MXPA97003062A - An enzyme with activity lipolit - Google Patents

Abstract

The invention relates, inter alia, to a DNA construct comprising a DNA sequence encoding an enzyme that exhibits lipolytic activity and which comprises: a) the DNA sequence shown in SEQ ID No. 1, ) an analog of the DNA sequence shown in SEQ ID NO. 1 which i) is homologous with the DNA sequence shown in SEQ ID No. 1, and / or ii) is hybrid with the same oligonucleotide pathway as the DNA sequence shown in SEQ ID NO. 1, iii) encodes a polypeptide that is homologous to the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No. 1 and / or iv) encodes a polypeptide that is immunologically reactive with an antibody produced against a purified lipolytic enzyme, which is encoded by the DNA sequence shown in SEQ ID NO. 1 and / or which is derived from Humicola insolena DSM 1800. Also described are, among others: the lipolytic enzymes encoded by such DNA constructs, the enzyme preparations, the additives for detergents and the detergent compositions comprising such lipolytic enzymes.

Description

AN ENZYME WITH LIPOLITIC ACTIVITY FIELD OF THE INVENTION The present invention relates to an enzyme with lipolytic activity, to a DNA construct comprising a DNA sequence encoding the enzyme, and to a method for the production of the enzyme. The invention also relates, inter alia, to enzyme preparations, detergent additives and detergent compositions containing the enzyme, and to the use of the enzyme in a number of industrial and domestic applications.

BACKGROUND OF THE INVENTION Although numerous lipolytic enzymes (enzymes that catalyze the hydrolysis of lipids, such as triglycerides) have been described and characterized in the literature, there is a continuing need to provide novel lipolytic enzymes, preferably in the form of a single component, having properties that improve their utility in various industrial or domestic applications, such as in detergent compositions for washing in REF: 24608 laundry or dish washing, or compositions for cleaning hard surfaces, degreasing and the like.

BRIEF DESCRIPTION OF THE INVENTION The present inventors have surprisingly succeeded in isolating and characterizing a DNA sequence from a strain of Humi col to insol ens, cp and sequence coding for an enzyme showing lipolytic activity, thereby making it possible to prepare a single lipolytic enzyme. component. It has been found that the lipolytic enzymes of the invention (see below) possess properties that make them very suitable, inter alia, for a number of applications of the types mentioned above. Accordingly, in a first aspect the invention relates to a DNA construct comprising a DNA sequence that codes for an enzyme showing lipolytic activity, the DNA sequence of which comprises: a) the DNA sequence shown in SEQ ID DO NOT. 1, and / or the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi if DSM 9975, or b) an analogue of the DNA sequence shown in SEQ ID NO. 1, and / or the sequence of DNA coding for a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi si e DSM 9975, which i) is homologous with the DNA sequence shown in SEQ ID No. 1 and / or the DNA sequence which encodes a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi si ae "DSM 9975, and / or ii) hybridizes with the same cleotide oligonucleotide probe as the DNA sequence shown in SEQ ID NO. 1, and / or the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi siae DSM 9975, and / or iii) encodes a polypeptide that is homologous to the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID NO. 1 and / or by the sequence of DNA encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevisiae DSM 9975, and / or iv) encodes a polypeptide that is immunologically reactive with an antibody produced against a purified lipolytic enzyme, which is encoded by the DNA sequence shown in SEQ ID NO. 1 and / or by the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevisiae DSM 9975, and / or which is derived from Humicol to insol ens DSM 1800. It is believed that the sequence of DNA shown in SEQ ID NO. 1 is identical to the sequence of DN coding for a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevisiae DSM 9975. The DNA sequence shown in SEQ ID NO. 1 codes for a mature enzyme with its native signal peptide. In an analogous manner, the amino acid sequence shown in SEQ ID NO. 2 constitutes the mature enzyme (amino acids 36-246) with its signal peptide (amino acids 1-35). It should be understood that as long as reference is made to the DNA sequence shown in "SEQ ID No. 1" in relation to the enzyme or DNA construct of the invention (e.g., as used in the preceding sections a) and b) i) -iv)), said sequence may be the complete sequence shown in SEQ ID NO. 1, but is more preferably the part of the sequence encoding the mature lipolytic enzyme. Accordingly, provided that reference is made to "the amino acid sequence shown in SEQ ID No. 2" in relation to the enzyme or DNA construct of the invention, it should be understood that said sequence may be the complete sequence shown in FIG. SEQ ID NO. 2, but is more preferably the part of the sequence that constitutes the mature lipolytic enzyme (eg, amino acid residues 36-246). In the present context, the "analogue" of the DNA sequence shown in SEQ ID No. 1, is intended to indicate any DNA sequence that codes for an enzyme that exhibits lipolytic activity, and which has one or more properties, or all of the properties i) -iv.) Such an analogous DNA sequence can: be isolated from another organism or from a related organism (eg the same) that produces the enzyme with lipolytic activity based on the DNA sequence shown in SEQ ID No. 1, or an appropriate subsequence (such as 20-500 bp) thereof, for example, using the methods described herein, and thus, for example, being an allelic variant or species of the DNA sequence comprising the DNA sequence shown herein, or - be constructed based on the DNA sequence shown in SEQ IO No. 1, for example, by the introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the lipolytic enzyme encoded by the DNA sequence, but which correspond to the use of the codon of the host organism aimed at the production of the enzyme, or through the introduction of nucleotide substitutions that can give rise to a different amino acid sequence . However, in the latter case the amino acid changes are preferably of a minor nature, for example, conservative amino acid substitutions that do not significantly affect protein folding or activity, deletions or small deletions, typically from one to about 30. amino acids; small amino- or carboxyl-terminal / les extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or a small extension that facilitates purification, such as a poly-histidine moiety , an antigenic epitope or a binding domain. See generally Ford et al., Protein? Xpression and Purification 2: 95-107, 1991. Examples of conservative substitutions are substitutions within the group of basic amino acids. { such as arginine, lysine, histidine), acidic amino acids (such as glutamic acid and aspartic acid) r polar amino acids (such as glutamine and asparagine), hydrophobic amino acids (such as leucine, isoleucine, valine) aromatic amino acids (such as phenylalanine, tryptophan , tyrosine) and small amino acids (such as glycine, alanine, serine, threonine, methionine). It will be apparent to those skilled in the art that such substitutions can be made outside the critical regions for the I function of the molecule and still result in an active polypeptide. The essential amino acids for the activity of the polypeptide encoded by the DNA construct of the invention, and therefore preferably not subject to substitution, can be identified according to methods known in the art, such as site-directed mutagenesis or Alanine scanning mutagenesis (Cunningham and Wells, Science 244, 1081-1085, 1989). In the last technique, mutations are? They are introduced into any residue in the molecule, and the resulting mutant molecules are tested for biological activity (eg, lipolytic) to identify the amino acid residues that are critical for the activity of the molecule. "Substrate-enzyme interaction sites can also be determined by analysis of the crystal structure, as determined by techniques such as nuclear magnetic resonance, crystallography or photoaffinity labeling, see, for example, de Vos et al., Science 255: 306-312, 1992; Smith et al., J. Mol. Bi-ol. 224: 899-9 < M, 1992; Wlodaver et al., FEBS Lett. 309: 59-64, 1992. The homology referred to in i) above is determined as the degree of identity between the two sequences, indicating a derivation of the first sequence from the second. The homology can be suitably determined by means of computer programs, known in the art, such as GAP provided in the GCG program package (Needleman, SB and Wunsch, CD, Journal of Molecular Biolgy, 48 443-453- <, 1970). Using GAP with the following adjustments for the comparison of the DNA sequence: penalty of 5.0 of the creation of GAP and penalty of 0.3 of the extension of GAP, the coding region of the DNA sequence shows a degree of identity preferably of less 40%, more preferably at least 50%, more preferably at least 60%, more preferably at least 70%, even more preferably at least 80% r especially at least 90%, with the coding region of the DNA sequence shown in SEQ ID NO. 1 or the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevisiae DSM 9975. The hybridization referred to in ii) above is intended to indicate that the DNA sequence Analogous DNA is hybridized to the same probe as the DNA sequence encoding the lipolytic enzyme, under certain specific conditions which are described in detail in the Materials and Methods section hereinafter herein.Normally, the analogous DNA sequence is highly homologous to the DNA sequence, such as at least CT% homologous to the sequence shown in SEQ ID No. 1, which encodes a lipolytic enzyme of the invention, such as at least 75%, at least 80%, at less 85%, at least 90% or even at least 95% homologous to the DNA sequence shown in SEQ ID No. 1. The degree of homology referred to in iii) above, is determined as the degree of identity between the two sequence s that indicate a derivation of the first sequence from the second. The homology can be suitably determined by means of computer programs known in the art, such as GAP provided in the GCG program page (Needleman, SB and Wunsch, CD, Journal of Molecular Biology, 48: 443- 453, 1970). Using GAP with the following adjustments for the comparison of the polypeptide sequence: penalty1 of "3.0 of the creation of GAP and penalty of 0.1 of the extension of GAP, the polypeptide encoded by an analogous DNA sequence shows a degree of identity preferably of minus 70%, more preferably at least 80%, especially at least 90%, with the enzyme encoded by a DNA construct comprising the DNA sequence shown in SEQ ID NO.1 p the sequence of "DNA encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyce-s cerevi if at DSM 9975, the amino acid sequence of said enzyme is shown in SEQ ID-NO. 2.

