MXPA97009226A - Multifunctional linking system for specific cellular transfer of nucleic acid - Google Patents

Abstract

The invention relates to a multifunctional system of ligands that is non-immunogenic and that carries out the transfer of nucleotide sequences specific to the cell. The system comprises at least one specific ligand of the target cell, at least one linker and at least one specific ligand of the gene construct, the specific ligand of the gene construct advantageously comprising an antibody, or a part thereof, that binds directly or indirectly to the gene construction. The invention also relates to ligand systems for preparing a pharmaceutical product or a vaccine for the treatment or prevention of a disease of the skin, the mucous membrane, the nervous system, internal organs, the coagulation of blood, hemopoietic system, the immune system, the musculature, the sustentacular tissue or the articulation

Description

MULTIFUNCTIONAL LINKING SYSTEM FOR SPECIFIC CELLULAR TRANSFER OF NUCLEIC ACID. FIELD OF THE INVENTION The invention relates to improved methods and agents for transferring polynucleotides to cells.

Field of the invention The binding of a gene construct to the surface of a cell is a necessary, although not sufficient, prerequisite for transferring genes to a cell. The stronger this union is, the greater is the probability that the gene construct will be successfully admitted by the cell and transcribed in the cell. The more specific the cell is this binding, the more likely it is that the gene construct will predominantly or only be linked to the target cell and will be accepted by this cell. The specificity of the binding of a gene construct to the target cell is of particular importance when cells of another type are present in addition to the gene construct and the target cell, but, nevertheless, the gene construct must be preferentially accepted or exclusively by the target cell. Several technologies have been developed that allow a gene construct to bind in a cell-specific manner. To all these technologies it is common the fact that they make use of the union of (1) a ligand to its receptor that is expressed on the cell membrane, or (2) an antibody to its antigen or hapten that is exposed on the cell membrane . Examples of such technologies include re-combining methods for incorporating ligands such as heregulin (Han et al., PNAS 92, 9747 (1995)), erythropoietin (Kasahara et al., Science 266, 1373 (1994)), antibody fragments. such- as single chain Fv (Marin et al., J. Virol. 70, 2957 (1996)) or receptors such as the extracellular residue of the Fe receptor (Dougherty et al., Transfusion Science 17, 121 (1996)) in the coating glycoprotein of retroviral vectors, and thus elicit specificity for the target cell. Chemical methods have also been used to bind ligands such as asialoglycoprotein (Wu et al., J. Biol. Chem. 269, 1152 (1994)) or synthetic derivatives of this protein (Marwin et al., Bioconjugate Chem. 5, 612 ( 1994)) to polylisin and complex the latter with the gene construct or chemically bind it to coat proteins of adenoviral vectors. Another method is to bind ligands to strep-tavidin, which in turn binds to biotin which is conjugated to the phospholipid groups of the liposome head, complexing the liposomes with the gene constructs (Redelmeir et al., Drug Deliv. J Deliv Targeting Therap, Agents 2, 98 (1995)). A first ligand system was presented by Fo inaya et al., J. Biol. Chem. 271, 10560, 1966. This ligand system comprises an antibody fragment that is specific for the Erb B2 receptor in tumor cells, the peptide fuse of Pseudomonas exotoxin A and the DNA binding domain of yeast Gal-4 protein, which binds to the corresponding Gal-4 binding sequence that is inserted into a plasmid containing the transgene. Although this ligand system results in specific transfection of the target cell, it suffers from the drawback of the immunogenicity of the yeast Gal-4 protein. None of these published methods adequately solved the problem of binding vectors in a manner specific to the target cell. The main reasons for this lack of specificity include: (1) impaired function of modified viral vectors; (2) the considerable complexity and size of the ligand systems used; (3) the immunogenicity and compatibility of heterologous or modified proteins, or of the streptavidin-biotin coupling system employed; and (4) an inadequate ability of the linked gene construct to effect specific cell transduction of the target cell. As a result of these limitations, there remains a great need for a simple and functionally-capable preparation ligand useful for the binding of viral and non-viral vectors to target cells.

SUMMARY OF THE INVENTION Accordingly, it is an object of the invention to provide a system of ligands for the specific transfer of the target cell from nucleotide sequences, which is not immunogenic and which is simpler to prepare and use than previously known systems. . Another object is to increase the specificity of target cell binding vectors, and thereby improve the efficiency and selectivity of the transfer of nucleic acid to target cells. In fulfillment of these and other objects, an aspect of this invention provides a multifunctional system of ligands for the transfer of nucleotide sequences, specific to the target cell, comprising at least one specific ligand of the daily cell, at least one ligand. specific for the gene construct comprising an antibody or an antibody portion, and a linker that binds the two ligands, the system not being immunogenic. In an advantageous embodiment, at least one ligand is an antibody, or an antibody fragment, humanized. In another advantageous embodiment, a composition for curing a disease is provided, comprising a multifunctional system of ligands for the specific transfer of the nucleotide sequence cell, comprising at least one specific ligand of the target cell, at least a specific ligand of the gene construct comprising an antibody or an antibody portion, and a linker that binds the two ligands, the system not being immunogenic, and being provided in a vehicle suitable for administration to a patient. In another advantageous embodiment, the ligand system comprises a connector that connects two ligands, and the connector comprises two linkers. In another advantageous embodiment, a ligand system is provided comprising: (a) a TS ligand comprising an anti-NCAM recombinant single chain Fv fragment, wherein the variable heavy chain and the light chain of the Fv fragment are covalently attached via of a short peptide sequence; (b) a linker comprising a fusogenic peptide having the sequence GLFEALLELLESL ELLLEA (SEQ ID NO: 1); and (c) a ligand GS comprising a recombinant antibody for N6-methyladenine. In another advantageous embodiment, the invention relates to the use of a ligand system according to the present invention, for the preparation of a medicament for preventing or treating skin diseases, mucous membrane diseases, diseases of the nervous system, diseases of the internal organs, diseases of the coagulation of the blood, diseases of the hematopoietic system, diseases of the immune system, diseases of the musculature and diseases of the sustentacular tissue or of the joints. "The ligand system is administered locally or injects a patient or, alternatively, cells obtained from a patient, to prevent, such as a vaccine, or to treat a disease associated with one or more of the group consisting of diseases of the skin, mucous membrane, nervous system, organs internal, blood coagulation, hematopoietic system, immune system, musculature, sustentacular tissue and articu These advantages are made possible by linking specific ligands of the cell to gene constructions according to the invention. Other objects, features and advantages of the present invention will become apparent from the detailed description that follows. However, it is to be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since from this detailed description it will become apparent to those skilled in the art various changes and modifications within the spirit and scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows three alternative ligand systems composed of cell-specific ligands and ligand-two specific gene constructs., in which the ligands are linked by a linker (Figure la and Ib) or 'by a "connector" (Figure 1c). Figure 2 presents an embodiment of the ligand system of Figure 1 c, wherein the "linker" comprises the hinge region of an antibody. Figure 3 shows another embodiment of the ligand system of Figure 1c, wherein the "linker" comprises a Gal80 protein and the Gal80 binding domain of Gal4.

Figure 4 depicts an embodiment in which a fusogenic peptide is used to bind two anti-body fragments. Figure 5 outlines pHENIS and pABl expression vectors, which are useful in the invention.

