MXPA97009618A - Hue stimulating factors - Google Patents

Abstract

The present invention relates to polypeptides that stimulate bone growth: Gly lle Lys Arg Thr Asn Glu His Thr Ala Asp Cys Lys lle Lys Pro Asn Thr Leu His Lys Ala Glu Thr Leu Met Val Leu Asp Gln Asn Gln pro and subsequences, particularly Arg Thr Asn Glu His Thr Ala Asp Cys and associated nucleotide sequences, methods of preparation and use, antibodies and study

Description

STIMULATING BONE FACTORS The present invention relates to polypeptides that stimulate bone growth. The understanding of issues related to bone growth and strengthening has progressed over the years, a summary is provided in International Patent Application No. PCT / CA 94/00144, published under International Publication No. WO 94/20615 on September 15, 1994. Various techniques for the treatment of diseases involving the reduction of bone mass and accompanying disorders are exemplified in the patent literature. For example, U.S. Patent No. 4,877,864, issued October 31, 1989, describes "human and bovine inductive factors" of bones. The international patent application published on September 17, 1992 under No. 92/15615 describes a protein derived from a porcine pancreas which acts to define calcium levels in the serum for the treatment of bone disorders that cause elevation of serum calcium levels. European patent application No. 504 938 published on September 23, 1992 describes the use of di- or tripeptides which inhibit the cysteine protease in the treatment of bone diseases. The international patent application published on September 3, 1992 under No. 92/14481 discloses a composition for inducing bone growth, the composition contains activin and morphogenic bone protein. European Patent Application No. 499 242 published August 19, 1992 discloses the use of cell growth factor compositions that are thought to be useful in bone diseases that involve the reduction of bone mass because they cause proliferation of osteoblasts. The international patent application published on June 25, 1992 under No. 92/10515 discloses a drug containing fragment 1-37 of the N-terminal parathyroid hormone (PTH). European patent application No. 451 867 published on September 16, 1991 discloses parathyroid hormone peptide antagonists for the treatment of calcium or phosphoric acid-associated disbolism, such as osteoporosis. U.S. Patent No. 5,461,034 issued October 24, 1995 to the Yissum Research Development Company of the Hebrew University of Jerusalem describes osteogenic growth polypeptides identified from bone marrow regeneration.

