MXPA97003889A - Peptido rantes and fragments and compositions that contain it, for the treatment of inflamac - Google Patents

Abstract

Modifications to RANTES may result in the modified polypeptide that acts as a RANTES or MIP-1alpha antagonist. Such antagonists can be used in therapy to reduce inflammation. These can also be useful in the study of the properties of RANTES or MIP-1al

Description

PEPTIDO RANTES AND FRAGMENTS AND COMPOSITIONS THAT CONTAIN IT, FOR THE TREATMENT OF INFLAMMATION The present invention relates to RANTES derivatives and their uses. The protein known as RANTES was originally cloned by Schall TJ et al., (J. Immunol., 141 1018-1025 (1988) in Krensky's laboratory at the Stanford University School of Medicine.) The term RANTES is derived from the phrase "Raised on activation, normal T-cell derived and secreted" (derived and secreted normal T cell produced by activation) (relevant underlined letters) Its expression is inducible by stimulation with antigen or mutagen activation of T cells. is a member of the chemokine superfamily (Schall TJ Cytokine 3 165-183 (1991), Oppenheim, JJ and collaborators Ann. Rev. Immunol., 9 617-48 (1991).) Pure protein was first identified in 1992 in platelets.

(Kameyoshi et al., J. Exp. Med 176 587-592 (1992)). "This is a potent attractant for eosinophils, CD4 + CD45RO + T cells, and also for monocytes, which has a sequence of sixty-eight amino acids.

REP: 24700 A receiver for RANTES has recently been cloned (Gao, JL and collaborators J. Exp. Med. 177 1421-7 (1993); Neote, K., et al., Cell 72 415-25 (1993)) - and it has been shown that it binds to chemokines in the power order range of MIP-la > RANTES. The present invention provides polypeptides that are antagonists of RANTES and / or MlP-la. Despite considerable interest in cytokines in general, and the work discussed above on RANTES and RANTES receptors in particular, prior to the present invention there was no description of the above antagonists or the possible utilities of such antagonists. According to the present invention, there is provided a polypeptide having substantial amino acid sequence homology with RANTES, and which functions as an antagonist for RANTES and / or for MlP-la with respect to one or more of the following. (a) chemotaxis of THP-1 cells in response to RANTES and / or in response to MlP-la; (b) the mobilization of calcium ions in THP-1 cells due to the presence of RANTES and / or due to the presence of MlP-la; and (c) the binding of RANTES and / or MlP-la to the THP-1 cell receptors.

The polypeptides provided by the present invention are useful in further characterization of RANTES and its effects - for example in the study of chemotaxis induced by RANTES, the mobilization of calcium ions and the binding to receptors. These are also useful in characterizing the binding of RANTES to its receptors. These are useful in the study of MlP-la for the corresponding reasons. In addition, the polypeptides of the present invention are believed to be useful in the treatment of various diseases, as will be discussed below. A preferred polypeptide of the present invention acts as an antagonist for RANTES and / or for MlP-la, due to the presence of one or more N-terminal amino acids (which are not present in the corresponding position in RANTES, and which by therefore, they can be considered as additional N-terminal amino acids, in relation to those present at the N-terminus of RANTES). These N-terminal amino acids are preferably amino acids (L-) of natural origin (which can be incorporated by the use of recombinant DNA techniques or by peptide fusion techniques). However, amino acids of non-natural origin (eg, D-amino acids) can also be used. These can be incorporated through the use of chemical synthesis techniques. There can be only one such additional amino acid, in which case it can be Leucine or Methionine, for example. Such polypeptides can be prepared by any appropriate techniques (e.g., by the use of gene cloning techniques), chemical synthesis etc.). In one embodiment of the present invention, these are prepared by providing a larger polypeptide comprising a desired sequence, and then using enzymatic cleavage to produce a polypeptide consisting of the desired sequence. The polypeptides of the present invention may comprise more than one additional N-terminal amino acid, for example, these may include up to five, up to ten or up to twenty additional amino acids. In some cases, up to twenty additional N-terminal amino acids may be present.

