MXPA96006195A - Composition to induce an immune response mucos - Google Patents

Abstract

A pharmaceutical composition for inducing a protective immune response to an antigen at a mucosal effect site in a host mammal is disclosed. The composition includes at least two identical or different components each containing an immune response inducing agent selected from the antigen, with the proviso that the antigen is a protein antigen, and an expression cassette capable of expressing the antigen, for concurrent administration or consecutive. One of the components is formulated for nasal / oral delivery so that the inducing agent is focused towards the site (s) inducing the immune response in the nose / oral cavity / pharynx or in the salivary glands, while the other component is formulated for mucosal delivery Properly different from the nasal delivery so that the inducing agent is focused towards the site (s) inducing an immune response at the effector site when an immune response is desired. Said composition may also optionally include a third component that is identical or different from the first two components and is formulated for systemic administration.

Description

COMPOSITION TO INDUCE A IMMUNE MUCOSICAL RESPONSE The present invention generally relates to a vaccination kit for inducing in a mammal an immunoprotective response against a pathogenic organism that infects mucous membranes. The immunity cells can be concentrated within the organs or they can form more or less diffuse lymphoid tissue, these tissues and organs collectively constitute the lymphoid system. Primary lymphoid organs are recognized, which are the major lymphoid sites (thymus, bone marrow), and secondary lymphoid organs and tissues, within which the lymphocytes can interact with each other or with the antigen. Secondary lymphoid organs include, but are not limited to, the spleen, lymph nodes, and lymphoid formations associated with mucous membranes (MALT for lymphoid tissue associated with mucous membranes), Peyer's patches, and palladium tonsils. In addition to the organized lymphoid tissue that constitutes MALT, a large number of lymphocytes are found in the mucosa of the stomach, small intestine, colon, bronchi, and various other organs. After differentiation in the primary lymphoid organs, the lymphocytes migrate to the secondary lymphoid organs. The latter can induce sites for systemic immunity or for mucosal immunity. These can be referred to as "systemic" or "mucosic" organs. Among the "systemic" organs, the spleen is recognized, which responds to the antigens that enter the blood circulation, and the peripheral ganglia, which provide protection against antigens that enter the anatomical region for which they can perform lymphatic drainage. . A list of different nodes in relation to the regions that can drain (inductive or effector sites) is presented in the following table. The immune system associated with the mucosa, in turn, protects the body against antigens that enter via the mucous epithelial surfaces and reside in these. This includes the Waldeyer's ring and lymphoid tissues are found associated with the airways (BALT for lymphoid tissue associated with the bronchi), with the digestive duct (GALT for lymphoid tissue associated with the intestine) and with the urogenital tracts. The immune system associated with mucous membranes (inducing sites) is present in the table below. Once stimulated in the secondary induction organs, the lymphocytes can migrate towards the effector sites transported by the lymph, through the ganglia associated with the effector sites, where appropriate via the larger lymph nodes draining these first lymph nodes, the lymphatic effluent venules that they end up in the thoracic duct.

The lymphocytes from the latter join the circulation of blood through which the cells make their way to the target organs or effector sites. In consideration of the MALT lifoid cells, the latter recirculate towards the mucous areas. For example, cells stimulated in Peyer's patches pass through the associated nodes and then into the blood to become localized in certain mucous sites. This selective recirculation is due to the ability of the lympho sites to recognize adhesion molecules expressed specifically in the endothelial cells of the postcapillary mucosal venules. As a result of this mechanism, the antigenic stimulation of a mucosal (inducing) area can induce a response in other mucous (effector) areas. To date, numerous immunization methods have been reported in the scientific literature. The key features of these methods are generally speaking, (i) the nature of the immunogenic substance, (ii) the route or routes of administration of the immunogenic substance, and also (iii) the formulation of the immunogenic substance. Considering the nature of the immunogenic substance, the possibility of using an immunogenic substance that is of a nucleic acid nature (RNA, DNA) as an alternative to an antigen that is protein in nature has already been known for a long time. Hence, there is no need to elaborate more on this aspect. Immunization routes and methods that favor the prevention or treatment of mucosal infections have already been subjected to a number of studies, but, unlike this, they have not been as successful as vaccines against systemic infections. However, these studies collectively indicate that, when a pathogen that establishes itself in the mucosa is involved, immunization by systemic administration does not seem sufficient for it to develop adequate protection. It seems desirable but essential to induce an immunization by mucosal administration, possibly in addition to an immunization by systemic administration, in order to convert this type of infection effectively. The immunization by mucosal administration makes it possible in essence to stimulate the lymphoid tissue by draining the mucosa (s) where the pathogen is loaded and thus obtain one. immune response focused on this / these mucosa (s). Immunoglobulins type A (IgA) constitute the majority of immunoglobulins on the surface of the gastrointestinal, respiratory, urogenital or other mucous membranes. They are hidden within these mucous membranes and must confer protection against infections that affect these sites. An immune response is normally obtained after immunization by mucosal administration, either directly in the effector mucosa or in another mucous site at a distance from the site in which the infection is to be combated. The mucosal routes that are initially accessible for immunization are the oral route, the intragastric route, the nasal route, the urogenital route, and the rectal route. However, the oral route is one in which the option preferably fails to account for its ease of use either for vaccination against infections of the gastrointestinal mucosa or for vaccination against infections that affect another mucosa. To illustrate this point, several examples of the prior art are given, below: Recently, Czinn et al., Vacuna (1993) 11: 637 have proposed in draft a vaccination method against HelicoJater pylori, the pathogen of a large number of animals. stomach ulcers Germ-free mice received a sonicate of H. felis with cholera toxin as an auxiliary, via the in ragastric route (sonication administered directly by intubation inside the stomach). After a change with H. felis, it was found that the immunized mice had been protected. This procedure is referred to for convenience in the rest of this document "as oral immunization". The equivalent of this document is found in the Czinn &; Nedrud WO 93/20,843. Jertborn et al., Vacuna (1992) 10: 130 reports a cholera vaccination study conducted with a small group of Swedish subjects. The vaccine was administered in two doses, in the form of a liquid solution to be ingested.

