MXPA97009504A - Anti-neutrophyl cytoplasmatic antibody material associated with ulcerative colitis and related methods and cases - Google Patents

Abstract

For the first time, the present invention provides pANCA isolated, essentially pure, and / or produced recombinantly associated with ulcerative colitis (UCpANCA) and UCpANCA material) as well as polynucleotides encoding UCpANCA, UCpANCA material and UCpANCA polypeptides of the present invention. Using the bateriophage display technique, the immunoglobulin gene repertoires derived for immunoglobulin purposes used by pANCA seropositive UC patients have been isolated, amplified, randomly recombined, to regenerate libraries of the fagemid expression vector encoding the DNA homologs of the gene repertoire. Methods are provided for enriching these libraries to create libraries of DNA homologs encoding VH- and VL- that have immunoreactivity of the UCpANCA antigen. Methods for selecting the libraries of the present invention for UCpANCA and UCpANCA material are also provided. These libraries can be encapsulated in particles of the bacteriophage or in the cells. Methods and kits for selecting UCpANCA in a sample and isolating the antigen from UCpAN are also provided.

Description

"CYTOPLASMIC ANTI-NEUTROPHYL ANTIBODY MATERIAL ASSOCIATED WITH ULCERATIVE COLITIS, AND METHODS AND RELATED CASES" I. ACKNOWLEDGMENTS This invention was prepared with the support under the numbers DK46763 and CA12800 of the concession of the National Institute of Public Health. Therefore, the government of the United States has certain rights in the invention.

II. BACKGROUND OF THE INVENTION A. The repertoire of antibodies Through a life, a person confronts the possibility of infection with an almost infinite number of singular foreign substances (antigens). Since one could never know in advance which of these antigens will eventually infect a person, it is beneficial that the body possesses an elegant system of producing an equally infinite formation of antibodies that recognize, bind and activate the destruction of antigens. Antibodies are tetrameric Y-shaped molecules that consist of a pair of relatively long identical polypeptide chains called heavy chains (H) and a pair of identical shorter polypeptide chains called light chains (L). Each arm of the "Y" shaped structure comprises a light chain and one end of a heavy chain linked together by a single disulfide bond. At the joining of the arms, the two heavy chains are linked to each other by two disulfide bonds to form the rod of the "Y" shaped structure. This architectural description of an antibody, even when it is visually pleasing, can be deceptively simplistic. The architecture of the antibody accommodates a wealth of structural diversity. Both heavy and light chains contain a variable (V) and constant domain. These V domains are responsible for the binding of the antigen. The heavy and light chain variable domains each consist of a B-scaffold overhauled by three binding and antigen circuits (complementary determinant regions or CDRs) of different lengths that are filled with a variety of secondary chains. The CDRs are the most diverse regions of the antibody molecule; all six are associated with one degree or another in the formation of the site where the antibody binds its antigen (antigen binding site).

The structural diversity of the circuits can create bonding sites of a variety of configurations ranging from almost flat surfaces to deep cavities. Therefore, the vast array of antibody specificities depends on the diversity of the variable domain structure which in turn depends on the diversity of the primary sequence of the V domain. By stressing the structural diversity of antibodies, there is a combinatorial genetic diversity. The heavy and coarse chain polypeptides are each encoded by a set of gene segments that are selected from the immunoglobulin (Ig) gene complexes. During the maturation of the B cell (the cells that produce antibodies), the discontinuous gene segments within these gene complexes undergo a series of somatic rearrangements to form the nucleic acid sequence that can finally encode the heavy and light chains of the antibody molecule. Typically in humans, the first rearrangements of the Ig gene occur within the Ig heavy chain gene complex. The variable heavy chain domain is generated by the set of an exon V ^ DJ ^ of three DNA segments of separate germ line. One or more of the diversity (D) of gene segments (which are selected from more than two dozen gene segments of germline D) is linked to a single segment of the binding gene (JJJ) (which is selected from approximately six gene segments of the functional JJJ germ line). The resulting DJ ^ complex can then be rearranged with a V ^ gene segment to form a VJ DJJJ exon that can encode the variable portion of the heavy chain of the antibody. Approximately 120 V ^ gene segments of germ line (of which only 80 are potentially functional) are available for rearrangement of the Ig gene and can be divided into at least six families on the basis of 80 percent nucleotide homology or higher. After the re-adjustment of VJJDJH satisfactory, a similar rearrangement occurs to produce the light chain. One of approximately 70 kappa variable gene segments (V ^) are rearranged in one of the five J gene segments thereby generating an exon that can encode a kappa light chain variable domain. In case this rearrangement stops generating a functional gene, then one of approximately 70 lambda light chain variable gene segments (V?) Can be rearranged in one of the four functional J "? - C? Complexes to generate an exon that can encode a lambda light chain variable domain The final products of these genetic gymnastics are the somatically generated genes that encode the two polypeptide chains of the antibody molecule Two of the heavy chains of the CDRs (1 and 2) they are encoded by the segment V ^. The heavy chain CDR3 is the most variable portion of the antibody molecule and is encoded by the 3 'end of the j segment, the D segment and the 5' end of the J ^ segment. With the addition of the nucleotide (diversity of the N region in the VJJ-D and DJ ^ junctions) the use of different reading frames in the D segments, the combination of different heavy and reached light chains, the diversity of the primary antibody libraries is huge. During an immune response, the variable domains of the antibody are also diversified by somatic hypermutation, leading to higher affinity binding of the antigen.

B. Autoantibodies The monumental repertoires of the adaptive immune system have evolved to allow it to recognize and trap virtually any microbial molecule configured either in existence during the present or that has yet to arrive. However, in doing so, it has been unable to prevent the generation of autoantibodies: antibodies that bind with the body's own constituents and activate a path of immune destruction. The natural immunological tolerance mechanisms prevent the expanded production of autoantibodies. After rearrangement of the antibody gene, virgin B cells (the cells that generate antibodies) that exhibit autoantibodies are destroyed or suppressed by the body's tolerance mechanisms. Despite this safety net, autoantibodies are still produced and for many people they do not create a recognizable pathogenetic disorder. It has been estimated that 10 percent to 30 percent of B cells in normal healthy people are responsible for producing autoantibodies. The production of autoantibodies is not only the result of an immune system, exceptionally diverse, an immune response against oneself, but can also arise in a disease • autoimmune or subsequent infections.

C. Inflammatory bowel disease Inflammatory bowel disease (IBD) is the joint term used to describe two gastrointestinal disorders: ulcerative colitis ("UC") and regional ileitis ("CD"). Even when diseases have different pathophysiological characteristics, they are often considered together due to the different clinical and therapeutic similarities. Excluded from this category are, however, gastrointestinal inflammatory disorders of known infections of toxic or ischemic etiology that can acutely copy IBD, but which do not cause chronic relapse and remission syndrome. The IBD occurs worldwide and is known as affecting as many as two million people. The course and prognosis of IBD is widely variable. Initiation has been documented at all ages. However, IBD begins predominantly in young adults. The three most common presenting symptoms of IBD are diarrhea, abdominal pain and fever. Diarrhea can vary from mild to serious and is often accompanied by urgency and frequency. In UC, diarrhea is usually bloody and may contain mucous and purulent matter as well. Anemia and weight loss are additional common signs of IBD. From 10 percent to 15 percent of all patients with IBD will require surgery over a period of 10 years. The risk for the development of cancer is increased in patients with IBD as well, particularly in those with UC. The longer the duration of the disease, the greater the risk of developing carcinoma. Patients with UC usually undergo cancer monitoring by endoscopy after 10 years of the disease. Reports of an escalating event of psychological problems, including possible anxiety and depression are not surprising side effects of what is often a debilitating disease that occurs in people in the prime of life.

D. Methods to diagnose PPI Inflammatory bowel disease presents a clinical and scientific risk to physicians and researchers. To date, most of the diagnostic tools for IBD are quite subjective. A group of costly and invasive, radiological and endoscopic laboratory evaluations are combined to derive a diagnosis of IBD and to assess the degree and severity of the disease. However, differentiating UC from CD, as well as other types of inflammatory bowel conditions, this irritable bowel syndrome, infectious diarrhea, rectal bleeding, radiation colitis and the like is difficult because the mucosa and the large and small intestines they react similarly to a large number of different crises. ConsequentlyInitial symptoms are often confused for non-chronic bowel disorders by doctors unfamiliar with IBD. As a result, IBD often continues not to be treated or diagnosed until the disease shows its chronicity which results in sending the patient to a specialist. Even then, the imprecise and subjective nature of the endoscopic and radiological examination may result in an incorrect diagnosis or intermediate diagnosis even when IBD is suspected. Unfortunately, the patient often must suffer as the disease progresses before a definitive diagnosis can be made. In many patients, however, the diagnosis of IBD must still be considered as intermediate due to the overlapping particularities of UC and CD, particularly with CD of the colon.

E. The cause (s) of IBD are unknown Even though the ethyogy of IBD is unknown, a number of studies have suggested that genetics is important in a person's susceptibility to IBD and that the immune system is responsible for mediating tissue damage in these diseases. Generally speaking, a failure to down-regulate the normal self-limited inflammatory bowel response is characteristic of IBD, but it remains unclear what triggers the pathogenic processes.

It has also been suggested that a primary abnormality of the immune system and its regulation could serve as primary initiating factors or that the process of the disease could be initiated by an infectious agent and the damage then perpetuated through immune-mediated processes or other processes. Although mucosal damage observed during acute disease episodes may resemble the effects of any of a number of recognized infectious agents such as, for example, Campyl obacter j ej uni, no transmissible infectious agent has been consistently identified with the IBD. Autoimmunity has been suggested in the pathogenesis of IBD. The evidence to suggest this hypothesis is based on the existence of circulatory antibodies that react with antigens from the unknown food pathway of both human and animal origin. For example, human and adult colonic, biliary, epithelial and vascular epithelial cells, components associated with the epithelial cell of the murine small intestine, the colonic epithelial glycoproteins of the rat and of a human, the intestinal bacterial polysaccharide and the antigens of rat-free fecal matter have been reported to react with sera from patients with IBD. Other studies showed an answer - li ¬ of increased local IgG in the colonic mucosa of patients with IBD, and other colonic inflammations. The mechanism of this IgG response, the specific local antigens involved and the role of these antibodies are unknown. Even though a wide range of immunological abnormalities have been reported in these disorders, none other than the detection of anti-neutrophil cytoplasmic antibody ("ANCA" or more specifically "pANCA", as will be described below) in UC patients. It seems to be reliable enough to be of diagnostic value. The isolation and identification of these antibodies and the corresponding antigens would provide a powerful tool to clarify the pathogenesis of UC and DC, ultimately leading to more effective treatment therapies.

F. Anti-neutrophil Cytoplasmic Antibodies Patients with certain chronic inflammatory conditions have been found to have serum antibodies to the cytoplasmic components of the neutrophil ("ANCA" or "cytoplasmic anti-neutrophil antibody"). The ANCAs have been divided into two broad categories based on the staining pattern generated by immunofluorescent microscopy of neutrophils fixed with alcohol: cytoplasmic neutrophil staining ("cANCA") and cytoplasmic staining with perinuclear salient characteristics ("pANCA"). Unfortunately, these dyeing patterns do not always accurately reflect the cellular location of the reactive antigens. In general, the literature has considered this pattern of perinuclear staining as being an artifact of alcohol fixation that causes cytoplasmic granules to redistribute around the nucleus of the cell. Thus, even though perinuclear staining may appear to detect nuclear binding in neutrophils, these antibodies have generally still been considered as binding to the antigen of cytoplasmic origin. However, these dyeing patterns have served as a basis to reliably distinguish between ANCA types. Recent studies have shown the presence of pANCA in the serum of patients with UC. Saxon and others, J. Allergy Clin. Immunol. 86: 202-209 (1990). This pANCA identified in UC patients is unique to cANCA associated with Wegener's granulomatosis and other systematic vascularities in both its immunocytochemical staining pattern and its antigenic target. In contrast to the pattern of perinuclear staining exhibited by ANCA associated with UC, the ANCA associated with Wegener's granulomatosis characteristically exhibits a granular diffuse cytoplasmic immunofluorescence pattern. Duerr et al., In Gastroenterology, 100: 1590 (1991). In addition, the pANCA associated with UC can be differentiated from the pANCAs that occur in patients who do not have UC through sensitivity of antigenic DNase. By indirect immunofluorescence, high levels of pANCA are reported in 60 percent to 80 percent of UC patients and only very rarely in CD and other colitis. Serum evaluations do not correlate with the current clinical status and high levels persist in patients even five years after colectomy. Although pANCA is found only rarely in healthy adults and children, healthy relatives of UC patients have an increased frequency of pANCA, suggesting that pANCA may be a marker of immunogenic susceptibility. Many putative antigens, including lactoferrin, cathepsin G and elastase, have been proposed as the target antigen, but the researchers have shown that these reactivities only account for a small portion, if any, of the pANCA activity associated with the UC.

G. PANCA Isolation Associated with Ulcerative Colitis Marker antibodies have a large role in diagnosing a diverse set of diseases ranging from viral infections, such as VHI to autoimmune disorders such as lupus. These antibodies can directly cause pathology, in which case it involves a host of potential treatment modalities. Alternatively, these antibodies can be markers only for the disease without directly causing tissue damage, or they can help reduce infection as seen with most microbial infections. Therefore, if they are responsible for the state of the disease or not, the characterization of the marker antibodies and their antigens can be very useful both to diagnose a disease, and to understand the incorrect and immune regulation that can be based on the pathogenesis Despite diligent efforts, attempts to isolate and identify the structure of the pANCA associated with UC have been unsatisfactory. Several factors have made this identification difficult. The traditional method for isolating antibodies by hybridoma production or EBV transformation is very time-consuming and laborious. Unless the B cells producing the antibodies of interest are over-represented, often these traditional methods fail simply because of the vast size and diversity of the native antibody repertoire. Even after the application of these conventional cloning strategies, the pANCA associated with UC has reportedly remained unidentified after five years of intensive studies. A surface integration technology has recently been described for expressing a product of the heterodimeric recombinant gene such as an antibody molecule on the surface of a filamentous bacteriophage containing recombinant genes. The technology uses a filamentous bacteriophage coat protein as a membrane anchor for the recombinant gene product, thereby linking the gene and the gene product during the assembly step of the duplication of the filamentous bacteriophage. This technique has been shown to be useful in the cloning and expression of antibodies from combinatorial libraries. Kang et al., In Proceedings of the National Academy of Science, USA, 88: 4363-4366 (1991); Barbas et al., Proceedings of the National Academy of Science, USA, 88: 7978-7982 (1991)). Using this technology, human combinatorial antibody libraries have been produced, which immunoreact with the surface antigens of hepatitis B virus. Zebedee et al., Proceedings of the National Academy of Science, USA, 89: 3175-3179 (1992) . The diversity of a library of combinatorial antibodies based on the filamentous bacteriophage has been increased by mixing the heavy and light chain genes (Kang et al., Proceedings of the National Academy of Science, USA, 88: 11120-11123 (1991)), altering the CDR3 regions of the cloned heavy chain genes of the library (Barbas et al., Proceedings of the National Academy of Science, USA, 89: 4457-4461 (1992)), and randomly introducing mutations into the library by means of reactions Polymerase chain reaction ("PCR") (Gram et al., Proceedings of the National Academy of Science, USA, 89: 3576-3580 (1992)). In addition, single chain Fv fragments have been displayed on the surface of the bacteriophage as described by Marks et al., Journal of Molecular Biology, 222: 581-597 (1991). Despite recent developments, such as these, there have been no reports of using these strategies to isolate the pANCA associated with UC. Undoubtedly, this is attributable to some of the same factors that have impeded the attempt to isolate the antibody through the use of traditional hybridoma techniques, namely the failure to know the structure of the target antigen and the failure to isolate a population of B cells producing a sufficient amount of pANCA for a meaningful study. Therefore, the structural identification and characterization of pANCA associated with UC has presented a frightening problem. In view of the fact that the diagnosis of IBD is a prolonged, invasive and costly process that frequently stops solving the insecurity until the diseases have shown their chronicity, and since the IBD and quite often its treatment affects the lifestyle and the functional capabilities of those who suffer from it, is particularly important the need to identify and clarify the pANCA associated with UC. The availability of pANCA would represent a major clinical advance that would aid in the diagnosis and therapeutic management of IBD and provide the basis for the design of more specific treatment modalities. In addition, the specific detection of UC in prospective parents can be useful in genetic counseling. Therefore, there has been a need for the isolation, identification and production of pANCA associated with UC for diagnostic, prognostic and therapeutic purposes.

III. BRIEF DESCRIPTION OF THE INVENTION Patients with certain chronic inflammatory conditions have been found to have serum antibodies to the cytoplasmic components of the neutrophil ("ANCA" or "cytoplasmic anti-neutrophil antibodies"). The ANCAs have been divided into two broad categories based on the staining pattern generated by indirect immunofluorescent microscopy of alcohol-fixed nuetrophils: cytoplasmic neutrophil staining ("cANCA") and cytoplasmic staining with perinuclear salient features ("pANCA"). Recent studies have shown the presence of pANCA in the serum of patients with UC. This pANCA associated with UC can be differentiated from the pANCAs that occur in patients who do not have UC through sensitivity of antigenic DNase. In accordance with the present invention, it has now been discovered that the pANCA of the UC has immunoreactivity with the antigen placed within the nuclear envelope of the neutrophils. Accordingly, new methods are provided to detect "the pANCA associated with UC in a sample, detecting immunoreactivity with the antigen placed within the nuclear envelope of neutrophils." Despite diligent efforts, attempts for isolation and identification of the pANCA structure associated with UC have been unsatisfactory For the first time, the pANCA associated with ulcerative colitis ("UCpANCA") has been produced recombinantly characterized using the bacteriophage display technique, as described herein Therefore, according to the present invention, isolated, essentially purified and / or recombinantly produced UCpANCA and a UCpANCA material and methods for recombinantly producing UCpANCA and the UCpANCA material are provided, in a currently preferred embodiment, the UCpANCA. and the UCpANCA material of the present invention is characterized as having immunoreactivity with the antigen located within the nuclear envelope of the neutrophil a pattern of perinuclear staining by means of the indirect neutrophil immunofluorescence assay fixed with alcohol, and the immunoreactivity that is interrupted by pre-treatment of the neutrophil with DNase. The UCpANCA and the UCpANCA material of the present invention is also characterized by the polynucleic acid sequences and the amino acid sequences that can encode them. Exemplary sequence information is provided herein. VL and V ^ polypeptides of UCpANCA, VL segments and V ^ segments of the UCpANCA polypeptide and polynucleic acids encoding these polypeptides are also provided. The exemplary complementarity determining regions of these polypeptides are presented in map form in the sequence information provided herein. This invention further provides methods for producing libraries of fagemid expression vectors encoding the heterodimeric antibody material from an immunoglobulin gene repertoire of seropositive colitis pANCA, as well as the libraries themselves. The present invention also provides methods for enriching these libraries in order to produce libraries of fagemid expression vectors that encode the material of the heterodimeric antibody having immunoreactivity with the antigen UCpANCA. The fagemid expression vectors of the present invention can be encapsulated by bacteriophage particles or cells. Methods for expressing the encoded library or the individual members of the library encoded as a superabundant or anchored antibody material in the bacteriophage were also provided. This invention also provides methods for detecting UCpANCA in a sample using UCpANCA and the UCpANCA material of the present invention in immunoassays. The methods are also provided to use UCpANCA and the UCpANCA material to isolate, characterize and clone the antigen UCpANCA. The cases containing the UCpANCA material are therefore also provided. For the first time, pANCA associated with ulcerative colitis ("UCpANCA") has been recombinantly produced and characterized using the bacteriophage display technique. Thus, in accordance with the present invention, UCpANCA and isolated UCpANCA material, essentially purified and / or recombinantly produced, are provided. Polypeptides encoding the VL and jj polypeptides of UCpANCA as well as the VL segments and V ^ segments of UCpANCA are also provided. polynucleotides encoding these polypeptides are also provided. This invention further provides methods for producing a library of fagemid expression vectors encoding the heterodimeric antibody material from a repertoire of immunoglobulin genes from seropositive colitis pANCA, as well as the libraries themselves. The present invention also provides methods for enriching these libraries to produce libraries of fagemid expression vectors encoding the heterodimeric antibody material having immunoreactivity with the antigen UCpANCA.

The fagemid expression vectors of the present invention can be encapsulated by particles or cells of the bacteriophage. Methods for expressing the encoded library or the individual members of the library encoded as a soluble antibody material or anchored in bacteriophage are also provided. This invention also provides methods for detecting UCpANCA in a sample using UCpANCA and the UCpANCA material of the present invention in immunoassays and by localizing the immunoreactivity of the sample within the neutrophil nucleus. Methods for using UCpANCA and the UCpANCA material to isolate, characterize and clone the antigen UCpANCA are also provided. Cases containing the UCpANCA material in this way are also provided.

IV. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a reproduction of a photograph of the confocally cut images illustrating the location of the immunoreactivity of UC + sera and EL-pANCA sera relative to the neutrophil cell nucleus. The boundary of the core and the core material is marked by reaction with propidium iodide (red) while the antibody-antigen reaction is marked in green. The view to the left of the cut images (Figures IB and ID) show both the signals together of antiserum (green) and propidium iodide (red), and the intermediate view shows only the signal provided by the antiserum reaction and the sight on the right shows only the propidium iodide signal. The pattern generated using UC + serum (Figures IA and B) is clearly within the nuclear border and co-localized with the outer border of the DNA stained with propidium iodide. The antigenic target of EL-pANCA is clearly perinuclear, since the signal on the outside of the nuclear border is not co-localized with the DNA stained with propidium iodide. Figure 2 is a reproduction of a photograph illustrating the immunoreactivity of UC + sera with the neutrophil nuclear antigen. The UC + sera were reacted with freeze-dried neutrophil cells fixed with paraformaldehyde and the reaction examined by electron microscopy. Immunological irradiation was observed through the heterochromatin DNA placed in the inner periphery of the nucleus of the neutrophils treated with UC + sera (Figure 2A). As a comparison, the staining pattern of anti-histone (Figure 2C) and normal human serum (Figure 2B) in neutrophils prepared in the same manner is also illustrated. Figure 3 shows amino acid sequences of the variable heavy chain domain of the Fab clone of UCpANCA 5-3 and 5-4 aligned with its duplicate human germline DP49. "-" indicates the identity of the amino acid residues.

V. DETAILED DESCRIPTION OF THE INVENTION A. DEFINITIONS As used herein the terms "isolated", "essentially pure" or "recombinant" in their various grammatical forms as a modifier of proteins including antibodies and antibody materials, polypeptides, amino acid sequences, polynucleotides and sequences of nucleic acid or molecules, means that the proteins, polypeptides, amino acid sequences, polynucleotides and nucleic acid sequences or molecules designated in this way have been produced in such a way by the hand of man and therefore are separated from their environment cellular in vivo native. As a result of this human intervention, the proteins, polypeptides, amino acid sequences, polynucleotides and nucleic acid sequences or isolated, pure and / or recombinant molecules of the invention, can be produced in large quantities, and are useful in ways in which they are not proteins, polypeptides, amino acid sequences, polynucleotides and nucleic acid sequences or molecules that occur naturally. The terms "antibody" and "antibody molecule" in their various grammatical forms are used herein as collective names to refer to a population of immunoglobulin molecules which may be polyclonal or more preferably monoclonal in origin and which may be any isotype, preferably of the gamma and kappa isotypes. The phrase "monoclonal antibody" or "monoclonal antibody material" in its various grammatical forms refers to a population of antibody molecules or antibody material that contain only one species of idiope capable of immunoreacting with a specific epitope on an antigen. A monoclonal antibody typically exhibits a single binding affinity for an epitope with which it immunoreacts; however, a monoclonal antibody can be a molecule having a plurality of idiopes, each immunospecific for a different epitope, eg, a bi-specific monoclonal antibody.

The term "antibody material" in its various grammatical forms is used herein as a collective name or noun that refers to a population of immunologically active fragments of immunoglobulin molecules, ie, molecules that contain a combination site of antibodies Exemplary antibody materials of the present invention include those portions of the immunoglobulin molecules known in the art as Fab, Fab 'and F (ab') 2- The antibody combining site is that structural portion of an antibody molecule that it comprises a heavy chain and a variable light chain and hypervariable regions that specifically bind (immunoreact with) an antigen. The term "immunoreact" in its various grammatical forms means the specific binding between the molecule containing the antigenic determinant such as an antigen and a molecule that contains an antibody combining site such as an antibody molecule or antibody material. The term "ANCA" refers to the cytoplasmic anti-neutrophil antibody. The term "pANCA" refers to ANCA that has a cytoplasmic staining pattern with perinuclear salient characteristics which is also referred to as a perinuclear staining pattern. The term "UCpANCA" refers to an antibody associated with ulcerative colitis, which immunoreacts with the nuclear antigen expressed by the neutrophil, and produces a pANCA staining pattern in an alcohol-bound neutrophil IIF assay. The term "materail UCpANCA" refers to the isolated antibody material, essentially pure or recombinantly produced with ulcerative colitis, which immunoreacts with the nuclear antigen expressed by the neutrophil and produces a pANCA staining pattern in the neutrophil IIF assay bound with alcohol. The term "UCpANCA polypeptide" refers to an isolated, essentially pure or recombinantly produced polypeptide contained as part of UCpANCA, the UCpANCA material. The phrase "pANCA seropositive ulcerative colitis" and the designation "UC +" are used as modifiers to indicate that modified tests of the positive article in neutrophil ELISA or more preferably exhibit a pANCA staining pattern by the IIF neutrophil test fixed with alcohol . The "V ^" symbol refers to the immunoglobulin heavy chain variable domain which includes the variable segment ("segment Vjj"), the diversity segment ("D") and the binding segment ("segment JH"). The "VL" symbol refers to the variable domain of the immunoglobulin light chain that includes the variable segment ("VL segment"), and the binding segment ("segment").