Detailed description of the preferred embodiments. The present inventors have discovered that a specific ligand for the target cell and a specific ligand for a gene construct could be connected to each other without forming an immunogen complex, by means of a linker, as shown in Figure 1. In addition, using in particular a " "linker" as shown in Figure 1c and in Figures 2 and 3, a ligand system could be constructed to overcome the limitations posed by the immunogenicity of the prior art, and the low specificity and efficacy of the transduced cells. A "target cell-specific ligand" (TS ligand), as referred to herein, is a molecule that binds to a determinant on the surface of a target cell, i.e., to a specific ligand binding partner of the target cell, for example to a receptor or to an adhesion molecule. A "linker" is a molecule that, in the simplest case, binds the specific ligand of the target cell with the specific ligand of the gene construct, and that advantageously possesses fusogenic properties, that is, properties that allow the penetration of the new ligand system through the cell membrane and / or through the lysosomal membrane, i.e., from the lysosomes into the cytoplasm. In an advantageous embodiment of the invention, the linker also has fusogenic properties. A "specific ligand of the gene construct" (ligand GS) is a molecule that binds directly or indirectly, by means of an antibody or a part thereof, to a gene construct. In a suitable embodiment of the invention, the ligand TS and the ligand GS are linked by a "connector". In addition, one of the ligands, or both, may contain different binders. Embodiments using a connector can take different forms depending on the specific ligand GS and ligand TS used (eg IX linker, 2 X TS ligand, 1 X GS ligand or 1 X linker, 1 X TS ligand, 2 X ligand GS). The coupling between the ligand TS, the linker and the ligand GS can be effected by covalent attachment [the description of the technology is given by Sedlacek et al., Contrib. to Oncol. 32, 42-49 and 81-85, Karger Verlag Munich (1988)] or by non-covalent means such as that based on different charges (ionic binding). However, the ligand system can also be prepared as a fusion protein using recombinant techniques, as already described in EP-A1-0 464 533. The nucleic acid sequence that is introduced into a target cell by means of the The ligand system of the invention can be a naked RNA or DNA, a naked RNA or a naked DNA, mixed with a non-viral vehicle, or a virus. During use, a ligand system of the invention is mixed with the gene construct, and the resulting complex is added to cells to be transduced or the complex can be administered to the patient. In the present text examples of specific ligands of the target cell, specific ligands of the gene construct, linkers and connectors useful for the invention are set forth, in order to illustrate some of the possible combinations contemplated by the inventors.

THE LIGANDO TS. In the context of the present invention, the ligand TS can be an active compound, a part of the active compound or an analog of the active compound that binds to a receptor in the target cell. Endogenous substances, portions of endogenous substances and other substances that mimic one or more epitopes of an endogenous substance, are advantageous for their low immunogenicity compared to most foreign substances when introduced into an organism. Examples of such active compounds are: growth factors such as VEGF, PDGF, EGF, TGFa, TGFβ, KGF, SDGF, FGF, IGF, HGF, NGF, BDNF, neurotrophins, BMF, bombesi, MrCSF, thrombopoietic, erythropoietic, SCF, SDGF, oncos-tatina, PDEGF and endothelin 1; cytocytes such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12 , IL-13, IL-14 and IL-15; interferon a, ß and?; tumor necrosis factors TNFa and TNFβ; iokines such as RANTES, MCAF, MlP-la, MlP-lβ, NAP and β-thromboglobulin; pep-tide hormones such as SRH, SIH, STH, MRH, MSH, PRH, PIH, prolactin, LH-RH, FSH-RH, LH / ICSH, FSH, TRH, TSH, CRH, ACTH; an-giotensin, a quinine, or histamine or homologues or analogues thereof; steroid hormones such as estrogens, progestagens, androgens, glucocorticoids or mineralocorticoids, or homologues or analogues thereof; and vitamins such as folic acid. Within the context of the present invention, the ligand TS can also be an adhesion molecule, a part of an adhesion molecule or an analog of an adhesion molecule that binds to a corresponding adhesion molecule that is located in the cell membrane, or another surface of the target cell that binds specifically to an adhesion molecule. Examples of such adhesion molecules that are capable of functioning as TS ligands are Lewis X (for GMP-140), S-Lewis X (for ELAM-1), LFA-1 (for ICAM-1 and ICAM-2), MAC -1 (for ICAM-1), VLA-4 (for VCAM-1), PECAM (for PECAM), vi-tronectin (for the vitronectin receptor), GMP-140 (for Lewis X), S-Lewis X (for for ELAM-1), ICAM-1, ICAM-2 (for LFA-1, MAC-1), VCAM-1 (oVLA-4), fibronectin (for LA-4), laminin (for VLA-6) , fibronectin, laminin (for VLA-1, VLA-2, VLA-3), fibronectin (for VLA-4), fibrinogen (for GPIIb-Illa), B7 (for CD28), CD28 (for B7), CD40 (for CD40L) and CD40L (for CD40). I Within the context of the present invention, the TS ligand may also be the extracellular part of a Fe receptor (Dougherty et al., Transfusion Science 1/7, 121 (1996)) to which an antibody that is specific for the target cell is bound via its Fe moiety. Within the context of the present invention, the ligand TS can also be a ligand for a VDL receptor or an LDL receptor (eg, LDL receptor, LDL-related receptor protein, FC receptor). of IgG (eg Fc? RII-B2, Fc? Rl), 88 kDa glycoprotein receptor, acetylated LDL receptor, oxidized LDL receptor or megalin). Ligands of this nature have already been described in detail in the literature and are, for example: apolipoprotein B-100 or fragments thereof containing the carboxyterminal moiety, apolipoprotein E, protease / inhibitor complex, such as the tPA / complex PAI-1, 2-macroglobulin, thrombospondin or its heparin binding ami-noter inal domain (eg aminio acids 1-214), oxidized LDL, acetylated LDL or acetoacetylated LDL, acetylated lysine, desialylated LDL, conjugated LDL with dialdehyde malonium, albumin treated with formaldehyde or treated with glutaraldehyde, maleilated albumin, protein associated with the 39 kDa receptor, or fragments thereof, for example those containing amino acids 18-112, 113-218 and 219- 323 or amino acids 1-114 and 114-319, lactoferrin, aprotinin, lipoprotein lipase, amyloid precursor protein (protease nexin 2) and Pseudomonas exotoxin. Within the context of the present invention, the ligand TS may also be an antibody molecule or an epitope-binding moiety of an antibody molecule. If used, a murine monoclonal antibody is preferably used in a humanized form to limit its immunogenicity. Humanization can be carried out in the manner described by Winter et al. (Nature 349, 293 (1991)) and Hoogenboom et al. (Rev. Tr. Transfus, Hemobiol 36, 19 (1993)). Antibody fragments are prepared according to the state of the art, for example in the manner described by Winter et al. (Nature 349, 293 (1991)), Hoogenboom et al. (Rev. Tr. Transfus, Hemobiol..36, 19 (1993), Girol, Mol.Immunol.28, 1379 (1991) or Huston et al., Int.Rev. Immunol., 10, 195 (1993). of recombinant antibodies can be prepared directly from existing hybrid ace, or can be isolated from libraries of murine or human antibody fragments using phage display technology (Sith, Science 228, 1315 (1985)) (Winter et al., Annu.Rev. Immunol., 12, 433 (1994). )). These antibody fragments are then used directly at the genetic level for further manipulations (eg fusion with other proteins). In order to prepare recombinant antibody fragments from hybridomas, the genetic information encoding the antigen binding domains (VH, VL) of the antibodies is obtained by isolation of the rtiRNA, reverse transcription of the RNA in cDNA and subsequent amplification using the polymerase chain reaction (Saiki et al., Science 230, 1350 (1985)) and oligonucleotides that are complementary to the 5f and 3 'ends, respectively, of the variable fragments (Orlandi et al., PNAS-USA J36, 3833 (1989)). The VH and VL fragments are then cloned into bacterial expression vectors, for example in the form of Fv fragments (Skerra and Plückthun, Science 240, 1038 (1988), single chain Fv fragments (sc-Fc) (Bird et al. ., Science 242, 423 (1988), Huston et al., PNAS-USA 85, 5879 (1988)) or as Fab fragments (Better et al., Science 240, 1041 (1988)). antibodies directly from libraries of antibodies (immunological libraries, native libraries) of murine or human origin, using phage display technology In the phage display of antibody fragments, the antigen binding domains are cloned as protein fusion with the g3P coating protein of filamentous bacteriophages, either in the phage genome (McCafferty et al., Nature 348, 352 (1990)) or in phagemid vectors (Breitling et al., Gene 104, 147 (1991)) in the form of scFv fragments (McCafferty et al., Nature 348, 552 (1 990)) or as Fab fragments (Hoo-genboom et al. (Nucí, Acid Res. 19, 4133 (1991), Barbas et al., PNAS-USA 88, 7978 (1991)). The antigen-binding phages are selected in plastic containers loaded with antigen (panning) (Marks et al., J. Mol. Biol. 222, 581 (1991)), in paramagnetic spheres conjugated with antigens (Hawkins et al., J Mol. Biol. 226, 889 (1992)) or by binding to cell surfaces (Marks et al., Bio / Technol.1_1, 1145 (1993)). Immunological libraries can be prepared by PCR amplification of the variable antibody fragments from the B lymphocytes of immunized animals (Sastry et al., PNAS-USA 86, 5728 (1989), Ward et al., Nature 341, 544 (1989), Clakson et al., Nature 352, 624 (1991) or patients (Mullinax et al., PNAS-USA 87, 8095 (1990), Barbas et al., PNAS-USA 8_8, 7978 (1991 )). For this, combinations of oligonucleotides are used that are specific for murine immunoglobulin genes (Orlandi et al., PNAS-USA 86, 3833 (1989), Sastry et al., PNAS-USA 86, 5728 (1989) or human ( Larrick et al., BBRC 160, 1250 (1989)) or for the human immunoglobulin gene families. {Marks et al., Eur. J. Immunol., 21, 985 (1991)). Native libraries can be prepared using non-immunized donors as a source of immunoglobulin genes (Marks et al., J. Mol. Biol. 222, 581 (1991)). Alternatively, germline genes of the immunoglobulin can be used to prepare repertoires of isynthetic antibodies, the region of determination of the complementarity 3 of the variable fragments being amplified by PCR using degenerate primers (Hoogenboom and Winter, J. Mol. Biol. 227, 381 (1992), Barbas et al., PNAS-USA 89, 4457 (1992), Nissim et al., EMBO J.. 13, 692 (1994), Griffiths et al., EMBO J. 13, 3245 (1994)). These so-called "single-pot" libraries have the advantage, in comparison to immu- no-logical libraries, that fragments of antibodies against a greater number of antigens can be isolated from a single library (Nissim et al., EMBO J. 13 , 692 (1994)). The affinity of antibody fragments can be further increased by using phage display technology, new libraries being prepared from existing antibody fragments by random mutagenesis (Hawkins et al., J. Mol. Biol. 226, 889 (1992), Gra et al., PNAS-USA 89, 3576 (1992)), based on codons (Glaser et al., J. Immunol., 1_49, 3903 (1992)) or site-directed (Balint and Larrick, Gene 137, 109 (1993)), by redistributing chains of individual domains using fragments from native repertoires (Marks et al., Bio / Technol. 10, 779 (1992) or using bacterial mutant strains (Low et al., J. Mol. Biol. 260, 359 (1996)), and antibody fragments having improved properties are isolated by reselection under constrained conditions (Hawkins et al., J. Mol. Biol. 226, 889 (1992)) In addition, fragments of murine anti-bodies can be humanized by replacing one of the variable domains with a human repertoire doing it in stages, and then selecting with the original antigen (guided selection) (Jespers et al., Bio / Technol. _12, 889 (1994)). Alternatively, the murine antibodies can be humanized by specific replacement of the hypervariable regions of human antibodies with the corresponding re-gions of the original murine antibody (Jones et al., Nature 321, 522 (1987)). Within the context of the present invention, the TS ligand may also be a shell protein, or a pair of envelope protein from viruses that specifically bind selected cells by means of their envelope protein. The choice of the TS ligand depends on the target cell that is to be transduced with the gene construct. Examples of ligands useful for the invention include substances that: activate endothelial cells, macrophages and lymphocytes; they bind to muscle cells, hematopoietic cells, synovial cells and inflammatory cells; they bind to cells that are infected with viruses; they bind to tissue cells such as liver cells; they bind to glia cells; and that they bind to leukemic cells. Some representative members of these ligands are summarized here.

