MXPA97006985A - Methods to prevent trombopoyetine (tpo) adsorption and stable compositions containing - Google Patents

Abstract

A composition containing TPO comprising a TPO protein that does not have a sugar chain residue and at least one pharmaceutically acceptable additive that is selected from the group consisting of proteins, cellulose derivatives, sulfated polysaccharides, surfactants, alcohol polyvinyl, macrogels and aminoacetic acid, and a method to prevent the TPO from being adsorbed on a container wall, using the aforementioned composition containing these additives, thus preventing the reduction of the titration caused by adsorption.

Description

"METHODS TO PREVENT TROMBOPOYETIN ADSORPTION (TPO) AND STABLE COMPOSITIONS CONTAINING TPO" BACKGROUND OF THE INVENTION 1. FIELD OF THE INVENTION This invention relates to a stable composition containing a TPO protein that does not have sugar chain residues, more particularly, with a stable composition containing TPO that is effective to prevent the loss or reduction of evaluation of TPO as the active component caused by its adsorption on the wall of a container, or by its association, polymerization or the like. This invention also relates to a method for preventing the reduction of a TPO titration caused by the adsorption of TPO on the wall of a container loaded with the composition. 2. EXHIBITION OF THE RELATED TECHNIQUE Human TPO (thrombopoietin) is a cloned protein as a coordinating group of Mpl that is a member of the cytokine receptor superfamily (from Sauvage et al., Nature (London) volume 369, pages 533-565 (1994); TD Bartley and others, Cell, volume 77, pages 1117 to 1124 (1994)). The Mpl coordinator groups can be detected in sera and blood plasmas of animals (e.g., the human being, mouse, dog, etc.) that produce thrombocytopenia and its association with the formation of megakaryocytes and platelets has already been confirmed. To develop a therapeutic agent to be used in the treatment of thrombocytopenia, the present inventors have purified TPO from the blood plasma rat of thrombocytopenic rats by measuring an activity that stimulates megakaryocyte production of cells highly purified megakaryocyte progenitor cells from the marrow of the rat, and have succeeded in cloning the rat TPO cDNA and the human TPO cDNA, based on their partial amino acid sequence and to obtain the homogeneous human TPO in a large amount by recombinant DNA techniques (H. Miyazaki et al., Exp. Hematol, volume 22, page 838 (1994)). The humunane TPO obtained in this way has the same amino acid sequence as the aforesaid factor obtained as the coordinating group of human Mpl (see SEQ ID NO: 1 which will be described later). The present inventors have found that the TPO of the present invention was effective for the treatment of thrombocytopenia, due to the inhibitory effect of thrombocytopenia, the thrombocytopoiesis improving effect and the hematopoietic function and it was observed that when the human TPO was administered to the mice with thrombocytopenia, where the suppression of the bone marrow has been induced by administration of a carcinostatic example or an immunosuppressant or by radiation or BMT. Due to its high activity, TPO can be used in an extremely small amount, namely it is usually administered several times a day with a dose of 0.05 microgram per kilogram of body weight to one milligram per kilogram of body weight, preferably of 0.5 microgram per kilogram of body weight up to 50 micrograms per kilogram of body weight, as the active ingredient, depending on conditions, sex and routes of administration. Therefore, it is necessary to produce pharmaceutical preparations containing TPO, using an extremely small amount of TPO but in this case, it is inevitable to cause the reduction of a TPO assessment due to the absorption of TPO in the packages (e.g. small vials, ampoules, etc.) and the loss of the TPO ingredient caused by its absorption and the infusion sets (bottles or tubes) when the preparations are mixed with an infusion liquid at the time of the infusion by drops. In the context, the present inventors have studied a stable composition containing TPO that can prevent the absorption of a TPO protein that does not have a sugar chain residue, with the aim of preventing the reduction of the TPO assessment, when the Preparation of pharmaceutical TPO occurs or when mixed with a transfusion fluid. As a result, it has now been found that the addition of a pharmaceutically acceptable protein, the cellulose derivative, sulfated polysaccharide, a surfactant source, polyvinyl alcohol, macrogol (aka: polyethylene glycol) or aminoacetic acid (aka: glycine) to the protein of TPO, is effective for this object.

COMPENDIUM OF THE INVENTION Therefore, according to the present invention, there is provided a method for the prevention in the reduction of a TPO assessment caused by the absorption of TPO in the wall of a container loaded with a composition containing TPO protein, which does not has a sugar chain residue, which comprises adding to the composition at least one pharmaceutically acceptable additive which is selected from the group consisting of proteins, cellulose derivatives, sulfated polysaccharides, surfactants (ie, surfuctants), polyvinyl alcohol , macrogoles and aminoacetic acid. The present invention also provides a TPO-containing composition comprising a TPO protein that has no sugar chain residue and at least one pharmaceutically acceptable additive that is selected from the group consisting of proteins, cellulose derivatives, sulfated polysaccharides, agents surfactants, polyvinyl alcohol, macrogols and aminoacetic acid.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a normal curve showing the relationship between a concentration of TPO (1-163) / E. coli and a corresponding absorbance value (450 nm / 650 nm), as determined by ELISA. Figure 2 is a graph showing the change in the recovery percentage of TPO (1-163) / E. coli through the course of time when human serum albumin (HSA) is added in several concentrations.

