MXPA97000208A - Preparation of antigen protein and immunological tests of helicobacter pyl - Google Patents

Abstract

A preparation of Helicobacter pylori proteins depleted of Helicobacter pylori antigens is described for which immunoreactivity is detected in individuals negative for Helicobacter pylori and immunological tests using the protein. The preparation is depleted of Helicobacter pylori antigens less than 30 kDa, especially antigens of 24 to 25 kDa and / or antigens of 18 to 19 k

Description

PREPARATION OF ANTIGEN PROTEIN AND IMMUNOLOGICAL TESTS OF HELICOBACTER PYLORI Field of the Invention This invention relates to a preparation of antigenic protein obtained from Heli cobacter pylori, and to methods for using this protein preparation in diagnostic tests related to Helicobacter pylori. , Background Heli cobacter pylori is a widely prevalent organism found in gastric biopsy in approximately 30 percent of the population under 40 years of age with increasing incidence after that age. The organism is a causative agent of chronic gastritis in humans (for example, Marshall &Warren 19841: Blaser, 19902).

'"Epidemiological studies have shown that Helicobacter pylori is most commonly found in association with gastritis Serological investigations have shown that evidence of a current or previous infection can be found in 30-50 percent of a population chosen at random from donors. of blood There has not been conclusively demonstrated yet a direct causal relationship for duodenal ulcer disease, however, the organism is found in 95% of patients with duodenal ulcer.In addition, the eradication of the organism results in rapid healing of the ulcer (eg, Rauws &Tytgat, 19903) These data provide strong evidence that Helicobacter pylori is a dominant factor in the development of duodenal ulcer.Additional evidence for the pathogenic involvement of Helicobacter pylori in these conditions has been provided by studies with gnotobiotic piglets (Lambert and colab speakers, 19874) and the fulfillment of Koch's postulates with human volunteers (Marshall et al., 19855; Morris & Nicholson, 19876). In addition, there is now strong circumstantial evidence implicating Heli cobacter pylori in the pathogenesis of gastric carcinoma (eg, Jiang et al., 19877; Lambert et al., 19868; Crabtree et al., 19929; 1993; Forman et al., 199011, 199112.; Nomura et al., 199113; Parsonnet et al14). More recently, the Eurogast Study Group, led by Forman (199315), demonstrated a significant relationship between Helicobacter pylori seropositivity in mortality and incidence of gastric cancer. Undoubtedly, there is now a convincing body of literature implicating infection with Heli cobacter pylori in a considerable proportion of upper gastrointestinal morbidity. Several hypotheses have been suggested for the pathogenic mechanisms of gastroduodenal disease induced by Helicobacter pylori, including the production of cytotoxins and mechanical disruption of the epithelium (eg, Blaser, 199216). Interestingly, however, many infected persons remain asymptomatic despite the persistent presence of the pathogen (Taylor &Blaser, 199117).

Principles of the Invention In accordance with the invention, a A preparation of Helicobacter pylori protein depleted of antigens for Helicobacter pylori for which immunoreactivity is detected in individuals with negative Helicobacter pylori In a preferred embodiment of the invention, the immunoreactivity is based on antibodies. of the invention the protein preparation is depleted of r '? Helicobacter pylori antigens characterized by a molecular weight less than 30 kDa.The protein preparation can be depleted of Helicojacter pylori antigens characterized by a molecular weight less than 29, preferably lower of 28, or ideally less than 27 kDa In a preferred embodiment of the invention the protein preparation is depleted of an antigen characterized by a molecular weight of about 24 to 25 kDa or of a derivative or fragment or precursor or mutant thereof.

In a preferred embodiment of the invention the protein preparation is depleted of antigens characterized by a molecular weight of about 18 to 19 kDa or derivatives or fragments or precursors or mutants thereof. Preferably the protein preparation is depleted of: - (i) antigens characterized by a molecular weight of about 24 to 25 kDa or a derivative or fragment or precursor or mutant thereof; (ii) antigens characterized by a molecular weight of about 18 to 19 kDa or a fragment or precursor or mutant thereof. The 24 to 25 kDa antigen is further characterized by including an N-terminal amino acid sequence shown in Sequence Identification Number 2 or portions thereof. • "" A The 24 to 25 kDa antigen is further characterized by including a terminal sequence of internal amino acids shown in Sequence ID Number 4 or portions thereof. The antigen 18 to 19 kDa is further characterized by including an amino acid sequence N-terminal shown in Sequence ID No. 1 or portions thereof or preferably an amino acid sequence N-terminal listed in the Sequence Identification No. 6 or portions of it. The 18-19 kDa antigen is further characterized in that it includes a terminal sequence of internal amino acids shown in Sequence Identification Number 3 or portions thereof. The antigen can be prepared as a glycine extract. The invention also provides a method for To detect the presence of antibodies specific for Helicobacter pylori comprising contacting a test sample with an immunogenically effective amount of Helicobacter pylori protein preparation of claims 1 to 13 to form, in the presence of said antibodies, amounts detectable antigen / antibody complex, and then subjecting the complex to a detection means in order to detect the complex. A "Preferably the test sample was selected from one of whole blood, serum, plasma, urine or a secretion such as gastrointestinal secretion or saliva.In a preferred embodiment of the invention the protein preparation is labeled or fixed on a support, preferably to a solid phase support Typically the solid support is a polystyrene plate or a nitrocellulose strip Preferably the detection means is a secondary antibody conjugated to a reporter molecule, and which is specific for at least part of the specific antibody for Helicobacter pylori found in the secretion The reporter molecule can be a fluorophore, a ligand such as a radio ligand or a gold ligand or an enzyme.The method can include the addition of a chromogen which is activated by the enzyme to produce A change in color or optical density Typically the enzyme is peroxidase and the chromogen is o-phenylenediamena (OPD). all may include the addition of a non-fluorescent substrate which is activated by the enzyme to produce a fluorescent substrate. Preferably the enzyme is 6-galactosidase and the non-fluorescent substrate is resosufin-β-D-galactopyranoside. The method may include the addition of a non-substrate ,, - luminescent which is activated by the enzyme to produce a luminescent substrate, typically the substrate is 3- (21-spiro-adamantan) -4-methoxy- (31-phosphoryloxy) phenyl-1,2-dioxetane and the enzyme is alkaline phosphatase. In one embodiment of the invention the sample is a human sample and the secondary antibody is rabbit anti-human immunoglobulin. The invention further provides a set of tests for detecting the presence of Helicobacter pylori in a test sample, the test set comprising: (a) a solid support having a protein preparation of the invention immobilized therein, - y ( b) a detection means that in use detects whether Helicobacter pylori-specific antibodies in the test sample bind to all or part of the protein preparation. Preferably, the test sample is selected from one of whole blood, serum, plasma, urine or a secretion such as a gastrointestinal or salivary secretion. The support is preferably a solid phase support and can be a polystyrene plate or a nitrocellulose strip. In one embodiment of the invention, the detection element is a secondary antibody, conjugated to a reporter molecule, and which is specific for at least < - - part of the specific antibody of Heli cobacter pylori found in the secretion. The reporter molecule can be a fluorophore, a ligand such as a radio ligand or a gold ligand or an enzyme. The test set may include a chromogen which, when acting by the enzyme, changes color or optical density. Typically, the enzyme is peroxidase and the chromogen is o-phenylenediamena. In another case the game includes a non-fluorescent substrate, which when activated by the enzyme, becomes fluorescent. Preferably the enzyme is β-galactosidase and the non-fluorescent substrate is resosufin-6-D-galactopyranoside. In another case the kit includes the addition of a non-luminescent substrate which is activated by the enzyme to produce a luminescent substrate, typically the substrate is 3- (21-spiro-adamantan) -4-methoxy- (3'phosphoryloxy) - - • 'Phenyl-l, 2-dioxetane and the enzyme is alkaline phosphatase. In a preferred embodiment of the invention the mammal is a human and the secondary antibody is rabbit anti-human immunoglobulin. The invention also provides a method for detecting the presence of antibodies specific for Helicobacter pylori comprising the steps of: - (a) contacting the protein preparation of the invention with a suitable support for use in agglutination tests; (b) incubating the contactants of step (a) with a test sample to form, in the presence of antibodies specific for Helicobacter pylori, agglutinated complexes of antigen-antibodies. The support may comprise a plurality of latex granules or red blood cells. The invention further provides a set of tests for detecting the presence of Helicobacter pylori in a test sample, the test kit comprising an agglutination test support having the protein preparation of the invention immobilized therein. Preferably the support comprises glass or latex granules or the like. Alternatively, the support comprises red blood cells. In this case the kit may also include an element for incubating the agglutination test support with a test sample. The invention also provides the use of the protein preparation of the invention in an immunological test.