Ligands TS for activated endothelial cells. Within the meaning of the invention, these ligands include antibodies or antibody fragments that are directed against membrane structures of endothelial cells, as described, for example, by Burrows et al. (Phar ac. Ther 6_4, 155 (1994)), Hughes et al. (Cancer Res. 49, 6214 (1989)) and Maruyama et al. (PNAS-USA 87, 5744 (1990)). In particular, these ligands include antibodies against VEGF receptors. The TS ligands also include all active compounds that bind to membrane structures or membrane receptors in endothelial cells. For example, these ligands include mannose-containing substances in a terminal position, and, in addition, IL-1 or growth factors, or their fragments or partial sequences thereof, that bind to receptors that are expressed by endothelial cells such as PDGF, bFGF, VEGF or TGFβ (Pusztain et al., J. Pathol. 169, 191 (1993)).

The TS ligands also include ligands for LDL receptors, for example for the LDL receptor acetylated LDL receptor oxidized to the receptor protein associated with LDL (LRP), for the glycoprotein of 88 kDa and for the Fc receptor for IgG . Ligands of this nature have already been described in detail in the literature. The TS ligands further include adhesion molecules that bind to activated and / or proliferating endothelial cells. Adhesion molecules of this nature, such as Slex, LFA-1, MAC-1, LECAM-1, VLA-4 or vitronectin, have already been described (reviews in Augustin-Voss et al., J. Cell. Biol. 119, 483 (1992), Pauli et al., Cancer Metast, Rev. 9, 175 (1990) and Honn et al., Cancer Metast, Rev. 11, 353 (1992)). Dentror.del meaning of this invention, the TS ligand includes, in particular viral glycoproteins coating having tropism for endothelial cells: Examples of these viruses are: filoviruses, for example Marburg virus with its coat proteins GP (glycoprotein) and sGP (second glycoprotein) or Ebola virus in each case with its coat proteins GP and sGP, cytomegalovirus in particular with its gB protein, herpes simplex virus type I, HIV-1 virus, measles virus, Hantaan virus, alpha -viruses such as Semliki Forest virus, epidemic hemorrhagic fever virus, polio virus, and enterovirus such as ECHO 9, ECHO 12 or Coxsackie B3.