DETAILED DESCRIPTION OF THE INVENTION As the TPO of the present invention, a protein having the amino acid sequence shown in SEQ ID NO: 1 and which does not have a sugar chain residue can be used, and its production method is not limited with particularity , as long as the product is an isolated protein that has a high purity. Useful also as the TPO of the present invention is a protein that contains a partially modified amino acid sequence (by substitution, deletion, insertion and / or addition) in the amino acid sequence shown in SEQ ID NO: 1 but does not have a sugar chain residue as long as it maintains the TPO activity. In other words, a protein having essentially the amino acid sequence shown in SEQ ID NO: 1 and having no sugar chain residue, can also be used. The term "having essentially the amino acid sequence shown in SEQ ID NO: 1 as used herein means that the amino acid sequence resulting from the substitution, deletion, insertion and / or partial addition in the amino acid sequence shown in SEQ. ID NO: l, as long as it maintains TPO activity "is included in addition to the amino acid sequence shown in SEQ ID NO: l. It has been found that recombinant human TPO proteins maintain a TPO activity even when amino acid residues on the C-terminal side of the amino acid sequence, shown in SEQ ID NO: 1 suppress up to position 152, even though Amino acid residues from the N-terminal side are deleted to position 6. The concrete data are shown in Table 1. Table 1 Derivative Activity Positions 1-231 + Positions 1-211 + Positions 1-191 + Positions 1-171 + Positions 1-163 '+ Positions 1-157 + Positions 1-156 + Positions 1-155 + Positions 1-154 + Positions 1 -153 + Positions 1-151 + Positions 1-150 Positions 7-163 + Positions 8-163 Positions 13-231 In this way, the TPO proteins of the present invention are proteins that do not have sugar chain residue, which contain in an amino acid sequence corresponding to positions 7 to 151 of the amino acid sequence shown in SEQ ID NO: 1 and having the activity of TPO. More specifically, the proteins include ones that do not have a sugar chain residue and that have a polypeptide chain at positions 1-231, 1-211, 1-191, 1-171, 1-163, 1-157 , 1-156, 1-155, 1-154, 1-153, 1-151 or 7-163 of the amino acid sequence shown in SEQ ID NO: l. They are also included in the TPO proteins of the present invention, proteins that do not have a sugar chain residue and that have a substitution, deletion, insertion and / or addition of at least one amino acid residue inside or outside of the aforementioned sequence 7-151 shown in SEQ ID NO: l , to the extent that the activity of the TPO does not deteriorate. The TPO proteins that do not have a sugar chain residue of the present invention can include a protein wherein at least Ser 1 and Ala 3 of the amino acid sequence of human TPO shown in SEQ ID NO: 1 are substituted by Ala and Val , respectively. A protein where Arg25 is replaced by Asn; a protein in which His33 is replaced by Thr; a protein in which Arg ^ 5 is replaced by Asn and Glu ^ 31 is replaced by Lys; and proteins wherein the polypeptide: Thr Ser lie Gly Tyr Pro Tyr Asp Val Pro Asp Tyr Wing Gly Val His His His His His His is added to each C-terminus of the proteins described above. Also included are proteins that do not have a sugar chain residue and that have the deletion and / or addition of at least the following amino acid residues in the sequence shown in SEQ ID NO: 1, namely, a protein wherein suppresses His33; a protein where Gly11 ^ is deleted; a protein where Arg117 is deleted; a protein in which a threonine residue is inserted between His33 and Pro34; a protein in which an alanine residue is inserted between His33 and Pro34; a protein in which a glycine residue is inserted between His33 and Pro34; a protein in which a glycine residue is inserted between His33 and Pro34 and Pro3 ^ is replaced by Ser; a protein in which an asparagine residue is inserted between Gly116 and Arg117; a protein in which an alanine residue is inserted between Gly11 ^ and Arg117 '"and a protein into which a glycine residue is inserted between Gly116 and Arg117. Still further examples of the TPO proteins of the present invention are a protein in which at least Leu1 ^ 9 is replaced by Arg, a protein in which His133 is replaced by Arg, a protein in which Met143 is replaced by Arg, a protein in which Gly ^ 2 is replaced by Leu; a protein in which Gly146 is replaced by Leu, a protein in which Ser14 ^ is replaced by Pro, a protein in which Lys ^ 9 is replaced by Arg, and a protein in which Gln11 ^ is replaced by Arg. also include as the TPO proteins that do not have sugar chain residue of the present invention the non-glycosylated proteins wherein the methionine and lysine residues are respectively added to positions -2 and -1 of the human TPO protein having the sequence amino acid molecule shown in SEQ ID NO: 1 and the derivatives described above; and proteins wherein the methionine residue is fixed at position -1 of the human TPO protein having the amino acid sequence shown in SEQ ID N0: 1 and the derivatives. Preferably, the TPO proteins of the present invention can be obtained by isolating and purifying them from the transformed host cells with a recombinant vector containing their cDNA, chromosomal DNA and chemically synthesized DNA. As the host, prokaryotes (e.g., bacteria, preferably E. coli) can be used.

