MXPA96006544A

MXPA96006544A - Receptors of melatonina of high affinity and susu

Info

Publication number: MXPA96006544A
Application number: MXPA/A/1996/006544A
Authority: MX
Inventors: M Reppert Steven; Ebisawa Takashi
Original assignee: The General Hospital Corporation
Priority date: 1994-06-17
Filing date: 1996-12-17
Publication date: 1999-09-01

Abstract

CDNAs and DNA encoding high affinity melatonin 1a and 1b receptors, and recombinant polypeptides expressed from such cDNAs are disclosed. Recombinant receptor polypeptides, fragments of receptors and analogues expressed on cell surfaces are used in methods for analyzing candidate compounds for their ability to act as agonists or antagonists of the interaction effects between melatonin and high affinity melatonin receptor. Agonists are used as therapeutics to retrain endogenous melatonin rhythms as means to treat circadian rhythm disorders in humans and control reproductive cycles in seasonal mating animals. Antagonists are used as therapeutics to control the onset or synchrony of puberty in humans, antibodies specific for a high affinity melatonin receptor (or receptor or analogous fragment) and their uses as a therapeutic are also disclosed.

Description

HIGH-AFFINITY ATTUNE RECEPTORS AND THEIR USES BACKGROUND OF THE INVENTION The invention relates to nucleic acids and their encoded high affinity melatonin receptor proteins. The high affinity melatonin receptor is a membrane protein that is coupled to binding proteins + 9 ^ - of the guanine nucleotide (G proteins). The G proteins, in turn, communicate ligand-activated receptor signals to the appropriate intracellular system or effect systems. The hormone melatonin inhibits adenylyl cyclase, causing a reduction in the concentration of intracellular cyclic AMP (cAMP). Melatonin, the main hormone of the pineal gland in vertebrates, stimulates potent neurobiological effects. Melatonin exerts influence on the circadian rhythm and mediates the effects of photoperiod on reproductive function in mammals of seasonal reproduction. In humans, it has been shown that the administration of melatonin alleviates the symptoms of so-called "jet lag" after air travel through several time zones. The hormone also has powerful sedative effects in humans and can be a useful hypnotic agent. Melatonin exerts its photoperiodic and circadian effects through high-affinity, pharmacological receptors. specifically (Dubocovich, M.L. and Takahashi, J., PNAS USA (1987) 84: 3916-3920; Vanecek, J., J. Neurochem. (1988) 51: 1436-1440; Reppert et al. (1988) supra). In seasonal mammals, the secretion of pineal melatonin regulates seasonal responses to changes in day length (Bartness, TJ and Goldman, BD Experientia (1989) 48: 939-945; Karsch et al., Recent Proa. Horm Res. (1984) 40: 185-232). The only site that contains receptors is "\ melatonin in all photoperiodic species examined up to date (Weaver et al., Suprachiasmatic nucleus: the mind 's clock; Klein, DC, Moore, RY and Reppert, SM, editors, New York, Oxford University Press (1991), pp. 289-308) is the pars tuberalis (PT), a portion of the pituitary gland.In contrast to other species, melatonin receptors are not present consistently in humans. In the PT, the high affinity melatonin receptors (Melx la) are located in discrete regions of the vertebrate central nervous system of various mammalian species, including humans.Ligation studies using ligand 2- [12SI] - iodomelatonin ( 125I-melatonin or [125I] MEL) have identified high affinity melatonin receptors (Kd less than 2x10"10 M) at sites such as suprachiasmal nuclei (SCN), the site of a biological clock that regulates number the circadian rhythms (Reppert et al., Science (1988) 242: 78-81). Until > W ^. The date, high affinity melatonin receptors have not been identified in tissues of the central nervous system other than the brain. The affinity of receptors is sensitive to guanine nucleotides and activation of the receptors leads consistently to the inhibition of adenylyl cyclase through a mechanism sensitive to pertussis toxin (Rivkees, SA et al., PNAS USA (1989) 86: 3883 -3886; Carlson, LL et al., 'Endocrinoloav (1989) 125: 2670-2676; Morgan, PJ et al., Neuroendocrinoloay (1989) 50: 358-362; Morgan, PJ et al., J. Neuroendocrinol. (1990) 2 : 773-776; Laitinen, JT and Saavedra, JM, Endocrinolocr (1990) 126: 2110-2115). The high affinity melatonin receptors thus appear to belong to the superfamily of G-protein coupled receptors. Compendium of the Invention In general, the invention presents substantially pure DNA (cDNA or genomic DNA) encoding a melatonin receptor-the high affinity in the brain and a melatonin-lb receptor in the retina. The invention also features substantially pure, high affinity melatonin-1 and lb receptive polypeptides. In preferred embodiments, the receptor includes an amino acid sequence substantially identical to the amino acid sequence shown in Figure 1 (SEQ ID NO: 2); figure 2 (SEQ ID NO: 4); Figure 3 (SEQ ID NO: 14); Figure 5 lUk (SEQ ID NO: 12), or comprising the amino acid sequence of Figure 4 (SEQ ID NO: 6) for melatonin receptors la. The invention also presents a new class of melatonin receptor designated melatonin-lb (Mel-Ib) distinguished by its characteristics of tissue distribution and ligation. In preferred embodiments, the Mel-lb receptor includes an amino acid sequence substantially identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: The invention includes a polypeptide having an amino acid sequence that includes a domain capable of binding melatonin and carrying out a reduction in the intracellular concentration of cAMP, and which is at least 80% identical to the amino acid sequence shown in FIGS. -6. The invention also features a substantially pure polypeptide which is a fragment or analogue of a high affinity melatonin-1 or melatonin-lb receptor, and which includes a domain capable of binding melatonin and effecting a reduction in the intracellular concentration of cAMP. . In various preferred embodiments, the receptor or receptor fragment is derived from a vertebrate animal, preferably a human, sheep, mouse or Xenopus laevis. By "high affinity melatonin receptor polypeptide" is meant all or part of a protein of the "14 ^ cell surface of vertebrates that specifically binds melatonin and signals the cascade of appropriate biological events mediated by melatonin (eg, a reduction in the intracellular concentration of cAMP.) The polypeptide is characterized by having ligand binding properties (including agonist and antagonist binding properties) and distribution in tissues described herein. By "polypeptide" is meant any <chain. "A" amino acids, regardless of length or post-translation modification (eg, glycosylation) By "substantially pure" it is meant that the high affinity melatonin receptor polypeptide provided by the invention is at least 60% free by weight of proteins and organic molecules that occur naturally by which it is naturally associated. ia, the preparation is at least 75%, more preferably at least 90%, and with the highest preference at least 99% by weight of the receptor polypeptide.

Wt high affinity melatonin. A substantially pure high affinity melatonin receptor polypeptide can be obtained, for example, by extraction from a natural source; by expression of a recombinant nucleic acid encoding a high affinity melatonin receptor polypeptide, or by chemical synthesis of the protein. The purity can be measured by any suitable method, for example column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.