Ligands TS for activated macrophages and / or activated lymphocytes. Within the meaning of the invention, a ligand can include a substance that specifically binds to the surface of an immune cell. Such substances include antibodies or antibody fragments that are directed against membrane structures of immune cells, such as those described, for example, by Powelson et al., Bio-tech. Adv. 11, 725 (1993). The TS ligands further include all ligands for LDL receptors, as already described above. The TS ligands also include antibodies or fragments of monoclonal or polyclonal antibodies that bind, by their variable part of binding with the antigen, to Fc receptors. or Fc-e or Fc-μ in immune cells (Rojanasakul et al., Pharm. Res. 11, 1731 (1994)). These ligands also include the Fe fragment of the human monoclonal or polyclonal immunoglobulin. Fe fragments of this nature are prepared, for example, by means of genetic manipulation using recombinant DNA or according to the methods of Haupt et al., Klin. Wschr. 47, 270 (1969), Kranz et al., Dev. Biol. Standard 44_, 19 (1979); Fehr et al., Adv. Clin. Pharmac. 6, 64 (1974), Menninger et al., Immuno-chem. 13, 633 (1976). The TS ligands further include all substances that bind to membrane receptors on the surface of immune cells. These ligands include cytokines such as IL-1, IL-2, IL-3, IL-4, IL-6, IL-10, TNF-α, GM-CSF and M-CSF, and also growth factors such as EGF. , TGF, FGF, IGF or PDGF, or their fragments or partial sequences thereof, which bind to receptors that are expressed by immune cells. The TS ligands further include adhesion molecules and other ligands that bind to membrane structures of the cell, for example the 6-phosphate bone receptor in macrophages in the spleen, liver, lung and other tissues. A selection of these ligands and membrane structures has been reviewed by Perales et al., Eur. J. Biochem. 226, 255 (1994). Within the meaning of this invention, the TS ligands also include envelope glycoproteins of those viruses that have tropism by lymphocytes and / or macrophages. Examples of these viruses that infect macrophages are: HIV-1, in particular those strains that possess mutations in the V3 region of gpl20, which mutations lead to increased binding with macrophages, HIV-2, Hanta virus, for example, Punmala virus , cytomegalovirus, respiratory syncytial virus, herpes simplex virus and filovirus. Examples of viruses that infect lymphocytes are: varicella zoster virus (VZV), herpes virus 6 (HHV-6), rabies virus, HIV-1, HTLV-II, HTLV-I, influenza C virus because influenza virus C bind, through hemagglutinin fusion protein esterase (HEF), the N-acetyl-ß-ace-tilneuramínico (Neu 5,9 Ac), which occurs in B lymphocytes, and preferably, to a lesser or greater degree, in T lymphocytes; Influenza C viruses that possess a mutation at the position of nucleotide 872 (which encodes position 284 of the amino acid sequence of the HEF), for example the replacement of threonine with isoleucine, because the surface protein HEF I possesses this mutation has an affinity for the N-aoethyl-9-O-acetylneuraminic acid receptor markedly stronger than the wild-type virus; Influenza C virus HEF cleavage products containing the structure for N-acetyl-9-β-acetylneuraminic acid binding because this binding structure is defined by the catalytic triad serine 71, histidine 368 or 369 and aspartic acid 261; Epstein-Barr virus because EBV infects B cells, herpes simplex virus 2, because HSV-2 infects T cells, and measles virus. I Ligands TS for muscle cells. Ligands that bind to muscle cell surfaces include, for example, antibodies or antibody fragments that are directed against membrane structures of muscle cells, in particular of smooth muscle cells. Examples of antibodies of this nature are: antibody 10F3, antibodies against actin, antibodies against angiotensin II receptors or antibodies against receptors for growth factors or antibodies that are directed, for example, against EGF receptors, or against PDGF receptors, or against FGF receptors or antibodies against FGF or antibodies against endothelin A receptors. The TS ligands further include all active substances that bind to membrane structures or membrane receptors in muscle cells. These ligands include, for example, growth factors, or fragments thereof or partial sequences thereof, which bind to receptors that are expressed by smooth muscle cells, for example: PDGF; EGF; TGFβ; TGFa; FGF and endothelin A. Within the meaning of this invention, the TS ligands also include envelope glycoproteins from those viruses that have tropism by muscle cells. These viruses include cytomegalovirus, for example.

Ligands TS for hematopoietic cells. The TS ligands include antibodies or antibody fragments that are directed against receptors that are expressed in relatively undifferentiated blood cells. Antibodies of this nature have been described, for example, for the following receptors: stem cell factor receptor, IL-1 receptor (type I), IL-1 receptor (type II), IL-3 receptor, IL-1 receptor -3, IL-6 receiver and GM-CSF receiver. The TS ligands further also include antibodies or fragments of monoclonal or polyclonal antibodies that bind, by their constant domains, to Fc receptors. in immune cells. The TS ligands also include all substances that bind membrane structures or membrane receptors on the surface of relatively undifferentiated blood cells. These ligands include, for example, growth factors such as SCF, IL-1, IL-3, IL-6 and GM-CSF, or their fragments or partial sequences thereof, which bind to receptors that are expressed by cells. blood Ligands TS for synovial cells and inflammatory cells. These ligands include antibodies or fragments of monoclonal or polyclonal antibodies that bind, by their variable domains, to membrane structures of synovial cells or inflammatory cells. Examples of such membrane structures are vimentin, fibronectin and Fe receptors. These ligands also include antibodies or fragments of monoclonal or polyclonal antibodies that bind, by their constant domains, to Fe receptors. In addition these ligands-two include all compounds active substances that bind to membrane structures or membrane receptors in synovial cells. These include, for example, cytokines or growth factors, or their fragments or partial sequences thereof, which bind to receptors that are expressed by synovial cells, for example IL-1-RA, TNFa, IL-4, IL- 6, IL-10, IGF and TGFβ. In addition these ligands include TS ligands whose essential constituent is terminal mañosa, which binds to I receptors of mannose 6-phosphate in macrophages.

Ligands TS for cells that are infected with viruses. A TS ligand can also be an antibody or antibody fragment that is directed against a viral antigen that is expressed on the cell membrane of cells infected with virus. Antibodies of this nature have been described, for example, for cells that have been infected with the HBV, HCV, HSV, HPV, HIV, EBV and HTLV viruses.

Ligands TS for liver cells and other tissue cells. The TS ligands include all substances that bind to membrane structures or membrane receptors on the surface of liver cells. These ligands include, for example, growth factors such as cytokines, EGF, TGF, FGF or PDGF, or their fragments or partial sequences thereof, which bind to receptors that are expressed by cells of this nature. These ligands further include TS ligands that bind to cell membrane structures that are selective for particular tissues. Examples are: Table 1: These ligands and membrane structures have been reviewed in Perales et al., Eur. J. Biochem. 226, 255 (1994).

Within the meaning of the invention, the TS ligands include, in particular, envelope glycoproteins from viruses having selective cell tropism, for example glycoproteins from respiratory syncytial viruses for bronchial epithelial cells, glycoproteins from hepatitis C virus. , filovirus, hepatitis B virus and hepatitis D virus for liver cells. For example, the liver cells are bound to Marburg virus by means of the asialoglycoprotein-tein receptor, or the liver cells are bound, preferably via the asialoglycoprotein receptor, to the preS2 and preSl domains of HSV. Another example is hepatitis B virus glycoproteins for hepatic sinusoidal cells, because HBV binds by means of fibronectin.