JH ") - A" dimer "is a polymer formed from two monomer molecules.When the dimer consists of two identical monomer molecules, it will be referred to herein as" homodimeric. "When a dimer consists of two molecules of different monomers will be referred to herein as "heterodimeric." As used herein, the term "essentially the same amino acid sequence" refers to amino acid sequences that have at least about 80 percent identity with with respect to the reference amino acid sequence, and preferably retains the comparable functional and biological properties characteristic of the polypeptide defined by the reference amino acid sequence Preferably, polypeptides having "essentially the same amino acid sequence" will have at least approximately 90 percent greater preference to 95 percent of the amino acid identity with r specific to the reference amino acid sequence; an amount greater than 97 percent identity of the amino acid sequence being especially preferred.

B. Identification of a Related Population of Lymphocytes for the Production of the Repertory of Immunoglobulin Genes of UC A repertoire of immunoglobulin genes is a collection of gene segments different from the immunoglobulin gene complex and can be isolated from natural sources or provenances or can be generated artificially. The natural sources of the immunoglobulin gene repertoires are typically a heterogeneous population of antibody producing cells, ie, B lymphocytes (B cells). However, in order to derive a repertoire of immunoglobulin genes in a manner that represents segments of the immunoglobulin gene associated with a specific disease or a subset of specific diseases, a population associated with the disease of rearranged B cells must be first generated or isolated. . For example, if the disease is associated with one or more antigens, a population of enriched B cells can be generated for genetic material that produces antibodies that have affinity for the antigen (s) by repeated immunization of a healthy animal with the antigen (S) before collecting the rearranged B cells. If, for example, the antigen (s) associated with the disease are not known or have not been isolated, a population of rearranged B cells of a diseased individual can be collected from the blood. Prior to the present invention, there were significant obstacles to the production of a useful repertoire of immunoglobulin genes representative of the immunoglobulin gene segments associated with seropositive ulcerative colitis pANCA (referred to herein as a "repertoire of the UC + immunoglobulin gene ") using any of these methods. First, in accordance with published literature, there have been no identified or isolated antigens that could be used to generate an enriched population of B cells by immunization. Furthermore, as demonstrated by the failure of the prior art to isolate or produce UCpANCA from blood lymphocytes, no population of B cells is known to have represented therein a sufficient amount of UCpANCA producing B cells to be useful. to generate a repertoire of the immunoglobulin gene of UC +. The present invention has overcome this significant obstacle by identifying, for the first time, a population of B cells producing UCpANCA. The origin of the B cell of UCpANCA could have been either the B cells of the systemic immune system or the B cells associated with the specific tissue. Accordingly, peripheral blood lymphocytes (PBL), mesenteric lymph node lymphocytes (MNL), and lamina propria (LPL) were isolated from seropositive UC patients pANCA to determine which of the lymphocytes in case of having produced them UCpANCA. 1. Peripheral Blood Lymphocytes of UC1 Peripheral blood lymphocytes (PBL) were isolated directly by the Ficoll-Hipaque fraction of 17 UC patients. All seven of these UC patients were seropositive for pANCA using Neutrophil ELISA, 16 of which demonstrated a pANCA staining pattern and the other exhibited a cANCA staining pattern by indirect fixed neutrophil immunofluorescence assay (IIF assay). Immunoglobulin spontaneously produced by these PBLs was generated by PBL isolated from extensive washing by growing them at 37 ° C in a humid atmosphere of 5 percent CO2: 95 percent air, for 12 days at a concentration of 2 X 106 cells per milliliter in RPMI 1640 supplemented with 10 percent fetal bovine serum and antibiotics as described by RP MacDermott et al., Gastroenterology, 81: 844-852 (1981), which is incorporated herein by reference. The supernatants from these cultures were analyzed for IgG content by solid phase radioimmunoassay, as described by R.P. MacDemortt et al., Gastroenterology, 81: 844-852 (1981). The neutrophil ELISA was used to detect ANCA in a 12-day PBL culture supernatant diluted 1: 2 in a blocking stabilizing agent and the IIF assay using the undiluted supernatant was used to characterize the ANCA staining pattern as a pANCA or cANCA. A comparison with serum tests is provided in Table 1.

Table 1: pANCA in peripheral blood lymphocyte supernatants from patients with positive UC ELISA n PBL supernatant liquid serum # ELISA # ELISA # ELISA # ELISA Positive Positive and Positive Positive and Perinuclear Perinclear 17 17 16 Only two samples of PBL (2/17) were found to spontaneously express ANCA but only one of these exhibited a pANCA staining pattern. When seven of the PBL samples were cultured in the presence of IL_4 (5 ng / milliliter) and one anti-CD40 antibody (one microgram per milliliter) to determine whether the production of UCpANCA could be stimulated, none of the seven samples could be stimulated to produce the pANCA dyeing pattern. Significantly, then, B cells that spontaneously secrete UCpANCA could not be found in the PBL fraction of the pANCA seropositive UC patients, nor could the PBL cells be stimulated to produce UCpANCA using a combination of known stimuli to increase the production of IgG !. 2. Mesenteric lymph node lymphocytes of UC + Mesenteric lymph node lymphocytes (MNL) were isolated from five of the same 17 UC patients from whom PBL samples were obtained. All five of these UC patients were seropositive for pANCA by neutrophilic ELISA, four of which exhibited a pANCA staining pattern and one of which exhibited a cANCA staining pattern by IIF assay. The neutrophil ELISA was used to detect ANCA in the liquid culture supernatant of diluted MNL 1/2 a blocking stabilizing agent and, if it is positive for ANCA, in the IIF assay using the undiluted supernatant liquid was used to characterize the pattern of ANCA dyed as pANCA or cANCA. The cultured MNL cells did not spontaneously produce ANCA. However, in a preliminary experiment, the MNL grown from two of these UC patients could be stimulated to produce ANCA that has a pANCA staining pattern by incubation with IL-4 (5 ng / milliliter) and the anti-CD40 antibody ( 1 microgram per milliliter) suggesting the presence of primed B cells, but not previously activated in this compartment.

. Self-contained lymphocytes of the UC_ The lamina propria (LPL) of the human intestinal mucosa of the colonic surgical specimens of the tissue involved with the disease and not involved of UC and CD patients as well as patients with diverticulitis and normal mucosa (the last two groups called "non-IBD patients") were isolated as described above by DM Bull and M.A. Bookman, Clin. Invest. 59: 966-974 (1977) as modified by R.P. MacDermott et al., Gastroenterology, 78: 47-56 (1980) and R.P. MacDermott et al., Gastroenterology, 81: 844-52 (1981), all of which are incorporated herein by reference. In short, the mucosa was dried free of muscularis and washed in a balanced salt solution of calcium-magnesium-free Hank stabilized with HEPES containing 5 percent human serum and antibiotics (washing stabilizer). After being weighed and chopped, the mucous pieces of 2-5 millimeters were stirred 0.75 mM EDTA containing the wash stabilizer for 15 minutes at 37 ° C. This treatment was repeated until no more tryptic cells were released in the wash solution. Mucosa pieces were digested by collagenase (16 units / milliliter, Orthington Biochemical, of Freehold, NJ) in the wash stabilizer supplemented with 10 percent human serum, with constant agitation at 37 ° C in a humidified atmosphere of 5 CO2 percent: 95 percent air. The LPL were separated from the supernatant liquid by centrifugation of the Ficoll-Hipaque gradient as detailed previously by A.F. Saxon et al., J. Aliergy Clin. Imunol., 86: 202-210 (1990), which is incorporated herein by reference.

The isolated LPLs were extensively washed and cultured as described above for the PBL to generate spontaneous immunoglobulin production. The supernatants of these cultures were analyzed to determine the IgG content by solid phase radioimmunoassay., as described by R.P. MacDermott et al., Gastroenterology, 81: 844-852 (1981). Neutrophil ELISA was used to detect ANCA in a 12-day PBL culture supernatant, diluted 1: 2 in a blocking stabilizer, and the IIF assay using undiluted supernatant was used to characterize the ANCA-staining pattern as pANCA or cANCA. The results, as indicated in Table 2 below, demonstrate that 68 percent (15/22) of all the supernatant fluids derived from the LPL of UC patients are ANCA positive with 71 percent (12 / 17) of ANCA expressing the mucosa involved and 60 percent (3/5) not involved.

Table 2: Summary of the neutrophil ELISA data fixed with alcohol and the IIF staining pattern correlated for the cultured LPL supernatant liquids Type of ANCA positive Standard IIF Level of Mucose n (% of n (% of IgG samples samples pos. ) (μg / ml) cANCA cANCA UC 22t 15 (68%) * 9 (60%) 6 (40%) 25x / + 2E -involved 17 12 (71%) 8 (67'- 4 (33%) 31x / + 30 -not involved 3 (60%) ** 1 (33%) 2 (67%) 12x / + 16 CD 1 (13%) 0 (0%) 1 (100%) 15x / + 26 without IBD 15 2 (13%) 0 (0%) 2 (100%) 5x / + 9 -diverticulitis 1 (11%) 0 (0%) 1 (100%) 3x / + 6 -normal 1 (16 *) 0 (0%) 1 (100%) 10x / + 11 * p < 0.01 versus sin-IBD and p < 0.02 versus CD ** p < 0.1 versus no-IBD: The percentage of ANCA positively from the non-involved samples of UC patients is not significantly different from that of patients without IBD. t The number (n) of samples tested to determine the UC population is one greater than the actual number of patients (21) participating in the study since two samples (involved and not involved) were obtained from one of the patients.

The small sample size of non-involved mucosa of UC patients precluded the statistical significance of that ANCA expression. In contrast, only 13 percent of the culture supernatants derived from both CD (1/8) and LPL without-IBD (2/15) expressed ANCA (P <0.02 and P <0.01, respectively versus UC). Sixty percent (9/15) of LPL positive ANCA from UC patients exhibited a pANCA staining pattern. All liquid supernatants that express ANCA of the LPL without UC exhibited a cANCA dyeing pattern. Since an increase in the spontaneous production of total IgG has been reported by the LPL of UC patients, it could be expected that the presence of ANCA in UC supernatants is due to this increase in IgG. Therefore, total IgG was measured in each liquid culture supernatant of LPL (UC, CD and sin-IBD patients) and plotted against the level of binding by neutrophil ELISA using linear regression analysis. No correlation was found between the level of total IgG in the supernatant liquids of LPL and the level of binding of ANCA. The discovery of ANCA positively in the LPL of UC patients is not simply due to improved levels of IgG in the LPL supernatants of UC +. Finally, the LPLs were also isolated from the five UC patients so that the PBL and MNL were isolated as described above allowing a direct comparison of the ANCA expression and the staining pattern between these three cell types of the cells. same people. Again, four of these five patients (4/5) were seropositive for ANCA and all but one exhibited a pANCA staining pattern while the other was cANCA. The LPL were cultured as described herein and the supernatants were tested by neutrophil ELISA and IIF assay to determine the ANCA and the ANCA staining pattern. The results of those tests and the data from the same assays as carried out in the serum, the PBL supernatant liquid and the MNL supernatant liquid are reported in Table 3.

Table 3: PANCA correlation in supernatant fluids of the lamina propria (LPL) peripheral blood lymphocytes (PBL) and mesenteric nodal lymphocytes (MNL) with serum p-ANCA values from the patient's UC positive ELISA Patient Serum LPL PBL MNL Number% of pattern% of pattern% of pattern% of pattern pos. of IF pos. of IF pos. of IF pos. of IF 1 9K +) P 18 (+) P 4 (-) n / a 2 (-) n / a 2 61 (+) P 13 (+) P 8 (-) n / a 4 (-) n / a 3 24 (+) P 21 (+) P 2 (-) n / a l (-) n / a H (+) 5 (- n / a 7 (-) n / a 2 (- n / a 17 (+) C 3 (-) n / a 17 (+) C 5 (-) n / a (+) = Positive sample ELISA (greater than the medium plus two standard deviations of ELISA values for the supernatants of the LPL normal) (-) = Negative ELISA sample (less than the medium plus two standard deviations of ELISA values for normal LPL supernatants).

P = Perinuclear immunofluorescence pattern. C = Cytoplasmic immunofluorescence pattern. n / a = Not applicable in negative ELISA samples.

Three of the 4 (75 percent) LPL supernatants of pANCA seropositive UC patients expressed ANCA and exhibited a pANCA staining pattern identical to that of their matched ANCA serum and only 1 (1/4) of the supernatant fluids. LPL was negative for ANCA while the corresponding serum showed a positive pANCA reaction. It has therefore been discovered that a population of B cells secreting UCpANCA are present and can be isolated from the mucosal LPL fraction of patients diagnosed with ulcerative colitis seropositive pANCA to be used to generate libraries of the repertoire of the immunoglobulin gene of UC +. These B cells that secrete ANCA are present in both mucous membranes involved with the disease (71 percent) and not involved (60 percent). The IIF analysis showed that the majority of these ANCAs (60 percent) are pANCA (Table 2). In contrast, only 13 percent of the inflammatory and noninflammatory CDI and non-IBD LADs produced ANCA after 12 days of culture. None of these exhibited pANCA dyeing pattern (Table 2). In accordance with the present invention, the lymphocytes of the lamina propria of a human patient diagnosed with UC and seropositive for pANCA, preferably the lymphocytes form an inflamed region of the lamina propria, and are used to generate a library of the same gene repertoire of human immunoglobulin of UC +. It should be noted that the greater the genetic heterogeneity of the population in the form of B cells that are obtained from the gene segments of the immunoglobulin gene repertoire, the greater the diversity of the immunological repertoire that will be available for selection according to the methods of the present invention. Therefore, the B cell of the lamina propria of different people, particularly those that have the immunologically significant age difference and the cells of people from different families and different races can be combined to increase the heterogeneity of a repertoire. The repertoires of the UC + immunoglobulin gene can be derived from the LPLs that produce immunoglobulin that have heavy chains of the IgA, IgD, IgE, IgG or IgM isotypes, most preferably of the LPLs that produce immunoglobulin that have heavy chains of the IgG isotype or IgM and even more especially of the LPL that produce immunoglobulin having heavy chains of the IgG isotype]. The repertoires of the UC + immunoglobulin gene can be derived from the LPLs that produce immunoglobulin having light chains of the Kappa or lambda isotype, preferably of the immunoglobulin-producing LPLs that have light chains of the kappa isotype.

C. Location of the Antigen UCpANCA The second obstacle that had to be overcome to isolate UCpANCA was to determine how the antibody material generated from the repertoire of the immunoglobulin gene of UC + could be segregated. The isolation and identification of the antigen (s) specifically recognized by UCpANCA 'has not yet been reported in the literature. The conventional assay to detect serum UCpANCA is through the IIF assay using neutrophils fixed with cytocentrifugal alcohol. As discussed above, the typical patterns produced by ANCA using neutrophils fixed with alcohol are cANCA and pANCA. Unfortunately, these dyeing patterns can be generated by more than one ANCA species such as, for example, ANCA specific for elastase (EL-pANCA) and ANCA specific for myeloperoxidase (MPO-pANCA). Even though in UCpANCA it could be distinguished from these other pANCA by its failure to immunoreact with elastase or myeloperoxidase, the additional assays would allow discrimination between this material that is not UCpANCA and the UCpANCA material that is desired. One of these assays employed herein is referred to as the "DNase sensitivity assay". It has been demonstrated that the pANCA dyeing pattern of UCpANCA, but not the pANCA dyeing pattern of no UCpANCA has been abolished or becomes cANCA when the neutrophils are pretreated with DNase. Therefore, in addition to the neutrophilic ELISA and the conventional Ilf assay, the DNase sensitivity assay was also used to identify and isolate UCpANCA. Another means of overcoming the drawbacks of the conventional IIF assay as a means of detecting UCpANCA is the localization of the antigen UCpANCA as described for the first time herein. The staining patterns generated by the IIF assay do not always accurately reflect the cellular localization of the reactive antigens. For example, it is known that some cytoplasmic antigens are artifactually associated with the neutrophil nucleus after fixation with alcohol to yield a "perinuclear" dyeing pattern. In order to determine if the UC-specific pANCA reactive antigen could in fact be present in a certain aspect of the nuclear domain or if the apparent perinuclear location was an artifact of the neutrophil alcohol binding, the location of the binding within the neutrophil Using IgG from sera from pANCA seropositive UC patients was examined by both confocal laser microscopy and immune electron microscopy using two methods of non-alcoholic cell fixation. By confocal microscopy, most of the most examined UC sera exhibited a nuclear reaction that was located on the inner side of the nuclear periphery (membrane). Immune electron microscopy revealed that the binding was predominantly located through concentrated heterochromatin towards the periphery of the nucleus. This reaction, however, is not due to recognition of the DNA antibody, since these sera do not react in a DNA ELISA (double-stranded type).

IIF Neutrophil-Fixed Alcohol Assay A jury of sera from 25 patients diagnosed with UC and previously determined to express moderate to high levels of ANCA (neutrophil binding level scale 37 percent - 153 percent) in the neutrophil ELISA was further examined, using the IIF assay to determine the type of dyeing pattern that each exhibited. All (100 percent) of the sera containing ANCA exhibited a pANCA staining pattern. This serum was also confirmed as being negative for antibodies recognizing double-stranded DNA (ds) using the anti-dsDNA assay kit of the HELIX diagnostic (from West Sacramento, CA) in accordance with the manufacturer's instructions. Similarly, sera previously characterized as containing antibodies against myeloperoxidase and elastase (which were provided by Dr. J. Charles Jennette of the University of North Carolina located in Chapel Hill, NC, underwent the same IIF assay and yielded a standard of typical pANCA staining, even when the antigens recognized by these latter antibodies are known to be constituents of the cytoplasmic granules. 2. IIF assay of Neutrophil Fixed with Paraformaldehyde It has been reported that when neutrophils are fixed by non-alcohol based reagents (eg, paraformaldehyde, formalin, etc.), the perinuclear staining pattern obtained with either MPO-pANCA sera or EL-pANCA sera are nullified and become a more cytoplasmic staining pattern. The reaction of UC + sera, as well as MPO- and EL-pANCA sera were examined using neutrophils fixed with paraformaldehyde / acetone and previously allowed to settle on the slide. This method of preparation of the slide sheet appeared to eliminate the redistribution of nuclear material that occurs due to cytocentrifugation and maintained the three-dimensional morphology of the cells. The reactions were visualized by confocal IIF microscopy. The DNA-specific fluorescent dye, propidium iodide, was used to delineate the boundary of the nuclear material for reference. The staining pattern observed in paraformaldehyde-fixed neutrophils treated with MPO-pANCA sera was a granular cytoplasmic combination with perinuclear staining of salient characteristic while the EL-pANCA sera retained a thin perinuclear staining pattern. A relatively broad band of dyeing around the periphery of the nucleus was observed in the nautrófilos fixed with paraformaldehyde treated with the UC + serum, while the serum of a normal donor was negative. 3. Comparison of UCJ1 and EL-pANCA Dye Patterns Using Confocal Microscopy Since the "perinuclear" staining reaction of both the UC + serum and the EL-pANCA serum was maintained in the neutrophils fixed with paraformaldehyde, the cut confocal images were examined and compared to determine whether the nuclear location of the recognized antigenic sites for these two antisera they were similar or different. As illustrated in the Figure 1, the boundary of the nucleus and the nuclear material was marked by reaction with propidium iodide (red) while the antibody-antigen reaction was marked in green.

The view to the left of the cut images (Figures IB and ID) show both the antiserum signals together (green) and propidium iodide (red), and the intermediate view shows only the signal provided by the reaction of the antiserum, and the view to the right shows only the propidium iodide signal.

The generated pattern of the UC + serum (Figures IA and B) is clearly within the nuclear border and is colocalized with the outer border of the DNA stained with propidium iodide. The antigenic target of EL-pANCA is clearly perinuclear, since the signal is outside the nuclear border and is not co-localized with the DNA stained with propidium iodide. 4. Microscopic Electronic Antigen Location UCpANCA To verify that the antigen (s) recognized by the UC + sera were located in the nucleus and that this location was different from that of the EL-pANCA specific antigen, the fixed cells were reacted with paraformaldehyde and freeze-dried with the UC + and the reaction was examined by electron microscopy. Immunogol radiation was observed through the heterochromatin DNA placed in the inner periphery of the nucleus of the neutrophils treated with UC + serum (Figure 2A). To ensure that nuclear localization of the UCpANCA antigen was not an artifact of the cell preparation process, the staining pattern of the anti-histone and normal human serum was also examined. As expected, no significant reaction was observed in neutrophils treated with normal human serum (Figure 2B), whereas the gold ratio of immunogold was observed throughout the nucleus in neutrophils treated with anti-human serum. -histone (Figure 2C). These findings confirm the nuclear localization of the antigen UCpANCA as demonstrated using confocal microscopy.

. Confocal Microscopic Analysis of a JANUARY of Positive Serums of UCpANCA To determine if all or only some of the sera of the UC + patients immunoreact with the nuclear antigen (s), a jury of sera from 25 pANCA seropositive UC patients was further analyzed by confocal microscopy using neutrophils fixed with paraformaldehyde-acetone. As seen in Table 4, 88 percent (22/25) of the UC + sera tested yielded a nuclear reaction.

Table 4: Confocal Microscopic Analysis of pANCA Dyeing Patterns Expressing UC Nucelar Cytoplasmic Sera 22/25 (88 percent) 3/25 (12 percent) Central Nuclear Nuclear Periphery * 4/25 (16%) 18/25 (72%) * the dyeing was located towards the nuclear periphery but within the boundary of the nuclear membrane.

Of these, 18/25 (72 percent) were found to be located towards the inner side of the nuclear periphery and 4/25 (16 percent) were found in a more central nuclear location. Only 12 percent (3/25) of the sera yielded a cytoplasmic reaction.

These results indicate that the majority (88 percent) of UCpANCA recognizes an antigenic species (s) located in the neutrophil nucleus, possibly in association with DNA. This discovery makes the antigen UCpANCA unique among the ANCA antigens described so far and provided a unique and reliable basis for discriminating the UCpANCA material from non-UCpANCA material.

Therefore, in accordance with the present invention, a new and useful method is provided for detecting UCpANCA in a sample comprising (a) contacting the sample and a detectable secondary reagent with the fixed neutrophil under appropriate conditions to form a complex neutrophil immune, UCpANCA and the secondary detectable reagent, wherein the secondary reagent has binding specificity for UCpANCA or the portion that determines the class of UCpANCA; (b) separating the unbound secondary reagent from the immune complex; and (c) assaying for the presence or absence of UCpANCA containing the immune complex within the neutrophil nucleus by detecting the presence or absence of the bound secondary reagent. UCpANCA is considered present in the test sample if the immune complex containing UCpANCA is detected within the neutrophil nucleus, or more preferably associated with the heterochromatin DNA located in the inner periphery of the nucleus of neutrophils. The assays of the present invention may be forward, reverse or simultaneous, as described in U.S. Patent No. 4,376,110, issued March 8, 1983 and assigned to David et al., Which is incorporated herein by reference in its entirety. whole. In the progress trial, each reagent is contacted in sequence with a fixed neutrophil. If desired, separation of the bound reagent from the unbound reagent can be achieved before addition of the next reagent. In the reverse test, all reagents are premixed before contacting the fixed neutrophil. A modified method of the reverse test is disclosed in U.S. Patent No. 4,778,751, issued October 18, 1988 in favor of El Shami et al., Which is hereby incorporated by reference in its entirety. In a simultaneous assay, all reagents are contacted separately but contemporaneously with the fixed neutrophil. A sample can be obtained from any biological fluid, for example, whole blood, plasma or other body fluids, or tissues that have a UCpANCA, preferably serum or the LPL supernatant fluid. The separation steps for the various assay formats described herein, including the removal of the unbound secondary reagent from the immune complex, can be carried out by methods known in the art. When appropriate, a simple wash with an appropriate stabilizer followed by filtration or aspiration is sufficient. If the neutrophil (s) is immobilized on a particulate support, it may be desirable to centrifuge the particulate material followed by removal of the washing liquid. If the neutrophil (s) is immobilized in the membranes or filters, the explanation of a vacuum or a liquid absorption member on the opposite side of the membrane or filter allows the liquid to be washed through the membrane or filter to be attracted. The methods of the present invention are normally carried out at room temperature and 37 ° C. Accordingly, temperatures appropriate for carrying out the methods of the present invention, generally range from about 22 ° C to about 38 ° C. In accordance with the methods of the present invention, the neutrophil (s) can be fixed by methods well known in the art that render neutrophils permeable for the reagents used in the methods of the present invention. Suitable fixing agents include for example methanol, ethanol, formalin or the like, and preferably include fixing agents that do not contain alcohol, such as for example paraformaldehyde and acetone. Of course, a person skilled in the art will appreciate that these binding agents should not significantly alter the nuclear or cellular morphology of the neutrophil (s). The neutrophil (s) and appropriate secondary reagents for use in the practice of the present invention will depend on the origin of the sample tested. As used herein, the terms "patient", "subject" or "person" when referring to the origin of the sample to be tested, means any animal capable of producing UCpANCA including, for example, humans, primates not humans, rabbits, rats, mice and similar. Preferably, the neutrophils and secondary reagents employed will have specific reactivity for the species from which the sample to be tested is obtained. For example, to assay for UCpANCA in the sample obtained from a human subject, the neutrophils and the secondary reagent are preferably specific for humans. If multiple secondary reagents are used, for example, secondary antibodies, each antibody is preferably species-specific for its antigen. Neutrophils useful in the present invention can be obtained from a variety of sources, v, g., The blood of a human, non-human primates, rabbits, rats, mice and the like, by methods known to those skilled in the art. . The term "secondary reagent" as used herein refers to any reagent or combination of reagents that can bind UCpANCA. For example, a secondary reagent may be an anti-UCpANCA antibody or specific fragments thereof for any UCpANCA idiotope., but preferably not that which would be competitive with neutrophil binding or that causes steric hindrance of neutrophil binding / UCpANCA. Alternatively, a secondary reagent may be an anti-isotype antibody having specificity for a portion that determines the class of UCpANCA, or it may be a protein A or protein G. Secondary reagents useful in the practice of the present invention may be obtain by well-known techniques in the field or from any of the various other commercial sources. If antibodies are used, they are preferably monoclonal or monoclonal pools. Another alternative to increase the sensitivity of the assay of the present invention is to use a multiple antibody system for the secondary reagent. In this manner, the methods of the present invention can be carried out using a combination of antibodies "as the secondary reagent, wherein at least one of the secondary antibody reagents of the combination has specificity for UCpANCA or the class of portion that determines the class of UCpANCA and at least one secondary antibody of the combination is detectable.

