MXPA97000502A - Pul cancer marker - Google Patents

Abstract

The present invention describes a sequence of isolated and purified nucleic acids and corresponding amino acid sequence for a novel protein specific for human lung cancer cells. This gene is expressed at a much higher level in these cells than in normal lung cells, other normal tissues and other tumor cell lines tested. Three additional recombinant forms of this gene and protein are also described, in the first two cases a membrane-related region is removed and in the third case an amino acid is changed by in vitro mutagenesis. Also described are sounds of acid for the detection of lung cancer cells from tissue biopsy and body fluids, sputum and bronchial secretions. A method for expressing the antigen in a host cell and its subsequent use as an immunogen in antibody production for test applications is described. An ELISA test is also described to measure detached antigen present in patient samples as well as an enzyme test to measure activity in specimens.

Description

LUNG CANCER MARKER TECHNICAL FIELD The invention relates to specific genes and proteins for certain cancers and methods for their detection.

BACKGROUND OF THE INVENTION Lung cancer is the most common form of cancer in the world. Estimates for the year 1985 indicate that there are approximately 900,000 cases of lung cancer in the world. (Parkin, et al., "Estimates of the highest incidence of eighteen major cancers in 1985," Int 3 C ncer 1993; 54: 594-606). Only for the United States of America, the projections - > of 1993 place the number of new cases of lung cancer at 170,000, with a mortality of approximately 88%. (Boring, et al., "Cancer statistics," CA Cancer 3 Clin 1993; 43: 7-26).

Although the occurrence of breast cancer is slightly more common in the United States, lung cancer is second behind prostate cancer for men and third behind breast cancer and colorectal cancer for women. Still, lung cancer is the most common cause of cancer deaths. The World Health Organization classifies lung cancer into four major histological types: (1) squamous cell carcinoma (SCO, (2) adenocarcinoma, (3) large cell carcinoma, and (4) small cell lung carcinoma as (SCLC). (The Uorld Health Organization, "The lorld Health Orga ization h stological t leping of lung + umours," A 3 Clin Pathol 1982; 77: 123-136.) However, there is much heterogeneity of tumors even within the different subtypes, and it is common for lung cancer to have "features of more than one morphological subtype." The term non-small cell lung carcinoma (NSCLC) includes squamous cell carcinoma, adenocarcinoma, and large cell carcinoma. uses a combination of x-rays and sputum cytology to diagnose lung cancer D-Tsafortuñadamente, at the time a patient seeks medical help for their symptoms, the cancer is in such an advanced state that it is usualme It is incurable (C ncer Facts and Figures (based on rates from the NCI SEER Program 1977-1981), New York: American Cancer Society, 1986). The large-scale routine radiological or cytological selection of smokers has been investigated. The studies concluded that cyto-normological selection does not significantly reduce the lung cancer mortality rate and is not recommended for routine use. ("Early lung cancer detection: its ary to conclusions," Om Rev Respir Dis 1984; 130: 565-70). However, in a subpopulation of patients where the cancer is diagnosed in an early and early stage and the lung is surgically resected, there is a 5-year survival rate of 70 to 90%. (Flehmger, et al., "The effect of surgical treatment on survival of lung cancer," Chest; 1992, 101: 1013-1018; pelamed, and others, "Screening for ear and lung cancer: results of Memorial Sloan-Ket + ering Study n New York, "Chest; 1984 86: 44-53). Therefore, research has focused on the early detection of tumor markers before the cancer becomes clinically evident and while the cancer is still localized and sensitive to therapy. The identification of antigens associated with lung cancer has stimulated considerable interest due to its use in the selection, diagnosis, clinical management and potential treatment of lung cancer. International seminars have attempted to classify lung cancer antigens into 15 possible clusters that may define histological origins. (Souha i, and others, "Antigens of lung cancer: results of the second international workshop on lung cancer antigens," 3NCI 1991; 83: 609-612). In 1988, more than 200 monoclonal antibodies (MAbs) that reacted with human lung tumors had been reported. (Radosevich, et al., "Monoclonal antibody aseays for lung cancer," in: Cancer Diagnosis in Vitro Using Monoclonal Antibodies, Edited by H. A. Kupchik, New York: Marcel Dekker, 1988). The rnAbs for lung cancer were first developed to distinguish NSCLC from SCLC. (Mulshine, et al., "Monoclonal antibodies that distinguish nonsmall-cell from small-cell lung cancer," 3 Irn unol 1983; 121: 497-502). In most cases, the identity of the surface antigen of the cell with which a particular antibody reacts, or has not been well characterized, is not known. (Scott, et al., "Eariy lung cancer detection using monoclonal antibodies," in: Lung Cancer, Edited by 3. Roth, 3. Dx Cox, and UK Hong. -Boston: Blackwell? Scientific Publication, 1993) . RnAbs have been used in immunocytochemical staining of sputum samples to predict the progression of lung cancer. (Tockrnan, et al., "Sensitive and specific monoclonal antibody recongnition of human lung cancer antigen on preserved sputum cells: a new approach to early lung cancer detection," 3 Clin Oncol 1988; 6: 1685-1693). In the study, two rnAbs, 624H12, were used, which binds to a glycolipid antigen expressed in SCLC, and 703D4, which is targeted to an NSCLC protein antigen. Of the sputum specimens of the participants who developed lung cancer, two thirds showed positive reactivity with either inAbs, the SCLC or the NSCLC. In contrast, of those who did not develop lung cancer, 35 out of 40 do not react with the SCLC mAb or NSCLC. This study suggests the need for the development of additional early detection targets to discover the onset of malignancy at the earliest possible stage. Carcinoembryonic antigen (CEA) is a tumor marker frequently studied for cancer, including lung cancer (Nutini, et al., "Serum NSE, CEA, CT, CA 15-3 levéis in human lung cancer," Int 3 Biol park- ers 1990; 5: 198-202). The squamous cell carcinoma antigen is another marker of established serum (Margolls, et al., "Serum tumor rnarl-ers m non-small cell lung cancer," Cancer 1994; 73: 605-609.). Other serum antigens for lung cancer include antigens recognized by mAbs 5E8, 5C7, and 1F10, the combination of which distinguishes between patients with and without lung cancer. (Schepart, et al., "Monoclonal antibody-mediated detection of lung cancer antigens in serum," Am Rev Reepir Dis 1988; 138: 1434-8). In addition, the combination of 5EB, 5C7 and 1F10 is more sensitive, specific and accurate to identify NSCLC when compared to the results of a combination of CEA and squamous cell carcinoma antigen tests. (Margolis, et al., Cancer 1994; 73: 605-609). CA 125 serum, initially described as an antigen associated with ovarian cancer, has been investigated for use as a prognostic factor in NSCLC. (Ten, et al., "Prognosis significance of serum CA 125 antigen assay in patients with non-small cell lung cancer," Cancer 1994; 73: 136876). The study determined that the preoperative serum level of CA 125 antigen correlates inversely with tumor recurrence and survival in NSCLC. Despite numerous examples of applications of mAbs, none have yet emerged that change clinical practice. (M? Lshine, et al., "Applications of rnonoclonal antibodies in the reatment of solid tumors," In: Biologic Therapy of Cancer edited by VT Devita, S. Hellrnan, and SA Rosenberg Philadelphia: B Lippincott, 1991, pp 563-588). Single rnAbs might not be the answer for early detection because they have only moderate success with immunological reagents for paraffin-fixed tissue. Second, lung cancer can express-characteristics that can not be differentiated by antibodies; for example, chromosomal deletions, gene amplification or transposition and alteration in enzymatic activity. After the gene for the rnAb that recognized the surface of the antigen has been cloned, powerful tools can be provided for the selection, diagnosis, management and finally treatment of lung cancer by means of cytogenetic and molecular techniques. An example of a lung cancer antigen that has been cloned is the antigen associated with adenocarcinoma. This antigen, recognized by MAb KS1 / 4, is a malignant / epithelial epithelial tissue glycoprotein of the human lung adenocarcinoma cell line UCLA-P3. (Strand, et al., "Molecular cloning and characterization of a human adenocarcinum to / epithelial cell surface antigen complementary DNA," Cancer Res 1989; 49: 314-317). The antigen has been found in all the adenocarcinoma cells tested and in different corresponding normal epithelial cells. Analysis d? Northern Blot indicated that the transcription of the antigen associated with adenocarcinoma was detected in RNA isolated from the nopnal colon, but not in RNA isolated from normal lung, prostate or liver. Therefore, the identification of the antigen associated with adenocarcinoma in lung cells can prove to be diagnostic for adenocarcinoma. The cloning of CEA and the cross-reacting antigen , - ~ .or specific (NCA) has allowed the development of tests of Specific DNAs that discriminate their expression in lung cancer at the mRNA level. (Hasegawa, et al., "Nonspeci fie crossreacting antigen (NCA) is a major member of the" CEA-related gene fa ily expressed in lung cancer, "Br 3 Cancer 1993; 67: 58-65.) NCA is a component of the CEA gene family in lung cancer and is also recognized by anti-CEA antibodies, especially polyclonal antibodies.The investigations to analyze CEA and NCA separately in lung disease, have been difficult due to cross-reactivity. of DNA determined that lung cancer cells fall into three different types, according to CEA and / or NCA expression by means of Northern Blot analysis.Specifically, lung cancers expressed both mRNA, CEA and NCA, only NCA mRNA, or no RNAs The expression of CEA-related mRNA was always accompanied by expression of NCA rRNA and there were no instances of expression of CEA mRNA alone The separate determination of CEA and NCA expression in lung cancers can of being important in determining the prognosis of lung cancers, since antigens have been described as cell-cell adhesion molecules and may play a role in cancer metastasis. Another method to detect the presence of an antigen gene or its mRNA in specific cells, or to locate an antigen gene for a specific locus on a chromosome, is in situ hybridization. In situ hybridization uses nucleic acid probes that recognize any repetitive sequences on a chromosome, or sequence along the entire length of the chromosome or chromosome segments. By labeling the probes with radioisotopes or color detection systems, regions of chromosomes within the cell can be identified. Investigations using in situ hybridization have demonstrated numerical chromosorphic abnormalities in tumor samples -human, including gallbladder, neo-ectodermal, breast, gastric and lung tumors. (Kim, et al., "Interphase cytogenetics in paraffin sections of lung tumors by non-isotopic in situ hybridization Mapping Genotype / phenotype heterogeneity," Am 3 Pathol 1993; 142: 307-317). Fluorescence in situ hybridization (FISH) allows to stain cells so that they can be quantified, using fluorescence microscopy, genetic aberrations that result in changes in the copy number or structure of the gene. In this technique, a chemically-labeled single-stranded nucleic acid probe homologous to the target nucleic acid sequence is attached to the denatured nucleic acid contained in the target cells. The cells can be mounted on a microscope slide, in suspension, or prepared from paraffin-fixed material. The treatment of the chemically modified probes with a fluorescent ligand makes the linked probe vietable. FISH has been used for 1) detection of changes in the number of gene copy and structure of the gene; 2) detection of genetic changes, even in low frequency subpopulations; and 3) detection and measurement of the frequency of residual malignant cells. (Gray, et al., "Molecular cytogenetics in human cancer diagnosis," Cancer 1992, 69: 1536-1542). Other molecular markers for lung cancer include oncogenee and tumor suppressor genes. Dominant oncogenes are activated by mutation and lead to uncontrolled cell growth. Such genes encode proteins that function as growth factors, growth factor receptors, signal translation proteins and nuclear proteins involved in transcription regulation. Amplification, mutation and transpositions have been documented in many different cancer cells and have been shown to lead to gene activation or overexpression. The ras family of oncogenes comprises a group of membrane-associated proteins linked to GTP that are thought to be involved in signal translation. Mutations within the ras oncogenes, which result in sustained growth stimulation, have been identified in L5 to 302 of human NSCLC. (Birrer et al., "Application of molecular genetics to the early diagnosis and screening of lung cancer," Cancer 1992; 52suppl, 2658s-2664s). The survival of patients with tumors that contain ras mutations decreased compared to patients whose tumors do not have ras mutations. The amplification of the polyrnerase chain reaction (PCR) of ras genes can be analyzed for the presence of mutations by several methods: (a) differential hybridization of 32p-labeled mutated oligonucleotides; t ») identification of new sites in the restriction enzyme created by means of the activation mutation; (c) single-chain confirmatory polymorphisms; and (d) nucleic acid sequencing. These methods combined with PCR technology could allow the detection of a ras gene - "" activated from sputum specimens. It has been found that another family of dominant oncogenes, the erb B family, is abnormally expressed in lung cancer cells. This group codes for membrane-associated tyrosine kinase proteins and contains erb Bl, the gene encoding the epidermal growth factor receptor (EGF), and erb B2 (also called Her-2 / neu). The erb Bl gene has been found amplified in NSCLC (up to 20X of squamous cell tumors), while the EGF sß receptor has been shown to be overexpressed in many NSCLC cells (approximately 90X of squamous cell tumors, 20 to 75X of adenocarcinomas, rarely in large or undifferentiated cell tumors). (Birrer, et al., Cancer 1992; 52 suppl, 2658s-2664s). The amplification of the related oncogene erb B2 (Her-2 / neu) occurs infrequently in lung cancer, but is a negative prognostic factor in breast cancer. However, over-expression of the erb B2 protein product, pl85"» u, occurs in some NSCLC and may be related to a poor prognosis (Kern, et al., "pl85" «or expression in human lung adenocarcinomas predicted Ortened S? rvival, "Cancer Res 1990, 50: 5184-5191). A third family of dominant oncogenes involved in lung cancer is the myc family. These genes encode nuclear phosphoproteins, which have potent effects on cell growth and which function as transcriptional regulators. Unlike the ras genes, which are activated by dot mutations in < Lung ance, the myc genes are activated by over-expression of cellular myc genes, either by gene amplification or by rearrangements, each eventually leading to increased levels of myc protein. The amplification of normal inyc genes is frequently seen in SCLC and rarely in NSCLC. The loss or inactivation of tumor suppressor genes may also be an important step in the pathway that leads to invasive cancer. Tumor-generating genes normally function to suppress cell proliferation, and since they are recessive oncogenes, mutations or deletions must occur in both alleles of these genes before the transformation occurs. A p53 osophotein, which is encoded by a gene located on chromosome 17p, suppresses transformation in its wild-type state. Although in its present state, p53 acts as a dominant oncogene, p53 functions at the junction of DNA and activation of transcription. Lae mutations of p53 have been found in many human cancers including cancerous cells of the colon, breast, brain, and lung. (Birer, et al., Cancer Res. (Suppl) 1992, 52: 2658s-2664s). In NSCLC cell lines, p53 mutations have been found at a 74% haeta rate. (Mitsudomi et al., "P53 gene mutat? Ons m non-small-cell l? Ng cancer cell lines and their correlation with the presence of ras nutions and clincal features," Oncogene 1992; 7: 171-180). Despite all the advances made in the area of lung cancer, the medical and surgical intervention has resulted in little change in the 5-year survival rate for patients with lung cancer. Early detection holds great hope for successful intervention. The need for a practical method to diagnose lung cancer continues, as close to its beginning as possible. For early detection to be feasible, it is important that specific markers be found and their sequences elucidated. Now, a lung cancer marker antigen, specific for NSCLC, has been found, sequenced and cloned. The antigen is useful in methods for detecting non-small cell lung cancer and for potential production of antibodies and probes for treatment compositions.