By "substantially identical" amino acid sequence is meant an amino acid sequence that differs only by conservative amino acid substitutions, for example substitution of one amino acid by another of the same class (eg, valine by glycine, arginine by lysine, etc.). ) or by one or more non-conservative amino acid substitutions, deletions or insertions located at positions of the amino acid sequence that do not destroy the biological activity of the receptor. Such equivalent receptors can be isolated by extraction of the tissues or cells of any animan that is naturally produced by that receptor or that can be induced to do so, using the methods described below, or their equivalent; or they can be isolated by chemical synthesis; or they can be isolated by conventional techniques of recombinant DNA technology, for example by isolation of cDNA or genomic DNA encoding such a receptor. By "derived from" is meant coded by the genome of the organism and present on the surface of a sub¬ * set of body cells. In another related aspect, the invention features isolated DNA encoding a high affinity melatonin-1 or melatonin-lb receptor (or receptor fragment or analogue thereof) described above. Preferably, the purified DNA is cDNA; is cDNA encoding a high affinity melatonin receptor of Xenopus laevis; it is cDNA that encodes a melatonin receptor-the high-affinity lamb; and it is cDNA encoding a melatonin-F receptor-the high-affinity human; and it is cDNA encoding a melatonin-lb receptor of high human affinity. By "isolated DNA" is meant a DNA that is not immediately contiguous (i.e., covalently linked) to both coding sequences to which it is immediately contiguous (i.e., one at the 5 'end and one at the 3' end). ) in the genome that occurs naturally from the organism from which the DNA of the invention is derived. The term includes, therefore, an <; g & Recombinant DNA that is incorporated into a vector; in a plasmid "or virus of autonomous replication, or in the genomic DNA of a prokaryote or eukaryote, or that exists as a separate molecule (eg, a cDNA or a genomic or cDNA fragment produced by PCR digestion or restriction endonuclease ), independent of other sequences, also includes recombinant DNA that is part of a hybrid gene encoding an additional polypeptide sequence. In other related aspects, the invention features vectors containing such isolated DNA and which are preferably capable of directing the expression of the protein encoded by the DNA in a cell containing the vector, and cells containing such vectors (preferably eukaryotic cells, for example CHO cells (ATCC, Cat cells, No. CCL 61 or COS-7, ATCC; Cat. No. CRLL 1651.) Preferably, such cells are stably transfected with such isolated DNA.For "transformed cell" is meant a cell in J ~ which (or in a ncess of which) a DNA molecule encoding a high affinity melatonin receptor (or a fragment or analogue thereof) has been introduced by genetic engineering. Such a DNA molecule is "positioned for expression", meaning that the DNA molecule is positioned adjacent to the DNA sequence that directs the transcription and translation of the sequence (i.e., facilitates the production of the high affinity melatonin receptor protein. , or tt * fragment or analogue thereof). By "specifically ligated", as used herein, is meant an agent, such as melatonin, a melatonin analog or other chemical agent including polypeptides such as an antibody, which binds the high affinity melatonin receptor, receptor polypeptide or fragment or analogue thereof, but which does not substantially bind other molecules in a sample, for example a biological sample, which naturally includes a high affinity melatonin receptor polypeptide. Preferably, the agent activates or inhibits the in vivo biological activity of the protein to which it binds. By "biological activity" is meant the ability of the high affinity melatonin receptor to bind melatonin and signal the appropriate cascade of biological events (as described herein). In yet another aspect, the invention features a method of determining candidate compounds for their ability to act as an agonist of a high affinity melatonin receptor ligand or melatonin-lb. The method involves: a) contacting a candidate agonist compound with a recombinant high affinity melatonin receptor (or fragment or analog that binds melatonin); b) measuring the ligation of the ligand with the receptor, the receptor polypeptide or the receptor fragment or analogue; and c) identifying agonist compounds such as those that bind to the recombinant receptor and trigger a reduction in the intracellular concentration of cAMP. By "agonist" is meant a molecule that mimics a particular activity, in this case the ability of a high affinity melatonin receptor ligand to bind to the high affinity melatonin receptor and trigger the biological events that result from such interaction (for example, the reduced intracellular concentration of cAMP). An agonist may possess higher activity than the naturally occurring high-affinity melatonin receptor ligand. In yet another aspect, the invention features a r * method of determining a candidate compound by its ability to antagonize the interaction between melatonin and a high affinity melatonin receptor. The method involves: a) contacting a candidate antagonist compound with a first compound, which includes a high affinity melatonin receptor, recombinant (or fragment or analog that binds melatonin) on the one hand, and a second compound that includes melatonin, on the other hand; b) determine whether the first and second compounds bind; and c) identifying antagonistic compounds such as those that interfere with ligation of the first compound to the second compound and that reduce melatonin-mediated decreases in the intracellular concentration of cAMP. By "antagonist" is meant a molecule that inhibits a particular activity, in this case the ability of melatonin to interact with a high affinity melatonin receptor and trigger the biological events that result from such an interaction (e.g., a reduced concentration). intracellular 'of cAMP). In preferred embodiments of both methods of determination or analysis, the recombinant, high-affinity melatonin receptor is stably expressed by a mammalian cell that normally does not substantially exhibit high affinity melatonin receptor on its surface (i.e. cell that does not exhibit any significant reduction, mediated by melatonin, in the intracellular reduction of cAMP); the cell of * mammal is a CHO cell or a COS-7 cell; and the candidate antagonist or candidate agonist is an analogue of melatonin or another chemical agent that includes a polypeptide such as an antibody. The receptor proteins of the invention are possibly involved in the control of the circadian rhythm of vertebrates. Such proteins are therefore useful to develop therapies to treat conditions such as "jet lag" (change of biological schedule), facilitate the re-entrainment of some endogenous rhythms of melatonin, synchronize the sleep cycle and disturbed awakening of the blind , relieve sleep disorders in shift workers, facilitate the emergence of a daytime pattern of sleeping and waking in neonates, regulate ovarian cyclicity in human females, control the onset and timing of puberty in humans, and alter the mating cycle in seasonal mating animals such as sheep. The therapies , 1A preferred include 1) agonists, for example melatonin analogues or other compounds that mimic the action of melatonin upon interaction with the high affinity melatonin receptor; and 2) antagonists, for example melatonin analogues, antibodies, or other compounds that block the function of melatonin or the high affinity melatonin receptor by interfering with the melatonin: receptor interaction. A "transgenic animal", as used herein, denotes an animal (such as a non-human mammal) that carries in one or all of its nucleated cells one or more genes derived from a different species (exogenous); if the cells carrying the exogenous gene include cells from the germination line of the animal, the gene can be transmissible to the progeny of the animal. As used herein, genes derived from a different animal species are exogenous genes. Preferably, the exogenous genes include nucleotide sequences that carry out the expression of the gene in its endogenous tissue distribution. Because the receptor component can now be produced by recombinant techniques and because candidate agonists and antagonists can be analyzed using cultured, transformed cells, the present invention provides a simple and practical approach for the identification of useful therapeutic materials. Such an approach was previously difficult, due to the location of the receptor in a few discrete fak regions in the central nervous system of most mammals. Isolation of the high affinity melatonin receptor gene (such as cDNA) allows its expression in a cell type that is not normally carrying high affinity melatonin receptors on its surface, providing a system for testing a melatonin: receptor interaction. Other aspects and advantages of the invention will be apparent from the following description of its preferred embodiments, and from the claims. Detailed Description The drawings will be briefly described first. In the drawings: Figure 1 includes the complete nucleotide and amino acid sequences (SEQ ID NO: 1 and SEQ ID NO: 2, respectively) of the cDNA region encoding the high affinity melatonin receptor gene of Xenopus laevis. The deduced amino acid sequence of the receptor is provided below the nucleotide sequence (reading frame b) and contains 420 amino acids. The deduced amino acid sequence begins at nucleotides 32, 33, 34 (ATG = Met) and ends with nucleotides 1292, 1293, 1294 (TGA = stop). Figure 2 includes the complete nucleotide and amino acid sequences (SEQ ID NO: 3 and SEQ ID NO: 4, respectively) of the region encoding the melatonin receptor gene-the high-affinity lamb, which is a genetic fusion of the Genomic DNA of the 5 'region and cDNA of the 30 region, as * - describe later. The deduced amino acid sequence of the receptor is provided below the nucleotide sequence and contains (reading frame a) 366 amino acids. The deduced amino acid sequence begins at nucleotides 49, 50, 51 (ATG = Met) and ends at nucleotides 1147, 1148, 1149 (TAA = stoppage). Figure 3 includes the complete nucleotide and amino acid sequences (SEQ ID NO: 13 and SEQ ID NO: 14, respectively) of the region encoding the melatonin receptor gene-the high affinity mouse. The deduced amino acid sequence of the receptor is provided below the nucleotide sequence and contains (reading frame a) 353 amino acids. The deduced amino acid sequence starts at nucleotides 1-3 (ATG = Met) and ends at nucleotides 1060-1062 (TAA = stoppage). Figure 4 includes the nucleotide and deduced amino acid sequences (SEQ ID NO: 5 and SEQ ID NO: 6, respectively) of a genomic DNA fragment of the region encoding the human high affinity melatonin receptor gene. The coding sequence corresponds to the region downstream (3 ') of the first intron. From the sequence portion of the receptor DNA, the deduced amino acid sequence is provided below the nucleotide sequence (reading frame a) and contains 288 amino acids. The coding region of the partial sequence begins at nucleotides 1, 2, 3 (GGA = Gly) and ends at nucleotides 865, 866, 867 (TAA = stoppage). Figure 5 includes the complete nucleotide and amino acid sequences (SEQ ID NO: 11 and SEQ ID NO: 12, respectively), of the human high affinity melatonin receptor cDNA. The deduced amino acid sequence of the receptor is provided below the nucleotide sequence (reading frame c) starting at nucleotides 33-35 (ATG = Met) and contains 350 amino acids ending in the nucleotides 1083-1085 (TAA = stoppage) . Figure 6 includes the complete nucleotide and amino acid sequences (SEQ ID NO: 15 and SEQ ID NO: 16, respectively) of the human high affinity melatonin-Ib receptor cDNA. The deduced amino acid sequence of the receptor is provided below the nucleotide sequence (reading frame a) starting at nucleotides 13-15 (ATG = Met), ending at nucleotides 1096-1098 (TAA = stop) and contains 362 amino acids . Figure 7 shows the alignment of the deduced amino acid sequences (SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 6, respectively), and the hydrophobic regions (Tables I-VII) of the melatonin receptors of high human partial affinity, and complete of Xenopus and lamb. Figure 8 shows the alignment of the deduced amino acid sequences (SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 12, respectively) and the hydrophobic regions (which are presumed to be the transmembrane I-VII domains emphasized by solid bars) of high affinity melatonin receptors complete with Xenopus and lamb, and partial human. Figure 9 is the proposed structure of the high affinity melatonin receptor of Xenopus in the cell membrane. The deduced amino acid sequence (SEQ ID NO: 2) is outlined. And, potential N-linked glycosylation site. Solid circles represent consensus sites for protein kinase C phosphorylation. Figures 10a and 10b show assay results of 125I melatonin binding of COS-7 cells containing the cDNA of the Xenopus melatonin receptor. Figure la shows a saturation curve. Non-specific ligation was determined using 10 μM melatonin. Figure 11b shows a single Scatchard plot representative of the saturation data to determine the relative constants of melatonin ligation 125 I xt for the high affinity melatonin receptor gene transfected from Xenopus. Figure 11 shows the competition of several ligands by ligation of melatonin 125 I in COS-7 cells transfected with the DNA of the melatonin receptor of Xenopus. Cells were incubated with 100 pM melatonin 125I and diversae concentrations of 2-iodomelatonin (I-MEL), melatonin (MEL), 6-chloromelatonin (6C1-MEL), 6-hydroxymelatonin (60H-MEL), N-acetyl-5- hydroxitrip - jíjt tamina (AS), or 5-hydroxytryptamine (5HT). Non-specific ligation was determined in the presence of 10 μM melatonin. The K ± values are: I-MEL, 1.1 x 10"10 M; MEL, 1.3 x 10"9 M; 6C1-MEL, 3.0 x 10" 9 M; 60H-MEL, 2.0 x 10 ~ 8 M; ÑAS, 2.0 x 10"6 M; 5HT, more than 1.0 x 10" 4 M. The data are representative of three experiments. Figure 12 shows the inhibition by melatonin of cAMP accumulation stimulated by forskolin in CHO cells stably transfected with the cDNA of the melatonin receptor of Xenopus. The 100% value is the average cAMP value induced with 10 μM forskolin. The data are representative of three experiments. Figure 13 is a Northern blot of transcripts of the melatonin receptor in melanoforas derived from Xenopus. The locations of the RNA size markers are indicated (Life Technologies, Bethesda, Maryland, United States). The spot was exposed to X-ray film overnight. Figure 14 shows binding assay results of melatonin 125 I of COS-7 cells containing cDNA of the sheep melatonin receptor. Figure 14a shows a saturation curve. Non-specific ligation was determined using 10 μM melatonin. Figure 14a (inset) shows a Scatchard plot of the saturation data to determine the relative constants of melatonin ligation 12SI for the high affinity transfected sheep melatonin receptor gene. The Kd value for the high affinity melatonin receptor of - M lambs is 3.6 x 10"11 M and the Bmax value is 104 fmol / mg of protein The data shown are representative of three experiments. A graph of the competition of several ligands for ligation of melatonin 125 I in COS-7 cells transfected with the cDNA of the sheep melatonin receptor (SEQ ID NO: 3), cells were incubated with 100 pM 125 I-Mel and various concentrations of 2 -odomelatonin (I-Mel), melatonin (Mel), 6-chloromelatonin (6Cl-Mel), 6-hydroxymelatonin (60H-? Mel), N-acetyl-5-hydroxytryptamine (NAS), or 5-hydroxytryptamine ^ ( 5-HT) Non-specific binding was determined in the presence of 10 μM melatonin The K ± values for the sheep receptor are: I-Mel, 3.7 x 10"11 M; Mel, 2.4 x 10"10 M; 6C1-Mel, 2.5 x 10" 10 M; 60H-Mel, 3.0 x 10"9 M; ÑAS, 1.4 x 10" 7 M; 5HT, more than 1.0 x 10"4 M. Inhibition curves were generated by Ligand (Munson, PL and Rodbard, D. Anal. Biochem. (1980) 107: 220-239) using a one-site model. are representative of at least three experiments.2 -odomelatonin is available from Research, - Biochemicals Inc., Natick, Massachusetts, United States; 6- Chloromelatonin is available from Ely Lilly, Indianapolis, Indiana, United States; present are available from Sigma, St. Louis, Missouri, United States Figure 15 shows assay results of melatonin ligation I12S of COS-7 cells containing the complete human melatonin receptor cDNA (SEQ ID NO: 11). Figure 15a shows a saturation curve Figure 15a (inset) shows the Scatchard plot of the saturation data to determine the binding constants of melatonin 125I for the transfected gene of the high affinity melatonin receptor of human The Kd value for the human high affinity melatonin receptor is 2.6 x 10"11 M and the Braax value is 220 fmoles / mg protein. Non-specific ligation was determined using 10 μM melatonin. The data shown are representative of three experiments. Figure 16b is a graph of competition for several ligands for 125 I-Mel ligation in COS-7 cells transfected with the human melatonin receptor cDNA (SEQ ID NO: 11). The cells were incubated with 100 μl of 125 I-Mel and various concentrations of 2-iodomelatonin (I-Mel), melatonin (Mel), 6-chloromelatonin (6C1-Mel), 6-hydroxymethtonin (60H-Mel), N -acetyl-5-hydroxytryptamine (ÑAS) or 5-hydroxytryptamine (5-Ht). The non-specific binding was determined in the presence of 10 μM melatonin. The K ± values for the human receiver are I-Mel, 1.8 x 10"11 M; Mel 2.3 x 10"10 M; 6C1- Mel, 2.0 x 10" 9 M; 60H-Mel, 2.0 x 10'9 M; AS, 1.7 x 10-7 M; 5HT, greater than 1.0 x 10"4 M. Inhibition curves were generated by Ligand (Munson and Rodbard (1980), supra) using a one-site model.The data shown are representative of at least three experiments. includes the results of studies showing that the recombinant mammalian melatonin receptor is "li." couples to Gj. Figure 16a shows the inhibition by melatonin of cAMP accumulation stimulated by forskolin in NIH cells. 3T3 stably transfected with the sheep melatonin receptor cDNA (SEQ ID NO: 3). The value 100% is the value Medium AMPc induced with 10 μM forskolin. The data shown are representative of four experiments. Figure 16b shows that the pertussis toxin blocks the ability of melatonin to inhibit cAMP accumulation stimulated by Forskolin in NIH 3T3 cells stably transfected with the sheep melatonin receptor cDNA (SEQ ID NO: 3).

