MXPA97009726A - Use of ova tissue transcription factors - Google Patents

Abstract

Novel DNA constructs are provided which can be used as molecular probes, or can be inserted into a host plant, to provide modification of the transcription of a DNA sequence of interest in ovarian tissue, particularly in the very early development of the fruit . DNA constructs comprise a regulatory region of the initiation of transcription associated with the expression of the gene in ovarian tissue, from immediately before anthesis to senescence of the ovary.

Description

USE OF OVARIAN TISSUE TRANSCRIPTION FACTORS REFERENCE WITH RELATED REQUESTS This application is a partial continuation of the Application of the United States of America with serial number 08 / 487,087 filed on June 7, 1995, which is a partial continuation of the Application with serial number 998,158 filed on December 29, 1992, which is a partial continuation of the Application of the United States of America with Serial No. 554,195 filed July 17, 1990, which is a partial continuation of the Application of the United States of America with Serial No. 382,518 filed on July 19, 1989, whose applications are incorporated herein by reference.

INTRODUCTION Technical Field This invention relates to methods for using transcription cassettes or DNA expression cassettes constructed in vitro, capable of directing the transcription of ovarian tissue from a DNA sequence of interest in plants, to produce ovarian-derived cells that have an altered phenotype, and methods to provide or modify the existing color in different tissues or parts of plants. The invention is exemplified by methods for using ovarian tissue promoters, to alter the color phenotype of cotton fibers, and cotton fibers produced by this method.

Background In general, genetic engineering techniques have been directed at modifying the phenotype of individual prokaryotic and eukaryotic cells, especially in culture. Plant cells have proven to be more intransigent than other eukaryotic cells, due not only to a lack of adequate vector systems, but also as a result of the different goals involved. For many applications, it is desirable to be able to control the gene expression at a particular stage of the growth of a plant, or in a particular plant part. For this purpose, regulatory sequences are required that provide the desired transcription initiation in the appropriate cell types and / or at the appropriate time in the development of the plant, without having serious detrimental effects on the development and productivity of the plant. Accordingly, it is interesting to be able to isolate sequences that can be used to provide the desired regulation of transcription in a plant cell during the growth cycle of the host plant. One aspect of this interest is the ability to change the phenotype of particular cell types, such as differentiated epidermal cells originating in ovarian tissue, ie, cotton fiber cells, to provide altered or improved aspects of the mature cell type. In order to effect the desired phenotypic changes, transcription initiation regions capable of initiating transcription are used only in the early development of the ovary. These transcription initiation regions are active before the establishment of pollination, and are less active or inactive, before the fruit grows, the maturation of the tissue, or something similar occurs.

Relevant Literature In European Application No. 88.906296.4, the disclosure of which is incorporated herein by reference, a class of specific fruit promoters expressed at or during anthesis through the development of the fruit is discussed, at least up to the beginning of the ripening CDNA clones that are preferably expressed in cotton fiber have been isolated. One of the isolated clones corresponds to mRNA and protein that are higher during the stages of synthesis of the late primary cell wall and the early secondary cell wall. John Crow PNAS (1992) 89: 5769-5773. CDNA clones have been isolated and characterized from tomato which exhibits differential expression during the development of the fruit (Mansson et al., Mol. Gen Genet (1985) 200: 356-361: Slater et al., Plant Mol. Biol. (1985) 5: 137-147). These studies have focused primarily on mRNAs that accumulate during the ripening of the fruit. One of the proteins encoded by specific cDNAs of maturation has been identified as polygalacturonase (Slater et al., Plant Mol. Biol. (1985) 5: 137-147). A cDNA clone encoding tomato polygalacturonase has been sequenced (Grierson et al., Nucleic Acids Research (1986) 14: 8395-8603). Improvements have been reported in aspects of tomato fruit storage and handling through the manipulation of transcription of the expression of the polygalacturonase gene (Sheehy et al., Proc. Nati. Acad. Sci. USA (1988) 85: 8805-8809; Smith et al., Nature (1988) 334: 724-726). The mRNA of the mature plastid for psbA (one of the components of photosystem II) reaches its highest level later in the development of the fruit, while in the establishment of maturation, the mRNAs of the plastid for other components of the photosystems I and II, decline to non-detectable levels in the chromoplasts (Piechulla et al., Plant Molec. Biol. (1986) 7: 367-376). Recently, interactions of cDNA clones representing genes apparently involved in tomato pollen have also been isolated and characterized (McCor ic et al., Tomato Biotechnology (1987) Alan R. Liss, Inc., NY) and in the tomato pistil ( Gasser et al., Plant Cell (1989), 1: 15-24). Other studies have focused on inducibly regulated genes, for example, genes encoding serum proteinase inhibitors, which are expressed in response to wound in tomato (Graham et al., J. Biol. Chem. (1985) 260: 6555 -6560: Graham et al., J. Biol. Chem. (1985) 260: 6561-6554), and in the mRNAs correlated with the ethylene synthesis in the ripening fruit and in the leaves after the wound (Smith et al. collaborators, Plant (1986) 168: 94-100). Accumulation of an etalocarboxypeptidase inhibitor protein in the leaves of wounded potato plants has been reported (Graham et al., Biochem &BioPhys, Res Comm. (1981) 101: 1164-1170). Also, genes that are expressed preferably in the tissues of plant seeds, such as embryos or seed coatings, have been reported. See, for example, European Patent Application Number 87306739.1 (published as 0 255 378 on February 3, 1988), and Kridl et al. (Seed Science Research (1991) 1: 209-219).

The transformation of medium cotton by Agrobacterium is described in U brek, U.S. Patents Nos. 5,004,863 and 5,159,135, and the transformation of cotton by particle bombardment is reported in International Publication Number WO 92/15675, published on 17 September 1992. The transformation of Brassica has been described by RadKe et al. (Theor, Appl. Genet. (1988) 75: 685-694, Plant Cell Reports (1992) 11-499-505). The transformation of the cultivated tomato is described by McCormick et al., Plant Cell Reports (1986) 5: 81-89 and Fillatti et al., Bio / Technology (1987) 5: 726-730.

SUMMARY OF THE INVENTION [0002] Novel DNA constructs and methods for their use are described, which are capable of directing the transcription of a gene of interest in the tissue of the ovary, particularly early in the development of the fruit. Novel constructs include a vector comprising a transcription and translation initiation region that can be obtained from a gene expressed in ovarian tissue, and methods for using constructions that include the vector to alter the fruit phenotype. The fruit may be edible or inedible. The method includes transfecting a host plant cell of interest with a transcription or expression cassette comprising a promoter that is active in the cells of the ovary prior to, and during, the pollination stage of the fruit, and then generates a plant, which grows to produce the fruit that has the desired phenotype. The constructions and methods of the present invention, therefore, find use in the modulation of endogenous fruit products, as well as in the production of exogenous products, and in the modification of the phenotype of the fruit and the products of the fruit. The constructions also find use as molecular probes. In particular, constructs and methods for use in gene expression in embryonic cotton fabrics are considered herein. By these methods, novel cotton plants and parts of cotton plants, such as modified cotton fibers, can be obtained. In the present application, constructs and methods of use related to the modification of the color phenotype in plant tissues are also provided. These constructs contain sequences for the expression of genes involved in the production of colored compounds, such as melanin and indigo, and also contain sequences that provide the direction of the gene products towards particular places in the plant cell, such as plastid organelles , or the vacuoles. The direction to the plastid is of particular interest for the expression of genes involved in the trajectories of aromatic amino acid biosynthesis, while the vacuolar direction is of particular interest where the precursors required in the synthesis of the pigment are present in vacuoles. For example, the production of melanin can be enhanced by vacuolar targeting in the tissues of plants that accumulate tyrosine in the vacuoles. The transcription initiation regions for the expression of genes related to color will be selected based on the tissue for which color modification is desired.

DESCRIPTION OF THE DRAWINGS Figure 1 shows the DNA sequence of the pZ130 cDNA clone. The sequences corresponding to the pZ7 cDNA clone are underlined. Figure 2 shows the sequence of the region of the Calgene Lambda 140 genomic clone, which overlaps with the pZ130 cDNA clone (this region is underlined), and a partial sequence of the 5 'and 3' regions for that region. The principle of transcription of the pZ130 gene is indicated by bold "A" and underlined at position 2567. An intron is indicated in the genetic sequence by the lowercase sequence from position 2702 to position 2921. Sites are indicated for the common restriction enzymes.

The symbols in the sequence have the following meanings: A = adenosine; C = cytosine; G = guanidine; T = thymidine or uracil; R = A or G; Y = C or T or U; M = C or A; K = T or U or G; W = T or U or A; S = C or G; N = any of C, T, A, G, or U; B = is not A; D = is not C; H = is not G; V = is not T or U. Figure 3 shows a restriction map of Calgene Lambda 140. B: BamHl; G: Bgllll; K-. HindlII; R: EcoRI; S: SalI. Figure 4 shows a complete DNA sequence of the pZ70 cDNA clone. The sequences corresponding to the pZ8 cDNA clone are underlined. The beginning and end of the mature protein encoded by the pZ70 gene are also indicated. Figure 5 shows a restriction map of the Calgene Lambda 116. B: BamHI; G: BglII; H: HindIII; P: SphI; R: EcoRI; S: SalI; X: XbaI. Figure 6 shows the results of a Northern blot experiment illustrating a time course of development of RNA accumulation of pZ7 and pZ8. The stages of development of the UC82B fruit (flowers and ovaries / fruit) are illustrated above. The numbers 1 to 21 represent the days after the flower opens. Figure 7 shows a binary vector for the transformation of the plant in order to express genes for the synthesis of melanin. Figure 8 shows a site map of the linker region.