Ligands TS for glia cells. These ligands include antibodies or anti-block fragments that are directed against glia cell membrane structures, as has been published, for example, by Mirsky et al., Coakham et al. and McKeever et al. These membrane structures also include neural adhesion molecules such as N-CAM, in particular their polypeptide C chain. These ligands also include all active compounds that bind to membrane structures or membrane receptors in glia cells. For example, these ligands include substances that carry mannose in the terminal position and that bind to the receptor of mannose 6-phosphate, insulin and growth factor-like insulin and PDGF, and those fragments of these growth factors that bind to the relevant membrane receptors. Within the meaning of the invention, the TS ligands include, in particular, envelope glycoproteins of those viruses that have glia cell tropism. Examples of these viruses are the HIV-1 subtype JRF 1 and herpes simplex virus I.

Ligands TS for leukemic cells. These ligands include antibodies or antibody fragments that are directed against membrane structures in leukemic cells. A large number of monoclonal antibodies of this nature have already been described for diagnostic and therapeutic methods (reviews in Kristensen, Danish Medical Bulletin 41, 52 (1994), Schranz, Therapy Hun-garica 38, 3 (1990), Drexler et al. , Leuk, Res. 10, 279 (1986), Naeim, Dis. Markers 7, 1 (1989), Stickney et al., Curr. Opin. Oncol, 4, 847 (1992), Drexler et al., Blut 57 , 327 (1988), Freedman et al., Cancer Invest. 9, 69 (1991)). The following monoclonal antibodies, or their antigen-binding antibody fragments, are suitable for use as ligands, depending on the type of leukemia: (1) for AML cells, membrane antigens CD13, CD14, CD15, CD33, CAMAL, sialosil -You; (2) for B-CLL membrane antigens CD5, CDlc, CD23, idiotypes and isotypes of membrane immunoglobulins; (3) for T-CLL membrane antigens CD33, M38, IL-2 receptors, T cell receptors; (4) for ALL membrane antigens CALLA, CD19, non-Hodgkin's lymphoma. I The TS ligands further include all active compounds that bind to membrane structures or membrane receptors of leukemic cells. These ligands include, for example, growth factors, or their fragments or partial sequences thereof, which bind to receptors that are expressed by leukemic cells. Growth factors of this nature have already been described (reviews in Cross et al., Cell 64 ^, 271 (1991); Aulitzky et al., Drugs 48, 667 (1994); Moore, Clin. Cancer Res. I, 3 (1995); and Van Kooten et al., Leuk. Lymph. 12, 27 (1993)). Examples are: IFNa in the case of lymphomas not of Hodgkin; IL-2, particularly in the case of cell-leukemia T; FGF in the case of T cell leukemia, monocytic, myeloid, erythroid and megakaryoblastic; TGFβ in the case of leukaemias, and retinoids, for example retinoic acid, in the case of acute promyelocytic leukemia.

Ligands TS for tumor cells. These ligands include antibodies and fragments of these antibodies that are directed against membrane structures in tumor cells. Antibodies of this nature have been reviewed, for example, by Sedlacek et al., Con-trib. to Oncol. _3_2, Karger Verlag, Munich (1988) and Contrib. to Oncol. 43, Karger Verlag, Munich (1992).

Other examples are antibodies against: sialyl Lewis, tumor peptides that are recognized by T cells, proteins that are expressed by oncogenes, gangliosides such as GD3, GD2, GM2, 9-0-acetyl GD3 and Fucosyul GM1, blood group antigens and its precursors, antigens in polyp epithelial mucin and antigens in heat shock proteins.

The linker The choice of linker depends on the chemical nature of the TS ligand and the GS ligand, and of the method used to connect the ligand TS and the ligand GS with each other by means of the linker. If the ligands are peptides or proteins, a peptide or a protein is preferably used as a linker, and the linker is preferably connected to the TS ligand and the GS ligand via a peptide bond. Ligand TS-linker-ligand GS or TS-ligand GS-linker molecules of this nature are preferably prepared as fusion proteins using recombinant DNA technology. Generally, an advantageous linker will be a substance of endogenous origin or it will resemble an endogenous substance to limit its immunogenicity. If the TS ligand is not a peptide or a protein, the linker, in its simplest form, is then a structure that connects the TS ligand to the GS ligand. Structures of this nature result from the different chemical conjugation methods used to link molecules to amino groups, hydroxyl groups, SH groups, carboxyl groups or aldehyde groups in proteins (for a review of the methods, see Sedla-cek et al. , Contrib to Oncol 32, 42-49 and 81-85, Karger Verlag, Munich (1988)). The linker and the ligand GS can also be themselves, in each case, a peptide or a protein. In this case, the connection between the two is preferably effected by means of a peptide bond, and the connection to the linker using one of the chemical conjugation methods. This is valid, in particular, in the case of embodiment c) of the invention. The choice of the linker also depends on the nature of the gene construct that is linked by the ligand GS. If the gene construct is a naked RNA or a naked DNA, either alone or in a complex with a non-viral vehicle, the linker is preferably a molecule that has fusogenic properties. These fusogenic properties facilitate the passage of the gene construct through the cellular membrane and away from the lysosomes into the cytoplasm. If the gene construct is a virus, then a molecule having fusogenic properties can be selected as a linker. Within the meaning of this invention, it is preferable to make use of a linker having fusogenic properties. The fusogenic properties of the linker can compensate for the deterioration of the fusogenic properties of the virus coat proteins, which is due to the GS ligand that is binding to the virus, or to increase the fusogenic properties of the virus coat proteins. Within the meaning of this invention, viral or bacterial peptides or proteins as well as synthetic peptides (for example those that form a helices in the acidic environment of the endosome) are used as linkers having fusogenic properties. Examples of molecules that have fu-sogenic properties are: peptides containing the translocation domain (domain III) of Pseudomonas exotoxin A (Wels et al., Cancer Res. 52, 6310 (1992)); Fominaga et al., J. Biol. Chem. 271, 10560 (1996)), peptides containing the GLFEALLELLESLWELLLEA peptide (SEQ ID NO: 1) (Gottschalk et al., Gene Ther. 3, 448 (1996)). ), peptides containing the peptide AALAEA [LAEA] 4LAAAAGC (SEQ ID NO: 2)) (Wang et al., Technol Advances in Vector Syst. For Gene Ther., 6-7 May, 1996, Coronado, IBC Conference), peptides containing the peptide FAGWLAGAALGVAAAAQI (SEQ ID NO: 3) of the measles virus fusion protein (Yeagle et al., Biochem Biophys, Acta 1065, 49 (1991)), peptides containing the peptide GLFGAIAGFIEGGWWGMIDG (SEQ ID NO: 4) of the HA2 protein of influenza A (Lüneberg et al., J. Biol. Chem. 270, 27606 (1995), peptides containing the peptide GLFGAIAGFIENGWEG-MIDGGLFGAIAGFIENGWEGMIDG (ID SEQ.NO: 5) (Burger et al., Biochem. 30, 11173 (1991) or the peptide GLFGAIAGFIE; (SEQ ID NO: 6), ALFGAIAGFIE; (SEQ ID NO: 7) , LFLGAIAGFIE; (SEQ ID NO: 8), LLLGAIAGFIE; (SEQ ID NO: 9), LILGAIAGFIE; (SEQ ID NO: 10), GIFGAIAGFIE; (SEQ ID NO: 11), GLLGAIAGFIE; (SEQ ID NO: 12), GLFAAIAGFIE; (SEQ ID NO: 13), GLFEAIAGFIE; (SEQ ID NO: 14), GLFGAMAGFIE; (SEQ ID NO: 15) GLFGAIAGLIE (SEQ ID NO: 16) or peptide GLFGAIAGFIV (SEQ ID NO: 17) (Steinhauer et al., J. Virol. 69, 6643 (1995 )) or the peptide GLFEAIAEFIEGGWEGLIEG (SEQ ID NO: 18) or the peptide GLLEALAE-LLEGGWEGLLEG (SEQ ID NO: 19) (Ishiguro et al., Biochem 32 9792 (1993)). Within the context of the present invention, use is also made of virus proteins possessing fusogenic properties. Several viruses possess fusogenic coating proteins, examples being paramyxoviruses, retroviruses and herpesviruses (Gaudin et al., J. Gen. Virol. 7_6, 1541 (1995)). Several viruses also possess glycoproteins that are responsible for both the adhesion of the virus and the subsequent fusion in the cell membrane (Gaudin et al., J. Gen. Virol 7_6, 1541 (1995)). Proteins of this nature are formed, for example, by alphaviruses, rhabdoviruses and ortho-myxoviruses. Fusogenic viral proteins within the meaning of the invention have been reviewed by Hughson, Curr. Biol. 5, 265 (1995); Hoekstra, J. Bioenergetics Biomembranes 22, 675 (1990); White, Ann. Rev. Physiol. 52, 675 (1990)). Examples of fusogenic proteins within the meaning of this invention are: the hemagglutinin of influenza A or influenza B viruses, in particular the HA2 component, the M2 protein of influenza A viruses, used either alone or in combination (Ohuchi et al., J.Virol., 68, 920 (1994)) with influenza hemagglutinin or with influenza A neuramidinase mutants lacking enzymatic activity but which, nevertheless, elicit haemagglutination, Peptide Analogs of Influenza Virus Hemagglutinin, HEF Protein of Influenza C Virus The fusion activity of the HEF protein is activated by cleavage of HEFO in the subunits HEF1 and HEF2, the transmembrane glycoprotein of filovirus, for example of Marburg virus and Ebola virus, the transmembrane glycoprotein of rabies virus, the transmembrane glycoprotein (G) of the vesicular stomatitis virus, the fusion protein of the HIV virus, in particular the gp41 component and its fusogenic components, the fusion protein of the Sendai virus, in particular the 33 amino-terminal amino acids of the Fl component, the transmembrane glycoprotein of the Semliki Forest virus, in particular the El component, the transmembrane glycoprotein of the transmitted encephalitis virus by mites, the human respiratory syncytial virus (RSV) fusion protein (in particular the gp37 component), the fusion protein (protein S) of the hepatitis B virus, the measles virus fusion protein, the protein of fusion of the Newcastle disease virus, the visna virus fusion protein, the murine leukemia virus fusion protein (in particular pl5E), the HTL virus fusion protein (in particular gp21) and the fusion protein of the simian immunodeficiency virus (SIV). The viral fusogenic proteins are obtained by dissolving the coating proteins of a viral concentrate with the help of detergents (such as β-D-octylglucopyranoside) and separating them by centrifugation., as reviewed by Mannio et al., BioTechniques 6, 682 (1988), or even by means of molecular biology methods that are known to the experts. Examples of the preparation of fusogenic proteins have been described, for example, for influenza hemagglutinin, fusogenic fragments of influenza hemagglutinin, M2 protein of influenza B, HEF protein of influenza C, transmembrane glycoprotein of filoviruses, for example Marburg vi-rus and Ebola virus, the transmembrane glycoprotein of rabies virus, the transmembrane glycoprotein of vesicular stomatitis virus, the transmembrane glycoprotein of Semliki Forest virus, the transmembrane glycoprotein of encephalitis virus transmitted by mites, and the transmembrane glycoprotein of the HIV-1 virus.