A relatively short half-life of PTH in blood serum and the positive effect of intermittent PTH injection on bone volume led the present investigator to the hypothesis that PTH can somehow lead to the induction of a second factor in the circulatory system. The presence of such an inducer in the blood serum of rats and humans has thus been investigated. It has been found possible to isolate from the blood serum of rats a polypeptide substance which, upon administration to rats incapable of producing PTH (parathyroidectomized rats), produces an increase in the bone mineral apposition ratio observed. A nucleic acid test based on the amino acid sequence of the rat peptide was synthesized and used to classify a fetal cDNA library of the human liver in order to isolate a nucleic acid sequence encoding a human bone apposition polypeptide. A polypeptide derived from the nucleic acid sequence was thus chemically synthesized according to the derived sequence Gly lie Gly Lys Arg Thr Asn Glu His Thr Ala Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp Gin Asn Gin Pro (SEQ ID NO: 1) It has been observed that the bone apposition ratio in intact rats is increased by a dose that depends on the mode under administration of this chemically synthesized compound. The reduced bone growth normally observed in ovariectomized rats was observed not to occur in rats after being administered with the polypeptide for a period of 4 weeks beginning 2 weeks after ovariectomization. The calcium density in the bones was found to be maintained in the ovariectomized rats administered with the polypeptide over a period of 8 weeks beginning 8 weeks after ovariectomization.It is thought that it is possible that the active polypeptide is a dimer of the aforementioned sequence having evidence of significant dimer formation, presumably due to a disulfide bridge between two polypeptides having the sequence shown. A modified form of the polypeptide containing a cys-ala substitution was thus synthesized: Gly lie Gly Lys Arg Thr Asn Glu His Thr Ala Asp Ala Lys lie Lys Pro Asn Thr Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp Gln Asn Gln Pro (SEC ID NO: 3). Some of the bone stimulating effects of the normal polypeptide (SEQ ID NO: 1) were found for the modified polypeptide. : In other experiments the bone apposition ratio in rats administered with rabbit antibodies to the normal polypeptide (SEQ ID NO: 1) was found surprising. Deletion was found to be attenuated in rats administered with the normal polypeptide and antibodies thereto. In addition some fragments of the normal polypeptide (SEQ ID NO: 1) have been synthesized and each has been found to have bone stimulating effects: IDSECNO: 4: Gly Ue Gly Lys Arg Thr Asn Glu His Thr Ala Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val ID SEC NO: 5: Gly lie Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Wing Wing ID SEC NO: 6: Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys Pro Asn Thr Leu ID SEC: 7: Gly lie Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He ID SEC NO: 8: Gly He Gly Lys Arg Thr Asn Glu His Thr Ala Asp Cys Lys ID SEQ NO: 9: Arg Thr Asn Glu His Thr Wing Asp Cys Lys In addition the polypeptide identified as SEQ ID NO: 7 has been found to increase the calcium content in ovariectomized rat bones when administered during a period of 8 or 12 weeks. Other polypeptide fragments of the normal polypeptide (ID SEC NO: l) They have also been synthesized and have been found to lack the stimulating effect of. bones found for the normal polypeptide: SEC ID NO: 10: Leu His Lys Lys Ala Ala Glu Thr Leu'Met Val Leu Asp Gln Asn Gln SEC ID NO: 11: Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp Gln Asn SEC ID NO: 12: Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln ID SEC NO: 13: Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp ID SEC: 14: '. "Thr Wing Asp Cys Lys Lie Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp ID SEC NO: 15: Arg Thr Asn Glu His Thr Wing Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Asn SEQ ID NO: 16: Arg Thr Asn Glu His Thr Ala Asp Cy Lys lie In this manner the present invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 1 with ( a), of the approximately 4 amino acids deleted from the N-terminus of SEQ ID NO: 1 (b) from 1 to about 22 amino acids deleted from the C-terminus of SEQ ID NO: 1, or both (a) and (b); or a functionally equivalent homologue Correspondingly, the invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 3 with (a) from 1 to about 4 amino acids deleted from the term N 'of SEQ ID NO: 3 (b) l to about 22 amino acids deleted from the C term of SEQ ID NO: 3, or both (a) and (b) or a functionally equivalent homolog. The sequence homology in polypeptides and proteins is understood for those with skill in the art as discussed, for example in molecular cell biology (H. Lodish, D. Baltimore, A. Berk, Zipursky SL, P. Matsudaira and J. Darnell , Scientific American Books, New York City, Third Edition, 1995). Similarly, the invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 4 with (a) up to about 4 amino acids deleted from the N * term of SEQ ID NO: 4, (b) up to 16 amino acids deleted from the term C of SEQ ID NO: 4, or both (a) and (b); or a functionally equivalent homologue. The invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 5 with (a) up to about 4 amino acids deleted from the N-terminus of SEQ ID NO: 5, (b) up to about 11 amino acids deleted from the C-terminus of SEQ ID NO: 5, or both (a) and (b); or a functionally equivalent homologue. The invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 6, with ta) up to about 4 amino acids deleted from the N-terminus of SEQ ID NO: 6, (b) up to about 5 amino acids deleted from the term C of SEQ ID NO: 6, or both (a) and (b), or a functionally equivalent homolog. The invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 7, with (a) up to about 4 amino acids deleted from the N-terminus of SEQ ID NO: 7, (b) up to about 1 amino acid deleted from the term C, of SEQ ID NO: 4, or both (a) and (b), or a functionally equivalent homolog. The invention also includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 8, with up to about 4 amino acids deleted from the N term or a functionally equivalent homolog. The invention includes a polypeptide having an amino acid sequence corresponding to SEQ ID NO: 9, or a functionally equivalent homolog thereof. The polypeptide of the invention can be synthetic and the amino acid sequence can have a molecular weight in the range of about 1000 to 4000. The invention includes a polypeptide having an amino acid sequence sufficiently duplicated iva of another, ie the second polypeptide has an amino acid sequence corresponding to SEQ ID NO: 1 (or SEQ ID NO: 3) with (a) from 1 to approximately 4 amino acids deleted from the term N of SEQ ID NO: 1 (or SEC ID NO: 3), (b) from 1 to approximately 22 amino acids deleted from the C term of the ID SEC N0: 1 (or SEQ ID NO: 3), or both (a) and (b), or a functionally equivalent homolog thereof, such that the polypeptide is encoded by a DNA that hybridizes under stringent conditions with DNA that encodes the second polypeptide. ' In another aspect the invention is a synthetic polypeptide having bone stimulating activity in vivo in mammals and which increases the mineral content (ie, calcium) in the bones of mammals having an amino acid sequence that is at least 19% conserved in relation to to the amino acid sequence identified as SEQ ID NO: 1 and having at least one amino acid deleted from it or a functionally equivalent homolog. The invention includes a synthetic polypeptide having bone stimulatory activity in vivo in mammals and which increases the mineral content in the bones of mammals, having an amino acid sequence that is at least approximately 25% conserved in relation to the amino acid sequence defined as SEQ ID NO: 1 and having at least one amino acid borradp thereof. The invention includes a synthetic polypeptide having a bone stimulating activity in vivo in mammals and which increases the mineral content in the bones of mammals, having an amino acid sequence that is at least approximately conserved; 28% in relation to the amino acid sequence defined as SEQ ID NO: 1 and having at least one amino acid deleted therefrom. The invention includes any of the above synthetic polypeptides in which at least 6 amino acids are deleted from the polypeptide sequence, or in which at least 11 amino acids are deleted from the sequence; or in which at least 17 amino acids are deleted from the sequence, or in which at least twenty-one amino acids are deleted from the sequence, or in which at least twenty-six amino acids are deleted from the sequence. The invention includes a polypeptide having a sufficiently duplicative amino acid sequence of one of the above synthetic polypeptides, such that the polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding the synthetic polypeptide. In another aspect the invention is a polypeptide that exhibits bone stimulating activity in mammals, the polypeptide having the sequence identified as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, ID SEC NO: 4, SEC ID NO: 6; SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9, their analogs, wherein the amino acids in the sequence may be substituted, deleted or added, provided that the mammalian bone stimulating activity derived from the structure three-dimensional sequence, be retained; and the conjugates of each of the peptides or their analogs, wherein if the polypeptide sequence has the latter identified as SEQ ID NO: 1, then there is at least one amino acid deleted from it. The invention includes a polypeptide having a sufficiently duplicative amino acid sequence of such bone stimulating polypeptide, (or functionally equivalent homolog thereof) that the polypeptide is encoded by a DNA that hybridizes under conditions. stringent with the DNA encoding the bone stimulating polypeptide. In another aspect, the invention is a polypeptide that includes an amino acid sequence 'that is between 19% and 90% conserved