MXPA97005445A - Monoclonal antibodies anti-cd6 and its u - Google Patents

Abstract

The present invention relates to monoclonal antibodies that recognize the CD6 antigen, pharmaceutical compositions containing these antibodies and are capable of achieving clinical and histological effectiveness in patients with the different clinical forms of the psorias

Description

MONOCLONAL ANTIBODIES ANTI-CD6 AND ITS USES TECHNICAL SECTOR The present invention relates to the immunology field and in particular to the production of pharmaceutical compositions containing an inonoclonal antibody which recognizes the anti-digestion enzyme leucocyte CD6.

PREVIOUS TECHNIQUE The An + i tonoclonal bodies (mAb) have allowed the characterization of molecules of physiological importance expressed in the cell membranes, defining in the cells of the immune system the antigens or "Clus + er of Leukocyte Differentiation" (CD), (Schlossrnan , F. F et al. (1994) Irn Uni. Today 15 (3): 9B). The role of the role of Cl) in the digestion and maturation of Iinfoid cells during their development on + ogenetic mechanisms of cell recognition and adhesion, the mechanisms of activation and proliferation during the immune response have led to the use of sleep. respective MAbs in the diagnosis and the mmunotherapy, with encouraging results (Dan + al, 3. et al. (1991) Curr. Opm. Im unol. 3: 740). The murine mAbs directed against molecules expressed in the cellular membrane of human T-lymphocytes have contributed to improve the clinical diagnosis of clinical entities where the functional defect lies in these cells, and they have also been used to explore new approaches -therapeutics , with the ín + ee of rn? du'lai? -u functional activity as n the Rejection of Transplantation, Disease Tnjer + or against Guest (GvHD) and Autoimmune Diseases (Ual drnann, TA (1991) Science 252: 1657; laldinann, TA (1992) Annu., Rev. Immunol., 10: 575). CD6 is a poorly characterized molecule. Re knows that it is a glycoprote or ei na that exists in two molecular forms that remain in dynamic equilibrium and differ only in the degree of phosphorylation. In resting T lymphocytes it is a phospholipid molecule of 105 kD and in cells activated a hyperphosphatic form of 130 r - Da (Cárdenas, L. et al. (1990) .Trnrnunol 145: 1450; wacr--, JA et al. (1991) 3. Biol. Chern. 266: 7137), member of a family of membrane receptors and secretion proteins with characteristic structure (Kodarna, T. et al. (1990) Na + ure 343: 531; Aruffo, A. e + di. (1991) 7 Exp. Ried. 174: 949); It is expressed on the surface of mature human tunocitos, in T peripheral blood samples, where it constitutes the majority of the population of CD3 + cells, in a subtype of B lymphocytes and in the neurons of the cerebral cortex, in T lymphocytes. of peripheral blood participates in the mechanisms of cellular activation (Reinherz, EL et al. (1982) Cell 30: 735; Karnoun, M. et al. (1981) ___ Irnrnunol ^ 127: 987; Mayer, B. et al. (1990) 3. Neuroimmunol., 29: 193, Rasrnussen, RA, et al. (1994) 3. Irnmunol., 152: 527). The role of CD6 in the ontogeny of T cells is unknown, as is their possible role in the pathophysiology of disease © or of different etiologies. Recently, a CD6 lyase with broad cellular distribution was identified and characterized in normal tissues such as thymus, spleen, lymph nodes and skin (Dhavall-'uinar, DP et al. (1995) 3. Exp. Med _ ^ _ 181: 1563). This molecule called ALCAM íActava + ed Leu ocytc Cell Molecule Adhesion) by its expression in lymphocytes T and B activated as well as in monocytes, is a type I membrane glycoprotein of 1001 Da Molecular Weight, with 5 similar ex-cell domains. to those of the unoglobulins, it can present different degrees of activation depending on divalent ca + ions and can mediate hornophilic and heterophilic interactions (Bowen, A. A. et al. (1995) 3. Exp. ried.181: 2213). In the clinic, different anti-CD6 ACH have been used, in the case of acute transplan + e rejection of organs (Kirkma, RL et al. (1983) Transplantat? On_36: 620) and to deplete T-lymphocytes. of bone marrow to prevent Graft Disease against Humans (GvHD) (Soiffer, R.3, et al. (1992) 3. Clin. Oncol ^ 10: 1191). The mAb íor ti is in Phase II Clinical Trial in the treatment of Cutaneous T Cell Lymphomas (García, C.A. et al. (1990) Biotec. Applied 7f2): 176; Faxas, tt.E. et ai. (1993) Biotec. Applied 10 (1): 20). The Monoclonal Antibody turino íor ti of isotype IgG2a, classified as ant i CD6 in the IV International Workshop of Antigens of Differentiation Leucocite of Vienna (1989), defines an epitope different from those recognized by < > Anti-CD6 mAbs that are stable conformation and insensitive to reducing agents, possibly localized in the primary structure of the CD6 molecule (Osopo, L.M. et al., (1994) Cell, Trnmunol., 154: 123). This Monoclonal Antibody has a lower recognition than other anti CD3 in peripheral mononuclear cells of healthy individuals; The recognition of the human cell lines in culture of origin T is in 3ur \ at 47%, MoU-4 (23%), CCRF-CEH (does not recognize it); of origin B in Ra í (9%), origin in troblastoid K-562 (L2%) and rmelornonocytic U-937 (9%), as well as it also recognizes peripheral mononuclear cells of patients with Leukemia l. %) (García, CA et al. (1992) Biotec, Applied 9 (1): 70) and 1 infocitos of cutaneous lesions of patients with Linfornas Cutaneous T Cells (Rodríguez, T. et al. (1985) Tterferferon and Biotec 2 (1): 1 J .. The mAb lor ti does not inhibit "in vitro" the specific antigenic cell totoxicity (Faxae, ME et al. (1993) Biotec Apla cada_10 (1): 47) and is able to activate "m vitro" l nfocitos T of peripheral blood of healthy individuals, at suboptirn concentrations of 0KT3 (anti CD3) cross-lml-'ing with lor -ti induces higher responses than those achieved with other anti-CD6 AcPl (Osopo, LM et al. (1994) Cell. Imrnunol ^ 154: 123). Psoriasis is a disease whose oocytopatosis is not defined (Hunzil-er, T. et al. (1993) Ther. Umsch. 50 (2): 110; Eider, 1. T. et al. (1994) 1. Invest. Dermatol,. 102 (6): 24); It is possible to present an inflammatory infiltrate in the target organ with a predominance of activated T lymphocytes with CD4 + and CD8 + phenotype (Chang, 3.CC et al. (1994) Proc. Nati. Acad. Sci. USA 91: 9282), As marked olyoclonality of the T Cell Receptors, these cells apparently have an accentuated trend to the skin (horning) (Barker, JNUN et al. (1992) Br. 3. Derrnatol ^ 127: 205; Menssen, A. et al. (1995) 3. I munol ^ 155: 4078; Valdirnarsson, H. et al. (1995) Irnmunol ._Today 16 (3): i45). The spontaneous remission of Psoriasis can be predicted if it decreases the number of T cells in the iel, so it is suggested that they play an important role in the perpetuation of the disease by releasing soluble mediators of immune response capable of inducing the proliferation of keratinocytes, responsible for the clinical manifestations of e fe med d. These considerations are supported by facts such as the cure of post-transplant bone marrow allogeneic disease, the probable HLA association, the improvement with eteroids and especially with immunomodulators such as Ciclosporma and the clinical improvement with anti-cell therapeutic Monoclonal Antibodies (mAbs). T, although reversibly (Gpffiths, CEM et al. (1992) Sppnger Sernin Immunopat hol 13: 441; Nanney, LB et al. (1986) J_Inveet Dermatol_86 f 3): 26; Picassia, D.D. et al. (1987) 3 Am Acad Derrnatol_l 7 (3): 408; schopf, R.E. et al. 11980) Arch P ^ rmat l Res_? 79 (2): 89; / n from Kerl-hof, P.C. et di. 0987) Der atologí ca_174 (5): 224). The success of immunotherapy with monoclonal antibodies depends on the selection of the target molecule, which must intervene in important cellular functions or the selection of mAb (Da tal, 3. et al. (1991) Curr. Opm ^ T immuno 1. 3: 740). The MAbs evaluated in the Psoriasis directed cont i to the CD3 (Uei nshenl er, E.G. ei al .. (1989) 3. r. Acad.