The term "derivative of" in relation to property iv) above, is not intended only to indicate a lipolytic enzyme produced by H. insole? S strain DSM 1800, but also a lipolytic enzyme encoded by a DNA sequence isolated from the strain DSM l? OO, and produced in a host organism transformed with the DNA sequence. The immunological reactivity can be. determined by the method described in the Materials and Methods section below. In additional aspects, the invention relates to an expression vector harboring a DNA construct of the invention, a cell comprising an "AJN or expression vector construct, and a method of producing an enzyme that exhibits activity" Tipolitlca , whose method comprises the cultivation of the cell under conditions that allow the production of the enzyme, and the recovery of the enzyme from the culture. In a further aspect, the invention relates to an enzyme that exhibits lipolytic activity, whose enzyme: a) is encoded by a DNA construct of the invention, and / or b) is produced by the method of the invention, and / or ) is immunologically reactive with an antibody produced against a purified lipolytic enzyme, which is encoded by the DNA sequence shown by SEQ ID NO. 1 and / or "the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi siae DSM 9975, and / or which is derived from Humi cola insol-ens DSM 1800. In a Further aspect, the present invention relates to a detergent additive or a detergent composition comprising an enzyme of the invention.

DETAILED DESCRIPTION OF THE INVENTION The DNA sequence of the invention that codes for an enzyme that shows lipolytic activity, can be isolated by a general method that involves: - the cloning, in appropriate vectors, of a genomic library of DNA from H. insolens, - the transformation of appropriate yeast host cells with said vectors, cultivation of the host cells under appropriate conditions to express any enzyme of interest encoded by a clone in the "DNA library, - selection for positive clones, by the determination of any lipolytic activity of the enzyme produced by such clones, and - the isolation of the DNA encoding the enzyme, from such clones. The method in general is further described in WO 94/14953. A more detailed description of the selection method is given in Example 1 below. The DNA sequence encoding the enzyme can, for example, be isolated by selection of a genomic cDNA library of H. insol ens, for example strain DSM 1800, publicly available from the DSM (Deutsche Sammlung von Mikrooifganismen und Zellkuíturen, Mascheroder "Weg b, D-38124 Braunschweig, Germany) and selection for clones expressing the activity of the appropriate enzyme (eg, lipolytic activity), or isolated from Saccharomyces cerevi siae DSM 9975 deposited under the Budapest Treaty on 11 The appropriate DNA sequence can then be isolated from the clone by standard procedures, eg, as described in Example 1. A DNA sequence encoding a homologous enzyme is expected to for example, an analogous sequence of DNA can be obtained from other organisms, for example, the DNA sequence can be derived by the similar selection of a genomic library of A DNc, of another microorganism, in particular a fungus, especially a fungus of the order Sordariales, such as a strain of Thielavia sp., In particular T. terrestris, a strain of an iChaetomium sp., In particular C. elatum or C. globosum , a strain of Gelasinospora sp., in particular G1 cerealis, a strain of a Neurospora sp., in particular N. crassa, a strain of a Podospora sp., in particular P. anse.ri? \ a ^ a strain of a Sordaria sp., in particular S. fimicola or S. macrospora, or a strain of another Uumicola sp. Other fungi of interest include the strains of Aspergillus sp., Such as A. aculeat, us or A. niger, strains of Trichoderma sp., Such as T. harzianum, T. reeseii, T. virider T. longibrachiatum or T. Toningii. , or strains of Tusarium sp., such as F. oxisporum. Alternatively, the? D? which encodes a lipolytic enzyme of the invention can, according to well known methods, be conveniently isolated from DNA from an appropriate strain, such as any of the aforementioned organisms, by the use of synthetic oligonucleotide probes prepared with base in a DNA sequence described herein. For example, an appropriate oligonucleotide probe can be prepared based on the DNA sequence shown in SEQ ID NO. 1, or the amino acid sequence shown in SEQ ID NO. 2, or any appropriate subsequence of any of these sequences. The DNA sequence may subsequently be inserted into a recombinant expression vector. This can be any vector that can be conveniently subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it will be introduced. Thus, the vector can be a vector of autonomous replication, for example a vector that exists as an extrachromosomal entity, the replication of which is independent of "chromosomal replication, eg, a plasmid." Alternatively, the vector can be one which, when introduced into a host cell, is integrated into the genome of the host cell and replicated together with the chromosome (s) into which it has been integrated.In the vector, the DNA sequence that The coding for the lipolytic enzyme must be operably linked to an appropriate promoter and a terminator sequence The promoter can be any DNA sequence that exhibits transcriptional activity in the host cell of choice, and that can be derived from genes coding for the proteins either homologous or heterologous to the host cell.The procedures used to ligate the DNA sequences that encode the enzyme li The policy, the promoter and the terminator, respectively, and to insert them into appropriate vectors, are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor, NY, 1989). The host cell that is transformed with the DNA sequence encoding the enzyme of the invention is preferably a eukaryotic cell, in particular a fungal cell, such as a yeast or a filamentous fungus cell. In particular, the cell may belong to a species of Aspergillus, more preferably A. oryzae or A. niger. Alternatively, the cell may belong to a Trichoderma species, such as T. reeseii, or a Fusarium species, such as F. oxysporum or F. graminearum. The fungal cells can be transformed by a process that involves the formation of protoplasts and the transformation of the protoplasts followed by the re-generation of the cell wall, in a manner known per se. The use of Aspergillus as a host microorganism is described in European patent EP 0,238,023 (Novo Nordisk A / S). The host cell may also be a yeast cell, for example, a strain of Saccharomyces, in particular Saccharomyces cerevisiae, Saccharomyces kluyveri or Saccharomyces uvarum, a strain of Schizoaaccharomyces sp., Such as Schizosaccharomyces pombe, or a strain of Hansenula sp. , Pichia sp. , Yarrowia sp. , such as Yarrowia lipolitica, or Kluyveromyces sp. , such as Kluyvero yces lactis. In a further aspect, the present invention relates to a method for the production of an enzyme according to the invention, wherein an appropriate host cell transformed with a DNA sequence encoding the enzyme, it is grown under conditions that allow the production of the enzyme, and the resulting enzyme is recovered from the culture. The medium used to cultivate the transformed host cells can be any conventional means, suitable for the development of the lysate cells in question. "The expressed lipolytic enzyme can be conveniently secreted into the culture medium, and can be recovered from it by well-known methods, including the separation of the cells from the medium, by centrifugation or filtration, the precipitation of the protein components" from the medium, by means of a salt such as ammonium sulfate, followed by chromatographic procedures such as "ion exchange chromatography, affinity chromatography or the like.