BRIEF DESCRIPTION OF THE DIBU30S Figure 1 represents the alignment of the amino acid sequence of HCAVIII with carbonic anhydrases described above. The conserved amino acids are shown in dark.

BRIEF DESCRIPTION OF THE INVENTION The invention relates to an lung cancer antigen gene (HCAVIII), specific for non-small cell lung cancer. In one embodiment, the invention relates to a substantially purified nucleic acid (SEQ ID NO: 1) which encodes the pre-protein sequence shown in SEQ ID NO: 2. In other embodiments, the invention relates to cDNA's that encode the mature form of the protein (SEQ ID NO: 4), or a truncated form of the protein which lacks the transmembrane domain (SEQ ID NO: 13 and SEQ ID NO: 15), or a protein in which One or more of the amino acids in the phosphorylation region have been altered to affect that function, an example of which is shown in SEQ ID NO: 18. In other embodiments, proteins encoded by the RDNc of SEQ ID No: l, are provided. SEC ID No: 3, SEC ID NO: 5, SEC ID No: 12, SEC ID NO: 14, and SEC ID No: 17. In another aspect, the invention relates to a recloning DNA clone for HCAVIII. In additional aspects of the invention, the expression vectors for HCAVIII and modifications to them are an object. The invention also relates to methods of detecting lung cancer. In one aspect, an in situ hybridization technique is provided. In another aspect, a fluorescence in situ hybridization technique is provided. In a further aspect, an ELISA test is provided. In another aspect, detection of carbonic anhydrase activity is provided which correlates with the lung cancer antigen.

DETAILED DESCRIPTION OF THE INVENTION The nucleic acid sequence encoding a cell surface protein (said protein hereafter referred to as HCAVIII), which is highly specific for non-small cell lung cancer cells, has now been obtained. This genetic sequence will facilitate the detection and treatment of the disease, which has often proved difficult to date. The cDNA for HCAVIII in the vector LC56 has been sequenced and characterized by including all the coding region and substantially all the untranslated regions towards the 5 'end and towards the 3' end. The cDNA in? LC56 was sequenced in both strands from deletions generated by exonuclease III and subsequent - subcloning into M13 vectors or directly from the cloning vectors using the di-deoxy method and an SEOUENASE * version 2.0 (US) kit. Biochemicals, Cleveland, OH). Additional DNA regions were subcloned as small restriction fragments in the same vectors for sequence analysis. They ordered overlapping segments using MacVector Aligne software (Kodak / IBI Technologies, New Haven CT). SEQ ID NO: l represents the cDNA encoding HCAVIII and a putative signal peptide. SEQ ID NO: 2 represents the signal peptide (amino acid residues -29 to -1), followed by the mature protein (amino acid residues 1 to 325). Such co was predicted from the cDNA sequence in? LC56, a protein of approximately 354 amino acids is encoded with the predicted size of 39,448 daltons. A hydrophilicity plot (MacVector software, Kodak / IBI Technologies) of this protein provided strong evidence of a N-terrninal part leader peptide and a membrane-related segment near the C-terminal part. The segment related to the membrane provides evidence that this protein is bound to the membrane, as is also predicted by its positive selection with methodology *** - »*** (see Uatson, et al., Recoding DNA, 2nd ed. , pp. 115-115, J 92). The site of signal cut, as predicted by von Hei ne (von Hei ne, Gunnar, Nucleic Acids Res L9B6; 14: 4683-4690), is 29 amino acids below the N-terminal methionine. SEQ ID NO: 3 roughly corresponds to the coding region of the mature polypeptide. It is proposed that the subsequent "mature" protein is 325 amino acids, starting with sepna, and 36401 calculated daltons and a pl of 6.42 (SEQ ID NO: 4). Homology searches against NCBI BlastN or BlastX version 1.3.12MP (National Center for Biotechnology Information, Bethesda, MD) yielded evidence that the gene and protein are novel, not previously identified in any data bank. (Altschul, and others, "Basic local alignrnent search tool," 3 Mol Biol 1990; 215: 403-410). Additional searches against other databases (Entrez, version 9) gave similar results. The isolation of a second cDNA encoding HCAVIII allowed the identification of new sequences within the 5 'and 3' untranslated regions-primer of this gene. SEQ ID NO: 5, a cDNA encoding HCAVIII, and a portion of the 5 'and 3' untranslated regions, have substantial identity with SEQ ID NO: l (positions 1-1104 of SEQ ID No: l are identical to positions 85-1188 of SEQ ID No: 5). The encoded protein is listed in SEQ ID NO: 5 and is identical with SEQ ID NO: 2, Homology searches of NCBI BlastN against SEQ ID No: 5 showed that these gene sequences have not previously been identified. SEQ ID NO: 7 represents additional AUNc sequences from the 3 'untranslated region of the HCAVIIT gene located towards the 3' end of the sequences depicted in SEQ ID No: 5. Homology searches against the same database identified two clones with homology for ID SEC No: 7. Both sequences are expressed sequence marks (EST), the first EST04899 (345 bp) and the second HUMGS04024 (466 bp). Alignment searches indicate that this protein shares common characteristics with the seven human carbonic anhydrase proteins identified above. However, as described below, there are certain structural features other than HCAVIII that can confer unique properties on this protein n role in the transformation path towards turnorgenicity. This group of enzymes catalyze the hydration of carbon dioxide.

C02 + HraO = HCO3- + H * and conversely the dehydration of HCO3-. This protein is identified as a carbonic anhydride (CA) based on the conservation of amino acids at critical positions for the binding of Zn + 2 t and α to CO2 catalysis, as well as numerous other conserved amino acids (see figure 1). The protein is 34 to 64 amino acids larger (in the C-terminal part) than any carbonic anhydrase reported previously, by virtue of the membrane-related region also found in HCAIV and an additional approximate 30 amino acids contained in the cytoplasmic side of The cell and apparently missing in other human CA isoforms. In addition, this intracellular domain contains a phosphorylation site recognized by the protein Cinaea C and other compounds, as defined by the "Arg-Arg-Lis-Ser" motif (SEQ ID NO: 8 and SEQ ID NO: 9). ) (amino acid residues 1-4 in SEQ ID NO: 9 and amino acid residues 299-302 in SEQ ID NO: 2 and SEQ ID NO: 6). Interestingly, this motif is found only in HCAVIII, and in a functionally significant site, that is, within the cytosol. An essential surface area for enzymatic function present in other carbonic anhydrases is conserved by this protein, suggesting that this protein also confers enzymatic activity. Five possible N-glycolylation sites are predicted by the primary amino acid sequence and the "Asn-Xaa-Ser (Thr)" motif, starting at amino acid residues -2, 51, 133, 151, and 202 in SEQ ID No. : 2, respectively. HCAVIII is expressed at a much higher level in a non-small cell lung cancer cell line (A549) than in normal lung tissue, other normal tissues, and other tumor cell lines, which makes it useful in the distinction of this disease. This is clearly shown in table 1. The data for this table were obtained as follows. Total cellular RNA was isolated from the actively developed cell lines, as described by Chirgwin, et al., "Isolation of bologically active ribonucleic acid from sources enriched m pbonuclease," Biochemistry 1979; .18: 5294-5299. The RNA samples were fractionated on an IZ agarose-formaldehyde gel and transferred to a nylon membrane (Oiagen, Chatsworth, CA), by means of capillary action. The hybridization probe was generated from a 1-kilobase paired BstXI restriction fragment, isolated from pLC56, a plasmid harboring the HCAVIII gene in its initial isolation. This fragment was radiolabelled with 32 p using a PRIME-ITR random primer labeling kit, obtained from Stratagene, La-Jolla, CA. It was purchased from Clonetech Laboratories, Inc., Palo Alto, CA, a membrane containing RNA derived from healthy human tissue. and hybridized RNA stains in a normal mixture containing the P-labeled probe at 42 ° C overnight, then exposed to X-ray film. Subsequently, upon removal of the probe, the same spots were re-hybridized with a second DNA labeled with 32 p from β-actin to serve as a positive control for integrin of stained RNA As observed in Table 1, normal lung tissue does not express the HCAVIII gene in detectable amounts. fail to express it, or express it only in minor amounts, which allows easy distinction from non-small cell carcinomas.