D ernate 20: 1132) and cont le CD4 f Poizot -Mart ± n, T. et al. (1991) Lancet 337: 1477; Prinz, 3. et al. (1991) Lancet_338: 32; Nicolás, D.F. et al. (1991) Lancet 338: 321) have led to clinical improvement in patients after multiple intravenous applications at high doses, with short-term remissions and early relapse of symptoms and signs of the disease in all cases. The use of Monoclonal Antibodies in multiple doses at multiple doses is associated with the appearance of undesirable effects in the patient due to the xenogenicity of the mucosal proteins, which leads to the appearance of the human antibody response against the immunoglobulins.

(Human Anti-Mouse Antibodies - HAMA); Thus, the humanization of mAbs using protein engineering guarantees the reduction of their immunogenicity, improvement in their far-reaching nature and clinical effectiveness (Uinter, G. et al. (1993) Trends- Pha rrnacol- ci ^ 14 (5): 139) Up to the present time, no study has been reported in which the fjx is described of the CD6 molecule or the T-lymphocytes of the skin infiltration of the skin in Psoriasis. ru the possible association of this molecule with the development of the disease, in addition the therapeutic use of a mAb an i CD6 in this disease has not been evaluated.

DISCLOSURE OF INVENTION The novelty of the present invention consists of providing technical and cyclic pharmacological compositions containing an anti-C6 monoclonal antibody, obtaining a humanized anti-CD6 monoclonal antibody and the therapeutic application of pharmaceutical compositions in patients with Vulgar Psoriasis, using different routes of administration and in different clinical forms of the disease.

BRIEF DESCRIPTION OF THE DRAWINGS Figures 1 and 2 show an analysis for the modification by humanization of T epitopes of the heavy and light chain variable regions of the Monoclonal Antibody u-i no íor tiA. Figure 1: Sequence of the variable region of the heavy chain of the mAb rnupno íor tlA Figure 2: Sequence of the variable region of the light chain of the mAb rnupno íor flA A: Sequence of the variable region of the heavy or light chain of the mRNA rnurino lor tlA B: Sequence of the variable region of the human Tg that more < -e par-ece al 1 1 tlA C. Modified sequence of the variable region of? tlA, by humanization of epitopes T. Residues of underlined amino acids: amino acids involved in the tertiary structure. Negative letters: Regions Complementary Complementary Needs (ODRs J. Amino acid residues framed in a table: proposed changes The description is similar to heavy chains and labels.) Figure 3 is an evaluation of the therapeutic efficacy of antimicrobial drugs used in the treatment of diabetes.