Detailed Description Figure 1: Serum adult (CLO negative) analyzed, to see the presence of anti-Helicobacter pylori IgB antibodies. The Figure shows a Western blot of Helicobacter pylori tested with serum obtained from CLO negative individuals. All serum was diluted 1: 100 in phosphate buffer saline (PBS) containing fat-free dry skim milk (5 percent, weight / volume). The proteins of the SDS-PAGE gels were transferred to the PVDF membrane. Antigen-antibody complexes were detected in the washed membranes using an improved chemiluminescent detection system. Each lane represents a different serum sample. Figure 2: Serum absorbed: Serum from two individuals negative for Helicobacter pylori was absorbed with either C. Jej uni (lane A), Helicobacter pylori (lane B), or E. coli (lane C) whole. Figure 3: Partial purification of 18 and 25 kDa proteins: Both proteins were purified from whole Helicobacter pylori based on molecular weight using continuous elution preparative SDS-PAGE on a Model 491 Prep-Cell from (Bio-Rad) . Figure 4: Serum obtained from CLO negative children analyzed to see the presence of smt-Helicobacter pylori IgG antibodies. The Figure shows a Western blot of Helicobacter pylori analyzed with serum obtained from CLO negative children.

All serum was diluted 1:50 in phosphate buffer saline containing non-fat dry skim milk (5 weight percent / volume). Each lane represents a different serum sample. Figure 5: Antigens recognized in C. jejuni and E. coli by anti-Helicobacter pylori antiserum. The Figure shows a Western blot of Helicobacter pylori (lane A), C. jej uni (lane B) and E. coli (lane C) tested with rabbit anti-Helicobacter pylori antiserum. Each bacterium (5μg) underwent SDS-PAGE followed by immune staining. Figure 6: Western blot of purified 25 kDa protein developed with an individual serum negative for Helicobacter pylori. The purified 25 kDa protein was subjected to SDS-PAGE and Western spotting. The spot was tested with serum obtained from a subject not infected with Heli cobacter pylori. Figure 7: Biotinylation of proteins located on the surface of Helicobacter pylori. Heli cobacter pylori grown on agar was harvested in phosphate buffer (pH 7.3) and washed twice in this regulator before the biotinylation of proteins exposed on the surface. Bacteria were resuspended (approximately 2 milligrams / milliliter) in phosphate buffer (1 milliliter) and preheated to 37 ° C. After that, biotin-X-NHS (sulfosuccinimidyl-6 (biotinamido) hexanoate, • Calbiochem) was added to a final concentration of 1 M and prepared immediately before use. After mixing for 10 minutes at 37 ° C, the labeling reaction was terminated by the addition of 1.5 M Tris-Cl (pH 8) to a final concentration of 10 mM. The suspension was washed three times by centrifugation (10,000 g, 1 minute) in ice-cold phosphate buffer. The examination of the bacteria by light microscopy after the labeling and washing procedures showed that the cells were still intact with motility. The biotinylated Helicobacter pylori was subjected to analytical SDS-PAGE, followed by Western staining, to identify the biotinylated proteins. Western blots were developed with Extravidin-peroxidase (Sigma). The present invention relates to improving the reliability of diagnostic immunological tests for Helicobacter pylori. Previous studies (reference 3) have indicated a high level of false positive results in diagnostic immunological tests in which the whole protein of Helicobacter pylori has been used. Second, the use of specific antigens may limit the sensitivity of the immunological test. The present invention is based on observations that use Western blot analysis of the antibody profile in individuals that are positive for Heli cobacter pylori as defined by positivity in the CLO test and in individuals that are negative for Helicobacter pylori as defined by the negativity to the CLO test . These studies identified two proteins of Helicobacter pylori of 19 and 25 kDa. Antibodies were detected for these two proteins in the majority of individuals who were negative for CLO in rapid urease tests. These antibodies were still detected in children who were negative for CLO. These proteins were purified and N-terminal and internal and internal sequences were identified as indicated in the Appendix. These proteins were the dominant conserved proteins to which immunoreactivity could be detected in individuals negative for Heli cobacter pylori. These proteins could be depleted from the total protein preparation by SDS-PAGE preparation electrophoresis without resulting in a significant depletion of other immunodominant antigens. As an example, this was more easily accomplished by the simple elimination of proteins less than 30 kDa but it could also be done by eliminating proteins smaller than 29, 28 or 27 kDa. The present invention relates to improving the reliability of immunological tests based on serum, saliva or other mucous secretions for Helicobacter pylori. The present invention improves the specificity of immunological tests based on protein "mixtures" for Helicobacter pylori by removing the 19 and 25 kDa proteins from the protein mixture. As an example, the removal of these proteins by SDS-PAGE analysts of preparation of all proteins less than 30 kDa from an antigenic preparation of Helicobacter pylori is mentioned. However, the removal of these proteins could also be achieved using affinity chromatography with antibodies for these specific proteins for example. An inherent restriction in the design of detection systems based on the ELISA is to establish a cut-off point so that all samples below this threshold are considered negative. Clearly, many seropositive cases will remain undetected in this situation and a true estimate of the incidence of prior contact with the organism would be underestimated. Western blotting techniques were used to investigate antigenic specificity of systemic responses to Heli cobacter pylori in both healthy individuals and those infected with Helicobacter pylori. The incidence of seropositivity in individuals negative for HelicoJacter pylori that has been shown is much higher than that shown previously. In addition, we have shown that antibodies to a 25 kDa protein are detectable in the majority of individuals negative for Helicobacter pylori. These were detected using a technique that we have modified called Enhanced Chemiluminescence. Improved chemiluminescence in Western blot analysis reveals that the majority of uninfected individuals have antibodies that are specific for Helicobacter pylori and recognize antigens that are not present in other microorganisms. Of these antigens the most common recognized is a 25 kDa protein that appears to be specific for Helicobacter pylori. A second protein was also identified at 18 kDa in a large subgroup of individuals negative for Helicobacter pylori. In addition, our data indicate that depletion of these antigens improves the specificity of the immune test by probably removing antigens to result in analysis; False-positive in negative individuals for Helicobacter pylori. An antigen component is present, for the purposes of this invention, if it is detectable by Western spotting analysis. Conversely, it is absent if it is not detectable by this means. The molecular weights of the antigen components useful in the present invention are necessarily approximate figures, due to the limitations of current methods for determining molecular weight. The molecular weights specifically mentioned have been obtained by polyacrylic amide gel electrophoresis (PAGE) system sold by BioRad under the trademark PrepCell. Those skilled in the art will realize that slightly different results can be obtained in different hands or even in different occasions in the same hands, and thus the approximate molecular weight figures cited in this specification should be read as + 5 percent or even + 10 percent. For this reason, the 18 kDa antigen is sometimes referred to as the 18-19 kDa antigen. The term "antigen" is used in its broadest sense and includes complete Helicobacter pylori cells or homogeneous, almost homogeneous extracts or heterogeneous extracts of Helicobacter pylori, all of which are capable of "binding" to a specific antibody in a serum or mucus secretion The antigenic components contemplated by the present invention include protein, polysaccharide or lipid or any combination thereof Preferably, the antigen is protein, lipopolysaccharide or Heli cobacter pylori cell extract prepared, for example, by sonification, pressure disintegration , detergent extraction or fractionation In the method of the invention, antibody is detected in the serum or fluid body secretion By "fluid body secretion" is meant the secretion of epithelial cells such as those that line the channels, cavities and tracts that communicate with the external air, and in particular the nose, throat, tract respiratory, eyes, genital and urinary passages and the digestive system. In preferred embodiments, the secretion is saliva or gastrointestinal secretion. Alternatively, this method can use any body fluid that contains the antibody, such as blood, plasma, serum or urine. Saliva or other mucus secretion can be tested undiluted or diluted with an appropriate diluent (such as distilled water). With increasing sensitivities, dilution may be preferred (particularly when collection devices are used). Antigen preparation for convenience and - preference will be fixed to a solid support. Suitable solid supports include a nitrocellulose membrane, glass or a polymer. The most commonly used polymers for this purpose are cellulose, polyacrylic amide, nylon, polystyrene, polyvinyl chloride or polypropylene, but the invention is not limited thereto. The solid supports may be in the form of strips, tubes, granules, discs or microplates, or any other convenient surface for conducting an immunological test. The antigenic components of Helicobacter pylori useful in this invention can be attached covalently or non-covalently ("passively") to the solid surface. Suitable fixation processes are well known in the art and generally consist of crosslinking, covalent attachment or physical adsorption of the antigen to the solid support. The infection is diagnosed by the present invention and by detecting the formation of a complex between the antibody in a serum or secretion sample and Helicobacter pylori antigens. In this particular case, the antigen preparation of Helicobacter pylori is depleted of antigens from 18 to 19 and from 24 to 25 kDa. This is achieved by the depletion of all antigens less than 30 kDa. Some form of detection means is necessary to identify the presence (or, if required, the amount) of the antibody-A antigen complex. The detection means may be a second antibody, conjugated to a reporter molecule, and which is specific for at least part of the class of antibody specific for Helicobacter pylori found in the secretion.