The enzi] ma of invention The enzyme of the invention is one that is encoded by the construction of "DNA of the invention." A preferred enzyme of the invention can also be characterized by having one or more of the following characteristics: it has a molecular weight of approximately 20-21 kDa. - has a pl in the range of 7-9, such as about 8 has an optimum pH in the range of about 6-10, such as in the range of 7-9, for example about 8 - has specificity, or at least shows greater lipolytic activity, towards short chain lipid substrates. The enzyme of the invention is preferably obtainable from a strain of Humicola such as a strain of H. insol ens or from a strain of any of the various organisms mentioned as appropriate sources of a DNA sequence encoding an omoloqa enzyme.

Compositions Detergents According to the invention, the lipolytic enzyme of the invention can typically be a component of a detergent composition (eg, a detergent composition for laundry or washing of textile fibers). As such, it can be included in the detergent composition in the form of a non-powdered granulate, a stabilized liquid, or a protected enzyme. Non-powdered granulates can be produced, for example, as described in U.S. Patent Nos. 4,106,991 and 4,661,452 (both for Novo Industri A / S) and can optionally be coated by methods known in the art. Examples of waxy coating materials are poly (ethylene oxide) (polyethylene glycol, PEG) products with average molecular weights of 1000 to 20,000, ethoxylated nonylphenols having from 1 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms, and in which there are 15 to 80 units of ethylene oxide; fatty alcohol. fatty acids; and mono-, di- and triglycerides of fatty acids. Examples of film-forming materials / coatings suitable for application by fluidized-bed techniques are given in British patent GB 1483591. Liquid enzyme preparations can, for example, be stabilized by the addition of a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid, according to established methods. Other enzyme stabilizers are well known in the art. Protected enzymes can be prepared according to the method described in European patent EP 238,216. The detergent composition of the invention can be in any convenient form, for example as powder, granules, paste or liquid. A liquid detergent can be aqueous, typically containing up to 70% water and 0-30% organic solvent, or non-aqueous solvent. The detergent composition comprises one or more surfactants, each of which may be anionic, nonionic, cationic, or amphoteric. The detergent will usually contain from 0 to 50% anionic surfactant such as linear alkylbenzene sulfonate (LAS), alpha-olefin sulphonate (AOS), alkyl sulfate (fatty alcohol sulfate) (AS), alconol ethoxysulfate (AEOS or AES), alkanesulphonates secondary (SAS), methyl esters of alpha-sulfonipic acid, alkyl- or alkenyl-succinic acid, or soap. It may contain from 0 to 40% nonionic surfactant such as alcohol ethoxylate (AEO or AE), carboxylated alcohol ethoxylates, nonionic ethoxylate, alkyl polyglucoside, alkyldimethylamine oxide, ethoxylated fatty acid monoethanolamide, fatty acid monoethanolamide. , or polyhydroxy-alkyl fatty acid amide (for example as described in WO 92/06154). The detergent composition may additionally comprise one or more other enzymes, such as another lipolytic enzyme (lipase), an amylase, a cutinase, a protease, a cellulase, a peroxidase, or an oxidase., for example a laccase. The detergent may contain 1-65% of a detergent additive or complexing agent such as zeolite, diphosphate, triphosphate, phosphonate, citrate, nitrilotriacetic acid (NTA), ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DTMPA), acid alkyl- or alkenylsuccinic, soluble silicates or layered silicates (for example SKS-6 from Hoechst). The detergent may also be without additive, for example, essentially free of the detergent additive. The detergent may comprise one or more polymers. Examples are carboxymethyl cellulose (CMC), poly (vinylpyrrolidone) (PVP), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polycarboxylates such as polyacrylates, maleic / acrylic acid copolymers, and lauryl methacrylate / acrylic acid copolymers. The detergent may contain a bleach system which may comprise a source of H202 such as perborate or percarbonate, which may be combined with a peracid-forming bleach activator, such as tetraacetylethylenediamine (TAED) or nonanoyloxybenzenesulfonate. { NOBS). Alternatively, the bleach system may comprise peroxyacids for example of the amide, imide, or sulfone type. Enzymes of the detergent composition of the invention may be enzymes using conventional stabilizing agents, for example, a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or an acid derivative. boronic, such as, for example, an aromatic borate ester, and the composition can be formulated as described in, for example, WO 92/19709 and WO 92/19708. The detergent may also contain other ingredients for conventional detergents such as, for example, fabric conditioners such as clays, foam formers, soapy water suppressants, anti-corrosion agents, soil suspending agents, soil anti-resurfacing agents, colorants, bactericides, optical brighteners, or perfume. The pH (measured in aqueous solution at the use concentration) will usually be neutral or alkaline, for example, in the range of 7 to 11. Particular forms of detergent compositions within the scope of the invention include: 1) A formulated detergent composition as a granulate having a bulk density of at least 600 g / 1, comprising: 2) A detergent composition formulated as a granulate having a bulk density of at least 600 g / 1 comprising: 3) A detergent composition formulated as a granulate having a bulk density of at least 600 g / 1 comprising: 4) A detergent composition, formulated as a granulate having a bulk density of at least 600 g / 1 comprising: ) An aqueous liquid detergent composition, comprising: 6) A structured, aqueous liquid detergent composition, comprising: Linear alkyl benzene sulphonate (calculated 15-21% as acid) Alcohol ethoxylate (eg 3-9% alcohol C? 2-i5, 7 EO, or Ca2-? 5, 5 EO alcohol) Soap as fatty acid (as acid) aleico) 3 - 10% Zeolite (as NaAISi04) 14 - 22% Potassium citrate 9 - 18% Borate (as B4O7) 0 - 2% Carboxymethylcellulose 0-2% Poly, ros (for example PEG, PVP) '0 - 3% Anchor polymers such as, by 0-3%, example, lauryl methacrylate / acrylic acid copolymer; molar ratio 25: 1 MP 3800 Glycerol 0 - 5% Enzymes (calculated as enzyme protein 0.0001 - 0.1% pure) Minor ingredients (eg 0 - 5% dispersants, suds suppressors, perfume, optical brightener) 7) A detergent composition formulated as a granulate, having a bulk density of at least 600 g / 1 comprising: 8) A detergent composition formulated as a granulate comprising: 9) A detergent composition formulated as a granulate comprising: 10) An aqueous liquid detergent composition comprising: 11) An aqueous liquid detergent composition comprising: Linear alkylbenzene sulphonate (calculated 20-32% as acid) Alcohol ethoxylate (eg alcohol 6-12% C? 2-i5, 7 EO, or alcohol Cj.2-15, 5 EO) Aminoe anol 2 - 6% Acid (citric 8 - 14% Borate (as B407) 1 - 3% Polymers (eg 0-3% maleic / acrylic acid copolymer, anchor polymer such as, for example, lauryl methacrylate / acrylic acid copolymer) Glyceryl 3-8% Enzymes (calculated as enzyme protein 0.0001 - 0.1 % pure) Minor ingredients (for example 0 - 5% hydrotropes, dispersants, perfume, optical brighteners) 12) A detergent composition formulated as u? granulate having a bulk density of at least 600 g / 1 comprising: Surfactant anionic 25 - 40% (linear alkylbenzenesulfonate, alkyl sulfate, alpha-olefinsulfonate, methyl esters of alpha-sulphonic fatty acid, alkanesulphonates, soap) Non-ionic surfactant (for example 1 - 10% alcohol ethoxylate) Sodium carbonate (as Na2C03) 8 - 25% Soluble silicate (as Na20, 2Si02) 5 - 15% Sulphate of sodium (as Na2S04) 5% Zeolite (as NaAlSi04) 15 - 28% Sodium perborate (as NaB03 * H20) 0 - 20% Bleach activator (TAED or NOBS) 0 - 5% Enzymes (calculated as enzyme protein 0.0001 - 0.1% pure), Minor ingredients (eg perfume, 0 - 3% optical brighteners) 13) Detergent formulations as described in 1) - 12), where all or part of the linear albinbpncensulfonate it is replaced by alkyl sulphate of 12 to 18 carbon atoms. 14) A detergent composition formulated as a granulate having a bulk density of at least 600 g / 1, comprising: ) A detergent composition formulated as u? granulate having a bulk density of at least 600 g / 1 comprising: 16) Detergent formulations as described in 1) - 15), which contain a stabilized or encapsulated peracid, either as an additional component or as a substitute for already specified bleaching systems. 17) Detergent compositions as described in 1), 3), 7), 9) and 12), wherein the perborate is replaced by percarbonate. 18) Detergent compositions as described in 1), 3), 7), 9), 12), 14) and 15), which additionally contain a manganese catalyst. The manganese catalyst can, for example, be one of the compounds described in "Efficient manganese catayst-s for low-temperature bleaching", Nature 369, 1994, p. 637-639. i 19) A detergent composition formulated as a non-aqueous detergent liquid, comprising a liquid non-ionic surfactant such as, for example, linear primary alkoxylated alcohol, an additive system (eg phosphate), enzyme and alkali. The detergent may also comprise anionic surfactant and / or a bleaching system.