Again, any suitable techniques can be used to prepare such polypeptides. The various aspects of the present invention will now be discussed in further detail. The present inventors have discovered that by using an E. coli expression system, designed to express RANTES in a form corresponding to mature human RANTES (for example with the deleted signal sequence), a polypeptide was expressed in which a methionine was present. Additional N-terminal (this one was not excised from the remaining sequence by the endogenous proteases of E. coli). It was surprisingly found that the presence of this additional amino acid substantially changed the characteristics of the polypeptide relative to those of RANTES. The methionylated polypeptide (referred to herein as methionylated RANTES or Met-RANTES) was found to act as an antagonist of RANTES and MlP-la in various assays, and was not found to have a substantial agonist activity. It should be appreciated that in many cases where N-terminal methionylation occurs in E. coli, this has little or no difference with the properties or results of the polypeptide therein, merely having reduced levels of its previous biological activity. It was therefore found entirely unexpectedly that N-terminal methionylation could, in the case of the present invention, effectively result in antagonist activity. In order to determine whether this effect was limited or not to the presence of an N-terminal methionine, another polypeptide was produced, in which the N-terminal methionine was replaced with an N-terminal Leucine. Again, it was found that this acts as a RANTES antagonist, as was an additional polypeptide in which the N-terminal methionine was replaced with N-terminal glutamine. In a preferred form, the polypeptide of the present invention has the sequence: (i) MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR QVCANPEKK VREYINSLEM S (sometimes referred to herein as "Met-RANTES") (ii) LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR QVCANPEKKW VREYINSLEM S (sometimes referred to herein as "Leu-RANTES") (iii) QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR QVCANPEKKW VREYINSLEM S (sometimes referred to herein as "Gln-RANTES") or has a sequence that is substantially homologous with any of the above sequences. The polypeptide can be in a glycosylated or non-glycosylated form. The term "substantially homologous" when used herein, includes amino acid sequences that have at least 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% sequential homology with the given sequence (in the order of preference). This term may include, but is not limited to, the amino acid sequences having from 1 to 20, from 1 to 10 or from 1 to 5 deletions, insertions or substitutions of single amino acids, relative to a given sequence - with the proviso that the resulting polypeptide acts as a RANTES or MlP-la antagonist. The polypeptide can be in a substantially pure form. This can be isolated from polypeptides of natural origin. It should be noted that it is well known in the art that certain amino acids can be replaced with others, resulting in no substantial change in the properties of a polypeptide.

Such possibilities are within the scope of the present invention. It should be noted that amino acid deletions or insertions can often be performed, which do not substantially change the properties of a polypeptide. The present invention includes such deletions or insertions (which may be, for example, up to 10, 20 or 50% of the length of the sequence of the specific antagonists, given above). The present invention also includes within its scope the fusion proteins in which the polypeptides of the present invention are fused to another portion. This can be done, for example, for marking purposes or for a medicinal purpose. The present inventors have demonstrated that a polypeptide of the present invention can act as an antagonist for the effects of RANTES or MlP-la in chemotaxis, calcium mobilization and receptor binding in THP-1 cells (a line of monocytic cells) . These cells are available from the ATCC (North American Tissue Culture Collection) and act as a good model system for studying RANTES because they show calcium responses and chemotactic responses to RANTES and MlP-la, as well as to other chemokines such as MCP-1. The polypeptide can act as a RANTES or MlP-la antagonist in chemotaxis, calcium mobilization and receptor binding in these cells. MlP-la was originally identified as part of an inflammatory polypeptide fraction of macrophages (which was divided into MlP-la, and -ß) (Obaru, K et al., J. Biochem 99: 885-894 (1988). PF et al J. Immunol 142: 1582-1590 (1989)). This shows chemotactic activity towards T cells and monocytes. It has also been shown to be a potent inhibitor of the proliferation of totipotential cells. Based on these observations, it is believed that the polypeptides of the present invention may be useful in blocking the effects of RANTES and / or MlP-la, and may therefore be of use in therapy. A preferred use of the polypeptides of the present invention is in blocking the effects of RANTES and / or MlP-la in the recruitment and / or activation of proinflammatory cells. The present invention can therefore be useful in the treatment of diseases such as asthma, allergic rhinitis, atopic dermatitis, atheroma / atherosclerosis and rheumatoid arthritis. In addition to the polypeptides discussed above, the present invention also covers the DNA sequences encoding such polypeptides (which may be in the isolated or recombinant form), vectors incorporating such sequences and host cells that incorporate such vectors, which are capable of expressing the polypeptides of the present invention. The polypeptides of the present invention can be produced by expression from prokaryotic or eukaryotic host cells, using an appropriate DNA purification sequence. Appropriate techniques are described in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, Laboratory Press. USES. Alternatively, these can be produced by the covalent modification of RANTES. This can be done, for example, by the methionylation of RANTES as its N-terminus. The present invention will now be described by way of example only, with reference to the accompanying drawings, wherein: Figure 1 shows a nucleotide sequence of a RANTES coding sequence, which was cloned in E. coli, together with the amino acid sequence encoded by this nucleotide sequence.