This vaccine proved effective and risk free. Vaccination against influenza via the nasal route has been carried out successfully in children and adults, as reported by Anderson et al., J. Clin. Microbiol. (1992) 30.: 2230 and Treanor et al., Ann inter. Med. (1992) 117: 625. Gallich et al., J. Infect. Dis. (1993) 168 : 622 shows that it is possible to induce both a mucosal immune response and a systemic response after intranasal administration of a recombinant adenovirud expressing a herpes simplex virus (BH) glycoprotein B (HVS). In conclusion, the authors suggest that, speaking in general, their technique could allow to obtain a prolonged period protection against viruses transmitted by mucous membranes or sexually. Some studies, such as Forest et al., Vacuna (1990) 8: 209, suggest that the rectal route could be a common entry route to the immuno-mucosal system as a whole and that it should be possible to induce an immuno-mucosal response at the site from the rectal mucosa, used as an entry route for the immunogenic substance. The combination of different immunization routes has already been described by several authors to be a means of choice to obtain an optimal response. The combination of a mucosal administration and a systemic administration is, for example, described in the following documents: Karen et al., Infect. Immun. (1988) 56 (4): 910 shows a method of immunization by combined routes, parenteral and oral, gives better results in terms of IgA response against Shigella flexneri than an immunization via a single route. In practice, mice receive the antigen intramuscularly and intragastrically by means of a tube under anesthesia. Yoshimura et al., Arch. Otolaryngol. Head Neck Surg. (1991) 117: 889 proposes vaccination against pneumocosis otitis by combining systemic and oral administrations. The immunization protocols are tested with guinea pigs. The so-called oral administration is carried out, in fact, in the duodenum or stomach by means of a catheter, or alternatively consists of taking enteric capsules. The authors show that only the combination of systemic administration + oral administration in the form of capsules gives good results. Forest et al., Infect. Immun. (1992) £ 0 (2): 465 tests several modes of immunization in men for the purpose of inducing an IgA response against Salmonella tiphi. The oral and subcutaneous routes are used as follows: oral; oral / oral oral / subcutaneous; and subcutaneous / oral. The authors show that a first type of injection followed several days later by a second dose taken orally does not promote the IgA response. In contrast, taking the vaccine orally, repeated once, gives good results. Hartman et al., Infect, Immun. (1994) 62 (2) : 412 describe several immunization protocols against Shigella. One of them in particular comprises a first intraperitoneal or subcutaneous injection, followed by a reinforcing or reinforcing injection via the ocular route. This protocol was tested in the guinea pig model of ceratoconjunctivitis. The authors showed that, in non-aggressive animals, immunization by mucosal administration is necessary for the induction of protection. Double immunization, parenteral and mucosal, increases the level of protection. Nedrud et al., J. Immunol. (1987) 139: 3484 describes a method of immunization against Sendai virus infections (infections of the nasopharynx, which may possibly progress in bronchitis and pneumonia). The effector site in which the immune response could be sought when carrying out this method is from here, the whole respiratory tract. The Nedrud et al. Method comprises two major stages: a primary oral (intragastric) immunization and a reinforcer via the nasal route. Generally speaking, the oral route (intragastric) is not considered as the best route to enable an inducing agent (in this case the Sendai virus) to reach one of the induction sites for an immune response in the respiratory tract. It has now been found that an immune response at a mucosal site of any type and against an antigen of any type could be promoted to a large extent by implementing an immunization protocol that combines several routes. In consecuense, the present invention relates to a pharmaceutical composition for inducing in a host mammal a protective immune response against an antigen, at a mucosal effector site, which comprises at least two identical or different products, each containing an immune response inducing agent. , selected from the antigen, provided the antigen as a protein, a cassette expression capable of expressing the antigen, for a concomitant or consecutive administration; one of the products is formulated to be administered via the naso-buccal route so that the inducing agent is focused towards the inducer site for an immune response in the naso-oropharynx or the salivary glands, the other products are formulated to be administered by an appropriate mucosal route different from the nasal route, so that the inducing agent is focused towards the inducer site for an immune response in the effector site in which the immune response is sought.

