MXPA97001224A - Vaccines against borrelia burgdorferi o - Google Patents

Abstract

The present invention provides a new antigen. OspG, by B. burgdorferi, which is useful in the prevention and diagnosis of Lima disease. The cloning, sequence and expression of the antige

Description

VACCINES AGAINST BORRE IA BURGDORFERI OspG DESCRIPTION OF THE INVENTION The present invention relates to novel antigens and their derivatives, derivatives of Borrelia burgdorferi, to methods for their production, to their use in medicine and diagnostics in humans and animals, and to pharmaceutical compositions containing them. In particular, the present invention provides the expression of cloning of a novel lipoprotein, from B. burgdorferi, polymorphic, OspG. This has been previously known as 1p77. The deduced amino acid sequence of this protein does not exhibit any significant homology to other known Borrelia antigens, such as OspA, OspB, OspC, OspD, OspE, OspF and P27. These outer surface proteins exhibit a similarity of 41 and 65% with OspG (Table 1). Lima disease (Lyme) is the infectious disease that carries the most common temperate climate vector. The etiologic agent, the spirochete Borrelia burgdorferi, causes a multisystem disease in humans, which can affect the skin, nervous system, joints and heart (8, 44). Strains of B. burgdorferi, isolated from different biological sources and graphic areas, are heterogeneous (2, 19. 38, 45, 50), and it is assumed that the patterns of disease manifestations are influenced by antigenic differences of the strains of spirochetes. Although vain attempts to classify B. burgdorferi have recently been reported, by immunological or molecular criteria, the taxonomy of B. burgdorferi remains a subject of controversy and active investigation. To date, a variety of B. burgdorferi antigens, such as outer surface protein A (OspA), OspB, pC and p100, have been used for serological diagnosis and as putative candidates for the development of vaccines (13, 14 , 36, 38, 40, 41). However, due to its obvious, unambiguous criteria of heterogeneity for the generation of a specific diagnostic standard for species and for the development of a polypeptide vaccine that could guarantee protection against any subspecies that remains deficient. The inventors of the present have discovered an additional lipoprotein from B. burgdorfep, which is designated as OspG. This molecule is characterized by having a molecular weight of about 22 kDa, and an isoelectric point of Pl = 52, and comprises 196 amino acids. The mature protein is further characterized by having a large hydrophobic domain of about 20 amino acids in the amino-terminal portion of the molecule. OspG. This N-terminal peptide corresponds to the leader signal peptide found in typical procapotic lipoprotein precursors. At the carboxy terminus of the hydrophobic core is a cleavage site presumably recognized by a B. burgdorferi signal peptidase. The potential cleavage site in OspG is between serine at position 19, and cysteine at position 20. The sequence around the OspG cleavage site is L-1-1-S-C. Like the gene for OspA, B, C, D, E, F and P27, the OspG gene is naturally located on the 55 kb plasmid in B. burgdorferi ZS7. The weak cross-reactivity of the OspG probe with the 45 kb plasmid was observed. OspG has the amino acid sequence substantially as set forth in Figure 1. It is further characterized by being expressed only during infection and is not detectable in B burgdorferi cultured in vitro. Accordingly, the present invention provides an isolated protein derived from B. burgdorferi, characterized in that it has a molecular weight of between 20-22 kDa, as determined by two-dimensional SDS gel electrophoresis, and an isoelectric point of between 4.9 and 5.4 . The inventors herein further provide a protein of an immunologically or antigenically equivalent fragment, or a derivative thereof, having at least 80% homology to the amino acid sequence depicted in Figure 1. The protein and its corresponding sequences of DNA and RNA find utility in the field of both vaccines and diagnostics. Preferably, the present invention provides a protein having at least 85% homology, preferably 90% homology, and most preferably at least 95% homology to the protein depicted in Figure 1.