Dishwashing Composition A lipolytic enzyme of the invention can suitably be a component of a dishwashing detergent composition. The dishwashing detergent composition will comprise a surfactant which may be anionic, nonionic, cationic, amphoteric or a mixture of these types. The detergent will contain 0-90% nonionic surfactant, such as propoxylated, ethoxylated straight chain alcohols, with low foaming or no foaming. The detergent composition may contain detergent additive salts of the inorganic and / or organic types. Detergent additives can be subdivided into types that contain phosphorus and those that do not contain phosphorus. The detergent composition usually contains from 1 to 90% of the detergent additives. Examples of alkaline, inorganic, phosphorus-containing detergent additives, when present, include water-soluble salts, especially pyrophosphates, orthophosphates, polyphosphates, and alkali metal phosphonates. Examples of non-phosphorus inorganic additives, when present, include water-soluble alkali metal carbonates, borates and silicates, as well as the various types of water-insoluble crystalline or amorphous aluminosilicides, of which the zeolites They are the best known representatives. Examples of suitable organic additives include the alkali metal, ammonium and substituted ammonium, citrates, succinates, malonates, fatty acid sulfonates, carboxymethoxy succinates, ammonium polyacetates, carboxylates, polycarboxylates, aminopolycarboxylates, polyacetyl carboxylates and polyhydroxysulfonates. Other suitable organic additives include the higher molecular weight polymers and the copolymers known to have additive properties, for example the appropriate polyacrylic acid, the polymaleic and polyacrylic / polymaleic acid copolymers, and their salts. The dishwashing detergent composition may contain chlorine / bromine or oxygen type bleaching agents. Examples of inorganic bleaches of the chlorine / bromine type are hypochlorite and lithium, sodium or calcium hypobromite, as well as chlorinated trisodium phosphate. Examples of organic bleaches of the chloro / bromo type are N-bromo- and heterocyclic N-chloro-imides such as trichloroisocyanuric, tribomoisocyanuric, dibromoisocyanuric and dichloroisocyanuric acids, and salts thereof with water solubilizing cations such as potassium and sodium. The hydantoin compounds are also suitable. Oxygen bleaches are preferred, for example in the form of an inorganic persalt, preferably with a bleach precursor or as a peroxyacid compound. Typical examples of suitable peroxy bleach compounds are the alkali metal perborates, both tetrahydrated and monohydrated, the alkali metal percarbonates, persilicates and alkali metal perfosphates. The preferred activating materials are TAED and glycerol triacetate. The dishwashing detergent composition of the invention can be stabilized using conventional stabilizing agents for the enzyme or enzymes, for example a polyol such as for example propylene glycol, a sugar or a sugar alcohol, lactic acid, boric acid, or a boric acid derivative, for example an aromatic borate ester. The detergent composition for dish washing may also comprise other enzymes, in particular an amylase, a protease and / or a cellulase. The dishwashing detergent composition of the invention may also contain other conventional detergent ingredients, for example, deflocculating material, filler material, foam depressants, anti-corrosion agents, soil suspending agents, sequestering agents, soil anti-settling agents, agents dehydrating, dyes, bactericides, fluorescers, thickeners and perfumes. Next, specifically preferred dishwashing compositions are exemplified: 1) POWDER COMPOSITION FOR AUTOMATIC DISHWASHING OF DISHES 2) COMPOSITION IN POWDER FOR AUTOMATIC WASHING OF PLATES 3) COMPOSITION IN POWDER FOR AUTOMATIC WASHING OF DISHES 4) POWDER COMPOSITION FOR WASHING AUTOMATIC DISHES ) COMPOSITION IN POWDER FOR AUTOMATIC WASHING OF DISHES 6) COMPOSITION IN POWDER AND LIQUID FOR WASHING PLATES, WITH SURFACTANT CLEANING SYSTEM 7) NON-AQUEOUS LIQUID COMPOSITION FOR AUTOMATIC PLATE WASHING 8) NON-AQUEOUS LIQUID COMPOSITION FOR WASHING DISHES 9) THIXOTROPIC LIQUID COMPOSITION FOR AUTOMATIC DISHWASHING OF DISHES ) LIQUID COMPOSITION FOR AUTOMATIC WASHING OF DISHES 11) LIQUID COMPOSITION FOR AUTOMATIC WASHING OF PLATES, WHICH CONTAINS PROTECTED WHITENING PARTICLES 11) Automatic compositions for washing dishes as described in 1), 2), 3), 4), 6) and 10), wherein the perborate is replaced by percarbonate. 12) Compositions for automatic dishwashing as described in 1) - 6), which additionally contain a manganese catalyst. The manganese catalyst can, for example, be one of the compounds described in * Efficient manganese catalysts for low temperature bleaching ", 5 Nat-ure 369, 1994, pp. € 37-639 In addition, the first lipolytic enzyme for washing The invention can be used in the softening compositions: The lipolytic enzyme of the invention can to be used in fabric softeners, for example, as described in Surfactant and Consumer Products, Ed. Ppr J. Falbe, 1987, pp 295-296; Tenside Surfactants Detergents, 30_ (1993), 6, pp. 394-399; JAOCS, Vol. 61 ^ (1984), 2, p. 367-376; And in the patents EP 517,762; EP 123,400; WO 92/19714; WO 93/1914,7; US 5,082.57 ?; EP 494,769; EP 544,493; EP 543,562; US 5,235,082; EP 568,297; EP 570,237. The lipolytic enzyme of the invention can be incorporated in concentrations conventionally used in detergents. To date it is contemplated that a lipolytic enzyme of the invention can be incorporated into a detergent composition of the invention in an amount corresponding to 0.00001-1 mg (calculated as pure enzyme protein) of the lipolytic enzyme per liter of the wash liquor.