Optionally, the pharmaceutical composition according to the invention comprises a third product identical or different from the first two, which contains an immune response inducing agent, selected from antigen and with the proviso that the antigen is of a protein nature, a cassette of expression capable of expressing the antigen and which is formulated for systemic administration, preferably before the two aforementioned products. In other words, the subject of the invention is a kit for inducing in a host mammal a mucosal immune response against an antigen, at an effector site, which comprises: (i) optionally a first immune response inducing agent, selected from a antigen and, with the proviso that the antigen is a protein, an expression cassette capable of expressing the antigen, a DNA or RNA fragment encoding the antigen; and (ii) a second and a third inducing agent for the immune response, selected from the antigen and with the proviso that the antigen is of a protein nature, an expression probe capable of expressing the antigen, a DNA or RNA fragment that encodes to the antigen; with (a) optionally, instructions for the systemic administration of the first inducing agent, (b) instructions for the nasobuccal administration of the second inducing agent, (c) instructions for the administration of the third inducing agent via an appropriate mucosal route, different from the route nasal, so that the antigen is focused towards the site (s) that induces the immune response in the effector site in which the immune response is sought, and (d) instructions for the concomitant or consecutive administration of the first, second and third agent inductor. The invention also relates to a method for inducing in an host mammal an immune response against an antigen, at a mucosal effector site, according to which, in any order: (i) a first immune response inducing agent, selected from the antigen, and with the proviso that the antigen is a protein, an expression cassette capable of expressing the antigen, a DNA or RNA fragment encoding the antigen, is optionally administered systematically to the host mammal; (ii) a second immune response inducing agent selected from the antigen, and with the stipulation that the antigen is a protein, an expression cassette capable of expressing the antigen, a DNA or RNA fragment capable of encoding the antigen, is administered via the nasal and / or buccal route (nasobuccal) to the host mammal; and (iii) a third immune response inducing agent, selected from antigen and, with the stipulation that the antigen be of a protein nature, and an expression cassette capable of expressing the antigen, a DNA and RNA fragment encoding the antigen, is administered to the host mammal via the appropriate mucosal route, different from the nasal route so that the antigen is focused towards the inducer site for the immune response at the effector site in which it is sought. The administration of the first inducing agent can be advantageously carried out in a single dose, by systemic injection such as an intravenous, intramuscular, intradermal or subcutaneous injection. The option of the injection site and the route will depend on the lymph nodes in which you want to focus. It can be noted that if it is necessary, for example, to focus the celiac ganglia, it is preferable to perform the injection in the dorsal-lumbar region using the intramuscular route (instead of the subcutaneous route). It is preferable for this inducing agent to be in the form of particles. The inducing agent is advantageously supplemented with an auxiliary, either by precipitation or by absorption. The auxiliary may be the traditional auxiliary of the aluminum phosphate or calcium hydroxide or phosphate type, or alternatively an auxiliary such as polyphosphazene. It can also be an auxiliary liposome, microsphere or virus-like particles; being especially advantageous to use the latter when it is desired to focus the ganglia that drain the urogenital regions. All these auxiliaries are familiar to a person skilled in the art. The appropriate dose varies according to certain parameters, for example, the individual concerned or the nature of the inducing agent. At an information point, it should be noted that an antigen varies from 5 to 100 μg, preferably from 25 to 50 μg. "Nasobucal route" means, for purposes of the present invention, the route that enables an immunogenic substance to essentially reach Waldeyer's ring or its equivalent, the NALT in species other than the human species. It should be clear that the noso-buccal (or buccal) route should not be confused with what is commonly referred to as the "oral route" and which should be more appropriately designated as the "gastrointestinal route". The oral route, including the gastrointestinal route, must be able to induce the agent (antigen) to reach predominantly the mucosa of the lower regions (digestive duct and mainly the small intestine and Peyer's patches), while the oral route transports the inducing agent essentially to the mucosa of the upper regions. The entrance site of the oral route and that of the oral route may be the same; in this case, the entrance site is the mouth. However, the trajectories are essentially different. The same comment applies in the case of the pulmonary route, which enables the inducing agent to reach the mucosa of the middle regions (bronchi). For purposes of optimizing the immune response that is desired, the formulation of the immunogenic substance is also important. Generally speaking, it has already been shown that a particulate antigen is more effective in inducing an immune response than a soluble antigen. The route that will be followed by the inducing agent initiating from an identical entry site will depend on several factors; among others, of the nature and size of particles in the form in which the inducing agent is to be presented, and of the apparatus, advantageously dew or aerosol, which is used to drive the particles, especially in their form, their directional propulsion and drive speed. With respect to the nature of the particles, a person skilled in the art has many options at their disposal; this option, although not limiting, is advantageously made from two groups: liposomes and microspheres. The methods of preparing these particles are conventional, and it is within the ability of a person skilled in the art to select one of these according to their own requirements and to determine the particle size that should be appropriate to induce the agent to be transported according to the route that has been adopted and optimally distributed in the target mucosa. Thus, a particle diameter of less than 10 μm is proposed for administration via the nasal or buccal route; for administration via the pulmonary route, a diameter of 0.05 to 10 μm; for administration via the oral route, a diameter of 0.05 to 10 μm, preferably 0.05 to 5 μm. The main effector sites in which an immune response should be sought are the respiratory system (bronchi, nasopharynx, lungs), stomach, intestine, and urogenital system. In the case of the respiratory system, the third inducing agent will advantageously be formulated for administration via the pulmonary route (e.g., liposomes, microspheres and the like). In the case of the stomach or intestine, the third inducing agent will be advantageously formulated for administration via the oral route, including the intragastric route (e.g., in the presence of an enteric protection, such as liposomes, microspheres, bicarbonate capsules or gelatin) . In the case of the intestine or urogenital system, the third agent will be advantageously formulated for administration via the urogenital route, for example in the form of a vaginal capsule, or via the rectal route, for example in the form of a suppository. The second or third inducing agent can, in addition be supplemented with an auxiliary or other liposomes or microspheres lacking in toxicity; different from non-toxic subunits or detoxified forms of bacterial toxins.

According to a preferred embodiment, the greater liposaccharide (MPLA: greater liposaccharide antigen) of a bacterium, for example of E. coli, Salmonella minnesota, Salmonella thyphirium or Shigella flexneri, is used as an auxiliary for the second or third agent. Indeed, it has been found that this type of compound has good properties when the immunization is carried out via the mucosal route. According to another aspect of the invention, it covers the use of MPLA with mucosal aid for the preparation of a composition (i) that contains an antigen or, with the proviso that the antigen is a protein in nature, an expression cassette capable of of expressing the antigen, a DNA or RNA fragment encoding the antigen, (ii) to induce an immune response against the antigen and (iii) for administration via the mucosal route. As a guide, it may be mentioned that the second or third inducing agent, when the latter is an antigen, can be administered at a ratio of 100 μg to 1 mg per dose. According to a preferred embodiment, the first inducing agent (systemic administration), when administered, is administered as a primary injection, allowing a period of 7 to 45 days, preferably 20 to 30 days, to finish before the first injection of reinforcement (administration of the second or third inducing agent).