TABLE 1 NORTHERN BLOT USING HCAVIII cDNA AGAINST NORMAL TISSUES AND TUMOR CELL LINES EJIDO mRNA (kB) INTENSITY TISSUE NORMAL heart ndi brain 4.5 1X2 placenta 4.5 IX lung nd liver nd skeletal muscle nd kidney 4.5 100X pancreas 4.5 10X FABRIC mRNA (kB) INTENSITY CELLULAR LINE OF TUMOR 0549 (lung carcinoma) 3.5 5000X 5.4 50X 8.0 25X 9.0 25X BT20 (breast carcinoma) nd '"361 (nelonorna) nd HT144 (melonorna) nd U937 (histiocytic lymphoma) nd KG-l (myelogen leukemia ) nd i nd = not detected IX = at the detection limit In one embodiment of the invention, probes were made corresponding to the cDNA sequences shown in SEQ ID NO: 3, which were complementary to the rRNA for HCAVIII. These probes can be radioactively or non-radioactively labeled in a number of ways well known in the art. Probes of different lengths can be made. Factors such as astringency and GC content can influence the length of the probe desired for particular applications. The probes correspond to a length of 10-986 nucleotides of SEQ ID NO: 3. The labeled probes can then be linked to detect the presence or absence of mRNA encoding HCAVIII in biopsy material through in situ hybridization. The mRNA is expected to be associated with T7 presence of non-small cell tumors and also be a marker- for the precancerous condition. In situ hybridization provides a specificity for white tissue that is not obtainable in Northern, PCR or other probe management technologies. In situ hybridization allows signal localization in mixed tissue specimens commonly found in most tumors and is compatible with many histological staining procedures.This technique is comprised of three basic components: first is the preparation of the sample of tissue supplied by the pathologist to allow successful hybridization for the probe .. Second is the preparation of the hybridization probe, typically an RNA complementary to the mRNA of the gene of interest (ie, RNA of contradictory). RNA on DNA probes for in situ hybridizations mainly because the hybridization of probe feedback to irrelevant nucleic acids or non-specific binding to cellular debris or subcellular organelles can be eliminated, with treatment with RNAse after hybridization. Hybridization and detection after hybridization Typically, the probe RNA transcript has been radiolabeled with the incorporation of 32 p or 35? nucleotides to allow subsequent detection of the specimen probed by autoradiography or quantification of silver grains after treatment with autoradiographic emulsion. Non-radioactive detection systems have also been developed. In one example, the biotinylated nucleotides can be replaced by the radioactive nucleus left in the preparation of the RNA probe, allowing visualization of the sample probed by techniques derived from inm? Nocitoquinu c. Example L describes in situ hybridization methods using RNA probes derived from the HCAVIII gene. Example 2 provides examples of fluorescent hybridization m s tu 'p'ISH). The cDNA for HCAVIII (SEQ ID NO: 3) is currently in an expression vector which is being used to generate the protein in E. coli. This expression system described in example 3 produces HCAVIII to be used as co or an antigen for the generation of antibodies (example 4) to be used in an ELISA test to detect HCAVIII released in body fluids, as described in example 5. The • methods for antibody production and ELISA type tests are well known in the art. Exemplary methods and components of these methods have been chosen and developed, and are described in Examples 4 and 5. The expression and purification of foreign proteins in E coli is often problematic. Occasionally, the protein is expressed at high levels but is deposited inside the cell as a denatured insoluble form called an inclusion body. These bodies are often observed when the foreign protein contains a hydrophobic domain such as that found in the segment of HCAVIII related to the membrane. Through recombinant DNA technology, the DNA sequences encoding the membrane-related segment of HCAVIII are deleted. The protein expressed in E coli of this constructed plasmid is now in a soluble and native form within the cell, allowing a quick and less rigorous purification. In addition, the ELISA test for measuring HCAVIII released in body fluids, as described in example 5, is based on the reclosing protein produced from E. coli. Typically, the evolved antigen is a receptor bound to the membrane that was released from the membrane-related segment, subjecting it to the cell. Consequently, the recordant HCAVIII constructed to remove the membrane-related segment is a more accurate representation of the putative antigen HCAVIII released, found in specimens and can be proved to be the preferred antigen for the production of polyclonal antisera and monoclonal antibody, such as It is described by the development of an ELISA test. To produce the constructed plasmid, a first plasmid is constructed by cutting pLC56 with the restriction enzyme Tthlll I, followed by treatment with DNA-T4 polymerase and dGTP, dATP, dTTP and dCTP, and finally with alkaline phosphatase to eliminate 5 '-terminal phosphates. The DNA sample is then purified by phenol / chloroform extraction and ethanol precipitation. The sample is digested with the restriction endonulease BspEl, then the fragments are resolved by means of agarose gel electrophoresis to allow the isolation of a fragment of 267 base pairs. A second plasmid described above for expression of the mature HCAVIII protein (ID? EC No: 4), is cut with EcoRT and BspEl, followed by treatment with alkaline phosphatase and purification by means of phenol / chloroform extraction and ethanol precipitation. 'Fc's oligonucleotides are synthesized, being 5' -TGAGTCGACG (SEQ ID NO: 10) and 5'-RATTCGTCGACTCA (SEQ ID NO: 11), which complement each other and by fixation, provide a stop codon (TGA) and sequence complementary to DNA cut with EcoRl. Finally, the two oligonucleotides, the 267 base pair fragment, and the BsoEI / EcoRI cut plasmid will be combined in a ligation reaction, and the resulting plasmid containing the truncated DNA sequence (SEQ ID NO: 12) it is used to transform E. coli. competent. By expression in E. coli, the resulting truncated protein (SEQ ID NO: 13) is 271 amino acids as determined by SDS polyacrylamide electrophoresis, and of a size consistent with other HCA's, but lacking the membrane-related segment and the intracellular domain. A second plasmid encoding a truncated HCAVIII protein (ID? EC No: 14) lacking the membrane-related segment and intracellular domain was created, as described above, except that the restriction enzyme Tthlll was replaced with IPle I, giving as a result a gel-purified DNA fragment of 276 base pairs. By expression in E. coli, the resulting protein is now 274 amino acids (SEQ ID NO: 15). We have actively sought an understanding of protein phosphorylation and its role in the mechanism of cellular transformation, most notably with tyrosine phosphorylation and activation of oncogenes. The role of phosphorylation of serine / threonine protein by means of a variety of protein kinase, including cmase C protein, has been studied extensively with respect to signal translation, but its role in oncogenesis is unclear. To provide a valuable tool to be used in the study of the role of serine phosphorylation of HCAVIII in oncogenesis, an altered cDNA can be prepared to code for an altered protein. Changes to arnino acids other than "Gli" can be made by alterations to the oligonucleotide sequence (SEQ ID NO: 16) used to code the selected residue. Other modifications to alter the serine phosphorylation site could use the described technology to modify either of the "Arg" residues, located within SEQ ID No: 9 or amino acid residues 299 and 300 of SEQ ID No: 2, SEC ID No: and SEC ID No: 6. Since the "Arg" residues contain a net positive charge, the substituted amino acids would preferably be "Lys" or "His", also positively charged amino acids. An exemplary plasmid is produced in which the codon "Ser" (amino acid residue 4 of SEQ ID NO: 9); amino acid residue 302 in SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6), is converted to a "Gil" codon using a technique of innutrition in it.ro described in Example 3 and cited above in Kun.-el, Thornae, "Rapid and efficient site-specific utagenesis without phenotypic selection", Proc Nati Acad Sci USA 1985; 82: 488-492; and the oligonucleotide 5'- CTTTTTTGATACCCTTCCTTCTGAA (SEQ ID NO: 16) (located in SEQ ID No: l in base pairs 1010-1034 with 1022 as the pair of "jase rnutagenizado.) Lae DNA sequences containing the gene HCAVIII constructed for mature protein production and the utagenized codon is released from the mutagenesis vector by means of restriction endonucleases BamHl and EcoRI and ligated in PGEX4T1 cut with the same enzymes, and the resulting plasmid is used to transform competent E. coli. Codon mutagenesis is confirmed by DNA sequence analysis and the protein is expressed and purified from E. '"coli, as described in example 3. The DNA sequence of the altered plasmid as shown in SEQ ID NO: 17 differs from the gene encoding the mature protein (SEQ ID NO: 3) in which nucleotide 1022 is changed from "A" to "G", and the protein sequence (ID? EC No: 18) expressed by the altered plasmid is identical to the mature protein (SEQ ID NO: 4), except that amino acid residue 302 is changed from "Ser" to "Gli." Another way to detect the presence of increased HCAVIII could be to test the activity levels of carbonic anhydrase in biopsy materials as described in example 6. This would be a useful test as HCAVIII, although it is an imologi- cally unique molecule, contains small but distinct regions that are conserved among the carbonic anhydrase proteins reported above In another embodiment of the invention, complementary primers to the HCAVIII cDNA (SEQ ID NO: 3) are made to detect The expression of The PCR amplification of the cDNA from lung biopsy cells could indicate the presence of the same lung carcinoma of the non-small cell. Due to the specificity of the non-small cell lung cancer of HCAVIII and the gene encoding the protein, the antibodies specific for HCAVIII could also exhibit specificity of non-small cell lung cancer, which can be used for diagnostic detection of HCAVIII in body fluids such as serum or urine, or cells that contain HCAVIII. Therapeutic drugs directed against cancer can also be developed for cells containing HCAVIII, using antibodies specific for HCAVIII. The gene expression of the gene encoding HCAVIII could be modulated by drugs or contrasense technology resulting in an alteration of the cancer state of cells containing HCAVIII.

EXAMPLE 1 In istu hybridization using RNA probes derived from the HCAVIII gene Tissue samples were treated with 4% dehide ormaldehyde (or equivalent fixative), dehydrated in ethanol solutions in increasing concentration sequence (v.gr .., 70%, 95% and 100%) with a final incubation in xylene (see Current Protocole m Molecular Biology, pp. 14.01-14.3 and I munocytochernistry II: IBR0 Handbook Series: Methods m the Neurosciences Vol 14; pp 281-300, incorporated herein by reference). The fabric is fixed in molten form, molded into a molding block and can be stored at room temperature. Tissue sections, typically 8 microns thick, are prepared with a microtiter, dried on "* - glass slides treated with gelatin and stored at -20 ° C. DNA sequences from the HCAVIII gene (ID? EC No: 3) are subcloned into a plasmid constructed for the production of RNA probes. In this example, a 776 bp DNA fragment is released from a pLC56 plasmid after digestion with Ba HI / AccI, where the BamH1 site has been created by in vitro rnutagenesis (see expression of E. coli below). This fragment is ligated into? GEM-2 (Promega Biotec, Madison, UI), which was cut with BamHl and Accel and transformed into competent E. coli. This constructed plasmid contains the polymerase RNA-I7 promoter towards the 3 'end of the flccl restriction site and can therefore handle the transcription of the HCAVIII contradictory sequences defined by the BarnHI / AccI fragment. After lmealization of the subsequent plasmid with BarnHi, an in vitro transcription reaction composed of a transcription buffer (40 nM Tris-HCl, pH 7.5, 6 M HCl2, 2 mM sperm, 10 nM NaCl, 10 nM NaCl) is incubated at 37 ° C. dithiothreitol, inhibitor of ribonuclease 1 U / ul), linearized plasmid, 10 M of GTP, 10 M of ATP, 10 M of CTP, 100 μCi of (35 S) UTP, and RNA-T7 polirnerase. Multiple RNA copies of the gene are produced and then used as a hybridization probe. The reaction is terminated by the addition of DNase, and the synthesized RNA is recovered from unincorporated nucleotides by phenol / chloroform extraction and sequential metal precipitations in, - "presence of 2.5M ammonium acetate. containing fixed sectioned tissues were rehydrated in decreasing concentration of ethanol (100%, 70% and 50%), followed by sequential treatments with HCl at 0.2 N, 2x SSC (where 20x SSC ee 3 M NaCl and eodium nitrate 0.3 M) at 70 ° C to remove the sample, pH phosphate buffer (PBS), fixation in 4% paraformalehyde and wash in PBS. The slides were blocked to avoid non-specific binding by the sequential additions of PBS / dithiothreitol to lOrnM (45 ° C), dithiothreitol at 10 nm / iodineacetamide at 0.19% / N-ethylenemalemide at 0.12% and washing in PBS. The slides were equilibrated in 0.1 M triethyia, pH 3.0, followed by treatment in Trieti lamina O.IM / 0.25% acetic anhydride, 0.1 M triethylamine / 0.5% acetic anhydride and washed in 2X SSC. . The slides were then dehydrated in increasing concentrations of ethanol (50%, 70% and 100%) and stored at -80 ° C. A hybridization mixture is prepared by combining 50% deionized formamide, 0.3 M NaCl, tris-HCl at lOrnM, pH 8.0, EDTA at lmM, Denhardt's IX solution (ficol 400 at 0.02%, polyvinylpyrrolidone at 0.02%, 0.02% bovine serum (BSA)), 500 μg / ml of yeast tRNA, 500 μg / ml of poly A, dithiothreitol at 50 mM polyethylene glycol 6000 at 10% and RNA probe labeled with 3 * 5. This solution is placed on fixed, fixed tissue slides, which are then incubated at 45 ° C in a humid chamber for 0.5 to 3 hours. The slides are washed to remove unbound probe in 50% formamide, 2XSSC, 2-mercaptoethanol at 20 nm (55 ° C), followed by 50% formamide, 2X SSC, 20mM 2-mercaptoethanol and x-ritin. 100 to 0.5% (50 ° C) and finally 2X SSC / 2-rnercaptoethanol at 20rnM (room temperature). The slides are treated with Tris-HCl at lOmM, pH 8.0 / NaCl at 0.3 M / 40 μg / ml RNase A / 2 μg / ml RNase TI (37 ° C) to reduce the levels of unbound RNA probe. After treatment with RNase the slides are washed with formamide / pH regulators of S? C at 50 ° C, room temperature and then dehydrated in increasing ethanol concentrations containing 0.3 M ammonium acetate, and a 100% final ethanol, the slides are then exposed to X-ray film followed by autoradiography in emulsion to detect silver grains. The test tissue samples are compared with matching controls derived from normal lung tissue. Evidence of elevated transcription of the HCAVIII gene in test tissue compared to normal tissue, as determined by autoradiography (X-ray film) or alternatively by the quantification of silver beads from the emulsion autoradiography provided evidence of diagnostic poetry for lung cancer.

Example 2 In Situ Fluorescent Hybridization (FISH) using flDN probes derived from the HCflVIII gene A gene clone for the HCAVIII gene (SEQ ID No. 1) is isolated using a pair of PCR primers that have been identified from the cDNA sequence of pLC56. This pair of primers is located in putative exon 6 of the pLC56 gene, and are identified as 6fl probe exon (5'-ACATTGAAGAGCTGCTTCCGG-3 '; SEQ ID NO: 19) and 6B probe exon (5'-AATTTGCACGGGGTTTCGG- 3 '; SEC ID No. 20). The genomic clone of HCAVIII is then identified as the PCR product of approximately 119 base pairs using this pair of primers from the designated genomic clone. This result is confirmed by the Southern blotting test and DNA sequence analysis. A sequence of 1363 base pairs derived from the HCAVIII genomic clone is reported in SEQ ID No: 21. This sequence is located directly before the HCAVIII cDNA and constitutes the putative promoter of this gene and probably contains regulatory elements of transcription directly involved in the expression of HCAVIII. The DNA probe comprising the HCAVIII genomic clone in addition to bleaching sequences is labeled in a random primer reaction with digoxigenin-11-dUTP (Boehringer Mannheim Biochemicals, Indianapolis, IN) by combining the DNA with dNTP (-TTP, final 0.05 rnM), digoxigenin-11-dUTP / dTTP (0.0125 mM and 0.0375 M, final 2-mercaptoethanol at 10mM, Tris-HCl at 50 M, pH 7.5, MgCl2 at 10 rnM, 20 U of DNA polymerase I and 1 ng / ml of DNA The reaction is incubated at 15 ° C for 2 hours, and then added by adding EDTA to a final concentration of 10 M. The labeled DNA probe is subsequently purified by gel filtration chromatography. in the art that other suitable sub-extracts such as biotin-11-dUTP can replace digoxigenin-11-dUTP in the above procedure.A hybridization mixture is prepared by combining 50% deionized formamide, 0.3 M NaCl, 10% Tris-HCl. rnM, pH 8.0, EDTA at 1 mM, De's solution nhardt to IX (ficol 400 to 0.02%, polyvinyl pyrrolidone to 0.02% and bovine albunin serum to 0.02%), 500 μg / ml of yeast HRNt, 500 μg / l of poly (A), dithiothreitol to 50 in, polyethylene lengl icol 5000 aL 10% and the labeled DNA probe. Single-cell suspensions of tissue or normal tissue biopsy material are fixed in methanol / glacial acetic acid (3: 1 vol / vol) and a drop of the miernae is placed on microscope slides. (Aanastasi et al., "Detection of Triso and 12 in chronic Lymphocytic leukemia by fluorescence in situ hybridization to m aterphase cells: a simple and sensitive method," Blood 1992; 77: 2456-2462). After the slides are heated for 1-2 hours at 60 ° C, the hybridization mixture is applied to the slides, which are then incubated at 45 ° C in a humid chamber for 0.5-3 hours. Deepuée of incubation, slides are washed 3 times with 50% formamide and 2X SSC solution at 42 ° C, washed twice in 2X SSC at 42 ° C, and finally washed in 4X SSC at room temperature. The slide is blocked with a solution of 4X SSC and 1% BSA, and then washed with a 4X solution of SSC and 1% Triton X-100. The probe labeled with hybridized digoxigenin is detected by the addition of a mixture of sheep anti-digoxigenin antibody (Boehringer Mannheim) diluted in 0.1 M sodium phosphate, pH 8.0, 5% dry skim milk and 0.02 sodium acid. %, followed by the addition of rabbit anti-rabbit IG conjugate with fluorecin for detection. The slides are then washed in PBS, mounted in Vectashield (Vector Laboratories, Inc., Burlmgmae, CA), and viewed through the luorescence microscope. Hybridization signals are enumerated in tumor-derived tissue and then compared with normal tissue. Normal tissue displays characteristics of hybridization signals other than a diploid state. Enumeration in the two-hybridization / cell signal regime is considered -"Significant.