in relation to the amino acid sequence identified with SEQ ID NO: 1; or an amino acid sequence that is between 19% and 69% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 19% and 56% conserved in relation to the identified amino acid sequence- as SEQ ID NO: 1; or an amino acid sequence that is between 19% and 42% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 19% and 39% conserved in relation to the .. amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 19% and 28% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 28% and 90% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 28% and 86% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 28% and 69% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 28% and 56% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1; or an amino acid sequence that is between 28% and 42% conserved in relation to the amino acid sequence identified as SEQ ID NO:?; or an amino acid sequence that is between 28% and 39% conserved in relation to the amino acid sequence identified as SEQ ID NO: 1, or a functionally equivalent homolog having bone stimulating activity in a mammal. The polypeptide can be a chimeric bone stimulating factor that includes any of the amino acid sequences described above as part of the invention. The invention includes an agent for use in the preparation and treatment of a bone reduction related to the disease that includes some polypeptide described above as part of the invention including of course a chimeric polypeptide as an active ingredient. The invention is thus also a pharmaceutical composition for promoting bone growth, having an effective amount of any polypeptide described above as part of the invention. The invention includes a method of increasing bone growth in a mammal by administering a therapeutically effective amount (or a pharmaceutical composition that includes the polypeptide) described above as part of the invention. The invention includes the treatment of osteoporosis, the promotion of bone growth in a mammal or the treatment of a human with a disease related to bone reduction. The invention includes the use of a polypeptide having a sequence according to any polypeptide of the invention in the preparation of a medicament for use in the promotion of bone growth or the treatment of osteoporosis, etc. The invention includes a diagnostic kit for determining the presence of a polypeptide of the invention, in which the kit includes an antibody for a polypeptide (or polypeptides) linked to a reporter system wherein the reporter system produces a detectable response when an amount of the polypeptide (or polypeptides) and the antibody become bound to each other. The invention includes a polypeptide that binds to a polypeptide of the invention. Particularly, the invention includes an antibody that binds to such polypeptide when the antibody is synthesized using the pplipeptide. The invention includes molecules, such as isolated nucleotide sequences related to the polypeptides of the invention. For example, the invention includes a fragment of the isolated DNA that encodes the expression of any of the polypeptides of the invention. It is understood that such fragments may vary due to the degeneracy of the genetic code. The invention also includes a reactor that has incorporated within it any DNA sequence. The invention includes an isolated DNA sequence encoding any amino acid sequence of the invention or an analog thereof, wherein the amino acids in the sequence can be substituted, deleted or deleted. aggregates, provided that the stimulating activity of bones in mammals derived from the three-dimensional conformation of the sequence in a polypeptide having the amino acid sequence is preserved., sequences that hybridize to DNA and that encode an amino acid sequence of a polypeptide, which displays stimulatory activity in mammals and a DNA that differs from the sequence due to the degeneracy of the genetic code. The invention thus includes processes for producing any polypeptide of the invention, including a process that includes: a) preparing a DNA fragment containing a nucleotide sequence encoding such polypeptide, b) incorporating the DNA fragment into an expression vector for obtaining a recombinant DNA fragment which contains the DNA fragment and is capable of undergoing replication, c) transforming a host cell with the recombinant DNA fragment to isolate a transformant capable of expressing the polypeptide; and d) culturing the transformant to produce the polypeptide and recovering it from the resulting culture mixture. BRIEF DESCRIPTION OF THE DRAWINGS In the following description, reference is made to the accompanying drawings, in which: Figure 1 graphically represents the ratio of bone mineral apposition (microns per day) in rats provided with the N-acetyl polypeptide (N-terminus) ) chemically synthesized human (SEQ ID NO: 2) through implantation in parathyroidized rats. The error bars indicate the standard deviation (S.D.) ± 1. The value of p was less than 0.001. Figure 2 graphically depicts the bone calcium density of the right femur of treated rats over a period of four weeks. The group A rat ovarietomized and injected daily with the normal chemically synthesized peptide (SEQ ID NO: 1). The '? Group B rats were ovariectomized and injected daily with control solution. The rat of group C underwent fake ovariectomization operations and were injected daily with the control solution. Group D were intact rats injected daily with the control solution. The error bars indicate standard deviation (SD) of ± 1. Figure 3 graphically represents the bone mineral apposition of rats as determined by tetracycline labeling after treatment as described in figure 2. The error bars indicate a standard deviation (SD) of ± 1.

Figure 4 graphically represents the femoral bone calcium concentration of treated rats over a period of 8 weeks. The rats of group A were ovariectomized and injected daily with the normal chemically synthesized peptide (SEQ ID: 1) beginning eight weeks after the operation. Group B rats were ovariectomized and injected daily with control solution. The rats of group C underwent simulated ovariectomization operations and were injected daily with control solution. Group D were intact rats injected daily with the control solution. The error bars indicate standard deviation (S.D.) of ± 1. Figure 5 graphically represents the bone mineral apposition ratio of intact rats as determined by labeling with tetracycline. Group A rats were treated with rabbit antibodies for the normal chemically synthesized polypeptide (SEQ ID NO: 1) Group B rats were treated with the same antibodies and the polypeptide itself. Group C is the control group. The error bars indicate the standard deviation (S.D) of ± 1. Figure 6 shows an SDS tricine electrophoretic gel of the chemically synthesized human polypeptide (SEQ ID NO: 1) and the same polypeptide containing a cys-ala substitution (SEQ ID NO: 3). Figure 7 graphically represents the mineral apposition (microns per day) in rats injected with the chemically synthesized human polypeptide (SEQ ID NO: 1), Group A; the chemically synthesized human polypeptide (SEQ ID NO: 3), Group B; and control, Group C (N = 6 for all groups). The error bars indicate the standard deviation (SD) of ± 1. Figure 8 graphically represents the mineral apposition ratio (microns per day) in rats injected with the chemically synthesized N-terminal polypeptides (SEQ ID NO. TO; SEC ID No. 7 (Group, B); SEC ID NO: 6 (Group C); (SEQ ID No: 5), Group D; SEC ID No: 4 (Group E). (N = 6 for all groups). The error bars indicate the standard deviation (SD) of ± 1. Figure 9 graphically represents the ratio of mineral bone apposition (microns per day) to the injection of rats with chemically synthesized polypeptides: SEQ ID No. 8 (Group G); SEC ID No :) (Group H). Figure 10 is a DEXA image of a right femur of a rat showing scanned areas: A, near end; B, diaphysis; and C, distal end. Figure 11 is a DEXA image of a right femur of a rat showing the scanned area of the neck. Figure 12 graphically represents the ratio of bone mineral apposition (microns per day) in rats injected with polypeptide fragments chemically synthesized without terms SEQ ID NO: 1 (Group H); SEC ID N: 16 (Group I); SEC ID N?: 15 (Group J); SEC ID N: 14 (Group K); SE SEC ID N: S: 10, 11, 12 and 13 (Group L). (N = 6 for all groups). The error bars indicate the standard deviation (SD) of ± 1. Figure 13 illustrates the amino sequences of several polypeptides tested, the active polypeptides being shown above the midline and being below the midline the sequences that were not found that stimulate bone growth. METHODOLOGY The applicable methodology was followed as described in the General Methodology section in the international patent application No. PCT / CA 94/00144. TOXICITY EXPERIMENTS INVOLVING THE CHEMICALLY SYNTHETIZED POLYPEPTIDE OF N-terminal ACETILE N (SEQ ID NO: 2) A miniosmotic pump (Alzet) was loaded with approximately 1.5 ml of the chemically synthesized polypeptide having an N-terminal acetyl group (SEQ ID No. 2) in acetic acid to give a calculated daily supply of approximately 25 μg per day. A pump was implanted under the subcutaneous bandage of the dorsal aspect of the left leg of the thorax of five rats which had been parathyroidectomized seven days before. Five similarly parathyroidized rats received similar implants containing only 1% acetic acid. Five rats were also used as controls. Twenty-eight days later 0.5 ml of an aqueous solution of tetracycline hydrochloride was injected intramuscularly into the right buttocks of each of the implanted rats, as described above. Another 48 hours later, a second injection of tetracycline hydrochloride solution was injected. The rats were sacrificed another 24 hours later. The bone mineral apposition ratio was determined by examination of a cross section of the right femur metaphysis of each of the ten rats which had been implanted. The results are summarized in Table One represented graphically in Figure 1.