Psoriasis was performed taking into account the variables infiltration, lesions, erythema and size of the area of the lesions, a degree of severity was established between the values 0 1 - 2; The extension of the treated plates was also considered by measuring 2 of their diameters. A TITLE OF SEVERITY OF PSORIASIS (TSP) similar to PASI (psoriasis area and sevepty index) and response to treatment is stratified according to changes in the TSP upon completion of the designated evaluation times, establishing the following categories: Whitening, Responder, No responder and getting worse. Figure 4 shows the clinical response of patients treated topically with the Monoclonal Antibody íor i contained in the therapeutic formulation at different doses (0.3mg, Irng or 3μg of AcM icr ti) evaluated by PAST, was related to the emergence of J response of human antibodies against murine immunoglobulins (human nti mouse antibody - HAMA). The best response was observed in the group of patients treated with the lower dose of mAb aor tJ (0.3rng), which corresponded to the group with the highest frequency of onset and the highest-grade HAM response. Figure 5 shows the following: treatment was applied with the Monoclonal Antibody íor ti for intravenously to a 56-year-old patient with a history < present Psoriasis with psophasic arthropathy diagnosed approximately 17 years ago, now with Severe Form of Generalized Psoriasis characterized by generalized ternato-lesion lesions, serous and muscular pains, to the general state of fever and generalized edema. Table that does not improve with medical treatment, including Meto rexate. Treatment was applied in a single dose of mAb íor ti at 0.6 rng / l - g of weight intravenously slowly, diluted in 200mL of 0.9% saline solution, simultaneously administered for 2 days, in all lesions, twice per day, therapeutic Dalea containing mAb contains the concentration of 3mg of mAb / g of jelly, for a total of 224g of therapeutic jelly. The clinical, immunohistochemical, and clinical laboratory response was evaluated, and evolutionary photographs of the cut lesions i.lia (internal to the treatment and to the 2J days) are shown.

DETAILED DESCRIPTION OF THE INVENTION Purification of the Murine Monoclonal Antibody The anti-CD6 Monoclonal Antibody (MAb) can be purified from ascitic liquid by Protein A l.'-harose, diluted with an equal volume of L.G M Tampon Glycine, 3M NaCl pH 8.9; balancing the matrix with the same amp 's and api. The same volume of ascites as of buffer should be eluted at a flow rate of 50 mL / h. The column is washed overnight until the base line is zero, with the same buffer. The column is then washed with Acid Tampon Citrus 0.1 M pH 6 to eliminate the TgGl, until the baseline reaches zero, at a flow rate of 50 mL / h (between 2-5 column volumes, approximately 2 hours). 0.1 M Citrus Acid Buffer, pH 5, is applied for the IgG2a (? Or-t).

Humanization of the Huraño Monoclonal Antibody From the anti-CD6 mAbs, variants such as chimeric and humanized antibodies can be constructed from the variable regions of the heavy and Jigera chains of the murmo antibody CTal shi, H. et al. M982) Ce 1 29: 718; Hie + er, P.A. et al. (1980) Cel l 29: 710) Description of the Humanization Method of the Monoclonal Antibody from the Murine Parental Secretory of the Monoclonal Antibody lor ti We obtained a subclone called ist tlA which recognizes the same epitope in the molecule 0DC > . Ior tlA was modified to obtain a less immunogenic monoclonal antibody, by the method described in the European patent application No. 0699755, by means of which the immunogemity of the original antipoint body is also reduced already While it preserves its umon properties to the ligand .. As the antigenicity of a protein is dependent on the presence of T epitopes in them, the immunogenicity of a xenogenic or allogenic antibody could be reduced by replacing the residues included in it. its anti-T-Sequences by the same found in other species, in this case in human immunoglobulins. Of course, the substitution of said residues does not include amino acids of the so-called "Vernier" zone nor those included in the canonical structures. These substitutions can not affect the structural determinants or the contact zones in the FRs and the CDRs in such a way as to guarantee the affinity in the binding to the antigen. r > - Analysis of homology of the non-sanitizable ei This procedure makes use of the available sequences of variable domains of human antibodies compiled by Kabat and colleagues, "Sequences of proteins of Immunological Tnterest "Fifth edi aon, Bethesda, Maryland, National Tnst. of Health, 1994. In the first stage, the variable domain of the light and heavy chains of lor flA upno are compared with the corresponding variable domains of the sequences human. The amino acid sequence of the variable domains of immunoglobulin mura are compared with the sequences of variable regions of human immunoglobulins reported, to identify the human immunoglobulm that has greater homology with the rnupna molecule under analysis. 15 The bases of human sequences used were those reported in GeneBanl-- (Nov 1990) and EMBL (Nov 1990). The program that is used to determine the homology between sequences is the PC-DOS HIBIO PROSTS 06-00, Hitachi. Through this program the sequences are compared and the residues that differ in each one of the positions within Jos frameworl-'S (Kabat, E. (1991) Sequences of proteins of nnunnological interest, Fifth Edition, National Institute of Health) are identified, among the human sequences of most of the hornologaa and the sequence is subjected to analysis. ? _Predication of epitopes T, \ ~ n the < Second stage, the two sequences' "Je regions and noble homologs (mouse and human) are analyzed to predict the sequences antagen cas T. The sequences of the variable domains of the immunoglobulins i inurinas are analyzed with the AMPHI Program (Berzofsl-y et al (.1987) 3. Immunol 138: 2213), which allows the prediction of amphipathic helix, to which has been related the nnnnnu tuity T - Analysis for i nrnunoge reduction. After identifying on the upna sequence the possible T epitopes and identifying the residues responsible for the canonical structures, the residues that are different in both species are replaced in the mupna molecule by those in the same position. in the human immunoglobulin of greater homology these substitutions are made only in those segments that the algorithms predict could be a T epitope and only in the region of Jos Frs. Finally, the substitutions of the residues involved in the canonical structures or in the so-called "Vernier" zone are not included because they can affect the three-dimensional structure of the antibody and therefore affect its binding to the antigen. Additional information on the influence of the substitutions that are made in the tertiary structure can be obtained by molecular analysis of the variable regions. - Method to construct and express the modified antibody. The following procedures are used to prepare sequence * - DNA rocomhi nant e, where amino acids of one species are substituted by amino acids of other species, this * -, mocations are carried out in a chain of the variable region of a i nrnunogl mouse obul. Once the mutations are performed, they are combined with a constant region of a human immunoglobulin and are reduced in an appropriate vector in order to express this less immunogenic antibody in higher cells. a) Mutagenesis in the variable region of both chains of an anti-body. To do this, the necessary changes are introduced to tr-birds of the utagenesis method by overlapping PCR. (Karn an, M. et al., (1989) N? Cleid Acids Res. 17: 5404). b) Preparation of an expression vector containing a human constant region and a variable inurin region, which once the resulting cells have been secreted, secrete the modified immunoglobulin with the desired affinity and specificity. c) Co-transfection of light and heavy chains into appropriate expression vectors in different cell lines. After two weeks, the supernatants resulting from transfection in 96-well plates are analyzed by ELISA detection of human immunoglobulins. The samples that produce human immunoglobulins will be tested in a method capable of detecting the binding of this antibody to its antigen. vit ro ", -" "in ivo." The di6 CD6 mAbs can be used for both in vi tro and in vivo diagnostics in the different clinical forms of Psoriasis, for the evolutionary follow-up of patients after applying therapeutic procedures. localized or systernic, as well as the prediction of relapse, these purified mAbs and d loosened in buffer solution (pH 7.0 «/ - 0.5) containing Sodium Azide (0.01 - 0.2%) and Albumin (0..05 - 0.2%). they can be used to quantify CD6 + T lymphocytes and / or the expression of this molecule on the surface of lymphoid cells in biological fluids (eg, blood, cephalococcal fluid, synovial fluid) incubating between 50 and 200 mL of the sample with amounts between 10 and 30 mL of mAb at concentrations between 0.1 - 3mg / rnL, between 20 and 30 man a »C. Subsequently, it should be washed with a tonic solution and incubated with immunoglobulins from another animal species conjugated with fluorescent substances (Ex: Fluorescema, Ficoeptrina). Anti CD6 can be conjugated directly with fluorescent substances by different methods (Coligan, J.E. et al. (Ed.) Current Protocol s m Irnmunology, National Institutes of Health. Vol.1: 5.3.2. Uiley Interscience) and used for similar purposes to those described, at concentrations between 5 to 30mg /? NL.