Example 3 Expression of HCflVIII Expression of foreign proteins is often performed in E. coli when an immunogen or amounts are desired - Large protein, as the development of a diagnostic team. A preferred system for expression of E. coli has been described (Smith, et al., "Single-step description of polypeptides expressed in Escherichia coli as f? Eions with glutathione-s-transferase," Gene 1988; 67: 31-40), whereby glutathione transferase is expressed with amino acids representing the cloned protein of interest fixed to carboxyl-terminal. The fusion protein can then be purified through affinity chromatography and the protein of interest can be fused to the released glutathione transferase by digestion with the thrombin of the protease or alternatively the fusion protein is released intact from the affinity column by medium of competent levels of Free glutathione. To express the HCAVIII protein (SEQ ID NO: 4) of this invention in E. coli using the technology described above, an expression plasmid fused to the glutathione transferase gene was produced by forming a frame with the HCAVIII gene (SEQ ID NO. : 1) to produce a fusion protein. The 'fusion gene / expression plasmid was assembled from nucleic acids derived from the following sources. First, the expression plasmid pGEX4TI (Pharmacia, Piscataway, NJ) was digested in the polycyclic region with restriction endonucleases BarnHi and EcoRI to allow insertion of the HCAVIII gene. Second, an oligonucleotide was synthesized, being 5'-GTCCACTTGGATCCGTTCACTGG-3 '(ID? EC NO: 22). Using the in vitro mutagenesis procedure described by Kunkel (Proc. Nati, Acad. Sci. USA, 1985; 82: 488-492) and the above oligonucleotide, a BarnHI restriction site was created without altering the amino acid codons of the original protein. In addition, the created Ba Hl site was placed in the correct reading frame and in proximity to the predicted digethion site by separating the signal peptide from the mature protein. DNA sequences encoding the mature sß protein released from the mutagenesis vector as a BA HI / EcoRI fragment, where the EcoRI site originates from a polycloning region of the DNA sequencing vector pUC19 found towards the 3 'end of the HCAVIII gene. The DNA fragments described above composed of? GEX4T-1 segmented in Barnhl and EcoRI and the HCAVIII gene released as BamHI / EcoRI fragment were combined in a mixture composed of pH regulator IX of T4 ligase (Tris-HCl at 50mM MGCI2 at 10 rnM, dithiothreitol at 20rnM, 50μg / ml ESA, final pH 7.5) and T¿ DNA ligase (New England Biolabs, Beverly, MA). The ligated DNA was used to transform a suitable E. coli strain such as' * 2ul XL-1 (? The recovered plasmid is formed in sequence to confirm the expected DNA sequence. Protein expression is induced in E. coli with the chemical compound isopropyl β-thiogalactoside, and the fusion protein is released by cell lieis, followed by denaturing and resolubilization of the fusion protein with 8 M urea / Tris. Cl to M (pH 8.5) / dithiothreitol at 10 mM, dialysis and renaturation of protein, and finally link to a column ,,,. of affinity composed of agarose glutathione (Sigma, St. Louis, MO) and digestion with thrombin to release the HCAVIII protein.

The resulting protein is suitable as an immunogen for production of polyclonal or monoclonal antibodies and for use in an ELISA kit as an internal normal value and positive control. The carbonic anhydrase enzyme activity (as described in Example 6) was measured for the HCAVIII and HCAVIII-truncated form derived from E. coli from (SEQ ID NO: 15) compared to commercially obtained human carbonic anhydrase II ( Sigma,? T Louis, Mo.). The activity, as reported in unit enzyme (U) / rng, for carbonic anhydrase TI was 3571 U / mg, for HCAVIII it was 274 U7mg, and the truncated form of HCPVIII was 2632 U / mg. These results indicated that an enzymatically active and derived form of renaturalizable HCAVIII was obtained from E. coli of enzymatic activity comparable to a human carbon II idraea. The length of the resulting protein can be varied "^ Iterating the length of the sequence identification number 1 before inerting in the expression plasmid, or digesting amino acids from the protein resulting in the previous example. Studies on structure / fusion of HCA suggest modifications (as defined by deletions at the N-terminal and C-terminal) more extensive than those described in ID? EC No: 12 would allow the production and use of a protein as an immunogen or normal value, these deletions being a protein defined by approximately amino acid residue 3 to amino acid residue 259 in TD SEQ ID NO: 12.

Using existing technology, a peptide of about 10 to 40 amino acids in length comprising a structural domain of HCAVIII could be synthesized. The synthesized peptide, coupled to a carrier protein, could be used to generate polyclonal anti-serum specific for native HCAVIII.

Example 4 Production of Antibodies to HCflVIII The production of anti-polyclonal serum is described in more detail in Harlow, and others, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, 1988, incorporated herein by reference. The HCAVIII protein (SEQ ID NO: 4) in the presence of an adjuvant is injected into rabbits with a series of increasing injections as an optimal prescribed program for high titers of antibodies in the serum. A total of 7 biweekly bleeds were obtained from 2 rabbits immunized with truncated HCAVIII protein (SEQ ID NO: 15. The resulting anti-HCAVIII serum titre was compared to pre-immune serum from the same rabbits and determined to be from L000 to 2000 times greater, therefore, suitable with an indirect ELISA reagent (Example 5) The rabbit antibody was partially purified by ammonium sulfate precipitation (50%, final) followed by dialysis and fractionation by preparative DEAE-HPLC. extensive description for producing monoclonal antibodies derived from B-cells of an immunized mouse and an immortalized rhielome cell is found in the above reference for production of polyclonal anti-serum Mice were immunized with purified HCAVIII proteins or a glutathione / HCAVIII fusion protein After the cell fusion, the selection for hybrid cells and subcloning, hybridized sifted for an anti-body po against whole A549 cells or purified HCAVIII proteins using an indirect ELISA test as described for the ELISA kit (see Example 5).

Example 5 ELISA test of HCflVIII An indirect ELISA screening test for HCAVIII proteins (SEQ ID No. 4) is designed to detect and monitor the HCAVIII protein in body fluids including but not limited to serum and other biological fluids such as sputum or bronchial secretion at effective levels - .necessary for sensitive but precise determinations. It is intended to assist in the early diagnosis of non-small cell lung cancer, for which there is currently no effective treatment. A precise noninvasive test of early detection for non-small cell lung cancer would be of great benefit in the management of this disease. The immunochemical compounds used in this procedure were rabbit anti-human HCflVIII antibodies (purified IgG, IgM) produced according to the procedure given in Example 4, HCAVIII anti-human mouse (monoclonal) also produced according to with the procedure given in Example 4, and conjugate of goat anti-rabbit TgG / peroxidase. The normal value of HCAVIII protein and the internal positive control were produced as described in Example 3 for expression in E. coli. Substrate components q? E include H2SO4 to 1 M stored at room temperature and 3 ', 5, 5' -tetramethyl-benzidine (TMB) (Sigma Chemical Co.) used as a substrate and stored at room temperature in the dark to avoid exposure to light. Various pH regulators, diluents and blocking agents were used in the procedure. Note that sodium azide preservatives were not used in any of the pH regulators. This was done to avoid any possible interference of the azide with the peroxidase conjugate. Saline solution with phosphate pH regulator (PBS) was prepared by adding 32.0 g of sodium chloride, 0.8 g of potassium phosphate, monobasic, 0.8 g of potassium chloride and 4.6 g of sodium phosphate, dibasic, anhydrous, to 3.2 liters of deionized water and mixing to dissolve. After bringing the solution to 4 liters with deionized water and mixing, the pH was about 7.2. The pH regulator can be stored at 4 ° C for up to 3 weeks. The solutions of bovine serum albumin (BSA) were used as diluyent.es. A solution of 1% BSA in PBS, used as the second anti-body / conjugate diluent, was prepared by adding 1 g of BSA (bovine albumin, fraction V, Sigrna Chemical Co.) to 00 ml of PBS, allowing to stand , as it slowly turned into solution, adding PBS to a final volume of 100 rnl and then mixing. This diluent was stored at 4 ° C for a maximum of 2 weeks; however, if the solution became cloudy, it was discarded. As a diluent for the normal values and the values, a solution of 0.025% BSA in fresh PBS was prepared for each test by diluting the diluent of 1% BSA with PBS 1:40 (vol / vol). Borate-blocking pH regulator was also used (0.17 M H3BO3, 0.12 M NaCl, 0.05% tween 20, 0.25% EDTA and 0.25% BSA) The pH regulator of the substrate was phosphate-citrate / sodium per borate ( Sigrna, St. Louis, Mo.) All tests were performed on Tmmulon IV plates (Dunatech, Chantilly, Va # 011-010-6301) .The test plates were coated with monoclonal antibodies against HCAVIII by adding 50 ul of a solution of 10 ug / rnl of antibody in PBS to each well of Im ulon IV plates The plates were covered and incubated overnight at room temperature The antibody solution was removed and the wells were rinsed 3 times with deionized water Three hundred microliters (300 ul) of the borate blocker pH regulator were added to each well and incubated at room temperature for 30 minutes.The pH regulator was removed, the wells were rinsed with deionized water and the plates were air dried The plates were then wrapped and and stored at 4 ° C. The truncated HCAVIII protein derived from normal E. coli (SEQ ID No. 15) was diluted to 32 ng / ml in PBS / BSA at 0. 025% and duplicate serial dilutions were made in it. The samples were also diluted in 0.025% PBS / BSA 50 microliters of normal solution or sample were applied to each well Plates were incubated overnight, covered, at room temperature Normal and sample solutions were removed from the wells and the wells were rinsed three times with deionized water Three hundred milliliters (300 μl) of borate-blocking pH regulator were added to each well and incubated at room temperature for 30 minutes.The plates were rinsed again with deionized water and plugged (inverted) on paper towels to remove the excess water The second anti-rabbit serum with truncated protein antibody HCAVIII (ID? EC No. 15), was diluted at 1 ug / rnl in PBS / 1% BSA and 50 microliters was added to each The plates were covered and incubated at room temperature for 2 hours.The antibody solution was removed from the wells which were then rinsed with deionized water for several times and then blocked for 10 minutes at room temperature. At room temperature with borate-blocking pH regulator, they were rinsed again with deionized water three times and placed on paper towels. The goat antibody conjugate, F (ab ') 2 < TgG rabbit and IgL-HPRO (Tago, Caman Lio, CA.) was diluted 1: 15,000 in PBS / 1% BSA and 50 rnicrolitres were added to each well. The plates were covered and incubated at room temperature for 2 hours. The antibody conjugate solution was removed from -the wells and these were rinsed with deionized water three times, blocked with 300 ricroliters of borate pH buffer at room temperature for 10 minutes, rinsed three times with deionized water and placed on paper towels. The substrate was prepared no more than 15 minutes before being used by dissolving a phosphate-citrate / sodium perborate capsule (Signma, St. Lo? Is, Mo.) in 100 ml of water. For each plate, a TMB tablet was added to 10 rnl of the phosphate-citrate / sodium perborate pH buffer and filtered by syringe. 100 μl was added to each well and the plates were covered and incubated at room temperature in the dark for 1 hour. The reaction was stopped by adding 50 icroliters of H2 SO4 to IM to each well. Lae plates were read on a microplate reader of molecular devices at 450 nm. Under these conditions, a linear response of 0.5 to 32 ng / ml was obtained using HCAVIII truncated protein as a normal value, with the test sensitivity at 0.5 ng / ml. No cross reaction was observed against HCAII, a carbonic anhydrase abundant in human serum.

Example 6 Carbonic anhydrase activity (Cfl) of biopsy tissue Ice cooled solutions from ITB were prepared (imidazole at 20MM, tris at 5mM, and para-nitrophenol at 0.4mM, pH 9.4-9.9) and pH A regulator (tietanolarnin at 25mM, H2O4 at * "9rnM H2SO4 at 59rnM and HCL at benzamidine at 1nM A homogenate was prepared by scraping with a cell scraper in 1-2 ml of pH A buffer, a rnonolayer of tissue cells cultured from a sample of tissue taken from a biopsy, a portion of the sample after boiling to inactivate CA. A tube was placed in a bath of ice water, for a test tube, glass tubes of 10 x 75 mm and a rubber stopper of 15 gauge and 18 gauge needle ports were used; for the test tube, tubes were used. 6 x 50 nrn glass and rubber stoppers with gauge for 18 gauge needle and 20 gauge needle with fixed PE90 tube.The sample is added and together with water cooled with ice to a final volume of 500 microliters for macro test 50 micro-test tubes: 500 μl (rnacro) or 50 μl (micro) of water cooled with gall or for a water control. 10 microlitres antispurna (A. H. Thomae, Philadelphia, PA) was added to the tube which was then incubated in ice water for 0.5 to 3 minutes.