It is contemplated that the lipolytic enzyme of the present invention may also be useful in, for example, the bread industry, as a catalyst in organic synthesis (e.g., esterification, transesterification or ester hydrolysis reactions), in the food industry. papermaking (eg for resin removal), and in the leather, wood and related industries (eg for degreasing of animal skins, sheep skins or wool), and for other applications involving degreasing . The invention is described in further detail in the following examples, which are in no way intended to limit the scope of the invention, as claimed.

MATERIALS AND METHODS Donor organism: The mRNA was isolated from Humi cola Iißsolens DSM 1800 developed in a fermentation medium containing pieces of corn, with agitation to ensure sufficient aeration. The mycelia were harvested after 3-5 days of development, immediately frozen in liquid nitrogen and stored at -80 ° C.

Yeast strains: The strain of Saccaromyces cerevi if used was yNG231 (MAT alpha, leu2, ura3-52, his4-539, pe, p4-delta 1, cir +) or JG169 (MATa; ura 3-52; leu 2 -3, 112; his 3-D200, pep 4-1137; prcl :: HlS3; prbl :: LEU2; cir +).

Plasmids: The expression plasmid pYES 2.0 (from Invitrogen) was used.

The expression vector pHD414 of Aspergillus pHD414 is a derivative of plasmid p775 (described in European Patent EP 0,238,023). The construction of pHD414 is further described in WO 93/11249.

Total RNA extraction was performed with guanidinium thiocyanate, followed by ultracentrifugation through a 5.7 M CsCl cushion and isolation of poly (A) * RNA was carried out by oligo (dT) -cellulose affinity chromatography using the process described in WO 94/14953.

Synthesis and modification of cDNA: The double-stranded cDNA was synthesized from 5 μg of poly (A) * RNA by the RNase H method (Gubler &Hoffman 1983, Sambrook et al., 1989) using the hairpin modification . The process is further described in WO 95/02043. After being treated with mung bean nuclease (Bethesda Research Laboratories), ds cDNA was blunted at the ends with T4 DNA polymerase (Invitrogen) and the cDNA was ligated to non-palindromic BstX I adapters (1 μg / μl, Invitrogen) according to the manufacturer's instructions.

Construction of the cDNA genomic libraries: The adapted dsDNA was recovered by centrifugation, washed in 70% ethanol and resuspended in 25 ml of water. Before ligation of the large-scale library, four test ligatures were carried out, each using 1 μl of ds cDNA (reaction tubes # 1 - # 3), 2 units of T4 ligase (Invfitrogen) and 50 ng (tube # 1), 100 ng (tube # 2) and 200 ng (tubes # 3 and # 4) of expression vector pYEs 2.0 from yeast excised with Bst XI (Invitrogen) in a total volume of 10 μl.

Using the optimal conditions, a large-scale ligation was carried out in 40 μl of ligation buffer. Aliquots of 1 μl were transformed into electrocompetent E. coli 1061 cells, and the transformed cells were ground and the library plated on LB + ampicillin plates with 5000-7000 colony forming units. { c.f, u. ) -license plate. To each plate 3 ml of the medium was added. The bacteria were scraped, 1 ml of glycerol was added and stored as -dO ^ C as combined. The remaining 2 ml were used for the isolation of DNA. For further details, reference is made to WO 94/14953.

Construction of the yeast libraries: To ensure that all bacterial clones were tested in yeast, a number of yeast transformants were placed as the limit times larger than the number of bacterial clones in the original combination.

Aliquots of 1 μl of the plasmid and purified DNA (100 ng / μl) from the individual pools were subjected to electroporesis (200 O, 1.5 kV, 25 μF) in 40 μl of S cells. cerevisiae JG 169 (D06oo = 1-5 in 500 ml YPD, washed twice in cold deionized water, once in cold 1 M sorbitol, resuspended in 0.5 ml of sorbitol. {Becker &Guárante, 1991). After the addition of 1 ml of sorbito,! cold 1 M, aliquots of 80 μl were placed on a plate on SC-URA + glucose to give 250-400 c.f.u. / plate and incubated 30 ° C for 3-5 days.

Identification of positive colonies: After "3-5 days of growth, the agar plates were plated in duplicate on plates of SC-olive oil / bright green and then incubated for 2-4 days at 30 ° C for the detection of lipolytic activity SC-URA plates-olive oil / bright green, which are SC-URA + 2% glucose + 0.6% olive oil + 1% bright green solution + 0.036% polyvinyl alcohol -. {MW 70,000-1 ^ -0, -00-0 Sigma T-1763-uracil) After incubation, lipolytic enzyme-positive colonies were identified as white colonies with a halo green around.

The cells from the enzyme-positive colonies were scattered for the isolation of single colonies on agar, and a single enzyme-producing colony was selected for each of the lipolytic enzyme-producing colonies identified.

Characterization of the positive clones: The positive clones are obtained as single colonies, the cDNA inserts were amplified directly on the yeast colony using biotinylated polylinker primers, purified by the magnetic sphere system ("Dynabead M-280, Dynal) and characterized individually by sequencing the 3 'end of each cDNA clone using the chain termination method (Sanger et al., 1977) and the Sequenase system ("United States Biochemical).

Isolation of the cDNA gene for expression in Aspergillus: One or more productpra yeast colonies of lipolytic enzyme were inoculated in 20 ml of YPD broth in a 50 ml glass test tube. The tube was shaken for 2 days at 30 ° C. Xas cells were harvested by centrifugation for 10 min. at 3000 rpm.

The DNA was isolated according to WO 94/14953 and dissolved in 50 μl of water. The DNA was transformed into S. col ± as described in WO 94/14953. Plasmid DNA was isolated from E. col using standard procedures and analyzed by restriction enzyme analysis. The cDNA insert was excised using appropriate restriction enzymes and ligated into an Aspergillus expression vector.

Transformation of Aspergillus oryzae or Azpergillus niger: Protoplasts can be prepared as described in WO 95/02043, p. 16, line 21-page 17, line 12.

Mix 100 μl of p otoplast suspension with 5-25 μg of the appropriate DNA in 10 μl of STC (1.2 M sorbitol, 10 mM Tris-HCl, pH = 7.5, 10 mM CaCl2). The protoplasts are mixed with p3SR2 (a plasmid carrying the amdS gene of A. nidulans). The mixture is left at room temperature for 25 minutes. 0.2 ml of 60% PEG 4000 (BDH 29576) is added, CaCl2 1/0 mM, and 10 mM Tris-HCl, pH '7.5, and mix carefully (twice), and finally add 0. 85 ml of the same solution and mix carefully. The mixture is left at room temperature for 2.5 minutes, centrifuged at 2500 g for 15 minutes and the button is resuspended in 2 ml of 1.2 M sorbitol. After further sedimentation, the protoplasts diffuse onto minimal plates [Cove, Biochem. Biophys, Acta 113 (1966) 51-56] containing 5-sucrose 1.0 M, pH 7.0, 10 mM acetamide as a nitrogen source and 20 mM CsCl to inhibit background growth. After incubation for 4-7 days at 37 ° C, the spores are harvested and diffused to obtain simple colonies. This procedure is repeated and the spores of a simple colony after the second reisolation are stored as a defined transformant.