DETAILED DESCRIPTION OF THE INVENTION In accordance with the present invention, novel constructs and methods for their use are described, which can be used as molecular probes, or can be inserted into a host plant to provide transcription of a nucleotide sequence of interest in ovary cells, compared to other cells of the plant, generally preferably in ovarian cells, to produce cells and parts of plants that have an altered phenotype. The period of at least 1 to 3 days before the anthesis through the senescence of the flower is of particular interest. The constructions include several forms, depending on the intended use of the construction. Accordingly, the constructs include vectors, transcription cassettes, expression cassettes, and plasmid. The transcription and translation initiation region (also sometimes referred to as a "promoter", preferably comprises a transcription initiation regulatory region, and a translational initiation regulatory region of non-translated 5 'sequences. ribosomes ", responsible for the binding of mRNA to ribosomes, and initiation of translation It is preferred that all functional elements of transcription and translation of the initiation control region are derived from, or obtained from, , the same gene In some embodiments, the promoter will be modified by the addition of sequences, such as enhancers, or deletions of non-essential and / or unwanted sequences. "What can be obtained" means a promoter having a sequence of DNA sufficiently similar to that of a native promoter, to provide the desired specificity of the transcription of a DNA sequence of interest. This includes natural and synthetic sequences, as well as sequences that can be a combination of synthetic and natural sequences. Vectors typically comprise a nucleotide sequence of one or more nucleotides and a transcription initiation regulatory region associated with gene expression in ovarian tissue. A transcription cassette, for the transcription of a nucleotide sequence of interest in ovarian tissue, will include, in the direction of transcription, a transcription initiation region of ovarian tissue, and optionally a translational initiation region, a DNA sequence of interest, and a transcription termination region, and optionally translational, functional in a plant cell. When the cassette provides for the transcription and translation of a DNA sequence of interest, it is considered an expression cassette. There may also be one or more introns present. There may also be other sequences present, including those encoding transit peptides and leader secretory sequences, as desired. The regulatory regions are able to direct transcription in ovarian cells from anthesis to flowering, but direct little or no expression after the initial changes, which occur at the time around pollination and / or fertilization; Transcription from these regulatory regions is not detectable at approximately 3 weeks after anthesis. In addition, the ovarian tissue transcription initiation regions of this invention are typically not readily detectable in other plant tissues. The ovarian tissue transcription initiation regions that are not ovarian specific may find a special application. Especially preferred are transcription initiation regions that are not found in the stages of fruit development other than pre-anthesis until flowering. Transcription initiation regions capable of initiating transcription in other tissues of plants and / or in other stages of ovarian development, in addition to the foregoing, are acceptable as far as those regions provide a significant level of expression in ovarian tissue in the defined interest periods, and do not interfere negatively with the plant as a whole, and in particular, do not interfere with the development of the fruit and / or parts related to the fruit. Also of interest are ovarian tissue promoters and / or promoter elements that are capable of directing transcription in specific ovarian tissues, such as the outer pericarp tissue, inner core tissues, hindrances, and the like. The transcription initiation regions that can be expressed in ovarian tissue at or near the maximum levels during the period of interest of this invention, generally the period of flowering of the reproductive cycles of the plant, are preferred. The period of at least 1 to 3 days before the anthesis until the senescence of the flower is of particular interest. The level of transcription must be sufficient to provide an amount of RNA capable of resulting in a modified fruit. The term "fruit" as used herein, refers to the mature organ formed as the result of the development of the ovary wall of a flower, and any other closely associated parts. See Weirer, T.E., 1, ed., Botany A Introduction to Plant Biology (6th edition) (John Wiley &Sons, 1982); Tootill and Backmore, The Facts on File Dictionary of Botany (Market Home Books Ltd., 1984). "Modified fruit" means fruit that has a detectably different phenotype from an untransformed plant of the same species, for example, one that does not have the transcription cassette in question of its genome. Of particular interest are the regions of transcription initiation associated with genes expressed in ovarian tissue, and which are capable of directing transcription at least 24 hours before anthesis until senescence of the flower. The term "anthesis" refers in the present to the period associated with the opening and flowering of the flower. The term "flower senescence" refers in the present to the period associated with the death of the flower, including the loss of the petals (of the flower), and so on. Abercrobie, M., and collaborators. A Dictionary of Biology (6 = edition) (Penguin Books, 1973). Unopened flowers, or buds, are considered "pre-anthesis." The anthesis begins with the opening of the petals of the flower, which represents the asexually receiving portion of the reproductive cycle of the plant. Typically, flowering lasts about a week in the UCB82 tomato variety tested. In a plant such as cotton, flowering lasts approximately 2 weeks, and fiber develops from the seed coat fabric. It is preferred that the transcription initiation regions of this invention do not initiate transcription for a significant time, or to a significant extent, before the flower bud of the plant is formed. Ideally, the level of transcription will be high for at least about 1 to 3 days, and encompasses the establishment of anthesis ("pre-anthesis"). further, it is desired that the transcription initiation regions of this invention show a decreased level of transcription activity within 1 to 3 days after the establishment of the anthesis, which does not increase, and preferably decreases over time. The fertilization of an embryonic tomato sac, to produce the zygote that forms the embryonic plant, typically occurs 2 to 3 days after the opening of the flower. This coincides with a decrease in the activity of a transcription initiation region of this invention. Accordingly, it is desired that the transcription activity of the promoter of this invention decrease in a significant manner within about 2 days after the establishment of the anthesis. The transcription initiation regions of this invention may direct expression in ovarian tissue at significant expression levels during the preferred periods described above. In some embodiments, it will be desired to selectively regulate transcription in a particular ovarian tissue or tissues. When used in conjunction with an untranslated 5 'sequence capable of initiating translation, expression in defined ovarian tissue, including the integuments of the ovary (also known as "epidermal cells of the ovum"), the left of the nucleus or pericarp, and the like, the transcription initiation region can direct a desired message encoded by a DNA sequence of interest in a particular tissue, to effect a desired phenotypic modification in a more efficient manner. For example, Expression in ovarian pericarp tissue, also known as the ovary wall and / or the ovarian nucleus tissue, could result in useful modifications to the edible portions of many fruits, including true berries, such as tomatoes, grape, blueberry, date, currant, and eggplant; hard fruits (drupes), such as cherry, plum, apricot, peach, nectarine, and avocado; and compound fruits (from drupe), such as raspberries and blackberries. In hesperidium (oranges, citrus), these expression cassettes are expected to be expressed in the "juicy" portion of the fruit. In peels (such as melon, cantaloupe, sweet melon, cucumber, and chayote), the equivalent tissue is more likely that of the internal edible portions. In other fruits, such as legumes, the equivalent tissue is the seed pod. The modification of analogous structures of inedible fruit may also be of interest. Accordingly, the regions of transcription initiation that can be expressed in at least the outer pericarp tissue of the ovary are of particular interest. For example, in cotton, the analogous structure of the ovary is the cover of the cotton capsule; in the rapeseed seed it is the pod of the seed. In a similar way, the regulation of the expression in the integuments of the ovary and / or in the tissue of the nucleus, can result in useful modifications to the analogous fruit, and to the related structures that evolve from it, for example, the hair covering the seeds, such as cotton fibers. The cotton fiber is a simple epidermal cell differentiated from the outer integument of the ovule. It has four distinct growth phases: initiation, elongation (synthesis of the primary cell wall), synthesis of the secondary cell wall, and maturation. The initiation of fiber development seems to be triggered by hormones. The primary cell wall extends during the elongation phase, which lasts up to 25 days after anthesis (DPA). The synthesis of the secondary wall begins before the elongation phase ceases, and continues until approximately 40 days after anthesis, forming an almost pure cellulose wall. In addition to the ovarian tissue promoters, transcriptional initiation regions are also of interest from genes expressed preferably in seed tissues, and in particular in the tissues of the seed coat, for applications where the modification of the cotton fiber cells. An example of a gene that is expressed at high levels in Brassica seed coat cells is the EA9 gene described in European Patent Number EPA 0 255 378. The nucleic acid sequence of a portion of EA9 cDNA is provided in it, and can be used to obtain corresponding sequences, including the promoter region. An additional seed gene that is expressed in the seed embryo and in the seed coat cells is the Brassica Bce4 gene. The promoter region from this gene also finds use in the present invention; this gene, and the corresponding promoter region, are described in International Publication Number WO 91/13980, which was published on September 19, 1991. Fiber-specific proteins are regulated by development. Accordingly, the regions of transcription initiation from proteins expressed in fiber cells are also of interest. An example of a fiber cell protein regulated by development is E6 (John and Crow, Proc. Nat.