The protein of the present invention can be a fusion protein, in such case, the fusion protein is characterized as having a portion of its amino acid sequence or a fragment thereof. Preferably, the portion is at least 80%, preferably 85%, preferably 90%, and most preferably 95% homologous to the protein sequence of Figure 1. Preferably, the protein is at least 70% pure, as determined by SDS polyacrylamide gel electrophoresis, and preferably 80% pure, and most preferably at least 90% pure. The protein of the present invention may be a lipoprotein, or be produced as a protein without any associated lipid. When produced by recombinant techniques, lipoprotein will be expressed with the signal sequence. Cleavage of the signal sequence to remove the N-terminal 19 amino acids will result in the production of a non-lipid molecule. The immunostaining analysis shows that OspG is recognized by sera from mice previously infected with intact spirochetes, which suggests that the native protein is immunogenic in this species. The inventors of the present invention have also identified and sequenced the gene for OspG. Accordingly, the invention provides a DNA sequence encoding an OspG protein or fragment or derivative thereof. Preferably, the DNA sequence is substantially as set forth in Figure 1. The term "substantially," as used herein, means at least 70% identity to the sequence set forth in Figure 1, preferably 80% identity. , preferably at least 85% identity, and most preferably at least 95% identity. In particular, the present invention provides a DNA sequence having substantially the sequence depicted in Figure 1, or a fragment thereof, or a DNA sequence which hybridizes to said sequence and which codes for a protein that exhibits a antigenic character to OspG. The DNA of the present invention can be prepared by enzymatic DNA polymerization, it can be performed in vitro using a DNA polymerase such as a DNA polymerase I (Klenow fragment) in an appropriate pH buffer, containing the nucleoside triphosphates, dATP, dCTP, dGTP and dTTP, as required at a temperature of 10-37 ° C, generally in a volume of 50 μl or less. Enzymatic ligation of DNA fragments can be performed using a DNA ligase, such as T4 DNA ligase, in an appropriate pH regulator, such as 0.05M Tris (pH 7.4), 0.01M MgCl, 0.01 dithiothreitol, 1m spermidine and 0.1 mg / ml of bovine serum albumin, at a temperature of 4 ° C to ambient, generally in a volume of 50μl or less. The chemical synthesis of the DNA polymer or fragments can be carried out by the conventional chemistry of phosphotriester, phosphite, or phosphotamidite, using solid phase techniques, such as those described in "Chemical and Enzymatic Synthesis of Gene Fragments" ("Chemical and Enzymatic Synthesis of Fragments of Gen "), Laboratory Manual (ed. HG Gassen and A Lang), Verlag Chemie, Weinheim (1982), or in other publications, for example, MJ Gait, H.W.D. Matthes, M. Singh, B.S. Sproat, and R C Titmas, Nucleic Acids Research, 1982, 10, 6243; B. Sproat and W Bannwarth, Tetrahedron Letters, 1983, 24, 5771; M D Matteucci and M.H. Caruthers, Tetrehedorn Letters, 1980, 21, 719, M.D Matteucci and M.H. Caruthers, Journal of the American Chemical Society, 1981, 103, 3185; S.P. Adams et. al, Journal of the American Chemical Society, 1983, 105, 661; N.D. Sinha, J. Biernat, J McMannus, and H. Koester, Nucleic Acids Research, 1984, 12, 4536, and H W D. Matthes et. al, EMBO Journal, 1984, 3, 801. Alternatively, the coding sequence can be derived from B. burgdorferi mRNA, using known techniques (for example reverse transcription of mRNA to generate a complementary cDNA chain), and commercially available cDNA equipment. The invention is not limited to the sequence specifically described, but includes all the molecules that code for the protein or an immunogenic derivative thereof, as described above. The DNA polymers that encode mutants of the protein of the invention, can be prepared by site-directed mutagenesis of the cDNA, which encodes the protein by conventional methods, such as those described by G.Winter et. al, in Nature 1982, 299, 756-758, or by Zoller and Smith 1982; Nucí Acids Res., 10, 6487-6500 or elimination mutagenesis, such as that described by Chan and Smith in Nuci. Acids Res. 1984, 12, 2407-2419, or by G. Winter et. al in Bioche. Soc. Trans., 1984, 12.224-225. In one aspect, the present invention provides a method comprising the steps of: i) preparing a replicable or integrating expression vector capable of, in a host cell, expressing a DNA polymer comprising a nucleotide sequence encoding said OspG protein or an immunogenic derivative thereof; I) transforming a host cell with said vector; iii) culturing said transformed host cell under conditions that allow the expression of said DNA polymer to produce said protein, and iv) recovering said protein. The term "transform" is used herein to represent the introduction of foreign DNA into a host cell by transformation, transfection, or infection with an appropriate plasmid or viral vector, using, for example, conventional techniques such as those described in Genetic Engineering; Eds. YE. Kingsman and A.J. Kingsman; Blackwell Scientific Publications; Oxford, England, 1988. The transformed term "or" transformant "will be applied later to the resulting host cell which contains and expresses the foreign gene of interest.The expression vector is novel and also forms part of the invention. replicable expression can be prepared according to the invention, by cleaving a vector compatible with the host cell to provide a linear segment of DNA, which has an intact replica, and which combines said linear segment with one or more DNA molecules which, together with said linear segment, encode the desired product, such as the DNA polymer encoding the OspG protein, or fragments of the same, under conditions of ligation. In this way, the DNA polymer can be preformed or formed during construction of the vector, if desired. The choice of vector will be determined in part by the host cell, which may be prokaryotic or eukaryotic. Suitable vectors include plasmids, bacteriophages, cosmids and recombinant virus. The preparation of the replicable expression vector can be carried out conventionally with enzymes suitable for the restriction, polymerization and ligation of the DNA, by methods described in, for example, Maniatis et al, cited above. The recombinant host cell is prepared, according to the invention, by transforming a host cell with a replicable expression vector of the invention, under transformation conditions. Suitable transformation conditions are conventional and are described in, for example, Maniatis et al, cited above, or "DNA cloning", vol. II, D.M. Glover ed., IRL Press Ltd, 1985. The choice of transformation conditions is determined by the host cell. In this way, a bacterial host, such as E. Coli can be treated with a CaCl 2 solution (Cohen et al, Proc. Nat. Acad. Sci., 1973, 69, 2110), or with a solution comprising a mixture of RbCI, MnCl2, potassium acetate and glycerol, and then with a 3- [N-morpholino] -propan-sulfonic acid, RbCI and glycerol. Mammalian cells, in culture, can be transformed by calcium co-precipitation of the DNA vector onto the cells. The invention also extends to a host cell transformed with a replicable expression vector of the invention. The culture of the transformed host cell under conditions that allow the expression of the DNA polymer is conventionally carried out, as described in, for example, Maniatis et. al and "DNA cloning", cited above. In this way, preferably the cell is supplied with nutrient and cultured at a temperature below 45 ° C. The product is recovered by conventional methods according to the host cell. In this way, when the host cell is a bacterium, such as E. coli, it can be lysed, chemically or enzymatically, and the protein product isolated from the resulting or supervariant lysate. When the host cell is a mammalian, the general product can be isolated from the nutrient medium or free cell extracts. Conventional protein isolation techniques include precipitation chromatography, absorption, selective, and affinity chromatography, including a monoclonal antibody affinity column. Alternatively, expression can be carried out on insect cells using a suitable vector such as Baculovirus. In a particular aspect of this invention, the protein is expressed in Lepidoptera cells, to produce immunogenic polypeptides. To express the protein in lepidopteran cells, the use of an expression system of a baculovirus is preferred. In such a system, an expression cassette comprising the protein coding sequence, operably linked to a baculovius promoter, is typically placed in a promiscuous vector. Said vector contains a sufficient amount of bacterial DNA to propagate the promiscuous vector in E. coli or some other suitable prokaryotic host. Said promiscuous vector also contains a sufficient amount of baculovirus DNA flanking the desired protein coding sequence, in order to allow recombination between a wild type baculovirus and the heterologous gene. The recombinant vector is then co-transfected into the lepidoptera cells with DNA, from a bacu lovirus of wild type. Recombinant bacu loviruses, which arise from homologous recombination, are II then selected and plaque purified by normal techniques. See Summers et al, TAES Bull (Texas Agricultural Experimental Station Bulletin) NR 1555, May, 1987. A method for expressing CS protein, in insect cells, is described in detail in USSN 287,934 of Smithkline RIT (WO-US 89- 05550). Production in insect cells can also be achieved by infecting insect larvae. For example, the protein can be produced in caterpillars Heliothis virescens, by feeding the recombinant baculovirus of the invention together with traces of wild type baculovirus, and then extracting the protein from the hemolymph after approximately two days. See, for example,. My Ile et. al, PCT / WO88 / 02030. The novel protein of the invention can also be expressed in yeast cells as described for CS protein, in EP-A-0278941. The present invention also relates to a vaccine composition comprising OspG or a fragment or derivative thereof. In the vaccine of the invention, an aqueous solution of the protein (s) can be used directly. Alternatively, the protein, with or without prior lyophilization, can be mixed or absorbed with any of the known auxiliary spans. Such auxiliaries include, but are not limited to, aluminum hydroxide, muramyl dipeptide and saponins such as Quil A. Particularly preferred auxiliaries are MPL (monophosphoryl lipid A) and 3D-MPL (3De-O-acylated monophosphoryl lipid A) . A very preferred auxiliary is known as QS21. 3D-MPL can be obtained from Ribi Immunochem or by the methods described in British Patent No. 2220211, while QS21 can be obtained from Cambridge Biotech, or by the method described in the US patent. No. 5,057,540. As a further illustrative alternative, proteins may be encapsulated within microparticles, such as liposomes, or associated with oil-in-water emulsions. In another illustrative alternative embodiment, the proteins can be conjugated to an immunostimulation macromolecule, such as Bordetella annihilated or a tetanus toxoid. In a preferred embodiment of the invention, the antigen of the present invention will contain other Borrelia antigens, in particular OspA. The proteins of the present invention can be expressed by living vectors such as BCG, Listeria or Salmonella, and formulated as live vaccines using said vectors. The preparation of the vaccine is generally described in New Tends and Developments in Vaccines, Voller et. al (eds), University Park Press, Baltimore, Maryland, 1978. Encapsulation within liposomes is described by Fullerton, U.S. Pat. 4,235,877. The conjugation of proteins to macromolecules is described, for example, by Likhite, patent of E.U.A. 4,372,945, and Armor et.al, patent of E.U.A. 4,474,757. The use of Quil A is described by Dalsgaard et.al, Acta Vet Scand, 18: 349 (1977). The amount of protein of the present invention, present in each vaccine dose, is selected as an amount that induces an immunoprotective response without significant adverse side effects in typical vaccines. This amount will vary depending on the specific immunogen used, and whether or not they will be used as adjuvants for the vaccine. Generally, each dose is expected to comprise 1-1000 μg of protein, preferably 1-200 μg. An optimal quantity for a particular vaccine can be ascertained by normal studies, which involve the observation of antibody titers and other responses in subjects. After an initial vaccination, subjects may receive additional administration to improve their immune response. The present invention also relates to antibodies, preferably monoclonal antibodies, which are specific to OspG. These antibodies find utility in the diagnosis and also in the prevention of Lima disease. In an alternative embodiment of the invention, a diagnostic kit comprising an OspG antigen is provided.