THE SPECIFIC LIGAND OF GENIUS CONSTRUCTION. Within the context of the present invention, the ligand GS is a structure that binds directly or indirectly to the gene construct and contains a whole antibody molecule or an epitope-binding fragment of an antibody. The murine monoclonal antibodies are preferably used in humanized form to limit their immunogenicity. As already described in the section entitled "Description of the TS ligand", this humanization is carried out in the manner indicated by Winter et al. (Nature 349, 293 (1991)) and Hoogenboom et al. (Rev. Tr. Transfus, Hemobiol 36, 19 (1993)). The fragments of antibodies and recombinant Fv fragments are prepared according to the state of the art, and as already described in the section entitled "Description of the ligand TS". The use of a bivalent or a monovalent fragment depends on the choice of antibody specificity and gene construct. A monovalent antibody fragment is preferred if the chosen antibody impairs the fusion activity of the coat protein of a viral gene construct (as described, for example, Ubol et al., J. Virol. 69, 1990 (1995)). The specificity of the antibody depends on the nature of the gene construct used. If the gene construct is a naked RNA or a naked DNA, either alone or in complex with a non-viral vehicle, one of the new embodiments of this invention is that the specificity of the anti-body is directed against those epitopes that have been introduced in the DNA Epitopes of this nature can be generated by one or more modifications of the DNA, with or without the introduction of a foreign group (xenogenic substance). Examples of this include crosslinking the DNA with cisplatin, alkylating the N7 from guanine with an alkylating agent such as nitrogen mustard, melphalan or chlorambucil, sandwiching an anthracycline, such as doxorubicin or daunomycin, into the DNA double helix. Examples of monoclonal antibodies with specificity for binding against a modified DNA epitope include antibodies directed against methylated DNA, 06-ethyldeoxyguanosine (after treating the DNA with ethylnitrosourea), N7-ethylguanine, Ns-methyl-N5 -formyl-2, 5,6-triamino-4-hydroxypyrimidine, 06-isopropylp-2'-deoxyguanosine, 04-methyl-2'-deoxythymidine, 04-ethyl-2'-deoxythymidine, addition products of melphalan and DNA and anthracyclines. Some useful epitopes in this context are those created by DNA methylation during DNA metabolism. It is known that strains of E. coli methylate plasmid DNA that has been introduced into the bacterium. Methylation occurs in the N6 position of adenine (Winnacker, From Genes to Clones, page 18/19, VCH Publisher, Weinheim (1987).) Bacteria possess the enzyme DNA adenine ethylase, which methylation specifically adenines in the N6 position during replication (Hattman et al., J. Mol. Biol. 126, 367 (1978).) Accordingly, this invention is related in particular to the use of monoclonal antibodies against methylated DNA and more specifically against N6 of methylated adenine, in The new ligand system If the gene construct is complexed with a non-viral vehicle, another particular embodiment of this invention is that the specificity of the antibody is directed against an epitope in the vehicle These vehicles include cationic polymers, peptides, proteins, polyamines or cationic lipids such as cationic lipids and phospholipids Examples of antibodies against vehicles of this nature are antibodies against spermidine, spermine, putrescin a, polylysine, albumin and phospholipid. If the gene construct is a virus, the specificity of the antibody is directed against one or more epitopes identical or different from a viral coat protein. Since the linker in the ligand system used is preferably a fusogenic peptide or protein, antibodies that impair cellular adhesion and / or fusogenic activity of the virus can also be used by binding to the coating protein. Examples of antibodies against virus coating proteins, which can be used as vectors, are antibodies against the murine leukemia virus, in particular against the coating proteins gp70 and pl5, HIV virus, adeno-virus, herpes simplex virus, in particular against glycoprotein B, glycoprotein H, glycoprotein L and glycoprotein D of this virus, cytomegalovirus, in particular against glycoprotein B (gpB), minute mouse virus, adeno-non-associated virus, in particular against cap and rep proteins, Sindbis virus, in particular against the E2 or E protein of the envelope and smallpox virus. In another advantageous embodiment of the invention, the ligand GS is the part of a Fe receptor that is outside the cell. One of the aforementioned antibodies, which binds directly or indirectly by its binding part with the antigen to the gene construct, binds to this Fe receptor via its Fe part. In another advantageous embodiment, the GS ligand is a unit Cationic structural, such as a cationic amino acid, a cationic peptide or protein or a biogenic amine, which can be complexed are the gene construct. Examples of these cationic structural units include lysine, polylysine, arginine, polyarginine, histidine, polyhistidine, peptides containing at least 1 potassium, 1 arginine and / or 1 histidine, and polyamines such as cadaverine, spermidine, spermine, agmatine or putrescine In another advantageous embodiment, the ligand GS is a receptor for the coat protein of the virus harboring the transgene. Receptors of this nature have been described, for example, for the following viruses: HIV concerning the CD4 molecule (soluble or native) and galactosylcera-mida, HBV concerning the IL-6 receptor and annexin or apolipoprotein, HTLV concerned to receptor IL-2 (β and β chains), measles virus relative to CD46 molecule, Friend leukemia virus concerning erythropoietin receptor, Varicella Zoster relative to fragment Fe of human immunoglobulin G, Sendai virus concerning glycophorin, influenza C virus concerning N-acetyl-9-acetamido-9-deoxineuraminic acid and 9-O-acetyl-N-acetylneuramin, ico, foot-and-mouth disease virus concerning integrin aVß3, EBV concerned to receptor 2 of the complement (CD21) and herpes simplex virus concerning the receptor of the mannose 6-phosphate of 275 kD or the receptor of the mannose 6-phosphate of 46 kDa.