According to one embodiment, the first inducing agent can also be administered at the same time as the second inducing agent. The second and third agents can be administered concomitantly or consecutively. When administered separately for a period of time, they can be advantageously administered at a range of 7 to 45 days, preferably 28 days. If necessary, it is also conceivable to administer the first and second inducing agents simultaneously (ie, approximately on the same day), and to repeat this operation once after an interval of several days. The choice of each of the three inducing agents is made independently of one with respect to the other. Advantageously, at least one of the three must be the antigen. It is very common that these three inducers are the same and, in this case, the antigen will advantageously be. As an alternative to an antigen that is protein in nature, it is possible to use (i) either a vaccine vector, for example, a type of pustule virus or adenovirus containing a DNA fragment encoding this antigen and placed under control of a suitable promoter, (ii) or this type of DNA fragment is such (not carried by a vaccine vector), placed in plasmid form, or otherwise (preferably the DNA fragment will be inserted into a plasmid in instead of the rest in the state of a simple transcription unit), presented in a liposomal formulation (anionic or cationic) or otherwise, (iii) alternatively the corresponding RNA fragment. These possibilities have already been described in the literature. To implement one of the different possibilities mentioned in the corresponding paragraph, a promoter capable of inducing in the mammary cells the expression of the DNA fragment encoding the antigen is used. For vaccines commonly referred to as DNA-based (to differentiate them from vaccines based on viral vectors); The premature human cytomegalovirus promoter (hCMV) is an option promoter. For this type of vaccination, it will be preferable to use a plasmid incapable of reproducing in mammals. It is also appropriate that such a plasmid be essentially non-integrative. According to a preferred embodiment, the antigen of a bacterium that is pathogenic to the host mammal is an H. pylori antigen, for example the apoenzyme form of urease of H. pylori or one of the ureA or ureB subunits of this same urease. More generally from the point of view of the immunization method, at the same time focused more precisely from the point of view of the antigen, it may be noted that the subject of the invention is also the use of a DNA fragment encoding an H antigen. pylori in the manufacture of a composition for preventing or treating an H. pylori infection, and for nasal or nasolabial administration. At this point, the DNA fragment is a vaccination agent that meets the criteria stated above. It was also found that, to induce a mucosal immune response against a pathogenic organism that infects the stomach or intestine, it would not be essential to administer an immunogenic substance in one of these sites, but it could be sufficient to administer it via the superior route, that is to say via the naso-buccal route, when it is appropriate to combine a systemic administration with this one. Accordingly, in another aspect, the invention relates to a composition for inducing in a host mammal an immuno response against an antigen, in the stomach or intestine, which comprises an inducer agent for the immuno response, selected from antigen, and with the stipulation that the antigen is of a protein nature, an expression cassette capable of expressing the antigen, a fragment of DNA or RNA encoding the antigen, the inducing agent is formulated to be administered via the nasolabial route. In this same aspect, the invention also covers the use of a product selected from an antigen and, with the stipulation that the antigen is of a protein nature, an expression cassette capable of expressing the antigen, a DNA or RNA fragment encoding the antigen. antigen, for the preparation of a composition to induce in a mammalian host an immune response against the product, in the stomach or intestine, and for administration via the naso-buccal route. Such a composition, when comprising an antigen of a pathogenic organism that infects the gastric or intestinal mucosa, is useful, in particular, in that it protects the host mammal against the infection in question, in particular by giving long-lasting protection, carrying in memory game to T and B lymphocytes. Possible infections are those caused by H. pylori, V. cholerae, Shigella, Flexneri, Shingella sonnei, Salmonella enteritidis, Clostridium difficile, Yersinia enterocolitica, and toxigenic and enteropathogenic E. coli. With respect to the antigen, the latter can be the pathogenic agent itself, in dead or lysed form or in attenuated form, or alternatively the antigenic components of this pathogen, such as in purified form, or a polypeptide characteristic of this pathogen, either purified directly from the pathogen or obtained by recombinant DNA techniques. For example, in the case of a composition for preventing H. pylori infections, an antigen of choice may be the apoenzyme of urease, composed of subunits A and B, which describe the corresponding fragments of DNA, in, for example, Labigne and collaborators., J. Bact. (1991) 173 (6): 1920, or one of the apoenzyme subunits, the cytoxin (WO93 / 18150), or alternatively adhesion family proteins (proteins capable of binding to the host cell receptors and proteins). which become capable of mediating a coupling of the pathogen to host cells and initiating the infectious process), or iron-regulated proteins. In the case of a cholera vaccine, an antigen of choice may be subunit B of cholera toxin, as described in the literature. The invention is illustrated below with reference to Figures 1 to 5. Figure 1 depicts an Elispot analysis of immune response induced by the administration of a B subunit (CTB) within the salivary glands (la) and within the stomach (IB) ). The results are related to three immunization protocols: subcutaneous / oral (Se O); subcutaneous nasal (Se O + N); and subcutaneous / oral + nasal (Se O + N). "Oral" of course, it is understood that it means "intragastric". The dark shading on a light background corresponds to the IgA response. The shaded light on a