The tube was plugged with a stopper and CO2 was bubbled at 150 rnl / rnin (inacro) or 100 rnl / rnin (micro) through the smaller needle port for 30 seconds. 50 μl (inacro) or 50 μl (micro) of the ITB solution were quickly added through the larger needle port with a cold Hamilton needle. The sample turned yellow. Using a time regulator or a stopwatch, the time at which the solution in the tube became colorless was measured and recorded. The tube can be removed momentarily from the bath and kept in front of a white background to determine the color change. Comparison with a previously acidified sample can be used. The procedure is repeated with the boiled sample. The sample volume corresponding to approximately one unit of enzyme is determined using the following formula. Volume (1EU - Vt "= volume used x log2 (boiled sample time / sample time activated) One unit of enzyme is the activity that halves the boiled sample control time The test is repeated 1-3 times with the sample and the boiled sample, using the adjusted sample volume.

LIST OF SEQUENCES (1) GENERAL INFORMATION: (i) APPLICANT: 5 (A) NAME: Cytpclonal Ph r aceutics, Inc. (B) Street: 9000 Harry Hines Blvd, Suite 330 (OR CITY: Dallas (D) STATE: Texas (E) COUNTRY: USA 0 (F) POSTAL CODE: 75235 (G) TELEPHONE: (214) 353-2923 (H) TELEFAX: (214) 350 -9514 (I) TELEX: -5 (ii) TITLE OF THE INVENTION: Marker of lung cancer (iii) NUMBER OF SEQUENCES: 22 0 (iv) ADDRESS OF CORRESPONDENCE: (A) RECIPIENT: RICHARDS, MEDLOCK 8. ANDREU? (B) STREET: 1201 Elm Street, Suite 4500 5 (CITY: Dallas (D) STATE: TX (E) COUNTRY: USA (F) POSTAL CODE: 75270-2197 0 (v) COMPUTER LEADABLE FORM: (A): TYPE OF MEDIUM: Flexible disk (B) COMPUTER: IBM COMPATIBLE PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Reléase «1.0, Version ífl.30 (vi) CURRENT DATA OF THE APPLICATION: (A) APPLICATION NUMBER: (B) DATE OF SUBMISSION: (C) CLASSIFICATION (vii) INFORMATION ABOUT THE POWDER / AGENT: (A) NAME: John A. Harre (B) NO. OF REGISTRATION: 37,345 (REFERENCE / NON-APPLIED: B35792CIPPCT (ix) TELECOMMUNICATIONS INFORMATION: (A) TELEPHONE: 214-939-4500 (B) TELEFAX: 214-939-4600 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 1: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1104 base pairs (B) TYPE: nucleic acid (CHAIN TYPE: both (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: (ix) CHARACTERISTIC: (A) NAME / KEY: inat._pe ti or (B) LOCATION: 119..1093 (lx) FEATURE: ( A) NAME / KEY: rn? Sc_caractep st? ca (B) LOCATION: 1023. . 1024 (D) OTHER INFORMATION: / note = "phosphorylation site recognized by protein Cmasa C and other ciña ..." (l) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 1: ? -CCSCGCCC GCCCCGCAGG AGCCCGCGAA G ATG CCC CGG CGC AGC CTG CAC 52 Met Pro Arg Arg Ser Leu His -29 -25 GCG GCG GCC GTG CTC CTG CTG GTG ATC TTA AAG GAA CAG CCT TCC AGC 100 Ala Ala Ala Val Leu Leu Leu Val lie Leu Lys Glu Gln Pro Be Ser -20 -15 -10 CCG GCC CCA GTG AAC GGT TCC AAG TGG ACT TAT TTT GGT CCT GAT GGG 148 Pro Wing Pro Val Asn Gly Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly -5 1 5 10 GAG AAT AGC TGG TCC AAG AAG TAC CCG TCG TGT GGG GGC CTG CTG CAG 196 Glu Asn Ser Trp Ser Lys Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln 15 20 25 TCC CCC ATA GAC CTG CAC AGT GAC ATC CTC CAG TAT GAC GCC AGC CTC 244 Ser Pro le Asp Leu Has Ser Asp He Leu Gln Tyr Asp Wing Ser Leu 30 35 40 ACG CCC CTC GAG TTC CAA GGC TAC AAT CTG TCT GCC AAC AAG CAG TTT 292 Thr Pro Leu Glu Phe Gln Gly Tyr Asn Leu Ser Wing Asn Lys Gln Phe 45 50 55 CTC CTG ACC AAC AAT GGC CAT TCA GTG AAG CTG AAC CTG CCC TCG GAC 340 Leu Leu Thr Asn Asn Gly H s Ser Val Lys Leu Asn Leu Pro Ser Asp 60 65 70 ATG CAC ATC CAG GGC CTC CAG TCT CG C TAC AGT GCC ACG CAG CTG CAC 388 Met His He Gln Gly Leu Gln Ser Arg Tyr Ser Wing Thr Gln Leu His 75 80 85 90 CTG CAC TGG GGG AAC CCG AAT GAC CCG CAC GGC TCT GAG CAC ACC GTC 436 Leu His Trp Gly Asn Pro Asn Asp Pro His Gly Ser Glu His Thr Val 95 100 105 AGC GGA CAG CAC TTC GCC GCC GAG CTG CAC ATT GTC CAT TAT AAC TCA 484 Ser Gly Gln His Phe Ala Ala Glu Leu His He Val His Tyr Asn Ser 110 115 120 GAC CTT TAT CCT GAC GCC AGC ACT GCC AGC AAC AAG TCA GAA GGC CTC 532 Asp Leu Tyr Pro Asp Wing Ser Thr Wing Ser Asn Lys Ser Glu Gly Leu 125 130 135 GCT GTC CTG GCT GTT CTC ATT GAG ATG GGC TCC TTC AAT CCG TCC TAT 580 Wing Val Leu Wing Leu He Glu Met Gly Ser Phe Asn Pro Ser Tyr 140 145 150 GAC AAG ATC TTC AGT CAC CTT CAA CAT GTA AAG TAC AAA GGC CAG GAA 628 Asp Lys He Phe Ser His Leu Gln His Val Lys Tyr Lys Gly Gln Glu 155 160 165 170 -GCA TTC GTC CCG GGA TTC AAC ATT GAA GAG CTG CTT CCG GAG AGG ACC 676 Wing Phe Val Pro Gly Phe Asn He Glu Glu Leu Leu Pro Glu Arg Thr 175 180 185 GCT GAA TAT TAC CGC TAC CGG GGG TCC CTG ACC AC CCT CCC AAC TGC 724 Ala Arg Glu Tyr Tyr Arg Tyr Gly Ser Leu Pro Pro Thr Thr Asn Cys 190 195 200 CCC ACT GTG GTT CTC ACA TGG TTC CGA AAC CCC GTG CAA ATT TCC CAG 772 Pro Thr Val Leu Trp Thr Val Phe Arg Asn Pro Val Gln He Ser Gln 205 210 215 GAG CAG CTG CTG GCT TTG GAG HERE GCC CTG TAC TGC AC CAC ATG GAC 820 Glu Gln Leu Leu Wing Leu Glu Thr Wing Leu Tyr Cys Thr His Met Asp 220 225 230 GAC CCT TCC CCC AGA GAA ATG ATC AAC AAC TTC CGG CAG GTC CAG AAG 868 Asp Pro Ser Pro Arg Glu Met He Asn Asn Phe Arg Gln Val Gln Lys 235 240 245 250 TTC GAT GAG AGG CTG GTA TAC ACC TCC TTC TCC CAG GTG CAG GTC TGT 916 Phe Asp Glu Arg Leu Val Tyr Thr Ser Phe Ser Gln Val Gln Val Cys 255 260 265 ACT GCG GCA GGA CTG AGT CTG GGC ATC ATC CTC TCA CTG GCC CTG GCT 964 Thr Wing Wing Gly Leu Ser Leu Gly He He Leu Ser Leu Wing Leu Wing 270 275 280 GGC ATT CTT GGC ATC TGT ATT GTG GTG GTG GTG TCC ATT TGG CTT TTC 1012 Gly He Leu Gly He Cys He Val Val Val Val Ser He Trp Leu Phe 285 290 295 AGA AGG AGG ATC AAA AAA GGT GAT AAC AAG GGA GTC ATT TAC AAG 1060 Arg Arg Lys Ser He Lys Lys Gly Asp Asn Lys Gly Val He Tyr Lys 300 305 310 CCA GCC AC C AAG ATG GAG ACT GAG GCC CAC GCT TGAGGTCCCC G 1104 Pro Ala Thr Lys Met Glu Thr Glu Ala His Ala 315 320 325 (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 354 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 2: Met Pro Arg Arg Ser Leu His Ala Ala Ala Val Leu Leu Leu Val He -29 -25 -20 -15 Leu Lys Glu Gln Pro Be Pro Pro Wing Pro Val Asn Gly Ser Lys Trp -10 -5 1 Thr Tyr Phe Gly Pro Asp Gly Glu Asn be Trp Ser Lys Lys Tyr Pro 5 10 15 Ser Cys Gly Gly Leu Gluc Ser Pro He Asp Leu His Ser Asp He 20 25 30 35 Leu Gln Tyr Asp Wing Ser Leu Thr Pro Leu Glu Phe Gln Gly Tyr Asn 40 45 50 Leu Be Ala Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly His Ser Val 55 60 65 Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu Gln Ser Arg 70 75 80 Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro Asn Asp Pro 85 90 95 His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Ala Ala Glu Leu 100 105 110 US His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing Ser Thr Wing 120 125 130 Be Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu He Glu Met 135 140 145 Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His Leu Gln His 150 155 160 Val Lvs Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe A = n He Glu 165 170 175 Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr Arg Gly Ser 180 185 190 195 Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr Val Phe Arg 200 205 210 Asn Pro Val Gln He Ser Gln Glu Gln Leu Leu Wing Leu Glu Thr Wing 215 220 225 Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu Met He Asn 230 235 240 Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val Tyr Thr Ser 245 250 255 Phe Ser Gln Val Gln Val Cys Thr Ala Wing Gly Leu Ser Leu Gly He 260 265 270 275 He Leu Ser Leu Ala Leu Ala Gly He Leu Gly He Cys He Val Val 280 285 290 Val Val Ser He Trp Leu Phe Arg Arg Lys Ser He Lys Lys Gly Asp 295 300 305 Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu Thr Glu Wing 310 315 320 His Wing 325 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 3: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 986 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: both (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE: cDNA (x) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 1.975 (? x) FEATURE: (A) NAME / KEY: rnisc_characteristic (B) LOCATION: 895..906 (D) OTHER INFORMATION: / note --- "phosphorylation site recognized by protein kinase C and other proteins ..." (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 3: TAG AAG TGG ACT TAT TTT GGT CCT GAT GGG GAG AAT AGC TGG TCC AAG 48 Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 AAG TAC CCG TCG TGT GGG GGC CTG CTG CAG TCC CCC ATA GAC CTG CAC 96 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 AGT GAC ATC CTC CAG TAT GAC GCC AGC CTC ACG CCC CTC GAG TTC CAA 144 Ser Asp He Leu Gln Tyr Asp Wing Ser Leu Thr Pro Leu Glu Phe Gln 35 40 45 GGC TAC AAT CTG TCT GCC AAC AAG CAG TTT CTC CTG ACC AAC AAT GGC 192 Gly Tyr Asn Leu Be Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 CAT TCA GTG AAG CTG AAC CTG CCC TCG GAC ATG CAC ATC CAG GGC CTC 240 His Ser val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 CAG TCT CGC TAC AGT GCC ACG CAG CTG CAC CTG CAC TGG GGG AAC CCG 288 Gln be Arg Tyr Ser Wing Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 AAT GAC CCG CAC GGC TCT GAG CAC ACC GTC AGC GGA CAG CAC TTC GCC 336 Asn Asp Pro His Gly be Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 110 GCC GAG CTG CAC ATT GTC CAT TAT AAC TCA GAC CTT TAT CCT GAC GCC 384 A1 * Glu LßU His Ile Val His tyr Asn Sßr Asp eu tVr Pro Asp la 115 120 125 AGC ACT GCC AGC AAC AAG TCA GAA GGC CTC GCT GTC CTG GCT GTT CTC 432 Being Thr Wing Being Asn Lys Being Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 ATT GAG ATG GGC TCC TTC AAT CCG TCC TAT GAC AAG ATC TTC AGT CAC 480 He Glu Met Gly be Phe A = n Pro Ser Tvr Asp Lys He Phe Ser His 145 150 155 160 CTT CAA CAT GTA AAG TAC AAA GGC CAG GAA GCA TTC GTC CCG GGA TTC 528 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Ala Phe Val Pro Gly Phe 165 170 175 AAC ATT GAA GAG CTG CTT CCG GAG AGG ACC GCT GAA TAT TAC CGC TAC 576 Aßn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 CGG GGG TCC CTG ACC AAC CCT TGC AAC CCC ACT GTG CTC TGG ACA 624 Arg Gly Be Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 GTT TTC CGA AAC CCC GTG CAA ATT TCC CAG GAG CAG CTG CTG GCT TTG 672 Val Phe Arg Asn Pro Val Gln He Ser Gln Gllu Gln Leu Leu Ala Leu 210 215 220 GAG ACÁ GCC CTG TAC TGC ACÁ CAC ATG GAC GAC CCT TCC CCC AGA GAA 720 Glu Thr Wing Leu Tyr Cys Thr Hxs Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 ATG ATC AAC AAC TTC CGG CAG GTC CAG AAG TTC GAT GAG AGG CTG GTA 768 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 TAC ACC TCC TTC TCC CAG GTG CAA GTC TGT ACT GCG GCA GGA CTG AGT 816 Tyr Thr Ser P I have been Gln Val Gln Val Cys Thr Wing Wing Gly Leu Ser 260 265 270 CTG GGC ATC ATC CTC TCA CTG GCC CTG GCT GGC ATT CTT GGC ATC TGT 864 Leu Gly He He Leu Ser Leu Ala Leu Wing Gly He Leu Gly He Cys 275 280 285 ATT GTG GTG GTG GTG TCC ATT TGG CTT TTC AGA AGG AAG AGT ATC AAA 912 He Val Val Val Val Ser He Trp Leu Phe Arg Arg Lys Ser He Lys 290 295 300 AAA GGT GAT AAC AAG GGA GTC ATT TAC AAG CCA GCC ACC AAG ATG GAG 960 Lys Gly Asp Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu 305 310 315 320 ACT GAG GCC CAC GCT TGAGGTCCCC G 986 Thr Glu Ala His Wing 325 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 4: (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 325 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 4 Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 Being Asp He Leu Gln Tyr Asp Wing Being Leu Thr Pro Leu Glu Phe Gln 35 40 45 Gly Tyr Asn Leu Being Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 Hiß Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 Gln Ser Arg Tyr Ser Wing Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 110 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 Ser Thr Wing Being Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 He Glu Met Gly Ser Phe Asn Pro Ser Tyr Aso Lys He Phe Ser His 145 150 155 160 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 Arg Gly Ser Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 Val Phe Arg Asn Pro Val Gln He Ser Gln Glu Gln Leu Leu Ala Leu 210 215 220 Glu Thr Ala Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 Tyr Thr Ser Phe Ser Gln Val Gln Val Cys Thr Wing Wing Gly Leu Ser 260 265 270 Leu Gly He He Leu Ser Leu Ala Leu Wing Gly He Leu Gly He Cys 275 280 285 He Val Val Val Val Ser He Trp Leu Phe Arg Arg Lys Ser He Lys 290 295 300 Lys Gly Asp Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu 305 310 315 320 Thr Glu Ala His Ala 325 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 5: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 2134 base pairs (B) TYPE: nucleic acid (CHAIN TYPE: both (D) TOPOLOGY: linear (ll) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: ( A) NAME / CLRVE: CDS (B) UBICACTON: L16..L177 (x) CHARACTERISTIC: (A) NAME / CLAVF: ??. At_pept? Do (B) LOCATION: 203. 