Acad. Sci. (USA) (1992) 89: 5769-5773). The E6 gene is more active in the fiber, although low levels of transcripts are found in the leaves, in the ovules, and in the flowers. To obtain a specifically derived transcription initiation region, the following steps may be employed. The messenger RNA (mRNA) is isolated from the tissue of the desired development stage. This mRNA is then used to construct cDNA clones that correspond to the mRNA population, both in terms of the primary DNA sequence of the clones, and in terms of the abundance of different clones in the population. The mRNA is also isolated from the tissue of a different developmental stage, where the target gene (alternative tissue) should not be expressed. The radioactive cRNA from the desired tissue, and from the alternative tissue, is used to screen duplicate copies of the cRNA clones. The preliminary screening allows classifying the cDNA clones as those corresponding to the mRNAs that are abundant in both tissues; those that correspond to the mRNAs that are not abundant in any tissue; those that correspond to the mRNAs that are abundant in one tissue and relatively non-abundant in the other. Then the clones corresponding to the mRNAs that are abundant only in the desired tissue are selected, and then these selected clones are further characterized. Since the hybridization probe for the preliminary screening illustrated above, is total cDNA from a particular tissue, it hybridizes primarily in the most abundant sequences. In order to determine the actual level of expression, particularly in the tissue where the mRNA is not so abundant, the cloned sequence is used as a hybridization probe for the total mRNA population of the desired tissues and different unwanted tissues. This is most commonly done as a Northern blot that gives information about both the relative abundance of mRNA in particular tissues, and the size of mRNA transcription. It is important to know if the abundance of mRNA is due to transcription from a single gene, or if it is the product of transcription from a family of genes. This can be determined by probing a genomic Southern blot with the cDNA clone. The genomic DNA is digested with a variety of restriction enzymes, and hybridized with the radioactive cDNA clone. From the pattern and the intensity of the hybridization, it is possible to distinguish between the possibilities that the mRNA is encoded by either one or two genes, or by a large family of related genes. It can be difficult to determine which of several cross-hybridized genes encode the abundantly expressed mRNA found in the desired tissue. For example, tests indicate that pZ130 (see Example 4) is a member of a small genetic family; however, the pZ7 probe can distinguish pZ130 from the rest of the family members. The cDNA obtained as described can be sequenced to determine the open reading frame (probable coding region of the protein), and the direction of transcription, such that a desired target DNA sequence can subsequently be inserted into the correct site and in the correct orientation, in a transcription cassette. The sequence information for the cDNA clone also facilitates the characterization of the corresponding genomic clones, including mapping and subcloning as described below. At the same time, a genomic library can be screened for clones containing the entire genetic sequence, including the control region flanking the transcribed sequences. Genomic clones generally contain large segments of DNA (approximately 10 to 20 kb), and can be mapped using restriction enzymes, then subcloned and partially sequenced to determine which segments contain the gene regulated by development. Using the restriction enzyme map and the sequence information, plasmids having the putative ovary gene or other desired promoter regions linked to the genes to be expressed in the tissue of the ovary and / or other desired tissue, particularly in tissue derived from the ovary, can be designed and constructed. These hybrid constructions are tested for their pattern of expression in transformed regenerated plants, to ensure that the desired time and / or tissue expression and / or overall expression level has been maintained successfully, when the promoter is no longer associated with the native open reading frame. Using the method described above, several regulatory regions of transcription have been identified. An example is the transcription initiation region derived from tomato, which regulates the expression of the sequence corresponding to the pZ130 cDNA clone. Sequences that can hybridize in clone pZ130, for example, probe pZ7, show abundant mRNA, especially in the early stages of anthesis. The message is expressed in the integument of the ovary and in the tissue of the outer pericarp of the ovary, and is not expressed, or at least not easily detectable, in other tissues or in any other stage of fruit development. Accordingly, it is considered that the transcription initiation region of pZ130 is ovarian specific for the purposes of this invention. Figure 1 provides the DNA sequence of the cDNA clone pZ130. The native function of the amino acid sequence encoded by the structural gene comprising pZ130 is unknown. Downstream from, and under the regulatory control of, the ovarian tissue transcription / translation initiation control region, is a nucleotide sequence of interest, which provides for the modification of the phenotype of structures that mature from the tissue of the ovary. ovary, such as fruit or fiber. The nucleotide sequence can be any open reading frame that encodes a polypeptide of interest, eg, an enzyme, or a sequence complementary to a genomic sequence, wherein the genomic sequence can be an open reading frame, an intron, a leader, non-coding sequence, or any other sequence in which the complementary sequence inhibits transcription, the processing of messenger RNA, for example, splicing or translation. The nucleotide sequences of this invention can be synthetic, naturally derived, or combinations thereof. Depending on the nature of the DNA sequence of interest, it may be desirable to synthesize the sequence with the preferred codons of the plant. The preferred codons of the plant can be determined from the highest frequency codons in the proteins expressed in the greatest amount in the particular plant species of interest. The phenotypic modification can be achieved by modulating the production, either of an endogenous transcription or translation product, for example, with respect to the amount, the relative distribution, or the like, or an exogenous transcription or translation product. , for example, to provide a novel function or products in a transgenic host cell or tissue. Of particular interest are DNA sequences that encode expression products associated with the development of the fruit of the plant, including genes involved in the metabolism of cytokinins, auxins, ethylene, abscisic acid, and the like. Methods and compositions for modulating cytokinin expression are described in U.S. Patent No. 5,177,37, the disclosure of which is incorporated herein by reference. Alternatively, different genes can be used, from sources, including other eukaryotic or prokaryotic cells, including bacteria, such as those from the auxin biosynthetic gene products and T-DNA cytokinin from Agrojacteriujn tumefaciene, for example, and mammals, for example interferons. Other phenotypic modifications include modification of the color of plant parts which develop from the integuments of the ovary and / or tissue of the nucleus, for example, the hairs covering the seeds, such as cotton fibers. G The genes involved in the production of melanin, and the genes involved in the production of indigo, are of interest. Melanins are brown pigments found in animals, plants, and microorganisms, any of which can serve as a source for the sequences to be inserted into the constructions of the present invention. Specific examples include the tyrosinase gene, which can be cloned from Streptojnyces antibioticus. The protein encoded by ORF438 in S is necessary. antibioticus for the production of melanin, and can provide a copper donor function. In addition, a tyrosinase gene can be isolated from any organism that makes melanin. This gene can be isolated from human hair, melanocytes or melanomas, cuttlefish fish, and red roosters, among others. See, for example, European Patent Application Number 89118346.9, which discloses a process for the production of melanins, their precursors and derivatives in microorganisms. Also, see Bernan et al., Gene (1985) 37: 101-110.; and della-Cioppa et al., Bio / Technology (1990) 8: 634-638. Indigo can be obtained by using genes that encode a mono-oxygenase, such as xylene oxygenase, which oxidizes toluene and xylene to obtain (methyl) benzyl alcohol, and also transforms indol into indigo. The cloning of the xylene oxygenase gene, and the nucleotide and amino acid sequences, are described in Japanese Unexamined Patent Application Kokai Number: 2-119777, published May 7, 1990. A dioxygenase, such as dioxygenase naphthalene, which also convert indol into indigo, also finds use; the naphthalene dioxygenase gene nahA is described in Science (1983) 222: 167. For cloning, we have the nucleotide sequence in the characterization of genes encoding naphthalene dioxygenase from Pseudomonas putida. See Kurkela et al., Gene (1988) 73: 355-362. A tryptophanase gene sequence in conjunction with an oxygenase can be used to increase the amount of indole available to become indigo. The sources of tryptophanase gene sequences include E. coli (see, for example, Deeley et al. (1982) J. Bacteriol. 151: 942-951). As demonstrated in the following examples, the expression of ORF438 and the tyrosinase genes of Streptomyces in transgenic tobacco plants using a pZ7 promoter, and the direction of the gene products towards the plastids by the action of the transit peptides, gave as This resulted in the phenotypic modification of tissues derived from the ovary and meristem, including the modification of the color in the meristematic regions and in the basal flower buds. A similar set of experiments was observed in which plastid direction sequences were not used in conjunction with ORF438 and tyrosinase genes, with no alteration of the phenotype. Presumably, the plants were not able to produce melanin, due to the deficiency of the substrates required in the cellular cytosol of the plant. Plastid targeting sequences (transit peptides) are available from a number of plastid proteins nuclearly coded by the plant, such as the small subunit (SSU) of ribulose bisphosphate carboxylase, the genes related to the biosynthesis of the plant fatty acid, including acyl carrier protein (ACP), stearoyl desaturase-acyl carrier protein, β-ketoacyl synthase-acyl carrier protein, and acyl thioesterase-acyl carrier protein, or the LHCPII genes. The coding sequence for a transit peptide that provides transport to plastids may include all or a portion of the coding sequence for a particular transit peptide, and may also contain portions of the sequence encoding the mature protein associated with a particular transit peptide. There are numerous examples in the art of transit peptides, which can be used to deliver an objective protein to a plastid organelle. The sequence encoding the particular plastid peptide used in the present invention is not critical, as long as the delivery to the plastid is obtained. As an alternative to the use of transit peptides to direct the pigment synthesis proteins to the plastid organelles, the desired constructs can be used to transform the plastid genome directly. In this case, promoters capable of providing gene transcription in plant plastids are desired. Of particular interest is the use of a T7 promoter to provide high levels of transcription. Since the plastids do not contain a polymerase suitable for transcription from the T7 promoter, the T7 polymerase can be expressed from a nuclear construct, and can be targeted to the plastids using the transit peptides as described above. (See McBride et al. (1994) Proc. Nat. Acad. Sci. 91: 7301-7305; see also the pending United States Patent Application entitled "Controlled Expression of Transgenic Construets in Plant Plastids", serial number, filed on June 6, 1995, and the Patent Application of the United States of America pending with Serial Number 08 / 167,638 filed on December 14, 1993, and Patent Number PCT / US94 / 14574 filed on December 12, 1994). Tissue specific or developmentally regulated promoters may be useful for the expression of T7 polymerase, in order to limit expression to the tissue or to the appropriate stage of development. For example, for the modification of the color of the flower, the T7 polymerase can be expressed from a specific promoter of petals, to limit the effects to the desired tissue. The direction of the genes for the synthesis of melanin to vacuoles is also of interest in the tissues of plants that accumulate the tyrosine substrate involved in the synthesis of melanin in vacuoles. The signal of the protein to be directed to the vacuoles can be provided from a plant gene that is normally transported through the crude endoplasmic reticulum, such as the N-terminal 32 amino acid region of the tomato metalocarboxypeptidase inhibitor gene. (Martineau et al. (1991) Mol. Gen. Genet, 228: 281-286). In addition to the signal sequence, vacuolar directed constructs also encode a vacuolar localization signal (VLS) placed at the carboxy terminus of the encoded protein. Appropriate signal sequences, and vacuolar localization signal regions, can be obtained from other different plant genes, and can be used similarly in the constructions of this invention. Numerous vacuolar direction peptides are known in the art and are reviewed in Chrispeels et al., Cell (1992) 68: 613-616. Accordingly, it is recognized that the constructs of the present invention, which provide sequences encoding genes involved in the production of color, and sequences that provide the direction of the gene products towards the appropriate cellular locations, have a wide application to modify the color in different plant tissues. The plant transcription initiation regions for use with these color modification constructions will depend on the particular plant tissue to be modified. For the modification of cotton fiber, for example, cotton-fiber specific promoters, or the pZ7 promoter described herein, may find use. Additional cotton fiber promoters that may find use in the methods of the present application are described in the pending United States Patent Application of Pear et al. Entitled "Cotton Fiber".