'"* ELISA (enzyme-linked immunosorbent assay) Immunological tests such as the immunofluorescence test (IFA), the enzyme-linked enzyme-linked immunosorbent assay (ELISA) and immunoblotting can be easily adapted to carry out the detection of the antigen. The ELISA method effective for the detection of the antigen can be, for example, as follows: (1) fixing the antigen to a substrate, - (2) contacting the bound antigen with a fluid or tissue sample containing the antibody; (3) contacting the foregoing with a secondary antibody bound to a detectable portion (e.g., the horseradish peroxidase enzyme or the alkaline phosphatase enzyme); (4) contacting the above with the substrate for the enzyme (5) contact the above with a colored reagent; (6) observe the color change.The above method can be easily modified to detect the antibody as well as the antigen. fico of an ELISA of the present invention is provided in Example 5.

Microagglutination test A microagglutination test can also be used to detect the presence of antibodies to Helicobacter pylori in a subject. Briefly, latex granules (or red blood cells) are coated with the antigen and mixed with a sample from the subject, such that antibodies in the tissue or body fluids that are specifically reactive with the antigen are cross-linked with the antigen, causing agglutination. The agglutinated antigen-antibody complexes form a precipitate, visible to the naked eye or by spectrophotometry. In a modification of the previous test, antibodies specifically reactive with the antigen can be fixed to the granules and by this the antigen is detected in the tissue or body fluid.

Other Systems In the diagnostic methods shown herein, the antigen can be fixed to a substrate and contacted by a fluid sample such as serum, urine, saliva or gastric juice. This sample can be taken directly from the patient or in partially purified form. In this way, antibodies specific for the antigen (the primary antibody) react specifically with the fixed antigen. Therefore, a secondary antibody bound to, or labeled with, a detectable portion can be added to increase detection of the primary antibody. Usually, the secondary antibody or another ligand that is reactive, either specifically with an epitope different from an antigen or not specifically with the ligand or reactivated antibody, will be selected for its ability to react with multiple sites on the primary antibody. Thus, for example, several molecules of the secondary antibody can react with each primary antibody, making the primary antibody more detectable. This system using depleted Helicobacter pylori antigen of 18 to 25 kDa proteins can use any substrate to fix the antigen preparation and can use any detectable portion to detect the primary antibody.

'Detectable Portions The detectable portion will allow visual detection of a precipitate or color change, visual detection by microscope, or automated detection by spectrometry, radiometric measurement or the like. Examples of detectable portions include fluorescein and rhodamine (for fluorescence microscopy), horseradish peroxidase (for light or electronic microscopy and detection • - "biochemistry", biotin-streptavidin (for light or electronic microscopy) and alkaline phosphatase (for biochemical detection by color change and immune gold.) Detection methods and portions used can be selected, for example, from the above list or other convenient examples by the standard criteria applied to these selections Conventionally, the antigen used is either a mixture of bacterial proteins or a bacterial protein ~ "purified for which there are antibodies circulated and secreted in the infected individual.The detection of these antibodies therefore denotes infection or exposure to the infectious agent.In the case of Helicobacter pylori, we have shown that individuals not infected with the organism have antibodies to one or both of the two specific protein species of Helicobacter pylori, therefore, removal of these species from the antigen mixture used for detection means the removal of a significant source of error to determine the infection active with Helicobacter protein It is another object of the present invention to increase the discriminatory power of the ELISA test to search for Helicobacter pylori by generating protein preparations of Helicobacter pylori for use in ELISA tests from which the 18 kDa protein has been removed. The removal of a strongly immunogenic antigen for which they are present - * - "* antibodies in individuals negative for Helicobacter pylori should increase the discriminatory capabilities of the ELISA to identify persons with active infection It is also an object of the present invention to increase the discriminatory power of the ELISA when looking to generate protein preparations of Heli cobacter pylori for use in ELISA tests in which the 18 kDa protein and other antigens have been removed for which immunoreactivity is detected in individuals negative for Helicobacter pylori The removal of a strongly immunogenic antigen for which antibodies are present in negative individuals Helicobacter pylori should increase the discriminatory capabilities of the ELISA to identify persons with active infection It is an object of the present invention to provide other purified proteins of Helicobacter pylori for which constituent antibodies are detected in individuals negative for Helicobacter p It is also an object of the present patent to provide a preparation of Heli cobacter pylori proteins from which proteins below 30 kDa have been removed as the basis of immunological tests to search Helicobacter pylori. We have developed a novel test for the detection of antibodies to Helicobacter pylori. This test uses Western staining and Enhanced Chemiluminescence (ECL). Using this test we have shown that approximately 75 percent of individuals who are negative for Helicobacter pylori by routine tests such as the rapid urease test have indeed had detectable antibodies to Heli cobacter pylori (Figure 1). In addition, these antibodies are not absorbed by C. j ej uni nor by E. coli suggesting that this is a specific antibody response (Figure 2). From particular observations we have made the characterization of the antigens recognized by these antibodies1 by molecular weight, using western staining Enhanced Chemiluminescence. Serum from uninfected individuals recognizes a range of Helicobacter pylori antigens . The most common recognized antigen is a 25 kDa protein that is recognized in more than 70 percent of individuals that are negative for the body in rapid urease test. Therefore this suggests that the 25 kDa protein may be an immunodominant antigen that evokes a powerful immune response in individuals that are negative for the organism. A second protein was identified in 18 kDa which obtained significant antibody responses in children negative for Helicobacter pylori.

SECTION OF METHODS The methods used in the identification and partial purification of two novel antigens for Heli coba cter pyl orí. Methods Western staining. SDS-PAGE gels proteins (30 percent T / 2.67 percent C) were electro-tapped (0.8 mA / square centimeter for 1 hour) to the PVDF membrane using a semi-dry spotting apparatus (LKB-Pharmacia). Primary antibodies were detected (human serum, dilution of 1/50 to 1/100) using a 1 / 5,000 dilution of anti-human IgG (Conjugated horseradish peroxidase) in combination with improved chemiluminescence (see below). The spots were washed in phosphate buffered saline (pH 7.5) containing nonfat dry skim milk (5 percent, weight / volume) and Tween-20 (0.05 percent, volume / volume). The spots were exposed to Kodak X-OMAT S film for 1 to 10 seconds. The exposed films were developed in a Kodak LX-24 developer and fixed in a Kodak dental X-ray fixator. Enhanced Chemiluminescence (ECL) The use of chemiluminescence to detect antibodies in Western blotting over conventional methods of using chromogenic substrates as detection reagents was adopted primarily because of the reported gain in detection sensitivity - "'/ (approximately 10 times) over that found when chromogens are used: Oxidized luminol emits visible light and the intensity of this light emission is increased 1000 times in the presence of chemical enhancers (eg iodophenol). it is described immediately: Substrate Concentration / Amount Luminol 1.2 mM (in 0.1 M-Tris (50 ml), pH 8.8) 4-Iodophenol 0.4 mM (dissolved in DMSO before use) Hydrogen peroxide 17 μl of a solution at 30 percent (volume / volume ) The spots were incubated in the above mixture for one minute and then exposed to X-ray film as described above.