1177 (xl) DESCRIPTION OF SEQUENCE: SEQUENCE ID NO: 5: GTACTCGCCA CGGCACCCAG GCTGCGCGCA CGCGGTCCCG GTGTGCAGCT GGAGAGCGAG 60"" "iGGCCACCGG GAGCCCCCGG CACAGCCCGC GCCCGCCCCG CAGGAGCCCG CGAAG ATG 118 Met -29. CCC CGG CGC AGC CTG CAC GCG GCG GCC GTG CTC CTG CTG GTG ATC TTA 166 Pro Arg Arg Ser Leu His Wing Wing Val Leu Leu Leu Val He Leu -25 -20 -15 AAG GAA CAG CCT TCC AGC CCG GCC CCA GTG AAC GGT TCC AAG TGG ACT 214 Lys Glu Gln Pro Ser Ser Pro Pro Pro Val Asn Gly Ser Lys Trp Thr -10 -5 1 TAT ??? Q ^ r CCT g ^ QQQ & & AAT AGC TGG TCC f ^ Q p ^ Q TAC CCG TCG 262 Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys Lys Tyr Pro Ser 5 10 15 20 TGT GGG GGC CTG CTG CAG TCC CCC ATA GAC CTG CAC AGT GAC ATC CTC 310 Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His Ser Asp He Leu 25 30 35 CAG TAT GAC GCC AGC CTC ACG CCC CTC GAG TTC CAA GGC TAC AAT CTG 358 Gln Tyr Asp Ala Ser Leu Thr Pro Leu Glu Phe Gln Gly Tyr Asn Leu 40 45 50 TCT GCC AAC AAG CAG TTT CTC CTG ACC AAC AAT GGC CAT TCA GTG AAG 406 Be Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly His Ser Val Lys 55 60 65 CTG AAC CTG CCC TCG GAC ATG CAC ATC CAG GGC CTC CAG TCT CGC TAC 454 Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu Gln Ser Arg Tyr 70 75 80 AGT GCC ACG CAG CTG CAC CTG CAC TGG GGG AAC CCG AAT GAC CCG CAC 502 Be wing Thr Gln Leu His Leu H s Trp Gly Asn .ro Asn Asp Pro His 85 90 95 100 GGC TCT GAC CAC ACC GTC AGC GGA CAG CAC TTC GCC GCC GAG CTG CAC 550 Gly Ser Glu His Thr Val be Gly Gln Hxs Phe Ala Ala Glu Leu His IOS 110 115" ATT GTC CAT TAT AAC TCA GAC CTT TAT CCT GAC GCC AGC ACT GCC AGC 598 He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing Ser Thr Wing Ser 120 125 130 AAC AAG TCA GAA GGC CTC GCT GTC CTG GCT GTT CTC ATT GAG ATG GGC 646 Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu He Glu Met Gly 135 140 145 TCC TTC AAT CCG TCC TAT GAC AAG ATC TTC AGT CAC CTT CAA CAT GTA 694 Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His Leu Gln His Val 150 155 160 AAG TAC AAA GGC CAG GAA GCA TTC GTC CCG GGA TTC AAC ATT GAA GAG 742 Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe Asn He Glu Glu 165 170 175 180 CTG CTT CCG GAG AGG ACC GCT GAA TAT TAC CGC TAC CGG GGG TCC CTG 790 Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr Arg Gly be Leu 185 190 195 ACC ACA CCT TGC AAC CCC ACT GTG CTC TGG ACÁ GTT TTC CGA AAC. 838 Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr Val Phe Arg Asn 200 205 210 CCC GTG CAA ATT TCC CAG GAG CAG CTG CTG GCT TTG GAG ACA GCC CTG 886 Pro Val Gln He Ser Gln Gllu Gln Leu Leu Ala Leu Glu Thr Ala Leu 215 220 225 TAC TGC ACÁ CAC ATG GAC GAC CCT TCC CCC AGA GAA ATG ATC AAC AAC 934 Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu Met He Asn Asn 230 235 240 TTC CGG CAG GTC CAG AAG TTC GAT GAG AGG CTG GTA TAC ACC TCC TTC 982 Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val Tyr Thr Ser Phe 245 250 255 260 TCC CAA GTG CAA GTC TGT ACT GCG GCA GGA CTG AGT CTG GGC ATC ATC 1030 Ser Gln Val Gn Val Cys Thr Wing Wing Gly Leu Ser Leu Gly He He 265 270 275 CTC TCA CTG GCC CTG GCT GGC ATT CTT GGC ATC TGT ATT GTG GTG GTG 1078 Leu Ser Leu Ala Leu Wing Gly He Leu Gly He Cys He Val Val Val 280 285 290 GTG TCC ATT TGG CTT TTC AGA AGG AAG AGT ATC AAA AAA GGT GAT AAC 1126 Val Ser He Trp Leu Phe Arg Arg Lys Ser He Lys Lys Gly Asp Asn 295 300 305 AAG GGA GTC ATT TAC AAG CCA GCC ACC AAG ATG GAG ACT GAG GCC CAC 1174 Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu Thr Glu Wing His 310 315 320 GCT TGAGGTCCCC GGAGCTCCCG GGCACATCCA GGAAGGACCT TGCTTTGGAC 1227 Wing 3"CCTACACACT TCGGCTCTCT GGACACTTGC GACACCTCAA GGTGTTCTCT GTAGCTCAAT 1287 CTGCAAACAT GCCAGGCCTC AGGGATCCTC TGCTGGGTGC CTCCTTGCCT TGGGACCATG 1347 GCCACCCCAG AGCCATCCGA TCGATGGATG GGATGCACTC TCAGACCAAG CAGCAGGAAT 1407 TCAAAGCTGC TTGCTGTAAC TGTGTGAGAT TGTGAAGTGG TCTGAATTCT GGAATCACAA 1467 ACCAAGCCAT GCTGGTGGGC CATTAATGGT TGGAAAACAC TTTCATCCGG GGCTTTGCCA 1527 GAGCGTGCTT TCAAGTGTCC TGGAAATTCT GCTGCTTCTC CAAGCTTTCA GACAAGAATG 1587 TGCACTCTCT GCTTAGGTTT TGCTTGGGAA ACTCAACTTC TTTCCTCTGG AGACGGGGCA 1647 TCTCCCTCTG ATTTCCTTCT GCTATGACAA AACCTTTAAT CTGCACCTTA CAACTCGGGG 1707 ACAAATGGGG ACAGGAAGGA TCAAGTTGTA GAGAGAAAAA GAAAACAAGA GATATACATT 1767 GTGATATATT AGGGACACTT TCACAGTCCT GTCCTCTGGA TCACAGACAC TGCACAGACC 1827 TTAGGGAATG GCAGGTTCAA GTTCCACTTC TTGGTGGGSA TGAGAAGGGA GAGAGAGCTA 1887 GAGGGACAAA GAGAATGAGA AGACATGGAT GATCTGGGAG AGTCTCACTT TGGAATCAGA 1947 ATTGGAATCA CATTCTGTTT ATCAAGCCAT AATGTAAGGA CAGAATAATA CAATATTAAG 2007 TCCAAATCCA ACCTCCTGTC AGTGGAGCAG TTATGTTTTA TACTCTACAG ATTTTACAAA 2067 TAATGAGGCT GTTCCTTGAA AATGTGTTGT TGCTGTGTCC TGGAGGAGAC ATGAGTTCCG 2127 AGATGAC 2134 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 354 amino acids two (B) TYPE: amino acid do B O (D) TOPOLOGY: l ineal (i i) TYPE OF MOLECULE: pro te i a (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 6: Met Pro Arg Arg Ser Leu His Ala Ala Ala Val Leu Leu Leu Val He -29 -25 -20 -15 Leu Lys Glu Gln Pro Ser Ser Pro Pro Ala Pro Val Asn Gly Ser Lys Trp -10 -5 1 Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys Lys Tyr Pro 5 10 15 Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His Ser Asp He 20 25 30 35 Leu Gln Tyr Asp Wing Being Leu Thr Pro Leu Glu Phe Gln Gly Tyr Asn 40 45 50 Leu Being Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly His Ser Val 55 60 65 Lys Leu Asn Leu Pro Being Asp Met His He Gln Gly Leu Gln Ser Arg 70 75 80 Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro Asn Asp Pro 85 90 95 His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Ala Ala Glu Leu 100 105 110 115 His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing Ser Thr Wing 120 125 130 Ser Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu He Glu Met 135 140 145 Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His Leu Gln His 150 155 160 Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe Asn He Glu 165 170 175 Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr Arg Gly Ser 180 185 190 195 Leu Thr Thr Pro Pro cys Asn Pro Thr Val Leu Trp Thr val Phe Arg 200 205 210 Asn Pro Val Gln He Ser Gln Gllu Gln Leu Leu Ala Leu Glu Thr Ala 215 220 225 Leu Tyr Cys Thr His Met Asp Asp Pro be Pro Arg Glu Met He Asn 230 235 240 Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val Tyr Thr Ser 245 250 255 Phe Ser Gln Val Gln Val Cys Thr Ala Wing Gly Leu Ser Leu Gly He 260 265 270 275 He Leu Ser Leu Ala Leu Ala Gly He Leu Gly He Cys He Val Val .280 285 290 Val Val Ser He Trp Leu Phe Arg Arg Lys Ser He Lys Lys Gly Asp 295 300 305 Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu Thr Glu Ala 310 315 320 His Ala 325 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 624 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: both (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 7: CCAATCTGCC TTTGAATCTG GAGGAAATAG GCAGAAACAA AATGACTGTA GAACTTATTC 60 TCTGTAGGCC AAATTTCATT TCAGCCACTT CTGCAGGATC CCTACTGCCA ACCTGGAATG 120 GAGACTTTTA TCTACTTCTC TCTCTCTGAA GATGTCAAAT CGTGGTTTAG ATCAAATATA 180 TTTCAAGCTA TAAAAGCAGG AGGTTATCTG TGCAGGGGGC TGGCATCATG TATTTAGGGG 240 CAAGTAATAA TGGAATGCTA CTAAGATACT CCATATTCTT CCCCGAATCA CACAGACAGT 300 TTCTGACAGG CGCAACTCCT CCATTTTCCT CCCGCAGGTG AGAACCCTGT GGAGATGAGT 360 CAGTGCCATG ACTGAGAAGG AACCGACCCC TAGTTGAGAG CACCTTGCAG TTCCCCGAGA k 420 ACTTTCTGAT TCACAGTCTC ATTTTGACAG CATGAAATGT CCTCTTGAAG CATAGCTTTT 480 TAAATATCTT TTTCCTTCTA CTCCTCCCTC TGACTCTAAG AATTCTCTCT TCTGGAATCG 540 CTTGAACCCA GGAGGCGGAG GTTGCAGTAA GCCAAGGTCA TGCCACTGCA CTCTAGCCTG 600 GGT6ACAGAG CGAGACTCCA TCTC 624 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 8 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 12 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: individual (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (IV) RNTI-SENSATION: NO (i?) CHARACTERISTICS: (fí) NAME / KEY: CDS (B) LOCATION: 1..12 (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 8: AGA AGG AG AGG Arg Arg Lys be - (2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. 9: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: Arg Arg Lys Ser 1 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 10: (i) CHARACTERISTIC? OF THE? ECUENCE: (A) LENGTH: 10 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-FEELING: NO (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 10: TGAGTCGACG 2) INFORMATION FOR SEQUENCE IDENTIFICATION NO. eleven: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSATION: NO (i) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 11: AATTCGTCGA CTCA (2) SEQUENCE IDENTIFICATION INFORMATION NO. 12 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 813 base pairs (B) TYPE: nucleic acid (CHAIN TYPE: «t-tibo (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..813"xi) SEQUENCE DESCRIPTION: SEQUENCE ID NO: 1 TAG AAG TGG ACT TAT TTT GGT CCT GAT GGG GAG AAT AGC TGG TCC AAG 48 Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 AAG TAC CCG TCG TGT GGG GGC CTG CTG CAG TCC CCC ATA GAC CTG CAC 96 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 AGT GAC ATC CTC CAG TAT GAC GCC AGC CTC ACG CCC CTC GAG TTC CAA 144 Ser Asp He Leu Gln Tyr Asp Wing Ser Leu Thr Pro Leu Glu Phe Gln 35 40 45 GGC TAC AAT CTG TCT GCC AAC AAG CAG TTT CTC CTG ACC AAC AAT GGC 192 Gly Tyr Asn Leu Be Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 CAT TCA GTG AAG CTG AAC CTG CCC TCG GAC ATG CAC ATC CAG GGC CTC 240 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 CAG TCT CGC TAC AGT GCC ACG CAG CTG CAC CTG CAC TGG GGG AAC CCG 288 Gln Ser Arg Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 AAT GAC CCG CAC GGC TCT GAG CAC ACC GTC AGC GGA CAG CAC TTC GCC 336 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gin His Phe Wing 100 105 110 GCC GAG CTG CAC ATT GTC CAT TAT AAC TCA GAC CTT TAT CCT GAC GCC 384 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 AGC ACT GCC AGC AAC AAG TCA GAA GGC CTC GCT GTC CTG GCT GTT CTC 432 Ser Thr Ala Ser Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 ATT GAG ATG GGC TCC TTC AAT CCG TCC TAT GAC AAG ATC TTC AGT CAC 480 He Glu Met Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His 145 150 155 160 CTT CAA CAT GTA AAG TAC AAA GGC CAG GAA GCA TTC GTC CCG GGA TTC 528 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 AAC ATT GAA GAG CTG CTT CCG GAG AGG ACC GCT GAA TAT TAC CGC TAC 576 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 CGG GGG TCC CTG ACC ACC CCT TGC AAC CCC ACT GTG CTC TGG ACA 624 Arg Gly Ser Leu Thr Thr Pro Pro Cys Aßn Pro Thr val Leu Trp Thr 195 200 205 GTT TTC CGA AAC CCC GTG CAA ATT TCC CAG GAG CAG CTG CTG GCT TTG 672 Val Phe Arg Asn Pro Val Gln He Ser Gln Gllu Gln Leu Leu Ala Leu 210 215 220 GAG ACÁ GCC CTG TAC TGC ACÁ CAC ATG GAC GAC CCT TCC CCC AGA GAA 720 Glu Thr Wing Leu Tyr Cvs Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 ATG ATC AAC AAC TTC CGG CAG GTC CAG AAG TTC GAT GAG AGG CTG GTA 768 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 TAC ACC TCC TTC TCC CAA GTG CAA GTC TGT ACT GCG GCA GGA CTG 813 Tyr Thr be Phe be Gln Val Gln val cys Thr Ala Wing Gly Leu 260 265 270 INFORMATION FOR SEQUENCE IDENTIFICATION NO. 13 CHARACTERISTIC? OF THE SEQUENCE: (A) LENGTH: 271 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 13: Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn be Trp Ser Lys 1 5 10 15 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 Being Asp He Leu Gln Tyr Asp Wing being Leu Thr Pro Leu Glu Phe Gln 35 40 45 Gly Tyr Asn Leu Being Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 Gln be Arg Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 110 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 Ser Thr Wing