Proteins, cellulose derivatives, sulfated polysaccharides, surfactants, polyvinyl alcohol, macrogols, aminoacetic acid and the like can be exemplified as useful additives for the preparation of the stable TPO-containing composition of the present invention. The types of these additives are not particularly limited so long as they can impede the absorption of the TPO in the containers, tubes (eg, infusion lines) or the like, made of glass, a resin or a similar material that includes the materials that will be indicated below. As proteins, human serum albumin, gelatin, bovine serum albumin, casein, collagen, human serum globulin and the like may of course be used. As cellulose derivatives, methylcellulose, hydroxypropylcellulose, hydroxyethylcellulose and the like can be used. Examples of useful surfactants include polyoxyethylene hydrogenated resin oil; polyoxyethylene castor oil; polyoxyethylene sorbitan fatty acid esters, such as polysorbate 80, polyoxyethylene sorbitan monolaurate (aka: polysorbate 20) and the like; polyoxyethylene polyoxyethylene glycol; sorbitan fatty acid esters, such as sorbitan monooleate and the like; sucrose fatty acid esters such as sucrose monolaurate and the like; egg yolk phospholipids, such as egg yolk lecithin and the like; aromatic quaternary amine salts such as benzethonium chloride, benzalkonium chloride and the like; alkyl sulfates such as sodium lauryl sulfate and the like. As the sulphated polysaccharides, sodium salt of chondroitin sulfate, sodium of heparin, etc. are usable. The above-described additives used in the present invention can be used in a concentration ranging from 0.001 percent to 10 percent when preparing the TPO-containing composition in the form of an aqueous solution. Also, it is desirable to use these additives within the range of 0.02 part by weight to 10,000 parts by weight per part by weight of the TPO protein, as an active ingredient. In addition, the TPO-containing composition of the present invention may also contain a diluent, a solubilizing agent, an antiseptic agent, an antioxidant, an excipient, an isotonicity agent or the like, depending on the purposes of preparation of the composition.

The stable TPO-containing composition of the present invention can be prepared in dosage forms, such as solutions, suspensions, lozenges, pills, capsules, granules or freeze-dried preparations, depending on the different routes of administration including parenteral administration (cf. .gr., injection), transpulmonary administration, transnasal administration and oral administration. The TPO and the additive as used in the present invention can be formulated in such a way that they co-exist in the same composition from the start or alternatively the TPO and the additive can be pre-formulated separately and combined when used. The following test and working examples will be provided to further illustrate the present invention.

EXAMPLES In the following test examples, the enzyme immunoassay of TPO was carried out in the following manner.

Enzyme-linked immunosorbent assay (ELISA) using the anti-human TPO monoclonal antibody The anti-human TPO monoclonal antibody (ie, L3-1 subclone L3-1-54) as a solid-phase antibody that recognizes the region of the human HT-1 TPO (corresponding to the amino acid sequence 8-28 shown in SEQ ID NO: 1) was prepared a concentration of 20 micrograms per milliliter in a 50mM carbonate stabilizing solution (pH 9.2) and distributed in 50 microliter portions in wells of a 96-well microtiter plate (Nunc-Immuno Píate MaxiSorp ™, manufactured by InterMed, Ca.No. 4-42404) The solid phase antibody was completely dispersed in the bottom of each well. well while stirring the plate in a microplate mixer (ADVANTEC TS-96, manufactured by Advantech Tokyo, Japan). The plate was sealed with a plate seal (manufactured by SUMILON, Ca.No.MS 30020) and left at a temperature of 37 ° C for two hours or at 4 ° C overnight to adsorb the solid phase antibody on the plate . Then, after washing with a wash stabilizer (20 mM Tris-HC1 / 0.5 M NaCl / 0.1 percent Tween 20 (pH 7.5)), 300 microliters of 4 X Block Ace was added to each well. (manufactured by Dainippon Pharmaceuticals, Japan, Ca.No.