The histological evaluation of the tissues selected from the five rats of each of the groups indicated in Table One was carried out microscopically. No evidence of toxic injuries was found. EXPERIMENTS INVOLVED IN OVARIECTOMIZED RATS AND NORMAL POLYPEPTIDE SYNTHETIZED CHEMICALLY (SEQ ID NO: 1), ADMINISTRATION DURING A PERIOD OF FOUR WEEKS Ovariectomies were performed on six female Sprague-Dawley rats, each was sedated with 1 mg of sodium barbiturate IP Fictitious operations were carried out in a second group of six rats. The rats were given two weeks to recover from the operations. The six ovariectomized rats were injected subcutaneously with 100 μl of a 0.1% acetic acid solution containing 100 μg of the chemically synthesized peptide (SEQ ID No. 1) every 24 hours for 28 days. On day 25, tetracycline hydrochloride was injected intramuscularly at each time to give 24 mg per Kg of body weight, as previously described. On day 27, without injecting a second dose of tetracycline hydrochloride and the rats were sacrificed on day 28.; A second group of six ovariectomized rats was treated in a similar manner with a 0.1% acetic acid solution that did not contain peptide during the same 28-day period. A third group of six rats, each of which had undergone the fictitious operation, was similarly treated with a 0.1% acetic acid solution that does not contain peptide during the same 28-day period. A fourth group of six intact rats was treated in a similar manner with an acetic acid solution that did not contain peptide during the same 28-day period. The postmortem blood was. taken by cardiac puncture and the serum was frozen until it was analyzed. A complete autopsy was performed on each rat. No disease effects were observed in the rats treated with the polypeptide. Each of the right femurs was dissected from its soft tissue fixed for two days after and x-rays were taken? 70 kV for one minute, two minutes and three minutes. The three-minute exposures gave more satisfactory results. The bone densities of the femurs of the second group of rats, the ovariectomized rats not treated with the peptide, showed a visibly lower bone density. The right femur of each rat was descalsified separately. The de-icing fluid consisted of 10% (v / v) formic acid and 5% (w / v) sodium citrate at a pH of 3.0. Each bone was placed in 6 ml of the de-icing fluid. The fluid was replaced four days later again another four days' after, again two days later, and once again after another 3 days. After another 2 days, the de-icing fluid was removed and replaced with deionized water, and the sample was stirred for 2 days. The water was changed after two days and again after another day later. After another day, the fluid samples from each rat were combined and the final volume of each was adjusted to 50 ml with deionized water. The volume of each femur was determined by determining the volume of water displaced when the bone was immersed in the water. The calcium concentration of each sample was determined according to standard methods and the calcium density of each bone was calculated. The results are tabulated in the Table Two and is depicted graphically in Figure 2. As can be seen, the bone calcium concentration measured in the ovariectomized rats treated with peptide (SEQ ID NO: 1) appears to be normal, whereas the calcium concentration of > Ovariectomized rats became depressed.

The mineral apposition of the rat was determined, as previously described, by measuring the lower metaphysis of the left femur. The results are tabulated in Table Three and are represented graphically in Figure 3.

EXPERIMENTS INVOLVED IN OVARIECTOMIZED RATS AND NORMAL POLYPEPTIDE SYNTHETIZED CHEMICALLY, ADMINISTRATION DURING A PERIOD OF EIGHT WEEKS. Eight weeks after the ovariectomy, 5 ovariectomized rats were injected subcutaneously with 100 μl of an acetic acid solution containing 100 μg of the chemically synthesized peptide, in which the N-terminal amino group was modified with an acetyl group (SEQ ID NO: 2) . This was done every 24 hours for 8 weeks. On day 54 a solution of tetracycline hydrochloride was injected intramuscularly into the maximum right buttocks of each rat to give 24 mg per Kg of body weight, as previously described. On day 56, a second dose of tetracycline hydrochloride was injected and the rats were sacrificed on day 57. A second group of 7 ovariectomized rats was similarly treated with an acetic acid solution that did not contain peptide during the same period . A third group of 5 rats, each of which had experienced the fictitious operation, was treated in a similar way with a 0.1% acetic acid solution that did not contain peptide during the same period. A fourth group of intact rats was treated similarly with a 0.1% acetic acid solution that did not contain peptide during the same 8 week period. Two rats from the second group began to become ill during the 8-week period and were sacrificed prematurely. The postmortem blood was taken by cardiac puncture and the serum was frozen until it was analyzed. An autopsy was performed on each rat. No obvious pathology was observed in the rats, except in the surgical scars and atrophy of the uteri and vagina of the ovariectomized rats.

The right femurs were descalsified and the density of calcium was determined as before. The results are presented in Table Four and Figure 4.

