigate whether the CDF-CHR activity identified above could contain members of the known E2F or DP family. To this end, an EMSA was carried out in the presence of antibodies directed against specific DP and E2F proteins. It has been shown that all these antibodies induce super displacements or extinguish E2F / DP binding in different arrangements. However, it could be clearly demonstrated that none of the antibodies used affected the formation of the CDF1-DNA complex, indicating that CDF-1 does not "contain any of the known E2F or DP family members. 2. 2 Identification of nucleotides that determine preferential binding with E2F or CDF-1 or E2F and CDF-1. The identification of nucleotide sequences linking E2F and CDF-1 was complicated by the fact that the DP / E2F and CDF-1 complexes show a very similar electrophoretic mobility in EMSA. Accordingly, the HeLa nuclear extract was fractionated by DNA affinity chromatography using a 20 bp CDE-CHR CDE-CHR sequence (see Materials and Methods for more details). This procedure provided partially purified CDF-I which shows binding properties very similar to those of CDF-1 in crude extracts, and gave a complete separation of CDF-1 from the binding activity of E2F. For the analysis of E2F complexes CDE-CHR CDE-CHR oligonucleotide was included in the binding reactions to avoid the formation of radiolabeled CDF-1 complexes. To determine the binding sites of DP / E2F and CDF-1, specific nucleotides were exchanged between the B-myb and cdc25C promoters in five specific regions in which the repressor modules differ from each other (noted 1-5 at the top of Table 2). The corresponding sequences were first tested for E2F binding (ie, binding of DP1 / E2F-1, -3 and -4 in HeLa nuclear extract) and interaction with partially purified CDF-I. This study provided two clear results. 1. The nucleotides flanking the CDE or the E2FBS nucleus (regions 1 and 2) play an important role in the binding of E2F. In contrast, the same residues do not appreciably influence the binding of CDF-1. Although the nucleotides in region 1 (CT in B-myb) influence the maximum binding of DP1 / E2F-4 (B-Cl in Table 2), residue G in region 2 is crucial for the interaction with all the E2F complexes (B-C, 2 and B-C2 in Table 2). Consistent with this conclusion, the introduction of regions I and 2 of B-myb but not of region i only confers on the CDE of cdc25C the ability to interact with complexes DP1 / E2F-1, -3 and -4 with high efficiency. CIA (C-Bl, 2 in Table 2). In contrast, none of these nucleotide changes around the E2FBS or CDE nucleus affected the binding of CDF-I (B-Cl and B-C1,2; B-C; C-Bl and C-Bl, 2 in Table 2). 2. The opposite was true for the binding of CDF-1: the structure of the CHR had a strong impact on the binding of CDF-1 although it did not involve the binding of E2F, and in this respect region 4 was the crucial one. . Thus, the exchange of two nucleotides in this region between cdc25C and B-myb led to a strong increase in the binding of CDF-1 to the B-myb promoter (B-C4 in Table 2), whereas the opposite exchange destroyed the binding of CDF-1 to the cdc25C promoter (C-B4 in Table 2). In contrast, changes in the CHR in region 4 did not affect the binding of E2F complexes. Since it was formally possible for B and b-CHR to extend beyond the limits determined for the CHR of cdc2? C and the two promoters differed at these positions (regions 3 and 5 in the table) it could not be excluded that C -B4 does not interact with CDF-1 due to an incomplete Bmyb-CHR. Therefore, the B-myb nucleotides found in regions 3 and 5 were also introduced into the cdc25C sequence in addition to the change in region 4 (C-B3,4, C-B3,4,5 and C-B4,5 in Table 2). However, these additional alterations were able to restore the binding of CDF-l only to a marginal extent, confirming that the sequences Bmyb-CHR and cdc25C-CHR are not equivalent with respect to interaction with proteins.