Cells were pre-incubated with either vehicle or pertussis toxin for 18 hours (PTX: 100 ng / ml; pertussis toxin was purchased from List, Campbell, California, United States). C, basal levels; F, 10 μM forskolin alone; FM, 10 μM forskolin plus 1 μM melatonin. The data are the mean plus the standard deviation for 3 plates of each treatment. The data shown are representative of three experiments. 4? Figure 17 shows a section of crown through the base of the brain and the pituitary of the sheep. Figure 17a is a histographic staining of the tissue section showing the pars tuberalis (PT) and the pars distalis (PD). Figure 17b is a film auto-radiographic image produced from a section in which [125I] MEL ligation is observed in the PT. Figure 17c is a self-radiographic film image produced from in-situ hybridization of a tissue receptor using a high-melatonin receptor riboprobe. # affinity of sheep, derived from the cloned sequence of the receiver. The hybridization pattern shows that mRNA that hybridizes to the riboprobe of the high affinity melatonin receptor of sheep exhibits the same expression pattern as the endogenous receptor protein. Figure 18 is a diagram of the structure of the human Mel-Ib receptor protein. Figure 18a is the ? - Predicted membrane topology of the human Mel-lb receptor protein. And, potential N-linked glycosylation site. The amino acids that are shaded are identical between the human melatonin Mel-la and Mel-lb receptors. Figure 18b is a comparison of the deduced amino acid sequence of the melatonin receptor Mel-lb and Mel-la human (GenBank, accession No. U14109), and the melatonin receptor of Xenopus (U09561). To maximize the homologies, free spaces (points) have been introduced in the three sequences. The seven presumed transmembrane domains (I-VII) are supra-striped. The consensus sites for N-linked glycosylation are underlined. The sequence of the human melatonin receptor lb has been deposited in the GenBank, under accession number U25341. Figure 19 is a graph of human Mel-lb receptor expression in COS-1 cells tested by 125 I-Mel ligation. or, total ligature; -, specific ligature; ? , non-specific binding (determined in the presence of 10 μM melatonin). • £ Box: Scatchard plot of saturation data. The Kd value sketched is 1.5 x 10 ~ 10 M. The Bmax value is 2.62 pmoles / mg of membrane protein. The data shown are representative of five experiments. Figure 20 is a graphical representation of the competition for several ligands by 125 I-Mel ligation in COS-1 cells transfected with either the melatonin receptor Mel-lb or Mel-la human. Cells were incubated with 200 pM Mel-lb receptor or 100 pM 125I-Mel-la receptor, and various concentrations of 2-iodomelatonin (I-Mel), melatonin (Mel), 6-chloromelatonin (6C1-Mel), or N-acetyl-5-hydroxytryptamine (ÑAS). The non-specific binding was determined in the presence of 10 μM melatonin. The data shown are the average values of three to five experiments for each drug. The Ki values are listed in Table 1. Figure 21 is a graphical representation of inhibition. by cAMP accumulation melatonin stimulated by forskolin in NIH 3T3 cells were stably affected with the human Mel-lb receptor. The 100% value is the average cAMP value induced with 10 μM forskolin. The data shown are the average values of two experiments. Figure 22 is a comparative RT-PCR analysis of the expression of the Mel-lb and Mel-la receptor gene in six human tissues. Brain refers to the analysis of the whole brain. H3.3 is histone H3.3. Figure 23 is a diagram showing the chromosomal location of the Mel-lb receptor gene. The human chromosome 11 idiogram illustrates the chromosomal content of somatic cell hybrids used to localize the Mel-lb melatonin receptor gene (MTNR1 B), to llq21-22. A description of the cloning and characterization of the high-affinity melatonin receptor cDNA of Xenopus laevis, the high-affinity melatonin receptor of sheep, mouse and human, as well as the receptor lb J ^ p- of high affinity melatonin of human being useful in the present invention. Transformed cells that contain and express the cDNA of the invention are also described. This example is provided for the purpose of illustrating the invention, and should not be construed as limiting. Molecular Cloning of a High Affinity Melatonin Receptor from Xenovus laevis Melatonin receptors are present in the dermal melanoforas of amphibians (Bagnara, J.T. and Hadley, M.E., Am. Zoologist (1970) 10: 201-216). The action of melatonin, mediated through the high affinity melatonin receptor coupled to the G ± protein (Abe, K. et al., Endocrinoloqy (1969) 85: 674-682; White, BH et al., J. Comp. Phvsiol. (1987) B 157: 153-159), results in the aggregation of melatonin in the dermal melonofora. Xenopus dermal melanoforum mRNA was used to clone the high affinity melatonin receptor cDNA of Xenopus (Ebisawa, T. et al., PNAS USA (1994) 91: 6133-6137). Primary cells or immortalized cells can be used to isolate mRNA. The cloning of the high affinity melatonin receptor cDNA of Xenopus was achieved as a useful initial step towards the cloning of the high affinity melatonin receptors of higher eukaryotes. The immortalized cell line used for isolation X? of mRNA was found to express a high level of 12S-melatonin ligation (more than 100 fmoles / mg of total cellular protein using 125 p-melatonin 50 pM). The cells were cultured by the method of Dianolos et al. (Pigment Cell Res. (1990) 3: 38-43). Using conventional techniques, total cellular RNA was isolated from melanoforas by extraction with guanidinium thiocyanate followed by centrifugal separation in a cesium chloride density gradient (Sambrook et al., Molecular Clonincr: A Laboratorv Manual (Cold Spring Harbor Lab. Press, Plainview, New York) (1989), 2nd ed.). Removal of melanosomes prior to separation in the cesium chloride density gradient was carried out as described by Karne et al. (J. Biol. Chem. (1993) 268: 19126-19133). Poly (A) + RNA was isolated using established methods, as described by Rivkees et al. (PNAS USA (1989) 84: 3916-3920). Poly (A) + Xenopus dermal melanoforph RNA was used as a template for the construction of a primordial randomized cDNA library (cDNA synthesis kit, Pharmacia Biotech Inc., Piscataway, New Jersey, United States). The cohesive ends were produced on double helix cDNA ligand with BstXl and EcoRl adapters (InVitrogen, San Diego, California, United States). The cDNA was fractionated in sizes on an agarose gel, and cDNA having a length equal to or greater than 2 pairs of kilobases (kb) was recovered by electro-elution. The cDNA selected by size was ligated into the expression vector pcDNAI (InVitrogen, San Diego, California, United States) and introduced into strain MC1061 / P3 of JE ?, coli by electroporation. A total of 4 x 10 5 recombinants of 5 μg of poly (A) + RNA was obtained and divided into 54 pools, each containing approximately 7,400 clones. Plasmid DNA was prepared from each cavity by the alkaline lysis method and transfected into the COS-7 cells by the DEAE-dextran method (Cullen, B.R., Methods Enz lmol. (1987) 152: 684-704). COS-7 cells were -jjt cultured as monolayers in Dulbecco's modified Eagle medium, supplemented with 10% fetal calf serum, penicillin (50 U / ml) and streptomycin (50 μg / ml), in C02 at 5% at 37 ° C. Three days after transfection, cells were incubated with 90 μM Tris-HCl 12S-melatonin, pH 7.4, containing 100 mM NaCl, KCl mM, 2 mM CaCl2, and 5% Nu-Serum I (Collaborative Biomedical Products, Bedford, Massachusetts, United States), for two hours at room temperature. The cells were washed, dried in air and exposed to X-ray film for 14 days. A clone cavity was sub-divided that showed positive signals, and the transfection procedure was repeated. This sub-division process was continued until a single clone was identified conferring specific ligation of 125I-melatonin to COS-7 cells. This clone, which contained a 2.2 kb cDNA insert was isolated, and both strands of the coding region were sequenced (SEQ ID NO: 1). The nucleotide sequences Two were analyzed by the dideoxynucleotide chain termination method of Sanger, F., and collaborators (PNAS USA (1977) 74: 5463-5467) using Sequenase (registered trademark) (United States Biochemical, Cleveland, Ohio, United States). ). The sequencing tempering was a double helix plasmid DNA. The primordial sequencing materials were synthetic oligonucleotides that were either specific to the vector or derived from sequence information.

-Wfi The isolated Xenopus cDNA encodes a protein of 420 amino acids (Figure 1) (SEQ ID NO: 2), with an estimated molecular mass of 47,424. In the flanking DNA sequence of the first two methionine codons in this reading frame, both exhibited a Kozak consensus sequence for the start of translation (Kozak, M., Nucleic Acids Res. (1987) 15: 8125- 8148). Hydropathy analysis (Kyte, J. and Doolittle, RF, J. Mol. Biol. (1982) 157: 195-232) of the predicted amino acid sequence revealed the presence of seven hydrophobic domains (see figures 4 and 5). ) that possibly represent the transmembrane regions of a G-protein coupled receptor. The term amino contains a consensus site for N-linked glycosylation, a typical feature of most G-protein coupled receptors (Pearson, WR, Methods Enzymol (1990) 183: 63-98). The melatonin receptor protein is not similar in identity to any particular group of G protein-coupled receptors, but is similar to a wide range of receptors; the highest amino acid sequence identity scores were approximately 25% for both mu opioid and somatostatin type 2 receptors. Using a database of G protein coupled receptors (Kornfeld, R. and Kornfeld, D., Ann. Rev. Biochem. (1985) 54: 631-664), the melatonin receptor appears to form a group that is distinct from other biogenic amine and peptide receptors. No sequence homology was identified between the melatonin receptor and the metabotropic glutamate-j or the families of the secretin receptor gene / calcitonin / parathoride hormone (Masu et al., Nature (1991) 349: 760-765; Juppner et al., Science ( 1991) 254: 1024-1026; Lin et al., Science (1991) 254: 1022-1024). The melatonin receptor has some general structural characteristics in common with the amine and peptide receptors. For example, it contains a single cysteine residue in Sk each of the first two extracellular loops that, based on mutagenesis studies of opsin and amine receptors (Dixon et al., EMBO J. (1987) 6: 3269-3275; and collaborators, PNAS USA (1988) 85: 8459-8463), are believed to form a bisulfide bridge that stabilizes the structure of the receptor. Furthermore, proline residues are present in the transmembrane domains IV, V and VI (Figures 7 and 8) that have been suggested to introduce loops in the alpha-helices that may be important to form the ligand ligation cavity (Findlay , J. and Eliopoulos, E., Trends Pharmacol, Sci. (1990) 11: 492-499, Hibert, MF et al., Mol.Pharmacol. (1991) 40: 8-15). The proline in motif NPXXY (SEQ ID NO: 7) which is in the transmembrane domain 7 of virtually all G protein-coupled receptors is replaced by an alanine in the melatonin receptor. The carboxyl tail of the melatonin receptor is 119 amino acid residues long and contains several consensus sites for phosphorylation of the * protein kinase C, which may be involved in the regulation of the receptor (Sibley et al., Cell (1987) 48 : 913-922). Xenovus Recombinant High Affinity Melatonin Receptor Ligation Studies To establish the ligation characteristics of the encoded Xenopus receptor (SEQ ID NO: 2), the cDNA in pcDNAI was expressed transiently in COS-7 cells. Three days after transfection, the medium was removed, the culture dishes were washed with PBS, and the cells harvested. The * Cells were then formed into beads (2,500 rpm, 10 minutes, 4 ° C) and stored at -80 ° C. Whole cell ligation studies were performed by thawing the cells and re-suspending them in ligation buffer (50 mM Tris-HCl, pH 7.4, with 5 mM MgCl 2) at a concentration of 456 μg protein / ml). The cell suspension was incubated with 125 I-melatonin (90 pM) in a total reaction volume of 0.2 ml of binding buffer in the presence or absence of an agonist or antagonist. ^. of melatonin; The suspension was incubated in a shaking bath for 1.5 hours at 25 ° C. Protein determinations were carried out using Pierce BCA protein assay (The Pierce Chemical Co., Rockford, Illinois, United States). The ligature data were analyzed by a computer using the Ligand program of Munson and rodbard (1980, supra). The results are shown in FIGS. 8 and 9. To further establish the ligation characteristics of the encoded Xenopus receptor (SEQ ID NO: 2), the cDNA in pcDNAI was expressed transiently in COS-7 cells. Three days after transfection, saturation studies were carried out using increasing concentrations of 125i-melatonin (5 to 1200 pM) (Figure 10a). The Scatchard analysis (Figure 10b) revealed that the transfected COS-7 cells were ligated with 125 I-melatonin with high affinity (Kd = 63 ± 3 x 10 ~ 12, n = 3 experiments). The Bmax value using the whole cell ligation assay was 67 + 7 fmoles / mg protein. No specific ligation of 125 I-melatonin was found in COS-7 cells transfected in apparent form. The pharmacological characteristics of 12SI-melatonin-specific ligation in acutely transfected COS-7 cells was examined below (figure 11). The order of inhibition of 12? I-melatonin specific binding of the Xenopus recombinant melatonin receptor by six ligands was characteristic of a high affinity melatonin receptor (Dubocovich, ML and Takahasi, J. (1987) supra; Rivkees et al. (1989) supra), the relative binding affinities having the order: 2-iodomelatonin greater than melatonin greater than 6-chloromelatonin greater than 6-hydroxymelatonin greater than n-acetyl-5-hydroxytryptamine greater than 5-hydroxytryptamine. In this manner, the cDNA isolated from Xenopus laevis of the present invention encodes a protein with the affinity and expected pharmacological properties of a high affinity melatonin receptor. The endogenous high-affinity melatonin receptor in dermal melafonoforas of Xenopus is coupled to the inhibition of adenylyl cyclase (Abe, K. et al. (1969) supra; White, B. H. et al. (1987) supra). To determine whether the receptor encoded by the recombinant cDNA (SEQ ID NO: 1) of Xenopus was coupled to the regulatory system of adenylyl cyclase, a CHO clonal line (ATCC, catalog cells No. CCL 61) was stably transfected with the cDNA of the recombinant receptor and it ^ F determined the inhibition induced by melatonin of cAMP accumulation stimulated by forskolin. Transformed CHO cells were placed in 35 mm culture dishes. After 48 hours, the cells were washed twice with Ham's F-12 (Life Technologies, Bethesda, Maryland, United States). The cells were then incubated in the presence or absence of melatonin analogues (diluted in F-12) for 10 minutes at 37 ° C. After the treatment, the medium was aspirated and 1 ml of 50 mM acetic acid was added to the culture dish. The cells were harvested, transferred to an Eppendorf tube, boiled for 5 minutes and centrifuged (13,750 rpm for 15 minutes). The supernatant was collected and tested for cAMP. All determinations were carried out in triplicate. The cyclic levels of AMP were determined in duplicate by radio-immunoassay (New England Nuclear, Boston, Massachusetts, United States).