I. Materials and Methods 1.1 Strains of Borrelia The strains of B. burgdorf eri used in this study were described anywhere (45). Borrelia was grown in a medium of Barbour-Stoenner-Kel and I I (BSK I I) modified (2) at 33 ° C. overnight at 65 ° C, in 0.5M NaHPO4 / 7% NaDodSO4, pH 7.2. after washing in 40 nM NaHPO4 / 1% NaDodSO4, pH 7.2, at room temperature for 30 minutes, the dried membrane was autoradiographed on a Kodak XAR-5 film, with intensification screens at -80 ° C for 1 hour. 12 hours. As a hybridization probe, a 500 bp DNA fragment was used, encompassing the LA7 coding region. The gene fragment of interest was recovered for the low melting agarose gel, precipitated by an ethanol treatment, and radiolabelled by random reaction of primers, as described. 1. 5 Gel Electrophoresis For the electrophoresis on SDS / PAGE slice gels, of one dimension, according to Laemmli (21), 40 μl of each lysate (equivalent to 108 organisms) were mixed with 10 μl 5 x pH regulator of sample of reduction. Two-dimensional polyacrylamide gel electrophoresis was carried out, as described by O'Farrel (29), using IEF (Pharmacia / LKB ampholytes: 1.45% pH 3.5-10, 0.1% pH 2.5-4.0, 0.2% pH 4-6, 0.2% pH 9-11) in the first dimension. The same amount of lysate was applied, as in the case of one-dimensional gel electrophoresis. The gels were either filtered with silver or processed by Western staining (15). Proteolysis of the surface was performed using proteinase K (Boehringer-Mannheim, Germany), according to the method of spirochetes were harvested by centrifugation at 10,000 xg at 4 ° C for 20 minutes, washed twice in PBS, and enumerated by means of dark field microscopy.