Finally, it was analyzed how the differential interaction of E2F and CDF complexes with B-myb and cdc25C observed previously would affect the repression of transcription regulated by the cell cycle and the timing of regulation. The same sequences tested for the binding of E2F and CDF-I were introduced into artificial luciferase bodies of the promoter B-myb and cdc25C and tested for activity in NIH3T3 cells stimulated by serum that had been synchronized in G0. The data in Table 2 indicate that the nullification of E2F binding to the B-myb promoter in the presence of CDF-1 binding similar to the wild type impairs G0 repression (see B-Cl, 2). This observation strongly indicated that the E2F complexes, instead of the CDF-1, are responsible for the transcription of the B-myb gene regulated by the cell cycle, which is in accordance with the relatively low affinity of CDF-1. by the promoter B-myb. In contrast, it could be found that mutations in the CDE of cdc25C that abolish the binding of CDF-1 also impair the regulation of the cell cycle. Similarly, the substitution of cdc25C with that of B-myb abolished the binding of CDF-l as well as the repression in G0 (C-B4, C-B3,4 and D-B3,4,5 in Table 2) . The opposite artificial entity harboring a CHR of cdc2ΔC on a B-myb promoter base (B-C4) indicated an intermediate cell cycle kinetics, ie, a delay in the derepression of transcription relative to B- and b wild type of 3 hours. 2. 3 Example of the construction and use of an artificial gene for gene therapy according to the invention. The selected gene artificial entity has the following DNA components (listed downstream from 5 'to 3'): the SV40 early promoter / enhancer region (nucleotides 48 to 5191; Tooze (ed.), Tumor DNA Viruses (Cold Spring Harbor, New York, New York, Cold Spring Harbor Laboratory; Lucibello et al., EMBO J. 14, 132 (1995)) linked to SEQ ID NO: 1 attached to the GCCACC sequence (Kodak, J. Cell Biol., 108, 229 (1989)) bound to the cDNA for the immunoglobulin signal peptide (nucleotide sequence = 63 a = 107; Riechmann et al., Nature 332, 323 (1988)) bound to the cDNA for β- glucuronidase (nucleotide sequence = 93 a = 1982, Oshima et al., PNAS USA 84, 665 (1987)) The artificial gene entity is cloned in a plasmid vector pUC18 / l9 The linkage of the different components of the artificial entity This is done through appropriate sites that are preserved in the terms of each component by PCR amplification. n specific ligases for the chosen restriction sites. These ligases are commercially available and known to those of skill in the art. Cultured human umbilical cord endothelial cells (HuVEC) are transfected with the plasmids described above according to the method described by Lucibello et al. (EMBO J. 14, 132 (1995)). The amount of β-glucuronidase produced by the HuVECs is measured using 4-methylumbelliferyl-β-glucuronide as a substrate. To test the specific specificity of the cell cycle, endothelial cells are synchronized in G0 / Gx by means of methionine deprivation for 48 hours. The DNA content of the cells is measured by FACS analysis by staining with Hoechst 33258 (Lucibello et al., EMBO J. 14, 132 (1995)). The following results can be achieved: 1. Transfected HuVECs secrete much more ß-glucuronidase compared to untransfected HuVECs. 2. The proliferating HuVECs (DNA> 2S) secrete significantly more glucuronidase than the HuVECs synchronized in G0 / G1. 3. Accordingly, the ID. SEC. NO .: 1 leads to a specific expression of the cell cycle of β-glucuronidase in HuVECs transfected with an artificial gene entity described above.

Table 1: artificial entities of mutations fifteen Table 2: 15

Claims (3)

1. Ia. An artificial nucleic acid entity comprising: a) at least one activating sequence; b) at least one chimeric promoter module comprising a nucleotide sequence that binds to a protein of the E2F family and to a protein of the CDF-1 family; and c) at least one structural gene, wherein said chimeric promoter module causes an up-regulation of gene expression in the cell cycle later than the B-myb promoter but before the cdc25C promoter.
2. 2*. An artificial nucleic acid entity according to claim Ia, wherein said activating sequence is upstream of said chimeric promoter module.