SYNTHESIS OF CHEMICALLY SYNTHETIC PROTEINS ANTIBODIES (SEQ ID NO: 1) The chemically synthesized protein (SEQ ID NO: 1) was coupled to KLH (Limpet Keyhole ocyanin) with three different linkers, as described below: GLUTARALDEHYDE COUPLING 2.5 ml of a PBS solution made up to 2.7 mMol of KCl, 1.2 mM of KH2P04, 138 mMol of NaCl, 8.1 mMol of Na2HP04, 5 mg of the peptide (SEQ ID NO: 1) were diluted to obtain a final peptide concentration of 2 mg / ml. 10 ml of KLH were diluted in 5.0 ml of PBS to obtain a final concentration of 2 mg / ml. To 1.25 ml of the KLH solution was added 1.25 ml of the peptide solution. Glutaraldehyde was added to a final concentration of 0.25%. The resulting solution was stirred for 1 hour at room temperature, after stirring, the solution was dialysed against one liter of PBS. The PBS was changed three times. COUPLING CARBODIHIMIDE (EDC) Peptide and KLH solutions were prepared as described in the preceding section. To the 1.25 ml solution was added a 1.25 ml peptide solution. To the resulting solution was added 2.5 mg of EDC. The solution was stirred at room temperature for 4 hours and then dialyzed against one liter of PBS, the PBS was changed three times. COUPLING ESTER OF M-MALEIMIDOBENZOIL-N-HIDROXISUCCINAMIDA To 500 μl of H20, 5 mg of the peptide was added and the pH was adjusted to 8.5 with NaOH to obtain a final concentration of 10 mg / ml. The citraconic aldehyde was diluted in H20 at a concentration of 10 mg / ml. 500 μl was added to the anhydride solution to the 100 μl peptide solution at one time with the pH adjustment at 8.5 between each addition. The solution was constantly stirred at room temperature for 1 hour. This was followed by the addition of 100 μl of a 1M sodium phosphate buffer (pH 7.2) and then 900 μl of 100 mM sodium phosphate buffer (pH 7.2). The sulfo-MBS was diluted in H20 to a concentration of 25 mg / ml and 400 μl of this solution was added to the peptide solution to have an MBS concentration of at least 5 mg / ml. This solution was constantly stirred at room temperature for 30 minutes. 6 μl of Beta-mercaptoethanol was added for a final concentration of 35 mM Beta-mercaptoethanol. The solution was constantly stirred at room temperature for 1 hour. KLH was dissolved in PBS at 3 mg / ml and 2.5 ml was added to the peptide solution. The solution was constantly stirred at room temperature for 3 hours and then again one liter of PBS was dialyzed, with three changes of PBS. The final peptide concentration was about 1 mg / ml and the final KLH concentration was about 1.5 mg / ml. GENERATION OF ANTIBODIES Rabbits were injected with the synthetic peptide solutions as follows. 250 μl of each of the peptide solutions coupled with glutaraldehyde and with EDC were mixed together with 500 μl of Freund's adjuvant. This solution was injected intramuscularly into the hind legs of a rabbit, 500 μl per leg. The total amount of peptide injected was 0.5 mg. 500 μl of synthetic peptide were coupled to KLH with MBS and mixed with 500 μl Freud's adjuvant. This solution was injected intramuscularly into the hind legs of another rabbit, 500 μl per leg. The total amount of peptide injected was 0.5 mg. The synthetic peptide was loaded in two gates, 1.5 mg and 4 mg of a gel (18% in run, 5% in stacking). The gel was dried overnight at 30 V and blocked with 3% milk in PBS. The gel was incubated overnight with rabbit serum diluted 1: 250 in 1% milk / PBS followed by incubation with goat anti-rabbit alkaline phosphatase diluted 1: 1000 for 1 hour. The gel was subsequently developed with substrate. The synthetic peptide was seen by dyeing blue comasie. The peptide was detected by the second bleeding of each rabbit and was not detected by the pre-immune serum of each rabbit. The interaction between the immobilized peptide and serum antibodies was further studied through surface plasma resonance using BIAcore ™. The synthetic peptide was covalently immobilized on a dextran matrix by amine coupling. Rabbit serum of different dilutions was injected onto the surface for 4 minutes and the amount of antibodies bound to the immobilized peptide was determined. The titration is defined as the last dilution of the serum that gives a positive response, this is greater than 50 resonance units. Using this technique, antibodies were present in the serum of both rabbits and the interaction can be blocked by pre-incubating the serum with the peptide. Antibodies in rabbit serum were found not to interact with an unrelated immobilized peptide. EXPERIMENTS INVOLVING RATS AND ANTIBODIES FOR SYNTHETIZED PEPTIDE QUMICALLY Antibody serum was prepared in 10 mM Tris.Cl at pH 7.4. Each of the 5 rats received 100 μl of the solution by injection into the upper left gluteus. Each rat of a second group of 5 rats was treated in a similar manner, but with an additional injection of solution containing 45 μg of polypeptide (SEQ ID NO: 1) in the upper right buttocks. Each rat of a third group of rats received an injection of 100 μl of 10 mM Tris.Cl at the pH of 7.0.

Each of the 15 rats was injected as above with tetracycline hydrochloride in the amount of 24 mg per kg of body weight. A second tetracycline chloride duster was injected about 48 hours later. The rats were sacrificed after approximately another 24 hours. The bone mineral apposition ratio was determined by measurements, described above, of the lower right femoral metaphysis. The results are given in Table Five and Figure 5.

The methodology and products can thus be developed using antibodies to the polypeptide for use in detecting the polypeptide with which the antibody binds. For example, the antibody can be linked to or conjugated to one of several well-known reporter systems configured to indicate the positive binding of the polypeptide to the body. Well-known reporter systems include radioimmunoassays (RIAs) or immunoradiometric tests (IRMAs). Alternatively, an enzyme-linked immunosorbent assay (ELISA) may have a relatively high degree of sensitivity in common with RIAs and IRMAs but may not, in general, be d on the use of radioisotopes. A visually detectable substance can be produced or at least one detectable in a spectrophotometer. An assay that is d on the fluorescence of a substance bound by the above is being valued could be used. It will be appreciated that there are a number of reporters that can be used in accordance with the present invention, to detect the presence of a particular polypeptide with the collection of samples with the collection and treatment of standardized samples, the presence of the polypeptide above a threshold amount. in blood serum it could be determined. Such a method d on an antigenic response to the chemically synthesized human polypeptide (SEQ ID NO: 1) could be developed and the polypeptide variants obtained, as described above, for the substitution, elimination and addition of amino acid (and conjugates) could then be pre -classified as potential bone stimulating factors. Those that react positively with the antibody to the peptide already known could then be tested on stimulant effects in vivo using the system described here for periods, for example. Such a reporter system of bound antibodies could be used in a method to determine if the blood serum of a subject contains a deficient amount of the polypeptide. Given a normal hybrral concentration of such polypeptide in the blood serum of a given type of subject, the test kits could be developed in this way. EXPERIMENTS INVOLVING HUMAN POLYPEPTIDE SYNTHETIZED CHEMICALLY CONTAINING CYSTEINE-ALANIN SUBSTITUTION A modified sequence (SEQ ID NO: 3) of the chemically synthesized polypeptide (SE.C ?: l) obtained by substituting the cysteine residue at position 13 for alanine It was prepared by standard chemical procedures. An alanine residue is substantially similar to a cysteine residue as long as it produces the polypeptide incapable of spontaneous dimerization. An SDS tricine electrophoretic gel of the unmodified (normal) polypeptides is shown in Figure 6. The experiments were carried out in three groups of six rats weighing between 295 and 320 g. A 1 mg ml of modified peptide solution (SEQ ID NO: 3) was prepared in 0.1% acetic acid. 1 mg per ml of normal peptide solution (SEQ ID No: 1) was prepared in 0.1% acetic acid. Each rat of a first group were injected subcutaneously into their right thighs with 0.1 ml of the modified peptide solution. Each rat of the third group, the control group, was injected with 0. 1 ml of 0.1% acetic acid solution. Immediately following these injections, each rat was injected intramuscularly with 24 mg per Kg of body weight of tetracycline hydrochloride dissolved in 0.5 ml of water. A second dose of tetracycline hydrochloride was administered 48 hours later. The animals were sacrificed 24 hours after the second dose by narcosis with C02. The inferior metaphysis of the right femur was dissected and fixed in a 10% aqueous solution of formaldehyde regulated at pH 7.2 by an acetate regulator. Bone sections were prepared for measurement as is. described earlier. The results are tabulated in Table Six and graphically represented in Figure 7. As can be seen, the bone apposition ratio for the rats injected with the modified polypeptide is significantly greater than that of the control group but below the apposition ratio shown in the rats injected with the normal peptide.

EXPERIMENTS INVOLVING ACTIVE FRAGMENTS OF THE HUMAN AMINO ACID POLYPEPTIDE 36 Polypeptides having the amino acid sequences identified as SEQ ID Nos: 4, 5, 6, 7, 8 and 9 were synthesized according to known chemical procedures. Sprague-Dawley rats were used as test animals to determine the bone mineral apposition ratio, as described above. Male rats weighing between 280 and 380 g were subjected to subcutaneous injection one week of acclimatization. Each animal was injected with 200 μl of a 1% acetic acid test solution, solutions that had been prepared in concentrations to obtain a dose of approximately 25 nmol of polypeptide per animal. Each test dose was followed immediately by intramuscular injection of 24 mg per kg of body weight of tetracycline hydrochloride. A second injection of tetracycline was made 48 hours later. Control group: 0.1% acetic acid solution.

Group A: SEC ID No: 1: Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Asn Gin Pro Group E: SEC ID No: 4 Gly Ue Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Ala Wing Glu Thr Leu Met Val Group D: SEC ID No: 5 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys Pro Asn Thr Leu His Lys Lys Ala Wing Group C: SEC ID No: 6 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys Pro Asn Thr Leu His Lys Lys Group B: SEC ID No: 7 Gly Ue Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He In a similar but separate set of experiments, the apposition ratios were tested using the following chemically synthesized polypeptides: Group F: SEC ID No: 8 Gly lie Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys Group G: SEC ID No: 9 Arg Thr Asn Glu His Thr Ala Asp Cys Lys The bone mineral apposition ratios were determined by measurements of the lower metaphysis of the right femur, as described above. The results obtained in the two sets of experiments are summarized in Tables Seven and Eight and graphically represented in Figures 8 and 9. As can be seen, all the polypeptides tested had a positive effect on the bone apposition ratio, that is, they showed bone stimulating activity.