dark background corresponds to the IgG2a response. The response in the stomach is presented as the number of mice that respond in a group of 5 mice; the number of grains per million cells is of the order of 9. Figure 2 represents the Elispot analysis of the immune response induced in the salivary glands (2A) and in the stomach (2B) by the administration of CTB according to the Subcutaneous / subcutaneous + oral + nasal protocol (Sc / Sc + 0 + N). "Oral" of course, it is understood that means "intragastric". The dark shading on a light background corresponds to the IgA response. The shaded light on a dark background corresponds to the IgG2a response. The response in the stomach is presented as the number of mice that respond in a group of 5 mice; the number of grains per million cells is of the order of 8.2. Figure 2 represents the Elispot analysis of the immune response induced in the salivary glands (3A) and in the stomach (3B) by the administration of grain urease. , jack according to the subcutaneous (alum) / oral + nasal protocol (liposome). "Oral" of course, it is understood that means "intragastric". The dark shading on a light background corresponds to the IgA response. The shaded light on a dark background corresponds to the IgG2a response. The response in the stomach is presented as the number of mice that respond in a group of 5 mice; the number of grains per molleen of cells is of the order of 620. Figure 4 represents the Elispot analysis of the immune response induced in the salivary glands (4A) and in the stomach (4B) by urease administration. with the subcutaneous (liposomes) / oral + nasal protocol (liposomes). "Oral" of course, it is understood that means "intragastric". The dark shading on a light background corresponds to the IgA response. The shaded light on a dark background corresponds to the IgG2a response. The response in the stomach is presented as the number of mice that respond in a group of 5 mice; the number of grains per million cells is of the order of 15. Figure 5 represents the plasmid pTG8665, used to produce the H. pylori urease apoenzyme. Figure 6 represents the plasmid pCMC / Ela in which the HindIII fragment (1 ) - SacII (754) contains the hCMV promoter, the Xhol (771) - Smal (2104) fragment contains the Ela ORF, the Smal (2104) - EcoRI fragment (2810) contains the BGH'3 end and the EcoRI fragment (2810) ) - HindIII (1) corresponds to the skeleton pUC19. Figure 7 depicts the plasmid pCB-ureB in which the ureB ORF extends from nucleotide 777 to nucleotide 2487. Figure 9 shows in diagram form the titers of the anti-urease antibody recorded in Balb / c mice immunized with IgG titers and the dotted curves, the IgA titrations. § corresponds to an immunization via the intranasal route repeated three times (DO, 21 and 42, plasmid alone or plasmid + liposomes). * corresponds to a primary immunization via the intramuscular route (plasmid only) followed by two booster injections at D21 and 42 via the intranasal route (plasmid + lipososms). • corresponds to a primary immunization via the intradermal route (plasmid alone), followed by two booster injections at D21 and 42 via the intranasal route (plasmid + liposomes). Figure 10 depicts a diagrammatic form of the optical density of the gastric medium of the mice after immunization, when appropriate, with the H. Pylori Urease apoenzyme and stimulus. First column: uninfected mice; second column: mice that have received liposomes in a row, by subcutaneous primary immunization followed by two reinforcing injections via the routes (nasal + intragastric); third column: mice that have received liposomes with urease, followed by two reinforcing injections via the route (nasal + intragastric); fourth column: mice that have received liposomes with urease, by repeated administration 3 times via the routes (nasal + intragastric). In all cases, DC-Chol liposomes were used. Example 1; Induction of an immune response against the cholera toxin subunit (CTB). the. Preparation of immunizing compositions l.A.a) For administration via the subcutaneous route. 1 μl of a purified and concentrated CTB preparation at 10 mg / ml (equivalent to 10 μg of CTB) are mixed with 100 μl of an aluminum hydroxide preparation. The mixture is diluted in a PBS buffer to obtain a final volume of 500 μl. This constitutes an individual dose. l.A.b) For administration via the oral route (intragastric) A volume of 3 μm latex pellets (Polysciences cat.1434) is removed and then washed three times in a PBS buffer (centrifugation 1,000 rpm for 3 minutes). The pellets are then mixed with a purified CTB preparation and concentrated at 10 mg / ml to obtain a preparation in which the CTB is diluted 1/20 (equivalent to a final concentration of 0.5 mg / ml). This preparation is left to stir for two hours. The preparation was then diluted to 1/25 with 200 μM of carbonate buffer. l.A.c) For administration via the nasal route A CTB preparation coated on latex beads is obtained as described in section l.A.b), except for the final dilution in carbonate buffer. The preparation was then diluted in PBS buffer according to the requirements. l.A.d) For administration via the oral + nasal route. Administration is carried out by combining oral and nasal administrations as described in l.A.b) and l.A.C). l.B Immunization protocol Three immunization protocols were compared. These are: 1) Subcutaneous / oral (intragastric) 2) Subcutaneous / nasal 3) Subcutaneous / oral (intragastric) + nasal BalbC mice received via the subcutaneous route 10 μg of CTB with aluminum as auxiliary as described in section lAa) in a volume of 500 μl. The mice that form a control group receive 500 μl of PBS subcutaneously. 28 days after the subcutaneous injection, the test mice were divided into 3 groups. The mice in the first group receive intragastrically, via a cannula attached to a 1 ml syringe, 10 μg of CTB coated in latex beads as described in section 1.A.b) in a volume of 500 μl. Mice taken from the control group receive 500 μl of carbonate buffer via the same route. The mice in the second group received via the nasal route 10 μg of CTB coated in latex beads as described in section 1.A.c), in a volume of 20 μl. These μl are applied dropwise to the nostrils. Mice taken from the control group received 20 μl of PBS via the same route.