The induction of the increase in cAMP concentration by 10 μM forskolin was inhibited by melatonin in a dose-dependent manner (Figure 12); The maximum inhibition of the average concentration of cAMP stimulated by forskolin was 68% at 1 x 10"8 M melatonin.An IC50 value of approximately 8 x 10" 10 M was determined by manually adjusting the data curve of the figure 12. This value was extremely similar to the computer-generated K ± value (1.3 x 10 ~ 9 M) determined for inhibition of 12-melatonin-specific ligation melatonin shown in figure 11. Melatonin alone was found (1 x 10"s M) does not alter basal cAMP levels in stably transfected CHO cells In addition, melatonin (1 x 10" 6 M) does not inhibit the forskolin-stimulated increase of cAMP levels in CHO cells stably transfected with a vector that lacks the Xenopus cDNA. In this way, the recombinant melatonin receptor is negatively coupled to the cAMP regulatory system. Dß Expression Xenopus Melatonin Receptor transcripts Northern blot analysis (see below) of Xenopus dermal melanofora revealed at least three hybridization transcripts between 2.4 and 4.4 kb under high stringency conditions (see below) (figure 13) . The presence of multiple hybridization bands may represent transcriptional modifications of the same gene, or the presence of afr transcripts of different but structurally similar genes. Northern analysis was carried out using conventional techniques (see, for example, Ausubel et al., Current Protocols in Molecular Bioloqy, John Wiley &Sons, New York, 1989). Poly (A) + RNA was electrophoresed through a 1% agarose-formaldehyde gel, run on GeneScreen (New England Nuclear, Boston, Massachusetts, United States), and hybridized with a fragment of the region of 'coding the cDNA of the receptor labeled with [alpha-32P] dCTP (2,000 Ci / mmol) by the random primordialization method (Promega, Madison, Wisconsin, United States). Hybridization conditions were 50% formamide, 1 M sodium chloride, 1% SDS, 10% dextran sulfate, and 100 μg / ml denatured salmon sperm DNA, at 42 ° C overnight. The final wash of the stain was in 0.2X SSC / 1% SDS at 65 ° C for 40 minutes. The spots were exposed to 80 ° C to an X-ray film with an intensification screen. Isolation dβ Mßlatonin dβ High Affinity Receptor Borrego To clone the high affinity melatonin receptor of sheep using conventional methods, totally degenerate primordial materials were designed based on, for example, the 5 'AIAINRY peptide sequences (SEQ ID NO: 8 ) (residues 125-131) and 3 'FAVCWAPL (SEQ ID NO: 9) (residues 252-259) of the Xenopus sequence (SEQ ID NO: 1) (Figure 1). Using these St populations of degenerate primordial materials, RT PCR of pars tuberalis mRNA from borrejo, amplified a cDNA fragment of approximately 400 bp that was 65% identical to the amino acid level with the corresponding region of the melatonin receptor of Xenopus. To isolate a longer cDNA sequence, this fragment was labeled (for example, with [32P] dCTP by random primordialization) producing a probe, and hybridization (under high stringency conditions) was carried out in one a? bilayer pars tuberalis cDNA library constructed in the "ZAP II vector (Stratagene, La Jolla, California, United States) using conventional hybridization techniques (see, for example, Ausubel et al., Current Protocols in Molecular Biology, supra). From 1 x 106 recombinants analyzed, two hybridization clones were isolated and plaque purified using conventional techniques, both clones contained the entire 3 'coding region, downstream of the predicted site of the third transmembrane domain, one clone was extended 5'. ? - towards the amino terminus region, upstream of the first transmembrane domain, but did not contain the entire 5 'end of the coding region. A 160 bp fragment from the 5 'end of this cDNA clone was labeled (e.g., radiolabelled) by standard techniques (see, for example, Ausubel et al., Supra) and used as a probe (e.g., the conventional techniques described, supra) in a sheep genomic library (in EMBL-3, catalog number UL lOOOd, Clontech, Palo Alto, California, United States). A clone was isolated and found to contain the remaining 5 'sequence of the coding region using conventional sequencing techniques. A 150 bp fragment of this genomic clone, containing a methionine with a consensus sequence for the start of translation, was isolated and ligated using conventional techniques (see, for example, Sambrook (1989), supra) in a vector (eg, example, pcDNAI, InVitrogen, San Diego, California, United States) in the frame with the coding region # 'corresponding downstream of the cDNA. The ligated construct encodes a 366 amino acid protein (SEQ ID NO: 4) that binds to [125 I] MEL with high affinity. Studies of the Recombinant, High Affinity Mßla onine Receptor Dß Borrego DNA of the high affinity melatonin receptor of sheep (SEQ ID NO: 3), cloned in pCDNAI, was expressed transiently in COS-7 cells. For ligand ligation studies, the sheep receptor cDNA (SEQ ID NO: 3) in pcDNAI was introduced into COS-7 cells using the DEAE-dextran method (Cullen, BR, Methods Enzymol. (1987) 152: 684 -704). Approximately two to three days after transfection, the cell culture medium was removed, and the culture dishes were washed with PBS, and the cells harvested. The cells were then formed into beads (2,500 rpm, 10 minutes, 4 ° C) and stored at -80 ° C. Whole cell ligation studies were carried out by thawing the cells and re-suspending them in ligation buffer (50 mM Tris-HCl, pH 7.4, with 5 mM MgCl 2) at a concentration of 200 to 500 μg protein / ml. The cell suspension was incubated with 125 I-Mel with or without drugs in a total reaction volume of 0.2 ml of ligation buffer; The suspension was incubated in a shaking bath for 1.5 hours at 25 ° C. All determinations were made either in duplicate or in triplicate. Protein measurements were carried out using the Pierce BCA protein assay. ~ The ligature data were analyzed by computer using the Ligand program of Munson and Rodbard (1980). Scatchard analysis (carried out as described above for the Xenopus clone) revealed that COS-7 cells transfected with the clone of the 12-melatonin-bound lamb Mel-la receptor with high affinity (Kd = 3.6 ± 0.1 x 10"11 M, mean + standard deviation, n = 3 experiments.) The Braax value for the sheep receptor clone using the whole cell ligation assay was greater than 112 ± 5 fmoles / mg protein (Figure 14a). No specific ligation of 12SI-melatonin was found in COS-7 cells transfected in appearance.The receptor encoded by the recombinant sheep melatonin receptor was tested to determine if it is coupled to the inhibitory G protein (G ±), as it has been demonstrated with the endogenous receptor of various mammals, including lambs (Carlson et al., (1989) supra; Morgan et al., (1990) supra). NIH 3T3 clonal cells stably transfected with the cDNA of the clearing receptor were used. go (SEQ ID NO: 3), sub-cloned in pcDNAI NEO (InVitrogen, San Diego, California, United States) and exhibiting high levels of melatonin receptor ligation (more than 10 fmoles / 60 mm of cells using 125I-Mel 100 pM). Transformed NIH 3T3 cells were placed in 35 mm dishes. After 48 hours, the cells were washed twice with DMEM, and then incubated with or without medication (diluted in DMEM) for 10 minutes at 37 ° C. At the end of the treatment, the medium was aspirated and 1 ml of 50 mM acetic acid was added. The cells were harvested, transferred to an Eppendorf tube, boiled for 5 minutes, and centrifuged (13,750 rpm for 15 minutes). The supernatant was collected and tested for cAMP. All determinations were made in triplicate. The cyclic levels of AMP were determined in duplicate by radio-immunoassay using conventional techniques. Although melatonin did not alter the basal levels of cAMP in the stably transfected lines, it caused a dose-dependent inhibition of the cAMP increase induced by 10 μM forskolin (Figure 16a). The estimated IC50 value for melatonin was 1 x 10"10 M, comparable with the K value for melatonin inhibition of 125 I-Mel specific binding (2.4 x 10 ~ 10 M; see figure 14b). Importantly, melatonin (1 μM) did not inhibit the accumulation of forskolin-stimulated cAMP in NIH 3T3 cells stably transfected with the vector (pcDNAI NEO) that lacks the cDNA of the lamb-sheep receptor. Pre-treatment with pertussis toxin (PTX, 100 ng / ml) of NIH 3T3 cells transfected with the receptor for 18 hours completely abolished the 1 μM melatonin capacity to inhibit the stimulated increase in forskolin in cAMP (figure 16b). Thus, as the endogenous high-affinity melatonin receptor of vertebrates (Carlson et al., (1989) supra; Morgan et al., (1990) supra; White et al., (1987) supra), the Mel-la receptor of recombinant sheep inhibits adenylyl cyclase through a mechanism sensitive to pertussis toxin. Northern blot analysis of sheep PT revealed a hybridization transcript greater than 9.5 kb and a transcript less than 4.2 kb. No signs of hybridization were found in pars distalis (data not shown). Using the anti-sense cRNA probes prepared using the sheep melatonin receptor cDNA, the hybridization in itself of the endogenous mRNA revealed a strong hybridization signal that was visible on autoradiographs on the PT film of the bighorn sheep. (figure 17); no signal was detected in the pars distalis. The distribution of mRNA in PT was identical to that found for the receptor protein using in vitro autoradiography of 12? I-Mel. The SCN region of the lamb was not examined for melatonin receptor mRNA because no high affinity melatonin receptors have been identified in sheep SCN using 125 I-Mel in autoradiography in vi tro (Bittman, EL and Weaver , DR, Biol. Reprod. (1990) 43: 986-993). Siberian hamster and rat brain tissue was examined to illustrate the distribution of the melatonin receptor in the brain of other species in which melatonin is known to have effects on reproductive and circadian rhythms (Bartness, TJ et al., J. Pineal Res. (1993) 15: 161-190; Margraff, RR and Lynch, GR, Am. J. Phvsiol. (1993) 264: R615-R621; and Cassone, V.M. , Trends Neurosci. (1990) 13: 456-464). The major sites of 125I-Mel specific ligation and receptor transcription hybridization in the Siberian hamster brain are PT, SCN and the paraventricular nucleus of the thalamus, as examined in adjacent sections by autoradiography in vi tro (data not shown ); see also Weaver, D.R. and collaborators, J. Neurosci. (1989) 9: 2582-2588). Thus, in this species, the mRNA distribution of the melatonin and protein receptor is identical and restricted to a few sites in the brain. The PT and SCN regions exhibited receptor transcription hybridization and 125 I-Mel ligation in adult and developing rats (data not shown). The mRNA distribution of the melatonin receptor was coincident with that of 125 I-Mel ligation throughout the SCN in both rats and hamsters.

In all the non-human mammals that have been examined, including the sheep (Figure 15), the Siberian hamster, the Syrian hamster and the rat, hybridization studies have detected mRNA for the high affinity melatonin receptor in the mRNA. PT. PT currently appears to be an important site through which melatonin mediates photoperiodic effects on reproductive function. The PT is the only site that contains melatonin receptors (as detected by in vivo autoradiography of 125I-Mel) in all of the seasonal mammals examined to date (Weaver et al., (1991) supra). The mechanisms by which the PT processes the melatonin signal daily and communicate that information to influence hypothalamic neurosecretion are unknown. High affinity melatonin receptors have not been consistently detected in human PT by autoradiography in 125 I-Mel, suggesting that neuroendocrine responses to melatonin in humans can occur through fundamentally different mechanisms than that underlie the regulation of reproduction in species of seasonal reproduction (Weaver, DR et al., J. Clin Endocrinol, Metab. (1993) 76: 295-301). Isolation of the D-Melatonin Receptor High Mouse Affinity Degenerate primordial materials were designed using conserved regions among other mammalian Mel-la receptor cDNAs, such as those of sheep (see Figure 2). The polymerase chain reaction (PCR) of mouse genomic DNA resulted in a 466 bp fragment that was 94% identical to the amino acid level of cDNAs of the rat Mel-la receptor and Djungarian hamster. Hybridization in the brain of the adult C57BL / 6J mouse using the fragment generated by PCR produced a pattern of hybridization consistent with that expected for the melatonin receptor Mel-la. The hybridization signal was more intense in the pars tuberalis of the pituitary gland. Southern blot analysis of genomic DNA indicated a single copy gene. RNA was isolated from a murine cell line (RT2-2) expressing the Mel-la receptor. Northern analysis of poly (A) + RNA indicated a transcription length of approximately 1.9 kb. RT-PCR was used to generate the full-length coding region (1, 059 bp) of the receptor, which showed an amino acid identity of 84% with the human Mel-la receptor. The RNase protection analysis, 5 'and 3' RACE cloning, and analysis of a BALB / c mouse EMBL3 SP6 / T7 genomic library revealed that the receptor gene consists of two exons divided by a large intron (more than 8 kb) . The 3 'untranslated region is 444 bp long, and includes the AUUAAA polyadenylation signal. RNase protection assays suggest that a major transcription start site is located approximately 100 bp upstream of the start codon. The nucleotide sequence and deduced amino acid sequence of the mouse Mel-la receptor are shown in Figure 3.