Transcriptional Factors, "with serial number, filed on June 7, 1995. For the modification of the color of the flower, promoters are of interest from genes preferentially expressed in flowers, and particularly in the petals of the flower. examples of promoters useful for expression in flowers include chalcone synthase, as described in Holton et al. (1994) TIBTECH, Volume 12, pages 40-42 (see also, Napoli et al. (1990) Plant Cell, Volume 2, pages 79-89; Lipphardt et al. (1988) EMBO, 7 (13) pages 4027-4034; and Toguri et al. (1993) Plant Mol. Biol, Volume 23, pages 933- 946. Also of interest are the genes involved in the production of colored pigments in plant tissues, such as the Al Ma gene, which encodes a reductase of dihydroflavonol, an enzyme from the path of anthocyanin pigmentation.In cells expressing the Al gene, dihydrochempferol becomes It is expressed in 2,8-alkyl-leucopelargonidin, which can be further metabolized to obtain the pelargonidin pigment by enzymes endogenous to the plant. Other pigments of the anthocyanin or flavonoid type may also be of interest for the modification of the fibers of the cotton cells, the flowers of the plant, or other plant tissues. For a review of the color of the plant flower, see van Tunen et al. (In Plant Biotechnology series, Volume 2 (1990), Developmental Regulation of Plant Gene Expression, D. Grierson ed). Although cotton fibers in commercially grown varieties are primarily white in color, other cotton varieties that occur naturally have chestnut or reddish-brown fibers. A cotton line containing green fibers has also been identified. The existence of these colored cotton lines suggests that the precursors required for the anthocyanin pigment trajectories are present in the cells of the cotton fibers, thus allowing other mocations of the color phenotype. For some applications, it is of interest to mo other aspects of the structures that develop from the integument of the ovary, and related structures. For example, it is of interest to mo erent aspects of cotton fibers, such as the strength or texture of a fiber. Accordingly, the appropriate gene can be inserted into the constructs of the invention, including genes for PHB biosynthesis (see, Peoples et al., J. Biol. Chem. (1989) 264: 15298-15303, and IJbid. 15397; Saxe a, Plant Molecular Biology (1990) 15: 673-683, which discloses the cloning and sequencing of the catalytic subunit gene of cellulose synthase, and Bowen et al., PNAS (1992) 89: 519-523, which gives to know the chitin synthase genes of Saccharomyces cerevisiae and Candida albicans). Transcription cassettes can be used when transcription of an anti-sense sequence is desired. When the expression of a polypeptide is desired, expression cassettes that provide for the transcription and translation of the DNA sequence of interest will be used. Different changes are of interest; these changes may include modulation (increase or decrease) in the formation of particular saccharides, hormones, enzymes, or other biological parameters. These also include modifying the composition of * the final fruit or fiber, that is, change the proportion and / or quantities of water, solids, fiber, or sugars. Other phenotypic properties of interest to be modified include stress response, organisms, herbicides, sow formation, growth regulators, and the like. These results can be achieved by providing reduction of the expression of one or more endogenous products, particularly an enzyme or a cofactor, either by producing a transcription product that is complementary (antisense) to the transcription product of a gene native, to inhibit the maturation and / or expression of the transcription product, or by providing expression of a gene, either endogenous or exogenous, to be associated with the development of a plant fruit. The termination region that is used in the expression cassette will be primarily a convenience, since the termination regions appear to be relatively interchangeable. The termination region may be native to the transcription initiation region, may be native to the DNA sequence of interest, and may be derived from another source. The termination region may occur naturally, or may be wholly or partly synthetic. Suitable termination regions are available from the Ti plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. In some embodiments, it may be desirable to use the native 3 'terminator region for the ovarian tissue transcription initiation region used in a particular construct. As described herein, in some instances additional nucleotide sequences will be present in the constructs, to provide the direction of a particular gene product towards specific cellular locations. For example, where coding sequences are used for the synthesis of aromatic colored pigments in a construct, particularly coding sequences for enzymes having as their substrates, aromatic compounds such as tyrosine and indole, it is preferable to include sequences that provide the delivery of the enzyme to the plastids, such as a small subunit transit peptide sequence. Also, for the synthesis of pigments derived from tyrosine, such as melanin, the direction towards the vacuole can provide better color changes. For melanin production, the tyrosinase and ORF438 genes from Streptomyces antibioticus (Berman et al. (1985) 37: 101-110) are provided in cotton fiber cells for expression from a pZ130 promoter. In Streptomyces, the ORF438 and tyrosinase proteins are expressed from the same promoter region. For expression from constructs in a transgenic plant genome, the coding regions can be provided under the regulatory control of separate promoter regions. The promoter regions may be the same or different for the two genes. Alternatively, a coordinated expression of the two genes can be desired from a single plant promoter. Constructs for the expression of the tyrosinase and ORF438 gene products from the pZ130 promoter regions are described in detail in the following examples. Additional promoters, for example, viral plant promoters, such as CaMV 35S, can also be desired, which can be used for the constitutive expression of one of the desired genetic products, the other genetic product being expressed in cotton fiber fabrics from promoter pZ130. In addition, the use of other plant promoters for the expression of genes in cotton fibers, such as the Brassica seed promoters, and the E6 gene promoter discussed above is also considered. In a similar way, other constitutive promoters may also be useful in certain applications, for example the plus, Mac, or DoubleMac promoters, described in U.S. Patent No. 5,106,739, and by Comai et al., Plant Mol. Biol. (1990) 15: 373-381. When plants comprising multiple genetic constructions are desired, for example, plants that express the melanin, ORF438, and tyrosinase genes, plants can be obtained by cotransformation with both constructions, or by transformation with individual constructions, followed by breeding methods. plants, to obtain plants that express both desired genes. The different constructions will normally bind to a marker for selection in the cells of the plants.

Conveniently, the label can be of resistance to a biocide, particularly an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, or the like. The particular marker used will be one that allows the selection of transformed cells, comparing with cells lacking the DNA that has been introduced. Components of DNA constructs, including the transcription cassettes of this invention, can be prepared from sequences that are native (endogenous) or foreign (exogenous) to the host. Strange means that the sequence is not found in the wild-type host into which the construct is introduced. The heterologous constructs will contain at least one region that is not native to the gene from which the transcription initiation region of the ovarian tissue is derived. In the preparation of the constructions, the different DNA fragments can be manipulated, to provide DNA sequences in the appropriate orientation, and as appropriate, in the appropriate reading frame for expression; adapters or linkers can be used to join the DNA fragments, or other manipulations can be involved to provide convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. In vitro mutagenesis, primer preparation, restriction, annealing, resection, ligation, or the like may be employed, where insertions, deletions, or substitutions may be involved, for example transitions and transversions. Conveniently, a vector or cassette may include a multiple cloning site downstream from the ovarian-related transcription initiation region, such that the construct can be employed for a variety of sequences in an efficient manner. In carrying out the different steps, cloning is employed, to amplify the amount of DNA, and to allow the DNA to be analyzed in order to ensure that the operations have occurred in the proper manner. By appropriate manipulations, such as restriction, filling in draperies to provide blunt ends, ligation of linkers, or the like, complementary ends of the fragments can be provided for binding and ligation. There is a wide variety of cloning vectors available, wherein the cloning vector includes a functional replication system in E. coli, and a marker that allows the selection of the transformed cell. Illustrative vectors include pBR332, the pUC series, the M13mp series, pACYC184, and so on. Accordingly, the sequence can be inserted into the vector at an appropriate restriction site, the resulting plasmid can be used to transform the E host. coli, the E Coli can be grown in an appropriate nutrient medium, and the cells can be harvested and lysed, and the plasmid can be recovered. The analysis may involve sequence analysis, restriction analysis, electrophoresis, or the like. After each manipulation, the DNA sequence to be used in the final construction can be restricted and linked to the next sequence. Each of the partial constructs can be cloned in the same plasmids or in different plasmids. There are a variety of techniques available and known to those skilled in the art for the introduction of constructs into a plant cell host. These techniques include transfection with DNA using A. tumefaciens or A. rhizogenes as the transfection agent, protoplast fusion, injection, electroincorporation, acceleration of particles, etc. For transformation with Agrobacterium, the plasmids can be prepared in E. coli, which contains DNA homologous with the Ti plasmid, particularly T-DNA. The plasmid may or may not be able to replicate in Agrobacterium, that is, it may or may not have a broad spectrum prokaryotic replication system, as does, for example, pRK290, depending in part on whether the transcription cassette will be integrated into the Ti plasmid, or whether it will be retained on an independent plasmid. The Agrobacterium host will contain a plasmid having the vir genes necessary for the transfer of the T-DNA to the cells of the plant, and may or may not have the complete T-DNA. At least the right border, and often both the right border and the left border of the T-DNA of the Ti or Ri plasmids, will be joined as flanking regions to the transcription construct. The use of T-DNA for the transformation of plant cells, has received an extensive study, and is widely described in the European Patent Application EPA with Serial Number 120,516, of Hoekema, In: The Binary Plant Vector System Offset-drukkerij Kanters BV , Alblasserda, 1985, Chapter V, Knauf et al., Genetic Analysis of Host Range Expression by Agrobacterium, In; Molecular Genetics of the Bacteria-Plant Interaction, Puhler, A. ed. , Springer-Verlag, NY, 1983, page 245, and An et al., EMBO J. (1985) 4: 277-284. For infection, particle acceleration, and electroincorporation, a disarmed Ti plasmid may be introduced that lacks particularly the tumor genes that are found in the T-DNA region in the plant cell. By means of an auxiliary plasmid, the construction can be transferred to A. tumefaciens, and the resulting transfected organism can be used to transfect a plant cell; you can grow explants with A. tumefaciene or transformed A. rhizogenes, to allow the transfer of the transcription cassette to the cells of the plants. Alternatively, to improve integration into the plant genome, terminal transposon repeats can be used as borders in conjunction with a transposase. In this situation the expression of the transposase must be inducible, in such a way that once the transcription construct is integrated into the genome, it must be integrated in a relatively stable manner. Then the cells of transgenic plants are placed in an appropriate selective medium for the selection of the transgenic cells, which are then cultivated to form calluses, grown shoots, and seedlings generated from the shoots, by means of the culture in a rooting medium. . To confirm the presence of the transgenes in the cells of transgenic plants, a Southern blot analysis can be performed using methods known to those skilled in the art. The expression products of the transgenes can be detected in any of a variety of ways, depending on the nature of the product, and include immunoassay, enzyme assay, or visual inspection, for example, to detect the formation of the pigment in the part or in the cells of the appropriate plant. Once transgenic plants have been obtained, they can be grown to produce fruit having the desired phenotype. Fruit or parts of the fruit, such as cotton fibers, can be harvested, and / or the seed can be harvested. The seeds can serve as a source to grow additional plants that have the desired characteristics. The terms "transgenic plants" and "transgenic cells" include plants and cells derived from transgenic plants or from transgenic cells. The different sequences provided herein can be used as molecular probes for the isolation of other sequences that may be useful in the present invention, for example, to obtain related transcription initiation regions from them or from different plant sources. . The related transcription initiation regions that can be obtained from the sequences provided in this invention will show at least a homology of about 60 percent, and the most preferred regions will show a still greater homology percentage with the probes. Of particular importance is the ability to obtain related transcription initiation control regions having the time and tissue parameters described herein. For example, using the pZ130 probe, at least seven additional clones have been identified, but have not been further characterized. Accordingly, by employing the techniques described in this application, and other techniques known in the art (such as Maniatis et al., Molecular Cloning, - A Laboratory Manual (Cold Spring Harbor, New York) 1982), can be determined other transcription initiation regions capable of directing transcription to ovarian tissue, as described in this invention. The constructions can also be used in conjunction with plant regeneration systems, to obtain plant cells, and plants; the constructions can also be used to modify the phenotype of a fruit, and fruits produced by them. For the modification of the color of the flower, you can use the transformation of different species of flowering plants, if desired, including the transformation of carnations, roses, gerbera, lilacs, orchids, petunias, and chrysanthemums. For cotton applications, different varieties and cotton lines may find use in the methods described. The cultivated cotton species include Gossypium hirsutum and G. bafcadense (extra-long stable, or Pima cotton), which evolved in the New World, and the Old World crops of G. herbacium and G. arboreum. The following examples are offered by way of illustration and not limitation.