Mice in the third group simultaneously received 10 μg of CTB via the oral (intragastric) route and 10 μg of CTB via the nasal route. The preparation of CTB coated in latex pellets is obtained as described in section l.A.d). Some mice are used as a control. 15 days after the booster injection, the stomach and the salivary glands of the mice are removed; the cells were extracted according to the protocol described in Mega et al. J. of Immunology (1992) 148: 2030, and the IgA response was subjected to the Elispot analysis according to the method described in Czerkinsky and Contributors in theoretical and technical aspects of ELISA. and other solid-phase immunoassays (DM Kenneny and SJ Chalacombe Eds): 217-239, John Wiley & Sons, Chichester, NY. The results are presented in Figure 1 and soon the following comments: The subcutaneous / oral (intragastric) protocol is unable to induce a strong mucosal immune response, while a response is observed in the case of subcutaneous / nasal and subcutaneous protocols. oral (intragastric). The last protocol proves to be the best, in view of the fact that a good local response represented by the Iga is obtained both in the salivary glands and in the stomach. l.C. Supplementary immunization protocol Mice that received a subcutaneous injection of CTB as described in section l.B. received 28 days later, simultaneously: 40 μg of CTB as prepared in section 1.A.d), via the oral route (intragastric), in a volume of 500 μl; - 10 μl of CTB as prepared in section l.A.d) via the nasal route, in a volume of 20 μl; 10 μg of CTB as prepared in section 1.A.a) via the subcutaneous route, in a volume of 300 μl. 15 days after the booster injection, the stomach and salivary glands of the mice were removed; the cells are extracted and the IgA response is subjected to Elispot analysis. The results are presented in Figure 2. A good IgA type immune response is obtained (5/5 mice responded), this being an index of a local immune response in the mucous membranes. Example 2: Induction of an immunosuppressive mucosal response against urease grain. 2.A. Preparation of the immunizing composition 2.A.a) urease as aluminum as an auxiliary 5 μl of a urease preparation of jack grain (Boehringer; Ref. 737 348) concentrated at 4 mg / ml in the PBS buffer are mixed with 100 μl of a 1% aluminum hydroxide preparation. The mixture is diluted in PBS buffer to obtain a final volume of 500 μl containing 20 μg of urease. This constitutes an individual dose. 2.A.b) Urea in liposomes Three techniques were used as follows: 1. Ethanol injection. 16.4 mg of a lipid mixture composed of cholesterol (sigma), dipalmitoylphosphatidyl chloride (Nattermann Phospholipids) and sodium salt of dimyristoylphosphatidylglycerol in molar proportions of 5: 4: 1 are dissolved in 50 μl of absolute ethanol. The solution is injected via a syringe of Hamilton in 2 ml of an aqueous solution containing 4 mg / ml urease of jack grain, when appropriate with PBS buffer diluted 1/10. The preparation is kept under stirring for 45 ° C. In contact with water, the lipids are organized spontaneously in the form of liposomes (predominant unilamellar liposomes with an average size of 50 to 10 nm), trapping a certain volume of urease. These liposomes are purified (isolated from excess free urease) by gel filtration through a Sepharose CL-4CB column (Pharmacia). The degree of encapsulation of urease measured using iodine-125-labeling (Enzymobeads ™ technique, Biorad), varies from 3 to 6%. If necessary, the liposome suspension is concentrated by ultrafiltration to a Novacell ™ cell (FILTRON) having an exclusion limit of 10 kD. 2. Extrusion 16.4 mg of a lipid mixture composed of cholesterol (sigma), dipalmitoyl phosphatidyl chloride * (Nattermann Phosholipids) and sodium salt of dimyristoylphosphatidylglycerol in molar proportions of 5: 4: 1 were dissolved in 4 ml of chloroform in one pyrex flask with a round bottom of 25 ml. The solution is evaporated (Buchi Rotavapor) to form a thin lipid film on the walls of the flask. The lipid film is dried under a high vacuum for two hours and then taken with up to 2 ml of water containing 8 ml of jack grain urease. After 4 hr of shaking at 45 ° C the suspension is stretched (Extruded ™, Lipex Biomembranes Inc., Vancouver) 5 times through two superposed polycarbonate membranes with porosity of 400 nm (Nucleopore ™ Costar) to form a homogenous population of predominantly unilamellar liposomes approximately 400 nm in diameter containing urease. These liposomes are purified isolated from the excess of free urease) by gel filtration through a Sepharose CL-4B column (Pharmacia). The degree of encapsulation of urease using iodine-125-labeled urease (Enzymobead ™ labeling technique, Biorad) ranges from 5 to 10%. If necessary, the suspension of liposomes is concentrated by ultrafiltration in a Novacell ™ (filter) with an exclusion limit of 10 K.D. 3. Microfluidizer method 82 mg of the lipid mixture composed of cholesterol, dipalmitoylphosphatidyl chloride and sodium salt of dimyristoylphosphatidylglycerol, in molar proportions of 5: 4: 1, obtained by lyophilization of an ethanolic solution (D3F - France), are taken with 10 ml of 10 mM Hepes buffer, 150 mM NaCl, pH 7.4 containing 3.6 mg / ml of the recombinant apoenzyme form of H. pylori urease. After 4 hours of stirring at 45 ° C, the suspension is microfluidized by 5 runs at 500 kPa in a microfluidizer M110S (Microfluidics Co.) to form a homogeneous population of predominantly unilamellar liposomes approximately 10 nM in diameter containing urease. These liposomes are purified by gel filtration (Sepharose CL-4B column, Pharmacia). The degree of encapsulation of urease, measured by protein assay, using the micro BCA kit (Pierce) is 14.5%. if necessary, the liposome suspension is concentrated by filtration in a Novacell cell (Filtron), having an extrusion limit of 10 kD. 2.A.c) Ureases in liposomes with MPLA as auxiliaries When liposomes are prepared, MPLA (extracted from E. coli, sigma) can be added to the lipid mixture, in the proportion of 1.2 or 5% relative to the lipid mass. 2.B immunization protocol Two immunization protocols were tested, these are: 1) Subcutaneous (aluminum / [oral (intragastric) + nasal] (liposomes) 2) Subcutaneous (liposomes) / [oral (intragastric) + nasal] (liposomes) ) 0F1 mice receive via the subcutaneous route: either 20 μg urease with aluminum as an auxiliary as described in section 2.A. a), in a volume of 500 μl. - or 20 μg of urease in a liposome preparation as obtained in section 2.A.b), in a volume of 500 μl. 28 days after the subcutaneous injection, the mice received simultaneously: via the oral (intragastric) route 20 μg of urease in a liposomal preparation as obtained in section 2.A.b), in a volume of 500 μl; and via the nasal route, 20 μg of urease in a liposome preparation as obtained in section 2.A.b), in a volume of 50 μl. 15 days after the booster injection the stomach and the salivary glands of the mice were removed; the cells were extracted according to the protocol described in the preamble to the examples and the IgA response is subjected to Elispot analysis according to the method described in the preamble. The results are presented in Figures 3 and 4. Figure 3 shows that, in the case of the subcutaneous (aluminum) / [oral (intragastric) + nasal] protocol (liposomes), the IgA response in the salivary glands (3A), although weak, it is predominant, while, with respect to the stomach (3B), 3 mice out of 5 respond to immunization with a high number of grains. Figure 4 shows that, in the case of the subcutaneous protocol (liposomes) / [oral + nasal] (liposomes), the response is very good in the salivary glands (4A), while it is weak in the stomach (4B). This suggests that, in addition to the protocol used, the formulation of the antigen is important. Example 3: Vaccination kit for H. pylori infections. Three preparations containing the H. pylori urease apoenzyme, each formulated in a different way depending on the method of administration conceived, are carried together in a kit. 3.A Preparation of the apoenzyme of one of the plasmids described in Labigne and Contributors (supra) (pILL914), a fragment encoding the N-terminal portion of UreA (up to the internal HindIII site), and containing a BspHl site at the translational initiation codon of UreA, is generated by PCR using the OTG5973 books and 0TG5974.