EXPERIMENTS OF CALCIUM CONTENT IN BONES INVOLVING SEQ ID NO: 7 An additional set of experiments was conducted using the polypeptide used as SEQ ID NO: 7 to determine the effect of the calcium content polypeptide on the bones when administered in rats. Ovariectomies were performed in rats as described above. A solution of 0.1% acetic acid containing 25 nmol of the polypeptide was administered subcutaneously to each rat each day for the duration of the experiment. A group of rats was: treated for 12 weeks beginning 100 days after the ovariectomization. Another group of rats was treated for 8 weeks beginning 8 weeks after ovariectomy. The rats were sacrificed at the end of the treatment period and dissected and the postmortem assessment of the bone mineral content was carried out. The lumbar spines L1-L4 were cleaned with a sturdy nylon brush to remove the attached muscle. They were placed with the ventral side down low, 3 cm of distilled water in a polypropylene container and were explored by a dual X-ray energy absorberometer (DEXA), Hologic 100 to determine the calcium content in grams. The right femur of each rat was also dissected intact and cleaned of the muscles attached with a sturdy nylon brush. The lower dorsal side was explored under 3 cm of distilled water by DEXA. Four regions of the femur were explored as indicated in Figures 10 and 11: A, near end; B, diaphysis; C, distal end; and D, neck. Bone mineral content (ie calcium) in grams was estimated in the four areas of the femur based on absorption and using an internal standard of the machine. The results are tabulated in Tables Nine to Eighteen.

As can be seen from the tabulated data, the increase in bone calcium content in vivo is more obvious in the femoral neck and in the femoral shaft, implying that the effect of the administered peptide may be site-specific, possibly being higher in the skeletal sites under mechanical stress. EXPERIMENTS INVOLVED BY OTHER FRAGMENTS OF THE POLYPEPTIDE HUMAN OF 36 AMINO CIDOS Polypeptide fragments (SEQ ID NO: 1) were also synthesized and tested for bone stimulating activity with terminal C fragments. Control group: 0.1% acetic acid Group H: SEC ID NO: 1 Gly Ue Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys lié Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Asn Gln Pro Group I: SEC ID NO: 16 Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Group J: SEC ID NO: 15 Arg Thr Asn Glu His Thr Wing Asp Cys Lys Ue Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr leu Met Val Leu Asp Gln Asn Group K: SEC ID NO: 14 Thr Wing Asp Cys Lys lie Lys Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Group L: SEQ ID NOS: 10, 11, 12 & 13 (mix) Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Asn Gln Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Asn Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp Gln Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp Reasons for bone mineral apposition were again determined by measuring the lower metaphysis of the right femur. The results obtained are summarized in Table Nineteen and are represented graphically in Figure 12. As can be seen in Figure 12, none of the variants that are not terminal N are identified as SEQ ID NO: 10, 11, 12, 13, 14, 15 or 16 were found to increase the bone apposition ratio with respect to control.

A summary of the results obtained with respect to the particular polypeptide sequences tested is provided in Figure 13. As can be noted, the polypeptide identified as SEQ ID NO: 9 has a sequence of 10 amino acids contained in the 36 amino acid sequence of the polypeptide identified as SEQ ID NO: 1, that is, the bone stimulating activity in vivo can be retained with a polypeptide in which as little as 28% of the amino acid sequence of SEQ ID NO: 1 is retained. One might also expect bone stimulating effects to be observed for polypeptide homologs identified as SEQ ID NO: 9. It can be found that one or more of the amino acids present in SEQ ID NO: 9 could be deleted and the activity of the polypeptide (or homologue) maintained. ). It is of course known to those skilled in the art that polypeptides that provide similar activity are generally related because they have the same or similar three-dimensional portion (s) that interact with other people, such as a receptor with which the polypeptide is linked. somehow. This is because it is possible to have several polypeptides that are related to each other that exhibit similar bone stimulating activity. The present invention provides a synthetic polypeptide having bone stimulating activity in vivo in mammals and which increases the density or calcium content in the bones of mammals, having an amino acid sequence that at least 19% is conserved in relation to the amino acid sequence identified as SEQ ID NO: 1 and having at least one amino acid deleted therefrom, or a homologue thereof. In the context of this invention, a polypeptide containing an amino acid sequence that can be aligned with SEQ ID NO: 1 such that at least 30% of the individual amino acid residues of the original sequence are present in the peptide is approximately 30 % with the amino acid sequence identified as SEC ID NO: l allowing homologous substitutions and a limited number of inserts or deletions between aligned sequences. An amino acid sequence having 7 residues outside the 36 amino acid residues of SEQ ID NO: 1 in -line sequence could be retained 19%. An amino acid sequence having 8 residues outside the 36 amino acid residues of SEQ ID NO: 1 could be retained 22%. An amino acid sequence having 8 residues outside the 36 amino acid residues of SEQ ID NO: l could be retained 25%. An amino acid sequence of SEQ ID NO: l could be retained 28%. Described in the slightly different form, a polypeptide of the present invention is an amino acid sequence corresponding to SEQ ID NO: 1 with Ca) an amino acid of 4 amino acids deleted from the N terminus of SEQ ID NO: 1, (b) from one to two amino acids deleted from the term C of SEQ ID NO: 1, or both (a) and (b), or a homologue. It may be possible to erase 5 or 6 or more amino acids to delete more than 22 amino acids from term C of SEQ ID NO: l. < In another sense, the polypeptide of the present invention can be described as a polypeptide that exhibits stimulating activity in mammalian bones, the polypeptide having the sequence identified as SEQ ID NO:], SEQ ID NO: 3, SEQ ID NO: 4, SEC ID NO. 5, SEC ID NO: 4, SEC ID NO: 6, ID SEC NO: 7, ID SEC NO: 8 or ID SEC NO: 9; its analogs in the amino acids in the sequence can be replaced, deleted or added as long as the stimulating activity of mammalian bones derived from the three-dimensional structure of the sequence is maintained; and the conjugates of each of the peptides or their analogs, wherein if the peptide sequence has been identified as SEQ ID NO: 1, then there is at least one amino acid deleted from it. A polypeptide of the present invention could include such a sequence which could have a molecular weight in the range of about 1000 a. 000. It is understood, however, that the sequence must be added by conjugation or any other technique which could increase the molecular weight of the total compound beyond 4000. It will also be understood without intending to be limited thereto, that a variety of amino acid substitutions it is possible as long as the three-dimensional structure responsible for the bone stimulant of the polypeptides disclosed herein is "maintained". In this way, it is expected, for example, that the exchange between non-linear aliphatic neutral amino acids, glycine, alanine, proline, valine and isoleucine, could be possible. Similarly, substitutions between neutral polar aliphatic amino acids, cerin, threonine, methionine, cysteine, aspargine and glutamine could possibly be made. That being said, the binding of peptides together by the disulfide bridge, seems to be of some importance, and so the residues of the cysteine ion will probably remain intact and other amino acids capable of forming a disulfide bond will not be substituted in another site in the sequence, although as was seen above a successful cis-wing substitution was made (SEQ ID NO: 3). Substitutions between charged acidic amino acids, aspartic acid, and glutamic acid could probably be made, as substitutions between charged basic amino acids, licina, and alginin could. Substitutions among the aromatic amino acids including, phenylalanine, histidine, tryptophan and thyrcomin could also probably be possible. The substitutions can be made alone or in combination. These kinds of substitutions and changes are well known to those skilled in the art. U.S. Patent No. 5,879,883, for example, describes other possible substitutions that include substitutions involving amino acids not encoded by the gene. Other substitutions might well be possible. The importance of the terminal portion N of the sequence is evident from the results described here. The peptide (SEQ ID NO: 9), which has amino acids 5 to 14 of SEQ ID NO: 1 displays bone stimulating activity while the polypeptides lack the first nine N-terminal amino acids, but have amino acids 10 to 32 ( SEQ ID NO: 14) or amino acids 20 to 35 (SEQ ID NO: 10) do not display bone stimulating activity. It may be possible to delete more amino acids either from the polypeptide terminus identified as SEQ ID NO: 9 while retaining the three-dimensional configuration of the polypeptide sequence responsible for bone stimulatory activity. Internal eliminations, although it may be possible to a certain extent, must be few. Of particular notoriety is the polypeptide having the sequence identified as SEQ ID NO: 16, which differs not only by an amino acid residue of the amino acid sequence identified as SEQ ID NO: 9. The former do not display activity while the latter they display stimulating activity of bones. It is possible to use experimental methods disclosed herein to distinguish between the sequences, which stimulate and not bone growth and which increase and not the calcium content in the bones. It might still be possible for minor amino acid additions to be made at the ends of the sequence and symmetric or near symmetric additions to the carboxy and the amino termini are likely to be possible. Internal additions, although they seem to be possible up to a certain limit, must be few.