UK-B25) and the plate was sealed with a plate seal and left at 37 ° C for one hour or at 4 ° C overnight. After the wash stabilizer was washed four times with an agent, 50 microliters of a sample to be tested or a known concentration of TPO as a standard was added to each well and diluted with 10 X Block Ace, and the plate was shaken using A microplate mixer was sealed with a plate seal and then left at 37 ° C for 2 hours, or 4 ° C overnight. After completing the reaction, the plate was washed four times with the wash stabilizing agent. Then, another anti-human TPO monoclonal antibody (ie, subclone L4-1-31 of L4-1) as the primary antibody that recognizes the human HTPO-TPO region (corresponding to amino acid sequence 47-62). shown in SEQ ID NO: l) was irradiated with biotin, diluted to 500 ng per milliliter with 10 X Block Ace and distributed in 50 microlitre portions to the wells, after which the plate was shaken in a microplate mixer , was sealed with a plate seal and left at 37 ° C for 2 hours or at 4 ° C overnight. After completion of the reaction and subsequent washing (4 times) with the wash stabilizing agent, an avidin irradiated with peroxidase (UltraAvidin ™ -Horseradish horseradish peroxidase, manufactured by Leinco Technologies, Ca.No. A106) was diluted 2,000 times in 10 X Block Ace was distributed in 50 microlitre portions to the wells. The plate was shaken in a microplate mixer, sealed with a silver seal and then subjected to one hour of reaction at 37 ° C. After completion of the reaction and subsequent washing (4 times) with the wash stabilizing agent, 100 microliters of a color former prepared by adding 1/100 volumes of a substrate solution to a color former TMBZ was added to each well. of the color development kit for peroxidase (manufactured by SUMILON, Ca.No. ML-1120T) and the plate was shaken in a microplate mixer, sealed with a plate seal and then subjected to the reaction at room temperature. After about 30 minutes, 100 microliters of a reaction termination solution was added to each well and the plate was shaken using a microplate mixer to stop the staining reaction. Absorbances at wavelengths of 450 nm / 650 nm were measured using an ELISA plate reader (THERMOmax, manufactured by Moleculaar Devices). A normal curve was provided based on the absorbance values of known concentrations of TPO (1- 163) / E. coli, obtained by the procedure described in the Reference Example (see Figure 1). In this regard, subclone (L4-1-31) of hybridoma L4-1 and subclone (L3-1-54) of hybridoma L3-1 used herein, whose subclones can both produce anti-TPO monoclonal antibodies -human, have been deposited on December 27, 1994 in the National Institute of Bioscience and Human Technology, Agency of Science and Industrial Technology, and the Ministry of International Trade and Industry, Japan, under the access numbers FERM BP-4956 and FERM BP-4955, respectively. The aforementioned subclones have also been deposited with the China Depositary Authority (CCTCC) under Accession Number CCTCC-C95003 for the mouse-Mouse hydridome L4-31 and Accession Number CCTCC-C95002 for the L3-1-54 hybridoma. of Mouse-Mouse, respectively.

Test Example 1 Test samples were prepared by adding human serum albumin to 10 mM Tris stabilizing agent (pH 7.5) to a final concentration of 0.005 percent, 0.01 percent, 0.02 percent, 0.05 percent, 0.1 percent, 0.2 percent or 0.5 percent. As a control sample, 10 mM Tris stabilizer (pH 7.5) was used alone. 1.5 microliters of a solution containing 3 micrograms of TPO was obtained which is obtained by the procedure that will be described later in the Reference Example, in a glass test tube that had been loaded with 1000 microliters of each sample, and then I let stand at room temperature. The solution was taken from the tube in 10 microliter portions after 0.5 minute, 1 hour or 2 hours, and the amount of TPO in the solution was measured by ELISA to calculate its recovery (percent) based on the expected value. The results are shown in Figure 2. In the drawing, WHITE indicates a 10 mM case of the stabilizer Tris (pH 7.5) only and HSA indicates human serum albumin. It was found that human serum albumin had the effect of preventing adsorption.

Test Example 2 2.7 microliters of a solution containing 3 micrograms of TPO [ie, TPO (1-163) / E. coli] obtained by the procedure described in the Reference Example, was added to a glass test tube that had been charged with 1000 microliters of a solution prepared by dissolving each of the different additives shown in Table 2, and 10 mM of the Tris stabilizer (pH 7.5) to a final concentration of 0.1 percent, and recovery after 24 hours of standing was measured by ELISA. The results are shown in Table 2.

Table 2 Additives (amount added, Recovery 1 milligram per milliliter) (Percentage) human serum albumin 41.3 purified gelatin (type A) 41.2 purified gelatin (type B) 24.9 aminoacetic acid 21.7 methylcellulose 44.0 hydroxypropylcellulose 51.5 hydroxyethylcellulose 23.3 sodium salt of chondroitin sulfate 61.6 heparin sodium 41.4 Macrogol 400 24.4 polyvinyl alcohol (partially saponified) 36.7 polyoxyethylene hydrogenated castor oil 60 50.3 polysorbate 80 67.8 polyoxyethylene sorbitan monolaurate 57.6 polyoxyethylene (160) -polyoxypropylene (30) glycol 33.7 sorbitan monooleate 89.6 sucrose monolaurate 59.2 yolk phospholipid of egg 20.8 benzethonium chloride 97.6 sodium lauryl sulphate 72.6 no addition 16.2 As shown in the table, all the additives tested could prevent the absorption of TPO when they come into contact with the glass test tubes. The production examples of the TPO-containing compositions of the present invention will be pointed out below.