THE LINKER AS A COMPLEX ("CONNECTOR") OF AT LEAST TWO MOLECULES. Within the meaning of the special embodiment c) of the invention, the connector is a special type of linker comprising at least two molecules or components. One of the molecules or components of the linker binds to at least one specific ligand of the gene construct, and another molecule or component of the linker binds to at least one specific ligand of the target cell. The complex further advantageously comprises at least one other "optional linker". The optional linker can be a fusogenic peptide. In case of more than one linker, the optional linker may be chemically identical or different. The fusogenic peptide facilitates the entry of nucleic acid into the target cell. Another optional linker in this context can be a signal producing substance such as a radioactive isotope, to allow quantitative determination of the complexes entering the cells. An advantageous example of a linker is the hinge region of an antibody, by means of which the two heavy chains of the antibody are connected to each other (Burbon, TIBS 15, 64, (1990); Oi et al., Nature 307, 136 ( 1984), Alt et al., Science 238, 1079 (1987), Lorenz, graduation speech: Kons-truktion und Expression von rek.Antikorper-Enzym-Hybridmole-külen für die Tumortherapie [Construction and expression of hybrid molecules antibody rec. / enzyme for tumor therapy], Faculty of Human Medicine, University of Marburg (1991). A new distribution of the hinge region is represented, for example, in diagram cl) of Figure 2. The hinge region is preferably connected to the linkers and the GS and TS ligands by means of peptide bonds, in the form of a fusion protein, which fusion protein is prepared using recombinant DNA techniques. Another example of a linker is the Gal80 protein (Leuther et al.j Science 256, 1333 (1992)) in combination with the do-bond of Gal80 binding of Gal 4 (Leuther et al., Science 256, 1333 (1992)). ) according to diagram c2) of Figure 3. The following examples are presented by way of illustration and not by way of limitation, and indicate the construction of a multifunctional system as depicted in Figure 4.

EXAMPLE ONE Preparation of a TS ligand. The hybridoma of the anti-NCAM monoclonal antibody 575/100 / 2 is used as the starting material for the TS ligand (Jaques et al., Cancer 72, 418 (1993)). Approximately 101 cells of this hybridoma are separated by centrifugation and the mRNA is extracted from these cells using the Pharmacia mRNA extraction ki t. This mRNA is then transcribed into cDNA by reverse transcription using a ki t synthesis of random cDNA and hexaoligonucleotides (from Pharmacia). This cDNA serves as a starting material for amplifying the variable heavy chain or the variable light chain of the immunoglobulin by means of the polymerase chain reaction (Saiki et al., Science 230, 1350 (1985)) using specific primers (Clackson et al. al., Nature 352, 624 (1991)). At the same time, the primers introduce restriction cleavage sites to clone the fragments in the bacterial expression vector pHENIS (which is derived from pHENl).; Hoogenboom et al., Nucí. Acids Res. 19, 4133 (1991); see Figure 5). This vector contains a pelB signal sequence for peri-plasmic secretion, a myc tag for detection with monoclonal antibody 9E10, a histidine tag for purification by means of immobilized metal affinity chromatography (IMAC) , as well as a cloning region for the heavy and light chains and a short sequence encoding a glycine-serine linker of 14 amino acids in length. In addition, fusion with the g3ß protein is carried out in order to appear on the surface of bacteriophages. The light and heavy chains are digested with the appropriate restriction enzymes (VH with Sfil and Shol; VL with Apa-LI and Notl) and cloned one after the other into the vector. This results in a recombinant single chain Fv fragment comprising the light chain and variable heavy chain, which are covalently linked by means of a short peptide sequence.

EXAMPLE TWO Preparation of a GS ligand. Recombinant antibodies possessing specificity for N6-methyladenine (from Sigma) are selected from native or semisynthetic antibody libraries (Nissim et al., EMBO J. 13, 692 (1994)), as described, by biopanning in N6-methyladenine-BSA or N6-methyladenine-thyroglobulin conjugates (Beiser et al., Methods Enzymol, XII, 889, 1968)). Positive antibody fragments are identified by ELISA on microtitre plates coated with antigen (Nissim et al., EMBO J. 13, 692 (1994)). Antibodies from these libraries are already in the desired single chain Fv format and can be employed directly for subsequent cloning.

EXAMPLE THREE Preparation of a linker. A fusogenic peptide having the amino acid sequence GLFEALLELLESLWELLLEA (SEQ ID NO: 1, Gottschalk et al., 1996) is used as the linker. The DNA encoding this peptide I is prepared as a double-stranded synthetic oligonucleotide, with suitable rescission cleavage sites (AscI and Xbal) being coupled at the ends. For this, the two synthetic oligonucleotides 01 (5'GGCCGCAGGCTTATTTGAGGCCCTTCTGGAAT- TGCTAGAGAGCCTCTGGGAATTGCTTCTGGAGGCAT, SEQ ID NO: 20) and 02 (5 'CTAGATGCCTCCAGAAGCAATTCCCAGAGGCTCTCTAGCAATTCCAGAAGGGCCTC-AAATAAGCCTG, SEQ ID NO: 21) are phosphorylated using T4 polynucleotide kinase (from Gibco) according to the manufacturer's instructions, heated at 80 ° C for 5 minutes and then slowly cooled to room temperature. This double-stranded DNA fragment is used directly for subsequent cloning.