Of the above-listed modifications to the sequence, additions, deletions or terminal substitutions are more likely to be useful, such as a modification may serve a variety of group identification functions for use in a radioimmune assay, or a binding group, as examples. As with the normal peptide (SEQ ID NO: 1), an active sequence containing a cysteine residue (ie SEQ ID NOS: 4, 5, 6, 7, 8 or 9) is likely to dimerize spontaneously and exist in the dimeric form. An additional advantage can be obtained through dimeric forms of the protein, as is known in the art. A DNA sequence encoding the entire protein, or a portion of the protein, could thus be linked to a sequence encoding the C-terminal portion of 0-Galatoxidase of E. Coli to produce a fusion protein, for example. An expression system for glycoproteins of human respiratory cinsitial virus F and G is described in U.S. Patent No. 5,288,630 issued February 2, 1994 and references cited there, for example. A polypeptide of the present invention could usually be synthetic, either prepared by conventional "chemistry" techniques or by recombinant techniques. Here, a polypeptide so produced is referred to as being substantially pure or biochemically pure when it is generally free of polypeptides or proteins with which it could exist if found directly in nature, such as in the blood serum of an animal, for example. The nucleic acid (DNA) sequences encoding the active portions of the normal polypeptide could be as follows: SEQ ID NO: 17 (corresponds to SEQ ID NO: 4) GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA CCG AAC ACC TTG CAT AAA AAA GCT GCA GAG ACT TTA ATG GTC SEC ID NO: 18 (corresponds to SEQ ID NO: 5) GGTATC GGAAAACGAACAAATGAACATACGGCAGATTGTAAAATTAAACCGAAC ACC TTG CAT AAA AAA GCT GCA SEC ID NO: 19 (corresponds to SEQ ID NO: 6) GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA CCG AAC ACC TTG SEC ID NO: 20 (corresponds to SEQ ID NO: 7) GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT SEC ID NO: 21 (corresponds to SEC ID NO: 8) GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA SEC ID NO.22 (corresponds to SEQ ID NO: 9) CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA Accordingly a vector incorporating the DNA sequence could be constructed for use in the synthesis of a polypeptide as described above, and particularly in the international patent application No. PCT / CA 94/00144. The DNA sequence encoding the polypeptide identified as SEQ ID NO: 1 is given as SEQ ID NO: 23 in the sequence listing of this specification. A DNA sequence or fragment of the present invention can be any fragment that contains a nucleotide sequence encoding a polypeptide of the present invention. In addition to any of the above coding sequences, the DNA fragment may have an appropriate promoter and an "SD" sequence (or an appropriate ribosome binding site) at its 5 'end and, if necessary, a nucleotide sequence which contains a translation start codon at the 5 'end and a nucleotide sequence containing a stop codon at the 3' end As is known to those skilled in the art, the genetic code is "degenerated". is a sequence of genes that can thus be replaced by other nucleotides according to the degeneracy of a particular codon (tripet coding), without changing the amino acid sequence of the polypeptide encoded by the gene. A DNA fragment of the present invention could thus be derived from any of the above sequences (and from the DNA sequences corresponding to the substituted polypeptide or other analogs not explicitly illustrated), and such replacement could be done in such a way that the codon (en) resulting shows high frequency utilization in a specific host cell when a polypeptide of the present invention is produced using genetic engineering techniques. Of course it will be understood that the antibodies of any of the polypeptides disclosed herein could be generated, as described in relation to the normal polypeptide (SEQ ID NO: 1). A polypeptide of the present invention can be made within a suitable pharmaceutical formation for use in the efficient administration to a patient in need of such administration, such as the person suffering from a reduction in bone formation, for example. Prophylactic treatment is another possibility. The injection seems to be a plausible candidate as a route of administration. A pharmaceutical preparation could include an appropriate carrier or medium such as sterilized water, physiological saline, a vegetable oil, a non-toxic organic solvent or the like generally used in drug preparations. A filler, coloring agent, emulsifying agent, suspending agent, stabilizer, condom or the like, etc., could also be used. Other possible routes of administration include straight, parenteral, ocular, nasal, sublingual, buccal, intravenous, etc. The form of a pharmacist could be a dispersion, solution, suspension, tablets, troches, etc. and it could be in a slow-release form or device or over time. The dosage could similarly vary with the type of patient, age, sex, etc. and the nature and severity of the condition to be treated. In general, the dose range for treatment of a condition related to the reduced bone condition could be in the range of about 0.001 pmol to 100 nmol per kg of a patient's body weight. LIST OF SEQUENCES 1) GENERAL INFORMATION (i) APPLICANT (TO) NAME: OSTEOPHARM LIMITED (B) STREET: 2395 Speakman Drive (C) CITY: Mississauga.- (D) PROVINCE: Ontario (E) COUNTRY: CA (F) AREA POSTCARD: L5K 1B3 (A) NAME: TAM Cherk Shing (B) STREET: 1072 Rectory Lane (C) CITY: Oakville (D) PROVINCE: Ontario (E) COUNTRY: CA (F) ZIP: L6M 2B7 (ii) TITLE OF THE INVENTION: BONE STIMULATING FACTOR (iii) NUMBER OF SEQUENCES: 22 (iv) COMPUTER LEADABLE FORM: (A) TYPE OF MEDIUM: Diskette, 3 1/2 Inches, Storage 1.4 Mb (B) COMPUTER: COMPAQ, IBM PC compatible (C) OPERATING SYSTEM: MS-DOS 5.1 (D) SOFTWARE: WORD PERFECT (v) DATA OF CURRENT APPLICATION: NUMBER OF APPLICATION: (vi) DATA OF PREVIOUS APPLICATION (A) APPLICATION NUMBER: US 08 / 487,074 (B) DATE OF SUBMISSION: 07- UN-1995 (2) INFORMATION FOR SEC ID NO: 1 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B)? PO: amino acid - (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 1 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 -15 Pro Asn Thr Leu His Lys Lys Ala Wing Glu Thr Leu Met Val Leu Asp 20 25 30 .. 'Gln Asn Gln Pro 35 (2) INFORMATION FOR SEC ID NO: 2 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B)? PO: amino acid ( D) TOPOLOGY: linear (ix) CHARACTERISTICS: (A) NAME / KEY: Modified site (B) LOCATION: ... 2 (D) OTHER INFORMATION: / note = "Xaa is N-acetyl glycine" (xi) DESCRIPTION OF SEQUENCE: SEC ID NO: 2 Xaa He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 Pro Asn Thr Leu His Lys Lys Wing Wing Glu Thr Leu Met Val Leu Asp 20 25 30 Gln Asn Gln Pro 35 (2) INFORMATION FOR SEC ID NO: 3 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 3 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Wing Lys He Lys 1 5 10 15 Pro Asn Thr Leu His Lys Lys Ala Wing Glu Thr Leu Met Val Leu Asp 20 25 30 Gln Asn Gln Pro 35 (2) INFORMATION FOR SEC ID NO: 4 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) ) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 4 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys lie Lys 1 5 10 15 Pro Asn Thr Leu His Lys Lys Ala Wing Glu Thr Leu Met Val 20 25 30 (2) INFORMATION FOR SEC ID NO: 5 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 5 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 Pro Asn Thr Leu His Lys Lys Wing Ala 20 25 (2) INFORMATION FOR SEC ID NO: 6 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 6 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10, 15 Pro Asn Thr Leu 20 (2) INFORMATION FOR SEC ID NO: 7 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 7 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He 1 5 10 15 (2) INFORMATION FOR SEC ID NO: 8 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 8 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp cys Lys 1 5 10 (2) INFORMATION FOR SEC ID NO: 9 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 10 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 9 Arg Thr Asn Glu His Thr Wing Asp Cys Lys 1 5 10 (2) INFORMATION FOR SEC ID NO: 10 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 10 Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp Gln Asn Gln 1 5 10, 15 (2) INFORMATION FOR SEC ID NO: 11 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 11 Leu His Lys Ala Ala Ala Glu Thr L eu Met Val Leu Asp Gln Asn 1 5 10 15 (2) INFORMATION FOR SEC ID NO: 12 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid .- (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 12 Leu His Lys Lys Ala Wing Glu Thr Leu Met Val Leu Asp Gln 1 5 10 (2) INFORMATION FOR SEC ID NO: 13 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 13 Leu His Lys Lys Ala Ala Glu Thr Leu Met Val Leu Asp 1 5 10 (2) INFORMATION FOR SEC ID NO: 14 (i) SEQUENCE CHARACTERISTICS: (A ) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 14 Thr Ala Asp Cys Lys He Lys Pro Asn Thr Leu His Lys Lys Ala Ala 1 5 10 15 Glu Thr Leu Met Val Leu Asp 20 (2) INFORMATION FOR SEC ID NO: 15 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEC ID NO: 15 Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys Pro Asn Thr Leu 1 5 10 15 His Lys Lys Wing wing Glu Thr Leu Met Val Leu Asp Gln Asn 20 25 30 (2) INFORMATION FOR SEC ID NO: 16 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 16 Arg Thr Asn glu His Thr wing Asp Cys Lys He 1 5 10 (2) INFORMATION FOR SEC ID NO: 17 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 90 base pairs (B) TYPE: nucleic acid (C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEC ID NO: 17 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA 48 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 CCG AAC ACC TTG CAT AAA AAA GCT GCA GAG ACT TTA ATG GTC 90 Pro Asn Thr Leu His Lys Lys Ala Ala Thr Leu Met Val 20 25 (2) INFORMATION FOR SEC ID NO: 18 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 75 base pairs (B) TYPE: nucleic acid (C) ) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 18 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA 48 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 CCG AAC ACC TTG CAT AAA AAA GCT GCA Pro Asn Thr Leu His Lys Lys Wing Ala 20 25 (2) INFORMATION FOR SEC ID NO: 19 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 60 base pairs (B) TYPE: nucleic acid (C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 19 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA 48 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 CCG AAC ACC TTG 60 Pro Asn Thr Leu 20 (2) INFORMATION FOR SEC ID NO: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEC ID NO: 20 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT 45 Gly He Gly Lys Arg Thr Asn Glu His Thr wing Asp Cys Lys He 1 5 10. "15 (2) INFORMATION FOR SEC ID NO: 21 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION : SEC ID NO: 21 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA 42 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys 1 5 10 (2) INFORMATION FOR SEC ID NO: 22 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid ( C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEC ID NO: 22 CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA 30 Arg Thr Asn Glu His thr wing Asp Cys Lys * 1 5 10 (2 ) INFORMATION FOR SEC ID NO: 23 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: base pairs (B) TYPE: nucleic acid (C) ENTRAMADO: simple (D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: ID SÉC NO: 23 GGG ATC GGA AAA CGA ACA AAT GAA CAT ACG GCA GAT TGT AAA ATT AAA 48 Gly He Gly Lys Arg Thr Asn Glu His Thr Wing Asp Cys Lys He Lys 1 5 10 15 CCG AAC ACC TTG CAT AAA AAA GCT GCA GAG ACT TTA ATG GTC AAA ATT 96 Pro Asn thr Leu His Lys Lys Ala Wing Glu Thr Leu Met Val Lys He AAA CCG AAC ACC 108 Lys Pro Asn Thr 35