Example 1 An aqueous solution containing 1000 micrograms of TPO, 0.025 gram of human serum albumin and 87.66 milligrams of sodium chloride in 10 milliliters of 5 mM phosphate stabilizer (pH 6.0) was prepared aseptically and distributed in one milliliter portions in small vials that were subsequently sealed.

Example 2 A pharmaceutical preparation was prepared by repeating the procedure of Example 1, with the exception that 0.1 gram of the purified gelatin was used. (type B) instead of 0.025 gram of human serum albumin.

Example 3 An aqueous solution containing 2500 micrograms of TPO, 10 milligrams of polysorbate 80 and 0.5 gram of sorbitol in 10 milliliters of 1 mM citrate stabilizer (pH 6.0) was prepared aseptically and distributed in 1 milliliter portions in small bottles which were subsequently sealed.

Example 4 An aqueous solution containing 2500 micrograms of TPO, 10 milligrams of hydrogenated polyoxyethylene castor oil 60 and 81.82 milligrams of sodium chloride in 10 milliliters of 10M Tris stabilizer (pH 6.5) was prepared aseptically and distributed in 1-fold portions. milliliter in small bottles. which were subsequently sealed. As a reference example, a process for the production of TPO as an active ingredient of the present invention will be described below.

Reference Example: Example of TPO production (1- 163) / E. coli in Escherichia coli (1) Construction of the E. coli expression plasmid pAMGll-hMKT (1-163) for hMKT (1-163) and its expression in E. coli: To express a protein that has an amino acid sequence of positions 1 to 163 shown in SEQ ID NO: 1 (referred to as "TP0 (1-163) / E. coli" below) in E. coli, an encoding of the DNA fragment for the sequence of amino acid was synthesized chemically using preferential codons for E. coli. In addition, a nucleotide sequence encoding the newly added methionine and usin residues to the N-terminal side was ligated with the DNA fragment, and a DNA sequence encoding a stop codon was added to a site corresponding to the DNA side. terminal C. SEQ ID NO: 2 shows an amino acid sequence of the protein encoded by this DNA namely, the protein in which Met-Lys are attached to the N-terminus of amino acid sequence 1-163 shown in SEQ ID NO: l (referred to as "hMKT (1- 163" below). The hMKT (1-163) gene fragment synthesized as above has Xbal and HindIII restriction sites at its 51 end and 3 'end, respectively and contains a ribosome binding site, an ATG initiation codon, a sequence encoding the amino acid sequence of hMKT (1-163) and a stop codon.

The aforementioned fragment was cloned into the Xbal-HindIII sites of the pAMGll lactose-induced expression vector. The pAMGll vector is a low copy number plasmid that has a duplication origin derived from pRIOO. The pAAMGll expression vector can be obtained from a plasmid pCFM1656 (ATCC No. 69576, deposited on February 24, 1994) causing a series of base mutations directed to the site through mutagenesis accompanied with PCR. This plasmid has a BglII site (plasmid bp # 180) starting with immediately on the 51 side of a plasmid duplication promoter, PcopB, followed by a plasmid duplication gene. The mutation of the base pairs is shown in Table 3.