EXAMPLE FOUR Preparation of a multifunctional ligand. The entire ligand system is prepared in the expression vector pAB1 (which is constructed similarly to pHE-NIS but does not include the fusion with g3p, see Fig. 5) in the form of a cloning into 3 fragments. The Fv chain fragment, simple anti-NCAM (TS ligand), which was cut with the restriction enzymes Sfil and Notl, the linker, which contains the cloning sites Notl and Xbal, and the single chain Fv fragment anti -N6-methyladenine (ligand GS), are used as starting material. For cloning, the GS fragment is reamplified using primers that insert the restriction cleavage sites Xbal and AscI and the term N and the term C, respectively. These fragments are cloned into the vector pAB1 that has been cut with the restriction enzymes Sfil and Ascl. The construction is transformed into the TG1 bacterial strain. The expression of the ligand system is regulated by means of the bacterial lacZ promoter, and is induced by adding isopropyl-β-D-thiogalactoside (IPTG) (as described in McCafferty et al., Appl. Biochem. Biotech 47, 157 (1994)). the expressed protein is purified from periplasmic preparations by means of IMAC according to the method of Griffi, ths et al. ', EMBO J. 13, 3245 (1994). The total protein has a macular weight of approximately 55,000 daltons and is presented as a monomer.

EXAMPLE FIVE Functional test of the multifunctional ligand. Tumor cells expressing NCAM (small cell bronchial carcinoma) are multiplied in a cell culture, using the cell culture technique known to the experts, and isolated. DNA that is methylated at the N6 of adenine is prepared by multiplying a plasmid (which contains the structural gene for β-glucuronidase, see patent application WO96 / 06940) in E. coli. The multifunctional ligand system is mixed with the plasmid DNA in a molar ratio of 20: 1, and the mixture is incubated at 37 ° C for 30 minutes. The binding to the plasmid DNA is checked by ELISA. The complex comprising the multifunctional ligand and the plasmid is mixed with the tumor cells in a ratio of 10: 1, and the whole is incubated at 37 ° C for 1 hour. A part of the tumor cells is washed. The binding of the complexes to these tumor cells is checked by means of immunofluorescence. The other tumor cells are incubated for a further 24 hours. Successful admission of complexes into the cell, release, linker-mediated, endosomes, and transcription and expression of the effector gene are determined by detecting the enzymatic activity of β-glucuronidase in the culture medium using 4-methylumbelliferyl- β-glucuronide as a substrate.

Claims (1)

1. CLAIMS Ia. A multifunctional system of ligands for specific transfer of the target cell, of a nucleotide sequence, comprising at least one specific ligand of the target cell, at least one specific ligand of the gene construct comprising an antibody or a portion of an antibody , and a linker that binds the two ligands, the system not being immunogenic. 2a. A ligand system according to claim Ia, further comprising a connector connecting said two ligands together, and wherein the connector comprises two linkers. 3a. A ligand system according to claims Ia or 2a, wherein said specific ligand of the target cell binds to the surface of a target cell. 4a. A ligand system according to any of claims Ia to 3a, wherein said specific ligand of the target cell is selected from the group consisting of a growth factor, a cytokine, an interferon, a tumor necrosis factor, a chemokine, a peptide hormone, an angiotensin, a quinine, a histamine, a steroid hormone, an adhesion molecule, a ligand of the VDL receptor, a ligand of the LDL receptor, an oxidized LDL receptor ligand, a protein ligand of the LDL-related receptor , an IgG Fe receptor ligand, an 88 kDa glycoprotein receptor ligand, an activated LDL receptor ligand, a megalin ligand, and a vitamin. 5a. A ligand system according to any of claims Ia to 3a, wherein said specific ligand of the target cell is an antibody or a fragment of an antibody that binds to the target cell. 6a. A ligand system according to claim 5, wherein said antibody fragment is selected from the group consisting of an F (ab) 2 fragment / Fab fragment, a double-stranded Fv fragment, a Fv fragment of sim-foot chain and a Fe fragment. 7a. A ligand system according to any of claims Ia to 3a, wherein said specific ligand of the target cell is an extracellular region of a Fe receptor that is recognized by an antibody Fe fragment. 8a. A system of ligands according to any of the claims 5a to 7a, wherein said antibody or antibody fragment is at least partially of human origin. 9a. A ligand system according to any one of claims Ia to 8a, wherein said specific ligand of the gene construct is selected from the group consisting of an antibody, a fragment of an antibody, a cationic structural unit and a receptor of a protein coating a virus. 10a. A ligand system according to claim 9, wherein said antibody fragment is selected from the group consisting of an F (ab) 2 fragment, a Fab fragment, a double chain Fv fragment and a single chain Fv fragment. 11a. A ligand system according to any one of claims Ia to 8a, wherein said specific ligand of the gene construct is an extracellular region of a Fe receptor that is recognized by an antibody Fe fragment. 12a. A ligand system according to any of claims Ia to 11a, wherein said antibody or said antibody fragment is at least partially of human origin. 13a. A ligand system according to any of claims Ia to 12a, wherein said antibody or said antibody fragment specifically binds to a nucleic acid epitope that has been introduced by attaching a xenogeneic substance to the nucleic acid, methylating the nucleic acid or alkylating the nucleic acid. 14 to. A ligand system according to any of claims Ia to 13a, wherein said antibody or said antibody fragment binds to an epitope of a non-viral vehicle. 15a. A ligand system according to claim 14, wherein said non-viral carrier is selected from the group consisting of a cationic polymer, a peptide, a protein, a biogenic amine, a polyamine, a lipid and a phospholipid. 16a. A ligand system according to any of claims Ia to 15a, wherein said antibody or said antibody fragment binds to an epitope of a viral coat protein. 17a. A ligand system according to claim 16, wherein said virus is selected from the group consisting of murine leukemia virus, HIV, adenovirus, herpes simplex virus, cytomegalovirus, mouse minute virus, adeno-associated virus, Sindbis virus and virus. of smallpox. 18. A ligand system according to claim 9, wherein said cationic structural unit comprises, alone or in combination, at least one factory moiety, at least 1 arginine, at least 1 histidine and at least 1 polyamine. 19a. A ligand system according to any of claims 2 to 18, wherein said connector comprises a covalent binding moiety to a functional moiety, the functional moiety selected from the group consisting of an amino moiety, a hydroxyl moiety, a SH moiety , a carboxyl moiety and an aldehyde moiety. 20 a. A ligand system according to any of claims 2 to 19, wherein at least one of said ligands is a phosgenetic substance. 21a. A ligand system according to claim 20, wherein said fusogenic substance is selected from the group consisting of a synthetic fusogenic peptide, a bacterial fusogenic peptide or protein, and a fusion product between a peptide or a protein and a virus. 22a. A ligand system according to any of claims 2 to 21, wherein said connector comprises the hinge region of an antibody or the Gal80 protein in combination with the Gal4 protein. 23a. A system of ligands according to claim Ia, I comprising: (a) a specific ligand of the target cell comprising an anti-NCAM recombinant single chain Fv fragment, wherein the variable light chain and heavy chain of the Fv fragment are covalently linked by means of a short peptide sequence; (b) a linker comprising a fusogenic peptide having the sequence GLFEALLELLESLWELLLEA (SEQ ID NO: 1); and (c) a specific ligand of the gene construct comprising a recombinant antibody for N6-methyladenine. 24a. A ligand system according to claim 23, further comprising a gene construct. 25a. A ligand system according to claim 24, wherein said gene construct is selected from the group consisting of a naked RNA, a plasmid, a naked nucleic acid or plasmid combined with a cationic polymer, peptide, protein or lipid, or a virus . 26a. The use of the ligand system according to any of claims Ia to 25a, for the preparation of a pharmaceutical product for preventing or treating a skin disease, a mucous membrane disease, a disease of the nervous system, a disease of internal organs , a disease of blood coagulation, a disease of the hematopoietic system, a disease of the immune system, a disease of the musculature and a disease of the sustentacular tissue or of the joints.