Preparation and screening of an expression bank of B. burgdorferi Genomic DNA was prepared from strain ZS7 of B. burgdorferi, by the lysozyme / SDS method. and DNA fragments were generated by the application of sound. Shaved-ended DNA was inserted into the pUEX1 vector, using an adaptive cloning strategy (7, 31). The ligated DNA was transformed to E. coli MC1061, followed by the screening of expression using an immune serum taken from DBA / 2 mice inoculated with 104 (and less) B. burgdorferi organisms (ZS7). 1. 2 Hybridization by Southern staining Total genomic DNA was extracted from Borrelia organisms, as previously described (32) Approximately 5 μg of DNA were digested with 100 U of restriction nuclease (Hindlll), according to the manufacturer's recommendations (Boehringer , Mannheim). The samples were subjected to electrophoresis using a 07% agarose gel. The DNA fragments were transferred to a Hybond ™ -N nylon membrane (Amersham), followed by entanglement and UV hybridization. In summary, using probes labeled as 32P, hybridization was performed Barbour et al. (twenty). The proteins were then separated by SDS-PAGE, and the individual antigens were identified by immunostaining. 1. 6 Western staining Following a two-dimensional SDS-PAGE, the proteins were electrotroved for one hour at a constant current (60 mA) on Hybond C nitrocellulose sheets (Amersham), using an electrowinning chamber, semi-dry (BIO-RAD) , Munich, Germany), according to the manufacturer's recommendations. After one night incubation, in blocking buffer (50mM Tris-HCl, 150mM NaCl, 5% dry milk, no fat), the immunostains were incubated for 2 hours at room temperature with a dilution of 1: 1 (v / v) of mouse and human antiserum in 50mM Tris-HCl, 150mM NaCl, 1% dry milk, no fat, 0.2% Tween 20, or with a culture supernatant of mouse mAbs ( LA7). The nitrocellulose fibers were washed five times, in a dilution pH regulator, and were incubated for an additional hour, with a goat anti-mouse antiserum conjugated with alkaline phosphatase (Dianova, Hamburg, Germany, 1: 400 v / v). The stains were washed four times in the aforementioned pH regulator, and twice in TBS, and the immunoreactive bands were then visualized by the addition of 20 ml of DEA-pH buffer (0.1M of diethanolamine (Sigma), 0.02% NaN3, 5mM MgCl2, pH 9.0). supplemented with 5-bromo-4-chloro-3-indolylphosphate (BCI P, Sigma; 165 μl / mg), and nitro blue tetrazolium (N BT, Sig ma; 330 μl / ml) as substrate. The reaction was stopped, washing the membrane in 50mM Tris-HCl, 150mM NaCl, and 5mM EDTA. 1. 7 DNA sequence The genomic DNA fragments of B. burgdorferi, cloned in pUXE 1 plasmids (Amersham), were sequenced using a T7 sequencer kit (Pharmacia), according to the manufacturer's recommendations. Simultaneous alignments were made for protein sequences and phylogenetic tree constructions, using HUSS programming. 1. 9 Immunofluorescence The B. burgdorferi organisms were washed twice in PBS, transferred onto adhesion slides (Superior, Bad Mergentheim, FGR), (1 x 1 05 spirochetes / reaction field), fixed in absolute ethanol (2 minutes, - 20 ° C) and air dried. The fixed spirochetes were incubated with the respective spirochetes diluted in mAbs, which were incubated with an isothiocyanate moisture chamber of luorescein, for 30 minutes. After three washes in PBS, the preparations were examined, using a fluorescent microscope, and documented using a black and white film of ASA 400 (H P5; Illford, UK). 1. 10 Immunofluorescence of B. burgdorferi B. burgdorfep organisms were washed twice in PBS, transferred to adhesion slides (Superior, Bad Mergentheim, FGR), (1 x 105 spirochetes / reaction field), fixed in absolute ethanol (2 minutes, -20 ° C) and air dried. The fixed spirochetes were incubated with the individual mAbs diluted in PBS, in a humidity chamber for 30 minutes. After three washes in PBS, the spirochetes were incubated with goat anti-mouse immunoglobulin antiserum, labeled with fluorescein isothiocyanate (Medac, Hamburg, Germany), in a humidity chamber, dark, for 30 minutes. After three washes in PBS, the preparations examined, using a fluorescent microscope, and documented using a black and white film of ASA 400 (HP5 ••• lllford, UK). The specific antibodies of B. burgdorferi-ELISA were measured in a solid-phase ELISA system with antigens of B. burgdorferi B31, as previously described (15) 2. 1 PCR amplification of a portion of the OspG gene The OspG gene, which lacks the sequence encoding the hydrophobic leader, was amplified by PCR with oligonucleotide primers 5'-GTGGATCCAAGATTGATGCGAGTAGTG -3 '(corresponds to nucleotides 61 to 79) and 5 '- GTGAATTCTATTTTTT ATCTTCTATATTTTGAGGCTCTG -3 (corresponds to nucleotides I 60 A 590). Plasmid pZS7 DNA was subjected to 30 cycles of PCR in a Cycler Thermal DNA (B? O-Med60). Denaturation was performed at 94 ° C for 60 seconds, setting at 48 ° C for 90 seconds, and an extension at 72 ° C for 90 seconds. The amplified fragment was ligated, in frame, with the glutathione S-transferase gene to vector pGEX-2T, after digestion with BamHI and EcoRI, and used for the transformation of DH5a host cells. 2. 2 Expression and purification of recombinant OspG The expression of the OspG fusion protein of glutathione S-transferase in E. coli DH5a, the affinity purification and the thrombin cleavage of endoproteinase from the fusion protein were carried out in accordance with recommended by the manufacturer (Pharmacia). 2. 3 Labeling of [3H] palmitate and phase division Triton X-100 E co organisms were grown with plasmids, bringing the total length (pZS77) of truncated versions (pOspG) of the OspG gene, in the presence of [9,10- (n) '3H] palmitic acid (specific activity, «SOCi / mmoles , Amersham), and radiolabeled lipoproteins were extracted by phase division Triton X-114, as previously described (14) 2.4 Generation of immune sera and serology Immunological sera were previously taken from mice, either inoculated into the tail with 108 (C B-17, IS ant? -108) or 103 (DBA / 2; IS anti-103) of viable B burgdorfep spirochetes of strain ZS7, or primed with 5-10 μg of lipOspA (BALB / c, IS anti-lipOspA) lipid (lip) or recOspG (BALB / c, IS anti-recOspG) recombinant (rec), sc, in ancillary (ABM2; Sebac, Aidenbach, Germany) and increased after 10 and 20 days All sera were analyzed by means of ELISA, for the amount of spirochete-specific immunoglobulin (Ig), in either all 11 spirochete (B b.lg) or in recOspA (OspA Ig) or recOspG (OspG Ig), as previously described (39). 2. 5 Protection Experiments SCID mice were either left untreated or reconstituted with normal mouse serum (NMS) or conjugated Immune Serum (IS). The amount of spirochete-specific IG (ELISA in whole burgdorfep B cell samples) transferred with individual IS was as follows. IS ant? -108, 44 μg Ig / mouse; IS anti-103, 4.5 μg Ig / mouse; IS antí-lipOspA, 5μg / mouse; IS anti-recOspG, 72μg / mouse. When tested in recOspG, the amount of specific Ig was about 10-20 times higher in IS anti-recOspG, as compared to IS ant? -103 IS were given ip, and one hour later, recipients were treated, sc, with 105 spirochetes (B. burgdorfep ZS7) The mice were investigated for the development of clinical arthritis, under conditions of blindness, and for the presence of spirochetes, by culturing ear biopsies in a BSK medium, as previously described (37 , 40). 2. 6 Pathology The development of clinical arthritis in the tibiotarsial joints was inspected under conditions of blindness, as described previously (37, 40). The classification used was as follows: + +, severe; +, less severe, (+), moderate, +/-, moderate swelling; (+ / -) marginal swelling, redness; and -, no clinical sign of arthritis Results Cloning of OspG and analysis of recombinant builders A collection of genomic DNA expression from B. burgdorferi ZS7 was tested with an immune serum from mice previously infected with 103 spirochetes (IS anti-103). It was previously shown that this IS lacks antibodies to OspA and OspB, but they transmit protection in SCID mice against subsequent infection (35). In addition, this IS recognized four individual proteins, with relative molecular masses of 19-20-kDa and two proteins of 40-kDa, when tested in immunostains of whole cell lysates of strain ZS7, separated by gel electrophoresis of two dimensions. Approximately 20 clones were identified with a clone, designated pZS77, being particularly reactive. The recombinant plasmid pZS77 was subjected to restriction analysis, subcloning and sequencing. The nucleotide sequence of OspG, together with the deduced amino acid sequence of OspG is shown in Figure 1. A consensus ribosome binding site (GGAG) is located 10bp towards the 5 'end of the ATG start codon of the OspG gene . In addition, towards the 5 'end of this translational initiation sequence is in region -10 (TATATT), in positions -70 to -64, and region -35 (TTGTTA), in positions -105 to -100. Two short inverted repeats with sequences ATATTT and TTACATTT were contained in this region towards the 5 end between positions -118 to -49. The ATG start codon of the OspG gene in position +1 is followed by an open reading frame of 588 nucleotides, corresponding to a protein of 196 amino acids, with a calculated molecular mass of 22,049 Da. A possible rho-independent terminator was identified between positions 620 and 656. The alignment of the DNA sequence towards the 5 'end of the ATG start codon of the OspG gene with the newly reported promoter region of the OspE-operon OspF, revealed an identity of 94%, as determined by the GAP algorithm. Note that the OspG promoter contains two highly conserved octamer DNA motifs, ATGTATTT (at position -187 to -180), and AATTACAT (at position -120 to -113), which have been shown previously to be associated with protein binding sites for a negative regulatory molecule, called MATa2, and to regulate the expression of the gene during the differentiation of the yeast (5,25). These DNA motifs have been identified on two genes of Saccharomyces cerevisiae, MFa2 and BAR1, respectively, and contain imperfect inverted repeats of a motif that resembles the octagon motif of the immunoglobulin, ATTTGCAT Of more interest, a sequence of Inmonoglobulin (Ig) octamer, ATTTGCAA (at position -154 to -147) is located between both S. cerevisiae-type motifs that differ from the Ig-octamer motif only by a transition substitution Analysis of the amino acid sequence of OspG The hydropathy profile of OspG suggests that the protein is highly hydrophilic with a hydrophobic domain of approximately 20 amino acids in the amino-terminal portion. This N-terminal region reveals similarities with the leader signal peptides, present in typical procapotic lipoproteins (51, 52). At the COOH-terminal end of the signal sequence is a putative peptidase II recognition motif, Leu-X-Y-Z-Cys (Figure 3a). The potential cleavage site in OspG is located between the serine in position 19 and the cistern in position 20. The calculated isoelectric point is in p 15 2 The comparison of the amino acid sequence of OspG with the sequences of all the proteins in known external surfaces of B. burgdorferi, OspA-OspF and P27, reveals that OspG exhibits the highest homology with OspF (65%) (Table 1). In addition, the N-terminal, basic peptide motif, M-N-K-K-M from OspG, is identical to that observed for OspE and OspF.

Representation of OspG Plasmid and chromosome DNA were separated from several strains of B. burgdorferi by pulse-field gel electrophoresis, and hybridized to specific OspA and OspG probes. The size of the plasmid containing OspA was estimated and is 53 kb for the ZS7 isolate of B. burgdorfep Aleman. The OspA containing the plasmid of strain ACA-1, was barely visible due to the low amounts of DNA loaded on the gel, but could be seen after a prolonged exposure (data not shown). Using the OspG probe, a prominent band was seen with a linear plasmid of approximately 48 kb, and a weaker one with a plasmid of 45 kb of strain ZS7. In contrast, in the American strain B31, two plasmids with a size of 45 kb and approximately 35 kb were hybridized with the probe of the OspG gene. Note that hybridization was not seen when genomic DNA was applied from strains, ZQ1, from B. garinii, and 20047 as well as the strain. HO14, by B. japonica. In a control experiment, the OspE-OspF probe, derived from the ZS7 strain, was used to determine if the different bands can be observed with these genomic DNAs This experiment revealed two plasmids of 45 kb and 35 kb for the strains ZS7, B31 , 20047. and 2108. DNAs isolated from other strains of Borrelia, such as B. coriaceae Co53, B. hermsu, and B tupcatae. and of Treponema pallidum, "> S did not hybridize to the OspG probe, indicating a specific character for the B. burgdorferi spice.