EXPERIMENTAL The following deposits have been made in the American Type Culture Collection (ATCC) (12301 Parklawn Drive, Rockville, MD 20852). The bacteriophages Calgene Lambda 116 and Calgene Lambda 140, each containing a transcription initiation region of this invention, were deposited on July 13, 1989, and received accession numbers 40632 and 40631, respectively.

Example 1 Construction of Pre-Anthesis Tomato Ovary cDNA Banks and Tracking of Ovarian Specific Clones Preparation of the cDNA Library Tomato plants (Lycopersicon esculentum cv UC82B) were grown under greenhouse conditions. Poly (A) + RNA was isolated as described by Mansson et al., Mol. Gen Genet (1985) 200: 356-361. The synthesis of cDNA from poly (A) + RNA, prepared from ovaries of unopened tomato flowers (pre-anthesis stage), was performed using the BRL cDNA Cloning Kit, following the manufacturer's instructions (BRL Bethesda, MD). The addition of restriction endonuclease EcoRI linkers (1078, New England Biolabs; Beverly, MA) to the resulting double stranded cDNA was performed using the procedures described in Chapter 2 of DNA Cloning Vol. I: A Pratical Approach, Glover, ed. , (BRL Press, Oxford 1985). The cDNA was cloned into the EcoRI site of the Lambda ZAP phage (Stratagene, La Jolla, CA) and the resulting recombinant phage packing (using GigaPack Gold, Stratagene), as described in the respective commercial protocols. The cDNA libraries were prepared as described above, from the same mRNA of the pre-anthesis stage. For the second library, which contained cDNA significantly longer than the first, the poly (A) + RNA sample was passed through a centrifugal RNA column (Boehringer Mannheim Biochemicals, Indianapolis, IN), following the manufacturer's instructions, before the cloning procedures.

Screening of the cDNA library The first cDNA library was screened by differential hybridization using 32P-labeled cDNA probes, made from the pre-anthesis mRNA, leaf mRNA, and young seedling mRNA. The clones were selected based on hybridization to only the pre-anthesis mRNA. The cDNAs corresponding to the selected Lambda ZAP clones (Stratagene) were cut from the phage vector, and propagated as plasmids (following the manufacturer's instructions). From an initial screening of 1,000 cDNAs, 30 selected clones were isolated that fall into five classes, based on the sequences of their cDNA inserts. Two clones were selected, clones pZ7 and pZ8 for another study. The DNA sequences of pZ7 and pZ8 are shown as the underlined portions of Figures 1 and 4, respectively. Several thousand recombinant clones were screened from the second cDNA library by plaque hybridization (as described in the Stratagene Cloning Kit Instruction Manual) with a mixture of radiolabelled DNA probes. The screening of approximately 3,000 clones from the second library with the DNA probes of pZ7 and pZ8, produced the selection of fourteen clones that had strong hybridization signals. The selected clones were cut from the phage vector, and prepared as plasmids. The DNA of each clone was isolated, cut with the restriction endonuclease EcoRI, then passed through electrophoresis through a 0.7 percent agarose gel. Duplicate stain hybridizations were performed as described in Maniatis et al., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York, 1982), with radiolabeled probes representing the genes of interest (pZ7 and pZ8). Seven clones were selected that were hybridized in pZ7, and three clones that were hybridized in pZ8. The longest of these for each probe, pZ130 (hybridization in pZ7) and pZ70 (hybridization in pZ8) were further characterized, and used in further experiments.

Example 2 Analysis of cDNA Clones Northern Analysis The tissue specificity of the cDNA clones was demonstrated as follows: RNA was isolated from ovaries of tomato, tomato leaves, and unorganized tomato callus at the stage of 1, 2, 3, 4, 5 , 6, 7, 10, 14, 17, and 21 days after the anthesis, in the anthesis, and in the pre-anthesis, using the method of Ecker and Davis, Proc. Nati Acad. Sci. USA, 84: 5203 (1987) with the following modifications. After the first nucleic acid precipitation, the granules were resuspended in 2 milliliters of diethyl pyrocarbonate (DEP) treated with water on ice. The solutions were brought to 1 mM MgCl 2, and 1/4 the volume of 8 M LiCl was added. The samples were mixed well and stored at 4 ° C overnight. Then the samples were centrifuged at 8,000 rpm for 20 minutes at 4 ° C. The granules were dried, resuspended in water treated with diethyl pyrocarbonate on ice as before, and precipitated in ethanol once more. The RNAs were electrophoresed on formaldehyde / agarose gels according to the method described by Fourney et al., Focus (1988) 10: 5-7, immobilized on Nytran membranes (Schleicher &Schuell; Keene, NH), and they were hybridized with probes labeled with 32P.

Based on Northern analysis with an EcoRI insert DNA of 32 P labeled pZ7, or an EcoRI insert DNA of pZ8, it is clear that both genes are more highly expressed in the anthesis in the UC82B tomato variety, and are expressed a little less highly before, and a day after, the opening of the flower. Figure 6 shows tomato flowers in different stages of development, and immediately afterwards, a representative ovary dissected from a flower in the same stage of development. As seen in Figure 6, two days after the establishment of anthesis, the expression of both genes has fallen dramatically. The size of the species of mRNA that hybridizes in the pZ7 probe was approximately 800 nt, and in the pZ8 probe approximately 500 nt. Two days after anthesis, pZ8 RNA accumulation apparently remained at a relatively low level, while pZ7 RNA accumulation continued to fall continuously until, at three weeks after anthesis, it was no longer detectable through this analysis. Accumulation of pZ8 RNA was not detectable by the method described above, in RNA samples isolated from tomato fruit older than the immature green stage of fruit ripening. No RNA hybridization was found in pZ7 or in pZ8 in the callus tissue; no hybridization of RNA in pZ7 was found in the leaf tissue; over longer exposures, a barely detectable hybridization signal for pZ8 was seen in the leaf RNA.

Expression Level The message abundance corresponding to the cDNA probe was determined, comparing the intensity of hybridization of a known amount of RNA synthesized in vitro, from the clones (using T7 or T3 RNA polymerase in the Riboprobe System (Promega )), with tomato ovarian RNA from the anthesis stage and three weeks of age. This analysis indicated that the cDNAs of pZ7 and pZ8 represent abundant RNA classes in tomato ovaries at the anthesis stage, which is approximately 5 percent and 2 percent of the message, respectively.

Cellular Specificity The cellular specificity of cDNA probes can be demonstrated using the site hybridization technique. The tomato ovaries from the pre-anthesis stage UC82B, were fixed overnight in a solution of 4 percent paraformaldehyde, phosphate-regulated serum (PBS), 5 mM MgCl2, pH 7.4 (phosphate-regulated serum is regulator of 10 mM phosphate, pH 7.4, 150 mM NaCl) (Singer et al., Biotechniques (1986) 4: 230-250). After fixation, the tissue was passed through a series of graduated tertiary butyl alcohol (TBA), starting in 50 percent alcohol, infiltrated with Paraplast, and emptied into paraffin blocks to be sectioned (Berlyn and Miksche, Botanical Microtechnigue and Cytochemistry, (1976) Iowa). Crossed ovaries were cut transversely, in sections of 8 micrometers thick, in a rotary microtome Reichert Histostat. Paraffin strips containing 5 to 7 sections of ovary were fixed on chromium-alum gelatin-coated slides (Berlyn and Miskche (1976) supra), and were kept in a powder-free box until hybridizations were performed on the site. The plates ready to hybridize were deparaffinized in xylene, and rehydrated by passing them through a series of hydration in ethanol, as described in Singer et al., Supra (1986). A 2X hybridization mixture consisting of 100 microliters of 20X SSC, 20 microliters of 10 percent bovine serum albumin, 100 microliters of 750 mM DTT, 200 microliters of 50 percent dextran sulfate, 50 microliters of RNasin, was made. and 30 microliters of sterile water. Probes of sense and anti-sense 35S-RNA were generated from cDNAs of interest, using in vitro transcription of T3 and T7 RNA polymerases (Riboprobe Promega Biotec or Stratagene), following the manufacturer's protocol. 2.5 microliters of tRNA (20 milligrams / milliliter), 2.5 microliters of salmon sperm DNA (10 milligrams / milliliter), and 4 x 106 cpm / probe were dried using a lyophilizer. This mixture was then resuspended in 25 microliters of 90 percent formamide containing 25 microliters of 2X hybridization mixture per plate. 40 microliters of this hybridization mixture were placed on each plate. A coverslip was placed over the sections, and the edges were sealed with rubber cement. The slides were placed in plate holders inside a box of glass plates, covered, and placed in a dry oven at 37 ° C overnight to hybridize. Treatments after hybridization were as described in Singer et al. (1986), supra. Autoradiography was performed as described in KODAK Materials for Light Microscope (KODAK (1986); Rochester, NY), using NTB-3 in liquid emulsion. The slides were allowed to be exposed in a light-proof box for approximately 2 weeks. After revealing the autoradiographic plates, sections were stained in 0.05 percent toluidine blue, and then dehydrated through a series of graduated alcohol; xylene: 100 percent ethanol, 1: 1, followed by two changes of 100 percent xylene, five minutes in each solution. The coverslips were mounted with Cytoseal (VWR, San Francisco, CA), and were left on a plate heater until dry (45 to 50 ° C, 1 to 2 days).

Then the autoradiographic plates were ready for the microscopic examination. When the pre-anthesis ovaries of tomato were hybridized to the sense and anti-sense 35S-pZ7 RNA, the anti-sense transcripts hybridized specifically to the outer pericarp region of the ovary, and to the outer region of the ovules ( the integuments). The sense transcripts (negative control) showed no hybridization. When pre-anthesis ovaries of tomato were hybridized to sense and anti-sense 35S pZ8 RNA, the antisense transcript hybridized specifically to the region of the inner nucleus of the ovary, and to the outer region of the ovules. The sense transcripts did not show hybridization. In summary, the transcripts of the mRNA encoded by the genes corresponding to pZ7 and pZ8, were expressed abundantly during a very specific stage of the development of the tomato fruit, primarily in the anthesis and a day before, and after, the opening of the flower. The transcripts were additionally expressed in a specific subset of tomato ovary cell types during this stage of development, particularly in the integuments (pZ7 and pZ8, as well as in the outer pericarp of the ovary (pZ7) and in the inner core region (pZ8).