The term "detectable secondary reagent" refers to the secondary reagent as defined above which can be detected or measured by a variety of analytical methods. This term includes reagents that are directly detectable without binding of radioactivators that generate signals or those that can be irradiated with a signal generating system to allow detection or measurement such as, for example, a radioisotope, a chromogenic or fluorogenic substance or a chemiluminescent label , gold, or similar. In any of the aforementioned methods, the reactivity of the secondary reagent with the UCpANCA should not be significantly altered by the presence of the radioactivator. In a currently preferred embodiment, the secondary reagent is an anti-IgG antibody material that is detectable by chemical bonding thereof with a fluorogenic compound. Suitable fluorogenic compounds are those that emit light at the visible ultraviolet wavelength subsequent to excitation by use or another source of energy. The fluorogens can be used alone or with an appropriate rapid cooling molecule. Methods for conjugating the appropriate fluorogens have been disclosed and described for example in Methods in Enzymology, Volume 74, Part C, 32105 (Van Vunakis and Langone, editors, 1991). Alternatively, the secondary antibody linked to the fluorogenic useful for the practice of the present invention can be obtained from a number of commercially available sources. In still another preferred embodiment, the secondary reagent is protein A or protein G irradiated with gold. Depending on the nature of the radioactivator used, a signal can be detected for example, by irradiating the test sample formed in complex with light and observing the fluorescence pattern; by electron microscopy; or in the case of chemiluminescence or radioactive irradiation, employing a radiation counter such as a gamma counter or gamma-emitting markers, such as iodine-125.

D. Derivation of the immunoglobulin gene repertoire of UCJ. Methods for preparing the genomic DNA fragments of which, the genes of the immunoglobulin variable region can be cloned as a diverse population are well known in the art. See for example of Herrmann et al., Methods in Enzymology, 152: 180-183 (1987); from Frischauf, Methods in Enzymology, 152: 183-190, (1987); from Frischauf, Methods in Enzymology, 152: 190-199 (1987); and from DiLella et al., Methods in Enzymology, 152: 199-212 (1987). (The teachings of the references cited herein are incorporated herein by reference). A repertoire of immunoglobulin gene can be isolated either from the genomic material containing the genes expressing segments V, D and J the variable domains of immunoglobulin or RNA messenger (mRNA) representing the variable domain transcript. The difficulty in using genomic DNA other than non-rearranged B lymphocytes lies in the juxtaposition of the sequences encoding the V ^, D, and J ^ segments of the heavy chain variable domain with one another and in the placement in juxtaposition of the sequences that code for the segments Vj? /? and J? / of the variable domain of the light chain one with the other where the sequences are separated by introns. Sequences containing the appropriate exons should be isolated, the introns cut off and the exons spliced in the proper order and orientation. For the most part, this will be difficult so that the alternative technique that employs the rearranged B cells will be the selection method because the segments of V ^, D and J ^, or the segments of V ^ /? and J? /? they are translocalized to be adjacent so that the sequence is continuous (free of introns) for all variable regions. When the mRNA is used, the B cells will be lysed under conditions of RNase inhibition. In a modality, the first step is to isolate the total cellular RNA. The poly A + mRNA can then be selected by hybridization to the oligo-dT cellulose column. The presence of mRNA coding for the heavy and / or light chain polypeptides can then be assayed by hybridization to the single-stranded DNA of the appropriate genes. Conveniently, the sequences encoding the constant portion of the immunoglobulin heavy and light chains can be used as polynucleotide probes whose sequences can be obtained from available sources. See for example, Early and Hood, Genetic Engineering, Setlo and Hollaender, editors, volume 3, Plenum Publishing Corporation, New York (1981), pages 157-188; and from Kabat et al., Sequences of Immunological Interest, National Institutes of Health, Bethesda, Maryland (1987). In a currently preferred embodiment, total RNA is extracted from the LPL cells of the UC + patients and the RNA preparation enriched for the heavy and light immunoglobulin chains encoding mRNA. Enrichment is typically achieved by subjecting the total RNA preparation or a partially purified mRNA product thereof to a primer extension reaction using a polynucleotide synthesis primer as described herein. Exemplary methods for producing repertoires of the V ^ and VL gene using the polynucleotide synthesis primers are described in FIG.

PCT Application Number PCT / US90 / 02836 (International Publication Number WO 90/14430). Particularly preferred methods for producing a gene repertoire depend on the use of preselected oligonucleotides as primers in a polymerase chain reaction (PCR) to carry out the PCR reaction of the products, as described herein. • 1. Preparation of Primers for Producing Repertoires of the Immunoglobulin Gene of UC ± Preferred repertoires of the immunoglobulin gene V ^ and VL of UC + are prepared separately before use in the present invention. The preparation of the repertoire is typically achieved by extension of the primer, preferably by extension of the primer in the polymerase chain reaction (PCR) format.

To produce a repertoire of VJJ-encoding DNA homologs by primer extension, the nucleotide sequence of a primer is selected to hybridize with a plurality of immunoglobulin heavy chain genes at a site essentially adjacent to the V ^ coding region. so as to obtain a nucleotide sequence coding for a functional polypeptide (capable of binding). To hybridize to a plurality of nucleic acid encoding different V ^, the primer must be a considerable complement of a conserved nucleotide sequence between the different chains. Preferred sites include nucleotide sequences in the constant region, the main region and the promoter region, even though fragments of the Vn domain can be obtained using sites in the region of the variable domain schema of the J region and the like. If the repertoires of DNA homologs that encode V ^ and encode VL are to be produced by amplification (PCR), two primers, ie a pair of PCR primers, must be used for each coding strand of the nucleic acid to be amplified. In PCR, each primer works in combination with a second primer to amplify a target nucleic acid sequence. The selection of the PCR primer pairs for use in PCR is regulated by considerations as discussed herein to produce the repertoires of the immunoglobulin gene. That is, the primers have a nucleotide sequence that is complementary to the sequence conserved in the repertoire. Primer sequences useful for amplification of the V ^ coding DNA homologs and VL coding are shown in SEQ ID NOs: 5 to 16. 2. Polymerase Chain Reaction to Produce Repertories of V ^ and Vt- Gene of CU ± The strategy used for the cloning of V ^ and VL genes contained within a repertoire will depend, as is well known in the art of type, complexity and purity of the nucleic acids that make up the repertoire. Other factors include and genes are or are not contained in one or a plurality of repertoires and whether or not they are amplified and / or mutagenized. The V ^ and VL gene repertoires consist of polynucleotide coding strands such as mRNA and / or the sense strand of genomic DNA. If the repertoire is in the form of double-stranded genomic DNA, it is usually first denatured, typically by fusion in single strands. A repertoire is subjected to a PCR reaction by (contacting) the repertoire with a pair of PCR primers, each member of the pair having a preselected nucleotide sequence. The pair of PCR primers is capable of initiating the primer extension reactions by hybridizing to nucleotide sequences, preferably at least about ten nucleotides in length and more preferably at least about 20 nucleotides in length which are conserved within the nucleotide sequence. repertoire. The first primer of the pair of PCR primers is sometimes referred to herein as the "sense" primer because it hybridizes to the coding or sense strand of a nucleic acid. further, the second pair of PCR primers is sometimes referred to herein as the "anti-sense primer" because it hybridizes to a non-coding or anti-sense strand of a nucleic acid, i.e., a complementary strand to a coding chain. In a currently preferred embodiment, the total RNA of the LPLs of human UC + patients is used to generate a plurality of DNA homologs encoding V - ^ - and V ~. Since the UCpANCA serum is typically of the IgG1 and kappa isotypes, the family-specific PCR primers of the variable heavy chain and the kappa chain are preferably placed in pairs with the PCR primers that hybridize with the constant regions. ? and K respectively. Preferred PCR primers for generating DNA homologs encoding V ^ - and VL ~ from the repertoire of the immunoglobulin gene of UC + are provided in SEQ ID NOs. 5 to 16. The PCR reaction is carried out by mixing the pair of PCR primers, preferably a predetermined amount thereof, with the nucleic acid of the repertoire, preferably a predetermined amount thereof, in a PCR stabilizer for form a PCR reaction mixture. The mixture is maintained under polynucleotide synthesizing conditions for a certain period of time which is typically predetermined to be sufficient for the formation of a PCR reaction product, thereby producing a plurality of DNA homologs other than Vj coding. and / or coding of A plurality of the first primer and / or a plurality of the second primers can be used in each amplification, e.g., a species of the first primer can be placed in pairs with a number of different second primers to form several different pairs of primers. Alternatively, an individual pair of the first and second primers may be used. In any case, the amplification products of the amplifications using the same or different combinations of the first and second primers can be combined to increase the diversity of the gene library. In a currently preferred embodiment, the VJJ- encoding DNA homologs are created in seven separate reactions by placing in pairs one of the specific primers of the heavy chain variable segment family (SEQ ID NOs: 6 to 12) with the specific primer of the constant region? l. Equal amounts of each of the homologues produced from each of the seven reactions are then combined to create the V-coding DNA homolog library of the immunoglobulin gene repertoire of UC + ("Vjj library of UC +"). "). It is also currently preferred that DNA homologs encoding VL can be created in three separate reactions by pairing one of the specific primers of the kappa light chain variable segment family (SEQ ID NOs: 14 to 16) with the specific primer of the constant region K. Then combine equal amounts of the homologs produced from each of the three reactions to create the library of the VL coding DNA homolog of the repertoire of the immunoglobulin gene of the UC + ("library"). VL of UC + "). PCR amplification methods are described in detail in U.S. Patent Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, and in at least several texts, including "PCR Technology: Principles and Applications for DNA Amplification", by H. Erlich , publisher, Stockton Press, New York (1989); and "PCR Protocols: A Guide to Methods and Applications," Innis et al., editors, Academic Press, San Diego, California (1990).

E. Production of a Library that Codifies the Material of the Heterodimeric Antibody of the Homologues of DNA Coding of VH- and VT? - of the Repertory of the Immunoglobulin Gene of the UCÍ. 1. General Rationed Exposure Methods for generating the UCpANCA material of the present invention using the bacteriophage display technique preferably include first combining the V ^ and VL libraries of UC + to form a "heterodimeric UC + library" that encodes the material of the heterodimeric antibody of the repertoire of the immunoglobulin gene of UC +. The members of the UC + heterodimeric library can then be expressed in an in vitro expression host such as for example E. coli, so that the co-expressed V ^ and VL polypeptides can be assembled into the material of the functional heterodimeric antibody. Then, the members of the UC + heterodimeric library are selected because of their ability of their heterodimeric antibody material expressed to bind the antigen of UCpANCA. This selection process requires a means to bind the expression product (i.e., the material of the heterodimeric antibody) with the V ^ and VL DNA homologs encoding the same. This is achieved by anchoring the heterodimeric antibody material in a bacteriophage coat which in turn encapsulates the DNA, VJJ and VL homologs encoding the heterodimeric antibody material. Finally, the members of the heterodimeric library of the UC + that encode the material of the heterodimeric antibody having antigen binding capacity are segregated from the rest of the library for further characterization and / or use. 2. Vectors for the Expression of the Material of Heterodimeric Antibody on the Surface of the Bacteriophage Since the object is to achieve the expression of the UC + V ^ and VL libraries combined in a manner that binds the expression product to the DNA homologs of ^ H and ^ L which encode the same, it is convenient to create and store the heterodimeric libraries of the present invention in an appropriate phagemid expression vector. The phagemid expression vectors useful in the practice of the present invention include the monocistronic vectors and, most preferably, dicistronic vectors. The fagemid vectors for expression of a heterodimeric antibody material on the surface of a filamentous bacteriophage particle are recombinant DNA molecules adapted to receive the coding DNA homologs of VJJ- and VL- and express these homologs as fusion proteins in wherein one of these homologs is fused to a membrane anchoring domain of filamentous bacteriophage coat protein and to a prokaryotic secretion signal domain and the other of these homologues is fused to a prokaryotic secretion signal domain. That is, one of either the V ^ and VL polypeptides is expressed as a fusion protein including a filamentous bacteriogage coating membrane anchor and a prokaryotic secretion signal and the other polypeptide is expressed as a fusion protein including a signal from prokaryotic secretion. A prokaryotic secretion signal is a relatively short amino acid sequence at the amino terminus of a polypeptide, which carries or directs the polypeptide through the plasma membrane of the bacteria and thus ensures its eventual secretion into the periplasmic space and possibly beyond it. The polypeptide of the main sequence is commonly removed before the polypeptide becomes active. A single expression vector can be used with two cistrons, for example, pComb 3, and two expression vectors can be used with one cistron each. Alternatively, an appropriate expression vector for use in the present invention (eg, the Vector SurfZap ™ that is provided by a kit by Stratagene, La Jolla, California) is adapted to receive a polynucleotide that encodes both a DNA homologue encoding V ^ _ yy one that encodes VL- that have been directionally linked to each other, preferably through a linker, and to express this polynucleotide as a single fusion protein that includes a membrane anchor of filamentous bacteriophage coat protein and a prokaryotic secretion signal. The skilled artisan will appreciate that appropriate vectors for the expression of a heterodimeric antibody material on the surface of a filamentous bacteriophage particle can be constructed in many different ways to achieve this proposed result. Therefore, the skilled person may select to use a combination of monocistronic expression vectors or a single expression vector with one or more cistrons. Preferably, a fagemid expression vector for expressing the heterodimeric antibody material provides a system for independently cloning (inserting) the coding homologs of VJJ_ and VL- into two separate expression cassettes present in the vector, to form two separate cistrons to express the V ^ and VL encoded polypeptides of the heterodimeric antibody material. The expression vectors of phagemid comprising two expression cassettes are referred to as a dicistronic phagemid expression vector. Currently preferred dicystronic phagemid expression vectors are pComb 3 and C3AP313H5, both of which were provided by Carlos Barbas III of Scripps Research Institute, of La Jolla California. The phagemid pComb 3 will be described in detail below to provide examples of the preferred attributes of a dicistronic phagemid expression vector. Phagemid pComb 3 comprises a first expression cassette (which will also be referred to herein as the "Hc2 expression cassette") which includes DNA sequences translatable upstream and downstream operably linked through a sequence of nucleotides adapted for directional ligation in a DNA homologue. The transposable upstream sequence encodes a prokaryotic periplasmic secretion signal ("pelB main region"). The presence of the main pelB region facilitates the secretion of a molten polypeptide thereto (e.g., VJJ or VL polypeptide) from the bacterial cytoplasm to the periplasmic space. Exemplary amino acid sequences of the appropriate pelB conductive region are provided in Table 1 of International Patent Application Number PCT / US93 / 08364, which is incorporated herein by reference. The sequence downstream of the first expression cassette of phagemid pComb 3 encodes the anchoring domain of the coat protein membrane of the filamentous bacteriophage of protein III coating of the filamentous bacteriophage. The membrane anchoring domain is a portion of the carboxy terminal region of the coating protein III ("cpIII") and includes a region of the hydrophobic amino acid residues to span a lipid bilayer membrane and a waste region of charged amino acids normally found in the cytoplasmic space of the membrane and extending away from the membrane. This bacteriophage coat protein membrane anchor is capable of binding the matrix of a filamentous bacteriophage particle thereby incorporating a polypeptide fused thereto to the surface of the bacteriophage. Exemplary amino acid sequences of the appropriate filamentous bacteriophage coat protein membrane anchoring domain cpIII and cpVIII are also provided in Table 1 of International Patent Application Number PCT / US93 / 08364, which is incorporated herein by reference. reference. The term "fusion protein" as used herein, refers to an amino acid polymer comprising at least two polypeptides and a linking sequence for operably linking the two polypeptides in a continuous polypeptide. The two polypeptides linked in a fusion protein are typically derived from two independent sources and therefore a fusion protein comprises two linked polypeptides not normally found bound in nature. This first expression cassette of phagemid pComb 3 includes DNA expression control sequences for expressing translatable DNA sequences. The DNA expression control sequences comprise a set of DNA expression signals to express a structural gene product and include both promoter and transcription terminators 5 'and 3' as is well known, operably linked with the rest of the cassette of expression such that the expression cassette is capable of expressing a structural gene product. The set of nucleotides that define the DNA expression control sequences, the upstream and downstream DNA sequences and the nucleotide sequence adapted for directional ligation in a DNA homologue are collectively referred to as an expression cassette. The 5 'control sequences define a promoter to initiate transcription (transcription promoter) and a ribosome binding site operably linked to the 5' terminal of the upstream translatable DNA sequence. The 3 'control sequences define at least one stop codon (stop) in the frame with and operably linked to the sequence encoding the membrane anchor polypeptide. Phagemid pComb 3 contains a second expression cassette (also referred to herein as "Lc2 expression cassette") to express a second polypeptide (e.g., either the V ^ or VL polypeptide, which does not is expressed through the first expression cassette). The second expression cassette includes a second translatable DNA sequence encoding a pelB main region, operably linked at its 3 'terminus through a nucleotide sequence adapted for directional ligation into a downstream DNA sequence of the vector that typically defines at least one stopping or stopping codon in the cassette reading frame. The second translatable DNA sequence is operably linked by its 5 'terminal with the DNA expression control sequences that make up the 5' elements. The second expression cassette is capable, during the insertion of a DNA sequence (e.g., a DNA homolog encoding VJJ- or VL ~), of expressing the second polynucleotide encoded in this way as a fusion protein comprising the main pelB region linked to the polypeptide encoded by the inserted DNA A cistron in a fagemid expression vector useful in the practice of the present invention is the region of the vector that forms, during insertion of the coding DNA homol of V _ or V ^ -, A nucleotide sequence capable of expressing, in an appropriate host, the UC + antibody material.Therefore, the sequence competent in expression of the nucleotides is referred to as a cistron.A cistron is formed when a DNA homol encoding Vpj- or VL- is inserted directionally ("directionally linked") between the upstream and downstream sequences through the nucleotide sequence adapted for that object. of translatable DNAs namely, the upstream sequences, the inserted and downstream sequences all are operably linked in the same reading frame. Thus, an expression vector of dicistronic phagemid to express the material of the heterodimeric antibody of UC + provides a system for cloning a member of each of the V ^ and VL libraries in the portions of the vector cassette to produce capable cistrons. of co-expressing a V _ and one VL polypeptide of the heterodimeric UC + antibody material. The phagemid pComb 3 expression vector also carries a selectable resistance marker gene to ampicillin in addition to the first and second expression cassettes. A duplication origin of the bacteriophage fl facilitates the generation of the single chain phagemid. Isopropyl thiogalactopyranoside (IPTG) induces the expression of a dicistronic message encoding the fusion protein of the first cistron and the fusion protein of the second cistron. As used herein, the term "vector" refers to a recombinant DNA molecule capable of transporting between different genetic environments another DNA molecule to which it has been functionally linked. The vectors are capable of autonomous duplication in a cell and to which a DNA segment eg, a gene or polynucleotide can be functionally linked in order to effect duplication of the attached segment. Vectors capable of directing the expression of translatable DNA and coding for one or more polypeptides are referred to herein as "expression vectors". As used herein with respect to DNA sequences or DNA segments, the phrase "operably linked" means that the sequences or segments have been covalently linked preferably by a conventional phosphodiester linkage, on a DNA strand, and either in the form of a single or double chain. The selection of the vector to which the transcription unit or cassette of this invention is operably linked depends directly as is well known in the art that the desired functional properties, eg, duplication of the vector and protein expression, and host cell to be transformed, these being the limitations inherent in the technique to construct the recombinant DNA molecules. A nucleotide sequence adapted for directional ligation, i.e., a polylinker is a region of the fagemid expression vector that (1) binds operably to duplicate and transport upstream and downstream DNA sequences and (2) provide a site or a means for directional ligation of a DNA homol in the vector. Typically, a directional polylinker is a nucleotide sequence that defines two or more restriction endonuclease recognition sequences or restriction sites. Under restriction dissociation, the two sides yield cohesive terminals to which a Vpj- or VL-encoding DNA homol can be ligated to the fagemid expression vector. Preferably, the two restriction sites provide during restriction diisocytion, cohesive terminals that are not complementary and therefore allow the directional insertion of a DNA homologue into the expression cassette. For example, the nucleotide sequence adapted for directional ligation in the first expression cassette ("Hc2") of the phagemid pComb 3, codes 5 'to 3' for the restriction site Xho 1 and the restriction site Spe I. The sequence of nucleotides adapted for directional ligation in the second expression cassette ("Lc2") of phagemid pComb 3 encodes 5 'to 3', the restriction site Sac I and the restriction site Xba 1. In a preferred embodiment, a vector The expression of fagemid is designed for convenient manipulation in the form of a filamentous bacteriophage particle that encapsulates a genome according to the teachings of the present invention. In this embodiment, a fagemid expression vector also contains a nucleotide sequence that defines a duplication origin of the bacteriophage filaments such that the vector, during the presentation of the appropriate genetic complement can duplicate itself as a filamentous bacteriophage in duplicated chain form. simple and pack into filamentous bacteriophage particles. This feature provides the ability of the expression vector of phagemid to package in bacteriophage particles for subsequent segregation of the particles, of the vector contained therein away from other particles comprising a population of bacteriophage particles. The duplication origin of the filamentous bacteriophage is a region of the bacteriophage genome as it is well known that it defines sites for initiation of duplication, termination and duplication and packaging of the duplicative form produced by duplication. See for example from Rasched and others Microbiology Review, 50: 401-427 (1986); and Horiuchi, Journal of Molecular Biology, 188: 215-223 (1986). A preferred duplication origin of the filamentous bacteriophage for use in the present invention is a duplication origin of the bacteriophage M13, fl or fd. The phagemide of pComb 3 uses the origin of duplication of the o - bacteriophage fl A preferred phagemid expression vector is a dicistronic phagemid expression vector. 3. Randomly Combine the Vu-Vy-Coding DNA Homologs in a Dicistronic Fagemide Expression Vector The construction of a library of dicistronic fagemide expression vectors capable of expressing V? _ And VL polypeptides from the VJJ libraries and VL of UC + is achieved preferably in two general steps. In the first step, the members of the libraries either V ^ or VL of the UC + are directionally linked in one of the cassettes of expression of the dicistronic vector. In the second step, the members of the other gene library are directionally linked in the other expression cassette so that the dicistronic vector contains a random combination of two DNA homologues, one encoding a Vn polypeptide and the tro coding a VL-polypeptide This results in a library of clones each of which potentially co-expresses a heavy and light chain of the UC +. The actual combinations are random and do not necessarily reflect the combinations present in the B cell population in the LPL of UC patients. 1 - In one embodiment of the present invention, a library of dicistronic phagemid expression vectors capable of expressing the heterodimeric UC + antibody material in the bacteriophage particles is prepared. Each member of the dicystronic phagemid expression vector library is capable of expressing a VJI polypeptide and a VL polypeptide from a first and a second cistron, respectively that can form, in an appropriate host, a heterodimeric antibody material of the UC + envelope. the surface of a filamentous bacteriophage particle. In accordance with another embodiment of the present invention there are provided methods for producing a library of dicistronic phagemid expression vectors encoding the heterodimeric antibody material from the repertoire of the immunoglobulin gene of UC + comprising: (a) forming a first mixture of ligation by combining in a ligation stabilizer (I) a first library of the repertoire of the immunoglobulin gene of the UC +, the first library comprises a plurality of DNA homologs in the form of dsDNA, each DNA homologue of the library having cohesive terminals adapted for directional ligation wherein the library is selected from the group consisting of the V ^ library of the UC and a VL library of the UC +, and (ii) a plurality of fagemid expression vectors in linear form, each having first cohesive terminals in upstream and downstream that are adapted to directionally receive a homolog d e DNA from the first library of the repertoire of the immunoglobulin gene of UC + in a common reading frame, and where the first cohesive terminals are operably linked to translatable DNA sequences in respective upstream and downstream which in turn they are operably linked to the respective upstream and downstream DNA expression control sequences. The translatable DNA sequence upstream of the first cohesive terminals encode a prokaryotic secretion signal and the translatable DNA sequence downstream of the first cohesive terminals encodes a membrane anchor of the filamentous bacteriophage coat protein. (b) subjecting the mixture to ligation conditions for a sufficient period of time to bind operably the DNA homologs of the first library of the immunoglobulin gene repertoire of UC + with the vectors and produce a plurality of circular fagemid expression vectors , each having a first cistron to express the first library of the immunoglobulin gene repertoire of UC +; (c) treating the plurality of circular phagemid expression vectors under DNA dissociation conditions to produce a plurality of fagemid expression vectors in linear form wherein each has second cohesive termini upstream and downstream that (I) are adapted to receive directionally a DNA homolog from a second library of the repertoire of the immunoglobulin gene of UC + in a common reading frame, and (ii) are operably linked to the respective downstream and downstream DNA sequences which are in turn operably linked to the DNA expression control sequences. The DNA sequence upstream of the second cohesive terminals is a translatable sequence encoding a prokaryotic secretion signal and the DNA sequence downstream of the second cohesive terminals has at least one stop or voltage codon in the frame Reading. (d) forming a second ligation mixture by combining in a ligation stabilizer (I) the plurality of fagemid expression vectors formed in (c) and (ii) the second library of the repertoire of the immunoglobulin gene of UC +, the second library comprising a plurality of DNA homologs in the form of dsDNA, each homologue having DNA from the library terminals 14- cohesives adapted for directional ligation with the second cohesive terminals of the fagemid expression vectors, wherein the library is selected from the group consisting of a V # library of the UC + and a VL library of the UC +; and (e) subjecting the second mixture to ligation conditions for a sufficient period of time to bind operably the DNA homologs of the second library of the UC + immunoglobulin gene repertoire with the vectors and produce a plurality of expression vectors of circular phagemid, each having a second cistron to express the second library of the immunoglobulin gene repertoire of UC + to thereby form the library of dicistronic phagemid expression vectors. In preferred embodiments, the prokaryotic secretion signal encoded by the translatable DNA sequence upstream of the first cohesive terminals and the prokaryotic secretion signal encoded by the transposable DNA sequence upstream of the second cohesive terminals is a signal of pelB secretion. It is also preferred that the coating protein membrane anchor of the filamentous bacteriophage encoded by the translatable DNA sequence downstream of the first cohesive terminals is derived from cpIII or cpVIII as described herein. The dicistronic phagemid pressure vectors useful for practicing the aforementioned method are the dicystronic phagemid expression vectors pComb 3 and C3AP313H5. In carrying out the methods for producing a library of the dicistronic phagemid expression vectors encoding the heterodimeric antibody material from a repertoire of the UC + immunoglobulin gene, it is preferred that the first cohesive terminals in upstream and downstream are not have the same nucleotide sequence of the second cohesive terminals in upstream and downstream. In this embodiment, the treatment of the plurality of circular phagemid expression vectors to produce a plurality of fagemid expression vectors in linear form typically involves the use of in restriction endonucleases that are specific for producing the second cohesive terminals but which they did not dissociate the circular phagemid expression vector at the sites that formed the first cohesive terminals. The first and second exemplary and preferred terminals are the terminals defined by the dissociation of pComb 3 with Xho I and Spe I to form the first cohesive terminals in upstream and downstream 6 - and which are defined by the dissociation of pComb 3 with Sac I and Xba I to form the second cohesive terminals in upstream and downstream. In this embodiment, other pairs of cohesive terminals may be used in the respective pairs of the first and second cohesive terminals as long as the four terminals each is a different non-complementary terminal. Exemplary are terminals found in vectors pCBAK8, pComb2-3, pComb2-3 ', pCombd and pComb2-8 which are described in International Patent Application Number PCT / US93 / 08364, which is incorporated herein by reference. The methods for treating the plurality of circular phagemid expression vectors under conditions of DNA dissociation to form the linear phagemid expression vectors, are generally well known and depend on the nucleotide sequence to be dissociated from the mechanism for the dissociation. The preferred treatment involves mixing the fagemid expression vector with a restriction endonuclease specific for the endonuclease recognition site at the desired dissociation location and in sufficient quantity so that the restriction endonuclease can be dissociated from the fagemid expression vector. The stabilizers, the dissociation conditions and the substrate conditions of the dissociation of the 7 - Restriction endonuclease are well known and depend on the specific enzymes used. The dissociation conditions of the exemplary restriction enzyme are described in the EXAMPLES that will be presented below. In another embodiment of the present invention methods are provided for producing a library of dicistronic fagemid expression vectors encoding the heterodimeric antibody material from a repertoire of the UC + immunoglobulin gene comprising: (a) forming a first ligation mixture combining in a ligation stabilizer (I) a VL coding DNA homolog library of UC + in the form of dsDNAs where each VL coding DNA homologue of the library has at its cohesive terminals the 5 'end and Sac I and its cohesive terminals at the 3 'end and Xba I, and (ii) a plurality of phagem phagemid expression vectors 3 in linear form, each having 5' and 3 * cohesive terminals adapted to directionally receive a counterpart of VL coding DNA from the VL coding DNA homolog library of UC + in a common reading frame, where the 5 'cohesive terminal is a Xba I cohesive terminal operably linked to a pelB main sequence upstream, where the 3 'cohesive terminal is a Sac I cohesive terminal operably linked to one of the downstream DNA sequences that has at least one stop codon or voltage in the reading frame, and wherein the main PelB sequence upstream and downstream DNA sequences are operably linked to the DNA expression control sequences in respective upstream and downstream waters; (b) subjecting the first ligation mixture to ligation conditions for a sufficient period of time to bind functionally the DNA homologs encoding V in the pComb 3 vectors and produce a plurality of circular pComb 3 vectors, each having a first cistron to express a DNA homologue encoding VL of the VL coding DNA homolog library of UC +; (c) treating the plurality of circular pComb 3 vectors under conditions of DNA dissociation to produce a plurality of pComb 3 vectors in linear form adapted to directionally receive a Vy coding DNA homolog from the DNA coding homolog library. V ^ of the UC + in a common reading frame and each having (I) a cohesive terminal Xho I at its 3 'end, the cohesive terminal Xho I is linked ¡9 - operably with an upstream translatable DNA sequence encoding a forward pelB sequence, the upstream translatable DNA sequence operably linked to upstream DNA expression control sequences, and (ii) a SpeI cohesive terminus at at its 5 'end, the Spe I adhesive terminal is operably linked to a downstream DNA sequence encoding a filamentous bacteriophage coat protein membrane anchor, the downstream DNA sequence is operably linked to the control sequences of downstream DNA expression; (d) forming a second ligation mixture by combining in a ligation stabilizer (I) the plurality of vectors pComb 3 in the linear form and (ii) a library of the coding DNA homologue of V? _ of the UC + in the form dsDNA adapted for directional ligation with the plurality of pComb 3 vectors, wherein each VH coding DNA homologue of the library has at its 5 'end a cohesive terminal Xho I and at its 3' end a cohesive terminal Spe I, and (e) subjecting the second ligation mixture to ligation conditions for a period of time sufficient to bind operably, the library of the DNA coding homolog of V ^ to the pComb 3 vectors and produces a plurality of circular pComb 3 vectors, each having the second cistron to express a homologue of the V ^ coding DNA of the V + coding DNA homolog library of UC +, thereby forming the dicistronic library. In yet another embodiment of the present invention there is provided a library of fagemid expression vectors containing the VL O Vu polypeptides. cDNA coding of a repertoire of the immunoglobulin gene of UC + 'wherein the repertoire of the immunoglobulin gene of UC + is derived from the LPL of one or more human beings diagnosed with UC and seropositive for pANCA. Preferably, the library of fagemid expression vectors contains VL polypeptides encoding kappa isotype cDNA, V ^ polypeptides of the gamma isotype. Still preferably, the library of the fagemid expression vectors contains VL coding peptides of cDNA from each family of the immunoglobulin kappa light chain variable segments or V ^ polypeptides of each immunoglobulin heavy chain variable segment family. Optionally, the cDNA encoding the VL O n polypeptides is operably linked to upstream DNA sequences and preferably also to downstream DNA sequences, which in turn are operably linked to the expression control sequences. of upstream and downstream DNA, where the upstream translatable DNA sequence encodes a prokaryotic secretion signal, preferably the major pelB, and the downstream DNA sequence encodes a coating protein membrane anchor of filamentous bacteriophage, preferably a cpIII membrane anchor. In yet another embodiment of the present invention there is provided a plurality of prokaryotic cells, preferably E. coli, which contain a library of the expression vectors of fagemid containing VL OV ^ polypeptides of cDNA coding from a repertoire of the immunoglobulin gene. UC + of the present invention. In a related embodiment, the plurality of prokaryotic cells contains both a library of the fagemid expression vectors containing the VL coding polypeptides of cDNA from a repertoire of the immunoglobulin gene of the UC + and a library of fagemid expression vectors that contain VJJ polypeptides encoding cDNA from a repertoire of UC + immunoglobulin gene. An alternative embodiment provides a population of filamentous bacteriophage particles that encapsulates a library of fagemid expression vectors containing VL or VJJ polypeptides encoding cDNA from a repertoire of the immunoglobulin gene of the UC + of the present invention. In a related embodiment, the plurality of prokaryotic cells contains both a library of fagemid expression vectors containing VL coding cDNA polypeptides from an immunoglobulin gene repertoire of UC + and a library of fagemid expression vectors containing polypeptides. JJ coding cDNA from a repertoire of immunoglobulin gene from UC +. Preferably, the VL OV ^ polypeptides encoded by cDNA contained in the fagemid expression vector are expressed on the surface of the fagemid particle which encapsulates same as a fusion protein comprising a VL O VJJ polypeptide and a membrane anchor of filamentous bacteriophage coating protein. Another library of the present invention is encompassed in a library of heterodimeric phagemid expression vectors that encode and are capable of expressing the heterodimeric antibody material from a repertoire of the immunoglobulin gene of UC +, wherein the repertoire of the immunoglobulin gene of the UC + is derived from the LPL of one or more human beings diagnosed with UC and seropositive for pANCA. One cistron of the dicistronic phagemid expression vectors contains VL coding cDNA polypeptides and the other cistron contains Vn cDNA encoding polypeptides. Preferably, the VL encoded polypeptides are of the kappa isotype and, even more preferably, each family of the immunoglobulin kappa light chain variable segments is represented in the polypeptides. It is also preferred that each of the immunoglobulin heavy chain variable segment families be represented in the Vn encoded polypeptides and that the Vu_ encoded polypeptides are of the gamma isotype. Both the cDNA encoding the VL polypeptides and the cDNA encoding the V ^ polypeptides are operably linked to an upstream translatable DNA sequence encoding a prokaryotic secretion signal, preferably the main pelB signal which is linked in turn. functionally with the upstream DNA expression control sequence. Either the cDNA encoding the VL polypeptides or the V ^ polypeptides is operably linked to a downstream DNA sequence encoding a membrane anchor of filamentous bacteriophage coat protein, preferably a cpIII membrane anchor which, in turn, it is functionally linked to a downstream DNA expression control sequence. Preferably, the dicistronic phagemid expression vectors is pComb 3 or C3AP313H.