RFLP of the OspG gene Restriction fragment length polymorphism (RFLP) analysis of OspG with Hindlll endonuclease revealed at least 7 distinct hybridization patterns among the 20 tested isolates of B. burgdorferi: most isolates of strict sensu B. burgdorferi are characterized by two hybridization fragments of 1.8 and 3.8 kb (Figure 6. lane 1); 3 out of 6 tested B. garinii isolates, not hybridizing with the OspG probe and B. garinii strains, 20047 and S90, exhibited 1.8 kb, and 1.7, and 3 kb fragments, respectively (data not shown), between the strains of the species B. afzelii, at least 3 different hybridization patterns could be observed: one band of 24 kb for the strain ACA-1 (lane 3) and two bands of either 1.9 and 2 kb, for the MMS strain ( lane 4), or 2 and 5 kb for strain EN40 (lane 5) Expression of the recombinant protein OspG in E. Coli To amplify OspG by PCR, primers were selected in such a way that the final recombinant product lacks the 20 amino acid residues, which make up the leader peptide (46). The product encoded by amplified OspG was inserted into the frame with the carrier protein of the expression vector pGEX-2T (Pharmacia, Freiburg, Germany) and after induction with IPTG, and approximately 44-kDa were obtained from a fusion protein. of GST-OspG. The GST-OspG fusion protein was enriched from E. coli lysate by the use of glutathione-agarose beads and the subsequent digestion of the bound GST-OspG fusion proteins, with a site-specific protease.

Marked with [3 H] palmitate To determine whether OspG is expressed as a lipoprotein in E. Coli, DH5a cells were transformed with either the pZS77 or pOspG plasmid and were labeled with [3H] palm? Tato (Figure 8). Plasmid pZS77 encodes the full length OspG precursor protein with its normal, N-terminal signal sequence, while pOspG specifies a protein having the first 21 residues of the OspG precursors with the Met-Lys sequence. After extraction by dividing the detergent phase and separation by SDS-PAGE, radioactive products were visualized by fluorography. The E Co cells, which contain the full-length OspG gene (plasmid pZS77), expressed a lipoprotein of 20 kDa that was divided into the detergent phase, while the lipoproteins could not be observed in DH5a cells containing the truncated OspG gene Subcellular localization of OspG To determine the subcellular localization of OspG in intact organisms, the spirochetes were treated with proteinase K, and subsequently analyzed by immunotyping using the anti-103 serum applied to isolate OspG from the expression collection. The anti- 103 immunoserum detected 4 proteins of low molecular weight, which partially disappeared after proteolysis, while two structures on the molecular weight scale of "40 kDa, were not affected by the proteinase treatment (17). To determine if rOspG is recognized by the anti-103 serum, Western staining was performed After absorption of the anti-103 serum with rOspG, the anti--103 serum absorbed recognized the same main proteins identical in size (Figure 7A) suggesting that OspG can not be present among the low molecular weight proteins contained in 11 satons of ZS7 cultured in vitro or alternatively, the OspG proteotsis may have occurred. In order to confirm the identity of OspG and to see if OspG is capable of being expressed in ZS7 of B. burgdorfep cultured in vitro, anti-rOspG murine hypepnmune sera failed to detect OspG from 10β ZS7 organisms cultured in vitro in some experiments, a weak unexpected reactivity could be observed, with a 40 kDa polypeptide, which can be either a vanishing OspG or represent a B. burgdorfep protein that shares some epitopes with OspG. In order to analyze the expression of the OspG gene of ZS7 from B. burgdorferi, cultured in vitro, the total RNA was isolated and analyzed for the presence of an opgG transcript by Northern blot hybridization. As a control for in vitro expression and RNA degradation, the NC filter was tested with an OspA gene probe. In contrast to the OspA probe, which binds to an individual transcript of approximately 2 kb, the OspG probe failed to detect an OspG transcript. These results suggest that deficiency in the expression of OspG during in vitro culture appears to be at the level of OspG transcription of mRNA stability. Since OspG was not detectable in ZS7 litter of B. burgdorferi, cultured in vitro, the expression of OspG may be different during growth in the mammalian host. Immunostaining analysis, using representative serum samples from both human patients with Lima disease and from experimentally infected mice, revealed that antibodies specific to OspG were present. Six of the thirteen serum specimens from patients with documented Lima borreliosis were shown to contain anti-OspG antibodies. In contrast, all sera from healthy donors (n = 8) did not contain antibodies recognizing rOspG (data not shown). These findings suggest that OspG is expressed only during the course of the infection. Partial protection of SCID mice by anti-OspG immune serum In order to test the protective capacity of the anti-OspG immune serum, SCID mice were treated with the following amounts of B-specific Igor burgdorferi from preparations of IS (immune sera) combined CB -17 IS anti-108, (4.4 μg Bb Ig / mouse), DBA / 2 IS anti-103, (4 5 μg Bb Ig / mouse), BALB / c IS anti-MpOspA (5 μg Bb Ig / mouse), and BALB / c IS anti-recOspG (72 ng Bb Ig / mouse). However, IS anti-recOspG contained >; of 10 times more antibodies for recOspG, compared to IS anti-103. The SCID mice were injected, i.p, with either the indicated IS and subsequently attacked with 105 B. burgdorferi organisms. The development of clinical arthritis and the presence of spirochetes in ear biopsies were inspected. SCID mice inoculated but otherwise untreated or treated with NMS (Normal Mouse Serum) developed clinical arthritis beginning on day 6, p.i. with severe swelling of the tibiotarsal joints developing between days 13 to 24 (end point). As described above, SCID mice passively immunized with IS anti? -108 or IS ant? -103 and IS anti-lip OspA did not show any signs, or showed only marginal signs of clinical arthritis. In contrast, in SCID mice passively immunized with IS anti-recOspG the development of arthritis was only delayed as indicated by the development of moderate swelling, between days 6 and 18. In the latter points, these mice developed more severe forms of arthritis , indicating that this IS was less efficient than the other IS to control the infection. The fact that IS anti-recOspG contained > 10 times more antibodies for recOspG than the IS ant? -103, but it was much less protective, suggest that in the additional specificity of IS anti-103 contributes to the control of the infection RE F ERENCIES 1. * Aron, Lt M. Ale shun. L. Perlee, I. Sch apz, H.P. Godfrey and F.C. Hair. 1994. Cloning and DNA sequence anajysis of bmpC, a gene encoding a potential membrane liproprotein of Borreha burgdorferi. FEMS Microbiol. Lett. 123: 75-82. 2. Barbour, A.G., S.L. Tessier, and S.F. There is. 1984. Variation in a major surface protein of Lyrne disease spirocheies. Infected Immun. 45: 94-100. 3. Barbour, A.G., and H.G. Stoenner. 1985. Antigenic variation of Borrelia hermsii. UCLA Symp.MolCell.Biol.New Ser. 20: 123-125. 4. Bergstrom, S., V.G. Bundoc, and A.G. Barbour. 1989. Molecular analysis of linear plasmid-encoded major surface proteins. OspA and OspB, of the Lyme disease spirochaete Borre a burgdorfep Mol Microbiol. 3: 479-486.