The recombinant mouse Mel-la receptor expressed in COS-7 cells bound melatonin with a high affinity comparable to the binding affinity of lamb-la and human receptors. Isolation of a Fragment of the High Affinity Human Receptor Mel-la To clone the high affinity melatonin human receptor, the degenerate primordial materials based on the 5 'AIAINRY peptide sequences (SEQ ID NO: 8) (residues 125-131 of the amino acid sequence deduced from Xenopus (SEQ ID NO: 2)) and 3 'FAVCWAPL (SEQ ID NO: 9) (residues 252-259 of the deduced amino acid sequence of Xenopus (SEQ ID NO: 2)) were used as described earlier. Human genomic DNA was amplified by conventional PCR techniques using the degenerate primordial materials and a fragment of approximately 400 bp was isolated and sequenced by conventional techniques. The deduced amino acid sequence of the 400 bp fragment was 65% identical to the amino acid level with the corresponding r * portion of the high affinity melatonin receptor of Xenopus. The 400 bp fragment was labeled (for example, by random primordial labeling, see, for example, Ausubel, supra) and used to analyze a human genomic library (in the vector EMBL-3, Clontech, Palo Alto, California, United States, catalog number HL1067J) under conditions of high stringency using conventional hybridization techniques (see, for example, Ausubel, supra). Several clones of positive hybridization were identified from 1 x 106 recombinant clones analyzed. The clones were plaque purified by conventional techniques, digested with appropriate restriction enzymes and sub-cloned into a convenient vector for sequencing (eg, pBluescript, Stratagene, La Jolla, California, United States). The human insert DNA (SEQ ID NO: 5) of a clone was sequenced using conventional techniques. Using the nucleotide and amino acid sequences jJ deduced from sheep (SEQ ID NO: 3) and Xenopus (SEQ ID NO: 1) (SEQ ID NO: 4 and SEQ ID NO: 2, respectively), for comparison (see figures 7) and 8), the human insert DNA was found to contain a portion of the coding region of the "GNXFW motif (SEQ ID NO: 10)" just downstream of the first transmembrane domain (see figures 7 and 8) and extends through of the 3 'end of the coding region. The human DNA of the sequenced clone is approximately 82% identical to the sheep nucleotide sequence (SEQ ID NO: 5) of the corresponding region. The * deduced amino acid sequences of sheep and human (SEQ ID NO: 4 and SEQ ID NO: 6, respectively) are approximately 80% identical in the corresponding regions. In this manner, the human DNA fragment (SEQ ID NO: 5) isolated by the above techniques encodes a protein with a strong identity with the corresponding portion of the high affinity melatonin receptor in another mammal, lamb. Genomic human DNA contains an intron (more than 2.0 jβ kb in length) upstream of the "GNXFW motif" (SEQ ID NO: 10). To obtain the 5 'portion of the human receptor coding region, the 160 bp fragment of the coding region of the sheep receptor immediately upstream of this GNXFW motif was used to re-probe the human genomic library at low stringency ( for example, low stringency hybridization conditions, see for example Ausubel et al. (1989), '' supra). A clone of hybridization r? positive was isolated and found by standard sequence analysis to contain the 5 'end of the coding region. RT-PCR (see, for example, Reppert et al., Mol. Endocrinol. (1991) 5: 1037-1048) of mRNA of the human hypothalamus using specific primordial materials directed at the 5 'and 3' ends of the region of Putative coding amplified the expected cDNA, containing the coding region of the human melatonin receptor. The cDNA was sub-cloned into pcDNAI for a ^ sequence analysis and transient expression of the receptor polypeptide. 'Sequencing results show that cDNA's cloned in the present invention encode a high affinity melatonin receptor of Xenopus, sheep and human. In total, the coding regions of the sheep receptor and the whole human receptor are about 60% identical to those of the melatonin receptor of Xenopus. Within the transmembrane domains, the identity is 77%. The most dissimilar regions between the mammal and frog receptors were in * the amino and carboxyl terminal regions. The amino terminus of mammalian receptors contains two consensus sites for N-linked glycosylation, as compared to a site in the frog receptor. Furthermore, the carboxyl tail of the sheep and human receptors is 64 amino acid residues shorter than the tail of the Xenopus receptor. The complete DNA of the high affinity melatonin human receptor shows a strong identity (approximately 82% at the nucleotide level and approximately 80% at the amino acid level) with the high affinity melatonin receptor of sheep with 87% amino acid identity when the comparison is limited to the transmembrane domains. This high structural homology suggests that human and sheep clones are homologous species of the same receptor. Studies of the Human Receptor Ligation Rßcombinantß Mel-la dß High Affinity The DNA of the human receptor the high affinity melatonin, complete (SEQ ID NO: 11) cloned in pcDNAI was expressed transiently in COS-7 cells and studies were carried out of ligature as described for the sheep receiver, supra. Scatchard analysis (carried out as described above for the Xenopus and lamb clones) revealed that COS-7 cells transfected with the complete human receptor clone (containing DNA of SEQ ID NO: 11) bound 125I- * melatonin with high affinity (Kd = 2.6 and 2.3 x 10"11 M; n = 2 experiments). The Bmax value using whole cell ligation assay was 210 and 220 fmoles / mg of protein for the human receptor in two experiments (Figure 15 No specific ligation of 125 I-melatonin was found in COS-7 cells transfected in appearance For the human clone, the rank order of inhibition was identical to that for sheep, except that 6-chloromelatonin was 10 times less potent to inhibit specific ligation of 125 I-Mel (the K values listed in the legend of Figure 13b.) Thus, recombinant sheep and human receptors bind 125 I-Mel with high affinity and exhibit the appropriate pharmacological characteristics of a r High affinity melatonin eceptor (Dubocovich and Takahashi, (1987) supr; Morgan et al., (1989) J. Endocrinol. 1: 1-4; Rivkees et al., PNAS USA (1989) 86: 3883-3886; Vanecek, J., J. Neurochem. (1988) 51: 1436-1440). Isolation of a High Affinity Human Mβl-lb Receptor To clone the subtypes of the melatonin receptor, PCR was used to amplify genomic human DNA with primordial degenerate oligonucleotide materials based on conserved amino acid residues in the third transmembrane domains and sixth of the melatonin receptor of Xenopus and the melatonin Mel-la receptors of mammals. For PCR with degenerate primordial materials, genomic DNA was subjected to 30 cycles of amplification with 200 nM (final concentration) of each of the primordial oligonucleotide materials. Each reaction cycle consisted of incubations at 94 ° C for 45 seconds, 45 ° C for 2 minutes and 72 ° C for 2 minutes, with AmpiTaq DNA polymerase (Perkin-Elmer Cetus). The amplified DNA was separated on an agarose gel. DNA bands were sub-cloned into pCRTMII using a TA cloning kit (InVitrogen), and recombinant clones were sequenced. For PCR with specific primordial materials, genomic DNA or cDNA from the first strand transcribed in reverse form from RNA was subjected to 25-35 cycles of amplification using incubations at 94 ° C for 45 seconds, 60 ° C for 45 seconds and 72 ° C for 2 or 3 minutes. The amplified DNA was separated on an agarose gel. DNA bands were sub-cloned into pcDNA3 (InVitrogen) for expression studies and sequence analysis, or subjected to Southern analysis for the assay of the comparative reverse transcription polymerase chain reaction (RT-PCR) (described later in the present). A human genomic library in EMBL-3 SP6 / T7 (Cloh) was plated and transferred to colony plate analysis filters (New England Nuclear). The filters were analyzed under conditions of either high or reduced astringency. The high astringency consisted of overnight hybridization in 50% formamide, 1 M sodium chloride, 1% SDS, 10% dextran sulfate, 100 μg / ml denatured salmon sperm at 42 ° C, the filters being washed in 2X SSC, 1% SDS at 65 ° C 1 hour. The reduced astringency consisted of the same hybridization solution at 42 ° C, except that the formamide concentration was 25%; the filters were washed in 2X SSC, 1% SDS at 55 ° C for 1 hour. The lambda phages that were hybridized in the probe were purified on plate. A novel cDNA fragment (364 bp) was found by sequence analysis using conventional techniques to be 60% identical at the amino acid level with either the human Mel-la receptor or the Xenopus melatonin receptor. This PCR fragment was labeled by a conventional random priming technique and used to probe a human genomic library at high stringency. From 1 x 106 recombinants, seven clones of positive hybridization were identified and plaque purified. A 6 kb Sacl fragment from one of the genomic clones that hybridized to the cDNA fragment generated by PCR was subcloned and partially sequenced. This fragment contained the 3 'end of the putative coding region and extended 5' to the GN motif in the first cytoplasmic loop, in which an apparent intron occurred; a consensus intron splice site occurs in an identical location in the human and sheep-bred Mel-la receptor genes (SEQ ID NO: 11 and SEQ ID NO: 3, respectively; Reppert, SM, Weaver, DR, and Ebisawa, T. (1994) Neuron 13: 1177-1185). To obtain the 5 'portion of the coding region, a 160 bp fragment encoding the first transmembrane domain of the sheep melatonin Mel-la receptor was used to round up the seven positive genomic clones to reduced astringency (Reppert, SM and collaborators, (1994) supra). A 2.3 kb Sacl fragment from one of the genomic clones that hybridized to the sheep receptor fragment was sub-cloned and sequenced by conventional techniques. This Sacl fragment contained the apparent 5 'end of the coding region that includes a methionine upstream, in frame, with a consensus sequence for the start of translation (Kozak, M., (1987) Nucleic Acids Res. : 8125-8148) and a consensus site for N-linked glycosylation. RT-PCR of human brain RNA using specific primordial materials directed to the 5 'and 3' ends of the putative coding region amplified the expected cDNA with the appropriate splicing predicted from the genomic analysis, indicating that the putative receptor gene is transcribed . A construct generated by PCR of the coding region of the human Mel-IB receptor was sub-cloned into pcDNA3 for expression studies and sequence analysis. The deduced amino acid sequence of the human Mel-lb receptor was identical to the corresponding sequence of the genomic Sacl fragments. The human lb receptor of melatonin encodes a 362 amino acid protein (SEQ ID NO: 16) with a predicted molecular mass of 40,188, not including post-translational modifications (Figure 6). The human Mel-lb receptor is a member of a newly described group of melatonin receptors that is distinct from the other receptor groups (eg, biogenic amine receptors, neuropeptide, and photopigmentation) comprising the prototypical family of coupled receptors. to G protein (Ebisawa et al., (1994) PNAS USA 91: 6133-6137; Reppert, SM et al., (1994) supra). Unique features of this group include a NRY motif just downstream of the third transmembrane domain (more than DRY) and a NAXXY motif (SEQ ID NO: 17) in transmembrane 7 (more than NPXXY (SEQ ID NO: 7)) ( figure 18). In addition, the human Mel-lb receptor, the mammalian Mel-la receptors, and the Xenopus melatonin receptor all have a CYICHS motif (SEQ ID NO: 18) immediately downstream of NRY in the third cytoplasmic loop that is a site of consensus for hemo ligation of the cytochrome c family (Mathews, FS (1985) Proa. Biophys., Mol. Biol. 45: 1-56). Pairwise comparisons of the human Mel-lb receptor, the human Mel-la receptor, and the Xenopus melatonin receptor reveal approximately 60% amino acid identity for any pair of the three sequences (Figure 18). Within the transmembrane domains, the amino acid identity between any two of the three sequences is 73%. The most dissimilar regions between any two of the three receptors are in the terminal amino and carboxy regions and in the second and third cytoplasmic loops. Within the amino terminus there is a consensus site for N-linked glycosylation for the melatonin receptor of Xenopus and the human Mel-lb receptor, although there are two sites on the amino terminus of the human Mel-la receptor (figure 18, bottom) . The possibility of additional translation start sites upstream can not be excluded. Ligation Studies of the Human Receptor Mßl-lb dß High Affinity Rßcombinantß The binding and pharmacological properties of the human Mel-lb receptor were examined by transiently expressing the receptor cDNA in COS-1 cells. Expression studies were conducted as follows. COS-1 and NIH 3T3 cells were cultured as monolayers in Dulbecco's Modified Eagle medium (DMEM), supplemented with fetal calf serum 10%, penicillin (50 U / ml), and streptomycin (50 μg / ml) in C02 al 5% at 37 ° C. For ligand ligation studies, cDNAs of the melatonin receptor in pcDNA3 were introduced into COS-1 cells using the DEAE-dextran method (Cullen, B. (1987) Methods Enzymol., 152: 684-704). Three days after transfection, the medium was removed, and the dishes were washed with PBS. The cells were harvested in Hank's balanced salt solution and centrifuged (1400 x gJv. ; 10 minutes, 4 ° C). The resulting pearls or pellets were stored at -80 ° C. Crude membrane homogenates were prepared by thawing the beads on ice and re-suspending them in TME buffer (pH 7.4) consisting of 50 mM Tris base, 12.5 mM MgCl 2, 1 mM EDTA, and supplemented with 10 μg / ml aprotinin and leupeptin, and 100 μM phenylmethylsulfonyl fluoride.

The cells were then homogenized using a homogenizer and centrifuged (45,000 x g, 15 minutes at 4 ° C). The resulting bead was re-suspended with a homogenizer in TME and frozen at -80 ° C in aliquots. Ligation assays were carried out in duplicate in a final volume of 200 μl, consisting of 20 μl of radio-ligand, 20 μl of TME containing either melatonin or displacer, and 160 μl of membrane homogenates. Incubations were initiated by the addition of the membrane preparation and conducted at 37 ° C for 60 minutes. Non-specific ligation was defined by 10 μM melatonin. All determinations were made either in duplicate or triplicate. Protein measurements were carried out by the Bradford method (Bradford, M.M. (1976) Anal. Biochem. 72: 248-254), using bovine serum albumin as standard. The ligature data were analyzed by computer using the Ligand program of Munson and Rodbard (Munson, P.J. and Rodbard, D. (1980) Anal. Biochem. 107: 220-239). For comparison, the ligation and pharmacology of COS-1 cells transiently expressing the human Mel-la receptor were determined in parallel. The Scatchard transformation of the saturation data showed that COS-1 cells transfected with either receptor bound 125 I-Mel with high affinity. The Kd value of the human Mel-lb receptor was 1.6 ± 0.3 x 10"1 M (mean ± SD, n = 5 experiments) (Figure 19).