Table 3 pAMGll bp # bp in pCFMl .656 bp camt) to pAMGll # 204 T / A C / G # 428 A / T G / C # 509 G / C A / T # 617 - - insertion of 2 pairs of G / C # 679 G / CT / A # 980 T / AC / G # 994 G / CA / T # 1004 A / TC / G # 1007 C / GT / A # 1028 A / TT / A # 1047 C / GT / A # 1178 G / CT / A # 1466 G / CT / A # 2028 G / C suppression # 2187 A / TT / A # 2480 A / TT / A # 2499--2502 AGTG GTCA TCAC CAGT # 2642 TCCGAGC deletion AGGCTCG # 3435 G / CA / T # 3446 G / CA / T # 3643 A / TT / A # 4489- • 4512 - - insertion of the following base pairs GAGCTCACTAGTGTCGACCTGCAG CTCGAGTGATCACAGCTGGACGTC Then, the DNA sequence between the unique sites AatlI and Clal was replaced by the following oligonucleotide. AatII (# 4358) 5 'CTCATATTTTTAAAAAATTCATTTGACAAATGCTAAAATTCTT-3' TGCAGAGTATTAAAAATTTTTTATAGTAAACTGTTTACGATTTTAAGAA - GATTAATATTCTCAATTGTGAGCGCTCACAATTTAT 3 '-CTAATTATAAGAGTTAACACTCGCGAGTGTTAAATAGC 5' Clal (# 4438) Expression of the hMKT (1-163) gene introduced into pAMGII can be induced by a synthetic lactose inducible activator such as the Ps4 activator having the following sequence: 5 'GACGTCTCATAATTTTTAAAAAATTCATTTGACAAATGCTAAA- -ATTCTTGATTAATATTCTCAATTGTGAGCGCTCACAATTTATCGAT 3' The expression induced by the Ps4 activator of the hMKT gene (1-163) is repressed by the lactose repressor (Lac I) which is a product of the E. coli lac I gene. Then, a strain of E. coli, K-12 containing 1 * 3 was transformed with the plasmid pAMGll-hMKT (1-163). 13 has a mutation within the lac I activator that increases the expression of the Lac I gene, thereby resulting in a more demanding control of protein expression by the Ps4 activator. Consequently, in the absence of lactose, the expression of hMKT (1-163) is repressed by Lac I. When lactose is added, the binding of the Lac I protein to the operator site of the Ps4 activator decreases, and the transcription of the hMKT gene (1-163) using the Ps4 activator. The E. coli used as the host cell in this example has been deposited with the ATCC on November 30, 1994 under the ATCC Number 69717. The E. coli strain (ATCC No. 69717) was transformed with the pAMGll- plasmid. hMKT (1-163) and was cultured under the following culture conditions. (2) Culture of a recombinant E. coli strain capable of expressing hMKT (1-163) and the production of TPO (1-163) / E. coli: The transformant obtained was cultured in an LB medium at 30 ° C for approximately 12 hours. The cells were then transferred aseptically to a thermenator containing a batch medium (20 grams per liter of yeast extract, 3.4 grams per liter of citric acid, 15 grams per liter of K2HPO, 15 milliliters of Dow P2000, 5 grams per liter of glucose, 1 gram per liter of MgS? 4 ~ 7H2O, 5.5 milliliters per liter of trace metals, 5.5 milliliters per liter of vitamins). The culture was continued until an optical density (O.D.) of the culture reached 5.0 ± 1.0 at 600 nm. Then, a first feeding medium was fed (700 grams per liter of glucose, 6.75 grams per liter of MgS? 4 ~ 7H2?), While adjusting a feeding regime at intervals of 2 hours in accordance with an established schedule. The addition of a second feeding medium (129 grams per liter of trypticase peptone, 258 grams per liter of yeast extract) was started when the O.D. of the culture reached 20-25 at 600 nm. The addition of the second feed medium was maintained at a constant flow rate while continuing to adjust the addition of the first feed medium. The temperature was maintained at approximately 30 ° C throughout the culture. The culture was maintained at a pH of about 7 with the addition of an acid or a base if necessary. The desired level of dissolved oxygen was maintained by adjusting a stirring regime, a rate of aeration and an oxygen entry rate in the fermenter. When the O.D. of the culture reached 57-63 at 600 nm, the addition of a third feeding medium (300 grams per liter of lactose) in the fermeter was introduced at a constant flow rate. The addition of the first feed medium was stopped and the flow rate of the second feed medium was changed to a new constant rate. The cultivation was continued through approximately 10 hours after the initiation of the addition of the third feeding medium. At the end of the culture, the culture was cooled to a temperature of 15 ° C ± 5 ° C and the cells were harvested by centrifugation. The resulting granule was stored at -60 ° C or lower.