In one embodiment, libraries of the heterodimeric phagemid expression vectors of the present invention may be contained in a population of prokaryotic cells, for example, a population of E. coli. An embodiment of a library of heterodimeric phagemid expression vectors that encode and are capable of expressing heterodimeric antibody material from a repertoire of UC + immunoglobulin gene that was produced in accordance with the methods of the present invention and that are contained in a population of E. coli cells, has been deposited with the American Type Culture Collection ("ATCC") of 12301 Parklawn Drive, Rockville, Maryland, United States of America, 20852, on May 31, 1995 and the ATCC Accession Number 69827 has been assigned under the terms of the Budapest Treaty on the International Recognition of Deposits of Microorganisms for the Purpose of Patent Procedure and Regulations promulgated thereunder Treaty. Samples of the deposited material are and will remain available for industrial property offices and other persons with legal rights to receive them under the terms of the Treaty and the Regulations, and otherwise non-compliance with the United States patent laws and regulations. of America and all other nations or international organizations where this application is submitted, or an application claiming ownership of this application, or where any granted patent is granted on any of these applications. In particular, during the issuance of a United States patent based on this or any claim claim priority, or by incorporating this request by reference thereto, all restrictions on the availability of the deposited material will be irrevocably eliminated.

F. Surface Expression of the Antibody Material of the UCÍ. in the Filamentous Bacteriophage that Encapsulates the Expression Vector 1. Filamentous bacteriophage Filamentous bacteriophages are a group of related viruses that infect bacteria. They are called filamentous because they are long, thin particles that consist of a protective coating shell that encloses the bacteriophage DNA. The filamentous bacteriophage F pili ("Ff bacteriophage") only infects gram-negative bacteria by specific adsorption to the F pili tip of the bacteria and includes Fd, Fl and M13. The bacteriophage Ff does not kill or kill the host cell or cause lysis. The coating of the mature Ff bacteriophage consists of five proteins encoded by the bacteriophage DNA. The coating length of the bacteriophage is formed by 2500 to 3000 copies of coat protein VIII ("cpVIII") in an ordered helix formation that forms the characteristic filament structure. About five copies of each of the other four coat proteins are present at the ends of the elongated coat: cpIII and cpIV at one end of the coat, and cpVII and cpIX at the other end. The cpIII encoded by gene III of the bacteriophage DNA serves as a receptor to bind the bacteriophage to its bacterial host in the initial phase of infection. For detailed reviews of the structure of bacteriophage Ff, see Rasched et al., Microbiology Review, 50: 401-427 (1986); and from Model and others, in "The Bacteriophages, Volume 2" Our Calendar and Plenum Press, pages 375-456 (1988), all of which are incorporated herein by reference. The assembly of the bacteriophage particle Ff involves highly complex reactions. In general, however, the bacteriophage particles are assembled during the extrusion of the viral genome through the membrane of the host cell. Before extrusion, cpVIII and cpIII are synthesized and transported to the membrane of the host cell. Both cpVIII and cpIII they remain anchored in the membrane of the cell before their incorporation into the mature particle. Both cpIII and cpVIII proteins include two domains that provide signals for the assembly of the mature bacteriophage particle. The first domain is a secretion signal which directs the newly synthesized protein towards the membrane of the host cell. The secretion signal is located in the amino terminal of the polypeptide and directs the polypeptide at least towards the membrane of the cell. The second domain is a membrane anchor domain that provides signals for association with the membrane of the host cell and for association with the bacteriophage particle during assembly. This second signal for both cpIII and cpVIII comprises at least one hydrophobic region to span the membrane. It has been shown through the manipulation of the cpIII sequence that the elongation of amino acid residue 23 of the C-terminus of hydrophobic amino acids is normally responsible for the membrane anchoring function to be altered in a variety of ways and to retain the ability to associate with the membranes. The expression vectors based on bacteriophage Ff have been described in which the entire sequence of the amino acid residue cpIII was modified by inserting a short polypeptide or an amino acid residue sequence defining a single domain of the single chain antibody. See Parmley and others, Gene, 73: 305-318 (1988); Cwirla et al., Proceedings of the National Academy of Science, USA, 87: 6378-6382 (1990); and McCafferty et al., Science, 348: 552-554 (1990), incorporated by reference herein. These hybrid proteins were synthesized and assembled into the bacteriophage particles in amounts of approximately five copies per particle, a density at which cpIII is usually found normal. In addition, enzymatically functional alkaline phosphatase has been expressed on the surface of filamentous bacteriophage particles as a fusion protein with cpIII. De McCafferty et al., Protein Engineering, 4: 955-961 (1991). 2. Methods for Producing the Filamentous Bacteriophage The filamentous bacteriophage particle of this invention is produced by normal filamentous bacteriophage particle preparation methods and is dependent on the presence of a fagemid expression vector of this invention that contains a duplication origin of the filamentous bacteriophage. as described herein to provide the necessary signals (1) production of a duplicated form of the single strand filamentous bacteriophage and (2) packaging of the duplication form in the filamentous bacteriophage particle. This phagemid expression vector can be packaged when present in a host of the bacterial cell during the introduction of the genetic complement to provide the filamentous bacteriophage proteins required for the production of infectious bacteriophage particles. In general, the method for producing the filamentous bacteriophage particles that have on the heterodimeric antibody material from the surface of the UC + particle comprises: (a) introducing into a permissible prokaryotic host cell for duplication of the filamentous bacteriophage a vector of dicistronic phagemid expression which contains and is capable of expressing the DNA homologs encoding Vu_ Y coding VL of the UC +, wherein one of the encoded peptides is fused to the membrane anchor of the filamentous bacteriophage lining protein, and ) maintaining the prokaryotic host cell containing the vector under conditions sufficient for the production of the filamentous bacteriophage under conditions sufficient for expression of the heterodimeric UC + antibody material, thereby forming the bacteriophage particle. Introducing an expression vector of dicistronic phagemid in a permissible prokaryotic host is achieved by transformation, for example, of E. coli with the vector. The transformation of a prokaryotic host cell is well known and includes calcium mediated transformation, electroporation and the like. Other means of introduction include infection by a filamentous bacteriophage particle. A prokaryotic host cell useful for producing a filamentous bacteriophage of this invention is a permissible one for filamentous infection and morphogenesis, and is well characterized in the filamentous bacteriophage techniques. A preferred host is an E. coli cell, although other prokaryotic cells may be used. Maintenance is carried out in accordance with (b) above to facilitate the expression and assembly of the DNA homologs in the introduced vector to form the bacteriophage particle. Typically, a fagemid expression vector of this invention contains minimal genetic information for the preparation and manipulation of recombinant DNA molecules, and as such, does not contain the full scale of genes required for the production of a filamentous bacteriophage particle. A typical and preferred method for genetic complementation is to infect a bacterial host cell containing a fagemid expression vector of this invention with an auxiliary filamentous bacteriophage thereby providing the genetic element required for assembly of the bacteriophage particle. Exemplary methods of rescue of the helper are described herein in the examples and are described by Short et al., Nucleic Acid Research, 16: 7583-7600 (1988), which is incorporated herein by reference. In this way, the maintenance step typically includes superinfection by the auxiliary bacteriophage combined with an incubation period under conditions to allow the helper genome to express the complementary genes and aid in the expression and assembly of a bacteriophage particle.

The amount of the UC + heterodimeric antibody material captured on the surface of the filamentous bacteriophage particle during the extrusion process of the bacteriophage particle from the host cell, it can be controlled by a variety of means. In one embodiment, the amount of the heterodimeric antibody material of the UC + on the surface of the bacteriophage particle can be controlled by controlling the time between the expression of the fusion proteins of V ^ and VL and superinfection by the auxiliary bacteriophage. After the introduction of the expression vector into the host cells, the longer delay times before the addition of the auxiliary bacteriophage will allow the increased accumulation of the fusion proteins in the host cell, thereby increasing the amount of the protein of fusion captured by the extrusion bacteriophage particle. Therefore, in accordance with a preferred embodiment of the present invention, a library of pComb 3 exposure vectors encoding the heterodimeric antibody material is introduced from the repertoire of the immunoglobulin gene of UC + in E. coli by transformation. A cistron of each expression vector pComb 3 contains cDNA encoding a VL polypeptide and the other cistron of each vector contains cDNA encoding a V ^ polypeptide. Both the cDNA encoding the VL polypeptides and the cDNA encoding the V ^ polypeptides are operably linked to an upstream translatable DNA sequence encoding a prokaryotic secretion signal preferably the main pelB signal, which in turn is operably linked with an upstream DNA expression control sequence. Either the cDNA encoding the VL polypeptides or the V ^ polypeptides is operably linked to a downstream DNA sequence encoding a membrane anchor of the filamentous bacteriophage coat protein, preferably a cpIII membrane anchor that in turn, it is functionally linked to a downstream DNA expression control sequence. The duplication origin of the bacteriophage fl in pComb 3 facilitates the generation of the phagemid of the single chain. Isopropyl thiogalactopyranoside (IPTG) induces the expression of the dicistronic message. The prokaryotic secretion signal, e.g., the main pelB signal, which subsequently dissociates, facilitates the coordinated secretion, but separated from both VL and Vj1 polypeptides from the bacterial cytoplasm into the periplasmic space. For example, if the VH polypeptide is fused to cpIII, it will be anchored in the membrane through the cpIII membrane anchor while the VL polypeptide will be secreted into the periplasm. The Vu_ polypeptide in the presence of the VL polypeptide is assembled to form the material of the heterodimeric UC + antibody, preferably the Fab molecules. The same result can be achieved if, in the alternative, the VL polypeptide is anchored in the membrane through a fusion protein of the VL polypeptide anchor / membrane and a soluble Vn polypeptide is secreted through the main pelB region towards the periplasm. . With subsequent infection of E. coli with the auxiliary bacteriophage as the filamentous bacteriophage assembly proceeds, cpIII is incorporated into the tail of the bacteriophage by anchoring the UC + antibody material to the surface of the bacteriophage. Thus, the present invention provides a population of filamentous bacteriophage particles that encapsulate a library of the dicistronic phagemid expression vectors encoding the heterodimeric antibody material from the UC + immunoglobulin gene repertoire, which can be produced from according to the methods of the present invention. In a mode related to the members of the filamentous bacteriophage population also expressed on the surface of the filamentous bacteriophage of the heterodimeric antibody material encoded by the encapsulating expression vector.

G. Segregation of UCpANCA-Expressing the Bacteriophage Particles from a Bacteriophage Library When a library of the present invention is produced, separately cloning first the V ^ and VL gene repertoires of the LPL of the UC +, which correspond to the polypeptides heavy and light chain of the UC + heterodimeric antibody material, the size of the resulting library after randomly combining the two repertoires in the form of a dicistronic vector is greatly increased. For example, the repertoires of the variable antibody of light chain and heavy chain each having 10 * ^ different members will be taken into account. By combining the two repertoires it theoretically yields a bacteriophage library containing 1012 different possible species of the heterodimeric antibody material. Isolation (segregation) of a bacteriophage particle containing the DNA expression vector encoding the VH and / or VL polypeptides of the UCpANCA material is typically carried out by segregation of the filamentous bacteriophage batch containing the homologue (s) of DNA of interest away from the population to the other particles of the bacteriophage comprising the library. The segregation of the bacteriophage particles involves the separation and physical propagation of the individual bacteriophage particles away from other particles in the library. Methods for the physical separation of the filamentous bacteriophage particles to produce individual particles, and the propagation of the individual particles to form bacteriophage populations of offspring derived from the segregated individual particle, are generally well known in the filamentous bacteriophage techniques. A preferred separation method involves the identification of the heterodimeric UCpANCA material expressed on the surface of a bacteriophage particle by means of a binding antigen specificity UCpANCA between the bacteriophage particle and the antigen UCpANCA. Exemplary and preferred use is the use of "panning" methods whereby a suspension of the bacteriophage particles is contacted with a solid phase antigen, for example, neutrophil fixed with methanol and allowed to immunoreact. After ligation, the unbound particles are washed from the solid phase and the ligated bacteriophage particles are those containing the immunoglobulin polypeptides specific for the antigen UCpANCA on their surface. The bound particles can then be recovered by eluting the bound particle from the solid phase typically by the use of aqueous solvents that interfere with the interaction of the antigen-antibody material. The typical solvent includes stabilizing agents having high ionic concentration or a low pH. An alternative method for separating the bacteriophage particle based on the specificity of the antigen UCpANCA from the material of the heterodimeric antibody expressed on the surface of the UC + from a population of particles is to precipitate the bacteriophage particles from the solution phase by cross-linking with the antigen use UCpANCA, for example, a neutrophil fixed in methanol. The use of the aforementioned particle segregation methods provides a means for selecting a population of filamentous bacteriophage particles present in a bacteriophage library of this invention. As applied to the bacteriophage library, the selection can be used to enrich the library for one or more of the particles expressing the UCpANCA material that has antigen specificity UCpANCA. When the library is designed to contain multiple species of the UCpANCA material that have all some detectable measure of the binding activity of the antigen UCpANCA, but which differs in the structure of the protein, antigenicity, binding affinity of the antigen or avidity and the like, selection methods can be used in sequence to first produce an enriched library for a preselected binding specificity and then to produce a second library further enriched by additional screening comprising one or more than the isolated particles of the bacteriophage. The methods for measuring the binding activities of the antigen, antigenicity and similar interactions between an antigen and an antibody material are, in general, well known and are not further discussed since they are not essential features of the present invention. Therefore, the present invention provides a population of filamentous bacteriophage particles that encapsulate the dicistronic phagemid expression vectors encoding a material of the heterodimeric UC + antibody, wherein the material of the heterodimeric antibody immunoreacts with the antigen UCpANCA as demonstrated by binding to the fixed neutrophil with methanol. Accordingly, the heterodimeric antibody material is referred to herein as the UCpANCA antibody material. In another embodiment, the present invention shows a population of filamentous bacteriophage particles that are the offspring of a single particle and therefore, all of the same material UCpANCA is expressed on the surface of the particle. This population of the bacteriophage is homogeneous and is derived in a clonal manner and therefore provides a source for expressing large quantities of the UCpANCA material.

H. Production of a Soluble Antibody Material from the Phagemid Coding Antibody Material The UC + heterodimeric antibody material anchored in the coating of a bacteriophage particle, in accordance with the present invention, can be expressed in a soluble form simply cutting the polynucleotide encoding the anchor domain of the protein membrane of the bacteriophage coat from the phagemid and discistronic expression vector encoding the heterodimeric antibody material. Therefore, the DNA homologs encoding V ^ and VL will be expressed as a fusion protein of pelB / V ^ and a fusion protein of pelB / VL, respectively. Each one will be secreted into the periplasmic space and will be assembled into the UC + heterodimeric antibody material but will not be anchored. This soluble antibody material can be recovered from the host cell extract for subsequent use or further characterization. For example, the expression vector pComb 3 contains the cDNA encoding the VJJ polypeptides and VL can be isolated and digested with the restriction endonucleases Spe I and Nhe I to cut the polynucleotide encoding the cpIII anchor domain. Because Spe I and Nhe I produce compatible cohesive ends, the vector can be purified with a gel, for example, and self-ligated by yielding a phagemid which can be induced to express the soluble antibody material in a transformed host.

I. UCpANCA Material The soluble heterodimeric UCpANCA material generated as described above is susceptible to further characterization in accordance with one of the immunometric assays also described herein. Therefore, in accordance with the present invention, there is provided a heterodimeric UCpANCA material having immunoreactivity with a nuclear antigen in neutrophils, wherein the immunoreactivity is characterized by a perinuclear staining pattern generated in an IIF assay of the neutrophil fixed with alcohol , as described in the EXAMPLES presented below. Preferably the immunoreactivity of the UCpANCA material is further characterized as being dislocated by pretreatment of the neutrophil fixed with alcohol with DNase, as demonstrated, for example, by the DNase sensitivity assay described in the EXAMPLES. The dislocation of the immunoreactivity of UCpANCA can be exhibited by itself in the IIF assay as a loss of the pANCA staining pattern to a change in the staining pattern from the pANCA staining pattern to a cANCA staining pattern. Still preferably, the immunoreactivity of the UCpANCA material is further characterized as being located within the nuclear envelope of the neutrophil, as can be shown for example by confocal microscopy or immune electron microscopy as described herein. Still preferably, the UCpANCA material is a Fab having a molecular weight of about 60,000 Daltons in 12 percent SDS-PAGE. The present invention also provides dicistronic phagemid expression vectors encoding the heterodimeric UCpANCA material of the present invention. Since the DNA homologs encoding the V ^ and VL polypeptides of UCpANCA can be produced in large quantities, cut from the dicistronic phagemid expression vectors and sequences by methods well known in the art, the UCpANCA material produced in accordance with the present invention, it can be defined in terms of the nucleic acid sequences and the deduced amino acid sequences encoding the constituent polypeptides. As described in more detail in the EXAMPLES, when the phagemids encode ten separate clones of the UCpANCA material that were digested with BstNl and analyzed by agarose gel electrophoresis, two compatible restriction patterns were detected. The clones representative of these two patterns (5-3 and 5-4) were analyzed directly by DNA sequence. The nucleic acid sequences of the V ^ polypeptides of clones 5-3 and 5-4 are given in SEQ ID NO: 1 and 3, respectively. The nucleic acid sequences of the V polypeptides of clones 5-3 and 5-4 are given in SEQ ID NO: 5 and 7, respectively. Segment sequences V, D and J were analyzed separately for homology with respect to the germline previously reported and the rearranged Ig genes using normal computer methodology. Figure 3 provides a comparison of the amino acid sequence between clones 5-3, 5-4 and its duplicate of the nearest germ line. Clone 5-3 uses Ju_3 with three substitutions of nucleotide and two of amino acid, and Jj ^ l with two substitutions of nucleotide. Clone 5-4 uses Ju_6 with a silent nucleotide substitution and J? 3 with two nucleotide substitutions resulting in a change to an amino acid. The diversity segment used by clones 5-3 and 5-4 were not assigned. Despite these differences in the use of the binding segments, the clones show a high degree of homology in the variable segments of heavy chain and light chain. Clones 5-3 and 5-4 both use a segment of Vj? assigned VA27, with 14 substitutions and nine amino acid substitutions, respectively. Clones 5-3 and 5-4 both also use a VH segment assigned to DP49 (homologous gene of the 1.9III gene) with 12 amino acid substitutions each. The novel sequence shared in CDR2 of Vu_, particularly the highly charged segment RKKK contained therein, and the high replacement ratio: silent in this segment (see Table 5), indicates that it is important for the recognition of the antigen.