3. 3*. An artificial nucleic acid entity according to claim 1 or 2, wherein said chimeric promoter module comprises at least one nucleotide sequence that is selected from the group consisting of ACTTGGCGGGAGATTTGAAT (ID. SEC. NO .: 1) and GCTTGGCGG ^ AGGTTTGAAT (SEQ ID NO: 2). 4a. An artificial nucleic acid entity according to any one of claims 1 to 3, wherein said chimeric promoter module interacts with said activating sequence, and wherein said interaction affects the expression of said structural gene. 5a. An artificial nucleic acid entity according to any of claims Ia to 4a, wherein said activating sequence is specific to the cell, specific metabolic or virus specific. 6a. An artificial nucleic acid entity according to claim 5, wherein said cell-specific activating sequence is activated in a cell chosen from the group consisting of an endothelial cell, a serous cell, a smooth muscle cell, a muscle cell, a synovial cell, a macrophage, a lymphocyte, a leukemic cell, a tumor cell, a keratin-cyto cell and a glial cell. 7a. An artificial nucleic acid entity according to claim 5, wherein said virus-specific activating sequence is a promoter or enhancer sequence derived from a virus selected from the group consisting of HBV, HCV, HSV, HPV, EBV, HTLV, CMV, SV40 and HIV. 8a. An artificial nucleic acid entity according to any of claims Ia to 7a, wherein said structural gene encodes an enzyme or a fusion protein between a ligand and an enzyme that converts or segments a precursor of a pharmaceutical product to produce a pharmaceutical product . 9a. An artificial nucleic acid entity according to any of claims 6a to 12a, wherein said structural gene encodes a substance that is selected from the group consisting of a cytokine, a growth factor, a cytokine receptor, a receptor of the growth factor, a protein that has an antiproliferative effect, a protein that has an apoptotic effect, a protein that has a cytostatic effect, a protein that has a cytotoxic effect, a protein that has an inflammatory effect, a protein that has an anti-inflammatory effect, a protein that has an immunosuppressive effect, an antibody, an antibody fragment, an inhibitor of angiogenesis, a coagulation factor, a fibrinolytic compound and a autocoagulant, a blood protein, a viral antigen, an antigen bacterial and a tumor antigen and a fusion protein between a ligand and one of the aforementioned substances. 10a. An artificial nucleic acid entity according to claims 8a or 9a, wherein said ligand is selected from the group consisting of a growth factor, a cytokine or an antibody. 11a. An artificial nucleic acid entity according to any one of claims Ia to 10a, wherein said nucleic acid is DNA. 12a. An artificial nucleic acid entity according to any of claims Ia to 11a, wherein said artificial entity contains the following components in the 5'-3 'direction: nucleotides 48 to 5191 of the promoter / early enhancer region of the SV40 bound to a fragment of DNA containing the sequence ACTTGGCGGGAGATTTGAAT (SEQ ID NO: 1) linked to nucleotides 63 to 107 encoding the signal peptide of an immunoglobulin linked to nucleotides 93 to 1982 of the β-glucuronidase cDNA. 13a. A vector comprising an artificial nucleic acid entity according to any of claims Ia to 12a. 14 to. A vector according to claim 13, wherein said vector is a non-viral vector. 15a. A vector according to claim 13, wherein said vector is a viral vector. 16a. A cell comprising an artificial nucleic acid entity according to any of claims Ia to 12 * or a vector according to any of claims 13a to 15a. 17a. A method for preparing an artificial nucleic acid entity according to any of the claims Ia to 12a or a vector according to any of the claims 13a to 16a, in which the elements of said artificial entity are linked in stages. 18 . The use of an artificial nucleic acid entity according to any of claims Ia to 12a or of a vector according to any of claims 13a to 16a, for preparing a pharmaceutical product for the treatment of a tumor disease, a leukemia, a cardiovascular disease, inflammatory reactions, an autoimmune disease, an allergy, an arthritis, a psoriatic disease, an imminent rejection of a transplanted organ, a damage in the CNS, an infectious disease, a blood coagulation disorder and / or an infection chronic viral 19a. CDF-1 protein that can be obtained by the following steps: (a) preparing a nuclear extract of HeLa cells, and (b) purifying the extract from step (a) by affinity chromatography in the presence of an oligonucleotide containing a motif of the sequence of CDE-CHR. 20 a. CDF-I protein according to claim 19, wherein the sequence motif of CDE-CHR contains the sequence GGCTG GCGGA AGGTT TGAAT. 21a. CDF-I protein according to claim 19, wherein the sequence motif of CDE-CHR contains the sequence GGCTG GCGGA AGGTT TGAAT GGCTG GCGGA AGGTT TGAAT. 22a. CDF-I protein according to any of claims 19a to 21a, wherein said oligonucleotide is coupled with agarose. 23a. CDF-I protein according to any of claims 19 a to 22 a, in which the nuclear extract is prepared by saline extraction of HeLa cells. 24a. The use of the CDF-I protein according to any of claims 19 a to 23 a to identify inhibitors or stimulators of CDF-I.