This value represents an affinity four times lower than that of the human Mel-la receptor (Kd = 6.5 ± 0.6 x 10"11 M, n = 3) found in parallel experiments.The Braax values were 2.7 + 0.1 pmol / mg protein of membrane for the human Mel-lb receptor and 2.8 ± 0.4 pmoles / mg of membrane protein for the human receptor Mel-la The pharmacological characteristics for inhibition of specific ligation of 12sI-Mel in acutely transfected COS-1 cells were immediately examined for the Mel-lb receptor and compared with those of the human Mel-la receptor (Figure 20, Table 1) Table 1 Competence of Various Ligands for 125i-Mel Specific Ligation in COS-1 Cells Transfected with either the Receptor DNA Human Mel-lb or Human Mel-Receptor The K ± values are mean ± D.E. of 3-5 experiments for each medication. ÑAS: N-acetyl-5-hydroxytryptamine; 5-HT: 5-hydroxytryptamine; S20098, a melatonin analog, was obtained from Bristol-Meyers Squibb, Princeton, New Jersey, United States. in the order of inhibition of 125I-Mel specific binding by six ligands was 2-iodomelatonin greater than 2-phenylmelatonin greater than S-20098 greater than 6-chloromelatonin greater than melatonin greater than N-acetyl-5-hydroxytryptamine (Figure 20a, Table 1). Micromolar concentrations of prazosin or 5-hydroxytryptamine did not inhibit 125 I-Mel specific ligation. The order of 125I-Mel specific binding inhibition range for the human Mel-lb receptor was very similar to that found in experiments * parallels for the human melatonin Mel-la receptor, except that 6-chloromelatonin was 10 times more potent for the inhibition of 125 I-Mel specific binding in cells expressing the human Mel-lb receptor (Figure 20b, Table 1). Thus, the cDNA of the human Mel-lb receptor encodes a protein with 125 I-Mel ligation characteristics that are quite similar to those of the melatonin Mel-la receptor. Mßlatonin Inhibits Accumulation of cAMP in Guß Cells Express Mßl-lb The recombinant Mel-lb receptor is coupled to the inhibition of adenylyl cyclase as is the melatonin Mel-la receptor (Reppert, SM et al. (1994), supra) . For these studies, clonal lines of NIH 3T3 cells stably transfected with the receptor cDNA in pcDNA3 were used. COS-1 and NIH 3T3 cells were cultured as monolayers in Dulbecco's Modified Eagle Medium (DMEM) * supplemented with fetal calf serum 10%, penicillin (50 U / ml) and streptomycin (50 μg / ml), in C02 al 5% at 37 ° C. For ligand ligation studies, cDNAs of the melatonin receptor in pcDNA3 were introduced into COS-1 cells using the DEAE-dextran method (Cullen, B. (1987) supra). Three days after transfection, the medium was removed, and the dishes were washed with PBS. The cells were harvested in Hank's balanced salt solution and centrifuged (1,400 x g; = ^ minutes, 4 ° C). The resulting beads were stored at a temperature of -80 ° C. Crude membrane homogenates were prepared by thawing the beads on ice and re-suspending them in TME buffer (pH 7.4) consisting of 50 mM Tris base, 12.5 mM MgCl 2, 1 mM EDTA, and supplemented with 10 μg / ml aprotinin and leupeptin, and 100 μM phenylmethylsulfonyl fluoride. The cells were then homogenized using a homogenizer and centrifuged (45,000 x g, 15 minutes at 4 ° C). The resulting bead was re-suspended with a homogenizer in TME and frozen at -80 ° C in aliquots. Ligation assays were carried out in duplicate in a final volume of 200 μl, consisting of 20 μl of radio-ligand, 20 μl of TME containing either melatonin or displacer, and 160 μl of membrane homogenates, incubations were initiated by addition of the membrane preparation and were conducted at 37 ° C for 60 minutes. Non-specific ligation was defined by 10 μM melatonin. All the determinations were made either in duplicate or triplicate. ß Protein measurements were carried out by the method of Bradford (Bradford, M.M. (1976) supra), using bovine serum albumin as standard. The ligature data were analyzed by computer using the Ligand program of Munson and Rodbard (Munson, P.J. and Rodbard, D. (1980) supra). For cAMP studies, the receptor cDNA in pcDNA3 was introduced into NIH 3T3 cells using lipofectamine (Gibco / BRL). Transformed NIH 3T3 cells resistant to geneticin, G418 (at 1.0 mg / ml, Gibco / BRL) were isolated and isolated colonies were isolated. * express melatonin receptor binding (more than 200 fmoles / jtig of total cellular protein). Transformed NIH 3T3 cells were plated in triplicate, on 35 mm plates. 48 hours later, the cells were washed (2X) with DMEM and pre-incubated with 250 μM 3-isobutyl-1-methylxanthine (IBMX) in DMEM for 10 minutes at 37 ° C. The cells were then incubated with or without drugs in DMEM with 250 μM IBMX for 10 minutes at 37 ° C. At the end of the treatment, the medium was aspirated and 0.5 ml of 50 mM acetic acid was added. Cells were harvested, transferred to an Eppendorf tube, boiled for 5 minutes, and centrifuged (13,750 rpm for 15 minutes). The supernatant was collected and tested for cAMP. All determinations were made in triplicate. The cyclic levels of AMP were determined in duplicate by radio-immunoassay (New England Nuclear). It bought 125I-Mel from New England Nuclear.

All drugs used in competition studies were purchased from Sigma Research Biochemicals, or were synthesized by conventional methods. All other chemicals were purchased from Sigma. The results of these studies show that melatonin (1 μM) did not increase the basal levels of cAMP in stably transfected NIH 3T3 cells. Melatonin caused a dose-dependent inhibition of the increase in 10 μM cAMP accumulation induced by 10 μM forskolin (Figure 21); the maximum inhibition of the mean cAMP value stimulated by forskolin occurred at 10 ~ 8 M melatonin. The estimated IC50 value of this response (approximately 1 x 10 ~ 9 M) was extremely similar to the value K i. computer generated (1.11 + 0.13 x 10"9 M) determined for 125 I-Mel specific ligation melatonin inhibition (Figure 20, Table 1.) Thus, the recombinant melatonin receptor lb is negatively coupled to the regulatory system of AMPc Characteristics of the Gene Receptor Mel-lb dß High Human Affinity and its Expression Restriction Endonuclease Mapping and Analysis PCR of genomic clones showed that the portion of the gene encoding the coding region of the human Mel-lb receptor comprises two exons, separated by an intron that is approximately 9.0 kb in length. Southern analysis of genomic human DNA digested with various different restriction endonucleases was carried out using a PCR fragment of the second exon of human Mel-lb DNA as a hybridization probe. Under conditions of high astringency, a simple band pattern was observed, suggesting that the human Mel-lb receptor is encoded by a single copy gene. To locate the gene for the human Mel-lb receptor, an intron pro PCR assay was developed that would amplify only the human Mel-lb receptor gene. A panel of 43 human-mouse somatic cell hybrids containing defined overlapping subsets of human chromosomes was analyzed (Geissler, E.N., Liao, M., Brook, J.D., Martin, F.H., Zsebo, K.M., Housman, D.E. and Galli, S.J. (1991) Somatic Cell Genet. 17: 207-214; Pelletier, J., Brook, D.J. and Housman, D.E. (1991) Genomics 10: 1079-1082; NIGMS Mapping Panel # 2, Coriell Institute, Camden, New Jersey, United States). Using the primordial materials 5 '-CTGTGCCTCTAAGAGCCACTTGGTTTC-3' (SEQ ID NO: 19) and 5 'TATTGAAGACAGAGCCGATGACGCTCA3' (SEQ ID NO: 29), PCR amplified a single band in those cell lines containing the human chromosome 11. The recipient gene Mel-lb was additionally located in band llq21-22 by PCR analysis of a panel of somatic cell hybrids containing various deletion fragments of human chromosome 11 (Glaser, T., Housman, D., Lewis, WH, Gerhard, D and Jones, C. (1989) Somat, Cell, Mol.Genet., 15: 477-501, figure 23). The gene encoding the human receptor Mel-lb has received the designation MTNBR1 B.

To determine the tissue distribution of human Mel-lb mRNA, a comparative RT-PCR analysis was carried out using a modification of a previously described procedure (Kelly, MR, Jurgens, JK, Tentler, J., Emanuele, NV, Blutt, SE, Emanuele, MA (1993) Alcohol 10: 185-189). Poly (A) + Clontech RNA was purchased and 2 μg of each tissue was primordialized with random hexamers and reverse transcribed as previously described (Reppert, SM, Weaver, DR, Stehle, JH and Rivkees, SA (1991 Mol Endocrinol 5: 1037- * 1048). The cDNA was subjected to 25 cycles of amplification with 200 nM of each of two specific primordial materials. The primordial materials of the Mel-lb and Mel-la receptors were designed to amplify cDNA through the intron splice sites in the first cytoplasmic loop. As the introns for both the Mel-lb and Mella receptor genes are large (more than 8 kb), the amplification of cDNA fragments of appropriate size would eliminate the possibility of genomic DNA amplification. The primordial materials of the human Mel-lb receptor were 5 '-TCCTGGTGATCCTCTCCGTGCTCA-3' (SEQ ID NO: 20) and 5 '-AGCCAGATGAGGCAGATGTGCAGA-3' (SED ID NO: 21), and amplified a 321 bp band. The primordial materials of the Mel-la receptor were 5 '-TCCTGGTCATCCTGTCGGTGTATC-3' (SEQ ID NO: 22) and 5 '-CTGCTGTACAGTTTGTCGTACTTG-3' (SEQ ID NO: 23) and amplified a band of 285 bp. Histone-H3.3 served as a control to verify the amount of tempering for each sample.