Claims (88)

1. CLAIMS 1. A polypeptide that includes up to 30 consecutive amino acids of the amino acid sequence identified as SEQ ID NO: 4 and having bone stimulating activity, or a functionally equivalent homolog.
2. 2. A polypeptide comprising up to 25 consecutive amino acids of the amino acid sequence identified as SEQ ID NO: 5 and having bone stimulating activity, or a functionally equivalent homolog.
3. 3. A polypeptide that includes up to 20 consecutive amino acids of the amino acid sequence identified as SEQ ID NO: 6 and having bone stimulating activity, or a functionally equivalent homolog. "
4. 4. A polypeptide including up to 15 consecutive amino acids of the sequence of amino acid identified as ID SEC NO: 7 and having bone stimulating activity, or a functionally equivalent homologue.
5. 5. A polypeptide that includes up to 14 consecutive amino acids of the amino acid sequence identified as SEQ ID NO: 8 and having bone stimulating activity, or a functionally equivalent homolog.
6. 6. A polypeptide that includes up to 10 consecutive amino acids of the amino acid sequence identified as SEQ ID NO: 9 and having bone stimulating activity, or a functionally equivalent homolog.
7. 7. A conservatively substituted variant of a polypeptide according to any of claims 1 to 6.
8. 8. The polypeptide according to claims 1 to 7 wherein the polypeptide is synthetic and the amino acid sequence has a molecular weight in the range of 1000 to 4000.
9. 9. A polypeptide that includes up to 30 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 1, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions to the DNA that encodes the second polypeptide '.
10. 10. A first polypeptide including up to 25 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 2, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding the second polypeptide.
11. 11. A first polypeptide that includes up to 20 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 3, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding the second polypeptide!
12. 12. A first polypeptide including up to 15 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 4, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding the second polypeptide.
13. 13. A first polypeptide that includes up to 14 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 5, such that the first polypeptide is encoded by a DNA that hybridizes under strict conditions with the DNA encoding to the second polypeptide.1
14. 14. A first polypeptide that includes up to 10 consecutive amino acids which are sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 6, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions to the DNA encoding the second polypeptide.
15. 15. A conservatively substituted variant of a polypeptide according to any of the claims 9 to 14.
16. 16. A chimeric bone stimulating factor comprising a polypeptide according to claims 1 to 15.
17. 17. An agent for use in the prevention and treatment of a disease related to bone reduction, which comprises a polypeptide according to any of claims 1 to 15, as an active ingredient.
18. 18. A pharmaceutical composition for promoting bone growth comprising a therapeutically effective amount of a polypeptide according to any of claims 1 to 15.
19. 19. A method for increasing bone growth in mammals by administering a therapeutically effective amount of a polypeptide having an amino acid sequence of a polypeptide defined according to any one of claims 1 to 15.
20. The use of a polypeptide according to any of claims 1 to 15 for the treatment of osteoporosis.
21. 21. The use of a polypeptide according to any of claims 1 to 15 for promoting bone growth in a mammal.
22. 22. The use of a polypeptide having a sequence according to any of claims 1 to 15 in the preparation of a medicament for use in promoting bone growth or for the treatment of osteoporosis.
23. 23. A diagnostic kit for determining the presence of a polypeptide according to any of claims 1 to 15, comprising an antibody to said polypeptide linked to a reporter system, wherein the reporter system produces a detectable response when a certain amount of polypeptide and antibody are linked together.
24. 24. An antibody that binds to a polypeptide according to any of claims 1 to 15, synthesized using one of said polypeptides.
25. 25. An isolated DNA fragment that encodes the expression of any of the polypeptides of claims 1 to 15 and the DNA that differs from the fragment due to the degeneracy of the genetic code.
26. 26. A vector comprising a DNA sequence encoding the expression of any of the polypeptides of claims 1 to 15.
27. 27. A process for producing a polypeptide according to any of claims 1 to 15, which comprises: (a) Prepare a DNA fragment containing a nucleotide sequence encoding said polypeptide; (b) incorporating the DNA fragment into an expression vector to obtain a recombinant DNA fragment which contains said DNA fragment and is capable of undergoing replication; (c) transforming a host cell with said recombinant DNA fragment, to isolate a transformant that can express said polypeptide; (d) culturing said transformant to allow it to produce the polypeptide and recover the polypeptide from the resulting cultured mixture.
28. 28. A synthetic polypeptide that contains bone stimulating activity in vivo in mammals and which increases the mineral content in the bones of mammals, which has an amino acid sequence which is preserved at least 19% and up to 83% is conserved in relation to the amino acid sequence identified as SEQ ID NO: 1, or a functionally equivalent homolog.
29. 29. A synthetic polypeptide that contains bone stimulating activity in vivo in mammals and which increases the mineral content in the bones of mammals, which has an amino acid sequence which is retained at least 22% and up to 69% is conserved in relation to the amino acid sequence identified as SEQ ID NO: 1, or a functionally equivalent homolog.
30. 30. A synthetic polypeptide containing bone stimulating activity in vivo in mammals and which increases the mineral content in the bones of mammals, having an amino acid sequence which is retained at least 25% and up to 56% is preserved in relation to the amino acid sequence identified as SEQ ID NO: 1, or a functionally equivalent homolog.
31. 31. A synthetic polypeptide containing bone stimulating activity in vivo in mammals and which increases the mineral content in the bones of mammals, which has an amino acid sequence which is preserved at least 28% and up to 42% is conserved in relation to the amino acid sequence identified as SEQ ID NO: 1, or a functionally equivalent homolog.
32. 32. A polypeptide according to claims 28, 29, 30, 31 or 32 having at least six amino acids deleted from said sequence.
33. 33. A polypeptide according to claims 28, 29, 30, 31 or 32 having at least eleven amino acids deleted from said sequence.
34. 34. A polypeptide according to claims 28, 29, 30, 31 or 32 having at least sixteen amino acids deleted from said sequence.
35. 35. A polypeptide according to claims 28, 29, 30, 31 or 32 having at least twenty-one amino acids removed from said sequence.
36. 36. A polypeptide according to claims 28, 29, 30, 31 or 32 having at least twenty-six amino acids deleted from said sequence.
37. 37. A polypeptide according to claims 28, 29, 30, 31 or 32, wherein the polypeptide has a molecular weight in the range of 1000 to 4000.
38. 38. A first polypeptide including up to 30 consecutive sufficiently sufficient amino acids of a second polypeptide corresponding to a polypeptide according to claim 28, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding the second polypeptide .
39. 39. A first polypeptide that includes up to 25 consecutive sufficiently sufficient amino acids of a second polypeptide corresponding to a polypeptide according to claim 29, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA that encodes the second polypeptide.
40. 40. A first polypeptide that includes up to 20 consecutive sufficiently sufficient amino acids of a second polypeptide corresponding to a polypeptide according to claim 30, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions with the DNA encoding to the second polypeptide.
41. 41. A first polypeptide that includes up to 15 consecutive sufficiently sufficient amino acids of a second polypeptide corresponding to a polypeptide according to claim 31, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions to the DNA encoding the second polypeptide.
42. 42. A first polypeptide including up to 10 consecutive sufficiently sufficient amino acids of a second polypeptide corresponding to a polypeptide according to claim 32, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions to the DNA encoding the second polypeptide.
43. 43. A chimeric bone stimulating factor comprising an amino acid sequence according to claim 28, 29, 30, 31 or 32.
44. 44. An agent for use in the prevention and treatment of a disease related to bone reduction, which comprises a polypeptide according to claims 28, 29, 30, 31 or 31.
45. 45. A pharmaceutical composition for promoting bone growth, comprising a therapeutically effective amount of a polypeptide according to the claims 28, 29, 30, 31 or 32.
46. 46. A method for increasing bone growth in a mammal by administering a therapeutically effective amount of a polypeptide having an amino acid sequence of a polypeptide defined in any of claims 28, 29, 30, 31 or 32.
47. 47. The use of a polypeptide according to any of claims 28, 29, 30, 31 or 32 for the treatment of osteoporosis.
48. 48. The use of a polypeptide according to any of claims 28, 29, 30, 31 or 32 to promote bone growth in a mammal.
49. 49. The use of a polypeptide having a sequence according to any of claims 28, 29, 30, 31 or 32, in the preparation of a medicament for use in promoting bone growth or for the treatment of osteoporosis.
50. 50. A diagnostic kit for determining the presence of a polypeptide according to the claims 28, 29, 30, 31 or 32, which comprises an antibody to said polypeptide linked to a reporter system, wherein the reporter system produces a detectable response when a predetermined amount of the polypeptide and the antibody are linked together.
51. 51. An antibody that binds to a polypeptide defined in claims 28, 29, 30, 31 or 32, synthesized using the polypeptide.
52. 52. An isolated DNA fragment encoding the expression of any of the polypeptides of claims 28, 29, 30, 31 or 32, and the DNA differs from the fragment due to the degeneracy of the genetic code.
53. 53. A vector comprising a DNA sequence encoding the expression of any of the polypeptides of any of claims 28, 29, 30, 31 or 32.
54. 54. A process for producing a polypeptide according to claims 28, 29 , 30, 31 or 32, which comprises: a) preparing a DN fragment containing a nucleotide sequence encoding said polypeptide; b) incorporating said DNA fragment into an expression vector to obtain a recombinant DNA fragment containing said DNA fragment and which is capable of undergoing replication; c) transforming a host cell with said recombinant DNA fragment to isolate a transformant that can express said polypeptide; and d) culturing the transformant to allow it to produce said polypeptide and recover the polypeptide from the resulting culture mixture.
55. 55. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 30 consecutive amino acids of a substance identified as SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 ,. V.ID SEC NO: 7, SEC ID NO: 8, SEC ID NO: 9; the analogues of these, where the amino acids in the sequence can be replaced, - eliminated or added, as long as the bone stimulating activity in mammals is derived from the three-dimensional structure of the sequence that is conserved; and the conjugates of each of the peptides or their analogues.
56. 56. A polypeptide according to claim 55, wherein the polypeptide is substantially pure and the amino acid sequence has a molecular weight in the range of 1000 to 4000.
57. 57. A first polypeptide that includes up to 30 consecutive amino acids sufficiently duplicative of a second polypeptide corresponding to a polypeptide of claim 55 or 56 or an equivalent homolog thereof, such that the first polypeptide is encoded by a DNA that hybridizes under stringent conditions to the DNA encoding the second polypeptide.
58. 58. A chimeric bone stimulating factor comprising an amino acid sequence of claim 55 or 56.
59. 59. An agent for use in the prevention and treatment of a disease related to bone reduction, which comprises a polypeptide according to Claim 55, 56, 57 or 58 as an active ingredient.
60. 60. A pharmaceutical composition for promoting bone growth, comprising a therapeutically effective amount of a polypeptide of claim 55, 56, 57 or 58.
61. 61. A method of increasing bone growth in a mammal by administering a therapeutically effective amount. of a polypeptide having an amino acid sequence of a polypeptide defined in claims 55, 56, 57 or 58.
62. 62. The use of a polypeptide according to claims 55, 56, 57 or 58 for the treatment of osteoporosis.
63. 63. The use of a polypeptide according to claims 55, 56, 57 or 58, to promote bone growth in a mammal.
64. 64. The use of a polypeptide having a sequence according to claims 55, 56, 57 or 58 in the preparation of a medicament for use in promoting bone growth or in the treatment of osteoporosis. *
65. 65. A diagnostic kit for determining the presence of a polypeptide according to the claims 55, 56, 57 or 58, which comprises an antibody to said polypeptide linked to a reporter system, wherein the reporter system produces a detectable response when a predetermined amount of the polypeptide and the antibody are linked together.
66. 66. An antibody that binds to a polypeptide defined in any of claims 55, 56, 57 or 58, synthesized using the polypeptide.
67. 67. An isolated DNA fragment encoding the expression of any of the polypeptides of claims 55, 56, 57 or 58, and the DNA differs from the fragment due to the degeneracy of the genetic code.
68. 68. A vector comprising, a DNA sequence encoding the expression of any of the polypeptides of claims 55, 56, 57 or 58.
69. 69. A process for producing a polypeptide according to claims 55, 56, 57 or 58, which comprises: a) preparing a DNA fragment containing a nucleotide sequence encoding said polypeptide; b) incorporating said DNA fragment into an expression vector to obtain a recombinant DNA fragment containing said DNA fragment and which is capable of undergoing replication; c) transforming a host cell with said recombinant DNA fragment to isolate a transformant that can express said polypeptide; and d) culturing the transformant to allow it to produce said polypeptide and recover the polypeptide from the resulting culture mixture.
70. 70. An isolated DNA sequence encoding the amino acid sequence disclosed in any of claims 1 to 15, 28 to 42, or 55 to 58, or an analog thereof, wherein the amino acids in the sequence can be substituted, deleted or added, as long as the stimulating activity in mammals derived from the three-dimensional conformation of the sequence is conserved, in a * polypeptide that contains the amino acid sequence, the sequences that hybridize to the DNA and that encode an amino acid sequence of a polypeptide that displays bone stimulating activity in mammals; and DNA differs from the sequence due to the degeneracy of the genetic code.
71. 71. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 30 consecutive amino acids of a sequence identified as SEQ ID NO: 4 and its conservatively substituted variants.
72. 72. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 25 consecutive amino acids of a sequence identified as SEQ ID NO: 5 and its conservatively substituted variants.
73. 73. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 20 consecutive amino acids of a sequence identified as SEQ ID NO: 6 and its conservatively substituted variants.
74. 74. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 15 consecutive amino acids of a sequence identified as SEQ ID NO: 7 and its conservatively substituted variants.
75. 75. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 14 consecutive amino acids of a sequence identified as SEQ ID NO: 8 and its conservatively substituted variants.
76. 76. A polypeptide that exhibits bone stimulating activity in mammals, the polypeptide includes up to 10 consecutive amino acids of a sequence identified as SEQ ID NO: 9 and its conservatively substituted variants.
77. 77. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 4 and its conservatively substituted variants.
78. 78. An isolated polypeptide exhibiting bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 5 and its conservatively substituted variants.
79. 79. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 6 and its conservatively substituted variants.
80. 80. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 7 and its conservatively substituted variants.
81. 81. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 8 and its conservatively substituted variants.
82. 82. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 9 and its conservatively substituted variants.
83. 83. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 4.
84. 84. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 5.
85. 85. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 6.
86. 86. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEC ID NO: 7.
87. 87. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 8.
88. 88. An isolated polypeptide that exhibits bone stimulating activity in mammals, consisting essentially of the amino acid sequence identified as SEQ ID NO: 9.