Partial purification of 18 and 25 kDa proteins Both proteins were partially purified from whole Helicobacter pylori based on molecular weight (Figure 2) using polyacrylic amide gel electrophoresis by sodium dodecyl sulfate continuous elution preparation (SDS- PAGE) in a Model 491 Prep-Cell from (BioRad). This method allows the quantitative purification of amounts of protein preparation in a soluble form. Purification method 25 milligrams of Heli cobacter pylori were precipitated with ice-cold acetone, washed once in acetone and the precipitate was solubilized in 3.8 milliliters of sample buffer by sodium dodecyl sulfate polyacrylic amide gel electrophoresis (SDS-PAGE) (62 nM Tris, pH 6.8, glycerol (10 percent, volume / volume), sodium dodecyl sulfate (2 percent, volume / volume), 2-mercapto-ethanol (5 percent, volume / volume), blue of bromophenol (o.002 percent, volume / volume) The published electrophoretic procedures, with very small modifications, were followed through the preparation of the sample Loading: The protein mixture, in sample regulator, was loaded on a polyacrylic amide tube gel at 12.5 percent (30 percent 1/2, 61 percent C) The dimensions of the tube gel were: 28 millimeters internal diameter, top surface 3.6 square centimeters, gel stacked 2 centimeters, g the resolution 10 centimeters. _v Operating conditions: Electrophoresis was performed at 40 mA (constant current) overnight at room temperature. Fractions (1 milliliter) were collected at 0.1 milliliter / minute. Samples of each fraction (5 μl) were subjected to polyacrylic amide gel electrophoresis by analytical SDS-PAGE sodium dodecyl sulfate to assess the parity and antigenicity of each protein. Each fraction within the '•' ._ region of molecular mass of interest was screened by both polyacrylic amide gel electrophoresis by sulphate sodium dodecyl SDS-PAGE (to assess purity) as Western staining (to assess antigenicity) in an attempt to isolate and characterize individual immunogenic proteins. The resolution of this technique is such that pure preparations of proteins alone can be achieved once the optimal electrophoresis conditions have been established. Preliminary optimization protocols involve electrophoresis of Hel i cobacter pylori protein mixtures under conditions designed to favor high resolution of low molecular weight proteins. The final electrophoretic conditions used to achieve partial purification of the selected proteins are detailed in the Methods section. Using these exact conditions the 18 kDa proteins eluted between 11-14 milliliters and the 25 kDa protein eluted within 16-20 milliliters. The '_. • Molecular weights of the proteins were determined by polyacrylic amide gel electrophoresis by analytical sodium dodecyl sulfate using a range of low molecular weight marker proteins (range: 14.5 kDa - 66 kDa; code: sigma SDS-7) and Western blotting confirmed that these proteins were the immunogens of interest. Figure 1 shows Western blot analysis of the antibody response to Helicobacter pylori in individuals negative for Helicobacter pylori in rapid urease test. Western blotting was performed as previously described using an improved chemiluminescence detection system. Antibodies to a large range of Helicobacter pylori proteins were seen in individuals that are negative for Helicobacter pylori in rapid urease test. The most common antigen for which an antibody with 25 kDa protein was detected. Figure 3 shows a gel elution profile for sodium dodecyl sulfate of the 25 kDa and 18 kDa proteins.

Detailed Description Material and Material Methods. All antibodies were obtained in Dako LTD., High Wycome, Bucks, United Kingdom. All other chemicals and solvents were obtained either from Sigma Chemical Company Ltd., Poole, Dorset, United Kingdom or BDH Chemicals Ltd., Poole, Dorset, United Kingdom. Electrophoresis of polyacrylic amide gel by sodium dodecyl sulphate (SDS-PAGE). Dispersed sodium dodecyl sulfate polyacrylic gel electrophoresis was performed essentially as described by Laemmli (1970) 18. A total of 5 milligrams of Helicobacter pylori precipitated in acetone is placed in each '"'" "well: The gels were either stained with Coomassie Blue R-250 or processed for immune staining, and wide-range molecular weight markers were purchased on BioRad.

Laboratories, 3300 Regatta Blvd., Richmond, CA 94804. Molecular masses were expressed as kDa.

Western stained. Gel proteins of amide gel electrophoresis ~ f > polyacrylic by sodium dodecyl sulfate (30 percent T / 2. 67 percent C) were electro-tapped (0.8 mA / square centimeter for 1 hour) to the PVDF membrane using a semi-dry spotting apparatus (LKB-Pharmacia), essentially as described by Towbin et al. (1979). Primary antibodies (human serum, 1/50 to 1/100 dilution) were detected using a 1/5000 dilution of antihuman IgG (conjugated horseradish peroxidase) in combination with enhanced chemiluminescence. The spots were washed in phosphate buffered saline (pH 7.5) containing nonfat dry skim milk (5 percent, weight / volume) and Tween-20 (0.05 percent, volume / volume). The spots were exposed to Kodak X-OMAT S film for 10 seconds. The exposed films were developed in a Kodak LX-24 developer and fixed in a Kodak dental X-ray fixator.

Serums Sera samples were obtained at the Research Center, Our Ladies Hospital for Sick Children, Crumlin, Dublin. all subjects were treated for medical conditions different from gastroenterological disorders. In addition, blood samples were obtained from a randomly selected human group (Harcourt Street Childrens Hospital, Dublin) or from adults attending the gastroenterology unit at St. James' s Hospital, Dublin. To all "* _ Patients underwent a rapid urease test (test CLO). Patients were defined as positive or negative for n based on positive or negative responses in the rapid urease test.

Anti-fíelicobacter oylori antiserum The anti-Helicobacter pylori antiserum was a kind donation from Prof. B. Drumm and Dr. M. Clyne. The antiserum was cultured in white mice from New Zealand against complete Helicobacter pylori using standard immunization and booster procedures.

Protein measurements. Protein was measured by the method of Markwell et al. (1978) 19 with bovine serum albumin as the protein standard.

Absorption of sera The antisera were either absorbed with E. coli or C. j uni by incubating a suspension of the bacteria with patient sera for 2 hours at room temperature with gentle mixing. Bacteria were removed from the suspension by centrifugation (12,000 x g, 3 minutes). '_ Bacterial strains and culture conditions The clinical isolates of Heli cobacter pylori used in this study were isolated from antral biopsies obtained from patients attending the gastroenterology clinic at St. James' s Hospital, Dublin. Heli cobacter pylori was cultured under microaerophilic conditions for 4 days on 7 percent horse blood agar used at 37 ° C. The cells were harvested in ice-cold phosphate buffered saline (pH 7.5) containing PMSF (1 mM, EDTA (1 mM), and leupeptin (50 μg / milliliter) .The cells were washed twice by centrifugation (10,000 xg, 5 ml). minutes, 4 ° C) in this regulator before use C. jej uni was a clinical isolate of stool in a patient with C. jejuni enteritis and was cultured for two days exactly as described above with the exception that the incubation temperature was 42 ° C. The E. coli strain used in this study is commercially available (Gibco) and was , 'kindly provided by Dr. Ciaran Cronin, Department of Pharmacology, University College Dublin.

EXAMPLE 1 Adults negative for CLO A group of sera from 19 adults was analyzed to look for IgG anti-Heli cobacter pylori antibodies. Each of these subjects was negative for CLO, although 83 percent had detectable antibodies (IgG) for Helicobacter pylori (Figure 1). Taken together, these data suggest extensive previous contact with Heli cobacter pylori. The most common antigen for which the antibody was detected was a 25 kDa species.