The primordial materials of histone-H3.3 were 5''GCAA-GAGTGCGCCCTCTACTG-3 '(SEQ ID NO: 24) and 5'-GGCCTCACTTGCCTCCTGCAA-3' (SEQ ID NO: 25), and amplified a band of 217 bp. After PCR, the reaction products were subjected to electrophoresis through a 1.5% agarose gel and stained on GeneScreen (New England Nuclear). To increase the specificity of the assay, the spots were hybridized with 25-mer oligonucleotides, labeled with [gamma-32P] ATP by T4 polynucleotide kinase. For each pair of primordial materials, the oligonucleotide probes were specific for a fragment sequence amplified among the primordial materials. The oligonucleotide sequences were 5 '-CTAATCCTCGTGGCCAATCTTCTATG-3' (SEQ ID NO: 26) for the human Mel-lb receptor; 5 '-TTGGTGCTGATGTCGATATTTAACA-3' (SEQ ID NO: 27) for the human receptor Mel-la; and 5 'CACTGAACTTCTGATTCGCA-AACTT-3' (SEQ ID NO: 28) for histone-H3.3. Hybridization conditions were 45 ° C overnight in 0.5 M NaP04 (pH 7.2), 7% SDS, 1% BSA, and 1 mM EDTA. The spots were washed twice in 0.2 M NaP04, 1% SDS and 1 mM EDTA at 45 ° C for 30 minutes. A 364 bp fragment of the rat homologue of the human receptor cDNA Mel-lb was cloned by RT-PCR from rat brain RNA; the rat cDNA fragment was 81% identical to the amino acid level with the human Mel-lb receptor. The rat fragment was used to probe a Northern blot containing 5 μg of poly (A) + ALRN from each of 20 different rat tissues. For more information, hybridization in if you using an anti-sense cRNA probe to the rat fragment did not reveal a hybridization signal in PT or SCN, sites that gave a positive hybridization signal in the same run in yes using an anti-cRNA probe -felt to receiver Mel-la (Reppert, SM, Weaver, DR and Ebisawa, T. (1994) Neuron 13: 1177-1185). Due to the apparent low level of transcripts of * receptor, was used to assay comparative RT-PCR to examine the expression of the human Mel-lb and Mel-la receptor genes in six human tissues (figure 22). The human Mel-lb receptor was expressed in the retina, with much less expression in the whole brain and hippocampus. The human Mel-la receptor was clearly expressed in the entire brain, with barely detectable expression in the retina and hippocampus. No mRNA was detected from the Mel-lb and Mel-la receptors in the pituitary, liver or spleen. To ensure consistency in the amount of reverse transcribed RNA and the efficiency of reverse transcription reactions between the tissues examined, the histone-H3.3 cDNA was amplified from each tissue examined; Extremely comparable amplifications occurred among the six tissues (Figure 22). Relative Characteristics of the Human Receptors Mßl-la and Mßl-lb dß High Affinity One aspect that distinguishes the Mel-lb receptor from the Mel-la receptor is its tissue distribution. The substantially greater expression of the Mel-lb receptor in the retina suggests that melatonin can exert its effects on retinal physiology in mammals through this receptor. Melatonin inhibits the Ca + 2 -dependent release of dopamine in the rabbit retina by activation of receptors with pharmacological specificity comparable to that reported here for the 'Wb- receptor Mel-lb (Dubocovich, ML and Takahashi, J. (1987 ) PNAS USA 84: 3916-3920; Dubocovich, ML (1983) Nature 306: 782-4). Melatonin appears to act on the retina to affect various light dependent functions, including photopigment disc fragmentation and phagocytosis (Besharse, JC and Dunis, DA (1983) Science 219: 1341-1343; Cahill, GM, Grace, MS and Besharse, JC (1991) Cell, Mol.Neurobiol., 11: 529-560). The discovery of the Mel-lb receptor that has similar binding characteristics and functional to those of the Mel-la receptor makes it conceivable that the Mel-lb receptor also participates in the circadian and / or reproductive actions of melatonin. Although the mRNA of the Mel-lb receptor is not detectable by hybridization in itself in SCN or rat PT, it can be present and functional in these or other neural sites at undetectable levels using conventional detection methods. A second distinctive aspect of the Mel-lb receptor is its location of chromosomes. The Mel-lb melatonin receptor maps to human chromosome llq21-22, a syngeneic region to mouse chromosome 9 in the D2-dopamine receptor region (Drd2) and the Thymus 1 (Thyl) cell antigen site (Goldsborough and collaborators (1993) Nucí Acids Res. 21: 127-132; Seldin, MF, Saunders, AM, Rochelle, JM and Howard, TA (1991) Genomics 9: 678-685). This contrasts with the Mel-la receptor that maps the human chromosome 4q35.1 and the mouse chromosome 8. In this way, these two structurally and functionally related melatonin receptors did not evolve merely by simple tandem duplication of an ancestral gene , but suggest that other mechanisms were involved, such as rearrangement and duplication of chromosomes. The discovery of a new member of the melatonin receptor family coupled to G protein shows that at least two distinct genes have evolved to sub-serve the functions of melatonin. The development of a method of identifying pharmacological agents that selectively affect the function of the Mel-la and Mel-lb receptors is an important therapeutic application available through the disclosed invention. Relative Characteristics of the Receptors d-Melatonin dß High affinity d Xenopus v Mammals An acute transfection of COS-7 cells with the melatonin receptor of Xenopus and the clones of the sheep receptor Mel-la results in transient expression of receptors that bind 125 I -melatonin with high affinity (figures 9 and 12b). Additionally, the specific binding of 125 I-melatonin to the Xenopus receptor expressed transiently in cells is inhibited by six ligands in an order in rank that is identical to that reported for the endogenous Mel-la receptor in reptiles, birds and mammals (Figure 9) (Figure 9). Dubocovich et al. (1987) supra; Rivkees et al. (1989) supra; Morgan, P.J. et al. (1989) supra). The ability of the high affinity melatonin receptor of Xenopus, recombinant to inhibit the stimulated increase by forskolin of cAMP accumulation in stably transfected CHO cells is consistent with endogenous receptor studies showing that a major path of signal transduction to the receptor High affinity mel-la is the inhibition of adenylyl cyclase (Abe, K. et al. (1969) supra; White et al. (1987) supra). Finally, the Xenopus melatonin receptor mRNA is moderately expressed in the cells whose RNA was used to generate the cDNA library. In this way, the cloned receptor reliably mediates the potent effects of melatonin on the aggregation of pigment in frog melanofora. Structurally, the protein encoded by the melatonin receptor cDNA defines a new receptor group within the large superfamily of G-protein coupled receptors. Previous studies using 125 I-Mel quantitative Pr 'autoanalysis in the human SCN have generally shown high affinity for melatonin and 6-chloromelatonin and very low affinity for serotonin (Reppert et al. (1988) supra), all of which is consistent with the pharmacological characteristics of the recombinant human receptor (Figure 15). The pharmacological characteristics of the sheep recombinant Mel-la receptor are virtually identical to those of the endogenous melatonin receptor in sheep PT (Morgan et al., J. Endocrinol. "IßÉ (1989) 1: 1-4). The lamb-la receptors of sheep and humans in their affinities for 6-chloromelatonin are reproducible and equally apparent when the sheep and human Mel-la receptors are examined in the same test run.Dexpression Polypeptides The polypeptides according to the invention can be produced by transforming a suitable host cell with all or part of the cDNA fragment encoding the high affinity melatonin receptor (eg, the cDNAs described above) into a suitable expression vehicle, and the expression of the receptor. technicians in the field of molecular biology will understand that any of a wide variety of expression systems can be used to provide r the recombinant receptor protein. The precise host cell used is not critical to the invention. The receptor can be produced in a prokaryotic host (e.g., E. coli) or in a eukaryotic host # (e.g., Saccharomyces cerevisiae or mammalian cells, e.g., C0S-6M, COS-7 NIH / 3T3, or ovary of Chinese hamster). Such cells are available from a wide range of sources (for example, the American Type Culture Collection of Rockville, Maryland, United States). The method of transfection and the selection of the expression vehicle will depend on the selected host system. Transformation and transfection methods of mammalian cells are described, for example "aB in Ausubel et al. (Current Protocols in Molecular Bioloay, John Wiley &Sons, New York (1989)), expression vehicles can be selected from the provided, for example in Clonina Vectors: A Laboratorv Manual (Pouwels, PH et al. (1985), 1987 supplement) A particularly preferred expression system is Chinese hamster ovary (CHO) cells (ATCC access No. CCL). 61) transfected with a pcDNAl / NEO expression vector (InVitrogen, San Diego, California, United States.) PcDNAl / NEO provides an SV40 origin of replication that allows replication in mammalian systems, a selectable neomycin gene, and SV40 splice sites and polyadenylation The DNA encoding the high affinity human, sheep or Xenopus receptor, or an appropriate receptor fragment or analog (as described above) will be ia inserted in the vector pcDNAl / NEO in an orientation designed to allow expression. Other preferable host cells that can be used in conjunction with the pcDNAl / NEO expression vehicle include NIH / 3T3 cells (ATCC acceeo No. 1658). The expression can be used in a method of analysis of the invention (described below) or, if desired, the recombinant receptor protein can be isolated as described below. Alternatively, the high affinity melatonin receptor (or receptor fragment or analog) is expressed by a stably transfected mammalian cell line. Several suitable vectors for stable transfection of mammalian cells are available to the public, for example see Pouwels et al. (Supra).; Methods for constructing such cell lines are also available publicly, for example in Ausubel et al. (supra). In one example, cDNA encoding the receptor (or receptor fragment or analog) is cloned into an expression vector that includes the dihydrofolate reductase (DHFR) gene. The integration of the plasmid and, therefore, the gene encoding the high affinity melatonin receptor in the chromosome of the host cell are selected by inclusion of 0.01-300 μM methotrexate in the cell culture medium (as described in Ausubel et al. collaborators, supra). This dominant selection can be achieved in most cell types. The expression of the recombinant protein can be increased by DHFR-mediated amplification of the transfected gene. Methods for selecting cell lines carrying gene amplifications are described in Ausubel and-61-co-workers (supra); such methods generally involve extended culture in a medium containing gradually increasing levels of methotrexate. DHFR-containing expression vectors commonly used for this purpose include pCVSEII-DHFR and pAd26SV (A) (described in Ausubel et al., Supra). Any of the host cells described above or, preferably a CHO cell line deficient in DHFR (eg, CHO DHFR cells, ATCC accession No. CRL 9096) are among the preferred host cells for DHFR selection of a stably transfected or amplified cell line of gene mediated by DHFR. A particularly preferred stable expression system is a CHO cell (ATCC) stably transfected with a pcDNAl / NEO expression vector (InVitrogen, San Diego, California, United States). Expression of the recombinant receptor (e.g., produced by any of the expression systems described herein) can be assayed by immunological methods, such as Western blot analysis or immunoprecipitation of recombinant cell extracts, or by immunofluorescence of recombinant cells intact (using for example the methods described in Ausubel et al., supra). The recombinant receptor protein is detected using an antibody directed to the receptor. Methods for producing non-melatonin receptor antibodies, the intact receptor or a peptide including a suitable high-affinity melatonin receptor epitope are described below. To detect the expression of a high affinity melatonin receptor fragment or analog, the antibody is preferably produced using, as an immunogen, an epitope included in the fragment or analog. Once the recombinant high affinity melatonin receptor protein (or fragment or analogue thereof) is expressed, it is isolated, for example using immunoaffinity chromatography. In one example, a high affinity melatonin anti-receptor antibody can be bound to a column and used to isolate the intact receptor or receptor fragments or analogs. Lysis and fractionation of cells carrying the receptor before affinity chromatography can be carried out by conventional methods (see, for example, Ausubel et al., Supra). Once isolated, the recombinant protein can, if desired, be further purified, for example ? by high performance liquid chromatography (see, for example, Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, Work and Burdon, eds., Elsevier (1980)). The receptors of the invention, particularly particularly short receptor fragments, can also be produced by chemical synthesis (for example, by the methods described in Solid Phase Peptide Svnthesis (1984), 2nd edition, The Pierce Chemical Co., Rockford, Illinois, States Assays of the Receptor Function of Mßlatonin dβ High Affinity Fragments or analogs of the receptor useful in the invention are those that interact with melatonin Such an interaction can be detected by a functional assay in vi tro (for example, the assay of cAMP accumulation). described herein.) This assay includes, as components, forskolin for accumulations of cAMP induced, melatonin and a recombinant high affinity melatonin receptor (or a fragment or suitable analogue), configured to allow melatonin binding (eg, those polypeptides described herein). Sigma melatonin and forskolin can be obtained from Sigma (St. Louis, Missouri, United States) or a similar provider. Preferably, the high affinity melatonin receptor component is produced by a cell that does not substantially exhibit the receptor on its surface naturally, for example by engineering applied to such a cell for * contain nucleic acid encoding the receptor component in an appropriate expression system. Suitable cells are, for example, those discussed above with respect to the production of the recombinant receptor, such as CHO or COS-7 cells. Determination Analysis of High affinity Mßlatonin Receptor Antagonists and Agonists As discussed above, one aspect of the invention includes analyzing compounds that antagonize the interaction between high affinity na, thereby preventing or reducing the cascade of events that are mediated by that interaction. The elements of the analysis are forskolin to induce the intracellular accumulation of cAMP, melatonin and recombinant high affinity receptor (or a suitable fragment or analog of the receptor, as noted above) configured to allow detection of melatonin function. As described above, melatonin and forskolin can be acquired from Signa, and the full-length Mel-la receptor, lamb, or the high-affinity melatonin receptor from Xenopus, or a human receptor or lb high-affinity melatonin. (or fragment or analog that binds melatonin to the human, Xenopus or sheep receptors) can be produced as described herein. Preferably, such assay of assay analysis is carried out using stably transfected cell lines with the high affinity melatonin receptor. Most preferably, the non-transfected cell line does not substantially exhibit receptor on its cell surface. The activation of the heterologous high affinity melatonin receptor with melatonin or an agonist (see above) leads to the reduction of the intracellular cAMP concentration, providing convenient means to measure the activity of melatonin or agonist. Such an agonist is expected to be a useful therapeutic agent for circadian rhythm disorders such as "jet lag", day / night cycle disorders in humans, or alterations in the mating cycle in animals such as sheep. Appropriate candidate agonists include melatonin analogues or other agents that mimic the action of melatonin. The inclusion of potential antagonists in the determination assay assay together with melatonin allows determination analysis and the identification of authentic receptor antagonists as those that reduce the intracellular accumulation of melatonin-mediated cAMP. The recipient carrier cells incubated with forskolin (for concentric ¬ * cAMP tion by initial induction) or melatonin (alone, ie in the absence of inhibitor) are used as a "control" against which antagonist assays are measured. Appropriate candidate antagonists include high affinity melatonin receptor fragments, particularly fragments of the protein predicted to be extracellular (see Figure 7) and therefore feasible to bind melatonin; such preferred fragments would include six or more amino acids. Other candidate antagonists include melatonin analogs as well as other peptide and non-peptide compounds and high affinity melatonin receptor anti-antibodies. Another aspect of the invention includes analyzing for compounds that act as high affinity melatonin receptor agonists; such compounds are identified as those that bind a high affinity melatonin receptor and mimic the cascade of events that are normally mediated by that interaction. This determination assay requires recombinant cells that express the recombinant high affinity melatonin receptor (or suitable receptor fragment or analog, as sketched herein), configured to allow detection of high affinity melatonin receptor function. In one example, a candidate agonist is added to CHO cells stably expressing the recombinant receptor and the intracellular levels of cAMP are measured (as described above). An agonist useful in the invention is one that mimics the * signal transduction pathway mediated by normal melatonin leading, for example, to a reduction in the intracellular concentration of cAMP. Appropriate candidate agonists include melatonin analogues or other chemical agents capable of mimicking the action of melatonin. Preparation of a Transgenic Animal Containing Genes Rßcomb-Fr nantßs Melatonin-la and / or Melatonin-lb There are several means by which transgenic animals can be made. A transgenic animal (such as a mammal) can be constructed by one of several techniques, including objectified insertion of an exogenous melatonin receptor gene into the endogenous gene of the animal, or other methods well known to those skilled in the art. A transgenic mammal whose germ cells and somatic cells contain an exogenous receptor gene the or lb of melatonin is produced by methods known in the art. See, for example, U.S. Patent No. 4,736,866, which describes the production of a transgenic mammal, incorporated herein by reference. Generally, the DNA sequence encoding an exogenous receptor gene or Ib of melatonin is introduced into the animal, or an ancestor of the animal, into an embryonic stage (preferably, the unicellular stage, or fertilized oocyte, and generally not after around the eight cell stage). There are several methods known in the art for introducing a foreign gene into an animal embryo to achieve stable expression of the foreign gene. One method is to transfect the embryo with the gene as it occurs naturally, and select transgenic animals in which the foreign gene has been integrated into the genome in a place that results in its expression. Other methods involve modifying the foreign gene or its control sequences before introduction into the embryo. For example, the melatonin Ib or Ib receptor gene can be modified with an inducible, enhanced, tissue-specific promoter. Transgenic mammalian tissues are analyzed for the presence of the exogenous melatonin or lb receptor, either by directly analyzing the mRNA, or by assaying the tissue with respect to the receptor or Ib of exogenous melatonin. Use of the Transgenic Mammal to Determine Effects Related to the Melatonin Agonist or Antagonist * The animals described above can be used to determine whether the candidate compounds are antagonists or melatonin agonists for Mel-la or Mel-lb receptors. Determination of In vivo Viral Melatonin Agonists or Antagonists One aspect of the invention includes analyzing for determination compounds that agonize or antagonize melatonin activity in vivo. The elements of the analysis are a transgenic mammal Mel-la or Mel-lb and a potential melatonin agonist or antagonist in a formulation suitable for administration to the mammal. The detection of a change in the phenotype of interest (for example, sleep / wake cycle or reproductive cycle) in relation to a transgenic control mammal to which no agonist or antagonist has been administered indicates a potentially useful candidate compound. High Affinity Mßlatonin Anti-Receptor Antibodies High affinity melatonin receptor (or immunogenic receptor fragments or analogs) can be used to create antibodies useful in the invention. As described above, the preferred receptor fragments for the production of antibodies are those fragments deduced or experimentally shown to be extracellular. Antibodies directed to high affinity melatonin receptor peptides are produced as follows. Peptides corresponding to all or part of the erminal extracellular loops are produced using a peptide synthesizer, by conventional techniques. The peptides are coupled to KLH with N-hydroxysuccinimide ester of m-maleimide benzoic acid. The peptide-KLH is mixed with Freund's adjuvant and injected into animals, for example guinea pigs or goats, to produce polyclonal antibodies. Monoclonal antibodies can be prepared using the high affinity melatonin polypeptides before "ßr described and conventional hybridoma technology (see, for example, Kohier et al., Nature (1975) 256: 495; Kohier et al., Eur. J. Immunol. (1976) 6: 292; Kohier et al., Eur. J. Immunol. (1976) 6: 511; Hammerling et al., In Monoclonal Antibodies and T Cell Hybridomas, Elsevier, New York (1981); and Ausubel et al., supra). The antibodies are purified by affinity chromatography of antigens to the peptide. Once produced, the antibodies are tested for specific recognition of the high affinity melatonin receptor by Western blot analysis or immunoprecipitation (by the methods described in Ausubel et al., Supra). Antibodies that specifically recognize the high affinity melatonin receptor are considered feasible candidates for useful antagonists; such candidates are further tested for their ability to specifically interfere with the interaction between melatonin and its receptor (using the assays of functional antagonists described herein). Melatonin antagonizing antibodies, high affinity melatonin receptor binding or high affinity melatonin receptor function are considered useful as antagonists in the invention. Therapy Particularly suitable therapeutic agents for the treatment of circadian rhythm disorders in humans, as well as for regulating changes in the reproductive cycle of seasonal breeding animals are the agonists and antagonists described above, formulated in an appropriate buffer such as physiological saline. Where it is particularly desirable to mimic a conformation of the receptor fragment at the membrane interface, the fragment can include a sufficient number of residues adjacent to the transmembrane. In this case, the fragment may be associated with an appropriate lipid fraction (for example, in lipid vesicles or bound to fragments obtained by breaking a cell membrane). Alternatively, high affinity melatonin anti-receptor antibodies produced as described above can be used as therapeutic agents. Again, the antibodies would be administered in a pharmaceutically acceptable buffer (eg, physiological saline). If appropriate, the antibody preparation can be combined with a suitable adjuvant.