Table 5. Mutation pattern in clones UCpANCA. The DNA sequences of clones 5-3 and 5-4 were compared with the putative heavy and light chain germ line genes and analyzed for the frequency of mutations resulting in replacement and silent coding changes. The replacement ratio: silent was calculated for the framework (FR1-3) and the regions (CDRl-2) that determine the complementarity. The evidence of antigenic selection (ratio greater than ~ 3) is observed for heavy and light chain CDRs of both clones. CDR Frame Heavy Chain 5-3 1.5 4 5-4 1.7 4 Light Chain 5-3 1.3 7 5-4 3 4/0 Accordingly, the skilled artisan will appreciate that the exemplary sequence information in the UCpANCA material and the UCpANCA polypeptides provided herein especially as presented in SEQ ID NOs. 1 to 8, can be re-modified by methods well known to the skilled artisan, for example, by techniques such as CDR grafting, dot mutagenesis, and the like in order to generate another UCpANCA material and UCpANCA polypeptides without deviating from the particularities basic and novel features of the invention as described herein. Therefore, the new UCpANCA material and the UCpANCA polypeptides can be generated having different sequences than the sequences provided specifically in the ID SEQUENCE LIST without destroying and possibly even improving the immunoreactive characteristics of the UCpANCA material and the polypeptides. For example, the present invention provides the UCpANCA material and the polypeptides of the UCpANCA material defined as follows with reference to the UCpANCA numbers 1 to 8. A person skilled in the art will appreciate that having provided the sequences of the antibody material use UCpANCA, the polypeptides and the polynucleotides of the present invention, additional embodiments of these compositions can be generated having an amino acid residue sequence essentially identical to a sequence specifically shown herein only by making conservative substitutions at one or more of the residue residues in a residue. of similar functionality and exhibiting the ability to mimic the compositions as described herein. Examples of conservative substitutions include the substitution of the non-polar (hydrophobic) residue, such as isoleucine, valine, leucine or methionine for another, the substitution of a polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of a basic residue such as lysine, arginine or histidine by another, to substitution of an acidic residue, such as aspartic acid or glutamic acid for another. The phrase "conservative substitution" also includes the use of a chemically derived residue instead of a non-derivatized residue that is provided in such a way that the polypeptide exhibits the required binding activity. The term "chemical derivative" refers to a polypeptide having one or more residues chemically derived by reaction of a secondary functional group. These derivatized molecules include, for example, those molecules wherein the free amino groups have been derivatized to form amine hydrochlorides, p-toluenesulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. The free carboxyl groups can be derivatized to form salts, methyl and ethyl esters or other types of hydrazide esters. The free hydroxyl groups can be derivatized to form 0-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine can be derived to form N-im-benzylhistine. Also included as chemical derivatives are those peptides that contain one or more amino acid derivatives that occur naturally from the normal twenty amino acids. For example: 4-hydroxyproline can be replaced by proline; 5-hydroxylysine can be replaced by lysine; 3-methylhistidine can be replaced by histidines; homoserin can be replaced by serine; and ornithine can be replaced by lysine. The polypeptides of the present invention also include any polypeptide having one or more additions and / or deletions of residues relative to the sequence of a polypeptide whose sequence is shown herein, as long as the required activity is maintained. Isolated and / or recombinant UCpANCA polypeptides comprising at least one segment-11 are provided! variable of an immunoglobulin heavy chain ("segment Vf"), wherein segment V ^ comprises framework regions, which additionally determine region I ("CDR ^ I") and which additionally determine region II ("CDRH II" ), and wherein CDRH I has essentially the same amino acid sequence as residues 33 to 37 of SEQ ID NO: 2 or residues 32 to 36 of SEQ ID NO: 4, and / or where CDR ^ II has essentially the same amino acid sequence as residues 52 to 68 of SEQ ID NO: 2 or residues 51 to 67 of SEQ ID NO: 4, and / or where the V ^ segment has essentially the same amino acid sequence as the residues 6 to 100 of SEQ ID NO: 2 or residues 6 to 99 of SEQ ID NO: 4. Especially preferably, CDR ^ I has the same amino acid sequence as residues 33 to 37 of SEQ ID NO: 2 or residues 32 to 36 or SEQ ID NO: 4 and / or CDRJJ II has the same amino acid sequence as residues 52 to 68 of SEQ ID NO: 2 or res. iduos 51 to 67 of SEQ ID NO: 4, and / or Vy have the same amino acid sequence as residues 1 to 95 of SEQ ID NO: 2 or residues 6 to 99 of SEQ ID NO: 4. In yet another These polypeptides of the UCpANCA material are provided with polypeptides, which further comprise an immunoglobulin heavy chain binding segment ("JH segment") and a diversity segment, wherein at least a portion of the J ^ segment and a portion of the diversity segment define a region III of complementarity determination ("CDR ^ III"), and wherein the amino acid sequence of COR _ III is essentially the same, or more preferably equal to the amino acid sequence of residues 101 to 109 of SEQ ID NO: 2 or residues 100 to 120 of SEQ ID NO: 4. In another embodiment of the invention, isolated, essentially pure and / or recombinant immunoglobulin heavy chain polypeptides having essentially the same sequence are provided of amino acid that l to SEQ ID NO: 2 or SEQ ID NO: 4, or more preferably the same amino acid sequence as SEQ ID NO: 2 or SEQ ID NO: 4. Any of these polypeptides containing regions of the heavy chain segments of immunoglobulin can be part of, for example, an Fd polypeptide, an immunoglobulin heavy chain of a Fab, Fab ', F (ab') 2 an antibody and the like. Also provided are isolated, essentially pure and / or recombinant polypeptides comprising at least one variable segment of an immunoglobulin kappa light chain ("segment V ^"), wherein segment V ^ comprises framework regions, region I of determination of complementarity ("CDR ^ I") and region II of determination of complementarity (CDRK II "), and wherein CDRj I has essentially the same amino acid sequence as residues 23 to 34 of SEQ ID NO: 6 or SEQ ID NO: 8, and / or wherein CDRK II has essentially the same amino acid sequence as residues 50 to 56 of SEQ ID NO: 6 or SEQ ID NO: 8. Most preferably, CDR ^ I has the same amino acid sequence as residues 23 to 34 of SEQ ID NO: 6 or SEQ ID NO: 8, and / or where CDRK II has the same amino acid sequence as residues 50 to 56 of SEQ ID NO: 6 or SEQ ID NO: 8. In stanother embodiment of the isolated polypeptides, essentially pu and, or recombinants of the UCpANCA material, polypeptides are provided, which further comprise an immunoglobulin kappa light chain binding segment ("segment" JK ") 'wherein at least a portion of the J' segment defines a region III of determination of complementarity ("CDRj? III "), and wherein the amino acid sequence of CDR ^ III is essentially the same amino acid sequence of residues 89 to 97 of SEQ ID NO: 6 or residues 89 to 98 of SEQ ID NO: 8, or more preferably, CDRK III has the same amino acid sequence as residues 89 to 97 of SEQ ID NO: 6 or residues 89 to 98 of SEQ ID NO: 8. In another embodiment of the invention, isolated, essentially pure and / or recombinant immunoglobulin kappa light chain polypeptides having essentially the same amino acid sequence as SEQ ID NO: 6 or SEQ ID NO: 8, or more preferably the same amino acid sequence, are provided than SEQ ID NO: 6 or SEQ ID NO: 8. Any of these polypeptides containing regions of the immunoglobulin light chain segments can be part of, for example, an immunoglobulin light chain, an immunoglobulin light chain of a Fab, Fab ', F (ab') 2 'an antibody, and the like. Preferably, these polypeptides containing the regions of the immunoglobulin light chain segments are combined in a dimeric antibody material, preferably with polypeptides of the present invention that contain regions of the immunoglobulin heavy chain segments. Still especially preferred, the UCpANCA polypeptides either alone or in combination with other polypeptides, retain at least to some extent the immunoreactivity of the UCpANCA material of the present invention. Accordingly, the present invention provides UCpANCA polypeptides characterized as immunoreactive with the neutrophil nuclear antigen, wherein the immunoreactivity is characterized by a perinuclear staining pattern generated in an IIF assay of the neutrophil fixed with alcohol, wherein the immunoreactivity is characterized as dislocating by pretreating the neutrophil fixed with alcohol with DNase, and / or wherein the immunoreactivity is characterized as localized within the nuclear envelope of the nucleophile. The nucleic acids in the form of single-stranded or double-stranded cDNA or RNA encoding the polynucleotides and antibody materials of the present invention are also provided by the present invention. These nucleic acids can be incorporated into vectors. A presently preferred vector of the present invention is an expression vector of dicistronic phagemid, such as, for example, pComb 3. Additional vectors useful herein are viruses, such as baculoviruses and retroviruses, cosmids, plasmids, and the like. The nucleic acid molecules are inserted into the genomes of the vector by methods well known in the art. For example, the insert DNA and vector can both be exposed to a restriction enzyme to create complementary ends in both molecules that form a base pair with one another and then bind together with a ligase. Alternatively, synthetic nucleic acid linkers that correspond to a restriction site in the vector DNA can be ligated to the insert DNA which is then digested with a restriction enzyme that recognizes a specific nucleotide sequence. In addition, an oligonucleotide containing a stop codon, an appropriate restriction site can be ligated to be inserted into a vector containing for example all of the following: a selectable marker gene, such as a neomycin gene for selection of stable transfectants or transient in mammalian cells; enhancer / promoter sequences of the immediate early gene of human CMV for high levels of transcription; transcription processing signals of termination and of SV40 RNA for mRNA stability; origins of duplicating SV40 polyoma and ColEl for appropriate episomal duplication; versatile multiple cloning sites; and the promoters of T7 and SP6 RNA for in vitro transcription of sense and antisense RNA. Other means are available and can easily be accessed by those skilled in the art.

Also provided are expression vectors comprising a cDNA molecule encoding the UCpANCA polypeptide or antibody material, adapted for expression in a bacterial cell, a yeast cell, a mammalian cell or other animal cells. The vectors further comprise the regulatory elements necessary for the expression of the DNA in the bacterial, yeast, mammal or animal cells located in relation to the DNA encoding the UCpANCA polypeptide in order to allow the expression thereof. Regulatory elements required for expression include the promoter sequences for ligating the RNA polymerase and the transcription initiation sequences for ribosome binding. For example, a bacterial expression vector includes a promoter such as the lac promoter for transcription initiation, the Shine-Delgarno sequence and the AUG initiation codon.

(Ausubel et al., Supra 1993). Similarly, a eukaryotic expression vector includes a heterologous or homologous promoter for RNA polymerase II, a downstream polyadenylation signal, the AUG initiation codon, and a termination codon for ribosome separation. These vectors can be obtained commercially or assembled by the sequences described in the methods well known in the art, for example, the methods described above, for constructing vectors in general. Expression vectors are useful for producing cells expressing the polypeptide. This invention also provides a fagemid expression vector containing cDNA encoding the VpO or V ^ UCpANCA polypeptides, preferably both, i.e., the UCpANCA material. Optionally, the cDNA encoding the VL O VH polypeptide is operably linked to the DNA sequences upstream and preferably also to the downstream DNA sequences which in turn are operably linked to the expression control sequences of DNA upstream and downstream where the upstream translatable DNA sequence encodes a prokaryotic secretion signal preferably the major pelB region, and the downstream DNA sequence encodes a membrane anchor protein coat bacteriophage filamentous preferably a cpIII membrane anchor. Still more preferably, the expression vector of phagemid is pComb 3. In yet another embodiment of the present invention there is provided a prokaryotic cell, preferably E. coli, which contains a fagemid expression vector containing cDNA encoding the UCpANCA VL OV ^ polypeptides, preferably both, ie, a UCpANCA material. This invention also provides a mammalian cell containing cDNA encoding a UCpANCA polypeptide or the antibody material. An example is a mammalian cell comprising a plasmid adapted for expression in a mammalian cell. The plasmid contains cDNA encoding a UCpANCA polypeptide and the regulatory elements necessary for the expression of the polypeptide. Different mammalian cells can be used as hosts, including for example the mouse fibroblast cell NIH3T3, the CHO cells, the HeLa cells, the Ltk cells, etc. Expression plasmids are those described supra that can be used to transfect mammalian cells by methods well known in the art, for example, calcium phosphate precipitation, DEAE-dextran, electroporation, microinjection, lipofection and the like. The present invention further provides a filamentous bacteriophage particle comprising a coat of the protein filamentous bacteriophage including the UCpANCA material, the UCpANCA material consisting of at least one UCpANCA V ^ or VL polypeptide integrated into the surface of the bacteriophage coat via a anchor domain of the filamentous bacteriophage coat protein membrane that is fused to at least one of the polypeptides of the UCpANCA material. Preferably, the bacteriophage coating is encapsulating a genome that encodes the polypeptides that make up the UCpANCA material. The preferred filamentous bacteriophage of this invention comprises a heterodimeric UCpANCA material that copies a UCpANCA VL polypeptide and a fused UCpANCA Vn polypeptide to the anchor of the filamentous bacteriophage coat protein membrane, forming a fusion protein UCpANCA V ^, wherein the of the membrane anchor of the UCpANCA fusion protein Vu_ is integrated into the bacteriophage lining and the Vy polypeptide portion of the UCpANCA VH fusion protein is ligated with the UCpANCA VL polypeptide otherwise it is a free soluble monomer . Manifesting differently, the VJJ polypeptide portion of the fusion protein of UCpANCA VH and UCpANCA VL are capable of autogenous assembly in a functional heterodimeric UCpANCA material, which is expressed on the outer surface of the bacteriophage in a manner accessible to the antigen UCpANCA , that is, they are integrated in their surface in the bacteriophage.

By the term "soluble", what is meant is a non-anchored, unbound, free polypeptide, a non-fusion, non-binding, non-binding protein releasable from an anchored state by the treatment of a dimer having links intersubunit, such as disulfide bonds between two cystine residues and the like. Therefore, the term "soluble" defines a heterologous polypeptide that is expressed from a vector of this invention and a membrane anchor that remains free to bind to another soluble monomer or anchored monomer. In addition, the term "soluble" also defines a heterologous polypeptide that is released from a dimer by exposure of that dimer to a reducing agent, such as beta-mercaptoethanol, which results in a separation of the monomeric subunits. The surface integration of the heterodimeric UCpANCA material is provided by the presence of the membrane anchor domain of filamentous bacteriophage coat protein fused thereto. Preferably, a coating protein is selected from the group consisting of cpIII and cpVIII. In a preferred embodiment, described herein, the anchor of the coat protein membrane of the filamentous bacteriophage is cpIII. However, when using cpVIII most of the coated bacteriophage is covered with the heterodimeric UCpANCA material. When cpIII is used as the anchor of the membrane, the heterodimeric UCpANCA material is located in a terminal of the bacteriophage particle.

J. Methods for using the UCpANCA Material 1. Diagnostic Systems The present invention also discloses a diagnostic system of choice, in the form of a kit for the assay for the presence of UCpANCA serum in humans, and in this way helps clinicians with the diagnosis of UC. Large volumes of the monoclonal UCpANCA material can be produced in accordance with the methods described above which by their nature are particularly well suited for use as a reference reagent in immunodiagnostic assays and kits for diagnosing UC. For example, the assay of the neutrophil IIF fixed with alcohol is a conventional assay to detect the presence of pANCA in the serum of a patient suspected of having UC. The use of UCpANCA material of the present invention as a reference reagent would provide a reliable positive control for the pANCA staining pattern associated with UC. Likewise, confocal microscopy provides a method that detects the presence of pANCA serum thus indicating UC. The UCpANCA material can be used as a reference reagent to provide reliable positive control to confirm the location of the immune complex to the interior of the neutrophil nucleus. A suitable kit of the present invention includes, for example, in a sufficient amount for at least one assay, the UCpANCA material, preferably monoclonal UCpANCA of an IgG isotype, a separately packaged reagent. Preferably, the kits also include one or more of the following in an amount sufficient for at least one assay: a neutrophil, DNase, DNase treated neutrophil, detectable label, enzyme substrate, anti-IgG and the like. In addition, other components, such as auxiliary reagents which may include for example: stabilizers, stabilizing agents, fixing agents and the like. "Instructions for use" typically includes a tangible expression describing the concentration of the reagent or at least one parameter of the method of an assay such as the relative amounts of the reagent and the sample to be mixed, maintenance time periods for the mixtures of the reagent / sample, temperature, stabilizer conditions and similar. The neutrophil, for example, can be fixed to a solid matrix to form a solid support comprising a package in the diagnostic systems. A reagent is typically fixed to a solid matrix by adsorption from an aqueous medium. Useful solid matrices are well known in the art. The UCpANCA material, the neutrophil, the irradiated specific binding agent, the DNase and the like of any kit described herein may be provided in solution, as a liquid dispersion or as an essentially dry powder, e.g., in lyophilized form. When the indicator means is an enzyme, the substrate of the enzyme can also be provided in a separate package of a system. The packaging materials discussed herein in relation to the cases are those that are customarily used in cases and can be obtained commercially. The term "package" refers to a solid matrix or material, for example, glass, plastic (e.g., polyethylene, polypropylene and polycarbonate), paper, thin metal foil and the like capable of retaining within the limits that have been fixed a diagnostic reagent, such as a protein, polypeptide fragment, antibody or monoclonal antibody of the present invention. Thus, for example, a package can be a bottle, a small bottle, a plastic wrap and laminated with metal and plastic paper or a similar bond used to contain a proposed reagent or it can be a well of a microtiter plate to which microgram quantities of the proposed reagents have been operably fixed, i.e., linked in order to be capable of immunologically binding by an antibody or polypeptide to be detected. 2. Isolation and Characterization of the antigen UCpANCA The UCpANCA material of the present invention is also well suited for characterization of the isolation and cloning of the UCpANCA antigen (s). Accordingly, the present invention provides methods for isolating this antigen comprising contacting the UCpANCA material to a lysate of the neutrophil cell for a time and at appropriate temperature and pH to form an immune complex comprising the UCpANCA material, then separating the Immune complex of the cell lysate not formed in complex and separating the UCpANCA material from the antigen. In a currently preferred embodiment, the Fab clone of recombinant UCpANCA 5-3 is used to characterize, isolate and clone the reactive antigen of UCpANCA by immunoactivity purification. This technique is one of one of the most powerful methods for the isolation of proteins and allows purification from 1,000 to 10,000 times in a single step. These techniques are well documented in Chapter 13 of Antibodies: A Laboratory Manual by Harlow and Lane, Cold Spring Harbor Laboratories, (1989), which is incorporated herein by reference. The process involves using the antibody or antibody material to bind the reactive antigen on a solid substrate, washing out the proteins from contamination and then selectively removing the antigen. Variations of many formats can be used to achieve this; One of these examples is the following. Neutrophils are isolated as described herein, and then solubilized on ice with 1 percent NP-40 in phosphate-stabilized saline. The lysed material is centrifuged at 300 X grams, and the granulated nuclear fraction (containing the antigen UCpANCA) is collected. The recombinant Fab UCpANCA clone 5-3 is incubated on ice with the nuclear fraction to allow the formation of a Fab immune complex of 5-3 UCpANCA with the antigen. Antigen-antibody complexes are solubilized by digestion of DNase I, and soluble complexes are isolated by affinity chromatography with Ni-NTA (E. Hochuli, S. Piesecki (1992): Interaction of hexahistidine fusion proteins with ions of Ni2 + chelated with nitrolotriacetic acid, Methods 4: 68-72 incorporated herein by reference). The nuclear weight of the isolated antigen is assessed by SDS-PAGE. Based on this information, the protocol is scaled upwards for the solution of the preparative antigen. The microsequence of the isolated protein is used to design the degenerate oligonucleotide primers, and these are employed in the PCR cloning of the gene from a bone marrow cDNA library or neutrophil cell line (A. Goldsborough, A. Ashworth, K Willison, Nucleic Acids Res 18: 1634 (1990), which is incorporated herein by reference.Alternatively, cloning of the UCpANCA antigen is carried out by direct selection of an expression cDNA library derived from bone marrow cDNA or neutrophil cell line See A. Aruffo, B. Seed, Proc Nati Acad Sci USA 84: 8573-8577 (1987), which is incorporated herein by reference.These expression clones provide a source of the antigen UCpANCA in quantities sufficient for the production of commercially useful amounts of the antigen UCpANCA for diagnostic and other commercial purposes The invention will now be described in greater detail with reference to the following non-limiting examples.

EXAMPLES Example 1 - PBL insulation Peripheral blood lymphocytes (PBL) were isolated directly by the Ficoll-Hipaque fraction from 17 UC patients for analysis of UCpANCA production. All 17 of these UC patients were seropositive for UCpANCA using the neutrophil ELISA, 16 of which demonstrated a p-ANCA staining pattern and the others exhibited a cANCA staining pattern by the indirect fluorescent immunofluorescence assay of the fixed neutrophil ( IIF trial). More specifically, 31.8 grams of Ficoll 400 (Pharmacia, Sweden) were combined with 400 milliliters of deionized H2O, stirred vigorously until dissolved and 100 milliliters of sodium diatrizoate hypaque were added and mixed (UCLA Pharmacy, Los Angeles, California). The specific gravity was checked using a hydrometer. It must be 1,077-1,080, preferably 1,080. The Ficoll-Hipaque solution is then sterilized by filtration through a 0.22 or 0.45 micron bottle top filter. The Ficoll-hipaque solution can be stored at 4 ° C, protected from light. The Ficoll-hipaque solution (15 milliliters) is emptied into 50 milliliters of a conical centrifuge tube, carefully placed over 30 milliliters of heparinized blood and centrifuged at 1000 x g (2000 revolutions per minute) for 20 minutes. Using a serological pipette or Pasteur pipette, the interface is removed, placed in a conical 50 milliliter centrifuge conical tube and diluted with at least an equal volume of Hanks Balanced Salt Solution (HBSS) (Irvine Scientific , Santa Ana, California). The diluted interface is centrifuged at 400 x g (1200 revolutions per minute) for 5 minutes and the supernatant liquid is decanted. The granule is resuspended in 50 milliliters of HBSS. Centrifugation and re-suspension of the granule is repeated twice and the PBL re-suspended in RPMI 1640 (Irvine Scientific, Santa Ana, California) + 5 percent of the fetal calf serum (GIBCO, from Gathersberg, Maryland).

Example 2 - Isolation of LPL The lymphocytes were isolated from the biopsy tissue of an inflamed region of the lamina propria of a UC patient having the pANCA serum of high valuation.

The tissue from the biopsy is crushed and then incubated at 37 ° C for 30 minutes in a sterile culture medium (RPMI 1640, 10 percent FCS, and antibiotics) with 20 micrograms per milliliter of collagenase, 20 micrograms per milliliter of hyaluronidase, and 0.1 percent of DNase.

The tissue is then evaluated through a needle of thickness 18 until a cloudy suspension is achieved.

After washing, the suspension of the resulting single cell is centrifuged in a Ficoll-Hipaque gradient to obtain mononuclear cells. For surgical resections, the tissue is washed in a saline solution to remove the adhered waste, and the mucosa dries away from the underlying layers. To remove the entire epithelial layer, small sections of mucosa (1 x 3 centimeters) are incubated in a shaking bath in Hank's Balanced Salt solution free of Ca2 + / Mg2 + ("HBSS") with 1 mM EDTA and the antibiotics through changes in the medium in series. The remaining tissue is crushed and HBSS is digested with 0.5 milligram per milliliter of collagenase and 1 milligram per milliliter of hyaluronidase, and then processed as for biopsy specimens. The isolated lymphocytes are cultured at 37 ° C in a humid atmosphere of 5 percent CO2: 95 percent air for 12 days at a concentration of 2 x 10 ^ cells per milliliter in RPMI 1640 (Irvine Scientific, Santa Ana, CA ) supplemented with 10 percent fetal bovine serum and antibiotics.

Example 3 - Isolation of the Neutrophil Neutrophils were isolated from the peripheral blood of normal persons by Ficoll-Hipaque density centrifugation (specific gravity 1.080) followed by sedimentation with dextran. Therefore, the Ficoll-hipaque solution (15 milliliters) prepared as described in the EXAMPLE 1 is emptied into a 50 milliliter conical centrifuge tube, and carefully placed on top with 30 milliliters of heparinized blood and. centrifuge at 1000 x g (2000 revolutions per minute) for 20 minutes.

The supernatant liquid is carefully removed from the granule of the red blood cell, 10 milliliters of dextran at 6 percent is added to 15 milliliters of the granule and covered with IX HBSS up to 50 milliliters. The granule is resuspended and then the red blood cells are allowed to settle, for approximately 45 minutes to an hour. The supernatant liquid is separated, covered with IX HBSS to 50 milliliters and centrifuged for 5 minutes at 1800 revolutions per minute. The supernatant liquid is decanted and the granular cap. The remaining red granules are subjected to hypotonic lysis by adding 9 milliliters of deionized water, stirring, and then 1 milliliter of 10X HBSS is added and immediately diluted with IX HBSS to 50 milliliters. The cells used are centrifuged for 5 minutes at 1000 revolutions per minute. The supernatant liquid is discarded and the neutrophil granule is re-suspended in 15 milliliters of IX HBSS.