Children negative for CLO The systemic humoral immune response (IgG) for Helicobacter pylori was studied in two groups of children as well. None of these subjects had received any form of anti-HelicoJacter pylori therapy. However, in almost all cases the children had a specific antibody response for Heli cobacter pylori. The first studies of the human group consisted of twenty children (age range: 4-15 years), negative for Helicobacter pylori in the CLO test. Of these, 75 percent had detectable IgG antibodies to Helicobacter pylori (Figure 4). The second group of children (n = 20) were .A asymptomatic and presented at the hospital with diseases other than gastrointestinal disorders. Although (note only 18/20 analyzed there) 13/18 (72 percent) had detectable IgG antibodies to several specific antigens of Helicobacter pylori. However, from the intensity of the response the data suggest that the antibody response is more likely due to the previous contact with the bacteria, when compared to the response "" ^ considerably stronger observed with individuals positive for Heli cobacter pylori.

EXAMPLE 2 Cross reactivity with other bacteria As many bacteria share common antigenic determinants, we examined the degree of cross-reactivity between Helicobacter pylori and the closely related C. jej uni, in addition to E. coli, using two complementary approaches. First, the ability of the anti-Helicobacter pylori polyclonal antiserum to recognize antigens in both C. jej uni and E. coli was examined by Western blotting (Figure 2). The anti-Helico acter pylori antiserum recognized several antigenic determinants in both E. coli and C. jej uni. specifically, the antiserum recognizes proteins of molecular mass 72, 50, 40, 36, and 25 kDa in C. jej uni and '' proteins of molecular mass 200, 116, 45, and 38 kDa in E. coli (Figure 5). Of these, only 3 proteins (70, 25 kDa of C. jej uni and 200 kDa of E. coli) show pronounced cross-reactivity with anti-Helicobacter pylori antiserum. Therefore, the cross-reactivity observed clearly is not extensive. Second, the absorption experiments showed that this cross-reactive antigen recognition was of minor importance. Serum samples absorbed with clinical isolates of Helicobacter pylori and C. jej uni in addition to a commercially available strain of E. coli demonstrated that the seroreactivity could be eliminated by absorbing with Heli cobacter pylori but not with C. j ej uni or E. coli (Figure 2). Figure 2 is a representative experiment. Absorption studies were carried out in approximately half of the serum samples analyzed in this study with results similar to those shown. The 18 and 25 kDa proteins were also detected in the Reference Strains of Helicobacter pylori NTCC 11637 and 11638 in addition to all the clinical strains tested. Having partially purified the 26-26 kDa protein by continuous elution preparation electrophoresis as shown in Figure 3, we confirmed the antigenicity of the 24-26 kDa protein by testing a Western blot of protein 24-26 purified with serum from a protein. uninfected individual (Figure 6). The example shown in Figure 6 is a representative experiment where the spot was incubated with the serum of an individual not infected with Helicobacter pylori. Clearly, this serum sample contains antibodies that specifically recognize the 24-26 kDa protein and furthermore, the results of this experiment demonstrate that the antigen preparation is highly enriched for this protein and that no other immunogenic protein is present in this preparation. We have obtained similar results with the 18-20 kDa protein.

EXAMPLE 3 Biotinylation of whole intact Helicobacter pylori Heli cobacter pylori cultured on agar in phosphate buffer saline (pH 7.3) was harvested and washed twice in this regulator before biotinylation of proteins exposed on the surface. Bacteria were re-suspended (approximately 2 milligrams / milliliter) in phosphate buffer (1 milliliter) and preheated to 37 ° C. After this, biotin-X-NHS (sulfosuccinimidyl-6 (biotinamido) hexanoate; Calbiochem) was added at a final concentration of 1 mM and prepared immediately before use. After mixing for 10 minutes at 37 ° C, the labeling reaction was terminated by the addition of 1.5 M Tris-Cl (pH 8) to a final concentration of 10 mM. The suspension was washed three times by centrifugation (10,000 -, g, l minute) in ice-cold phosphate buffer. The examination of the bacteria by light microscopy after the labeling and washing procedures showed that the cells were still intact with motility.

Analysis of biotinylated proteins Biotinylated Helicobacter pylori was subjected to both analytical and preparation SDS-PAGE, followed by Western staining, to identify biotinylated proteins. Western blots were developed with Extravidin-peroxidase (Sigma). The extensive incorporation of the biotin ester into the Heli cobacter pylori proteins was observed (Figure 7). Furthermore, it is clear from this figure that the proteins in the 18-24 kDa region are biotinylated as well as several other proteins (Table 1), indicating that these proteins are present on the surface of the bacteria.

Table 1 Biotinylated Protein Apparent molecular weight 1 13, 800 2 15,600 3 16,600 4 * 17,700 5 20,500 6 * 23,500 7 26,400 ELISA for the detection of anti-Heli cobacter pylori antibody using two different antigen preparations for Helicojbacter pylori. Methods: The NTCC 11637 strain of Helicobacter pylori was cultured for 3 days on 7 percent horse blood agar used at 37 ° C (at least 20 trays). The bacteria were harvested in distilled water (1 milliliter / tray). The bacteria were washed three times by centrifugation at 3,000 revolutions per minute for 15 minutes at 4 ° C. The sediment was resuspended in distilled water (1: 2 volume / volume). The cell suspension was sonified on ice using 6 x 15 s 100 Watt pulses, with cooling intervals of 30 seconds between them, using a Soniprobe DAWE 7532A. The cell suspension was centrifuged at 2,500 revolutions per minute for 40 minutes. The supernatant was removed and the protein content was estimated. A final protein concentration of 5 μg / milliliter is required for the test. The Helicobacter pylori antigens were purified in polyacrylic amide gel electrophoresis by sodium dodecyl sulfate and the protein having a molecular weight of less than 30 kDa was removed. A final concentration of 5 μg / milliliter is required for the test. Both antigenic preparations were aliquoted and stored at -70 ° C until required. Heli cobacter pylori antigens were diluted with bicarbonate buffer and 100 μl of diluted antigens were dosed in each well of 96 well flat bottom trays respectively. The trays were incubated overnight in a humid environment at 4 ° C. Patient sera and control sera were diluted 1/400. The trays were then washed three times using phosphate-regulating saline-Tween 20 just before the addition of the serum. 100 μl of diluted serum was added in the first and second rows and mixed gently twice in the second rows. Each test was titrated, thus double dilutions were made from row B to row D.

The trays were incubated at 37 ° C for 60 minutes. The trays were then washed three times using phosphate-Tween buffer 20. Rabbit antihuman immunoglobulin conjugated with peroxidase was diluted with incubation buffer (1: 2000). 200 μl of diluted conjugate was added to each well. The trays were incubated at 37 ° C for 30 minutes. The trays were washed three times with Phosphate-Tween 20 buffer saline. The new substrate (o-phenylenediamena-OPD) was prepared before use and protected from light. 200 μl of diluted substrate was dispersed in each well. The trays were protected from light and left at room temperature for 15 minutes. The reaction was terminated by the addition of H2SO4 (50 μl) and read at a wavelength of 492 nm. An absorbance of 0.5 was used at the dilution of 1/400 as the cut-off point.

EXAMPLE 4 - Immunological test An example is provided in which the depletion of the 25 and 19 kDa proteins, in this case by removing proteins less than 30 kDa, resulted in an improved specificity of immunological tests of Helicobacter pylori. The positivity or negativity for Helicobacter pylori was defined in this case by results of the CLO test that have a correlation of approximately 90 percent with the bacterial culture performed on histological specimens. The use of protein preparations depleted of proteins with less than 30 kDa allowed a significantly increased specificity for the test without influencing sensitivity.