Immunohistochemical evaluation of lesions of patients with Ib For this reason, the study of skin lesions or other affected tissues (eg, tears) of patients with Vulgar Psoriasis can be performed on tissue dispositions (eg: not in acetone frin, incubating the AcM «nti CD6 dis? El or between 3 to lOrng / rnL of buffer solution (pH 7.0 * / - 0.5) containing Sodium Azide (0.05 - 0.2%) and Albumin (0 05 - 0.2%) during 30m? N. The samples are then incubated with anti-immunoglobulin conjugate Biotmiled and Biotinylated Biotin-Avidin-Peroxidase complexes (eg: CDal-Ol sheep) for 3nm at room temperature; finally it is revealed with the substrate 3-arnmo-9-eta 1-carbazoi CSi l (Hsu, S.M. et al. (J981) 3. Histochern, Cyfochern, 29: 577). Lae biopsies should be analyzed by 2 specialists and the assessment of CD6 is adjusted to a point scale < 10% (±), 10-25% (+), 25-50% (++), 50-90% (+++), 90-100% Í ++++).

Different mAbs can be used, which are directed against CD lymphocytes, anti CD3 (lor t3), an + i CD4 dor t4), anti CD8 dor t8) and an anti CD45 (lor L3), plus an mAb anfi Factor Receptor of the Epidermal Growth Factor egf / r3) co or activation marker of eratinocytes (Mozzanica, N. et al. (1994) Acta Derrn. Venereol. Suppl. Stock- h. 186: 171), which allows to evaluate in detail the characteristics of the inflammatory infiltrate (lesions in the course of the treatment of the disease.

Follow-up i nrnunohi stoguírní co of lesions of aci n t ratios Patients treated with Monoclonal Anti-CD6 Antibodies can be biopsied of the previous lesions and the beginning of the treatment, during the course of the treatment and after the end of the treatment, in the surrounding area to the initial biopsy to evaluate the therapeutic effectiveness of the compositions for topical or sistern use. The classification scale of the response to treatment can be qualitative in percent and is established by the labeling index of CD6 cells "on the total of CD45 + cells, evaluated in each biopsy.

CD6 + cell number Number of cells CD6 + x J00 Number of CD45 cells * In addition, the labeling rates of CD3 +, CD4 + and CD8 + cells on total CD45 + cells and the labeling index of CD4 + and CD8 + cells on total CD6 + cells can be established. CD3 + cell number = CD3 + cell number x 100 CD45 cell number * CD4 + cell index = CD4 + cell number * x 100 CD45 + cell number CD8 + cell number = CD8 + cell number x 100 CD45 cell number * 10 CD4 + cell number - Number of CD4 + cells x 100 Number of CD6 + cells CD8 + cell number - Number of CD6 + cells x 100 Number of CD6 + cells Follow-up of the agr ical ng of treated patients Another way to evaluate the effect of the therapy with the anti-CD6 mAb could be the inrnunogarnrnagraphic study in the patient of the expression and distribution of the CD6- * cells during the treatment, using 1 and 5rng of the mAb ism conjugated with radioactive isotopes such as Technetium 99, using the conjugation method as described by Mather, SJ et al. (1990) 3. Nucí. Med. 31 (5): 692.

Obtaining therapeutic formulations for topical use and if feared. For therapeutic purposes, anti-CD6 mAbs can be used in the different clinical forms of Psoriasis, both with formulations for topical and systernic use, in single or multiple doses, with one or several treatment cycles according to the clinical form and the severity of the disease. The therapeutic formulations of peak use with anti CD6 mAb can be composed of semi-solid systems in one or two phases, mainly with hydrofalic formulations that allow the incorporation of the dissolved mAb in sterile tarnpon solution (pH 7.0 «/ - 0.5) in dosages between .lrng to 5rng for each gram of product. Gel can be formulated < = -s, jellies, ointments, lotions or creams -.on liquid matrix (eg: water formulated with gelatin, earboxirnet to 1 cellulose or similar substances and bases containing glycemia, calcium gluconate; in addition the compositions may include preservatives ( eg inethyl p-hydroxybenzoate) to avoid contamination, the pH must be physiological so that it does not affect the characteristics of the mAb.These therapeutic compositions should allow the release and penetration of the mAb into the skin. It should be applied one and three times a day, on the covered lesions or not and it can be combined with the systemic use (mainly intravenous) of the same mAb with doses between 0.1 to I g / kg of the patient's weight, it should be diluted in Physiological Solution for endovenous use and administration slowly intravenous treatment can be applied independently to the topical route of administration.