. Borst, P. and D.R. Greaves. 1987. Prograrnrned gene rearrangements altering gene expression. Science 235.658-667 6. Brandt, M.E., B.S. Riley, J.D Radolf, and M.V. Norgard. 1990. Immunogenic integral membrane proteins of Borrelia burgdorferi are lipoproteins. Infected Immun 58: 983-991. 7. Bressan, G.M. and K.K. 1987 pUEX, a bacterial expression vector related to pEX with universal host specificiry. Nucí Acids Res. 15: 10056. 8. Burgdorfer, W., A.G. Barbour, S.F Hayes, J.L. Benach, E. Grunwaldt, and J.P. Davis. 1982. Lyme disease - a tic -borne spirochestosis? Science 216: 1317-1319. 9. Champion, C.I. , D.R. Blanco, J.T. Skare, D A. Haake, M.Giladi, D.Foley, J.N. Miller, and M.A. Lovett. 1994 A 9 0-k? Lobase-pa? R circular plasmid of Borrelia burgdorferi encodes an exposed protein E \ idence for expression only during infection. Infected Immun. 62 2653-2661.

. Church, G.M. and. Gübert 19S4. Genomic sequencing. Proc. Nati Acad. Sci. USA 81: 1991-1995. < l 11. Craft, J.E., D.K. Fischer. G.T. Shi axnoto. and A.C. Steere. 1986. Antigens of Borrelia burgdorferi recogrused during Lyme disease. J Clin. Invest. 78í934-939. 12. Dattwyler, R.J., D.J. Vol man, J.J. Halpenn, B.J.Luíi, J. Thomas, and M.G. Golightly. 1988. Specific immune responses in Lyme borreliosis. Ann. NY Acad. Sci.USA 539: 93-102. 13. Fi rig, E., S.W. Banhold. F.S. Kantor, and R.A. Flavell. 1992. Long-term protection of mice from Lyme disease b vacci ation with OspA. Infect. Immun. 60: 773-777. 14. Fikrig, E., S.W. Ba thold, N. Marcantonio,. Deponte, F.S. Kantor, and R.A. Flavell. 1992. Roles of OspA. OspB, and flagellin in protective immuniry to Lyme borreliosis in laboratory mice. Infected Immun. 60: 657-661.

. Fikrig, E., H. Tao, F.S. Kantor, S .W. Baphold, and R.A. Flavell. 1993. Evasion of protective immunity by Borrelia burgdorferi by truncation of outer surface protein B. Proc. Nati Acad. Sci. USA 90: 4092-4096. 16. Fuchs, H., R. Wallich, M.D. Kramer, and M.M. Simon 1994. The outer surface protein A of Borrelia burgdorferi is a plasrnin (ogen) binding protein. Proc. Nati Acad. Sci. USA, 91: 12594- 12598 17. Geni, L., U.E. Schaible, and M.M. Simon 1993. Mode of inoculation of the Lyme disease agent Borrelia burgdorferi influences infection and immune responses inbred strains of mice. J. Iniect. Dis. 167: 971-975. 18. Hughes, C.A.N. , YE. Engstrom, L.A. C? Leman, C.B. Kodner, and R.C. Johnson. 1993. Protective imrnurury is induced by a Borrelia burgdorferi mutant that lacks OspA and OspB. Infected Immun. 61: 5115-5122. 19. Jonsson, M., L. Noppa. A.G. Barbour, and S. Bergstróm. 1992. Heterogeneiry of outer membrane proteins in Borrelia burgdorferi: Comparison of osp operons of three isolates of difieren: ceographic origins. Infect. Immun. 60: 1845-1853.

. Kurashige, S., M. Bissert, and L. Oshiro. 1990. Characterization of a tick isolate of Borrelia burgdorferi that posseses a major low-molecular-weight surface protein. J. Clin. Microbiol. 28: 1362-1366. 21. Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. N ature 227: 680-685. 22. Lam, T.T., T.-P.K. Nguyen, R.R. Montgomery, F.S. Kantor, E. Fikrig, and R.A. Flavell. 1994. Outer surface proteins E and F of Borrelia burgdorferi, the agent of Lyme disease. Infected Immun. 62: 290-298. 23. Margolis, N., and P.A. Pink. 1993. Regulatory of expression of major outer surface proteins in Borrelia burgdorferi. Infect. Immun. 61: 2207-2210. 24. Masuzawa, T., H. Kawabata, Y. Beppu. K. Miya oto, M. Nakao, N. Sato, K. Muramatsu, R.C. Johnson, and Y. Yanagihara. 1994. Characterization of monoclonal antibodies for identification of Borrelia japonica, isolates from Ixodes ovarus. Microbiol. Immunol. 38: 393-398.

. Miller, A.M., V.L. MacKay, and K.A. Nasmyth. 1985. Identification and comparison of two sequence elements that confer cell-rype specific transcription in yeast. Narure 314: 598-603. 25a. Miller, J.F., J.J. Mekalanos, and S. Falkow. 1989. Co-ordinate regulation and sensory transduction in the control of bacterial virulence. Science 243: 916-922. 26. Needleman, S.B. , and C.D. Wunsch 1970. A general method applicable to the search for similarities in the amuio acid sequence of rwo proteins. J. Mol. Biol. 48: 443 ^ 53. 27. Nguyen, T.-P.K .. T.T. Lam, S .W. Barthold, S.R. Telford, III, R.A. Flavell, and E. Fikrig. 1994. Partial destruction of Borrelia burgdorferi within ticks that engorged on OspE-or OspF-immunized mice. Infected Immun. 62: 2079-2084. 28. Norris, S.J. , C.J. C rter, J.K. Howell. and A.G. Barbour. 1992. Low-passage-associated proteins of Borreha burgdorferi B31: Characterization and molecular cloning of OspD, to surface-exposed. plasmid-encoded lipoprotein. Infect. Immun. 60: 4662-4672. 29 *. O'Farrel, P.H. 1975. High resolution rwo-dimensional poly-acrylamide gel electrophoresis. J. Biol. Chem. 250: 4007-4021.

. Padula, S.J., A Sampieri. F. Days A. Szczepanski, and R.W. Ryan. 1993 Molecular characterization and expression of p23 (OspC) from a North American strain of Borrelia burgdorferi. Infect. Immun. 61: 5097-5105. 31. Preac-Mursic, V., B. Wilske, E. Paisouris, S. Jauris, G. Will, E. Soutschek, S. Rainhardt, G. Lehnert, U. Klock-mann. and P. Mehraein. 1992. Active immunization with pC protein of Borrelia burgdorferi protecis gerbils against B. burgdorferi infection. Infection 20: 342-349. 32. Reindl, M., B. Redi, and G. Stofffler. 1993. Isolation and analysis of a linear plasmid-located gene of Borrelia burcdorferi B29 encoding at 27 kDa surface lipoprotein (Pll) and its overexpression Ln Escherichia coli. Mol. Microbiol. 8: 1115-1124. 33. Reindl, M., B. Redi, and G. Stofffler. 1994. A restriction map of the ospAB operon containing linear plasmid of Borrelia garinii B29, p.57-60. In: R. Cevenini, V. Sambri, M. Plate, (eds.) Advances in Lyme Borreliosis research. Proc. of the VI. Int. Conf. On Lyme Borreliosis. Bologna Italy 34. Sadziene, A., B. Wilske, M.S. Ferdows, and A.G. Barbour. 1993. The cryptic ospC gene of Borrelia burgdorferi B31 is located on a circular plasmid. Infected Immun. 61: 2192-2195.