Table 1 The levels of anti-Helicobacter pylori IgG antibodies in patients with positive or negative individuals in the "CLO" test. IgG levels were measured by the Helicobacter pylori antigen from the whole bacteria. Patients were designated as positive Helicobacter pylori based on the "CLO" test. 10/42 HP + ve 32/42 HP-ve in test "CLO" in test "CLO" Serology + ve 10/10 (100%) 12/32 (38%) Serology-ve 0/10 20/32 (62 %) Table 2 Levels of anti-Helicobacter pylori IgG antibodies in patients with positive or negative individuals in the "CLO" test. IgG levels were measured for the Heli cobacter pylori antigen from protein greater than 30 kDa. Patients were designated as Heli cobacter pylori positive based on the "CLO" test. /42 HP + ve 32/42 HP-ve in test "CLO" in test "CLO" Serology + ve 10/10 (100%) 6/32 (13%) Serology-go 0/10 28/32 (87 %) It will be appreciated that although we have referred to a molecular mass of 24 to 25 kDa and 18 to 19 kDa, the molecular mass can fall in the range of 24-26 kDa and 17-19 kDa. IG Partial sequencing of the two antigens of Helicobacter pylori Analysis of N-terminal sequence 15 Purified proteins of 18 and 24 kDa were electro-induced for PVDF and ProBlott, respectively, from gels of - "polyacrylic amide at 12.5 percent. The proteins were located on membranes staining with 0.1 percent black amido (in 1 percent acetic acid, 40 percent potassium methanol) for 15 seconds followed by spotting in several changes of deionized distilled water. The membranes were air dried completely and subjected to sequence analysis using the Edman degradation procedure as described by Matsudaira (1989) 20. The N-terminal amino acid sequence of the r '25 and 18 kDa protein is given in the identification sequences numbers 1 and 2 respectively.

Peptide mapping The method of peptide mapping by N-chlorosuccinimide from Lischwe and Ochs was used with small modifications (1982) 21. The bands of interest were placed on polyacrylic amide gel electrophoresis gel by sodium dodecyl sulfate (12.5 percent T) by briefly staining the gel with 0.1 percent Coomassie Blue R250 (in 50 percent methanol, 10 percent acetic acid) and then sliced with a scalpel blade. The proteins present in the gel slices were digested with N-chlorosuccinimide (15 mM) in acetic acid / urea / water (1: 1: 1, volume / weight / volume) for 30 minutes at 20 ° C. The treated gel slices were then washed with several water changes and equilibrated with polyacrylic amide gel electrophoresis sample buffer by sodium dodecyl sulfate exactly as described by Lischwe and Ochs. finally, the gel slices were placed in the 15 percent polyacrylic amide gel sample wells and subjected to electrophoresis. After electrophoresis, the separated peptides were transferred to either PVDF or ProBlott by Western blotting. Peptides were visualized by staining the membrane with black amido in acetic acid (1 percent) and methanol (40 percent). After extensive washing with water, the peptides were subjected to sequencing without any other modification. Mercaptoacetic acid (2 mM) was included in the upper electrode regulator during the electrophoretic procedures of polyacrylic amide gel electrophoresis by sodium dodecyl sulfate. This mobile thiol behaves as a free radical scavenger and thus avoids blocking N. The amino acid sequences for internal peptides from the 18 and 25 kDa proteins are given in identification sequence numbers 3 and 4, respectively.

Extraction of chromosomal DNA from Helicobacter pylori Chromosomal DNA was extracted as described (Silhavy et al., 1984. Experiments with gene fusions - 'J [Experiments with gene fusions] C.S.H. publications). Amplification of the 18-19 kDa protein gene sequence using degenerate primers. The degenerate DNA sequence was deduced from the amino acid sequences listed in sequence identification numbers 2 and 3. Four degenerate primers were designated from these sequences, to allow a polymerase chain reaction (PCR), nested , of two stages. Eagl enzyme restriction sites were constructed in each primer, allowing subsequent cloning of the fragment. When three or more bases were possible somewhere, inosine was incorporated instead of all possible bases, except when these sites were four bases or less of the 3 'terminal primers (3 prime), in which case all the bases were included. possible bases. Inosine was also avoided in positions immediately adjacent to the Eagl sites. Degenerate primers for the pl8 gene: 1. GAARA CGGCC GARAT IYTIA ARCAY YTICA RGC 2. TCYTC GGCCG TYTCY TCIGT NGCY 3. RATIY TCGGC CGYYI CARGC IGAYG C 4. ATYTC GGCCG TIGCY TTRTG NAC Genomic DNA for the protein p18 gene of 18- 19 kDa was amplified as follows using the external set of primers (primers 1 &2): the samples were heated to 94"A.C degrees for 3 minutes to denature the DNA, followed by 35 cycles of 94 degrees C for 30 seconds, 56 degrees C for 40 seconds and 72 degrees C for 30 seconds." 100 pmol of each primer was used in the presence of 2.5 mM of MgCl2 and 0.2 mM dNTPs, in a reaction volume of 50 ul. 1 ul of this reaction was used as the subtracted for the reaction 'nested' This reaction was the same as that indicated for the previous reaction, except that the internal primers (primers 3 and 4) were replaced by the external primers, and a concentration of 2.0 mM MgCl2 was used. Electrophoresis of the reaction products resulted in a clearly visible band on a 2 percent agarose gel, estimated at approximately 120 base pairs in size (judged by a molecular size scale).

Sequencing of the simplified DNA sequence. The nested polymerase chain reaction fragment corresponding to the 18-19 kDa protein gene was cloned by digesting the fragment with Eagl and ligating this at the unique Eagl site in the Bluescript vector (Stratagene [stratum gene]). E.coli cells were transformed (according to standard procedures) and plasmid DNA was harvested using the alkaline lysis method (Sambrook et al., 1989. Molecular cloning: A laboratory manual 2nd Ed., CSH publications) followed by a RNase digestion step, 'r' extraction and precipitation of phenol / chloroform using 2.5 M ammonium acetate and 2 volumes of ethanol Two independent isolates of plasmids were sequenced using universal forward and reverse sequencing primers The inserted DNA derived from the pl8 gene was sequenced In the forward and reverse orientations, sequencing was performed using an ABI automatic sequencer and a sequencer termini sequencing kit of fluorescent dedeoxi chain based on the Genpak PCR polymerase chain reaction. The internal polymerase chain reaction primers are: GATCGTGTTATTTATGAAAGTGC? TAACTTCCATTGGAATGTGAAAGGCAC- CGATTTTTTCAAT This base sequence is translated into the amino acid sequence listed in the identification sequence no.

. - "- 'This sequence (Identification sequence number 5) overlaps both the N-terminal amino acid sequence of the 18 kDa protein listed in identification sequence number 2 and the internal amino acid sequence of the 18 kDa protein enlisted in sequence number 3, to give the enlarged N-terminal amino acid sequence listed in the identification sequence number 6. Many variations in the specific embodiments described will become readily apparent and in accordance with the foregoing the invention is not limited by the embodiments described hereinabove which can be varied in detail.

REFERENCE LIST 1. Marshall, B.J. and Warren, J.R. (1984). Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. (Curved bacillus not identified in the stomach of patients with gastritis and peptic ulceration). Lancet 1, 1311-1314. 2. Blaser M.J. (1990) . Helicobacter pylori and the pathogenesis of gastrodudodenal inflammation. (Helicobacter pylori and the pathogenesis of gastroduodenal inflammation). J. Infect. Dis. 161, 626-633. 3. Rauws, E.A.J. and Tytgat, G.N.J. (1990). Eradication of Helicobacter pylori cures duodenal ulcer (Eradication of Helicobacter pylori cures duodenal ulcer): Lancet 1, 1233-1235. 4. Lambert, J.R., Borromeo, M., Pinkard, K.J., Turner, H., Chapman, C.B., and Smith, M.L. (1987). Colonization of gnotobiotic pigs with Campylobacter pylori - an animal model? (Colonization of gnotobiotic pigs with Campylobacter pylori - an animal model) J. Infect. Dis. 155, 1344. 5. Marshall, B.J., Armstrong, J.A., McGechie, D.B., and Glancy, R.J. (1985). Attempt to fulfil Koch's postulates for pyloric Campylobacter. (Attempt to meet Koch's postulates for Campylobacter pylori). Med. J. Aust. 142, 436-439. 6. Morris, A. and Nicholson, G. (1987). Ingestion of Campylobacter pylori causes gastritis and raises fasting gastric pH. (Ingestion of Campylobacter pylori causes gastritis and elevates gastric pH on an empty stomach) Am. J. Gastroenterol. 82, 192-199. 7. Jiang, S.J., Liu, W.Z., Zhang, D.Z., Shi, Y., Xiao, S.D., Zhang, Z.N., and Liu, D.Y. (1987). Campylobacter- like organisms in chronic gastritis, peptic ulcer and gastric • * - carcinoma. (Organisms similar to Campylobacter in chronic gastritis, peptic ulcer and gastric carcinoma). Scand. J. Gastroenterol. 22, 553-558. 8. Lambert, J.R., Dunn, K.A., Eaves, E.R., Korman, M.G., and Hansky, J. (1986). Campylobacter pyloridis in diseases of the human upper gastrointestinal tract. (Campylobacter pyloris in diseases of the human upper gastrointestinal tract). Gas troenterology 90, 1509. A 9. Crabtree, J.E., Figure, N., Taylor, J.D., Bugnoli, M., Armellini, D., and Tompkins, D.S. (1992).