Example 4 - Immobilization and Alcohol Fixation of the Neutrophil in the Micro-titration Plate The isolated neutrophils are resuspended in a sufficient volume of IX HBSS to achieve 2.5 x 106 cells per milliliter. 0.1 milliliter of the cell suspension is added to each well of a 96-well microtiter plate Immulon 1 ™ or Immulon ™ (available from Dynatech Laboratories of Chantilly, Virginia) and the cells are allowed to settle for 30 to 60 minutes . The supernatant liquid is removed with an 8-channel collector connected to a vacuum and the plates are air dried (approximately 2 hours) or tumbled on the laminar flow hood grid to dry (approximately 10 minutes). The neutrophils are fixed with alcohol incubating the cells for 10 minutes in 0.1 milliliter of 100 percent methanol per well. The methanol is then discarded and the plates are air dried. Store at -20 ° C. All neutrophil plates are used within 2 weeks of preparation.

Example 5 - Neutrophil ELISA The following "neutrophil ELISA" was carried out in several samples described herein to detect or confirm the presence of ANCA or the antibody material having specificity for the neutrophil.

The wells were blocked with 0.25 percent BSA in phosphate stabilized saline ("PBS") for one hour. Supernatant liquids from lymphocytes, transformed cells, serum or other test sample was diluted as described in the present PBS + 0.5 percent Tween 20 which was added to the wells prepared in accordance with EXAMPLE 4, incubated for one hour and then raised five times with 0.5 percent Tween-PBS. The plates were then developed by adding an anti-human IgG specific antibody F (ab ') 2 conjugated goat (Pierce) diluted with 1/1000 in PBS-0.5 percent Tween to each well and allowing them to incubate for one hour. The wells were washed five times with 0.5 percent Tween-PBS and then three times with Tris-NaCl (50mM Tris, / 50mM NaCl, pH 7.5). The immune complex was detected with p-nitrophenyl phosphate (one tablet, Sigma 104 pnPP per 5 milliliters of 10 percent diethanolamine, 1 mM MgCl2> pH of 9.8.). The absorbances were measured at 405 nm using a Biorad or Particle Data ELISA reader.

Example 6 - Neutrophil ELISA Antigen An ELISA format was also used to determine whether the antigenic source for binding antibodies and fixed neutrophil antibody materials was the result of the presence of one of the following cytoplasmic constituents of neutrophils: elastase, cathepsin G, myeloperoxidase, and lactoferrin. These tests are referred to together as the "neutrophil ELISA antigen". These tests were carried out in accordance with the same protocol described in EXAMPLE 5 above, with the exception that the wells of the microtiter plates were coated overnight at 4 ° C with elastase, cathepsin G, myeloperoxidase or lactoferrin. The anti-rabbit antigen antibodies were tested with each antigen as the positive controls.

Example 7 - Kappa-Capture ELISA The presence of the UC + soluble dimeric antibody material, and the kappa isotype UCpANCA material was detected and quantified in the supernatant liquid using an ELISA referred to herein as "kappa-capture ELISA".

This ELISA was carried out by coating the wells of a microtiter plate with a 1/1000 dilution of unirradiated goat anti-human IgG kappa (Southern Biotechnology Associates) by incubating the plates containing the antibody overnight at 4 ° C. . The remaining steps were carried out at room temperature. The wells were blocked with 0.25 percent BSA in phosphate-stabilized saline ("PBS") for one hour. Supernatant liquids diluted in PBS + 0.5 percent Tween 20 were added to the wells, incubated for one hour and then washed five times with 0.5 percent Tween-PBS. Plates were then developed by adding the anti-human IgG specific antibody F (ab ') 2 from goat conjugates (Pierce) diluted to 1/1000 in PBS-0.5 percent Tween to each well and allowed to incubate for one hour . The wells were washed five times with 0.5 percent Tween-PBS and then three times with Tris-NaCl (50mM Tris, / 50mM NaCl, pH 7.5). The immune complex was detected with p-nitrophenyl phosphate (one tablet, Sigma 104 pnPP per 5 milliliters of 10% diethanolamine, 1 mM MgCl 2, pH 9.8). The absorbances were measured at 405 nm using a particle data or Biorad reading device.

Example 8 - Immobilization and Alcohol Fixation of the Neutrophil in Glass Slides The isolated neutrophil is re-suspended in a sufficient volume of IX HBSS to achieve 2.5 x 106 cells per milliliter. The suspended neutrophils (0.1 milliliter) are placed on a glass slide and the cells are applied to the slide using a cytorotation at 500 revolutions per minute for 5 minutes. The immobilized neutrophils are fixed by incubating the slide plates for 10 minutes in a sufficient volume of 100 percent methanol to cover the sample. The slide slides are allowed to air dry and can be stored at -20 ° C.

Example 9 - Indirect Immunofluorescence Assay with Alcohol To the slide slides prepared according to EXAMPLE 8 above, 0.05 milliliter of serum diluted 1/40 in phosphate-stabilized saline, a UCpANCA material or the heterodimeric UC + antibody material diluted 1/500 in saline stabilized with phosphate, or the undiluted supernatant liquid of cultured PBL, MNL or LPL and allowed to incubate for one hour at room temperature. 0.05 milliliter of phosphate-stabilized saline is added to clean the slide slides as blank models. After three washes with PBS-Tween, the slide slides were stained by adding 0.05 milliliter of goat F (ab ') 2 anti-human IgG antibody material irradiated with FITC (Jackson Immuno-Research, Westgrove, PA) at a dilution of the saline stabilized with antibody: phosphate of 1: 1000 and allowing them to incubate for one hour at room temperature. After washing with approximately 100 to 250 milliliters of the phosphate-buffered saline per slide slide to remove the unbound anti-IgG antibody, the slide slides were allowed to air dry and viewed under a fluorescein microscope equipped with epifluorescent optics. A pANCA staining pattern indicates the presence of UCpANCA.

Example 10 - DNase Sensitivity Test The DNase sensitivity assay was carried out in an IIF assay format. Accordingly, the same protocol as described in EXAMPLE 9, above, was followed. Then the protocol was repeated for a second sample derived from the same source with the exception that before adding the sample to the slide slides, the neutrophils were incubated with one unit per slide of DNase I, for example, DNASCI ™ (Sigma), per milliliter of the stabilizer (40 mM Tris-HCl, 10mM NaCl, 6mM MgCl2, 10mM CaCl2, pH 7.9). for 30 minutes at 37 ° C. The slide slides were then washed three times with PBS, the sample was added and the remainder of the IIF assay protocol was followed. The neutrophil staining patterns with the first sample and the neutrophil staining pattern treated with DNase with the second sample were compared to detect the cleavage of the ANCA antigen binding. The presence of a pANCA dyeing pattern in the first sample and the absence of a pANCA dyeing pattern or the presence of a cANCA dyeing pattern in the second sample indicates the presence of the UCpANCA material in the samples.

Example 11 - Confocal microscope The neutrophils (100, 000 / lamella slide) were seated on the glass slides for 30 minutes at room temperature, fixed with 10 milligrams of paraformaldehyde per milliliter of PBS for 10 minutes at room temperature, and incubated with pure acetone at 20 ° C for one minute. The slide slides were then air dried and stored at -20 ° C. In addition, the nucleus of the neutrophil cell was visualized by counterstaining with propidium iodide, a DNA-specific dye. The sera of the UC patients, the UC patient whose cells were used to prepare the antibody bacteriophage library and the UCpANCA Fab (at 1/20 dilution for sera and 1/100 dilution for Fab) were incubated with the fixed neutrophils for one hour at room temperature. After three washes with PBS-Tween, the immune complex was irradiated by incubating the neutrophils with 1/1000 of the goat anti-human IgG (ab ') 2 specific antibody material irradiated with FITC for one hour at room temperature. After washing, confocal images were taken in a Bio-Rad UV MRC-1000 confocal laser scanning system with a 60x objective lens (N.A. 1.4) attached to a Nikon 200 Diaphot microscope equipped with epifluorescence optics. The confocal micrographs were prepared with a sublimation digital color printer of the Mitsubishi S3600 dye.

Example 12 - Immune Electron Microscopy Neutrophils were prepared by rapid freezing, freeze dried by molecular distillation, stabilized by paraformaldehyde vapors and infiltrated with Gold LR. The ultra-thin sections were reacted with either UC + serum (1: 5 and 1:10 dilution) or normal control serum and the antigen-antibody reaction detected by binding to the G-gold protein or the Conjugated protein A-gold (colloidal gold of 5 nm) was diluted to 1: 100. G-gold protein, A-gold protein and stabilizer controls were included. Antibody to histone was used as a positive control for nuclear staining. All sections were finally fixed in Trumps solution (1 percent glutaraldehyde / 4 percent paraformaldehyde, pH 7.2) were washed and air dried. The sections were coated with carbon and were observed at 22.00-35,000 fold amplification using a Philips CM12 electron microscope operating at an acceleration voltage of 40 KV.

Example 13 - Determination of ANCA Isotype The supernatant liquid of the cultured LPL was analyzed for total serum IgG concentrations by the normal ELISA method. In short, wells from the microtiter plates (Costar, Pleasanton, CA) were coated overnight (4 ° C) with goat antihuman IgG (Southern Biotechnology Associates, Birmingham, AL) diluted in a carbonate-bicarbonate stabilizer pH of 9.6 (Sigma, St. Louis, MO). The plates were rinsed three times for 15 minutes with PBS + 0.5 percent Tween-20 and incubated for one hour at 4 ° C with serial dilutions for each serum sample, which were tested in triplicate and then stained for a time. hour at 4 ° C with horseradish peroxidase-goat anti-human IgG (Southern Biotechnology Associates). The samples were incubated with a substrate of o-phenylenediamine dihydrochloride (OPD) (Sigma) for 30 minutes at 37 ° C, stopped with 3-N H2SO4 and the absorbance was determined 492 nm. A normal IgG binding curve was established using a normal purified human IgG serum (Sigma). The sample values were interpolated from the normal curve using a Macintosh ELISA program (Biorad, Richmond, CA).

Example 14 - Construction of the Library The homologous DNA libraries encoding VH ~ Y VL ~ from the heavy and light chain gene repertoire of LPL cells from humans diagnosed with UC and seropositive for pANCA were randomly combined, were expressed and the resulting antibody material was selected due to its ability to bind the neutrophile using a bateriophage display technique. These variable light heavy chain libraries were constructed by PCR cloning of the variable heavy and light chains of these LPLs. The homologs of these libraries were randomly placed in the dicystronic phagemid expression vector of pComb 3 as described herein, resulting in a variable heavy chain fusion protein containing the V ^ polypeptide and a fragment of the Protein III coating of the filamentous bacteriophage. The E. coli were subsequently transformed with these vectors containing the DNA encoding heterodimeric antibody material. The expression of the vectors was induced and the cells were transformed with an auxiliary bateriophage. Bacteriophages that were extruded from the transformed E. coli encapsulated the vector DNA encoding the nucleotide sequence and exhibited the heavy and light encoded chains as Fab antibody material anchored in the bacteriophage coat via the anchor protein of gene III . This system of fagemid expression therefore links both the recognition process and the duplication in a single bacteriophage particle. In a process called panning as described by Parmley et al., Gene, 74: 305-318 (1988), the bacteriophage expressing the material of the heterodimeric antibody having anti-neutrophil immunoreactivity is enriched and isolated. The material of the heterodimeric antibody is then assayed for further characterization of UCpANCA if the nucleic acid encoding representative UCpANCA Fab is sequenced.

Generation of the VH and VT Library, The nucleotide sequences that encode the immunoglobulin CDRs are highly variable. However, there are several regions of conserved sequences flanking the V domains of light and heavy chains containing substantially conserved nucleotide sequences, i.e., sequences that will hybridize in the same primer sequence. Polynucleotide synthesis primers ("amplification") were constructed which hybridize to these conserved sequences and which incorporate restriction sites in the homologue of DNA produced, restriction sites that are suitable for operably linking the DNA homologue to a vector. More specifically, the primers are designed in such a way that the resultant DNA homologs produced can be inserted into the expression vector in the reading frame with the translatable DNA sequence upstream in the region of the vector containing the ligation medium. directional. The amplification with the primers described herein is carried out in cDNA templates produced from the total RNA isolated from the LPLs of a human being diagnosed with UC and seropositive for pANCA.

Vu primers For the amplification of the V ^ domains, the primers are designed to introduce cohesive terminals compatible with the directional ligation towards the singular sites Xho I and Spe I of the Hc2 expression cassette of the phagemid expression vector pComb 3. In In all cases, the 5 'primers listed in SEQ ID Nos. 10 to 16 are selected to be complementary to the first-strand cDNA in the conserved N-terminal region (antisense strand). The additional jj amplification primers, including the singular 3 'primer, are designed to be complementary to the domain portion of the first constant region of the gamma 1 heavy chain mRNA (SEQ ID NO: 9). These primers will produce DNA homologs containing polynucleotides encoding amino acids of the Vu_ domain and the domain of the first constant region of the immunoglobulin heavy chains of the IgG isotype. These DNA homologs can therefore be used to produce Fab fragments instead of Fy. The additional 3 'unique primers designed to hybridize in similar regions of another immunoglobulin heavy chain class such as IgM, IgE and IgA, are proposed. Other 3 'primers that hybridize to a specific region of a specific class of the CH_ constant region and are adapted to transfer the amplified VH domains using this primer to an expression vector capable of expressing those domains Vr_ with a different class of Constant heavy or light chain regions are also proposed.

The amplification is carried out in seven separate reactions, each containing one of the 5 'primers shown in SEQ ID NOs: 10 to 16, and a 3' primer shown in SEQ ID NO: 9. The 5 'primers incorporate an Xho I site and the 3 'primers incorporate a Spe I restriction site for the insertion of the DNA homologue encoding Vj into the Hc2 expression cassette of the phagemide pComb 3.

Vr primers, For the amplification of the VL domains, amplification primers are constructed which hybridize to the conserved sequences of the immunoglobulin light chains and which incorporate restriction sites that allow the cloning of the VL coding DNA homologs in the Lc2 expression cassette of phagemide pComb 3 cut with Sac I and Xba I. The 5 'primers (SEQ ID NOs: 18 to 20) are designed to be compliant with the first chain cDNA in the conserved N-terminal region. These primers also introduce a restriction endonuclease site Sac I to allow the DNA homologs encoding VL to be cloned into the Lc2 expression cassette of phagemid pComb 3. The amplification primer VL 3 '(SEQ ID NO: 17) is designed to hybridize in the constant region of the kappa cDNA to introduce the restriction endonuclease site Xba I required to insert the DNA homologs encoding VL in the Lc2 expression cassette of phagemide pComb 3.

These primers allow the DNA homologs encoding the immunoglobulin light chains of the kappa isotype to be produced. These primers make it possible to produce a Fab fragment instead of an Fy fragment. The amplification of the immunoglobulin light chain gene repertoire is carried out in three separate reactions, each containing one of the 5 'primers (SEQ ID NOs: 18 to 20) and one of the primers 3 '(SEQ ID NO: 17). The 5 'primers contain a Sac I restriction site and the 3' primers contain the Xba I restriction site. Amplification primers designed to amplify the human light chain variable regions of the lambda isotype are also proposed. All the primers and synthetic polynucleotides described herein were purchased from Oligos etc. (from Wilsonville, OR).

Construction of the Vff and Vj Library, Total RNA was extracted from 1.15 x 107 lymphocytes using normal guanadinium isothiocyanate extraction protocols. See, for example, by P. Chomcynski, and N. Saochi, Anal. Biochem., 162: 156-159 (1987), which is incorporated herein by reference. In the preparation for PCR amplification, the RNA prepared above is used as a template for cDNA synthesis by a primer extension reaction. Therefore, 10 micrograms of RNA were reverse transcribed to the single-stranded cDNA using a microgram of the oligo-dT primer with 10 mM dithiothreitol, RNasin ™ (an RNase protein inhibitor from Promega Corporation, Madison, WI). ), 25 mM each of dATP, dCTP, dGTP, dTTP, the reverse transcriptase stabilizer lx (Bethesda Research Laboratories, Bethesda, MD) and 2 microliters (200 units) of reverse transcriptase (Superscript, Bethesda Research Laboratories) in one vol of 50 microliters for 10 minutes at room temperature followed by 50 minutes at 42 ° C. After 5 minutes, heating to 90 ° C and 10 minutes on ice, the reaction is treated with 1 microliter (one unit) of RNase H (Bethesda Research Laboratories) for 20 minutes at 37 ° C. The single-stranded cDNA generated above was amplified using the polymerase chain reaction ("PCR") method. The primers of the variable region of the specific family and the specific isotype constant region as described below were used to create specific heavy chain libraries IgGl, Vjjl to Vj ^ 6 and light chain kappa VLI to VL3 as specific libraries : Primer to create the IgGl heavy chain constant region library: CGlz 5 'GCATGTACTAGTTTTGTCACAAGATTTGGG 3' (SEQ ID NO: 9) Primers to create the heavy chain variable region library: VHla 5 'CAGGTGCAGCTCGAGCAGTCTGGG 3' (SEQ ID NO: 10) VH2f 5 'CAGGTGCAGCTACTCGAGTCGGG 3' (SEQ ID NO: 11) VH3a 5 'GAGGTGCAGTTCGAGGAGTCTGGG 3' (SEQ ID NO: 12) VH3f 5 'GAGGTGCAGCTGCTCGAGTCTGGG 3' (SEQ ID NO: 13) VH4f 5 'CAGGTGCAGCTGCTCGAGTCGGG 3' ( SEQ ID NO: 14) Vh6a 5 'CAGGTACAGCTCGAGCAGTCAGG 3' (SEQ ID NO: 15) VH6f 5 'CAGGTACAGCTGCTCGAGTCAGGTCCA 3' (SEQ ID NO: 16) The primer to create the constant region library of the kappa light chain: C? Ld 5 'GCGCCGTCTAGAACTAACACTCTCCCCTGTT GAAGC TCTTTGTGACGGGCGATCTCAG 3 '(SEQ ID NO: 17) Primer to create the kappa light chain variable region library: V? 5' GACATCGAGCTCACCCAGTCTCCA 3 '(SEQ ID NO: 18) V? 2a 5' GATATTGAGCTCACTCAGTCTCCA 3 '(SEQ ID NO: 19) V 3a 5 'GAAATTGAGCTCACGCAGTCTCCA 3' (SEQ ID NO: 20) The PCR amplification is carried out in a 100 microliter reaction containing the products of the reverse transcription reaction (approximately 1 microliter of the 450 reaction microliters of the single-stranded cDNA), 60 pM of the 3 'VH primer (SEQ ID NO: 9), 60 pM of the 5 'primer (one of SEQ ID NOs: 10 to 16), 8 microliters of the mixture of dNTP at 25 M each, 10 microliters of 10 x PCR stabilizer (Perkin-Elmer), and 5 units of the Tag DNA polymerase (Perkin-Elmer, Norwalk, CT). The reaction mixture is subjected to 30 cycles of amplification using the Perkin-Elmer 9600 thermocycling apparatus. Each amplification cycle included denaturation of the 94 ° C cDNA for 15 seconds, followed by annealing the primers at 52 ° C for 50 seconds and amplification at 72 ° C for 90 seconds. This was followed by an extension of 10 minutes at 72 ° C. Synthesis of the efficient and reproducible DNA homologue was achieved with the primers defined herein and producing homologous amplified V ^ coding cDNAs having a major band of approximately 680 bp and homologous of amplified V ^ coding cDNAs having a main band of approximately 660 bp. After verification by electrophoresis of the agarose gel that all the amplifications had been satisfactory and that similar yields were achieved, the DNA homologues of Vj coding and VL coding were separately placed and gel purified in 0.8 percent of Seaplaque Agarose GTG (FMC, Rockland, ME) according to the manufacturer's instructions.

Ligation of the DNA homologs encoding Vj to the vector Equal portions of the products of each light chain primer extension reaction were mixed to generate a VL library of the UC +. The VL library was digested twice with 70 units of Xbal per microgram of the VL library and 35 units of Sacl per microgram of the V- ^ library. (All restriction enzymes are available from Boehringer-Mannheim, of Indianapolis, IN). The digested products were again gel purified as described above and the region of the gel fragments containing gel of approximately 660 bp were cut, extracted from agarose and precipitated with ethanol. The resulting VL DNA homologs represent a repertoire of kappa light chain polypeptide genes having cohesive terminals adapted for directional ligation with the Lc2 expression cassette of phagemide pComb 3.

The Lc2 expression cassette of phagemid-pComb 3 was prepared by inserting a light chain DNA homologue by mixing 30 micrograms of phagemid to a solution containing 280 units of Xba I restriction endonucleases and 160 units of Sac I and a recommended stabilizer. the manufacturer. This solution was maintained at 37 ° C for 3 hours. The solution was precipitated with 2 milliliters of glycogen, 1/10 volume of 3M MaAc, 2.5 volumes of ethanol at -20 ° C for 1 hour and then granulated and washed with 70 percent ethanol. The granule was resuspended in water and purified with gel in .8 percent of 1 x TAE Seplaque 676. A 4 Kb band was cut, extracted with phenol, treated with LÍCI3 treated and precipitated with ethanol as well as PCR products. The Lc2 expression cassette was then ready for ligation with the VL coding DNA homologs prepared above. These VL coding DNA homologs were inserted directly into the Lc2 expression cassette digested with the restriction Xba I and Sac I ligand 0.45 microgram of the VL DNA homolog in 1.4 micrograms of pComb 3 digested (kindly provided by Dr Carlos Barbas III, from The Scripps Research Institute, La Jolla, California and described in the article by Barbas et al, Proc. Nati, Acad. Sci. USA, 88: 7978-7982 (1991), which is incorporated herein by reference) using 10 units of ligase in a volume of 200 microliters of the ligase stabilizer stored overnight at 25 ° C and then exterminated by heating at 65 ° C for 15 minutes (Boehringer-Mannheim). The DNA was precipitated, washed with 70 percent ethanol and resuspended in 15 microliters of 10 mM MgCl2.

Transformation of the host with the vector containing the Vj library, Escheri chia coli XLI-Blue cells (Stratagene, La Jolla, CA) were transformed with the resuspended DNA by electroporation: 300 microliters of the material that were made by concentrating 1 liter of E. coli. ODßQO = «8 to 4 milliliters of cells were electroporated with 15 microliters of DNA (« 2 micrograms) (all the ligature mixture). Transformed cells were selected by resistance to the plasmid antibiotic by a supergrowth broth containing 100 micrograms per milliliter of carbenicillin. The size of the library was 8.6 x 10 ^ transformants with 6 percent background re-ligature. The antibiotic-resistant colonies were amplified by growth in liquid cultures at 37 ° C in a super-caldo medium ("SB") (30 grams of tryptone, 20 grams of yeast extract and 10 grams of 3 [N-Morpholino] propan acid. -sulphonic (Mops) per liter of water, adjusted to a pH of 7) supplemented with 10 micrograms per milliliter of tetracycline, 20 milligrams per milliliter of carbenicillin, 40 mM of glucose and 10 M of MgCl2. The pComb 3 phagemids encoding a VL kappa polypeptide ("Kappa-pComb 3 fagemida") were isolated using Qiagen-tips ™, an anion exchange resin from Qiagen, Chatsworth, CA followed by the manufacturer's instructions. The isolated Kappa-pComb 3 phagemids were digested twice with 10 units of Xhol and 3 units of Spel per microgram of the phagemid Kappa-pComb 3. The reaction mixture was precipitated with ethanol and 4.7 kB of the double-cut phagemid was purified with gel in .8 percent of the Seaplaque TAE gel as above. The Kappa-pComb 3 phagemids are now ready for ligature with the heavy chain library.

Ligation of Homologues of Vu Coding DNA to the Vector and Transformation of the Host Equal portions of the products of each extension of the heavy chain primer were mixed to generate a homologous library of V ^ coding DNA. The V ^ library was prepared for ligation in the Hc2 expression cassette of the Kappa-pComb 3 phagemid by digestion with the Xho I and Spe I nucleases. Accordingly, the VH library was double digested with 70 units of Xhol and 17 units of Spel per microgram of the library of jj. Then, 40 microgram of the digested heavy chain library was ligated with 1.4 micrograms of the digested Kappa-pComb 3 phagemid described above, using 10 units of ligase and 200 microliters by volume of the ligase stabilizer. The reaction was stopped by heating at 65 ° C for 15 minutes. The DNA was precipitated, the granule was resuspended in 15 microliters of 10 mM MgCl2 and used for the electroporation of E. coli XLI-Blue cells. The electroporated cells were grown in SB, supplemented as described above except that glucose was not included. The size of the library was 4.9 x 10 ^ with 14 percent re-ligature background after cloning of the heavy chain. The presence of both coding homologues of V ^ and VL in the vector was verified by restriction analysis, and seven of the seven clones contain both homologs. Ten milliliter cultures of the E. coli XLI-Blue cells subjected to electroporation were then transferred to SB supplemented with 50 micrograms per milliliter of carbenicillin, 10 micrograms per milliliter of tetracycline, and 10 mM MgCl2 and incubated for another hour. The cultured cells were then infected with the auxiliary bacteriophage 1012 VCS-M13 (Stratagene, La Jolla, CA) to initiate the generation of copies of the sense chain of the phagemid DNA. After adding the auxiliary bacteriogage the mixture was added to 100 milliliters of SB supplemented with 50 microliters per milliliter of carbenicillin, 10 microliters per milliliter of tetracycline, and 10mM of MgCl2- The mixture containing the auxiliary bacteriophage was then kept for 2 hours additional at 37 ° C to allow the filamentous bacteriophage assembly where the material of the heterodimeric antibody expressed from UC + fused to the anchor domain of bacteriophage cpIII was incorporated on the surface of the bacteriophage particle. After 2 hours the mixture was boosted with 70 micrograms per milliliter of kanamycin to select for E. coli infected with the auxiliary bacteriophage and then allowed to grow overnight at 37 ° C, 300 revolutions per minute. The bacteriophage was precipitated by centrifugation resulting in a bacterial cell granule and a bacteriophage containing supernatant liquid with the evaluation of the colony forming units ("CFU") determined by plating on LB plates with 100 micrograms per milliliter. of carbenicillin.