Figure 2 shows a map of the pCBA-M plasmid.

Figure 3 shows a map of the pT7- plasmid Figure 4 shows that various chemokines can induce chemotaxis in THP-1 cells.

Figure 5 shows that Met-RANTES can inhibit the chemotaxis induced by MlP-la and RANTES, in THP-1 cells.

Figure 6 shows that various chemokines can induce calcium flow in THP-1 cells.

Figure 7 shows that Met-RANTES can inhibit a calcium response induced by RANTES in THP-1 cells.

Figure 8 shows the competitive binding of Met-RANTES with RANTES for CCKR1 receptors.

Figure 9 shows that Leu-RANTES can act as an antagonist for chemotaxis induced by RANTES.

Figure 10 shows that Gln-RANTES can act as an antagonist for chemotaxis induced by RANTES.

EXAMPLE (a) Cloning of the human RANTES coding sequence, by PCR Human RANTES was cloned from a genomic cDNA? GTll library of human bone marrow (Clontech) by PCR. In summary, the inserts of Total cDNA in the bone marrow genomic library were first amplified using? GTll primers which flanked the EcoRI cloning site in a 100 μl reaction containing 2 μl phage stock (106 pfu's), 10 mM Tris-HCL pH 8.3 , KCl 50 mM, MgCl2, 1.5 mM, 0.2 mM dNTPs, 2.5 units of AMPLITAQMR (Perkin er-Cetus) and 1 μm of each primer (? GTllPCR-1) (forward primer) 5 'GATTGGTGGCGACGACTCCT and? GTHPCR-2 (reverse primer) 5' CAACTGGTAATGGTAGCGAC) for 30 cycles of 95 ° C 2 minutes, 55 ° C 2 minutes and 72 ° C 5 minutes, in a Techne PHC-2 thermal cycler. One tenth of the reaction mixture was then subjected to a second round of PCR in a 100 μl reaction, now containing 1 μm of each of the specific primers (RANTES-1 5 'CCATGAAGGTCTCCGCGGCAC sense and RANTES-2 5' CCTAGCTCATCTCCAAAGAG antisense ) based on the published sequence of RANTES (Schall TJ et al. (J. Immunol., 141 1018-1025 (1988)) for 30 cycles of 95 ° C 2 minutes, 55 ° C 2 minutes and 72 ° C 2 minutes. PCR products are visualized on agarose gels with 3% Nu-Sieve (FMC) stained with ethidium bromide at 0.5 μg / ml and the bands that migrated to a predicted size of the RANTES cDNA (278 base pairs) were purified gel by standard methods (Sambrook J. et al., (1989) Molecular Cloning - A Laboratory Manual, Cold Spring Harbor, Laboratory Press, USA) The gel-purified DNA was then blunted at the ends by sequential treatment with the polynucleotide -Kinase T4 (New England Biolabs) of acuer to the instructions of the manufacturers, in a total volume of 50 μl per hour at 37 ° C. After this time, 2.5 μl of 2.5 mM dNTPs and 1 μl of Kleno fragment of E DNA polymerase I were added. coli (New England Biolabs) and incubation continued for an additional 30 minutes to 37 ° C. The reaction mixture was then inactivated by heat at 70 ° C for 30 minutes, and then extracted once with Tris-HCl pH 8.0 with saturated phenol / chloroform (1: 1 v / v). The DNA was precipitated by the addition of 10 μl of 3M sodium acetate pH 5.5, 1 μl of glycogen (20 mg / ml) (Boehringer) and 250 μl of ethanol at -20 ° C. The DNA was recovered by centrifugation at 10,000 x g for 20 minutes at 4 ° C, and washed with 70% ethanol. The final button was resuspended in sterile water at a concentration of 10 ng / μl. The blunt ended PCR product (10 ng) was ligated to 50 ng of plasmid pBluescipt II SK treated with alkaline phosphatase, digested with EcoRV (Stratagene) in a volume of 20 μl using 2 μl of T4 DNA ligase (400,000 units / ml) (New Englands Biolabs) for at least 16 hours at 15 ° C. The ligation products were diluted to 100 μl with 1 X TE (10 mM Tris-HCl, pH 8.0 / 1 mM EDTA) and phenol / chloroform extracted as previously described. The ligation products were precipitated by the addition of 10 μl of 3M sodium acetate, pH 5.5, lμl of glycogen (20 mg / ml) and 250 μl of ethanol for 15 minutes at -70 ° C. The DNA was recovered by centrifugation as described above and resuspended in 10 μl of sterile water. The resuspended ligating products were then subjected to electroporesis in E. coli strain XL-1 blue electrocompetent (40 μl) using a Bio Rad Gene pulsator according to the instructions of the manufacturers. After electroporation, 1 ml of LB medium was added and the cells were grown at 37 ° C for one hour. After this time, aliquots of 100 μl of culture medium were plated onto LB plates containing 100 μg / ml ampicillin, and grown for 16 hours at 37 ° C. Individual bacterial colonies were collected in 5 ml of LB medium containing 100 μg / ml ampicillin, and grown overnight at 37 ° C. Small-scale plasmid DNA preparations (mini preps) were then made from 3 ml of each culture using a WizzardTM mini-prep DNA purification system (Promega) according to the manufacturer's instructions. Aliquots of 3 μl of mini-prep DNA were then digested with restriction enzymes . { HindII and EcoRI) (both from New England Biolabs) according to the instructions of the manufacturers, in a reaction volume of 15 μl. The reaction products were analyzed on 1% agarose gels containing 0.5 μg / ml ethidium bromide. The mini-prep DNAs which produced an insert size of approximately 280 base pairs, were then subjected to DNA sequence analysis using primers T3 and T7 and Sequenase (USB) according to the instructions of the manufacturers. The cloning vector pBluescript II SK- was prepared as follows: 20 μg of plasmid purified by gradient of CsCl were digested in a reaction volume of 100 μl for 2 hours at 37 ° C with 200 units of EcoRV (New England Biolabs) from according to the instructions of the manufacturers. After 2 hours, the digested vector was treated with 10 μl of calf intestinal alkaline phosphatase (20 units / ml) (Boehringer) for an additional 30 minutes at 37 ° C. The reaction mixture was then quenched by heating at 68 ° C for 15 minutes, and then extracted once with Tris-HCl pH 8.0 saturated phenol / chloroform (1: 1 v / v). Plasmid DNA was precipitated by addition of 10 μl of 3M sodium acetate, pH 5.5, and 250 μl of ethanol at -20 ° C. The DNA was recovered by centrifugation at 10,000 X g for 20 minutes at 4 ° C, and washed with 70% ethanol. The final button was resuspended in sterile water at a concentration of 50 ng / ml.