Clinical follow-up of treated patients The clinical evolution of the lesions can be used as the main criterion for evaluating therapeutic efficacy. The main response variables used to measure the effects of treatment may be the improvement of the clinical characteristics of the lesions (infiltration, lesions, erythema) and the reduction of the lesion area. The degree of severity of the signs of the disease (Infiltration, Esca and Erythema) can be established between values 0 - 1 - 2 0- in l yes no 1- scarce presence 2 intense presence Consideration should also be given to the extension of the treated plates by measuring 2 of their diameters and the area of the lesion is calculated with the product of the radii ( in crn) by p (..14), the size of the plate at time 0 represents 100%, and in the successive evaluations the percentage of the plate size is set by rule 3. It is obtained a SEVERITY TITLE OF PSORIASIS (ÍSP) similar to PASI (psoriasis area and sevepty index) (Fredril'sson, T. et al. (1978) Dermatológica 157: 238), with the formula infiltration (0-2) + scales (0-2) * erythema (0-2) x% of affected area 6 The response to treatment is stratified according to the changes in the TSP upon completion of the designated evaluation times, establishing the following categories (Per ns,. et al. (1993) Br. 3. Derrnatol 129: 584): -White (> 90% improvement in the TSP) -Responder (&50% improvement in the TSP) -Not responding (< 50% improvement in the TSP or worsening of the TSP) -Warliness (> 50% increase in the TSP) The t? Ern? Oc of the hista response can be assumed the 12 = emana from the beginning of the application of the treatment (foot treatment, weeks 1, 2, 3, 4, 6, B, 12) EXAMPLES OF REALIZATION: EXAMPLE 1 SEQUENCING OF THE VARIABLE REGION OF THE MONQCLONAL ANTIBODY MURINO íor ti The RNA was extracted from 106 cells of the hybridizer A. It was prepared as described by Faloro et al (Faloro, et al., 1989) Method m Enzirnology 65: 718). -The synthesis reaction of cDNA consists of adding 5rn of RNA, 250rnM of each dNTP, 50nM Tps-Hcl, Ph7.5, 75nm KCl, lOrnM DTT, 3mM MgC12, 25 prols of oligo CG2A FOR (5 ' GGAAGCTTAGACCGATGGGGCTGTTGTTTTG 3 ') for the heavy chain variable region or 25 pmol s of CK2 FOR (5'GGAAGCTTGAAGATGGATACAGTTGGTGCAGC 3') and 15 units of RNAse inhibitor for a total volume of 15 ml, heated at 700C for 10 minutes and slowly cooled to 370C. Then 100 units of reverse transen ptasa (BRL) are added and incubated at 37 ° C for 1 hour. The VH and VK cDNAs were then amplified by PCR, as described by Orlandi et al. (Orlandi, et al (1989) Proc. Nati, Acad. Sci. USA 86: 3833). For the amplification of VH, a reaction mixture is made to which 5 ml of cDNA is added? 5 pinoles of ol i uo CG2A FOR and 25 pmoles of oligo VHl BACK (5 'GGT (G / C) (A / C) A (/) CTGCAG (G / C) GTC (A / T) GG 3 '). For the amplification of VK, the reaction mixture consists of 5 rnl of cDNA, 25 prnol s of CK2 FOR and VK10BACI (5 'TTGAATTCCAGTGATGTTTTGATGACCCA 3'). To these mixtures were added 2.5 inM of each dNTP, 5 rnl of the iOX ampoule of the Ther-molase enzyme and one unit of enzyme, in a final volume of 50 rnl. The reaction mixture was subjected to 25 cycles of denaturation, hybridization and extension at 940C, 550C, and 720C, respectively, with a final incubation of 5 rnin to 720C. 2% agarose gels, stained with etidium bromide were used to visualize the fragments produced by PCR. Said fragments were purified with Prep A gene (Kit of the Bio Rad) and cloned in M13"The clones were sequenced using the method of the di deoxucleotides with T7 DNA polymerase enzyme from Pharmacia (see FIGURES 1 and 2).

EXAMPLE 2 MODIFICATION OF THE SEQUENCE OF THE VARIABLE REGIONS OF THE MONOCLONAL ANTIBODY MURINO ior ti TO OBTAIN AN IMMUNOGLOBULIN LESS IMMUNOGENIC BY HUMANIZATION OF THE POTENTIAL EPITOPES It is part of the knowledge of the sequence of the variable region of the heavy chain of the monoclonal antibody tlA. This sequence was analyzed with the AMPHI program, which determined the regions of 11 amino acids with amphipathic helix structure and therefore the candidate regions to bind to the MHC II molecules. In the variable region of the heavy chain of the α or tlA antibody, 3 fundamental blocks appeared: - FR 1 between amino acids 2 - 21. - CDR1 and FR2 between amino acids 29 - 43. - CDR 3 and FR4 between amino acids 95 - 111. The numbering of the amino acids corresponds to that proposed by Kabat in baee to the invariant amino acids.

In FIGURES 1 and 2 the possible epitopes T are represented.