EXAMPLE 3 Sequencing of cDNA Clones pZ130 v pZ70 The complete DNA sequences of clones pZ130 and pZ70 of the cDNA were determined using the dideoxy technique of Sanger et al. (1971). The DNA sequences of both pZ130 and pZ70 were transferred in three frames. The sequences, including the longest open reading frame for each, are shown in Figure 1 (pZ130) and Figure 4 (pZ70).

Example 4 Analysis of the Genetic Family The Southern analysis was performed as described in Maniatis et al., Supra (1982). The total tomato DNA from the UC82B culture was digested with BaHI, EcoRI, and HindIII, separated by agarose gel electrophoresis, and transferred to nitrocellulose. Southern hybridization was performed using probes labeled with 32P produced by random priming of pZ130 or pZ70. A simple hybridization pattern indicated that the genes encoding pZ130 and pZ70 are present in a few, or perhaps only one, copy in the tomato genome. Further analysis, using a pZ130 hybridization probe to hybridize in tomato genomic DNA digested with the restriction endonuclease BglII, indicated that this gene is actually a member of a small family (approximately 5 to 7 members). The clone of the original pZ7 cDNA, consisting of sequences restricted to the 3 'untranslated region of the longer clone pZ130, however, is strongly hybridized only in one band, and perhaps in a second band, based on Southern analysis using Genomic DNA of tomato digested with BglII.

Example 5 Preparation of Genomic Clones P2130 and PZ7Q Two genomic clones were obtained, representing each of the cDNA clones pZ130 and pZ70, as follows. A genomic library constructed from DNA from the tomato cultivar UC82B, partially digested with the restriction endonuclease Sau3A, was established in the Lambda phage vector, lambda-FIX, according to the manufacturer's instructions (Stratagene, La Jolla, CA). This library was tracked using pZ130 and pZ70 labeled with 32P as probes. A genomic clone containing approximately 14.5 kb of sequence was isolated from the tomato genome, which was hybridized in pZ70. The region that hybridizes to the pZ70 probe was found inside the Xbal-HindIII restriction fragment of approximately 2 kb of Calgene Lambda 116 (see Figure 5). A second genomic clone, which contained approximately 13 kb of sequence from the tomato genome, was isolated and hybridized in pZl30 (and in pZ7). The region that hybridized on the pZ130 probe was found inside the larger EcoRI-HindIII restriction fragment of Calgene Lambda 140 (see Figure 3).

Preparation of pCGN2015 pCGN2015 was prepared by digesting pCGN565 with Hhal, blunting it with mung bean nuclease, and inserting the resulting fragment into a BluescriptKSM13- (Stratagene) vector digested with EcoRV, to create the pCGN2008 gene. The pCGN2008 gene was digested with EcoRI and HindIII, blunted with Klenow, and the chlaramphenicol fragment of 1.156 base pairs was isolated. BluescriptKSM13 + (Stratagene) was digested with Dral, and the 2,273 base pair fragment was isolated and ligated with the chloramphenicol fragment pCGN2008 creating pCGN2015.

Preparation of pCGN2901 / pCGN2902 pCGN2901 contains the region surrounding the pZ7 hybridization pressure of genomic clone pZ130, including approximately 1.8 kb in the 5 'direction, and approximately 4 kb in the 3' direction. To prepare pCGN2901, Calgene Lambda 140 was digested with Sali, and the resulting fragment containing the pZ7 hybridization region was inserted into pCGN2015, at the unique SalI site of pCGN2015, to create pCGN2901. PCGN2902 contains the other SalI fragment (which does not hybridize in pZ7) of the pZ130 genome derived from SalI digestion of Calgene Lambda 140 also placed in a pCGN2015 construct.

EXAMPLE 6 Preparation of an Expression Construction of PZ130 Plasmid DNA isolated from pCGN2901, was digested to completion with Ncol, and then treated with exonuciease isolated from mung beans (Promega, Madison, Wl), to eliminate the sequences of Single-stranded DNA, including the ATG sequence that forms a portion of the Ncol recognition sequence. Then the sample was digested until finished with Sacl. The resulting Sacia Ncol 5 'fragment of 1.8 kb (approximate) was then inserted into an ampicillin resistant plasmid derived from pUC, pCGP261 (described below), which had been prepared as follows. PCGP261 was digested until complete with Zbal, the single-stranded DNA sequences were filled in by treatment with the full polymerase I fragment of the DNA, and the pCGP261 DNA was re-digested with Sacl. The resulting expression construct contained, in the 5 'to 3' direction of transcription, an ovarian tissue promoter derived from Lambda 140, a tmr gene, and the 3 'transcription termination region of tmr. Plasmid pCGP261 contains the sequences from position 8,762 to 9,836 of the octopine Ti plasmid of Agrobacterium tumefaciens pTil5955 (as sequenced by Barker et al., Plant Molec. Biol. (1983) 2: 335-350). This region contains the entire coding region for the genetic site designated as tmr, which encodes the isopentenyltransferase (Akiyoshi et al., PNAS (1984) 81: 4776-4780), 8 base pairs 5 'of the ATG codon of the translational initiation, and of 341 base pairs of sequences 31 for the TAG codon of translation arrest. Plasmid pCGP261 was created as follows. Plasmid pCGN1278 (described in pending application of the United States of America 382,176 filed July 19, 1989, which is hereby incorporated by reference in its entirety), was digested with Xbal and EcoRl. The single-stranded DNA sequences produced were filled by treatment with the Klenow fragment of DNA polymerase I. The Xbal to EcoRI fragment containing the tmr gene was then ligated into the ml3 Bluescript- vector (Stratagene Inc., La Jolla, CA) at the Smal site, resulting in the plasmid pCGP259. The entire region found upstream of the ATG translation initiation codon, and some of the tmr gene coding region, was removed by digestion of pCGP259 with BspMI and BstXI. The resulting coding region, and 8 base pairs of the sequence originally found upstream of the first ATG codon, were reintroduced into the plasmid, and an Xbal site was introduced into the plasmid by means of a synthetic oligonucleotide comprising the following sequence: 5 'AATTAGATGCAGGTCCATAATTTTTTTCTAGACGCG 3'. The resulting plasmid is pCGP261. A fragment of Xbal to Kpnl from pCGP261 containing the pZ130 gene 5 'was then inserted., and then the coding construct of the tmr gene and the 3 'region was inserted into a binary cassette such as pCGN1557, and transgenic plants were prepared. (See the pending application of the United States of America with Serial Number 382,176 described above).

Example 7 Preparation of the Promoter Cassette of pZ130 The cassette of pZ130 contains 1.8 kb (pCGN2909) or 5 kb (pCGN2928) of the 5 'DNA of the translation start site, and region 31 (from the TAA stop codon to the downstream 2 kb site) of the pZ130 gene. The pZ130 cassettes were constructed as follows.

Recription of Transcription Initiation The plasmid DNA isolated from pCGN2901 (see above) was digested to completion with Ncol, and then treated with exonuciease isolated from mung beans (Promega, Madison, Wl) to remove the DNA sequences of a single chain, including the ATG sequence that forms a portion of the Ncol recognition sequence. Then the sample was digested until completed with Sacl. The Sacl to Ncol 5 'fragment resulting from 1 to 8 kb was then inserted into pCGN2015 (described above) to create pCGN2904. In order to eliminate the redundant restriction enzyme sites and to make the next cloning easier, the plasmid DNA isolated from pCGN2904 was digested until complete with SalI and EcoRI, and the resulting 1.8 kb fragment, containing the 5 'sequences of pZ130, was inserted into pBluescriptII (Stratagene; La Jolla, CA) to create pCGN2907.

Transcription and Translational Termination Region Plasmid DNA isolated from pCGN2901 was digested to completion with EcoRI and BamHI. The resulting 0.72 kb EcoRI to BamHl fragment, located downstream (3 ') from the coding region of pZ130, was inserted into pCGN2907, creating pCGN2908. The insertion of the 0.5 kb DNA sequence (approximately), including the TAA stop codon of the pZ130 gene, and the sequences between the stop codon and the downstream (3 ') EcoRI site, and the addition of unique restriction sites to facilitate the insertion of foreign genes, performed as follows. A polylinker / "primer" comprising the 5 'sequence GTTCCTGCAGCATGCCCGGGATCGATAATAATTAAGTGAGGC-3' was synthesized to create a polylinker with the following sites: Pstl-Sphl-Smal-Clal, and to include the TAA stop codon of the pZ130 gene, and following 13 base pairs (31) of the sequence of region 30 of pZ130. Another oligonucleotide comprising the sequence 5 • -CAAGAATTCATAATATTATATATAC 3 'was synthesized to create a "primer" with an EcoRI restriction site, and 16 base pairs of the 3' region of the pZ130 gene immediately adjacent to the EcoRI site located at approximately 0.5 kb 3 'of the TAA stop codon of the pZ130 gene. These synthetic oligonucleotides were used in a polymerase chain reaction (PCR), where the plasmid DNA isolated from pCGN2901 was used as the substrate in a thermal cycler (Perkin-Elmer / Cetus, Norwalk, CT) in accordance with the manufacturer's instructions. The resulting 0.5 kb DNA product was digested to completion with PstI and EcoRI, and the resulting 0.5 kb DNA fragment was inserted into pCGN2908 to create pCGN2909. The complete DNA sequence of the 0.5 kb region from the PstI site to the EcoRI site was determined using the dideoxy technique of Sanger et al. (1971), to verify that no sequence errors had occurred between the oligonucleotide primers during the polymerase chain reaction. The cassette of pZ130, pCGN2909, therefore, comprises the 5 * DNA sequences of pZ130 from the SalI site at position 808 to position 2636 (see Figure 2), whose unique sites Pstl, Sphl, and Smal can be used conveniently for inserting genes, and the 3 'DNA sequences of pZ130 from the TAA stop codon at position 3173 (Figure 2) to the BamHI site at position 4380.