Sequencing revealed that all clones obtained were identical to the published sequence, except for a single base change at nucleotide 22 in the PCR sequence, which could result in a change from Arg to Pro in the proposed signal sequence. of the RANTES propeptide. This is illustrated in Figure 1 where, the cloned DNA coding sequence is given, along with the corresponding amino acid sequence. (b) Preparation of an expression vector for methionylated RANTES (a RANTES antagonist) The construction containing the gene for RANTES was subjected to PCR using the primers 'TTAATTAATTAAATCGATTCATAG. CBT. CCA. TAT CBT. TCG. GAC .AC-3 'where the two underlined sections are a Clal restriction site and an Ndel restriction site, respectively (the Ndel site that includes the part of an initiating metiotine codon) and '-TACTGATATAATCTAGACTAGCTCATCTCCAAAGAGTTG-3 'This fragment was then cleaved with Clal at the 5' end and with Xbal at the 3 'end. Plasmid pCba-M, which is shown in Figure 2, was then cleaved with Xbal / Sall. The large fragment was then excised with Salí and Clal. Subsequently, a three-way ligature was carried out using the small Sall / Xbal fragment from the first digestion, the Sall / Clal fragment from the second digestion, and the PCR fragment, to produce a construction similar to pCba-M where the mTNF gene was replaced by that for the secreted form of human RANTES, beginning with an initiating methionine. (The secreted form of human RANTES does not include the first twenty-three amino acids of the amino acid sequence shown in Figure 1. This includes the remaining amino acids shown in Figure 1, and begins with the amino acids SPY ...). This Ndel / Sall fragment was then removed from this vector and placed in the plasmid pT7-7 of T7 expression, which is shown in Figure 3. This fragment contains the gene of interest plus 600 base pairs of another material, but Subsequent experiments (not included in the present) showed that the removal of the other material (vector sequences) had no effect on expression levels.