FIGURE 1 shows the sequences corresponding to the heavy chain. The sequencing is compared with the sequences of human proteins repopulated in the GenBanl-- and EMBL bases, from which the variable region sequence of a human immunoglobulin is extracted, which has greater homology, belonging to to the subgroup III of Kaba. Subsequent to determine those amino acids of the immunoglobulin rnupna that differ from those found in the same position in the human sequence. Both variable regions of heavy chain, human and upna are compared, and amino acids are chosen in the Frs that are not involved in the "Vernier" zone or in the canonical structures and that could be substituted. Positions 13 and 19 are not modified because the amino acid Lys is found in those positions in other human immunoglobulins belonging to the same subgr-upo. For the heavy chain, 4 changes were proposed: THR of position 40 by ALA. GLU of position 42 by GLY., THR < je the position 108 porLEU. LEU of position 109 by VAL. FIGURE 2 shows the previous analysis applied to the light chain of the tlA, resulting in a group of superimposed segments, which predict an antigem zone from amino acid 2 to 69. After the analysis 7 replacements are proposed in the Frs 1 and 2. -LYS in position 3 by GLN. -MET in position 11 by LEU. -TYR in position 12 for SER.

-LEU in position 15 por- VAL. -GLU in position 17 by ASP. -TRP in position 41 for GLY. - SER in position 43 by ALA EXAMPLE 3 CONSTRUCTION OF THE MUTANT BY HUMANIZATION OF EPITOPOS T IN THE VARIABLE REGION OF HEAVY CHAIN OF THE MONOCLONAL ANTIBODY ior tlA Changes in the amino acids of the heavy chain variable region to construct the mutant by humanization of T epitopes were constructed by rnutagenesis overlapping PCRs (Karnman, M. et al, (1989) Proc. Nati. Acad. Sci. USA 86, 4220). Briefly, two PCR amplifications: The reaction mixture was: 0.5 rnl of single chain VH supernatant cloned in M13, 25 pmoles of mutager oligos 1 or 2, 25 pmoles of rnutagenico oligo 3 or 4 (see below the sequences of the oligos). To these mixtures were added 2.5 mM each of dATP, dTTP, dCTP, dGTP, 5 ml of the 10X buffer of the Vent DNA polymer-ase (NEB) and a unit of DNA polymerase Vent (NEB) in a final volume of 50 rnl . Samples were submitted between 12-15 cycles of POP (940C, 30 sec, 50 ° C, 30 sec and 75 <C, 1 min), with a final incubation of 75 ° C for 5 min. The products of both PCRs are joined in a second PCR using only the 2G outside oligos < 1 and 4). The amplified incubating VH was purified by Prep. A gene pupf ication 1-? Ti üio Rad)., For the changes of positions 40 and 42, the oligos used were the following: OH I 1: 5 'TGG GTT CGC CAG GCT CCG GGG AAG AGG CTG GAG? J Oligo 3 5 'GTAAAACGACGCCCAGT'. These smells were combined in a single PCR. Olí go 2: 5 'CTC CAG CCT CTT CCC CGG AGC CTG GCG AAC CCA 3' 011 or 4: 'AGCGGATAACAATTTCACACAGGA'. These oligos were combined in a single PCR. The products of both PCRs are used in a single PCR using oligos 3 and 4.

For the changes in positions 108 and 109 the oligos designed were: Oli or 1: 5 'GGC CAA GGC ACC CTT GTC ACC GTC TCC'. Oligo 3: 5 'GTAAAACGACGGCCAGT 3'. These oligos were combined in a single PCR.

Oligo 2: r GGA GAC GGT GAC AAG GGT GCC TTG GCC V. 01 i or 4: 5 'AGCGGATAACAATTTCACACAGGA'. These smells were combined in only PCR. The pr-oducts of both PCRs are used in a single PCR using symbols D and 4. For the light chain the changes in the FR1 in residues 3, 11, 12, 15 and 17 the designed oligos were the following: Oligote: 'TGTGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCGGTGGGAGACAGAGTCA CC 3 'Oli go 3: 5 OTAAAAC6ACGGCCAGT3' .. These oligos are combined in a sol or PCR. Ol i go 2: 5 'GGTGACTCTGT CTCCCACCGATGCAGACA6GGAGGATGGAGACTGGGTCATCTGGATGTCA CA 3 'Oligo 4: 5? CTGGCCGTCGTTTTAC3'. These oligos are combined in a single PCR. The product of both PCRe are combined in a PCR using olios 3 and 4. For the proposed changes in residues 41 and 43 of the FR2, the oligos were: Olago 1: 5 'CAGAAACCAGG6AAAGCTCCTAAGACCCTG 3' Oligo 3: 5 'GTAAAACGACGGCCAT3 ' These choices are made in a single PCR. 0. 1 igo 2: 5 'CAGGGTCTTAGGAGCTTTCCCTGGTTTCTG 3' Oli or 4: 5 'ACTGGCCGTCGTTTTAC3'. These smells are combined in a single PCR.