BspHl OTG 5973: CCAAATC ATG AAA CTC ACC CCA AAA GAG TTA Met Lys Leu Thr Pro Lys Glu Leu GAT AAG TTG Asp Lys Leu HindIII GCTTCTACATAGTTAASCTTAATGCCTT The fragment generated by TCR is digested by BspHl and HindIII and inserted simultaneously with the 2.35-kb HindIII fragment of pILL914 that carries the 3 'portion of UreA and UreB within the rector pTG3704 digested with Ncol and HindIII, to give the plasmid pTG8665 as shown in the figure. 5. This plasmid carries the UreA and UreB genes fused in the araB promoter. The vector pTG3704 is described in the European patent application No. 584,286, published on March 9, 1994. This vector is derived from plasmid paral3 (Cagnon and Contributors) Prot. Eng. (1991) 4: 843) by destruction of the site Sphl by treatment with Klenow polymerase. The strain E. coli Xac-I (Normandy et al., PNAS (1986) 1: 6548) was transformed with the plasmid pTG8665. The transformed strain is grown in the LB medium supplemented with 100 μg / ml of ampicillin. In the exponential growth phase, 0.2% arabinose are added for the purpose of inducing the expression of UreA and UreB. After several induction times (1 to 3 hrs.) The level of production of UreA and UreB is very high (approximately 10% of total protein), and the cells are then removed. 220 g of cells are recovered by centrifugation of 2.5 1 of cultures. These cells taken in approximately 1 1 of 20 mM sodium phosphate buffer, pH 7.5 containing 175 mg of PMSF (1 mM). 4 μl of a benzonane solution at a concentration of 250 U / μl (Merck, ref 1654), equivalent to one final unit / ml, as well as one ml of 1 M MgCl 2, was then added to the cell suspension. The reaction was allowed to proceed for 30 minutes. The suspension is then introduced into a Rannie apparatus (high pressure homogenizer) and subjected to a pressure of 1,000 bars for 1 h in order to break the cells. The choice can then be made between two alternate methods of purification. 3.A. a) First method. The rupture of the cells was monitored by optical density. When the OD is of the order 2.5 - 2, the suspension is removed from the apparatus and supplemented with 1 ml of 0.5 M EDTA solution. It was centrifuged for 2 hours at 10,000 rpm and the supernatant was then recovered and centrifuged at 100,000 x g for one hour to remove the membranes. The purification is carried out according to a protocol similar to that described by Hu et al., Infect. Immun. (1992) £ 0: 2657. The supernatant containing the soluble proteins is adjusted to a pH of 6.8 and then loaded at a flow rate of 4 ml / min onto an anion exchange column (DEAE-Sepharose, Pharmacia) with 5 cm x 25 cm volume equilibrated with 20 mM KP04 buffer, pH 6.8 containing 1 mM PMSF (PO buffer). The column is rinsed with a linear gradient of KC1 from 0 to 0.5 M. 14-ml fractions were collected and analyzed by SDS-PAGE. Fractions containing urease in the purest form were stored. KC1 was added to the fraction thus obtained so that the final concentration of KC1 is equal to 1 M, and the solution was loaded onto a phenyl-Sepharose column (Pharmacia). The column is rinsed with an ingredient of KC1 from 1 M to 0 M. As before, the fractions are collected and analyzed by SDS-PAGE. Fractions containing urea in the purest form are stored and dialyzed against 20 M KP04 buffer, pH 7.5. The obtained fraction is loaded in an anion exchange column (Q-Sepharose fast flow, Pharmacia) equilibrated with KP04 buffer at 20 mM, pH 7.5; Like the previous one, the column is rinsed with a linear gradient KC1 from 0 to 0.5 M and the fractions are collected and analyzed by SDS-PAGE.