The purification of hMKT (1-163) produced in this manner in E. coli and the production of TPO (1- 163) / E. coli that were carried out in the following way. 1800 grams of the cell pellet were suspended in approximately 18 liters of 10 nm EDTA and passed through a high pressure homogenizer at 1054.5 kilograms per square centimeter. The suspension of the disintegrated cell was centrifuged and the precipitated material was resuspended in 10 liters of 10 mM EDTA. The suspension was centrifuged and 200 grams of precipitated material was solubilized in 2 liters of 10 mM Tris stabilizer, pH of 8.7, containing 8 M guanidine hydrochloride, 10 mM DTT and 5 mM EDTA. This solution was slowly diluted in 200 liters of 10 mM CAPS, pH 10.5, containing 3 M urea, 30 percent glycerol, 3 mM cystamine and 1 mM cysteine. The diluted solution was stirred slowly for 16 hours at room temperature and the pH was adjusted to 6.8. after pH adjustment, the solution was clarified and loaded onto a 2-liter Sepharose CM column equilibrated with 10 mM sodium phosphate stabilizer, pH 6.8 containing 1.5 M urea and 15 percent glycerol. After loading, the column was washed with 10 mM sodium phosphate containing 15 percent glycerol of pH 7.2. HMKT (1-163) was eluted with a linear gradient of O M to O. 5 M sodium chloride and 10 mM sodium phosphate stabilizer of pH 7.2. The fractions eluted from the Sepharose CM column were concentrated using a membrane (molecular weight interruption of 10,000) and exchanged simultaneously with a stabilizer with 10 mM sodium phosphate stabilizer, pH 6.5. The concentrated solution (protein: about 2 milligrams per milliliter) was treated with cathepsin C (porotein substrate: enzyme = 500: 1 (molar ratio)) for 90 minutes at room temperature. The reaction mixture was loaded onto a 1.2 liter High Function Sepharose column of SP equilibrated with 10 mM sodium phosphate stabilizer, pH 7.2, containing 15 percent glycerol. After loading, an active TPO protein, TPO (1- 163) / E was eluted. coli where the Met-Lys N-terminus of hMKT (1-163) was dissociated with a linear gradient from 0.1 M to 0.25 M sodium chloride in 10 mM sodium phosphate, pH 7.2. The material eluted from ammonium sulfate was added from the column of Great Function Sp at a concentration of 0.6 M. The eluted material was then loaded onto a 1.6 liter column of Toyopearl Phenyl (Toso Corporation., Japan) equilibrated with 10 mM of the Sodium phosphate stabilizer of pH 7.2, containing 0.6 M ammonium sulfate. A crest of the TPO (1-163) / E. coli was eluted with a linear gradient of 0.6 M to 0 M ammonium sulfate in 10 mM sodium phosphate pH 7.2. The eluate material resulting from the column of Toyopearl of Phenyl was concentrated using a membrane (molecular weight cut-off of 10,000) and exchanged simultaneously with the stabilizer with 10 mM Tris stabilizer of pH 7.5, containing 5 percent sorbitol.

LIST OF SEQUENCES INFORMATION FOR SEQ ID NO: l: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 332 amino acids (B) TYPE: amino acid (ii) TYPE OF MOLECULAR: prot3Ína (vi) SOURCE ORIGINAL: (A) ORGANISM : human (Homo sspiens) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: l: Ser Pro Ala Pro Pro Ala Cys Asp Leu Arg Val Leu Ser Lys Leu Leu 1 5 10 15 Arg Asp Ser His Val Leu His Ser Arg Leu Ser Gln Cys Prc Glu Val 20 25 30 His Pro Leu Pro Thr Pro Val Leu Leu Pro Val Val Asp Phe Ser Leu 40 45 Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lye Wing Gln Asp lie Leu 50 55 60 Gly Ala Val Thr Leu Leu Leu Glu Gly Val Met Ala Ala Arg Gly Gln 65 70 75 80 Leu Gly Dro Thr Cys Leu Be Ser Leu Leu Gly Gln Leu Ser Gly Gln 85 90 95 Val Arg Leu Leu Leu Gly Ala Leu Gln Ser Leu Leu Gly Thr Gln Leu 100 105 110 Pro Pro Gln Gly Arg Ttr Thr «.la His Lys Asp Pro Asn Ala lie Phe 135 120 125 Leu Ser Phe Gln His Leu Leu Arg Gly Lye Val Arg Phe Leu M3t Leu 130 135 1¿0 Val Gly Gly Ser Thr Leu Cys Val Arg Arg Ala Pro Pro Thr Thr Ala 145 150 55 160 Pro Pro Arg Thr Ser Leu Val Leu Thr Leu Asn Glu Leu Pro Asn 165 170 175 Arg Thr Ser Gly Leu Leu Glu Thr Asn Phe Thr Wing Being Wing Arg Thr 180 185 190 Thr Gly S «; r Gly Leu Leu Lys Trp Gln Gln Gly Phe Arg Ala Lys He 195 200 205 Pro Gly Leu Leu Asn Gln Thr Ser Arg Ser Leu Asp Gln He P or Gly 210 215 220 Tyr Leu Asn Arg He His Glu Leu Leu Asn Gly Thr Arg Gly Leu Phe 225 230 235 240 Pro Gly Pro Ser Arg Arg Thr Leu Gly Ala Pro Asp He Ser Ser Gly 245 250 255 Thr Ser Asp Thr Gly Ser Leu Pro Pro Asn Leu Gln Pro Gly Tyr Ser 260 265 270 Pro Pro Pro Thr His Pro Pro Thr Gly Gln Tyr Thr Leu Phe Pro Leu 275 280 285 Pro Pro Thru Leu Pro Thr Pro Val Val Gln Leu His Pro Leu Leu Prc 290 295 300 Asp Iro Ser Wing Pro Thr Pro Thr Pro Thr Ser Pro Leu Leu Asn Thr 305 310 315 320 Ser Tyr Thr His Ser Gln Asn Leu Ser Gln Glu Gly 325 330 INFORMATION FOR SEQ ID NO: 2: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 535 pairs of kisses (B) TYPE: nucleic acid (C) TYPE OF CHAIN: double (D) TOPOLOGY: linear (il) TYPE OF MOLECULAR:? Synthetic DN (vi) ORIGINAL SOURCE: (A) ORGANISM: human (Homo sapiens) (xi) DESCRIPTION OF THE SEQUENCE: SEQ ID NO: 2 CTAGAAAAAA CCAAGGAGGT AATAAATA 28 ATG AAA AGT CCT GCA CCA CCT GCA TGT GAT TTA CGG GTC CTG TCT AAA 76 Met Lys Ser Pro Pro Wing Pro Wing Cys Asp Leu Arg Val Leu Ser Lys +1 5 10 CTG CTG CGC GAC TCT CAC GTG CTG CAC TCT CGT CTG TCC CAG TGC CCG 124 Leu Leu Arg Asp Ser His Val Leu His Ser Arg Leu Ser Gln Cys Pro 15 20 25 30 GAA GTT CAC CCG CTG CCG ACC CCG GTT CTG CTT CCG GCT GTC GAC TTC 172 Glu Val His Pro Leu Pro Thr Pro Val Leu Leu Pro Ala Val Asp Phe 35 40 45 TCC CTG GGT GAA TGG AAA ACC CAG ATG GAA GAG ACC AAA GCT CAG GAC 220 Ser Leu Gly Glu Trp Lys Thr Gln Met Glu Glu Thr Lys Ala Gln Asp 50 55 60 ATC CTG GGT GCA GTA ACT CTG CTT GAA GGC GTT ATG GCT GCA CGT 268 He Leu Gly Ala Val Thr Leu Leu Leu Glu Gly Val Met Ala Ala Arg I 65 70 7b ' GGC CAG CTT GGC CCG ACC TGC CTG TCT TCC CTG CTT GGC CAG CTG TCT 316 Gly Gln Leu Gly Pro Thr Cys Leu Ser Ser Leu Leu Gly Gln Leu Ser 80 85 90 GGC CAG GTT CGT CTG CTG CTC GGC GCT CTG CAG TCT CTG CTT GGC ACC 364 Gly Gln Val Arg Leu Leu Leu Gly Ala Leu Gln Ser Leu Leu Gly Thr 95 100 105 110 CAG CTG CCG CCA CAG GGC CGT ACC ACT GCT CAC AAG GAT CCG AAC GCT 412 Gln Leu Pro Pro Gln Gly Arg Thr Thr Ala His Lys Asp Pro Asn Ala 115 120 125 ATC TTC CTG TCT TTC CAG CAC CTG CTG CGT ÜGC AAA GTT CGT TTC CTG 460 He Phe Leu Ser Phe Gln His Leu Leu? Ig Gly Lys Val Arg Phe Leu 130 135 14 & ATG CTG GTT GGC GGT "? CT ACC CTG TGC GTT CGT CGG GCG CCG CCA ACC 508 Met Leu Val Gly Gly Ser Thr Leu Cys Val Arg Arg Ala Pro Pro Thr 145 150 155 ACT GCT GTT CCG TCT TAATGAAAGC TT 535 Thr Ala Val Pro Ser 160