Example 15 - Cultivation in Batea Each well of the 24-well microtiter plate was coated with neutrophils fixed with methanol by adding 10 ^ neutrophils, allowing them to settle and air dry and then settling with 100 percent methanol. Each well was blocked for one hour at 37 ° C with 3 percent bovine serum albumin ("BSA") in a saline stabilized with Tris- ("TBS"). The blocking solution was removed and 5 x 1H of the bacteriophage in 250 microliters of TBS was added and allowed to incubate for two hours at 37 ° C. After washing, elution with acid, and neutralization, the number of eluted bacteriophages was monitored by CFU. The eluted bacteriophages were amplified by reinforcing the E. coli XLI-Blue and the pan / amplification cycle was repeated five times until at least 100-fold enrichment was obtained. In this way, a bacteriophage library enriched for the UCpANCA material was generated. For quantification of enrichment, the aliquots of the original library were again washed in a pan in parallel with each enrichment cycle to control the daily fluctuations in bacteriophage recovery. The enrichment was calculated by the ratio of bacteriophage content versus noncontent and compared with the non-enriched library that was tested on the same day. Panning was also carried out in a 96 well format with 101] - bacteriophages per well to compare the formats.

Example 16 - Preparation of Soluble Recombinant Anti-neutrophil Antibody Material from UC and Library Selection The preparation of the soluble heterodimeric antibody material, specifically Fab, was carried out by isolating the phagemid using Qiagen-tips ™ in accordance with the manufacturer's instructions. (Qiagen, Chatsworth, CA). The isolated phagemid was then digested with 17 units of Spel and 50 units of Nhel per microgram of the phagemid to remove the segment of the cpIII gene. The phagemid DNA was then gel purified and auto-ligated using 10 units of ligase per 1 microgram of phagemid and maintaining the reaction mixture overnight at 25 ° C. The reaction was stopped by maintaining it at 65 ° C for 15 minutes. 200 ng of the gel-purified fragment in 20 microliters in volume were used to transform the E. coli XLI-Blue by electroporation at 0 ° C in a pipette of space of .2 cm to 2.5 kV, 25 μF and 200 R using 40 microliters of E. coli material and 1 microliter of ligature mixture. Single colonies of LB agar plates containing 100 micrograms per milliliter of carbenicillin were collected and grown in 10 milliliters of SB supplemented with 10 micrograms per milliliter of tetracycline, 50 micrograms per milliliter of carbenicillin, and 20 mM MgCl2 for 6 hours . The cultures were then induced by the addition of 1 mM of isopropyl 6-D-thiogalactopyranoside ("IPTG") (United States Biochemicals, Cleveland, OH) and grown overnight. The bacteriophage was isolated by centrifugation resulting in a granule of the bacterial cell in a supernatant liquid containing the bacteriophage. The supernatant liquid was removed and analyzed for Fab production by kappa capture ELISA, as described above, being detected with goat antihuman alkaline phosphatase (Pierce, from Rockland, IL). Ten clones, each of the enriched and unenriched libraries, were selected for comparison purposes. Six of the ten - 16Í Clones from the non-enriched library produced significant amounts of Fab as assayed by kappa-capture ELISA. In contrast, ten of the ten clones in the enriched library produced Fab indicating that the enriched library had been positively selected for Fab expression. These clones were also analyzed for neutrophil binding by the neutrophil ELISA. None of the ten clones in the non-enriched library bound the neutrophil while all the sample clones from the enriched library demonstrated avid neutrophil binding. The diversity of heavy and light chain usage in enriched and non-enriched libraries Fabs were monitored by digesting 4 micrograms of the phagemid encoding a single Fab with 20 units of BSTN1 (New England Biolabs, Beverly, MA) and analyzing the fragments in a 3 percent agarose gel. Each of the thirty clones in the non-enriched library showed a different restriction pattern while the clones in the enriched library exhibited only two clonal patterns. The clones representative of these two patterns (5-3 and 5-4) were therefore analyzed directly by DNA sequences, as will be described below.

Example 17 - Purification of Fab Both enriched and non-enriched libraries were transferred from pComb 3 to C3AP313H5, a pComb 3 derivative that fuses six histidines at the carboxy terminus of the Fab after the digestion of Spel and Nhel to remove the cpIII anchor domain. (C3 P313H5 was a gift from Carlos Barbas III, Scripps Research Institute, La Jolla, California). The libraries were moved, removing the Vu_- and V ~ coding polynucleotides from the expression cassettes Hc2 and Lc2 of pComb 3 and sequencing them in C3AP313Hg. The E. coli XLI-Blue cells were transformed with the new phagemid by electroporation. Individual colonies were isolated by selection of LB agar supplemented with 100 microliters per milliliter of carbenicillin. Clone 5-3 of the enriched library was selected for large-scale purification. A single colony was collected and allowed to grow overnight in 10 milliliters of SB, supplemented with 10 micrograms per milliliter of tetracycline, 50 micrograms per milliliter of carbenicillin, 10 M of MgCl2, and 40 mM of glucose. The bacterial culture was granulated by centrifugation to remove the glucose and the granule of the cell was transferred to one liter of SB containing 50 micrograms per milliliter of carbenicillin and 20 mM of MgCl2 • XLl-Blue cells were grown at 37 ° C stirring at 300 revolutions per minute until the absorbency (ODgoo) was between 0.6 and 0.8. The cell culture was then induced with 4 mM of IPTG to express the heterodimeric antibody material and grown at 30 ° C overnight. The cell culture was centrifuged to pellet the XLl-Blue cells and the pellet was re-suspended in 30 milliliters of a sonification stabilizer. (50 mM NaP 4, 300 mM NaCl 2, 0.01 percent NaN 3, pH 7.9). The re-suspended cells were sonicated eight times in 15 second bursts at 50 percent power (microswitch, 40 watts, Tekmar, Cincinnati, OH). The sonified material was centrifuged at 15,000 revolutions per minute in a Beckman JA-20 centrifuge for 40 minutes at 4 ° C and the supernatant liquid was serially filtered through a 0.45 and 0.22 micron Nytex filter (Amicon, of Beverly, MA ). The sonified material was immediately loaded at 20 milliliters per hour into a 1 milliliter column of NTA-Ni (Qiagen) and washed with the sonification stabilizer, typically 40 to 50 milliliters until the absorbency (OD280) was < 0.01. The column was then washed with 10 milliliters of 10 mM imidazole in the sonification stabilizer to remove the contaminants, followed by 10 milliliters each of 100 mM, 250 mM and 500 mM of imidazole collecting the 1 milliliter fractions monitored by OD280- The aliquots were analyzed by SDS-PAGE by denaturing and reducing the gel to determine where the Fab had eluted. Due to the presence of imidazole, the samples with the loaded dye were not boiled but instead denatured at 37 ° C for 10 minutes before loading. Typically, the Fab is eluted in the first 3 fractions of the imidazole wash of 100 mM. The one-milliliter fractions containing Fab were then pooled and dialyzed (membranes cut from 6-8 kD) using Amicon dialysis membranes against PBS to remove the imidazole. The samples were concentrated and any of the free heavy or light chains were removed using a Centricon 50 ™ 'a dialysis-centrifugation membrane from Amicon Corporation, of Beverly, MA. Interestingly, the antibody level calculated in the purified fraction differed with the total protein (Bio-rad Protein Assay, Richmond, CA) versus the ELISA (anti-Kappa) determination. For 1 liter of bacterial culture, the Fab yield was ~ 1 milligram per total protein assay, versus ~ 0.1 milligram by immunoassay. Since the use of the proteins in this study used ELISA immunoreactivity, Fab concentrations are reported using the ELISA method. Fab 5-3 was characterized using the assays described herein. The intense bond (approximately 0.1 microgra / / milliliter) to the fixed neutrophil in the ELISA format. It is also notable that Fab 5-3 UCpANCA is avid compared to UC serum, since the optimal binding occurred at 1 percent serum (or approximately 0.1 milligram per milliliter of total IgG). Calculating that approximately 1 percent of the hyperimmune serum is antigen-specific, then the level of native p-ANCA IgG is approximately 1 microgram per milliliter, or is similar in scale to the binding by the monovalent Fab. In inflammatory disorders, ANCA-type marker antibodies are specific for certain defined neutrophil proteins. Fab 5-3 UCpANCA was tested on the neutrophil ELISA antigen for reactivity with catespina G elastase, myeloperoxidase and lactoferrin. No binding was detected up to 500 nanograms per milliliter of Fab 5-3-UCpANCA. Fab 5-3 UCpANCA was also tested by the neutrophil IIF assay fixed with alcohol for the pANCA staining pattern. The immunofluorescent detection of neutrophil staining using Fab 5-3 UCpANCA yielded the same pANCA staining pattern produced by conventional UC serum. When the immunoreactivity of Fab 5-3 UCpANCA was tested for DNase sensitivity, as with conventional pANCA seropositive UC serum, treatment with neutrophil DNase I caused complete loss of the detectable pANCA staining pattern. In addition, confocal microscopy showed that Fab 5-3 UCpANCA binds the antigen placed inside the nuclear envelope, a characteristic found in the seropositive UC serum pANCA. Example 18 - Sequence of Nucleic Acid The nucleic acid sequence was carried out in the double-stranded DNA of clones 5-3 and 5-4 using the 5 'and 3' primers for the heavy and light chains (SEQ ID NOs 21 and 22, and SEQ ID NOs 23 and 24, respectively) and Sequenasa 1.0 (United States Biochemicals). Investigations and homology alignments were carried out using Genebank.

LIST OF SEQUENCES (2) GENERAL INFORMATION (i) APPLICANT (TO) NAME: CEDARS-SINAI MEDICAL CENTER (B) STREET: 8700 BEVERLY BLVD (C) CITY: LOS ANGELES (D) STATE: CALIFORNIA (E) COUNTRY: UNITED STATES (F) ZIP CODE: 90048 (G) TELEPHONE: 310 855-5284 (H) TELEFAX: 310 967-0101 (A) NAME: THE REGENTS OF THE UNIVERSITY OF CALIFORNIA (B) STREET: 300 LAKESIDE DRIVE, 21ST FLOOR (C) CITY: OAKLAND (D) STATE: CALIFORNIA (E) COUNTRY: UNITED STATES (F) POSTAL CODE (ZIP) : 94612-3550 (G) TELEPHONE: 310-206-4401 (H) TELEFAX: 310-206-3619 (ii) TITLE OF THE INVENTION: CYTOPLASMIC ANTI-NEUTROPHYL ANTIBODY MATERIAL ASSOCIATED WITH ULCERATIVE COLITIS AND METHODS AND RELATED CASES (iii ) NUMBER OF SEQUENCES: 24 (iv) COMPUTER LEADABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patent in Release # 1.0, Version # 1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 699 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: circular ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: lymphoid associated with the intestine (G) TYPE OF CELL: Lymphocyte (vii) IMMEDIATE SOURCE: (B) CLONE: 5-3 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1 .. 699 (D) OTHER INFORMATION: / codon_start = 1 / product = "Human Heavy Chain of ANCA IgG associated with UC" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..15 (D) OTHER INFORMATION: / product = "Terminal N Marker" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 16..96 (D) OTHER INFORMATION: / label = FR1 / note = "" FR1"refers to Framework Region 1" (ix) FEATURE: (A) NAME / CLAV E: misc_ARN (B) LOCATION: 97..111 (D) OTHER INFORMATION: / label = CDRl / note = "" CDRl "refers to Region 1 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: mise ARN (B) LOCATION: 112..153 (D) OTHER INFORMATION: / label = FR2 / note = "" FR2"refers to Region 2 of Frame "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 154..204 (D) OTHER INFORMATION: / label = CDR2 / note =" "CDR2" refers to Region 2 Determination of Complementarity " (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 205..300 (D) OTHER INFORMATION: / label = FR3 / note = "" FR3"refers to the Region 3 of the Framework" (ix) ) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 301..327 (D) OTHER INFORMATION: / label = CDR3 / note = "" CDR3"refers to Region 3 of Determination of Complementarity" (ix) ) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 328 ... 360 (D) OTHER INFORMATION: / label = FR4 / note = "" FR4"refers to the Region 4 of the frame" (ix) FEATURE : (A) NAME / KEY: misc_ARN (B) LOCATION: 361..651 (D) OTHER INFORMATION: / label = CH1 / note = "" CH1"refers to Segment 1 Constant of the Heavy Chain" (ix) CHARACTERISTICS : (A) NAME / KEY: misc_ARN (B) LOCATION: 652..678 (D) OTHER INFORMATION: / label = Hinge / / note = "Hinge" refers to the Partial Hinge Segment of the Heavy Chain " (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 679..699 (D) OTHER INFORMATION: / label = Hex-HTAG / note = "" Hex-HTAG "refers to the Hexahistidine Tag" (ix) FEATURE: (A) NAME / KEY: mÍsc_ARN (B) LOCATION: 16,651 (D) OTHER INFORMATION: / label = Fd / note = "" Fd "refers to the Fd of the Heavy Chain" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 16..300 (D) OTHER INFORMATION: / label = VHSEGMENT / note = "" VHSEGMENT "refers to the Variable Segment of the Heavy Chain" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 301..315 (D) OTHER INFORMATION: / label = D / note = "" D "refers to the Diversity Segment" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 316..360 (D) OTHER INFORMATION: / label = JH / note = "" JH "refers to the Heavy Chain Union Segment" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 16..360 (D) OTHER INFORMATION: / label = VHDOMAIN / note = "" VHDOMAIN "refers to the Variable Domain of the Heavy Chain" (xi) DESCRI PTION OF THE SEQUENCE IA: SEQ ID NO: 1: GCC CAG GTG AAA CTG CTC GAG CAG TCT GGG GGA GGC GTG GTC CAG CCT 48 Wing Gln Val Lys Leu Leu Glu Gln Ser Gly Gly Gly Val Val Gln Pro 1 5 10 15 GGG AAG TCC CTG AGA CTC TCC TGT GCA GCC TCT GGA TTC ACC TTC AGG 96 Gly Lys Ser Leu Arg Leu Ser Cys Ala Wing Ser Gly Phe Thr Phe Arg 20 25 30 AAC TAT GGC ATG CAC TGG GTC CGG CAG GCT CCA GGC AAG GGG CTG GAG 144 Asn Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Lau Glu 35 40 45 TGG GTG GCA GGT ATT TCC TCT GAT GGA AGA AAA AAA AAG TAT GTA GAC 192 Trp Val Wing Gly lie Ser Asp Gly Arg Lys Lys Lys Tyr Val Asp 50 55 60 TCC GTG AAG GGC CGA TTC ACC ATC TCC AGA GAC AAG TCC AAG AAC ACG 240 Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Lys Ser Lys Asn Thr 65 70 75 80 CTG TAT CTG CAA ATG AAC AGC CTC AGA GCT GAG GAC ACG GCT GTG TAT 288 Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 TAC TGT GCG AAA TTG TCC CGC GCG GGT GGT TTT GAC ATC TGG GGC CAA 336 Tyr Cys Wing Lys Leu Ser Arg Wing Gly Gly Phe Asp lie Trp Gly Gln 100 105 110 GGG ACA ATG GTC ACC GTC TCT TCA GCC TCC ACC AAG GGC CCA TC G GTC 384 Gly Thr Met Val Thr Val Ser Ser Wing Ser Thr Lys Gly Pro Ser Val 115 120 125 TTC CCC CTG GCA CCC TCC TCC AAG AGC ACC TCT GGG GGC ACA GCG GCC 432 Phe Pro Leu Wing Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Wing 130 135 140 CTG GGC TGC CTG GTC AAG GAC TAC TTC CCC GAA CCG GTG ACG GTG TCG 480 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 TGG AAC TCA GGC GCC CTG ACC AGC GGC GTG CAC ACC TTC CCG GCT GTC 528 Trp Asn Ser Gly Wing Leu Thr Ser Gly Val His Thr Pr.e Pro Wing Val 165 170 175 CTA CAG TCC TCA GGA CTC TAC TCC CTC AGC AGC GTG 373 ACC GTG CCC 576 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Val Val Thr Val Pro 180 185 190 TCC AGC TTG GGC ACC CAG ACC TAC ATC TGC AAC GTG AAT CAC AAG 624 Ser Ser Be Leu Gly Thr Gln Thr Tyr laughs Cys Asn Val Asn His Lys - 195 200 205 CCC AGC AAC ACC AAG GTG GAC AAG AAA GCA GAG CCC AAA TCT TGT GAC 67; Pro Ser Asn Thr Lys Val Asp Lys Lys Wing Glu Pro Lys Ser Cys Asp 210 215 220 AAA ACT AGT CAC CAC CAC CAC CAC CAC 699 Lys Thr Ser His His His His His His 225 225 230 (2) INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 233 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 Ala Gln Val Lys Leu Leu Glu Gln Ser Gly Gly Val Val Gln Pro 1 5? O 1S Gly Lys Ser Leu Arg Leu Ser Cys Wing Ala Ser Gly Phe Thr Phe Arg 20 25 30 Asn Tyr Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu 35 40 45 Trp Val Wing Gly lie Ser Asp Gly Arg Lys Lys Lys Tyr Val Asp 50 55 60 Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Lys Ser Lys Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90 95 Tyr Cys Ala Lys Leu Ser Arg Ala Gly Gly Phe Asp He Trp Gly Gln 1 °° 105 no Gly Thr Met Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 115 120 125 Phe Pro Leu Wing Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Wing 130 135 140 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 145 150 155 160 Trp Asn Ser Gly Wing Leu Thr Ser Gly Val His Thr Phe Pro Wing Val 165 170 175 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Val Val Thr Val Pro 180 185 190 Ser Ser Leu Gly Thr Gln Thr Tyr He Cys Asn Val Asn His Lys 195 200 205 Pro Ser Asn Thr Lys Val Asp Lys Lys Ala Glu Pro Lvs Ser Cys Aso 210 215 220 Lys Thr Ser His His His His His His His 225 230 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 732 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: circular iii ) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (v) TYPE OF FRAGMENT: N-terminal (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE : Imfcide? .- ': i ?. with the intestine (G) TYPE OF CELL: Lymphocyte (vii) IMMEDIATE SOURCE: (B) CLONE: 5-4 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1.732 (D) OTHER INFORMATION: / codon_start = 1 / product = "Human Heavy Chain of ANCA IgG associated with the UC" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..15 (D) OTHER INFORMATION: / product = "N -Terminal "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 16..93 (D) OTHER INFORMATION: / label = FRl / note =" "FRl" refers to Region 1 of Frame "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 94..108 (D) OTHER INFORMATION: / label = CDRl / note =" "CDRl" refers to Region 1 of Determination of Complementarity (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 109..150 (D) OTHER INFORMATION: / label = FR2 / note = "" FR2"refers to the Region 2 of the Framework" (ix) ) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 151..201 (D) OTHER INFORMATION: / label = CDR2 / note = "" CDR2"refers to Region 2 of Determination of Complementarity" (ix) ) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 202..297 (D) OTHER INFORMATION: / label = FR3 / note = "" FR3"refers to Frame Region 3" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 298 ..360 (D) OTHER INFORMATION: / label = CDR3 / note = "" CDR3"refers to Region 3 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 361 ..393 (D) OTHER INFORMATION: / label = FR4 / note = "" FR4"refers to Region 4 of the frame" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 394 .. 684 (D) OTHER INFORMATION: / label = CH1 / note = "" CH1"refers to the Constant Segment of the Heavy Chain" (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 685 .. 711 (D) OTHER INFORMATION: / label = Hinge / note = "Hinge" refers to the Partial Hinge Segment of the Heavy Chain "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 712 .. 732 (D) OTHER INFORMATION: / label = Hex-HTag / note = "" Hex-HT ag "refers to the Hexahistidine Label" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 16..684 (D) OTHER INFORMATION: / label = Fd / note = "" Fd "refers to a Fd of the Heavy Chain "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 16..297 (D) OTHER INFORMATION: / label = VHSEGMENT / note =" "VHSEGMENT" refers to the Segment Heavy Chain Variable "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 298..363 (D) OTHER INFORMATION: / label = D / note =" "D" refers to the Segment of Diversity "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 364..408 (D) OTHER INFORMATION: / label = JH / note =" "JH" refers to the Chain Union Segment Heavy "(ix) FEATURE: - (A) NAME / KEY: misc_ARN (B) LOCATION: 16..408 (D) 'OTHER INFORMATION: / label = VHDOMAIN / note = "" VHDOMAIN "refers to the Variable Domain of the Heavy Chain"' xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 3: CTC GAG TCT GGG GGA GGC GTG GTC CAG CCT GGG AAG TCC CTG AGA CTC 48 Leu Glu Be Gly Gly Gly Val Val Gln Pro Gly Lys Ser Leu Arg Leu 1 5 10 15 TCC TGT GCA GCC TCT GGA TTC ACC TTC AGG AAC TAT GGC ATG CAC TGG 96 Ser Cys Wing Wing Ser Gly Phe Thr Phe Arg Asn Tyr Gly Met His Trp 20 25 30 GTC CGG CAG GCT CCA GGC AAG GGG CTG GAG TGG GTG GCA GGT ATT TCC 144 Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Wing Gly lie Ser 35 40 45 TCT GAT GGA AGA AAA AAA AAG TAT GTA GAC TCC GTG AAG GGC CGA TTC 192 Be Asp Gly Arg Lys Lys Lys Tyr Val Asp Ser Val Lys Gly Arg Phe 50 55 60 TTC ATC TCC AGA GAC AAT TCC AAG AAC ACC CTG TAT CTG CAA TTG AAC 240 Phe He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Leu Asn 65 70 75 80 AGC CTG AGA GCT GAG GAC ACG GCT GTC TAT TAC TGT GCG AAA GAT GAG 288 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Glu 85 90 95 TTT AGT TCT ACC CGG AAG AAC TTC TTG ACT GGT CAA TCA AAG ACC TTT 336 Phe Ser Ser Thr Arg Lys Asn Phe Leu Thr Gly Gln Ser Lys Thr Phe 100 105 110 GCG GCC TAC TAC GGT ATG GAC GTC TGG GGC CAG GGG ACC ACG GTC ACC 384 Ala Ala Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr 115 120 125 - GTC TCC TCA GCC TCC ACC AAG GGC CCA TCG GTC TTC CCC CTG GCA CCC 432 Val Ser Ser Wing Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Wing Pro 130 135 140 TCC TCC AAG AGC ACC TCT GGG GGC ACA GCG GCC CTG GGC TGC CTG GTC 480 Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Wing Leu Gly Cys Leu Val 145 150 155 160 AAG GAC TAC TTC CCC GAA CCG GTG ACG GTG TCG TGG AAC TCA GGC GCC 528 Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Wing 165 170 175 CTG ACC AGC GGC GTG CAC ACC TTC CCG GCT GTC CTA CAG TCC TCA GGA 576 Leu Thr Ser Gly Val His Thr Phe Pro Wing Val Leu Gln Ser Ser Gly 180 185 190 CTC TAC TCC CTC AGC AGC GTG GTG ACC GTG CCC TCC AGC TTG GGC 624 Leu Tyr Ser Leu Ser Val Val Thr Val Pro Ser Ser Leu Gly 195 200 205 ACC CAG ACC TAC ATC TGC AAC GTG AAT CAC AAG CCC AGC AAC ACC AAG 672 Thr Gln Thr Tyr He Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys 210 215 220 GTG GAC AAG AAA GCA GAG CCC AAA TCT TGT GAC AAA ACT AGT CAC CAC 720 Val Asp Lys Lys Wing Glu Pro Lys Ser Cys Asp Lys Thr S er His His 225 230 235 240 CAC CAC CAC CAC 732 His His His His PAPA INFORMATION SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 244 amino acids (B) TYPE: amino acid (C) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE : SEQ ID NO:: - ia9 Leu Glu Be Gly Gly Gly Val Val Gln Pro Gly Lys Ser Leu Arg Leu 1 5 10 15 Be Cys Wing Wing Be Gly Phe Thr Phe Arg Asn Tyr Gly Met His Trp '20 25 30 Val Arg Gln Wing Pro Gly Lys Gly Leu Glu Trp Val Wing Gly He Ser 35 40 45 Ser Asp Gly Arg Lys Lys Lys Tyr Val Asp Ser Val Lys Gly Arg Phe 50 55 60 Phe He Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Leu Asn 65 70 75 80 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Asp Glu 85 90 95 Phe Ser Ser Thr Arg Lys Asn Phe Leu Thr Gly Gln Ser Lys Thr Phe 100 105 110 Wing Wing Tyr Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr 115 120 125 Val Ser Ser Wing Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro 130 135 140 Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Wing Leu Gly Cys Leu Val 145 150 155 160 Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Wing 165 170 175 Leu Thr Ser Gly Val His Thr Phe Pro Wing Val Leu Gln Ser Ser Gly 180 185 190 Leu Tyr Ser Leu Ser Val Val Thr Val Pro Ser Ser Leu Gly 195 200 205 Thr Gln Thr Tyr He Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys 210 215 220 Val Asp Lys Lys Wing Glu Pro Lys Ser Cys Asp Lys Thr Ser His His 225 230 235 240 His Hxs His His (2) INFORMATION FOR SEQ ID NO: 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 642 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: circular (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: lymphoid associated with the intestine (G) TYPE OF CELL: Lymphocyte (vii) IMMEDIATE SOURCE: (B) CLONE: 5-3 (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1.662 (D) OTHER INFORMATION: / codon_start = 1 / product = "Kappa Light Chain of ANCA associated with Ulcerative Colitis" (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..3 (D) OTHER INFORMATION: / label = Marbete N-Terminal (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 4.285 (D) OTHER INFORMATION: / label = VKSEGMENT / note = "" VKSEGMENT "refers to the Variable Segment of the Kappa Light Chain "(ix) FEATURE: (A) NAME / KEY: mísc_ARN (B) LOCATION: 286..324 (D) OTHER INFORMATION: / label = JK / note =" "JK" refers to the Union Segment of the Kappa Light Chain "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 325..642 (D) OTHER INFORMATION: / label = CK / note =" "CK" refers to the Constant Segment of the Kappa Light Chain "(ix) FEATURE: (A) NOM BRE / CLAVE: misc_ARN (B) LOCATION: 4..66 (D) OTHER INFORMATION: / label = FRl / note = "" FRl "refers to Region 1 of the frame" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 67..102 (D) OTHER INFORMATION: / label = CDRl / note = "" CDRl "refers to Region 1 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 103..147 (D) OTHER INFORMATION: / label = FR2 / note = "" FR2"refers to the Region 2 of the frame" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 148..168 (D) OTHER INFORMATION: / label = CDR2 / note = "" CDR2"refers to Region 2 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 169.264 (D) OTHER INFORMATION: / label = FR3 / note = "" FR3"refers to Region 3 of the Framework" - (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) 'LOCATION: 265..291 (D) OTHER INFORMATION: / label = CDR 3 / note = "CDR3" refers to the Region of Complementing Determination? "(ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 292..324 (D) OTHER INFORMATION: / label = FR4 / note -" "FR4" refers to the Pegiar. of the frame "(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 5: GCC GAG CTC ACG CAG TCT CCA GGC ACC CTG TCT TTG TTT CCA GGG GAA 48 Wing Glu Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Phe Pro Gly Glu 1 5 10 15 AGA GCC ACT CTC TCC TGC AGG GCC AGT CAG AGA ATT AGC ACC AGT TT; -t Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Arg He Ser Thr Ser Phe 20 25 30 TTA GCC TGG TAC CAG CAG AAG CCT GGC CAG TCT CCC AGG CTC CTC ATC 144 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Arg Leu Leu Ha 35 40 45 TTT GAT GCA TCC ACC AGG GCC CCT GGC ATC CCT GAC AGG TTC AGT GCC 1 2 Phe Asp Wing Ser Thr Arg Wing Pro Pro Gly He Pro Asp Arg Phe Ser Wing 50 55 60 AGT TGG TCT GGG ACÁ GAC TTC ACT CTC ACC ATC AGC AGG CTG GAG CCT 240 Ser Trp Ser Gly Thr Asp Phe Thr leu Thr He Ser Arg Leu Glu Pro 65 ~ 3 75 SO GAA GAT TTT GCA GTC TAT TAC TGT CAA CAT TAT GGT GGG TCT CCC TGG S8 Glu Asp Phe Wing Val Tyr T r Cys Gln His Tyr Gly Gly Ser Pro Trp 85 90 95 ACG TTC GGC CAA GGG ACC AAG GTG GAA ATC AAG CGA ACT GTG GCT GCA 336 Thr Phe Gly Gln Gly Thr Lys Val Glu He Lys Arg Thr Val Ala Wing 100 105 110 CCA TCT GTC TTC ATC TTC CCG CCA TCT GAT GAG CAG TTG AAA TCT GGA 384 Pro Ser Val Phe He Phe Pro Prc Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 ACT GCC TCT GTT GTG TGC CTG CTG AAT AAC TTC TAT CCC AGA GAG GCC 432 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Wing 130 135 140 AAA GTA CAG TGG AAG GTG GAT AAC GCC CTC CAG TCG GGT AAC TCC CAG 480 Lys Val Gln Trp Lys Val Asp Asn Wing Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 GAG AGT GTC ACÁ GAG CAG GAC AGC AAG GAC AGC ACC TAC AGC CTC AGC 528 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 AGC ACC CTG ACG CTG AGC AAA GCA GAC TAC GAG AAA CAC AAA GTC TAC 576 Ser Thr Leu Thr Leu Ser Lys Wing Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 GCC TGC GAA GTC ACC CAT CAG GGC CTG AGC TCG CCC GTC ACÁ AAG AGC 624 Wing Cys Glu Val Thr His G n Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 TTC AAC AGG GGA GAG TGT 642 Phe Asn Arg Gly Glu Cys 210 (2) FA? A INFORMATION. L ??; II NO: 6: í i j CARACTE? : T: AÍ:? THE SECUENC: A: (A) -;.: I: 7":::;, rmo acids ÍC) T? * - - "- A-: ^ -, 1; ii) TYPE OF MOLECULE: protein [xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 6 Wing Glu Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Phe Pro Gly Glu 1 5 10 15 Arg Wing Thr Leu Being Cys Arg Wing Being Gln Arg He Being Thr Being Phe 20 25 30 Leu Wing Trp Tyr Gin Gln Lys Pro Gly Gln Being Pro Arg Leu Leu He 35 40 45 Phe Asp Wing Being Thr Arg Wing Pro Gly He Pro Asp Arg Phe Ser Ala 50 55 60 Ser Trp Ser Gly Thr Asp Phe Thr Leu Thr He Ser Arg Leu Glu Pro 65 70 75 80 Glu Asp Phe Wing Val Tyr Tyr Cys Gln His Tyr Gly Gly Ser Pro Trp 85 90 95 Thr Phe Gly Gln Gly Thr Lys Val Glu He Lys Arg Thr Val Ala Wing 100 105 110 Pro Ser Val Phe He Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly 115 120 125 Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Wing 130 135 140 Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln 145 150 155 160 Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser 165 170 175 Be Thr Leu Thr Leu Ser Lys Wing Asp Tyr Glu Lys His Lys Val Tyr 180 185 190 Wing Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser 195 200 205 Phe Asn Arg Gly Glu Cys 210 (2) INFORMATION FOR SEQ ID NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 645 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: circular (ii) TYPE OF MOLECULE : CDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (F) TYPE OF TISSUE: lymphoid associated with the intestine (G) TYPE OF CELL: Lymphocyte (vii) IMMEDIATE SOURCE: (B) CLONE: 5-4 (ix) CHARACTERISTIC: (A) NAME / KEY: CDS (B) LOCATION: 1..645 (D) OTHER INFORMATION: / codon_start = 1 / product = "Kappa Light Chain of ANCA associated with Ulcerative Colitis" (ix) CHARACTERISTICS: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..3 (D) OTHER INFORMATION: / label = Marbete N-Terminal (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 4.285 (D) OTHER INFORMATION: / label = VKSEGMENT / note = "" VKSEGMENT "refers to the Variable Segment of the Kappa Light Chain "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 286..327 (D) OTHER INFORMATION: / label = JK / note =" "JK" refers to the Union Segment of the Kappa Light Chain "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 328..645 (D) OTHER INFORMATION: / label = CK / note =" "CK" refers to the Constant Segment of the Kappa Light Chain "(ix) FEATURE: (A) NAME E / KEY: misc_ARN (B) LOCATION: 4..66 (D) OTHER INFORMATION: / label = FRl / note = "" FRl "refers to Region 1 of the frame" (ix) FEATURE: (A) NAME / KEY: mísc_ARN (B) LOCATION: 67..102 (D) OTHER INFORMATION: / label = CDRl / note = "" CDRl "refers to Region 1 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 103..147 (D) OTHER INFORMATION: / label = FR2 / note = "" FR2"refers to the Region 2 of the frame" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 148..168 (D) OTHER INFORMATION: / label - CDR2 / note = "" CDR2"refers to Region 2 of Determination of Complementarity" (ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 169..264 (D) OTHER INFORMATION: / label = FR3 / note = "" FR3"refers to the Region 3 of the frame" (ix) FEATURE: (A) NAME / KEY: p? isc_ARN (B) 'LOCATION: 265..294 (D) OTHER INFORMATION: / label = CDR3 / note = "CDR3" refers to Region 3 of Determination of Complementarity "(ix) FEATURE: (A) NAME / KEY: misc_ARN (B) LOCATION: 295..327 (D) OTHER INFORMATION: / label = FR4 / note = "" FR4"refers to Region 4 of the Framework" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO; 7: GCC GAG CTC ACG CAG TCT CCA GGC ACC CTG TCT TTG TCT CCA GGG GAA 48 Wing Glu Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly Glu 1 5 10 15 AGA GCC ACC CTC TCC TGC AGG GCC AGT CAG GGT GTT AGC AGC GGC TCC 96 Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Gly Val Ser Ser Gly Ser 20 25 30 TTA GCC TGG TAT CAG CAG AAA GCT GGC CAG GCT CCC AGG CTC CTC ATC 144 Leu Wing Trp Tyr Gln Gln Lys Wing Gly Gln Wing Pro Arg Leu Leu He 35 40 45 TAT GGT GCA TCC AGG AGG GCC ACT GGC ATC CCA GAC AGG TTC ACT GGC 192 Tyr Gly Wing Wing Arg Arg Wing Thr Gly He Pro Asp Arg Phe Thr Gly 50 55 60 AGT GGG TCT GGG ACA GAC TTC ACT CTC ACC ATC ACC AGA CTG GAG CCT 240 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Thr Arg Leu Glu Pro 65 70 75 80 GAA GAT TTT GCA GTG TAT TAC TGT CAG CAG TAT GGT AGC TCC CAG GGA 288 Glu Asp Phe Wing Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Gln Gly 85 90 95 TTC ACT TTC GGC CCT GGG ACC AAA GTG GAT CTC AAA CGA ACT GTG GCT 36 Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Leu Lys Arg Thr Val Wing 100 105 110 GCA CCA TCT GTC TTC ATC TTC CCG CCA TCT GAT GAG CAG TTG AAA TCT 384 Pro Wing Val Phe He P he Pro Pro Ser Asp Glu Gln Leu Lys Ser 115 120 125 GGA ACT GCC TCT GTT GTG TGC CTG CTG AAT AAC TTC TAT CCC AGA GAG 432 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 GCC AAA GTA CAG TGG AAG GTG GAT AAC GCC CTC CAG TCG GGT AAC TCC 480 Wing Lys Val Gln Trp Lys Val Asp Asn Wing Leu Gln Ser Gly Asn Ser 145 150 155 160 CAG GAG AGT GTC ACÁ GAG CAG GAC AGC AAG GAC AGC ACC TAC AGC CTC 528 Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 AGC AGC ACC CTG ACG CTG AGC AAA GCA GAC TAC GAG AAA CAC AAA GTC 576 Ser Ser Thr Leu Thr Leu Ser Lys Wing Asp Tyr Glu Lys His Lys Val 180 185 190 TAC GCC TGC GAA GTC ACC CAT CAG GGC CTG AGC TCG CCC GTC ACA AAG 624 Tyr Wing Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 AGC TTC AAC AGG GGA GAG TGT 645 Ser Phe Asn Arg Gly Glu Cys 210 215 (2) INFORMATION FOR SEQ ID NO: o: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 215 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: proteir.a ( xi) DESCRIPTION OF THE SEQUENCE: ?? 0_ ID NO: 8: Wing Glu Leu Thr Gln Ser Prc Gl Thr le Ser Leu Ser Pro Gly Glu 1 5 :: 15 Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Gly Val Ser Ser Gly Ser 20 25 30 Leu Wing Trp Tyr Gln Gln Lys Wing Gly Gln Wing Pro Arg Leu Leu He 35 40 45 Tyr Gly Wing Wing Arg Arg Wing Thr Gly He Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr He Thr Arg Leu Glu Pro 65 70 75 80 Glu Asp Phe Wing Val Tyr Tyr Cys Gln Gln Tyr Gly Ser Ser Gln Gly 85 90 95 Phe Thr Phe Gly Pro Gly Thr Lys Val Asp Leu Lys Arg Thr Val Wing 100 105 110 Wing Pro Ser Val Phe He Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser 115 120 125 Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu 130 135 140 Wing Lys Val Gln Trp Lys Val Asp Asn Wing Leu Gln Ser Gly Asn Ser 145 150 155 160 Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu 165 170 175 Be Ser Thr Leu Thr Leu Ser Lys Wing Asp Tyr Glu Lys His Lys Val 180 185 190 Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys 195 200 205 Ser Phe Asn Arg Gly Glu Cys 210 215 (2) INFORMATION FOR SEQ ID NO: 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..30 (D) OTHER INFORMATION: / label = CGlz / note = "" CGlz "refers to the cDNA Primer for the IgGl Heavy Chain Constant Segments" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 9: GCATGTACTA GTTTTGTCAC AAGATTTGGG 30 (2) INFORMATION FOR SEQ ID NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..24 (D) OTHER INFORMATION: / label = VHla / note = "" VHla "refers to the cDNA primer for the variable segments of the heavy chain that are members of the VH1 gene family" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 10: CAGGTGCAGC TCGAGCAGTC TGGG 24 (2) INFORMATION FOR SEQ ID NO: 11: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..24 (D) OTHER INFORMATION: / label = VH3a / note = "" VH3a " refers to the cDNA Primer for the Variable Segments of the Heavy Chain that are Members of the VH3 Gene Family "(vi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 11: GAGGTGCAGC TCGAGGAGTC TGGG 24 (2) INFORMATION FOR SEQ ID NO: 12: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..23 (D) OTHER INFORMATION: / label = VH2f / note = "" VH2f "refers to the cDNA primer for heavy chain variable segments that are members of the VH2 gene family" (vi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 12: CAGGTGCAGC TACTCGAGTC GGG 23 (2) INFORMATION FOR SEQ ID NO: 13: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 1..24 (D) OTHER INFORMATION : / label- VH3f / note = "" VH3f "refers to the cDNA primer for heavy chain variable segments that are members of the VH3 gene family" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 13: GAGGTGCAGC TGCTCGAGTC TGGG 24 (2) INFORMATION FOR SEQ ID NO: 14: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCALIZATION: 1..23 (D) OTHER INFORMATION : / label = VH4f / note = "" VH4f "refers to the cDNA primer for the variable segments of the heavy chain that are members of the VH4 gene family" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 14: CAGGTGCAGC TGCTCGAGTC GGG 23 (2) INFORMATION FOR SEQ ID NO: 15: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..23 (D) OTHER INFORMATION : / label = VH6a / note = "" VH6a "refers to the cDNA primer for heavy chain variable segments that are members of the VH6 gene family" (vi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 15: CAGGTACAGC TCGAGCAGTC AGG 23 (2) INFORMATION FOR SEQ ID NO: 16: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY : linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..27 (D) OTHER INFORMATION: / label = VH6f / note = "" VH6f "is re applies to the cDNA primer for the variable segments of the heavy chain that are members of the VH6 gene family "(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 16: CAGGTACAGC TGCTCGAGTC AGGTCCA 27 (2) INFORMATION FOR SEQ ID NO: 17: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 58 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: mis < c_ARN (B) LOCATION: 1..58 (D) OTHER INFORMATION: / label = CKld / note = "" CKld "refers to the cDNA Primer for Constant Segments of the Kappa Light Chain" (vi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 17: GCGCCGTCTA TAACAC TCTCCCCTGT TCTCTT TGTGACGGGC TCAG 58 (2) INFORMATION FOR SEQ ID NO: 18: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..24 (D) OTHER INFORMATION: / label = VKla / note = "" VKla "refers to the cDNA Primer for Segments the Kappa Light Chain Variables that are Members of the VK1 Gene Family" (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: GACATCGAGC TCACCCAGTC TCCA 24 (2) INFORMATION FOR SEQ ID NO: 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCALI ZATION: 1..24 (D) ANOTHER INFORMATION: / label = VK2a / note = "" VK2a "refers to the cDNA primer for the Kappa Light Chain Variable Segments that are members of the VK2 Gene Family" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 19: GATATTGAGC TCACTCAGTC TCCA 24 (2) INFORMATION FOR SEQ ID NO: 20: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple ( D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..24 (D) OTHER INFORMATION: / label = VK3a / note = "" VK3a "refers to the Primer of CDNA for the Kappa Light Chain Variable Segments that are Members of the VK3 Gene Family "(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 20: GAAATTGAGC TCACGCAGTC TCCA 24 (2) INFORMATION FOR SEQ ID NO: 21: ( i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..22 (D) OTHER INFORMATION: / note: "5 'Heavy Chain Sequence Primer" (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 21: GGCCGCAAAT TCTATTTCAA GG 22 (2) INFORMATION FOR SEQ ID NO: 22: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..18 (D) OTHER INFORMATION: / note = "Heavy Chain Sequence Primer 3 '(xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 22: CGCTGTGCCC CCAGAGGT 18 (2) INFORMATION FOR SEQ ID NO: 23: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..18 (D) OTHER INFORMATION: / note = "Light Chain Sequence 5 '" (xi) ) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 23: CTAAACTAGC TAGTCGCC 18 (2) INFORMATION FOR SEQ ID NO: 24: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: simple (D) TOPOLOGY: linear ( ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTIC: (A) NAME / KEY: misc_ARN (B) LOCATION: 1..21 (D) OTHER INFORMATION: / note = "Light Chain Sequence Primer" (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 24: ATAGAAGTTG TTCAGCAGGC A 21