Being Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 He Glu Met Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His 145 150 155 160 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 Arg Gly Ser Leu Thr Thr Pro Pro cys Asn Pro Thr Val Leu Trp Thr 195 200 205 Val Phe Arg Asn Pro Val Gln He Ser Gln Glu Gln Leu Leu Ala Leu 210 215 220 Glu Thr Ala Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 235 Tyr Thr be Phe Ser Gln val Gln Val Cys Thr Ala Wing Gly Leu 260 265 270 (2) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO. 14 (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 822 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: both (D) TOPOLOGY: linear "" -ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1..822 (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 14 TCC AAG TGG ACT TAT TTT GGT CCT GAT GGG GAT AAT AGC TGG TCC AAG 48 Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 AAG TAC CCG TCG TGT GGG GGC CTG CTG CAG TCC CCC ATA GAC CTG CAC 96 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 AGT GAC ATC CTC CAG TAT GAC GCC AGC CTC ACG CCC CTC GAG TTC CAA 144 Ser Asp He Leu Gln Tyr Asp Ala Ser Leu Thr Pro Leu Glu Phe Gln 35 40 45 GGC TAC AAT CTG TCT GCC AAC AAG CAG TTT CTC CTG ACC AAC AAT GGC 192 Gly Tyr Asn Leu Ser Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 CAT TCA GTG AAG CTG AAC CTG CCC TCG GAC ATG CAC ATC CAG GGC CTC 240 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 CAG TCT CGC TAC AGT GCC ACG CAG CTG CAC CTG CAC TGG GGG AAC CCG 288 Gln Ser Arg Tyr Ser Wing Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 AAT GAC CCG CAC GGC TCT GAC CAC ACC GTC AGC GG CAG CAC TTC GCC 336 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 11 0 GCC GAG CTG CAC ATT GTC CAT TAT AAC TCA GAC CTT TAT CCT GAC GCC 384 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 AGC ACT GCC AGC AAC AAG TCA GAA GGC CTC GCT GTC CTG GCT GTT CTC 432 Ser Thr Wing Ser Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 ATT GAG ATG GGC TCC TTC AAT CCG TCC TAT GAC AAG ATC TTC AGT CAC 480 He Glu Met Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His 145 150 155 160 CTT CAA CAT GTA AAG TAC AAA GGC CAG GAA GCA TTC GTC CCG GGA TTC 528 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Ala Phe Val Pro Gly Phe 165 170 175 AAC ATT GAA GAG CTG CTT CCG GAG AGG ACC GCT GAA TAT TAC CGC TAC 576 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 CGG GGG TCC CTG ACC AAC CCT TGC AAC CCC ACT GTG CTC TGG ACA 624 Arg Gly Ser Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 GTT TTC CGA AAC CCC GTG CAA ATT TCC CAG GAG CAG CTG CTG GCT TTG 672 Val Phe Arg Asn Pro Val Gln He Ser Gln Gllu Gln Leu Leu Ala Leu 210 215 220 GAG ACÁ GCC CTG TAC TGC ACÁ CAC ATG GAC GAC CCT TCC CCC AGA GAA 720 Glu Thr Wing Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 ATG ATC AAC AAC TTC CGG CAG GTC CAG AAG TTC GAT GAG AGG CTG GTA 768 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 TAC ACC TCC TTC TCC CAG GTG CAG GTC TGT ACT GCG GCA GGA CTG AGT 816 Tyr Thr Ser Phe Be Gln Val Gln Val Cys Thr Ala Wing Gly Leu Ser 260 265 270 CTG GGC Leu Gly 822 (2) SEQUENCE IDENTIFICATION INFORMATION NO. fifteen: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 274 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (Xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 15: Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu A = n Ser Trp Ser Lys 1 5 10 15 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 Being Asp He Leu Gln Tyr Asp Wing Being Leu Thr Pro Leu Glu Phe Gln 35 40 45 Gly Tyr Asn Leu Being Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 Gln Ser Arg Tyr Ser Ala Thr Gln Leu His Leu HAS Trp Gly Asn Pro 85 90 95 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 110 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 Ser Thr Wing Being Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 He Glu Met Gly Ser Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His 14 150 155 160 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 Arg Gly Ser Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 Val Phe Arg Asn Pro Val Gln He Ser Gln Glu Gln Leu Leu Ala Leu 210 215 220 Glu Thr Ala Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 Tyr Thr Ser Phe Ser Gln Val Gln Val Cys Thr Ala Wing Gly Leu Ser 260 265 270 Leu Gly (2) SEQUENCE IDENTIFICATION INFORMATION NO. fifteen: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear "(ii) TYPE OF MOLECULE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSATION: NO (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 16: CTTTTTTTGAT A CCCTTCCTT CTGAA (2) SEQUENCE IDENTIFICATION INFORMATION NO. 17 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 986 base pairs (B) TYPE: nucleic acid (C) CHAIN TYPE: both (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (ix) CHARACTERISTICS: (A) NAME / KEY: CDS (B) LOCATION: 1.975 (xi) OF? SEQUENCE CRIPTION: ID. OF SEQUENCE NO: 17: TCC AAG TGG ACT TAT TTT GGT CCT GAT GGG GAT AAT AGC TGG TCC AAG 48 Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 AAG TAC CCG TCG TGT GGG GGC CTG CTG CAG TCC CCC ATA GAC CTG CAC 96 Lys Tyr Pro Ser Cys Gly Gly Leu Leu Gln Ser Pro He Asp Leu His 20 25 30 AGT GAC ATC CTC CAG TAT GAC GCC AGC CTC ACG CCC CTC GAG TTC CAA 144 Ser Asp He Leu Gln Tyr Asp Ala Ser Leu Thr Pro Leu Glu Phe Gln 35 40 45 GGC TAC AAT CTG TCT GCC AAC AAG CAG TTT CTC CTG ACC AAC AAT GGC 192 Glv Tyr Asn Leu Ser Wing Asn Lys Gln Phe Leu Leu Thr A = n Asn Gly 50 55 60 CAT TCA GTG AAG CTG AAC CTG CCC TCG GAC ATG CAC ATC CAG GGC CTC 240 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 CAG TCT CGC TAC AGT GCC ACG CAG CTG CAC CTG CAC TGG GGG AAC CCG 288 Gln Ser Arg Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 AAT GAC CCG CAC GGC TCT GAC CAC ACC GTC AGC GGA CAG CAC TTC GCC 336 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln Hxs Phe Ala 100 105 11 0 GCC GAG CTG CAC ATT GTC CAT TAT AAC TCA GAC CTT TAT CCT GAC GCC 384 Wing Glu Leu Kis He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 A0c-. ACT GCC AGC AAC AAG TCA GAA GGC CTC GCT GTC CTG GCT GTT CTC 432 h. . Thr Wing Being Asn Lys Ser Glu Gly Leu Wing Val Leu Wing Val Leu 130 135 140 ATT GAG ATG GGC TCC TTC AAT CCG TCC TAT GAC AAG ATC TTC AGT CAC 480 He Glu Met Gly Ser Phe A = n Pro be Tyr Asp Lys He Phe Ser His 145 150 155 160 CTT CAA CAT GTA AAG TAC AAA GGC CAG GAA GCA TTC GTC CCG GGA TTC 528 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 AAC ATT GAA GAG CTG CTT CCG GAG AGG ACC GCT GAA TAT TAC CGC TAC 576 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 CGG GGG TCC CTG ACC AAC CCT TGC AAC CCC ACT GTG CTC TGG ACA 624 Arg Gly Ser Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 GTT TTC CGA AAC CCC GTG CAA ATT TCC CAG GAG CAG CTG CTG GCT TTG 672 Val Phe Arg Asn Pro Val Gln He er Gln Gllu Gln Leu Leu Ala Leu 210 215 220 GAG ACÁ GCC CTG TAC TGC ACÁ CAC ATG GAC GAC CCT TCC CCC AGA GAA 720 Glu Thr Ala Leu Tyr Cys Thr His Met Asp Asp Pro Ser Pro Arg Glu 225 230 235 240 ATG ATC AAC AAC TTC CGG CAG GTC CAG AAG TTC GAT GAG AGG CTG GTA 768 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe Asp Glu Arg Leu Val 245 250 255 TAC ACC TCC TTC TCC CAG GTG CAA GTC TGT ACT GCG GCA GGA CTG AGT 816 Tyr Thr Ser Phe Ser Gln Val Gln Val Cys Thr Wing Wing Gly Leu Ser 260 265 270 CTG GGC ATC ATC CTC TCA CTG GCC CTG GCT GGC ATT CTT GGC ATC TGT 864 Leu Gly He He Leu Ser Leu Ala Leu Ala Gly He Leu Gly He Cys 275 280 280 ATT GTG GTG GTG GTG TCC ATT TGG CTT TTC AGA AGG AAG GGT ATC AAA 912 He Val Val Val Val Ser He Trp Leu Phe Arg Arg Lys Gly He Lys 290 295 300 AAA GGT GAT AAC AAG GGA GTC ATT TAC AAG CCA GCC ACC AAG ATG GAG 960 Lys Gly Asp Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu 305 310 315 320 ACT GAG GCC CAC GCT TGAGGTCCCC G 986 Thr Glu Ala His Ala 325 (2) INFORMATION FOR IDENTIFICATION OF SEQUENCE NO. 1 (l) SEQUENCE CHARACTERISTICS: (A) LENGTH: 325 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (n) TYPE OF MOLECULE: protein (xi) SEQUENCE DESCRIPTION: TD. OF SEQUENCE NO: 13: Ser Lys Trp Thr Tyr Phe Gly Pro Asp Gly Glu Asn Ser Trp Ser Lys 1 5 10 15 Lys Tyr Pro Ser Cvs Gly Gly Leu Glu Gln Ser Pro He Asp Leu His 20 25 30 Being Asp He Leu Gln Tyr Asp Wing Being Leu Thr Pro Leu Glu Phe Gln 35 40 45 Gly Tyr Asn Leu being Wing Asn Lys Gln Phe Leu Leu Thr Asn Asn Gly 50 55 60 His Ser Val Lys Leu Asn Leu Pro Ser Asp Met His He Gln Gly Leu 65 70 75 80 Gln Ser Arg Tyr Ser Ala Thr Gln Leu His Leu His Trp Gly Asn Pro 85 90 95 Asn Asp Pro His Gly Ser Glu His Thr Val Ser Gly Gln His Phe Wing 100 105 110 Wing Glu Leu His He Val His Tyr Asn Ser Asp Leu Tyr Pro Asp Wing 115 120 125 Ser Thr Ala Ser Asn Lys Ser Glu Gly Leu Ala Val Leu Ala Val Leu 130 135 140 He Glu Met Gly be Phe Asn Pro Ser Tyr Asp Lys He Phe Ser His 145 150 155 160 Leu Gln His Val Lys Tyr Lys Gly Gln Glu Wing Phe Val Pro Gly Phe 165 170 175 Asn He Glu Glu Leu Leu Pro Glu Arg Thr Wing Glu Tyr Tyr Arg Tyr 180 185 190 Arg Gly Ser Leu Thr Thr Pro Pro Cys Asn Pro Thr Val Leu Trp Thr 195 200 205 Val Phe Arg Asn Pro Val Gln He Ser Gln Glu Gln Leu Leu Ala Leu 210 215 220 Glu Thr Ala Leu Tyr Cys Thr His Met A = p Asp Pro Ser Pro Arg Glu 225 230 235 240 Met He Asn Asn Phe Arg Gln Val Gln Lys Phe A = p Glu Arg Leu Val 245 250 255 Tyr Thr Ser Phe Ser Gln Val Gln Val Cys Thr Wing Wing Gly Leu Ser 260 265 270 Leu Gly He He Leu Ser Leu Ala Leu Wing Gly He Leu Gly He Cys 275 280 285 He Val Val Val Val Ser He Trp Leu Phe Arg Arg Lys Gly He Lys 290 295 300 Lys Gly Asp Asn Lys Gly Val He Tyr Lys Pro Wing Thr Lys Met Glu 305 310 315 320 Thr Glu Ala His Ala 325 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 19: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) TYPE OF CHAIN: individual (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 19: ACATTGAAGA GCTGCTTCCG 6 21 (2) SEQUENCE IDENTIFICATION INFORMATION NO. twenty: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (OR TYPE OF CHAIN: individual (D) TOPOLOGY: linear (Ü) TYPE OF MOLECULE: cDNA (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 20: AATTTGCACG GGGTTTCGG 19 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 21: (l) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1363 base pairs (B) TYPE: nucleic acid (OR CHAIN TYPE: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic co) * r i) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 2 L: CTGACACCAC TCAGACCGTG TSTGATCTGG CTCAACCAGT TCTGCGATCC CACCCAGGAA 60 CAGAAGACTG CAAGAAAACG TTACTTCAAC CCCCCTGTGA TCCCATCTGC AACCTGACCA 120 ATCAGCACTC CCCAAGTCCC AAGCCCCTAT CTGCCAAATT ATCTTTAAAA ACTCCCCAGA 180 GGCAGGGTGC AGTGGTTCAA CGCCTGTAAT CCCAGCACTT TAGGTGGATC ACGAGATCAA 240 GAGATCAAGA CCAGCCTGGC CAACATGGTG AAACCCCGTC TTCTTACTAA AAATACAAAA 300 ATTAGCTGGG TGTGGCGGCG CGTGCCTGTA ATCCCAGCTA CCCAGGAGGC TGAGGCAGGA 360 GAATCGCTTG AACCCGTGAG GCAGAGGTTG CAGTGAGCCA AGACCATGCC ACTGCATTTC 420 AGCCTGGGCG ACAGAGGGGA ACTCCGTCTG AACAAACAAA CAAACAAACA ACTCCCGGAA 480 TGCTTGGGGA GACTGATTTG AGTACTGGAA TCCCAGTACT TTAGGAGGCC AAGGTAGGTG 540 GATCATTTGA GGTCAGGAGT TCCAGACCAG CCTGGCCAAC ATGGTGAAAC CCCGTCTCTA 600 CTAAAATTAG AAAAATTAGC CGGGTGTGGT GGTGGGCGCC TGTAATCCCA GCACTTTGGG 660 AAGCCAAGGC AGGTGAATTA TCTGAGGTCG GGAGTTTAAG GCCAGCCTTA AACTGGCGAA 720 ACCCCGCCTC TACTAAAAAT ACAAAAATTA TCTGGGCATG GTGGCATGTG CCTGTAATCC 780 CAGCTACTCG GGAGGCTGAG GCAGGAGAAT CGCTTGAACC CGGGAGGCGG AGGTTGCAGT 840 GAGCCGAGAT CACGCTATTG CACTCCGGCC TGGGCAACAG AGCGAGACTC CGTCTCAAAC 900 AAACAAACAA AGGAACGAAA ACTCCGGTCT CCGGCACGGC AAGCTCTGCG TGAATTACTT 960 TCTCCATTGC AACTCCCCTG TCTTGATAAA TGGGCTCTGT CTAAGCAGCG GGCAAGGTGA 1020 ACTCGTTGGG CTGTTACAGG ACCAGTGACA GACCAAGGCA TGCCACTGAA GGAATCCCTA 1080 GACGCACCCT TCTGGATGTG AGGCAGGCGG ATCTCACCCC ACGCCTGCCA GCAGCTCCTC 1140 GGAGAACTGT GTTCCTGGGT CAGCCCTGGC CCAGAGGAGC GCCGGGGACC CGCAGAGTGC 1200 TGCTGAAGTC AAGGCTACAA CTCACCTAGG ATCTGGGGCG CCAGCCTCCG GTGGGCAGGG 1260 CGTTCTCCTC CCCCACCCCC TCCCCGCACG ATGACATCAA GT - TTTGGCG TTGAGTTGCT 1320 CCATAAAAGC TGCCCGGGGA AGCCAGGAGA GCGAAGGGCG GAC 1363 (2) SEQUENCE IDENTIFICATION INFORMATION NO. 22: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (CHAIN TYPE: individual (D) TOPOLOGY: linear ~ "< ll) TYPE OF MOLECULE: ODNc (III) HYPOTHETICAL: NO (IV) ANTI-SENSATION: NO (xi) SEQUENCE DESCRIPTION: ID. OF SEQUENCE NO: 22: GTCCACTTGG ATCCGTTCAC TGG