Tests of transformants of A. oryzae: 15 Each of the transformants was inoculated in 10 ml of YPM and propagated. After 2-5 days of incubation at 30 ° C, 10 ml of supernatant was removed. The lipolytic activity was identified by the application of 10 μl of supernatant to holes of 4 mm diameter perforated on agar plates containing 0.1 M Tris, pH 9, 9.0 M CaCl2, 1% Triton X-100, 0.5% olive oil. Lipolytic activity is indicated by the formation of a cloudy halo. Hybridization conditions (to be used in the evaluation of property ii) of the DNA construct of the invention): Appropriate conditions for the de / termination of hybridization between an oligonucleotide probe and an analogous DNA sequence " , Involve the pre-wetting of the filter containing the DNA sequences to hybridize in 5xSSC, and the prehybridization of the sequences for 1 hour at -50 ° C in a 5xSSC solution, 5x Denhardt's solution, 50 M sodium phosphate, pH 6.8, and 50 μg of denatured sonicated calf thymus, followed by hybridization in the same solution, supplemented with 50 μCi of the probe labeled with 32 P-dCTP for approximately 18 hours at 50 ° C, followed by washing three times in 2 × SSC, 0.2% sodium dodecyl sulfate (SDS) at 50 ° C for 30 minutes An appropriate oligonucleotide probe, for use in hybridization, can be prepared based on the DNA sequence shown in SEQ ID No. 1 or a subsection appropriate to said sequence (for example, a fragment of 20 nucleotides thereof). Alternatively, an appropriate oligonucleotide probe can be prepared based on the amino acid sequence shown in sequence SEQ ID No. 2.

Immunological cross-reactivity: Antibodies to be used in the determination of immunological cross-reactivity can be prepared by the use of a purified lipolytic enzyme. More specifically, the antiserum against the enzyme of the invention can be produced by the immunization of rabbits. { or of other rodents) according to the procedure described by N. "Axelsen et al., in: A Manual of Quantitative TmHtunoele-etrophoresis, B-lackwell Scientific Publications, 1973, Chapter 23, or A. Johnstone and R. Thorpe, Immunochemistry in Practice, Blackwell Scientific Publications, 1982 (more specifically pp. 27-31). Xas purified immunoglobulins can be obtained from the antisera, for example by saline precipitation [(NH4) 2S0], followed by dialysis and ion exchange chromatography, for example on DEAE-Sephadex ™. The immunochemical characterization of the proteins can be performed either by means of the double-diffusion analysis of Outcherlony (O. Ouchterlony in: Handboofc of Experimental I munology (DM Weir, Ed.), Blackwell Scientific Publications, 1967, pp. 655-706) , by immunoelectrophoresis (N. et al., supra, Chapters 3 and 4), or by immunoe / lectroforesis (N. Axelsen et al., supra, Chapter 2).

YPD media: 10 g yeast extract, 20 g peptone, H20 up to 900 ml. Sterilized in an autoclave, 100 ml of 20% glucose is added (sterilized by filtration). YPM: 10 g of yeast extract, 20 g of peptone, H20 up to 900 ml. Sterilized in an autoclave, 100 ml of 20% maltodextrin are added (sterilized by filtration). 10 x basal salt: 66.8 g of yeast nitrogen base, 100 g of succinic acid, 60 g of sodium hydroxide, H20 to 1000 ml, sterilized by filtration. SC-URA: 90 ml of 10 x basal salt, 22.5 ml of 20% casamino acids, 9 ml of 1% tryptophan, add water to 806 ml, sterilize in autoclave, add 3.6 ml of 5% threonine and 90 ml of 20% glucose or 20% galactose. SC-URA agar: SC-URA, 20 g / 1 agar is added. Olive oil: Sigma 0-1500. Bright Green Solution: 4 mg / 1 Bright Green (Sigma B-6756) in water EXAMPLE 1 An E. coli genomic library was constructed from H. dnsolens DSM 1800 consisting of about 106 individual clones in 50 combined. DNA was isolated in 20 individual clones from the library, and subjected to analysis for cDNA insertion. It was found that the insertion frequency was > 90% and the average size of the insert was approximately 1400 bp. DNA from some of the pools was transformed into yeast, and 50-100 plates containing 200-500 yeast colonies were obtained from each pool. More than 70 positive colonies were identified and isolated on agar plates. The cDNA inserts were amplified directly from the yeast colony, and characterized as described in the Materials and Methods section above. The cDNA sequence encoding the lipolytic enzyme is shown in SEQ ID No. 1. Subsequently, the cDNA encoding the lipolytic enzyme was isolated for expression in Aspergillus as described above, and transformed into α. coli using standard procedure. Two colonies of E were isolated. coli from each of the transformations, and they were analyzed with the restriction enzymes HindIII and Xbal which removed the DNA insert. DNA from one of these clones was retransformed into yeast strain JG169.

EXAMPLE 2 In order to express the gene in Aspergillus, the cDNA is isolated and digested with HindIII / Xbal, subject to size fractionation on a gel and purification, and subsequently ligated to pHD414, resulting in the plasmid pA2L79. After amplification in E. coli, the plasmid is transformed into A. oryzae or A. niger, according to the general procedure * described above.

Transformant test of A. oryzae Each of the transformants was tested for lipolytic activity as described above. Some of the transformants had lipolytic activity, which was significantly greater than the history of Aspergillus oryzae. This demonstrates the efficient expression of the lipolytic enzyme in Aspergillus oryzae. The transformant with the highest lipolytic activity was selected and inoculated into a 500 ml shake flask with medium PM. After 3-5 days of fermentation with sufficient agitation to ensure good aeration, the culture broths were centrifuged for 10 minutes at 2000 g, and the supernatant was recovered and analyzed. The lipolytic activity in the supernatants was identified as described above.

Fermentation in batch The batch fermentation was performed in a medium comprising maltose syrup as a carbon source, urea as a source of nitrogen and yeast extract. Batch fermentation is carried out by inoculating a shake flask, with a culture of the A. oryzae host cells in question, into a medium comprising 3.0% of the carbon source and 0.4% of the source of nitrogen. After 24 hours of culture at pH 7.0 and 34 ° C, the fermentation was finished, after which the enzymes could be recovered by centrifugation, ultrafiltration, clear filtration and germinal filtration.

EXAMPLE 3 Purification and characterization of a lipolytic enzyme of H. insolens The supernatant of the batch fermentation was centrifuged and the precipitate containing the cell waste was discarded. The supernatant was adjusted with solid ammonium sulfate to a saturation of 60%, and allowed to stand overnight. The precipitate containing cutinase activity was separated by centrifugation. The precipitate with ammonium sulfate was dissolved in water and adjusted to p? 6 with dilute acetic acid. The sample containing the Impolytic activity was passed over an agarose and bacitracin column to get rid of the alkaline protease activity present in A. oryzae. The lipolytic activity that does not bind to Bacitracin-agarose was recqlected as an effluent. The combination containing the activity was adjusted to pH 5.8 and the ionic strength was adjusted to 2 Milli Siemens. The sample was applied on a SP-Sepharose ™ High Performance cation exchange column from Pharmacia ™, which was equilibrated with 25 mM sodium acetate buffer, pH 5.8 The bound activity was eluted with a gradient / te of linear salt Using the same buffer, the molecular weight of the purified protein was determined using gradient gels of 8-25% PHAST SDS-PAGE (PHAST SystemTM, Pharmacia) The molecular weight was estimated at 20-21 kD. the protein was determined using the PAGE plates Ampholine * 1 *, pH 3.5-9.5 (Pharmacia LKB) according to the manufacturer's instructions The pl was found to be 8. The lipolytic enzyme was found to be inhibited by fluoride of phenyl-methyl-sulfonyl, suggesting an active site accessible to the solvent and thus esterase activity.