Example 8 Preparation and Analysis of Test Constructs A reporter gene of β-glucuronidase (GUS) was used to evaluate the expression and tissue specificity of the pZ130-GUS constructs. The GUS is a useful reporter gene in plant systems, because it produces a highly stable enzyme, there is little or no background (endogenous) enzyme activity in plant tissues, and the enzyme is easily assayed using fluorescent or spectrophotometric substrates. (See, for example, Jefferson, Plant Mol. Rep. (1987) 5: 387-405). There are also isochemical stains for the available GUS enzyme activity, which can be used to analyze the pattern of enzyme accumulation in transgenic plants. Jefferson (1987), supra. A cassette of pZ130 and pCGN2928 was prepared by inserting the Kpnl fragment into Sali of 3.2 of pCGN2059 at the Kpnl and Sali sites of pCGN2909. PCGN2059 was prepared by inserting the SalI to BglII fragment of 3.2 from pCGN2902 into M13mpl9. Accordingly, pCGN2928 is identical to pCGN2909, with the exception that it includes approximately an additional 3.2 kb of the DNA sequence of pZ130 upstream of the SalI site located at position 808 of Figure 2.

Preparation of the Test Constructs of pCGN2917 and PCGN2918 These constructs contain 1.8 kb of the 5 'sequence of pZ130, the coding region of the GUS gene, and 1.8 kb of the 3' sequence of pZ130. PCGN2917 and pCGN2918 differ from each other only in the orientation of the pZ130 / GUS construct with respect to the other elements of the binary vector plasmid, for example, the 35S promoter from CaMV. Constructs were made by inserting the PstI fragment of pRAJ250 (Jefferson (1987) supra), or any other plasmid construct having the fragment PstI containing the GUS coding region, in the PstI site of pCGN2909. The resulting plasmid, which has the GUS gene in the sense orientation with respect to the promoter region of the pZ130 gene, was designated pCGN2914. The pZ130 / GUS construct was cut as a fragment from Xbal to Kpnl, and cloned into the binary vectors pCGN1557 and pCGN1558, to make pCGN2917 and pCGN2918, respectively. PCGN1557 and pCGN1558 are described in McBride and Summerfelt, Plant Mol. Bio. (1990) 14: 269-296.

Preparation of the Test Construction of pCGN2926 This construct contains 5 kb of the 5 'sequence of pZ130, the coding region of the GUS gene, and 1.2 kb of the 3' sequence of pZ130. It was done by inserting the Kpnl fragment to Salí of 3.2 kb from pCGN2059 at the Kpnl and Salí sites of pCGN2914. The resulting plasmid was designated pCGN2923. The pZ130 / GUS / pZ130 construct of pCGN2923 was then cut as a fragment from Xbal to Kpnl, and cloned into the binary vector pCGN1557, resulting in pCGN2926.

Analysis of the GUS Enzyme Activity The β-glucuronidase activity of the transformants was measured using 4-methyl-umbelliferyl glucuronidase as a substrate, as illustrated in Jefferson (1987) supra, and the activity of the GUS enzyme was it easily detected the ovaries of the transformed plants, and quantitatively it was very high in comparison with the background of activity observed in the ovaries isolated from untransformed tomato plants, and from leaves of transformed plants. It is interesting that, upon a comparison of the transformants pCGN2917 and pCGN2918, it was discovered that proximity to a 35S CaMV enhancer region (pCGN1558), can reduce or eliminate the specificity of the ovarian tissue.

Example 9 Cotton Transformation pZ7 Preparation of EX lante 315 Coker seeds were surface disinfected by placing them in 50 percent Clorox (2.5 percent sodium hypochlorite solution) for 20 minutes, and rinsing 3 times in sterile distilled water. Following the surface sterilization, the seeds were germinated in sterile tubes of 25 x 150, containing 25 milliliters of salts 1/2 x S: vitamins 1/2 x B5: 1.5 percent glucose: 0.3 percent gelrite. Seedlings were germinated in the dark at 28 ° C for 7 days. On the seventh day, the nurseries were placed in the light at 28 + 2 ° C.

Cocultivation v Regeneration of the Plant The simple colonies of A. tumefaciens strain 2760, containing the binary plasmids pCGN2917 and pCGN2926, were transferred to 5 milliliters of MG / L broth, and cultured overnight at 30 ° C. Bacterial cultures were diluted to 1 x 108 cells / milliliter with MG / L, just before cocultivation. The hypocotyls of the 8-day-old seedlings were cut, cut into sections of 0.5 to 0.7 centimeters, and placed on tobacco feeder plates (Horsch et al., 1985). Feeder plates were prepared 1 day before use, coating with 1.0 milliliter of tobacco suspension culture on a petri dish containing Callus Initiation Medium, MIC, without antibiotics (MS salts: vitamins B5: 3 percent glucose: 0.1 milligrams / liter of 2,4-D: 0.1 milligrams / liter of kinetin: 0.3 percent gelrite, and the pH was adjusted to 5.8 before autoclaving). A sterile filter paper disk (Whatman # 1) was placed on top of the feeder cells before use. After all the sections were prepared, each section was submerged in a culture of A. tumefaciens, dried on sterile paper towels, and returned to the tobacco feeder plates. After two days of cocultivation in the feeder plates, the hypocotyl sections were placed in Callus Initiation Medium containing 75 milligrams / liter of kanamycin, and 500 milligrams / liter of carbenicillin. The tissue was incubated at 28 + 2 ° C, 30uE 16: 8 light period: dark for 4 weeks. At four weeks, the whole explant was transferred to the fresh callus initiation medium containing antibiotics. After two weeks on the second pass, the callus was removed from the explants, and divided between Calcium Initiation Medium and Regeneration Medium (MS salts: KN0340mM: NH4C110mM: vitamins B5: 3 percent glucose: gelrite 0.3 percent: 400 milligrams / liter of carb: 75 milligrams / liter of kanamycin). The embryogenic callus was identified 2 to 6 months after initiation, and subcultured on fresh regeneration medium. Embryos were selected for generation, static liquid embryonic impulse medium (Stewart's medium and Hsu: 0.01 milligrams / liter of NAA: 0.01 milligrams / liter of kinetin: 0.2 milligrams / liter of GA3), and incubated during the night at 30 ° C. The embryos were dried on paper towels, and placed in magenta boxes containing 40 milliliters of Stewart medium and Hsu solidified with Gelrite. The germinating embryos were maintained at 28 + 2 ° C 50 uE m ~ 2s_1, photoperiod of 16: 8. The seedlings with roots were transferred to land, and settled in the greenhouse. The growth conditions of cotton in the culture chambers are as follows: photoperiod of 16 hours, temperature of approximately 80 to 85 ° C, light intensity of approximately SOOμEinsteins. The growth conditions of cotton in the greenhouses are as follows: photoperiod of 14-16 hours with light intensity of at least 400μEinsteins, daytime temperature of 32 ° C-35 ° C, night temperature of 21 ° C to 24 ° C , and relative humidity of approximately 80 percent.

Analysis of the Plant The flowers of the IT plants grown in the greenhouse were labeled in the anthesis in the greenhouse. Cubes (cotton buds), flowers, pods, etc., were harvested from these plants at different stages of development, and were tested by GUS activity. Fluorometric and GUS histochemical assays were performed on manually cut sections, as described in Jefferson (1987) supra. At least ten events (transgenic plants) of each construction (pCGN2917 and pCGN2926) were sent to the Growing / Greenhouse Chambers. Approximately 80 percent (9/11) of plants 2917, and 100 percent (12/12) of plants 2926, expressed GUS at a level detectable by fluorometric or histochemical assay. The cubes of several of the plants transfected with pCGN2917 and pCGN2926 were assayed by GUS expression, using histochemical analysis, where cells expressing GUS are stained blue. The preliminary analysis indicates that all the plants expressed GUS in the floral parts in development. The ovules and anthers were stained extremely dark. Bracts and walls of locules were also blue in some cases. The fibers of 5, 9, and 12 DPA pods of these plants, were also expressing GUS. Several GUS trials were carried out on pods under development in the cube formation stages up to 53 days after anthesis. The activity of GUS is very high in the cubes and in the flowers. The activity in the pods varies from plant to plant. The activity was present in the fiber in two of the plants 2926 in 43 and 53 dpa. ß-glucuronidase is a very stable enzyme; therefore, the presence of GUS activity may not be directly correlated in a temporal manner with the expression of the gene; however, the specificity of expression in the tissues and / or structures derived from the integument of the ovary was negligible. Other tissues not derived from the ovarian integument did not show GUS activity on the background. Differences in GUS decomposition, as well as differences in expression, may explain the variability of expression patterns.

Comparisons between Cotton and Tomato Expression An initial MUG test was performed on tissues of tomato and cotton plants transfected with pCGN2917 and pCGN2918. The activity of GUS was found in the roots, stems, and leaves of tomato, as well as in the meristems, and in the floral parts. The amount of activity varied from plant to plant. In cotton, the activity was higher in the floral parts, but was detectable in the roots and stems of some plants. The tomato plants T2 of 2926 and 2917 are being labeled in the anthesis. These plants have been proven by both the expression of kan and GUS. As the fabric matures, it will be tested and photographed.

Example 10 Expression of Transgenic Melanin Synthesis Gene A binary construct is prepared for the transformation of the plant to express genes for the synthesis of melanin, as follows. The melon operon of Streptomyces antibioticus (Bernan et al. (1985) 34: 101-110) is subcloned as a Bell fragment into a Bluescript vector. The Ncol and BamHl sites are inserted by mutagenesis immediately 5 'to (and including) the ATG initiation codon for 0RF438. The resulting plasmid is pCGN4229. PCGN4229 is further mutagenized by inserting a pstl site immediately following the stop codon of 0RF438, and by adding the Ncol and BamHl sites at the initiation codon of the tyrA site, and consequently, the melon operon is provided. mutagenized A PstI site from the plasmid vector is similarly located immediately 3 * to the tyrA coding region. The cassette of pZ130, pCGN2909, is utagenized to reinsert the Ncol site including the ATG codon for the initial MET of the encoded sequence of pZ130, and results in pCGN4228. PCGN4228 is mutagenized to suppress the BamH1 site at the 3 'end of the transcription termination region of pZ130, and to insert an AscI linker fragment in place, resulting in pCGN4235. pCGN4228 is also mutagenized to suppress the 3 'BamHl site, insert an AscI linker to 51 for the transcription initiation region of pZ130 (in pCGN4228 digested with Xhol / SalI and treated with Klenow), resulting in PCGN4241 . The 0RF438 region of Streptomyces is obtained under the digestion of the mel operon construction mutagenized with Ncol and PstI, and inserted into the pCGN4235 digested with Neo / Pst. The tyrA region is cloned as an Ncol / PstI fragment from the construction of the mutagenized operon, in pCGN4241 digested with Nco / Pst. A fragment of the small subunit gene of tobacco ribulose bisphosphate carboxylase encoding the transit peptide and 12 amino acids of the mature protein is inserted, in the reading frame, with the coding sequence of the ORF 438, as an NcoI fragment. / BamHI. The fragment is similarly inserted in front of the tyrA coding sequence. The resulting constructs contain fusions of the transit peptide / 0RF438, and transit peptide / tyrA placed for expression from the 5 'and 3' regulatory regions of pZ130. A binary vector is prepared (see Figure 7) to insert the constructs of 0RF438 and tyrA, starting from pCGN1578 (McBride et al., Supra), by replacing the linker region of pCGN1578 with a linker region containing the following Restriction digestion sites: Asp718 / Asc / Pac / XbaI / BamHI / Swa / Sse / HindIII. (See Figure 8). This results in pCGN1578PASS. Ase, Pac, Swa, and Sse are restrictive enzymes that cut at 8 base recognition sites. Enzymes are available in New England BioLabs: Ase, Pac; Boehringer Manheim: Swa; and Takara (Japan): SSe. The construction of pZ130 of 0RF438 is inserted into the pCGN1578PASS as an Asp / Asc fragment. The construction of pZ130 from tyrA is inserted adjacent to the pZ130 construct of ORF438 as an Ase / Xba fragment.