The expression vector type pT7 is discussed by Studier FW, Rosenberg AH et al, in Meth Enzymol, 185, 60-89, (1990). The construct was then transformed into E. coli strain BL21 (DE3) (F. ompT, hsd sB 5 (rB ~, mB ~) containing the LysS gene on the plasmid pACYC184 (Chan and Cohen, J. Bact, 134, 1141 , 1978) The expression vector requires the T7 polymerase to be induced in order for protein expression to take place.T7 polymerase is induced in the cells by the addition of IPTG (isopropylthiogalactoside) to the medium. (c) Demonstration that met-RANTES does not actually show Antagonist Activities L5 (i) Chemotaxis Assay Chemotaxis in vi tro was carried out using 96-well chambers (from the Neuro Probé MB series, Cabin John, MD 20818, USA) according to the 20 instructions of the manufacturers. The chemotaxis induced by the CC, RANTES, MlP-la and MCP-1 chemokines was tested using a human monocytic cell line, THP-1. 4X105 THP-1 cells in 200 μl of RPMI 1640 medium (Gibco) containing 2% inactivated 25-fetal calf serum were incubated in each well of the upper chamber. In the lower chamber, 370 μl of RPMI 1640 medium (without FCS) containing the chemoattractant (for example chemokine) was placed in appropriate dilutions. For the inhibition of chemotaxis, the chemoattractant was maintained at a constant concentration of 5x the EC5o, previously determined for each chemokine, and Met-RANTES was added at varying concentrations. The chambers were incubated for 1 hour at 37 ° C under 5% C02. The medium was removed from the upper chamber and replaced with PBS containing 20 mM EDTA, and the chambers were incubated for 30 minutes at 4 ° C. The PBS was removed from the upper wells which were then rubbed to dryness. The unit was centrifuged for 10 minutes at 1800 rpm to harvest the cells from the lower chamber, and the supernatant was removed by aspiration. Cells in the lower chambers were measured using the Cell Titer 96MR Non-Radioactive Cell Proliferation Assay (Promega, Madison USA) which periodically verifies the conversion of tetrazolium blue to its formazan product. 100 μl of a 10% solution of the dye in RPMI 1640 medium was added to each well, and the chamber was incubated overnight at 37 ° C under 5% C02. 100 μl of the solubilization solution was then added to each well, and the absorbance was read at 500 nm after 4 hours in a Thermomax microtiter plate vector (Molecular Devices, Palo Alto, CA). The results are shown in Figure 4 and in Figure 5. (ii) Calcium Flow The calcium flux induced by the chemokines, RANTES and MlP-la was measured according to Tsien RY, Pozzan T., and Rink T J., (1982) "ho calcium eostasis in intact lymphocytes: cytoplasmic free calcium verified periodically with a new fluorescent indicator intracellularly trapped "J Cell Biology 94) but using Fura-2 / AM (Fluka) instead of Quin2 as the fluorescent indicator. THP-1 cells were harvested at less than lOVml to ensure that they were in the exponential phase. Cells were resuspended in Krebs-Ringer solution containing 0.2% Fura-2 / AM and 1 mg / ml BSA, at a concentration of 106 / ml, and incubated at 37 ° C for 30 minutes in the absence of light . The cells were harvested by centrifugation and resuspended in Krebs-Ringer solution and kept on ice. Aliquots of 1 ml were incubated at 37 ° C for 2 minutes before use. The chemokines were added to the cell suspension under agitation. To study the inhibition by Met-RANTES, aliquots of the antagonist were added to the cells, during the 2 minute incubation for 37 ° C at varying concentrations. The results are shown in Figure 6 and in Figure 7. (iii) Receptor Link Test The competition test was carried out in 96 well plates with multiple mesh filter (Millipore, MADV N6500) which had been pretreated for 2 hours with 50 mM HEPES buffer, pH 7.2, containing 1 mM calcium chloride, 5 mM magnesium chloride, and 0.5% BSA, (link buffer). The assays were performed using either THP-1 cells or COS cells expressing the recombinant CC-CKR1 receptor (Neote, K., DiGregorio, Mak, JY, Horuk, R., and Schall, T. J., (1993). Molecular cloning, functional expression and signaling characteristics of a CC chemokine receptor, Cell 72 415-425; Gao, JL, et al. J. Exp. Med. 177 1421-7 (1993)). Each well