Expression of 120 kDa protein and cytotoxicity in Heli cobacter pylori. (Expression of the 120 kDa protein and cytotoxicity in Heli cobacter pylori). J. Clin. Pathol. 45, 733-734. 10. Crabtree, J.E., Wyatt, J.I., Sóbala, G.M., Miller, G., Tompkins, D.S., Primrose, J.N., and Morgan, A.G. (1993). Systemic and mucosal humoral responses to Heli cobacter pylori in gastric cancer. (Systemic and humoral mucosal responses to Helicobacter pylori in gastric cancer, Gut 34, 1339-1343 11. Forman, D., Sitas, F., and Newell, DG (1990) Geographic association of Helicobacter pylori antibody prevalence and gastric cancer mortality in rural China. (Geographical association of the prevalence of antibodies to Helicobacter pylori and mortality from gastric cancer in rural China.) Int. J. Cancer 46, 608-611. * -v 12. Forman, D., Newell , DG, Fullerton, F., Yarnell, JWG, Stacey, AR, Wald, N., and Sitas, F. (1991) Association between infection with Heli cobacter pylori and risk of gastric cancer: evidence from a prospective investigation between infection with Heli cobacter pylori and risk of gastric cancer: evidence from a prospective investigation.) BMJ 302, 1302-1305 13. Nomura, A., Stemmermann, GN, Chyou, PH., Kato, I., Perez- Perez, G.I1, and Blaser, MJ (1991) Helicobacter pylori infection and gastric carcinoma amongst J apanese Americans in Hawaii. (Heli-Cobacter pylori infection and gastric carcinoma among Japanese-Americans in Hawaii), N. Engl. J. Med. 325, 1132-1136. 14. Parsonnet, J., Friedman, G.D., Vandersteen, D.P., Chang, Y., Vogelman, J.H., Orentreich,?. , and Sibley, R.K. (1991). Helicobacter pylori infection and the risk of gastric carcinoma. (Infection with Heli cobacter pylori and the risk of gastric carcinoma). N. Engl. J. Med. 325, 1127-1131. 15. Forman, D. (1993). An international association between Helicobacter pylori infection and gastric cancer. The EUROGAST Study Group. (An international association between Helicobacter pylori infection and gastric cancer, the EUROGAST Study Group). Lancet 341, 1359-1362. 16. Blaser M.J. (1992). Hypothesis on the pathogenesis and natural history of Heli cobacter pylori -induced inflammation. (Hypothesis on the pathogenesis and the natural history of inflammation induced by Heli cobacter pylori). Gastroenterology, 102, 720-727. 17. Taylor, D? and Blaser, M.J. (1991). Epidemiology of Heli cobacter pylori infection. (Epidemiology of Helicobacter pylori infection). Epidemiol. Rev. 13, 42-59. 18. Laemmli, U.K. (1970). Na ture 227, 680-685. 19. Markwell, M.A.K., Haas, S.M., Bieber, L.L. and Tolbert,? .E. (1978) Analyti cal biochemis try, 87, '206-210. 20. Matsudaira, P.T. (1989) A practical guide to protein and peptide purification for microsequencing. (A practical guide for the purification of proteins and peptides for microsequencing). Academic Press, San Diego. 21. Lischwe, M.A. and Ochs, D. (1982). A new method for partical peptide mapping using? -chlorosuccinimide / urea and peptide silver staining in sodium dodecyl sulfate poliacrylamide gels. (A new method for mapping practical peptide using N-chlorosuccinimide / urea and silver staining of the peptide in polyacrylic amide gels by sodium dodecyl sulfate). Analyti cal Biochemistry 127, 453-467.

APPENDIX LIST OF SEQUENCES (1) GENERAL INFORMATION (I) APPLICANT (A) NAME: RICAN LIMITED (B) STREET: 1 STOKES PLACE, (C) CITY: DUBLIN 2, (D) COUNTRY: IRELAND (E) POSTAL CODE: ( F) TELEPHONE: 353-1-2881230 (G) TELEFAX: 353-1-2883439 (II) TITLE OF THE INVENTION: "Preparation of antigen protein and immunological tests of Helicobacter pylori" (III) SEQUENCE NUMBER: 4 (IV) (V) CURRENT APPLICATION DATA: 6 APPLICATION NO. : (2) INFORMATION FOR THE SEQUENCE ID. DO NOT . : '1 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 20 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: (A) ORGANISM: HELICOBACTER PYLORI (XI) DESCRIPTION OF THE SEQUENCE: SEO. ID. DO NOT. 1 Met-Leu-Val -Thr-Lys -Leu-Ala-Pro-Asp-Phe-Lys -Ala-Pro-Ala- 5 10 Val-Leu-Gly-Asn-Asn-Glu 15 (3) INFORMATION FOR THE SEQUENCE ID. DO NOT. : 2 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 20 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: (A) ORGANISM: HELICOBACTER PYLORI ( XI) DESCRIPTION OF THE SEQUENCE: SEO. ID. DO NOT. 2 Met-Lys-Thr-Phe-Glu-Ile-Leu-Lys-His-Leu-Gin-Ala-Asp-Ala-5 10 lie-Val-Leu-Phe-Met-Lys 15 NH2 (4) INFORMATION FOR THE SEQUENCE ID. DO NOT. : 3 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 20 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR _A "(II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: (A) ORGANISM: HELICOBACTER PYLORI (XI) DESCRIPTION OF THE SEQUENCE: SEO ID NO.3 Asn-Val-Lys-Gly-Thr-Asp-Phe-Phe-Asn-Val-His-Lys-Ala-Thr- 5 10 Glu-Glu- Ile-Tyr-Glu-Glu 15 20 (5) INFORMATION FOR SEQUENCE ID. DO NOT. : 4 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 4 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: (A) ORGANISM: HELICOBACTER PYLORI ( XI) DESCRIPTION OF THE SEQUENCE: SEO. ID. DO NOT. 4 Lys-Asp-Thr-Pro (6) INFORMATION FOR SEQUENCE ID. DO NOT. : 5 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 21 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: (A) ORGANISM: HELICOBACTER PYLORI ( XI) DESCRIPTION OF THE SEQUENCE: SEO. ID. DO NOT. 5 lie-Val-Leu-Phe-Met-Lys -Val -His -Asn-Phe-His-Trp-Asn-Val - 5 10 Lys-Gly-Thr-Asp-Phe-Phe-Asn 15 20 (7) INFORMATION FOR THE SEQUENCE ID. DO NOT. : 6 (I) CHARACTERISTICS OF THE SEQUENCE (A) LENGTH: 46 AMINO ACIDS (B) TYPE: AMINO ACID (C) TOPOLOGY: LINEAR (II) TYPE OF MOLECULE: PROTEIN (IV) ORIGINAL SOURCE: - '(A) ORGANISM: HELICOBACTER PYLORI Met-Lys-Thr-Phe-Glu-Ile-Leu-Lys-His-Leu-Gln-Ala-Asp-Ala-5 10 Lie-Val-Leu-Phe-Met-Lys-Val -His-Asn-Phe- His-Trp-Asn-Val - 15 20 25 Lys-Gly-Thr-Asp-Phe-Phe-Asn-Val-His-Lys-Ala-Thr-Glu-Glu- 30 35 40 Ile-Tyr-Glu-Glu 45

Claims (52)

1. A preparation of Helicobacter pylori protein depleted of antigens for Helicobacter pylori for 5 which immunoreactivity is detected in individuals negative for Helicobacter pylori.

2 . A protein preparation of Heli cobacter pylori as claimed in claim 1 wherein the immunoreactivity is based on antibodies. lCT

3. A protein preparation of Heli cobacter pylori as claimed in claim 1 or 2 depleted of Helicobacter pylori antigens characterized by a molecular weight of less than 30 kDa.