Example 11 Expression of Transgenic Melanin Synthesis Gene in Tobacco Plants Transgenic tobacco plants were generated using techniques and DNA constructs provided in Examples 8 to 10. A set of non-transformed plants was used as a control. All non-transformed control plants used in this next experiment exhibited normal growth and development phenotypes. (See Table 1). A first set of transgenic plants was obtained using the binary vector pCGN4269, which expressed both the ORF438 and tyrA gene, involved in the synthesis of melanin in the cytosol of these tobacco plants. The transgenic plants obtained using pCGN4229 contained a DNA construct that contained the transcription and translation region of tomato pZ130, which was used to boost the expression of the OFR438 and tyrA gene products. The cytosol specific expression of the melanin synthesis genes produced transgenic plants that had a normal phenotype, compared with the untransformed control tobacco (Table 1). Melanin synthesis is not detectable in these plants, since substrates for melanin production are not expected to be present at high levels in the cytosol.

A second set of transgenic plants was obtained using the binary vector pCGN4272, which specifically directed the polypeptides expressed from the melanin synthesis genes to the plastids of these plants. The transgenic plants transformed with pCGN4272 contained a DNA construct containing the pZ130 transcription and translational initiation region of tomato, and the DNA encoding a small tobacco subunit transit peptide, and a 6 amino acid region of the polypeptide. of mature small subunit coupled with the OFR438 gene encoding a small tobacco subunit transit peptide, and a 6 amino acid region of the mature small subunit polypeptide coupled to the tyrA gene. The transit peptide was used to direct the transport of the ORF438 and tyrA gene products to the plastids of these plants. The expression directed to the plastid of the ORF438 and tyrA products of melanin synthesis, resulted in plants having the altered phenotype (see Table 1). Phenotypic alterations included meristem abortion, arrested growth, narrow leaves, and new leaf ripples. Alteration of the color of the plant was also observed: some of the transgenic plants exhibited yellowing of the meristem and black stripes on several portions of the plant, and different meristematic regions in relation to the control plants. In addition, the basal flower buds of these transgenic plants were extremely dark, compared with the transgenic plants that expressed the genetic products of the cytosol-specific melanin synthesis, or compared with the control plants. It is known that the pZ7 promoter results in the expression of foreign genes in tissue derived from the ovary and meristem. It is believed that the observation of this phenotype is due to the depletion of the tyrosine amino acid groups in the plastid, and / or the effect of the auxin-form melanin compounds on the growth and development of the plant.

TABLE 1 Number of plants Plants that have altered the phenotype Control 20 0 Construction of cytosol-specific DNA. 40 Construction of specific DNA of the plastid. Example 12 Constructs for Directing Pigment Synthesis Genes Constructs are prepared which have coding sequences for bacterial genes involved in the biosynthesis of pigmented compounds, and sequences for directing the transport of the encoded proteins to the plastids or vacuoles. The sequences are manipulated to be present in an NcoI / EcoRI fragment, which can then be further manipulated to add the useful transcription initiation regions to provide transcription in the tissues of the plant. Examples of useful promoters include pZ7, T7 (for the expression of the plastid), and different promoters capable of providing expression in cotton fibers or in flower petals of plants. For the address to the plastid, the constructs contain a fragment of the small subunit gene of tobacco ribulose bisphosphate carboxylase encoding the transit peptide and 12 amino acids of the mature protein (Tssu) placed in the open reading frame with the sequence of appropriate coding. For the production of indigo, the pCGN5128 (Tssu :: tna) and pCGN5129 (Tssu :: pig) find use for the direction to the plastid. The designation of tna means the gene encoding tryptophanase from E. coli, an enzyme that converts tryptophan to indole (Stewart et al., (1986) J. Bacteriol 166: 217-223). The pig designation is used for the coding sequence for the production of indigo from Rhodococcus, which produces indigo from indole (Hart et al., (1990) J. Microbiol Gen 136: 1357-1363). Both tna and pig are obtained by polymerase chain reaction. In pCGN5128 and pCGN5129, the transit of SSU includes the transit peptide of 54 amino acids of tobacco plus 12 amino acids of the mature small subunit protein. For the production of melanin in plants, the constructs pCGN5075 (Tssu :: TyrA) and pCGN5076 (Tssu:: ORF438) find a use for the direction to the plastid. In this approach, melanin synthesis comes from the expression of two proteins from Streptomyces antibioticus, the tyrA that converts tyrosine to melanin, and ORF438, which is thought to assist the tyrA enzyme in copper fixation (Bernan et al. (1985) Gene 37: 101-110). Both proteins were obtained by polymerase chain reaction. In pCGN5076 and pCGN5075, transit from the small subunit also includes the transit peptide of 54 amino acids of tobacco plus 12 amino acids of the mature small subunit. For the vacuolar direction of the melanin synthesis genes, the constructs include a fragment of the metallocarboxypeptidase inhibitor gene, which encodes all the N-terminus signal peptide of 32 amino acids of that protein plus 6 amino acids of the mature protein (CPI + 6 ) (Martineau et al., Supra), placed in the open reading frame with the appropriate coding sequences. In addition to the signal peptide, a sequence encoding a vacuolar localization signal (VLS) is inserted 3 'of the protein coding sequence. Therefore, for the production of melanin in vacuoles, CPI + 6:: tyrA:: VLS and CPI + 6:: ORF438:: VLS, are the ones used. In this example, the vacuolar localization signal used is that of the 8 amino acids obtained from beyond the C-terminus of the etalocarboxypeptidase inhibitor gene described in Martineau et al. As shown by the above results, one can have the expression of a gene of interest in cells derived from ovarian cells, including tomato fruit and cotton fibers, and the expression of the genes involved in the synthesis of pigments, combined with the appropriate targeting sequences, results in the modification of the color phenotype in the selected plant tissue. All publications and patent applications cited in this specification are hereby incorporated by reference as if each publication or individual patent application was specifically or individually indicated as being incorporated by reference. Although the invention has been described in some detail, by way of illustration and example for purposes of clarity and understanding, it will be readily apparent to ordinary experts in the field, that certain changes and modifications may be made thereto, without departing from the spirit or scope of the appended claims.

Claims (23)

1. A DNA sequence comprising, as components operably linked in the direction of transcription, a coding sequence for transport signal from a nuclear plant coding gene, and an open reading frame encoding a protein required for synthesis of a pigment.

2. The DNA sequence according to claim 1, wherein the transport signal coding sequence encodes a plastid transit peptide.

3. The DNA sequence according to claim 2, wherein this sequence further comprises a portion of the coding region of the mature protein for this nuclear plant coding gene.

4. The DNA sequence according to claim 1, wherein the transport signal coding sequence encodes a signal peptide that provides transport through the crude endoplasmic reticulum.

5. The DNA sequence according to claim 4, wherein this sequence further comprises, at 3 'for the open reading frame, a vacuolar localization signal.

6. The DNA sequence of claim 1, wherein the pigment is melanin or indigo.

7. The DNA sequence of claim 6, wherein the open reading frame is from a bacterial gene.

The DNA sequence of claim 7, wherein the bacterial gene is selected from the group consisting of ORF438, tyrA, pig, and tna.

9. A DNA construct comprising a promoter for transcription in a plant cell operably linked to the DNA sequence of claim 1.

10. The DNA construct of claim 9, in the plant cell is a cell of cotton fiber.

The DNA construct of claim 10, wherein the promoter is a tomato pZ7 promoter.

The DNA construct of claim 9, wherein the plant cell is a flower petal cell.

13. A plant cell comprising a DNA construct of claim 9.

14. A plant comprising a cell of claim 13.

15. A method for modifying the color phenotype in a plant tissue, this method comprising: transforming a plant cell with DNA comprising a construct for the expression of a protein in a pigment biosynthesis pathway, wherein this construct comprises, as the operably linked components: a functional transcription initiation region in the cells of this tissue plant, a transport signal encoding the sequence from the plant nuclear coding gene, an open reading frame encoding a protein required for the synthesis of a pigment, and a functional transcription termination region in the cells of This plant tissue, wherein said plant tissue comprises a substrate of said protein; and growing the plant cell to produce a plant comprising this tissue, wherein the protein reacts with the substrate to produce the pigment.

16. The method of claim 15, wherein the transport signal coding sequence encodes a plastid transit peptide.

The method of claim 15, wherein the transport signal coding sequence encodes a signal peptide that provides transport through the crude endoplasmic reticulum.

18. The method of claim 16, wherein the DNA comprises constructs for the expression of two proteins in a pigment biosynthesis path, wherein each of the constructs comprises components i) through iv), and wherein these two proteins do not they are encoded by the same gene.

The method of claim 7, wherein the DNA comprises constructs for the expression of two proteins in a pigment biosynthesis path, wherein each of the constructs comprises components i) to iv), and wherein these two Proteins are not encoded by the same gene.

The method of claim 18 or 19, wherein the pigment is melanin, and the proteins are encoded by tyrA and ORF438.

The method of claim 18, wherein the pigment is indigo, and the proteins are tna and pig.

22. The method of claim 15, wherein the tissue of the plant is a cotton mat.

23. The method of claim 15, wherein the plant tissue is a flower petal.