contained 105 cells in a 150 μl volume of binding buffer containing [I125] Mip-la 0.4 nM or [I125] 0.4 nM RANTES (New England Nuclear, NEX 277) and varying concentrations of competitive Met-RANTES. The tests were carried out in triplicate. After 90 minutes of incubation at 4 ° C, the cells were washed 4 times with 200 μl of ice-cold binding buffer containing 0.5 M sodium chloride which was removed by aspiration. The filters were dried, 3.5 ml of Ultima Gold scintillation fluid (Packard) were added and counted on a Beckman LS5000 counter. The results are shown in Figure 8. (d) Preparation of Leu-RANTES (also referred to herein as L-RANTES) and demonstration of antagonism The L-RANTES expression vector was elaborated in two steps. PCR was first used to truncate the gene for human RANTES within the first cysteine codon, and to introduce the unique restriction sites at either end of the gene. This PCR product was cloned into the E. coli expression vector based on T7, pET23d (Novagen) using a SacI site introduced at the 5 'end of the gene, and a BsmAI site designed to produce a compatible HindIII site protruding from the end 3 'of the gene. The genes encoding the N-terminal variants of human RANTES were then created by inserting oligonucleotides coding for the variants immediately 5 'to the RANTES coding sequence. For this purpose, the RANTES clone truncated in pET23d was digested with Sacl and followed by T4 DNA polymerase to remove the 3 'overhang to the left by Sacl and then a second digestion with Ncol. The oligonucleotides encoding the peptide sequence MKKKWPRLSPYSSDTTP were then cloned into the expression vector. The expression of the pET23d / L-RANTES construct was carried out as described for the pT7-7 construct pET23d / RANTES Ncol pET23d / RANTES Sacl / T4 5 'C C TGC TTT 3' 3 'GGTAC G ACG AAA 5' oligonucleotides L-RANTES 'CATGAAAAAAAAATGGCCAAGGCTGTCCCCGTACTCCTCCGACACCACCCCGTG 3, TTTTTTTTTACCGGTTCCGACAGGGGCATGAGGAGGCTGTGGTGGGGCAC The pET23d / L-RANTES construct is one of a series of expression vectors which can be used to generate RANTES with different amino acids at position 1. These T7 expression vectors code for proteins with N-terminal sequences of MKKKWPR-X -RANTES. X can be either L, I, Q, E, or G for example. Cleavage with endo-Arg-C will produce different X-RANTES proteins. + 2 M K K K W P R L S P Y S S D T T 1 CATGAAAAAA AAATGGCCAA GGCTGTCCCC GTACTCCTCC GACACCACCC GTACTTTTTT TTTACCGGTT CCGACAGGGG CATGAGGAGG CTGTGGTGGG +2 P C C F A Y I A P P P A H I K 51 CGTGCTGCTT TGCCTACATT GCCCGCCCAC TGCCCCGTGC CCACATCAAG GCACGACGAA ACGGATGTAA CGGGCGGGTG ACGGGGCACG GGTGTAGTTC + 2 E Y F Y T S G K C S N P A V V F V 101 GAGTATTTCT ACACCAGTGG CAAGTGCTCC AACCCAGCAG TCGTCTTTGT CTCATAAAGA TGTGGTCACC GTTCACGAGG TTGGGTCGTC AGCAGAAACA +2 T R K N R Q V C A N P E K K W V 151 CACCCGAAAG AACCGCCAAG TGTGTGCCAA CCCAGAGAAG AAATGGGTTC GTGGGCTTTC TTGGCGGTTC ACACACGGTT GGGTCTCTTC TTTACCCAAG + 2 R E Y I N S L E M S * HINDIII NOTI XHCI 201 GGGAGTACAT CAACTCTTTG GAGATGAGCT AAAGCTTGCG GCCGCACTCG CCCTCATGTA GTTGAGAAAC CTCTACTCGA TTTCGAACGC CGGCGTGAGC The purification of Leu-RANTES was carried out as follows: 4 g of E. coli cell paste were suspended in 15 ml of 50 mM Tris-HCl buffer, pH 7.6, containing 1 mM dithiothreitol, 5 mM benzamidine hydrochloride, 0.1 mM phenylmethylsulfonyl fluoride and DNase (0.02 mg / ml). The cells were broken by three steps through a French Press for cells, with 1 minute of sonication on ice after each step. The resulting solution was centrifuged for 60 minutes at 10,000 x g. The cell buttons were dissolved in 2 ml of 10 mM Tris-HCl buffer pH 8.0, containing 6 M guanidine hydrochloride, and 1 mM dithiothreitol. The solution was heated for 60 minutes at 60 ° C to ensure monomerization, cooled to room temperature and gel filtered on a Superdex 200 16/60 column equilibrated in the same buffer. Fractions containing the recombinant RANTES construct (16 ml) were renatured by dropwise addition to 384 ml of 100 mM Tris-HCl buffer, pH 8.0, containing 1 mM oxidized glutathione and 0.1 mM reduced glutathione, and shaken all night. This solution was dialyzed against 50 mM sodium acetate buffer, pH 4.5, and then applied to a HiLoad SP26 / 10 column equilibrated in the same buffer.