Claims (28)

R E I V I N D I C A C I O N S

1. An isolated antibody material associated with ulcerative colitis and immunoreactivity with the nuclear antigen in neutrophils, wherein the immunoreactivity is characterized by a perinuclear staining pattern generated in an indirect neutrophil immunofluorescence assay fixed with alcohol.

The antibody material of claim 1, wherein the immunoreactivity is further characterized as being dislocated by the pretreatment of the fixed neutrophil with DNase alcohol.

3. The antibody material of claim 1, wherein the immunoreactivity is further characterized as located within the nuclear envelope of the neutrophil.

4. The antibody material of claim 1, wherein the antibody material is a Fab having a molecular weight of about 60,000 Daltons in 12 percent SDS-PAGE.

5. The antibody material comprising the anti-neutrophil cytoplasmic antibody material associated with ulcerative colitis, wherein the antibody material is characterized as having immunoreactivity with the antigen located within the neutrophil nuclear envelope wherein the immunoreactivity is characterized by a pattern of perinuclear staining by indirect neutrophil immunofluorescence assay fixed with alcohol and wherein the immunoreactivity is further characterized as being dislocated by neutrophil pre-treatment with the DNase.

6. A recombinant polypeptide comprising at least one variable segment in an immunoglobulin heavy chain ("segment ^"), wherein the segment Vpj comprises framework regions, the complementarity determination region 1 ("CDR ^ I") and region II of determination of complementarity ("CDR ^ II"), and wherein CDR ^ I has essentially the same amino acid sequence as the amino acid sequence selected from the group consisting of residues 33 to 37 of SEQ ID NO. : 2 and residues 32 to 36 of SEQ ID NO: 4.

7. The polypeptide of claim 6, wherein the CDR ^ II has essentially the same amino acid sequence as the amino acid sequence selected from the group consisting of residues. 52 to 68 of SEQ ID NO: 2 and residues 51 to 67 of SEQ ID NO: 4.

8. The polypeptide of claim 7, further comprising an immunoglobulin heavy chain binding segment ("segment JH") and a diversity segment, wherein at least a portion of the JH segment and a portion of the diversity segment define a region III of determination of complementarity ("CDR ^ III"), wherein the amino acid sequence of CDR ^ III is essentially the same as the amino acid sequence selected from the group consisting of residues 101 to 109 of SEQ ID NO: 2 and residues 100 to 120 of SEQ ID NO: 4.

9. A recombinant polypeptide comprising at least one variable segment of an immunoglobulin heavy chain ("segment V _"), wherein the segment V ^ comprises regions of framework, region I of complementarity determination ("CDRf I") and region II of complementarity determination ("CDRj II"), and wherein CDR ^ II has essentially the same amino acid sequence as the amino acid sequence e) of the group consisting of residues 52 to 68 of SEQ ID NO: 2 and residues 51 to 67 of SEQ ID NO: 4.

10. The polypeptide of claim 9, further comprising a chain binding segment. heavy immunoglobulin ("JH segment") and a diversity segment, wherein at least a portion of the JH segment and a portion of the diversity segment define a region III of complementarity determination ("CDRjj III"), and where the amino acid sequence of CDR ^ III is essentially the same as the amino acid sequence selected from the group consisting of residues 101 to 109 of SEQ ID NO: 2 and residues 100 to 120 of SEQ ID NO: 4.

11. An isolated polypeptide comprising an immunoglobulin heavy chain variable domain having essentially the same amino acid sequence as the amino acid sequence selected from the group consisting of residues 16 to 217 of SEQ ID NO: 2 and residues 6 to 136 of SEQ ID NO:.

12. An isolated polynucleotide encoding the polypeptide of claim 11.

13. The antibody material comprising the polypeptide of claim 11, wherein the antibody material is selected from the group consisting of Fab, Fab ', F (ab') 2 and an antibody.

The antibody material of claim 13, wherein the antibody material is Fab, wherein Fab consists of an immunoglobulin heavy Fd chain and an immunoglobulin light chain.

15. The antibody material of claim 14, wherein the immunoglobulin light chain comprises essentially the same amino acid sequence as the amino acid sequence which is selected from the group consisting of residues 2 to 107 of SEQ ID NO: 6 and residues 2 to 108 of SEQ ID NO: 8.

16. A polynucleotide that encodes the polypeptide having essentially the same amino acid sequence as the amino acid sequence that is selected from the group consisting of residues 2 to 107 of SEQ ID NO. NO: 6 and residues 52-108 of SEQ ID NO: 8.

17. A method for producing a library of dicistronic phagemid expression vectors encoding the heterodimeric antibody material from an immunoglobulin gene repertoire of UC +, comprising: (a) forming a first ligation mixture by combining in a ligation stabilizer: (i) a first library of the repertoire of the immunoglobulin gene of the UC +, the first library c a plurality of DNA homologs in the form of dsDNA is comprised, each library DNA homolog having cohesive terminals adapted for directional ligation, wherein the library is selected from the group consisting of a V + library of UC + and a library VL of UC +, and (ii) a plurality of fagemid expression vectors in linear form, each having first cohesive termini upstream and downstream which are adapted to directionally receive a DNA homolog from the first library of the repertoire of the UC + immunoglobulin gene in a common reading frame, and wherein the first cohesive terminals are operably linked to the respective upstream and downstream DNA sequences, which in turn are operably linked to the control sequences of DNA expression upstream and downstream, respectively; (b) subjecting the mixture to ligation conditions for a sufficient period of time to operably link the DNA homologs of the first library of the UC + immunoglobulin gene repertoire with the vectors and produce a plurality of circular fagemid expression vectors , each having a first cistron to express the first library of the repertoire of the immunoglobulin gene of UC +, where the translatable DNA sequence upstream of the first cohesive terminals encodes a prokaryotic secretion signal and the translatable DNA sequences in downstream of the first cohesive terminals encode a filamentous bacteriophage coat protein membrane anchor; (c) treating the plurality of circular phagemid expression vectors under DNA dissociation conditions to produce a plurality of phagemid expression vectors in linear form each having second cohesive terminals in upstream and downstream, which (i) ) are adapted to directionally receive a DNA homologue from the second library of the UC + immunoglobulin gene repertoire in a common reading frame, and (ii) are functionally linked to the respective downstream and downstream DNA sequences. which in turn are operably linked to the DNA expression control sequences, wherein the DNA sequence upstream of the second cohesive terminals is a translatable sequence encoding a prokaryotic secretion signal and the downstream DNA sequence. of the second cohesive terminals have at least one stop or voltage codon in the reading frame; (d) forming a second ligation mixture by combining in a ligation stabilizer (i) the plurality of expression vector of fagemid formed in (c), and (ii) the second library of the immunoglobulin gene repertoire of UC +, the second library comprises a plurality of DNA homologous in the form of dsDNAs, each library DNA homolog having cohesive terminals adapted for directional ligation with the second cohesive terminals of the fagemid expression vectors, wherein the library is selected from the group which consists of a V + library of UC + and a VL library of UC +; and (e) subjecting the second mixture to ligation conditions for a period of time sufficient to operably link the DNA homologs of the second library of the UC + immunoglobulin gene repertoire to those vectors, yielding a plurality of expression vectors of circular phagemid each having a second cistron to express the second library of the immunoglobulin gene repertoire of the UC +.

18. A library of fagemid expression vectors containing cDNA homologs encoding the VL and V ^ polypeptides of an immunoglobulin gene repertoire of UC +, wherein the repertoires of the UC + immunoglobulin gene are derived from the LPL of a human being diagnosed with UC and seropositive for pANCA.

19. A plurality of prokaryotic cells containing the library of the fagemid expression vectors of claim 18.

20. A population of filamentous bacteriophage particles encapsulating the library of claim 18.

21. The library of expression vectors of fagemid contained in the population of E. coli deposited with the American Type Culture Collection and having an Accession Number of ATCC 69827.

22. A method for producing filamentous bacteriophage particles having on the surface of the particle the heterodimeric antibody material of the UC + comprising (a) introduce into the permissive prokaryotic host cell for duplication of the filamentous bacteriophage one or more fagemid expression vectors containing and capable of expressing the coding DNA homologues Vu_- and VL coding ~ of the UC +, where one of the encoded polypeptides is fused to a filamentous bacteriophage coat protein membrane anchor and wherein both encoded polypeptides are each fused to a prokaryotic secretion signal, and (b) maintaining the prokaryotic host cell containing the vector under sufficient conditions for the production of the filamentous bacteriophage and under sufficient conditions is for the expression of the heterodimeric antibody material of UC +, thus forming the bacteriophage particle.

23. A population of filamentous bacteriophage particles that encapsulates the dicistronic phagemid expression vectors encoding the heterodimeric antibody material of UC +, wherein the material of the heterodimeric antibody immunoreacts with the antigen UCpANCA as demonstrated by binding to the fixed neutrophil with alcohol.

24. A method for detecting UCpANCA in a sample, comprising: (a) contacting the sample and a detectable secondary reagent with the fixed neutrophil under appropriate conditions to form a neutrophil immune complex, UCpANCA and the detectable secondary reagent, in where the secondary reagent has a binding specificity for UCpANCA with the portion that determines the class of UCpANCA; (b) separating the unbound secondary reagent from the immune complex; and (c) assaying for the presence or absence of the immune complex containing UCpANCA within the nuclear envelope of the neutrophil, detecting the presence or absence of the bound secondary reagent.

25. A case comprising the material UCpANCA in an amount sufficient for at least one assay and instructions for the use of the UCpANCA material as a reference reagent in an immunoassay to be selected for UC.

26. A method for isolating the immunoreactive antigen UCpANCA comprising: (a) contacting the UCpANCA material with the neutrophil cell lysate for a time, at an appropriate temperature and pH to form an immune complex comprising the UCpANCA material , (b) preparing the immune complex of the lysed material of the non-complexed cell, (c) separating the UCpANCA material from the antigen.

27. The nucleic acid encoding the UCpANCA antibody material.

28. An anti-idiotypic antibody that has binding specificity for UCpANCA.