Assay for lipase activity and lipolytic enzyme specific activity The activity of the lipase was determined using a substrate prepared by emulsification of glycerol tributyrate (MERCK), using gum arabic as an emulsifier. The activity of the lipase was tested at pH 7 using a p? -stat method (using a VTT Radiometer trademark shredder). One unit of lipase activity (LU) is defined as the amount needed to release one micromole of fatty acid per minute. The specific activity at pH 7 was determined to be at least about 1200 LU / mg.

Specificity of the Substrate: To compare the lipolytic activity of the lipolytic enzyme H. insol eε of the invention (having the amino acid sequence shown in SEQ ID No. 2) to a long chain substrate (olive oil) ) and a short chain substrate (glycerol tributyrate), two tests were carried out at pH 9: 1) Sigma olive oil substrate test using the Sigma lipase substrate emulsion (Sigma Catalog No. 800-1) , 2) an assay with tributyrin (glycerol tributyrate) as a substrate, using gum arabic as an emulsifier. The tests were carried out using a pH-stat method at pH 9. At pH 9, the The activity of the lipolytic enzyme was about 500 units of Sigma / O028o lipase and around XU / D028o in assays 1 and 2, respectively, suggesting that lipolytic enzyme has better activity with short-chain substrates such as tributyrin Optimal pH of the enzyme: l. polysic of H. ± psroleiis- The lipolytic activity of the eyrix at different pH values was investigated with gli tributyrate, cerol as a substrate, and gum arabic as an emulsifier, using the pH-stat method. The activity of the enzyme as a function of pH (pH 6, 7, 8, 9, 10, respectively) is shown in Figure 1; ~ The Optimal pH seems to be about 8, with a high percentage of the maximum activity that is still "preserved at pH 10.

N-terminal sequencing The lipolytic enzyme "of H. insol ens DSM 1800 of the invention was finally purified using reverse phase high performance liquid chromatography (HPLC)." The N-terminal amino acid sequence of the enzyme was determined for the 27 residues using a sequencer Applied 'Biosystems The resulting sequence is shown in SEQ ID No. 3, in which Xaa designates an unassigned residue that is almost certainly a cysteine residue.In position 12, Gly and Ala were found in equal amounts.

EXAMPLE 4 Operation of the lipolytic enzyme of H. insolens DSM 180 of the invention, in an assay to evaluate the "First Wash" lipolytic effect The "textile wash / laundry" operation of the lipolytic enzyme of the invention was tested in a cycle wash test carried out on a thermoadjusted Terg-O-Timer (TOM) followed by in-line drying.

The experimental functions -were as follows: Washing liquor: 1000 ml per container. Samples: 7 samples of cotton (9 x 9 cm) per container. Stain: Colored butter with Sudan Red (Sigma) (0.75 mg Sudan Red / g lard). 50 μl of colored butter heated to 70 ° C, were applied to the center of each sample. The samples were then heated in an oven for 25 minutes at 75 ° C and stored overnight at room temperature before the first wash. Water hardness: 3.2 mM Ca2 + / MG2 + (in a ratio of 5: 1). Detergent: 5 g / 1 of a compact powder, European, commercial, standard (AríelMR Futur). There was no adjustment to pH. Lipolytic enzyme concentration:: 0 LU / 1 (control) and 12500 LU / 1. , Washing time: 20 minutes Washing temperature: 30 ° C Rinse: 15 minutes in tap water of the I key. Drying: Overnight at room temperature (approximately ZO ^ C, 30-40% - relative humidity ^.

Evaluation: After washing, rinsing and drying the samples, the residual fat was extracted with petroleum ether in a Soxhlet extraction apparatus. The solvent was distilled and the amount of residual fat material was removed from the samples and determined by weighing. Results: in relation to the amount of residual fat material in the samples washed in the enzyme-free wash liquor, washing the samples in the wash liquor containing enzymes resulted in the removal of 16% of the fatty material. It is apparent from these results, that the lipopolytic enzyme in question (a lipolytic enzyme of the invention) is capable of performing excellent "first wash" removal of the lipid in the textile wash.

EXAMPLE 5 Affinity by substrate of the lipolytic enzyme of H. insolens DSM 1800 of the invention The following procedure was designed to evaluate the ability of a lipolytic enzyme to accumulate on / in a phase of the lipid substrate (in this case olive oil) which is in contact with an aqueous, alkaline, buffered phase that contains the enzyme, in the presence of a non-ionic surfactant. In this example, the affinity for the substrate of the aforementioned lipolytic enzyme of the invention was compared with that of the commercial lipolytic enzyme LipolaseM (available from Novo).

Nordisk A / S, Begsvaerd, Denmark).

Process 1. An aliquot of 5 ml of buffer solutions (100 mM glycine, pH 9.0) was placed on each of two, 20 ml, identical, sealable flasks; 2. The chosen enzyme is added to both bottles to give a concentration in the range of 5-10 LU / ml (same concentration in both bottles); "3. Add 5 ml of olive oil to a bottle (" sample "bottle) and both bottles are shaken vigorously and incubate for 24 hours at 4 ° C 4. The residual lipolytic activity is determined (denoted AND below; in Xü / ml) in the aqueous phases in the "sample" bottle (s) and the "reference bottle" (r), respectively.

The ratio Ys / Yr gives a measure of the affinity of the enzyme for the substrate in question.

Results: The results for the lipolytic enzyme of the invention and for Lipolase ™, respectively, are shown in the following table.

It is apparent from the foregoing that the enzyme according to the invention shows very high affinity for olive oil.

EXAMPLE 6 Lipolytic activity of the lipolytic enzyme of H. insolens DSM 1800 of the invention, in a mixed monolayer containing an alcohol ethoxylate A mixed monolayer was prepared from a diglyceride. { dicaproine) and a monocomponent alcohol etsxylate (monooctadecyl heptaethanol glycol ether) diffused over an aqueous phase (10 mM glycine, pH 10.0, 0.1 mM EDTA, temperature 25 ° C) using a KSV-5000 monolayer apparatus. { KSV Instruments, Finland). The surface pressure was adjusted to the desired value (in this case 30 mN / m) and the chosen enzyme (10 LU) was injected into the aqueous phase. The lipolytic action manifests itself through the speed with which a mobile barrier comprising the monolayer has to be moved in order to maintain a constant surface pressure, as the substrate molecules insoluble in water are hydrolyzed to give products more soluble in water. Using this procedure, a particular lipolytic enzyme is characterized by a parameter ß which indicates the percentage of final area of the remaining non-hydrolyzed substrate, by the enzyme as lipolytic activity ceases. In this example, the enzyme of H. ínsol ens DSM 1800 of the invention was compared with the commercial enzyme "Lipolase ™.

Results: The results are summarized in the following table: It is apparent from the latter results, that the lipolytic enzyme of the invention works very well in the hydrolysis of lipids in the presence of an alcohol ethoxylate (for example a non-ionic surfactant).

REFERENCES Becker, D.M. & Guárante, L. 1991 Methods Enzimol 194: 182-187.

Gubler, U. & Hoffman, B. J. 1993. Gene 25: 263-269, Sambrook, J. Tritsch, E. F. & Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Lab., Cold Spring Harbor, NY.