Claims (7)

CLAIMS:

1. A composition comprising thrombopoietin (TPO) consisting of protein TPO having no residue sugar chain and at least one pharmaceutically acceptable additive selected from the group consisting of proteins, cellulose derivatives, sulfated polysaccharides, surfactants, polyvinyl alcohol, macrogols and aminoacetic acid. The TPO-containing composition according to claim 1, wherein the additive is contained in an amount of 0.001 percent to 10 percent, when the composition is in the form of an aqueous solution. 3. The TPO-containing composition according to claim 1 or claim 2, wherein the protein is human serum albumin and / or gelatin. 4. The TPO-containing composition according to claim 1 or claim 2, wherein the cellulose derivative is at least one compound selected from the group consisting of methylcellulose, hydroxypropylcellulose and hydroxyethylcellulose. 5. The composition containing TPO according to claim 1 or claim 2 wherein the surfactant is at least one compound selected from the group consisting of hydrogenated castor oil, polyoxyethylene castor oil, polyoxyethylene an ester of fatty acid polyoxyethylene sorbitan ester, a sorbitan fatty acid ester, a sucrose fatty acid, a phospholipid of egg yolk, salt and aromatic quaternary ammonium alkylsulfate. 6. The composition contains TPO according to claim 1 or claim 2, wherein the sulphated polysaccharide is sodium salt of chondroitin sulfate and / or sodium of heparin. 7. A method for preventing the reduction of a TPO titration caused by the adsorption of TPO on the wall of a container loaded with a composition containing TPO protein, which has no sugar chain residue, which comprises adding to the composition at least one pharmaceutically acceptable additive selected from the group consisting of proteins, cellulose derivatives, sulfated polysaccharides, surfactants, polyvinyl alcohol, macrogols and aminoacetic acid.