The proteins were eluted by a linear gradient of 0-2 M sodium chloride in the same buffer. Fractions containing the renatured protein were dialyzed against 3 x 5 liters of 1% acetic acid and lyophilized. To remove the hexapeptide KKKWPR from the fusion protein, the lyophilized powder was dissolved in water, and adjusted to 1 mg / ml of 50 mM Tris-HCl buffer, pH 8.0. To 2 ml of this solution, 20 μg of the endoproteinase Arg C (Boehringer Mannheim) was added and the solution was incubated for 2 hours at 37 ° C. The digested protein was separated from the starting material by reverse phase HPLC using a nucleosyl-C8 column (10 x 250 mm) equilibrated in 0.1% trifluoroacetic acid. Proteins were eluted with a gradient of 22.5-45% acetonitrile in 0.1% trifluoroacetic acid, lyophilized and stored at -80 ° C. Antagonistic activities on RANTES-induced chemotaxis of THP-1 cells were tested as described for the Met-RANTES protein. The results are shown in Figure 9. (e) Preparation of Gln-RANTES (sometimes referred to as Q-RANTES) and demonstration of antagonism The process described in (d) above was repeated muta ti s mutandi s in order to prepare Gln-RANTES. Antagonistic activities of the chemotaxis induced by Gln-RANTES or RANTES of the THP-1 cells was tested as described for the Met-RANTES protein. The results are shown in Figure 10.