Sanger, F., Nicklen, S. & Coulson, A. R. 1977. Proc. Nati Acad. Sci. E.TT.A. 74-: 5463-54-67.

SEQUENCE LIST SEQ ID No. 1 DNA sequence coding for the lipolitic enzyme of H. insol ens (mature enzyme + signal peptide) GCC ACCACTTACCAACCAGCTTCCGCAAACAAAGTCGCCAAC ATGAAGTTCTTCACCACCATCCTCAGCACCGCCAGCCTTGTTGCTGCTCT CCCCGCCGCTGTTGACTCGAACCATACCCCGGCCGCTCCTGAACTTGTTG CCCGGCAGCTGGGAGCCATCGAGAACGGCCTTGAGAGCGGCAGCGCCAAC GCCTGCCCCGACGCCATCCTGATCTTTGCTCGCGGCTCGACCGAGCCAGG CAACATGGGCATCACCGTCGGCCCTGCTCTCGCCAACGGCCTTGAGTCCC ACATCCGGAACATCTGGATCCAGGGCGTCGGCGGCCCTTACGACGCCGCG CTGGCCACCAACTTCCTGCCGCGGGGCACCTCGCAGGCCAACATCGACGA GGGCAAGCGGCTGTTTGCGCTGGCCAACCAAAAGTGCCCCAACACGCCCG TCGTCGCCGGCGGGTACAGCCAGGGCGCGGCGCTCATCGCTGCCGCCGTC AGCGAGCTCAGCGGCGCCGTCAAGGAGCAGGTCAAGGGCGTCGCCCTCTT CGGATACACCCAAAACCTCCAGAACCGTGGCGGCATCGCCAACTACCCGC GCGAGCGCACCAAGGTGTTCTGCAACGTTGGCGACGCCGTCTGCACCGGC ACGCTCATCATCACCCCGGCGCATCTGTCGTACACGATCGAGGCGCGCGG TGAGGCCGCGAGGTTCCTGCGGGATCGCATCCGTGCTTATATGGAATGGG TTATCAGAGGGAAAGATGGCTGGATAGGTAACAAAGGATGAGTCCGGGCG GGATTGGGTTCAGGAGTTGGGCAGGCGGATTGCTCGATGGCTGGATGGAT GGATGGAAGCCGGGCTGGGACCGGAGGCTGATGACGGTGATGACCTTTTT CCTCAGTACATAGCATCATGATGTCTCCTGCACATATCTGTTTATGAATC GAGTTTTGGTTTGCGGCCGCTGCCTCAGAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA SEQ ID No. 2 Amino acid sequence of the lipolytic enzyme of H. insol ens (mature enzyme + signal peptide) 1 MKFFTTILST AS VAALPAA VDSNHTPAAP ELVARQ GAI ENG ESGSAN ACPDAILIFA 61 RGSTEPGNMG ITVGPALANG LESHIRNTWI QGVGGPYDAA ATNFLPRGT SQANIDEG R 121 LFALANQKCP NTPWAGGYS QGAALIAAAV SELSGAVKEQ VKGVALFGYT QNLQNRGGIA 181 NYPRERTKVF CNVGDAVCTG TLIITPAHLS YTIEARGEAA RFLRDRIRAY NEWVIRGKDG 241 IGNKG * SEQ IX) No. 3 N-terminal amino acid sequence (mature enzyme) Gln-Leu-Gly-Ala-Ile-Glu-Asn-Gly-Leu-Glu-Ser-Gly / Ala-Ser-Ala; -Asn-Ala-Xaa-Pro-Asp-Ala-Ile-Leu-Ile-Phe -Ala-Arg-Gly- It is noted that in relation to this date, > The best method known by the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following:

Claims (17)

1. A DNA construct comprising a DNA sequence encoding an enzyme showing lipolytic activity, the DNA sequence of which is characterized in that it comprises a) the ATM sequence shown in SEQ ID No. 1, and / or the DNA sequence coding for a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi if at DSM 9975, or b) an analogue of the DNA sequence shown in SEQ ID No. 1, and / or the DNA sequence encoding for a lolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi siae DSM 9975, which i) is homologous with the DNA sequence shown in SEQ ID No. 1 and / or the DNA sequence coding for a lipolytic sequence, which is obtainable from the plasmid in Saccharomyces cerevi if DSM 9975, and / or ii) is hybridized with the same oligonucleotide probe as the DNA sequence shown in SEQ ID No. 1 and / or the sequence of DNA that codes for an enzyme lipolytic, which is obtainable from the plasmid Saccharomyces cerevi siae DMS 9975, and / or iii) encodes a polypeptide which is homologous to the polypeptide encoded by a DNA sequence comprising the DNA sequence shown in SEQ ID No . 1 and / or the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi if DSM 9975, and / or iv) codes for a pelpeptide which is i-reactive with an antibody produced against a purified lipolytic enzyme which is encoded by the DNA sequence shown in SEQ ID No. 1 and / or by the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi si DSM 9975, and / or which is derived from 'Humi col a Insol ens DSM 1800.

2. The DNA construct according to claim 1, characterized in that the DNA sequence encoding an enzyme showing lipolytic activity is obtainable from a microorganism.

3. The DNA construct according to claim 2, characterized in that the DNA sequence is obtainable from a filamentous fungus or a yeast.

4. The DNA construct according to claim 3, characterized in that the DNA sequence is obtainable from a strain of Thielav, ia, Chaetomi um, Gelasinospora f Neurospora, Podospora, Sordari or Humicola.

5. The DNA construct according to claim 4, characterized in that the DNA sequence is obtainable from a strain of Chaetomi um or humi tail, in particular a strain of H. insolens.

6. The DNA construct according to claim 5, characterized in that the DNA sequence is isolated from or produced based on a genomic DNA library of H. insol DSM 1800.

7. A recombinant expression vector, characterized in that it comprises a DNA construct according to any of claims 1-6.

8. A cell, characterized in that it comprises a DNA construct according to any of claims 1-6 or a recombinant expression vector according to claim 7.

9. A cell according to claim 8, characterized in that it is a eukaryotic cell, in particular a fungal cell, such as a yeast cell or a filamentous fungus cell

10. A cell according to claim 9, characterized in that the cell belongs to a strain of Aspergillus or Tri choderma, in particular to a strain of Aspergillus oryzae or Aspergillus niger.

11. A method for the production of an enzyme that exhibits lipopolytic activity, characterized in that the method comprises culturing a cell according to any of claims 8-10 under the conditions leading to the production of the enzyme, and recovering the enzyme from the culture.

12. An enzyme exhibiting lipolytic activity, characterized in that the enzyme is a) encoded by a DNA construct according to any of claims 1-6, and / or b) is produced by the method according to claim 11, and / or c. ) is immunologically reactive with an antibody produced against a purified lipolytic enzyme, which is encoded by the DNA sequence shown in SEQ ID No. 1 and / or by the DNA sequence encoding a lipolytic enzyme, which is obtainable from the plasmid in Saccharomyces cerevi siae DSM 9975, and / or which is derived from Humi cola insol ens DSM 1800.

13. An enzymatic preparation, characterized in that it comprises a lipolytic enzyme according to claim 12.

14. An additive for detergent, characterized in that it comprises a lipolytic enzyme according to claim 12.

15. A detergent composition, characterized in that it comprises a lipolytic enzyme according to claim 12.

16. A detergent composition according to claim 15, characterized in that it is for laundry washing.

17. A detergent composition according to claim 15, characterized in that it is for. Washing dishes.