Claims (53)

NOVELTY OF THE INVENTION CLAIMS

1. - A substantially purified nucleic acid entity encoding the amino acid sequence of HCAVIII illustrated in SEQ ID No. 2.

2. The nucleic acid according to claim 1, further characterized in that said nucleic acid is mRNA.

3. A cDNA that encodes the amino acid sequence of HCAVIII or a portion thereof.

4. The cDNA according to claim 3, further characterized in that the amino acid sequence is encoded by the coding region of the nucleotide sequence illustrated in SEQ ID No. 1.

5. The cDNA according to the claim 3, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 2.

6. The cDNA according to claim 3, further characterized in that the amino acid sequence is encoded by the coding region of the sequence of nucleotides illustrated in SEQ ID No. 3.

7. The cDNA according to claim 3, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 4.

8. - The cDNA according to claim, further characterized in that the amino acid sequence is encoded by the nucleotide sequence illustrated in TD SEQ. No. 12.

9. The cDNA according to claim 3, further characterized in that the sequence of amino acids comprises the sequence illustrated in SEQ ID No. 13.

10. The cDNA according to claim 3, further characterized in that the amino acid sequence is encoded by the nucleotide sequence illustrated in TD SEQ. No. 14.

11 The cDNA according to claim 3, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 15.

12. The cDNA according to claim 3, further characterized in that it comprises the illustrated nucleotide sequence. in SEQ ID No. 5.

13. The cDNA according to claim 3, further characterized in that it comprises the nucleotide sequence illustrated in SEQ ID No. 5 and SEC ID. No. 7.

14.- A cDNA encoding the amino acid sequence of HCAVIII wherein the phosphorylation region has been mutated.

15. The cDNA according to claim 14, further characterized in that the amino acid sequence is encoded by the nucleic acid sequence illustrated in SEQ ID No. 17.

16. - The cDNA < according to claim 14. further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 18.

17.- A protein q? e comprises the amino acid sequence of HCAVIII or a portion of the same.

18. The protein according to claim 17, further characterized in that the amino acid sequence is -odified by the coding region of the nucleic acid sequence illustrated in SEQ ID No. 1.

19.- The protein in accordance with the reinvidication 17, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 2.

20. The protein according to claim 17, further characterized in that the amino acid sequence is encoded by the coding region of the sequence of nucleic acids illustrated in SEQ ID No. 3.

21. The protein according to claim 17, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 3.

22. The protein according to claim 17, further characterized in that the amino acid sequence is encoded by the coding region of the nucleic acid sequence illustrated in SEQ ID No. 12.

23. The protein according to claim 17, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 13. R2

24. - The protein according to claim 17, further characterized in that the amino acid sequence is encoded by the coding region of the nucleic acid sequence illustrated in SEQ ID No. 14. 25.- The protein according to the claim 17, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 13. 26.- A protein may comprise the amino acid sequence of HCAVIII wherein the phosphorylation region has been a. 27. The protein according to claim 26, further characterized in that the amino acid sequence is encoded by the nucleic acid sequence illustrated in SEQ ID No. 17. 28.- The protein according to claim 26, further characterized in that the amino acid sequence comprises the sequence illustrated in SEQ ID No. 18. 29.- A recombinant DNA clone comprising a cDNA of an isolable HCAVIII transcript of human A549 cells of approximately 1.1 kilobasee. 30. An expression vector comprising the nucleic acid sequence for HCAVIII or a portion thereof. 31. The expression vector according to claim 30, further characterized in that the nucleic acid sequence comprises the coding region of the G3 nucleotide sequence illustrated in SEQ ID No. 1. 32.- The expression vector according to claim 30, further characterized in that the nucleic acid sequence comprises the coding region of the nucleotide sequence illustrated in SEQ ID No. 3. The expression vector according to claim 30, further characterized in that the nucleic acid sequence comprises the coding region of the nucleotide sequence illustrated in SEQ ID No. 12. 34.- The expression vector according to claim 30, further characterized in that the nucleic acid sequence comprises the coding region of the nucleotide sequence illustrated in SEQ ID No. 14. 35.- The expression vector according to claim 30, further characterized in that the nucleic acid sequence comprises the nucleotide sequence illustrated in SEQ ID No. 17. 36.- An in vitro method of tissue detection cancerous or precancerous lung comprising: (a) preparing a tissue biopsy section; (b) probing said tissue with a labeled probe complementary to the cDNA of SEQ ID NO: 1; (c) removing said probe that has not been hybridized to the tissue; and (d) detecting the presence of the hybridized probe. 37. An in vitro method for detecting lung cancer antigen specific for non-small cell carcinoma in a human cell specimen comprising: a) marking a DNA probe comprising the genomic clone of HCAVIII; b) reacting the labeled DNA probe with a specimen of human pre-human cells and a specimen of normal human cells under conditions suitable for hybridization of the labeled probe to any RNA of HCAVIII that may be present in the cell specimen of test and normals; c) removing unreacted components from the test and normal cell specimens; d) detect the hybridized probe bound to the test and normal cell specimens; e) quantify and compare the amount of hybridized probe bound to the test and normal cell specimens. 38.- The in vitro method for detecting lung cancer antigen specific for non-small cell carcinoma in a human cell specimen according to claim 37, further characterized in that it comprises: a) labeling a DNA probe which comprises the genomic clone of HCAVIII with a substrate that could be ligated to a substance to form a labeled DNA probe; b) reacting the labeled DNA probe with a specimen of human test cells and a specimen of normal human cells under conditions suitable for hybridization of the labeled probe to any HCAVIII mRNA that may be present in the test cell specimen and normal c) removing unreacted components from the test and normal cell specimens; d) reacting the specimens of test and normal cells with a detection substance that has the ability to fluoresce; e) compare- the fluorescence of the specimens of test and normal cells. 39.- An in vitro method for selecting human specimens for HCAVIII protein, which comprises: a) mixing a human test specimen with a first amount of antibody specific for the HCAVIII protein in a first reaction well; b) mixing a control lung cancer antigen comprising at least one portion of the HCAVTII protein with a second amount of antibody specific for the HCAVIII protein in a second reaction well; and c) detecting whether the test specimen binds to said antibody in comparison to said control lung cancer antigen. 40.- An in vitro method for testing a sample of human cells for lung cancer which comprises testing a cell homogenate for carbonic anhydrase activity. 41.- An antibody made by immunizing animals with HCAVIII, a lung cancer antigen associated with small cell lung cancer cells. 42.- An antibody according to claim 41, further characterized in that said lung cancer antigen has the amino acid sequence illustrated in SEQ ID NO: 2. 43.- An antibody according to claim 41, further characterized in that said Lung cancer antigen has the amino acid sequence illustrated in SEQ ID NO: 4. 44.- An antibody according to claim 41, further characterized in that said lung cancer antigen has the amino acid sequence illustrated in SEQ ID NO: 1 . 45.- An antibody according to claim 1, further characterized in that said lung cancer antigen has the amino acid sequence illustrated in SEQ ID NO: 15. An antibody according to claim 41, further characterized because said lung cancer antigen has the amino acid sequence illustrated in ID? EC NO: 18. 47.- A therapeutic composition for the treatment of small cell lung cancer cells comprising an antibody to HCAVIII protein bound to a substance which affects the ability of said cancer to replicate. 48. The therapeutic composition for the treatment of small cell lung cancer cells according to claim 47, further characterized in that said substance is a drug for cancer. 49.- The therapeutic composition for the treatment of small cell lung cancer cells according to claim 48, further characterized in that said substance is a radioisotope. 50. The therapeutic composition for the treatment of small cell lung cancer cells according to claim 49, further characterized in that said substance affects the genetic expression of a gene q? E encodes HCAVIII. 51.- A substantially purified nucleic acid comprising the nucleotide sequence illustrated in SEQ ID NO: 7. 52.- A cDNA comprising the nucleotide sequence illustrated in SEQ ID NO: 7. 53.- A substantially purified nucleic acid which comprises the nucleotide sequence illustrated in SEQ ID NO: 21.