. Schaible, U.E. , L. Gern. R. Wallich, M.D. Kramer. M. Préster, and M.M. Simon 1993. Distinct patents of protective antibodies are generated against Borrelia burgdorferi in mice experimentally inoculated with high and low doses of antigen. Immunol. Lett. 36: 219-226. 36. Schaible, U.E., M.D. Kramer. K. Eichmann, M. Modolell, C. Museteanu, and M.M. Simon 1990. Monoclonal antibodies speciñc for ihe outer surface protein A (OspA) of Borrelia burcdorferi orevem I .vine hnp-piincic in ^ cp. combined immunodeficiency (scid) mice. Proc. Nati Acad. Sci USA 87: 3768-3772. 37- Schaible, U.E., M.D. Kramer, C. Museteanu. G. Z nmer, H. Mossmann, and M.M. Simon 1989. The severe combined immunodeficiency (scid) mouse. A laboratory model for the analysis of Lyme aphritis and carditis. J. Exp. Med. 170: 1427-1432. 38. Schaible, U.E. , R. Wallich, M.D. Kramer, L. CJern, J.F. Anderson, C. Museteanu, and M.M. Simon 1993. Immune sera to individual Borrelia burgdorferi isolates or recombinant OspA protect protect SCID mice against infection with homologous strains but only partially or at all those of different OspA / OspB genorype. Yaccine 11: 1049-1054. 39. Schouls, L.M. , H.G.J. van der Heide, and J.D.A. van Embden. 1991. Characterization of the 35-kilodalton Treponema pallidum subsp. pallidum recombinant lipoprotein TrnpC and antibody response lipidated and nonlipidated T. pallidum antigens. Infected Immun. 59: 3536-3546. 40. Simon, M.M. , U.E. Schaible, M.D. Kramer, C.Eckerskorn, C. Museteanu, H.K. Müller-Hermelink, and R. Wallich. 1991. Recombinant outer surface protein A from Borrelia burgdorferi induces antibodies protective against spirochetal infection in mice. J. Infecí. Dis. 164: 123-132. 41. Simón, M.M., U.E. Schaible, R. Wallich, and M.D. Kramer. 1991. A mouse model for Borrelia burgdorferi infection: Approach to a vaccine against Lyme disease. Immunol. Today 12: 11 -16. 42. Simpson, W.J., W. Burgdorfer, M.E. Schrumpf, R.H. Karstens, and T.G. Schwan. 1991. Antibody to a 39-kilodalton Borrelia burgdorferi antigen (P39) as a marker for infection in experimentally and narurally inoculated animáis. J. Clin. Microbiol. 29: 236-243. 43. Simpson, W.J. , W. Cieplak. ME. Schrumpf, A. G. Barbour, and T.G. Schwan. 1994. Nucleotide sequence and analysis of the gene in Borrelia burgdorferi encoding the i munogeruc P39 antigen. FEMS Microbiol. Lett. 119: 381-388. 44. Steere, A.C. 1989. Lyme disease. N. Engl. J. Med. 321: 586-596. 45. Wallich, R., C. Helmes, U.E. Schaible. Y. Lobet. HE Moter, M.D. Kramer, and M.M. Simon 1992. Evaluation of genetic divergence among Borrelia burgdorferi isolates by use of OspA. fia, HSP60, and HSP70 gene probes. Infect. Immun. 60: 4856-4866. 46. Wallich, R., S.E. Moter, M.M. Simon, K. Ebnet, A. Heiberger, and M.D. Kramer. 1990. The Borrelia burgdorferi flagellum-associated 41-kilodalton antigen (flagellin): Molecular cloning. expression, and amplification of the gene. Infected Immun. 58: 1711-1719. 47. Wallich, R., U.E. Schaible, M.M. Simon, A. Heiberger, and M.D. Kramer. 1989. Cloning and sequencing of the gene encoding the outer surface protein A (OspA) of a European Borrelia burgdorferi isolaie. Nucleic Acids Res. 17: 8864. 48. Wallich, R., M.M. Simon H. Hofmann, S.E. Moter, U.E. Schaible, and M.D. Kramer. 1993. Molecular and immunological characterization of novel polymorphic lipoprotein of Borrelia burgdorferi. Infected Immun. 61: 4158-4166. 49. Wallich, R., et al. Unpublished data 50. Wilske, B., A.G. Barbour, S.Bergstrom, N. Burman, B.I. Restrepo, P.A. Rosa, T. Schwan, E. Soutschek, and R. Wallich. 1992. Antigenic variation and strain heterogeneiry in Borrelia spp. Res. Microbiol. 143: 583-596. 51. Wu, H.C. 1987 Posrtranslational modification and processing of memberane proteins in bacteria, p. 37-74; In: M. Inouye (ed.) Bacterial outer membranes as model systems. John Wiley & Sons, Inc .. New York. 52. Wu, H.C. and M. Tokunaga. 1986. Biogenesis of lipoproteins in bacteria. Curr. Top. Microbiol. Immunol. 125: 127- 157.

LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT (A) NAME Max Plank Gesellschaft zur Forderung der Wissenschaft e V (B) STREET: Busenstrasse 10 (C) Gottigen CITY (E) COUNTRY: Germany (F) POSTAL CODE (ZONE) D-3400 (A) NAME Deutsches Krebsforschungszentrum Stitung des offentilichen Rechts (B) STREET: Im Neuenheimer Feld 280 (C) CITY Heildelberg (E) COUNTRY: Germany (F) POSTAL CODE (AREA) D-6900 (ii) TITLE OF THE INVENTION Vaccines (iii) NUMBER OF SEQUENCES 2 (? V) LEGIBLE FORM IN COMPUTER (A) TYPE OF MEDIUM flexible disk (B) ) COMPUTER IBM PC compatible (C) OPERATING SYSTEM PC-DOS / MS-DOS (D) SOFTWARE Patent In Relay # 1 0, Version # 1.30 (EPO) 17 (2) INFOMATION FOR SEC ID NO 1 (i) SEQUENCE CHARACTERISTICS (A) LENGTH 196 amino acids (B) TYPE of amino acid (C) CHAIN STRUCTURE "individual (D) linear TOPOLOGY (ii) TYPE OF MOLECULE protein (iii) HYPOTHETICAL NO (iv) ANTI-SENSE NO ( vi) ORIGINAL SOURCE (A) ORGANISM B burgdorfep (B) INDIVIDUAL ISOLATED Osp G (ix) SEQUENCE DESCRIPTION SEC ID NO: 1 Met Asn Lys Lys Met Lys Asn Leu lie lie Cys Ala Val Phe Val Leu 1 5 10 15 lie lie Ser Cys Lys He Asp Wing Being Ser Glu Asp Leu Lys Gln Asn 20 25 30 Val Lys Glu Lys Val Glu Gly Phe Leu Asp Lys Glu Leu Met Gln Gly 35 40 45 Asp Asp Pro Asn Asn Be Leu Phe Asn Pro Pro Pro Val Leu Pro Wing 50 55 60 Being Ser Kis Asp Asn Thr Pro Val Leu Lys Ala Val Gln Ala Lys Aßp 65 70 75 80 Gly Gly Gln Gln Glu Gly Lys Glu Glu Lye Glu Lys Glu He Gln Glu 85 90 95 Leu Lys Asp Lys He Asp Lys Arg Lys Lys Glu Leu Glu Glu Ala Arg 100 105 110 Lys Lys Phe Gln Glu Phe Lys Glu Gln Val Glu Ser Wing Thr Gly Glu 115 120 125 Ser Thr Glu Lys Val Lys Lys Gln Gly Asn He Gly Gln Lys Ala Leu 130 135 140 8 Lys Tyr Ala Lys Glu Leu Gly Val Asn Gly Ser Tyr Ser Val Asn Asp 145 50 155 160 Gly Thr Asn Thr Asn Asp Phe Val Lys Lys Val He Asp Asp Ala Leu 165 170 175 Lys Asn He Glu Glu Glu Glu Leu Glu Lys Leu Glu Pro Gln Gl Asn He 180 185 190 Glu Asp Lys Lys 195 (2) INFORMATION FOR SEC ID NO. 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH 591 base pairs (B) TYPE: nucleic acid (C) STRING STRUCTURE: individual (D) TOPOLOGY, linear (ii) TYPE OF MOLECULE. DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE (TO) ORGANISM. Borrelia burgdorferi (B) CEPA: ZS7 (vii) IMMEDIATE SOURCE (B) CLON: OspG (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: ATGAATAAGA AAATGAAAAA TTTAATTATT TGTGCAGTTT TTGTTTTGAT AATTTCTTGC 60 AAGATTGATG CGAGTAGTGA AGATTTAAAA CAAAATGTAA AAGAAAAAGT TGAAGGATTT 120 TTAGATAAAG AGTTAATGCA AGGTGACGAT CCTAATAACA GTCTGTTTAA TCCACCACCA 180 GTATTGCCGG CAAGTTCCCA CGATAACAA CCCGTATTAA AAGCGGTGCA AGCAAAAGAT 240 GGTGGTCAAC AAGAAGGAAA AGAAGAGAAA GAAAAAGAAA TTCAAGAATT AAAGGATAAA 300 ATAGATAAAA GAAAAAAAGA ATTAGAAGAG GCTAGAAAGA AATTTCAAGA ATTTAAAGAA 360 * CAAGTTGAAT CTGCAACTGG AGAAAGTACT GAGAAAGTTA AAAAACAAGG AAATATTGGA 420 CAAAAAGCTT TAAAGTATGC TAAAGAATTG GGTGTAAATG GAAGTTATTC TGTTAATGAT 480 GGTACTAATA CTAATGATTT TGTAAAAAAG GTTATAGATG ATGCTCTTAA AAATATTGAG 5 0 GAAGAACTTG AAAAGCTAGC AGAGCCTCAA AATATAGAAG ATAAAAAATA A 591 TABLE 1 External surface lipoproteins of Borrelia burgdorferi name origin length MW Plasmid similarity ref. (strain) (aa) (kDa) loe with OspG (%) OspA ZS7 273 29.3 89 49 kb linear 48.4 (47) OspB B31 296 31 8 99 49 kb linear 43.1 (4) OspC B31 210 22.3 86 26 kb circular 41.8 ( 30) OspD B31 257 284 52 38 kb linear 45.6 (28) OspE N40 171 192 8 1 45 kb 52.9 (22) OspF N40 230 26 1 53 45 kb 64.9 (22) east OspG ZS7 196 22 5 2 55 kb study P27 B29 248 28.9 86 49 kb linear 45.2 (32) TABLE 2 Development of clinical arthritis in individual SCID mice, untreated and pretreated, i.p., with indicated immunosueros and subsequently inoculated with 1 x 106 of Borrelia burgdorferi ZS7 Clinical arthritis in p.i. Reculti¬ Serum Vagina Mouse Transfer No. 13 18 20 27 (ear) None 1 + + + + / + + + + / + + + + / + + 2 (?) / (?) + / + + + / + + + + / + + + + / + + NMS 1 (+) / * + / + + + / + + + + / + + + + / + + [5 μg / mouse] 2 1.1 () + / + + + / + + + + / + + + + / + + 3 ( l) / (?) + / + + + / + + + + / + + + + / + + IS ant? -103 1 (DBA / 2) 2 [4.5μg esp. 3 + / + 1 / (1) Ig / mouse] 4 (1) / - +/- IS ant? -108 1 + / - u- (C.B-17) 2 - / + [4.4 μg esp. 3 Ig / mouse] 4 + / + 1'- IS anti-lip (i) / - OspA + / + (BALB / c) [5μ g esp. ig / -Kl.) mouse] IS anti-rec 1 (*) (+ > ± J- + / + + + + / + + OspG 2 (+) / (+> Ui. (+) / (+ ) + + / + + (BALB / c) [72 3 (+) (+) ± Ji. + + / + + + + / + + Ng esp.lg / 4 (+) / (+) + + / + + + + / + + mouse] mAb LA 10 '1 [5μg esp. 2 + / + + + / + + + + / + +. Ig / mouse] 3 + / + + + / + + + + ((+ ) 4 + / + + + + / + + + + + + mAB LA2 * [5 1 μg esp 2 1.1- (i) / - Ig / mouse] 3 + / - 4 0 Value: + severe + less severe; (+) moderate; moderate swelling; (+) marginal swelling, redness; - no clinical signs in the left or right tibiotarsal joint. * mAB were previously described (20, 35, 39).

Claims (18)

1. CLAIMS 1. - A purified OspG of B burgdorfep, or an immunologically functional derivative thereof.
2. 2. A purified OspG of B burgdorfep, characterized in that it has an apparent molecular weight of 22 kDa, an isoelectric point of Pl of approximately 5 2, and has 196 amino acids , or an immunologically functional derivative thereof.
3. 3. A purified OspG of B burgdorfep as set forth in Figure 1.
4. 4. A purified OspG of claim 3, having at least 80% homology with the sequence of amino acid set forth in Figure 1 5.- A purified OspG claimed herein, for use in Medicine 6.- A vaccine composition comprising a purified OspG as claimed in any of claims 1 to 4. 7.- A composition of vaccine as claimed in claim 6, further comprising a B. burgdorferi antigen. 8. A vaccine composition as claimed in claim 6, further comprising an OspA antigen from Borre a. 9. A vaccine composition as claimed in any of claims 6-8, further comprising QS21 or 3D-MPL. 10. The use of an OspG antigen as claimed in claims 1 to 4, for the preparation of a vaccine for the immunoprophylactic or immunotherapeutic treatment of a patient suffering from or susceptible to the Lima disease. 11. A method for treating a patient suffering from or susceptible to Lima disease, comprising administering an effective amount of a composition according to claims 6-9 12. An isolated DNA sequence encoding a protein of OspG or immunologically functional derivative as claimed in claims 1 to 4 13. An isolated DNA sequence encoding an OspG protein according to claim 12, further characterized in that it has the sequence substantially set forth in Figure 1. 14. - An expression vector containing a DNA sequence according to claims 12 to 13 15. A host cell transformed with a sequence of DNA of claim 12 or 13 16. A method for producing a purified OspG according to claims 1 to 4, comprising transforming a cell with an expression vector of claim 14, and isolating by culturing the cells, and isolating the resulting portion 17. - A method for producing a vaccine comprising the OspG of claims 1 to 4, comprising mixing said OspG or immunologically functional derivative, with a pharmaceutically acceptable excipient. 18.- A diagnostic equipment comprising an OspG of B. burgdorferi.