4. A preparation of Helicobacter 15 pylori protein as claimed in claim 1 to 3 depleted of Heli cobacter pylori antigens characterized by a molecular weight less than 29 kDa.

5. A protein preparation of Heli cobacter pylori as claimed in claim 1 to 4 exhausted of 20 Heli cobacter pylori antigens characterized by a molecular weight lower than 28 kDa.

6. A protein preparation of Helicobacter pylori as claimed in claims 1 to 5 depleted of Heli cobacter pylori antigens characterized 25 by a molecular weight less than 27 kDa.

7. A protein preparation of Heli cobacter pylori as claimed in any of the preceding claims depleted of antigens characterized by a molecular weight of about 24 to 25 kDa or derivatives or fragments or precursors, or mutants thereof.

8. A protein preparation of Helicobacter pylori as claimed in any of the preceding claims exhausted from antigens characterized by a molecular weight of about 18 to 19 kDa or derivatives or fragments or precursors or mutants thereof.

9. A protein preparation of Hel i cobacter pylori as claimed in any of the preceding claims exhausted from: - (i) antigens characterized by a molecular weight of about 24 to 25 kDa or a derivative or fragment or precursor or mutant of the same, - (ii) antigens characterized by a molecular weight of approximately 18 to 19 kDa or a fragment or precursor or mutant thereof.

10. A protein preparation of Helicobacter pylori as claimed in any of claims 7 to 9 in which the 24 to 25 kDa antigen is further characterized by including an N-terminal amino acid sequence shown in Identification Sequence Number 1 or portions of it.

11. A protein preparation of Helicobacter pylori as claimed in any of claims 7 to 10 in which the 25 kDa antigen is further characterized by including a terminal sequence of internal amino acids shown in Sequence ID Number 4 or portions thereof .

12. A protein preparation of Helicobacter pylori as claimed in claims 8 to 11 in which the 18 to 19 kDa antigen is further characterized by including an N-terminal amino acid sequence shown in Sequence Identification Number 2 or portions thereof

13. A protein preparation of Helicobacter pylori as claimed in claims 8 to 12 in which the 18 to 19 kDa antigen is further characterized by including a terminal amino acid sequence shown in FIG. Sequence of Identification Number 3 or portions thereof.

14. A protein preparation of Heli cobacter pylori as claimed in claim 12 or 13 in which the 18 to 19 kDa antigen is further characterized by including an N-terminal amino acid sequence shown in Identification Sequence Number 6.

15. A protein preparation of Helicobacter pylori as claimed in any of the preceding claims wherein the antigen ee prepares as a glycine extract.

16. A method for detecting the presence of antibodies specific for Helicobacter pylori comprising contacting a test sample with an immunogenically effective amount of a Helicobacter pylori protein preparation of claims 1 to 14 to form, in the presence of said antibodies, detectable amounts of antigen / antibody complex, and then subjecting the complex to detection elements in order to detect the complex.

17. A method as claimed in claim 16 in which the test sample is selected from among whole blood, serum, plasma, urine or a secretion such as gastrointestinal secretion or saliva.

18. A method as claimed in "* - claim 16 or 17 wherein the protein preparation is labeled or fixed on a support.

19. A method as claimed in claim 18 wherein the support is a solid phase support.

20. A method as claimed in claim 19 wherein the support is a polystyrene plate.

21. A method as claimed in claim 19 wherein the support is a strip of nitrocellulose.

22. A method as claimed in any of claims 16 to 21 wherein the element of5 detection is a secondary antibody, conjugated to a reporter molecule, and which is specific for at least part of the antibody specific for Heli cobacter pylori.

23. A method as claimed in claim 22 wherein the reporter molecule is a V. fluorophore or a ligand such as a radio ligand or a gold ligand.

24. A method as claimed in claim 22 wherein the reporter molecule is an enzyme.

25. A method as claimed in claim 24 which includes the addition of a chromogen that __. it is activated by means of the enzyme to produce a change in color or optical density.

26. A method as claimed in claim 25 wherein the enzyme is peroxidase and the chromogen is o-phenylenediamine (OPD).

27. A method as claimed in claim 25 which includes the addition of a non-fluorescent substrate that is activated by the enzyme to produce a 25 fluorescent substrate.

28. A method as claimed in claim 27 in which the enzyme is β-galactosidase and the non-fluorescent substrate is resosufin-β-D-galactopyranoside.

29. A method as claimed in claim 24 which includes the addition of a non-luminescent substrate which is activated by the enzyme to produce a luminescent substrate, typically the substrate is 3- (2'-spiro-adamantan) -4 -methoxy- (3'-phosphoryloxy) phenyl-1, 2- * dioextane and the enzyme is alkaline phosphatase. U

30. A method as claimed in any of claims 16 to 29 wherein the sample is a human sample and the secondary antibody is rabbit anti-human immunoglobulin.

31. A set of tests for detecting the presence of Helicobacter pylori in a sample for testing, the test suite comprising: (a) a solid support having a protein preparation of any of the claims 1 to the 15 immobilized in it; and 0 (b) a detection means which in use detects whether Heli cobacter pylori-specific antibodies in the test sample bind to all or part of the protein preparation.

32. A set of tests as claimed in claim 31 in which the test sample is selected from whole blood, serum, plasma, urine or a secretion such as a gastrointestinal or salivary secretion.

33. A set of tests as claimed in claim 31 or 32 wherein the support is preferably a solid phase support.

34. A set of tests as claimed in claim 33 in which the solid support is a polystyrene plate. , / -.-

35. A set of tests as claimed in claim 33 wherein the solid support is a strip of nitrocellulose.

36. A set of tests as claimed in any of claims 31 to 35 wherein the detection element is a secondary antibody, conjugated to a reporter molecule, and which is specific for at least part of the specific antibody of Helicobacter "* pylori 37.

A set of tests as claimed in claim 36 wherein the reporter molecule is a fluorophore or a ligand such as a radio ligand or a gold ligand 38.

A set of tests as claimed in FIG.

Claim 36 wherein the reporter molecule is an enzyme 39.

A set of tests as claimed in claim 38 which includes a chromogen which, when activated by the enzyme, changes color or optical density. of tests as claimed in claim 39 in which the enzyme is peroxidase and the chromogen is o-phenylenediamena

41. A set of tests as claimed in claim 38 which includes a su non-fluorescent strato, the Which, when activated by the enzyme, becomes fluorescent.

42. A set of tests as claimed in claim 41 in which the enzyme is 6-galactosidase and the non-fluorescent substrate is resosufin-β-D-galactopyranoside.

43. A set of tests as claimed in claim 38 which includes the addition of a non-luminescent substrate which is activated by the enzyme to produce a luminescent substrate, typically the substrate is 3- (2'-spiro-adamantan) -4-methoxy- (3'phosphoryloxy) phenyl-1,2-dioextane and the enzyme is alkaline phosphatase.

44. A set of tests as claimed in claim 31 to 43 in which the sample is a human sample and the secondary antibody is rabbit anti-human immunoglobulin.

45. A method for detecting the presence of antibodies specific for Helicobacter pylori comprising the steps of: - (a) contacting the protein preparation of any of claims 1 to 15 with a convenient support for use in agglutination tests; (b) Incubate the contactants of step (a) with a test sample to form, in the presence of Helicobacter pylori, specific antibodies, antigen-agglutinated antibody complexes. - '

46. A method as claimed in claim 45 in which the support comprises a plurality of latex granules.

47. A method as claimed in claim 46 in which the support comprises red blood cells.

48. A set of tests for detecting the presence of Helicobacter pylori in a test sample, the test set comprising an agglutination test support having the protein preparation of claims 1 to 15 immobilized in the test kit.

49. A set of tests as claimed in claim 47 in which the agglutination test support comprises glass or latex granules or the like

50. A set of tests as claimed in claim 48 in the which support of the agglutination test comprises red blood cells

51. A set of tests as claimed in any of the claims from 48 to 50 which also includes an element for incubating the agglutination test support with a sample No.

52. The use of the preparation of claims 1 to 15 in an immunological test.