It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following:

Claims (13)

1. A polypeptide, which has at least 40% amino acid sequence homology with RANTES, and which functions as an antagonist for RANTES or for MlP-la in one or more of the following: (a) Chemotaxis of THP-1 cells in response to RANTES or MlP-la; (b) mobilization of calcium ions in THP-1 cells due to the presence of RANTES, or due to the presence of MlP-la; and (c) the binding of RANTES to the receptors of the THP-1 cells; characterized the polypeptide because it acts as an antagonist for RANTES or for MlP-la due to the presence of one or more N-terminal amino acids

2. A polypeptide according to claim 1, characterized in that one or more of said N-terminal amino acids are N-terminal to the sequence SPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR - QVCANPEKKW VREYINSLEM S. 12

3. A polypeptide according to claim 1 or claim 2, characterized in that one or more N-terminal amino acids comprise or consist of a methionine, a leucine, or a glutamine.

4. A polypeptide according to claim 3, characterized in that the methionine, leucine, or glutamine is at the N-terminus of the polypeptide.

5. A polypeptide according to any of the preceding claims, characterized in that the polypeptide has the sequence: (i) MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR QVCANPEKKW VREYINSLEM S (sometimes referred to herein as "Met-RANTES") (ii) LSPYSSDT TPCCFAYIAR PLPRAHIKEY FUTSGKCSNP AWFVTRKNR QVCANPEKKW VREYINSLEM S (sometimes referred to herein as "Leu-RANTES") (iii) QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AWFVTRKNR QVCANPEKKW VREYINSLEM S (sometimes referred to herein as ("Gln-RANTES") 13 or has a sequence that is substantially homologous with any of the above sequences.

6. A DNA or RNA sequence, characterized in that it encodes a polypeptide according to any of the preceding claims.

7. A vector, characterized in that it comprises a sequence according to claim 6.

8. A host cell, characterized in that it comprises a vector according to claim 7.

9. A polypeptide according to any one of claims 1 to 5, characterized in that it is for use in therapy or diagnosis with respect to the human or a non-human animal.

10. A polypeptide according to any one of claims 1 to 5, Characterized in that it is for use in the treatment of a disease by the inhibition or reduction of inflammation mediated by RANTES or MlP-la.

11. A polypeptide according to claim 10, characterized in that it is for use in the treatment of asthma, allergic rhinitis, atopic dermatitis, atheroma / atherosclerosis or rheumatoid arthritis.

12. A method for the production of a polypeptide according to any of claims 1 to 5, characterized in that it comprises causing a host cell according to claim 8 to express said polypeptide.

13. A polypeptide, characterized in that it is substantially as described hereinabove with reference to the appended examples. fifteen