The product of both PCRs are combined in a PCR using the ol. 3 and 4 EXAMPLE 4 OBTAINING A PHARMACEUTICAL FORMULATION FOR TOPICAL USE IN SKIN LESIONS OF PATIENTS WITH VULGAR PSORIASIS The MBA was purified and obtained in solution in sterile solution (pH 7.0 +/- 0.5). Ingredients Amount Quality AcM IOG ti 50 ing * Sodium phosphate monobasic 4.50 rng reactive USPXXII Dibasic sodium phosphate? 18 mg reactant USPXXTI Sodium Chloride 86 ing reagent USPXXII Poly sorbate 80 1,852 mi USPXXTI A g ua pa r < ~ injection c s p 10 rnl USPXXI r * according to manufacturer's quality specifications The solution containing the mAb was incorporated into a Jelly Base with the composition: -Carboxirnet sodium lcellulose (alpha viscosity) A / V 3.00 g -Propylene glycol 10.00 g -Me < 11 pa rabeno 0. i 8 D < j -Paracil parabeno 0.020 g -Tpetanolarnina 0.045 g - Distilled water c.s. to complete 100. 00 g The therapeutic jelly was elaborated with tarnpon solution with similar composition to that described for the MAb (pH 7.0 +/- 0.5) EXAMPLE 5 HISTOLOGICAL STUDY OF CUT NEAS INJURIES OF PATIENTS WITH PSORIASIS VULGAR l study inrnunohi stoqu? m.? The cutaneous lesions of patients with Vulgar Psoriasis were carried out on cryosections, 7e used mAb íor ti in parallel with different mAbs directed cont or CD of lymphocytes T lor t.3 (anti CÜ3), íor t4 (ar .ti CD4), 101 +.8 (anti CD8), íor 1.3 ianti CD45) and Dale CDB (anta CD6) as control, plus the lor egf / r3 (a receptor of the Growth Factor into Fpa dertn? co). The samples were then incubated with Biotylated Murmus Antimicrobial Conjugate and Biotin-Avidin-Perexidascí Complex [Doka], finally revealed with 3-a? N? No-9-eti i-carbazole rsigrna]. Biopsies were analyzed. by 2 specialists and adjusted the evaluation of CD6 at a point scale: < 10% (±), 10-25% (+), 25-50% (++), 50-90% (+++), 90-100% (++++). In the treated patients, lesions were biopsied prior to the start of treatment and at the end of the third week of treatment, in the area surrounding the initial biopsy. The classification scale of the treatment response was qualitative in percent and was established by the OD6- * cell labeling index on the total CD45 + cells, evaluated in each biopsy. The percentage of expression of the receptor of the Cre Credential, Epidermal Factor i was also determined. n the different v.aps of the skin as well as modifications of the typical histological characteristics of the disease, -CD3 + lymphocytes represent approximately 100% of the CD45 + cells. -It was found that in the inflammatory infiltrate characteristic of Vulgar Psoriasis there is expression between 60-90% of cells with T-lymphoid phenotype Cüfi ^, -Of the cells marked with the Monoclonal Antibody Dalo CD6 only between 30-50% were marked with Monolonal Antibody lor t 1. -Expression in keratomocytes of EGF receptor was elevated with reticulate pattern. It is significant the predominance of expression of the CD6 + molecule in the T lymphocytes of the inflammatory infiltrate of Vulgar Psoriasis, as it is a characteristic molecule of activated T lymphocytes, this leads us to think that it can constitute a leukocyte adhesion molecule in the T-lymphocytes. Initially activated in skin by the penetration of exogenous or modified antigens, necessary for the interaction with specific cellular determinants of the skin activated during the response to said antigens. The difference in recognition observed between the monoclonal anti-CD6 antibodies evaluated, supports the approach of the epitope difference recognized by the íor ti. 1 EXAMPLE 6 CLINICAL RESPONSE OF PATIENTS WITH PSORIASIS VULGAR TO TOPICAL THERAPEUTICS WITH MA MA Clinical Trial was performed in patients with Vulgar Psoriasis- diagnosed, in relapse, with characteristic lesions of this disease. The study was structured in groups of patients defined by the jelly that received topical treatment (mAb lor ti or vehicle) and 14 patients were included por-gr-upo.Tic therapeutic formulation was used formed by a base jelly or vehicle (Carboxirneti Ice-ligh sodium A / V, Propylene glycol, Methiiparaben, Propylparaben, Tpetanolami na) on which the MAb was incorporated Treatment was applied twice a day without occlusion of the lesions treated, for 21 days. psoriatic lesions in plaques treated with mAb lor tl (FIGURE 4) This result corresponds to what was observed in the post-triage biopsy performed only 21 days after the start of the application of the MAb, where a decrease in the infiltration of the mucosa was found. T, decreased expression of the EGF receptor in keratomocytes and regression of the characteristic histological signs of the disease.

EXAMPLE 7 RELATION OF THE CLINICAL RESPONSE TO THE DOSE OF MONOCLONAL ANTIBODY MURINE lor ti APPLIED TYPICALLY IN PATIENTS WITH VULGAR PSORIASIS Clinical Trial was carried out in 19 patients with Vulgar Psoriasis diagnosed in relapse, with characteristic lesions of this disease. The study was structured in three groups of patients defined by the concentration of monochorionic antibody contained in the therapeutic formulation that they received as topical treatment (0.3 mg, lmg or 3 mg of mAb lor ti) and 6, 7 and b patients respectively were included. per group. A topical therapeutic formulation was used, consisting of a base jelly or vehicle (Carboxymethylcellulose sodium A / V, Propylene glycol, Metiiparaben, Propi Iparaben, Tpetanolarnin) on which the MAb was incorporated. The treatment was applied 2 times a day without occlusion of the lesions treated, for 21 days. The clinical evolution of the patients was evaluated using the PASI (Psopatic Area and Sevepty Index) and simultaneously c-e analyzed in the serum of these patients the appearance of the human antibody response against the human immuno- ulin antibodies (HAMA). The best case was observed in the group of patients treated with the lower dose of the MAb jor ti (0.3rng), which corresponded to the group with the highest frequency of appearance and the largest titles of HAME reepueeta. The presence of antidiarrheal antibodies (anti-AcM lor ti) was also evaluated by the FLI A method (Enzyme Linked Immunosorbent Assay) and by FACS iFl uor-escent Act ivating Cell Sorb) and was observed frequency of ap? -? tion and a greater degree of response (ie antibodies against the immune system in the same or group of patients.