# The therapeutic preparation is administered according to the condition to be treated. Ordinarily, it will be administered intravenously, at a dose, of a duration and with the appropriate timing to stimulate the desired response. Appropriate timing refers to the time in the natural circadian rhythm at which administration of the therapeutic preparation stimulates the desired response. Alternatively, it may be convenient to administer the oral, nasal or therapeutic agent.

# Topically, for example as a liquid or dew. Again, the doses are as described above. The treatment can be repeated as necessary to alleviate the symptoms of disease. High affinity melatonin receptor agonists can be used to re-cycle the endogenous melatonin rhythm of humans; relieve the symptoms of "jet lag" in humans; shifting the phase of the sleep / wake cycle of some blind individuals, reinforcing the endogenous melatonin rhythm using low intensity light / dark cycle; control ovulation in humans; and alter reproductive cycles in animals of seasonal reproduction. Antagonists may be useful for controlling the onset or timing of puberty in humans. The methods of the invention can be used to analyze the agonists and antagonists of the therapeutic receptor in terms of their effectiveness to reduce the intracellular production itmo circadio; or alter the reproductive cycles by the assays described above. Where a non-human mammal is treated or where a therapeutic agent for a non-human animal is analyzed, the high affinity melatonin receptor or receptor fragment or analog or the antibody employed are preferably specific for that species. Other Ways of Performing Polypeptides according to the invention include # any high affinity melatonin receptors (as • * described in the present). Such receptors can be derived from any source, but are preferably derived from a vertebrate animal, for example a human being, a sheep or a frog. These polypeptides are used, by way of example, to analyze for antagonist antagonists or agonists that mimic a melatonin: receptor interaction (see above). The polypeptides of the invention also include any analog or fragment of a high affinity melatonin receptor capable of interacting with melatonin (eg, those derived from the extracellular domains of the high affinity melatonin receptor). Such analogs and fragments can also be used in analyzes to determine antagonists or agonists of the high affinity melatonin receptor. In addition, that subset of receptor fragments or analogs that bind melatonin and are preferably soluble (or insoluble and formulated in a lipid vesicle) can be used as a part of the endogenous melatonin cycle, possibly providing induction of puberty in humans . The efficacy of an analog or fragment of the receptor depends on its ability to interact with melatonin; such interaction can be easily assayed using functional assays of the high affinity melatonin receptor (eg, those described herein). Specific analogs of the receptor of interest include full or partial length receptor proteins, including an amino acid sequence that differs only by conservative amino acid substitutions, for example substitution of one amino acid by another of the same class (eg, valine by glycine, arginine by lysine, etc.) or by one or more non-conservative amino acid substitutions, deletions or insertions located at positions in the amino acid sequence that do not destroy the ability of the receptor to signal melatonin-mediated wÉt reduction in the intracellular concentration of cAMP ( for example, as it was tried before). Specific fragments of the receptor of interest include any portion of the high affinity melatonin receptor that is capable of interacting with melatonin, for example, all or part of the extracellular domains (described above). Such fragments may be useful as antagonists (as described above), and are also useful as immunogens to produce antibodies that neutralize the receptor activity of (e.g., interfering with the interaction between the receptor and melatonin.; See later) . The extracellular regions of the novel high affinity melatonin receptors can be identified by comparison with other related proteins of similar structure (eg, other members of the superfamily of G protein-coupled receptors); Useful regions are those that exhibit homology to the extracellular domains of well-characterized members of the family. Alternatively, from the primary amino acid sequence, the secondary protein structure, and hence the extracellular domain regions, can be deduced in a semi-empirical fashion, using a hydrophobicity / hydrophilicity calculation such as the Chou method. Fasman (see, for example, Chou and Fasman, Ann. Rev. Biochem. (1978) 47: 251). The hydrophilic domains, particularly those surrounded by hydrophobic strands (eg, transmembrane domains), present themselves as strong candidates for extracellular domains. Finally, the extracellular domains can be identified experimentally using standard enzymatic digestion analysis, for example tryptic digestion analysis. The candidate fragments (e.g., any extracellular fragment) are tested for their interaction with melatonin by the assays described herein (e.g., - $ - the assay described above). Such fragments are also tested for their ability to antagonize the interaction between melatonin and its endogenous receptor using the assays described herein. Analogs of useful fragments of the receptor (as described above) can also be tested for their effectiveness as components or antagonists of determination analysis (using the assays described herein); such analogs are also considered useful in the invention. Other embodiments are within the claims.

P

Claims

-f CLAIMS 1. Substantially pure DNA encoding a high affinity melatonin receptor.
2. The DNA of claim 1, wherein said DNA is genomic DNA.
3. The DNA of claim 1, wherein said DNA is cDNA.
4. The DNA of claim 1, wherein said DNA is from a mammal.
5. Substantially pure DNA having the sequence of Figure 1 (SEQ ID NO: 1), or its degenerate variants, and encoding the amino acid sequence of Figure 1 (SEQ ID NO: 2).
6. Substantially pure DNA having the sequence of Figure 2 (SEQ ID NO: 3), or its degenerate variants, and encoding the amino acid sequence of Figure 2 (SEQ ID NO: 4).
7. Substantially pure DNA, comprising the DNA sequence of Figure 4 (SEQ ID NO: 5), or its degenerate variants, and encoding an amino acid sequence comprising the amino acid sequence of Figure 4 (SEQ ID NO. : 6).
8. Substantially pure DNA, comprising the DNA sequence of Figure 5 (SEQ ID NO: 11), or its degenerate variants, and encoding an amino acid sequence comprising the amino acid sequence of Figure 5 (SEQ ID NO. : 12).
9. Substantially pure DNA, comprising the DNA sequence of Figure 3 (SEQ ID NO: 13), or its degenerate variants, and encoding an amino acid sequence comprising the amino acid sequence of Figure 3 (SEQ ID NO. : 14).
10. Substantially pure DNA, comprising the DNA sequence of Figure 6 (SEQ ID NO: 15), or its degenerate variants, and encoding an amino acid sequence comprising the amino acid sequence of Figure 6 (SEQ ID NO. : 16).
11. Substantially pure DNA having 50% or more sequence identity with the DNA sequence of Figure 2 (SEQ ID NO: 3) and encoding a protein capable of binding melatonin.
12. Substantially pure DNA that hybridizes to the DNA sequence of Figure 1 (SEQ ID NO: 1) under conditions of high stringency.
13. Substantially pure DNA that hybridizes to the DNA sequence of Figure 2 (SEQ ID NO: 3) under conditions of high stringency.
14. Substantially pure DNA that hybridizes to the DNA sequence of Figure 4 (SEQ ID NO: 5) under conditions of high stringency.
15. Substantially pure DNA that hybridizes to the DNA sequence of Figure 5 (SEQ ID NO: 11) under conditions of high stringency.
16. Substantially pure DNA that hybridizes to the DNA sequence of Figure 3 (SEQ ID NO: 13) under conditions of high stringency.
17. Eustancially pure DNA that hybridizes to the DNA sequence of Figure 6 (SEQ ID NO: 15) under conditions of high stringency.
18. Substantially pure high affinity melatonin receptor protein.
19. The receptor protein of claim 18, having an amino acid sequence substantially identical to the amino acid sequence shown in Figure 1 (SEQ ID NO: 2).
20. The receptor protein of claim 18, having an amino acid sequence substantially identical to the amino acid sequence shown in Figure 2 (SEQ ID NO: 4).
21. The receptor protein of claim 18, comprising the amino acid sequence of Figure 3 (SEQ ID NO: 6).
22. The receptor protein of claim 18, having an amino acid sequence substantially identical to the amino acid sequence shown in Figure 4 (SEQ ID NO:
23. The receptor protein of claim 18, having an amino acid sequence substantially identical to the amino acid sequence shown in Figure 3 (SEQ ID NO: 14)
24. The receptor protein of claim 14, having an amino acid sequence substantially identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: 16) )
25. A substantially pure polypeptide, having an amino acid sequence that is at least 80% identical to the amino acid sequence shown in Figure 1 (SEQ ID NO: 2), wherein a) said polypeptide binds melatonin; and b) said polypeptide mediates a reduction in the intracellular concentration of cAMP in a cell expressing said polypeptide on its surface.
26. A substantially pure polypeptide, having an amino acid sequence that is at least 80% identical to the amino acid sequence shown in Figure 2 (SEQ ID NO: 4), wherein a) said polypeptide binds melatonin; and b) said polypeptide mediates a reduction in the intracellular concentration of cAMP in a cell expressing said polypeptide on its surface.
27. A substantially pure polypeptide, having an amino acid sequence that is at least 80% identical to the amino acid sequence shown in Figure 5 (SEQ ID NO: 12), wherein a) said polypeptide binds melatonin; and b) said polypeptide mediates a reduction in the intracellular concentration of cAMP in a cell expressing said polypeptide on its surface.
28. A substantially pure polypeptide, having an amino acid sequence that is at least 80% identical to the amino acid sequence shown in Figure 3 (SEQ ID NO: 14), wherein a) said polypeptide binds melatonin; and b) said polypeptide mediates a reduction in the intracellular concentration of cAMP in a cell expressing said polypeptide on its surface. Tp
29. A substantially pure polypeptide, having an amino acid sequence that is at least 80% identical to the amino acid sequence shown in Figure 6 (SEQ ID NO: 16), wherein a) said polypeptide binds melatonin; and b) said polypeptide mediates a reduction in the intracellular concentration of cAMP in a cell expressing said polypeptide on its surface.
30. A substantially pure polypeptide which is a < fragment or analog of a high affinity melatonin receptor, comprising a domain capable of binding melatonin and mediating a reduction in the intracellular concentration of cAMP.
31. A vector comprising the DNA of claim 1.
32. A cell containing the DNA of the claim
33. A method of testing a candidate compound for the ability to act as an agonist of a high affinity melatonin receptor ligand, said method comprising: a) contacting said candidate compound with a cell expressing a protein on its surface high-affinity melatonin receptor, recombinant, or a fragment or analog that binds melatonin thereof; b) measuring the intracellular concentration of cAMP in said cell; and c) identifying said candidate compound as an agonist wherein said contact causes a reduction in the intracellular concentration of cAMP.
34. A method of testing a candidate compound for the ability to act as an antagonist of a high affinity melatonin receptor ligand, said method comprising: a) contacting said candidate compound with a cell expressing on its surface a recombinant high affinity melatonin receptor protein, or a fragment or analog that binds melatonin thereto; b) measuring the binding between said receptor protein and melatonin; and c) identifying said candidate compound as an antagonist wherein said contact causes a reduction in the binding between said recombinant high affinity melatonin receptor protein and melatonin.
35. The method of claim 33 or 34, wherein said cell is a mammalian cell that normally does not substantially exhibit high affinity melatonin receptor on its surface.
36. A therapeutic composition comprising as an active ingredient a high affinity melatonin receptor agonist, said active ingredient being formulated in a physiologically acceptable carrier.