EXAMPLE 8 CLINICAL RESPONSE OF A PATIENT WITH A SEVERE FORM OF PSORIASIS GENERALIZED TO DRUG-THERAPEUTIC THERAPY WITH THE ACM ior ti A 56-year-old female patient with a history of Psoriasis with psopasic arthropathy diagnosed approximately 17 years ago, in the last 5 years with frequent and intense seizures, for which she has received several admissions. It begins with an outbreak of the disease, with generalized erythein + o-lousy lesions, serous and muscular pains, general state, low-grade fever and generalized edema, this picture is maintained and 21 days later it appears in submammal, axillary folds and in the neck Fatal injuries with exuicerations with serous and fever sedation, accompanied by fever. Because of the rapid evolution of the disease, no tolerance to any topical treatment including steroid creams was decided to administer treatment with Metot rexate (total dose 15rng) 3 cycles, with no clinical response. -One single dose of MAb to 0.6 mg / 1 g of weight per intravenous slow, diluted in 200 mL of 0.9% Saline Solution. - imulti neously was administered during 2 days, in all the lesions, twice a day, therapeutic jelly containing the mAb? or- '1 to the concentration of 3mg of mAb / g of .laic From day 6 of being performed the Treatment The patient begins to improve her general condition and dermatological condition. It was evaluated 21 days after the treatment and presented approximately 60% of the body surface without lesions and the rest of the skin with improvement of the clinical signs of the disease, the patient referred improvement of the articular synodontology; He presents good general condition, normal vital signs and routine tests of the clinical laboratory without alterations. Thirty days later, the patient stays with complete regression of the synfornatology of the disease. The result of the expression of the CD6 antigen in lymphocytes of the inflammatory infiltrate characteristic of cutaneous lesions of patients with Vulgar Psoriasis is presented. This evaluation was carried out in skin freeze biopsies with lesions located in the upper and / or lower limbs and / or thorax-abdomen in the form of plaques. The histological evaluation was carried out prior to the treatment by techniques of i nmunoha sf oqu i rn i cß > ...

CUABRO 1 CUflDRO BE RESULTS BE Lfl EXPRESSION BEL ANTI6EN0 CDS IN INFLAMATORY BEL INFILTRATED LYMPHOCYTES CHARACTERISTICS BE THE SKIN INJURIES OF PATIENTS WITH VULGAR PSORIASIS 15 20: > R 30 35

Claims (3)

NOVELTY OF THE INVENTION CLAIMS

1. Inonoclonal antibodies that recognize human CD6 characterized because they are useful for the diagnosis and treatment of Psoriasis.

2. Monoclonal antibodies that recognize human CD6 according to claim 1, characterized in that they are subclones of murine monoclonal antibodies called lor ti,? Or tlA, as well as any humanized vanant obtained from them.

3. Monoclonal antibodies according to claims 1 and 2 characterized in that the subclone lor ti A obtained from the hibrandna of the same name (pending Deposit Number) has a variable region of its heavy chain whose sequence is: Glu Val ein Leu Val Glu Ser Gly Gly Glv Leu Val Lys Pro Gly Gly Ser Leu Lys Leu Ser Cye Wing Wing Gly Phe Lys Phe Ser Arg Tyr Wing Net Ser Trp Val Arg Gln Thr Pro Glu Lys flrg Leu Glu Trp Val Wing Thr He Ser Ser Gly Gly Ser Tyr lie Tyr Tyr Pro Asp Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Asn Val Lys Asn Thr Leu Tyr Leu Gln net Ser Ser Leu Arg Ser Glu Asp Thr Wing Met Tyr Tyr Cys Wing Arg Arg Asp Tyr Asp Leu flsp Tyr Phe Asp Being Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Being and the variable region of its light chain has a sequence corresponding to: Asp He I and s Met Thr Gln Ser Pro Ser Ser Met Tyr Ala Ser Leu GJy Glu Arg Val Thr Tie Thr Cys Lys Wing Arg Asp Tie Arg Ser Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Trp Lys Ser Pro Lys Thr Leu lie Tyr Tyr Ala Thr Ser Leu Ala Aep Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser-Leu Thr Be Ser Leu Glu Be Asp Asp Thr Wing Thr- Tyr Tyr Cys Leu Gln His Gly Glu Ser Pro Phe Thr Phe Gly Ser- Gly Thr Lys Leu Glu He Lys Arg Ala 4 .. - Rnonocl onalee antibodies according to claims 1 to 3, characterized by being a humanized variant of the subclone ior tlA whose variable region of its heavy chain has the sequence : 61U Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Lys Leu Ser Cys Wing Wing Ser Gly Phe Lys Phe Ser Arg Tyr Wing net Ser Trp Val Arg 61n Wing Pro Gly Lys Arg Leu Glu Trp Val Wing Thr I've Been Ser Gly Gly Being Tyr I've Tyr Tyr Pro Asp Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Asn Val Lys Asn Thr Leu Tyr Leu 61n net Ser Ser Leu Arg Ser 61u Asp Thr Wing Net Tyr Tyr Cys Wing Arg Arg Asp Tyr Asp Leu Asp Tyr Phe Asp Ser Trp GH-Glr, Gly Thr Leu Val Thr Val Ser Ser and the sequence of the v riable region of its csi ena lie corresponds to: Asp Tie Gln Met Thr Gln Ser- Pro r.er Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Lie Thr Cys Lys Wing Being Arg Asp He Arg Being Tyr Leu Thr Trp Tyr Gln Gln Lys Pro Gly Lye Wing Pro Lys Thr Leu He Tyr Tyr Ala Thr Ser Leu Ala Aep Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr- Ser Leu Thr lie Be Ser Leu Glu Be Asp Asp Thr Ala Thr Tyr- Tyr Cys Leu Gln Hie Gly Glu Ser Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu Glu He Lys Arg Ala 5. Monoclonal antibodies according to claims 1 to 4 characterized in that said monoclonal antibodies recognize in the human CD6 molecule an epitope of stable conformation and insensitive to reducing agents. 6. Monoclonal antibodies according to claims 1 to 3 characterized in that it is IgG2a isotype. 7. Humanized monoclonal antibodies according to claim 5, characterized in that they are IgGl isotype. 8. Ueo of the antibodies of claims 1 to 4 for the manufacture of a drug useful in the treatment of psoriasis. 9. Use of the antibodies of claims 1 to 4 for the manufacture of a reagent useful in the diagnosis "ín vifro" of Psoriasis. 10. Pharmaceutical composition for the treatment of Psoriasis characterized in that it contains one of the monoclonal antibodies of claims 1 to 4 and a pharmaceutically acceptable carrier therefor. Ll.- Reagent for the diagnosis of Psoriasis characterized in that it contains one of the monoclonal antibodies of the claims 1 to Ja k and a pharmaceutically acceptable vehicle for them.