Fractions containing urea are stored and filtered by diafiltration through a membrane whose cut-off threshold is 100 kDa, and the fraction is applied to a gel filtration column (Sephacryl 400 hr) equilibrated in 20 mM NaP04 buffer , pH of 7.5; after analysis of the different fractions by SDS-PAGE those containing urease are collected and concentrated by diafiltration through a membrane whose cut-off point is 100 kDa, and the solution is filtered through a membrane with a porosity of 0.22 μm . sterile sucrose solution was added to obtain a final concentration of 2%. The solution is then lyophilized and stored in this form while waiting for the subsequent steps. 3.A.b) Second method. This supernatant was adjusted to the pH of 7.5 and then loaded at a flow rate of 4 ml / min into an anion exchange column (Q-Sepharose fast flow, Pharmacia, ref: 17-0510-01 with volume 5). x 25 cm equilibrated with equilibration buffer of KP04 at 20 mM, pH 7.5 containing 1 mM PMSF.The column was wiped with a linear gradient of KC1 from 0 to 0.5 m in the equilibrium buffer (gradient vol .: 2.25 1; flow rate: 4 ml / min.) Fractions of 14 ml were collected and analyzed by SDS-PAGE The cleanest fractions are collected and stored (these are in general, fractions 82 to 121 that start from the beginning of the gradient). The Q-Sepharose deposit is loaded at a flow rate of 2 ml / min into a zinc chelate column (rapid flow of chelating Sepharose); Pharmacia; ref 17-0575-012) of volume 2.6 cm x 11 cm , prepared in advance as follows. The column is loaded with metal with two volumes of 0.2 M ZnCl2 solution and then wiped with 3 volumes of 0.5 M NaCl and thereafter with 3 volumes of an equilibrium buffer of 50 mM Tris-HCl, pH 8, containing 0.5 M NaCl, 1 mM imidazole and 1 mM PMSF. The column was washed with a volume of the equilibrium regulator containing 10 mM imidazole and then wiped with 3 volumes of the equilibrium regulator containing 1 mM imidazole. When the load is finished, the column is washed with the equilibrium regulator until the washings return to the baseline value (washing carried out overnight at 0.2 ml / min). The column is then rinsed with 200 ml of equilibrium buffer containing 7.5 mM imidazole at a flow rate of 1 ml / min. The rinse takes place in a linear imidazole gradient of 7.5 mM in the equilibrium regulator (gradient volume: 250 mM, flow rate of 1 ml / min.) 10 ml of fractions are collected and analyzed by SDS-PAGE. Fractions containing pure urease are collected and stored (these are in general, fractions 19 to 30 starting from the beginning of the gradient). The chelating Sepharose deposit is then concentrated to 25 ml by ultrafiltration through an Amicon YM100 membrane. This concentrate is then loaded into a column of Sephacryl S-300 (Pharmacia, ref 17-0599-01) with a volume of 2.6 cm x 96 cm balanced in KP04 regulator, 0.5 M NaCl, pH 7.5. Chromatography is performed at a ratio of 0.5 ml / min. 10 ml of fractions are recovered and analyzed by SDS-PAGE. Fractions containing pure urease are stored (these are generally fractions 21 to 27 of the loading end) and concentrated to approximately 2.5 mg / ml by ultrafiltration through an Amicon YM100 membrane. The preparation of the apoenzyme is filtered through a membrane with a porosity of 0.22 μm and stored frozen -20 ° C or lyophilized in the presence of sucrose, for example. The case preparations are as follows: 3.B. Apoenzyme with auxiliary aluminum for administration via the subcutaneous route A dose for injection is prepared by absorbing 20 μl of the apoenzyme solution obtained in 3.A. (equivalent to 50 μg) with 250 μl of 1 mg / ml of an aluminum hydroxide preparation (alhydrogel; Superfos); after absorption for two hours at + 4 ° C, the final volume was adjusted to 500 μl by adding PBS. 3.C Apoenzyme in liposomes for administration via nasobucal route, in aerosol form. The H. pylori urease apoenzyme form is encapsulated in liposomes. These liposomes have an average diameter of 100 nm and a protein content of 60 μg / mg of lipid. A total amount of 0.1 mg of formulated urease is administered via the naso-buccal route. An aerosol can with two nozzles (nose and mouth) of the type marketed by the company VALOIS (Le Prieuré, BPG, 27110 Le Neuborg) is used. The pumping allows a finite volume to be delivered depending on the type of pump, a nozzle of variable size that fits in the container coupled with your pump (no more than 300 μl per administration, it is possible that this dose is repeated in the intervals of selected times). 3.D Apoenzyme in liposomes for intragastric administration. A total amount of 0.5 mg of formulated urease is administered via the intragastric route. The apoenzyme is prepared according to the method described in section 3.C, then it is lyophilized and taken with 20 ml of 200 mM sodium bicarbonate solution. 3.E. Immunization protocol An adult receives subcutaneously the dose prepared in 3.B. 28 days after the primary injection, he receives via the nasobucal route the dose prepared in 3.E and the dose prepared in 3.D is ingested on the same day. Example 4: Vaccination kit for H. pylori infections (DNA encoding the UreB subunit of urease, used as a vaccinating agent). 4.4 Construction of the plasmid vectors. The eukaryotic expression vector pCB-ll is constructed from the following three elements: plasmid pUC19 (commercially available) previously digested with Xbal and EcoRI; a Spel-SacII fragment isolated from plasmid pCMV / Ela (Figure 6), which contains the human cytomegalovirus premature promoter (hCMV) as described in, for example, US Patent 5,168,062; and - a SacII-EcoRI fragment containing the 3 'portion of the bovine growth hormone gene including polyadenylation signal as well as mRNA stabilization sequences. The SacII-EcoRI fragment is obtained from the pBS-BGH plasmid, constructed by inserting a BmHI-EcoRI fragment originating from the pCMV / ela plasmid into the Bluescript plasmid (commercially available). These 3 fragments are ligated together to form the plasmid pCB-ll (Figure 7). The UreB gene is amplified by PCR from the plasmid pILL914 and using the following books: Upstream book: 5 'cgtctcgagccaccatgaaaaagattagcagaaaag Downstream book: 5' atcgtcccgggcaggcctcttagaaaatgctaaagagttgcgccaagct The upstream book enables the Xhol restriction site and the Kozak sequence to input the UreB open reading block (ORF) upstream, while the downstream book enables the Smal site to be entered downstream of the ORF. The fragment generated by PCB is digested and then inserted into plasmid PCB-ll previously digested with XhoI and Smal, to generate plasmid pCB-ureB (Figure 8). E. coli XL1 is transformed with this plasmid and then cultured according to conventional techniques. The plasmid thus identified is harvested in a standard manner by alkaline lysis followed by a gradient of isopicnic caesium chloride. The DNA is taken either in distilled water or in physiological saline (0.9% NaCl). 4.B Preparation of a liposome / DNA composition. Bromide 0,0 ', 0"-Tridodecanoil-N- (? Trimethylammonium-dodecanoyl) tris (hydroxymethyl) aminomethane (commonly known as TC1-12) was made according to the method described Kunitake et al, J. Am. Chem Soc. (1984) 106: 1978. 10 ml of this product were dissolved in 50 μl of ethanol.This preparation was then rapidly injected using a Hamilton syringe in 2 ml of deionized water with stirring at 42 ° C. Liposomes of about 50 nm in diameter are formed spontaneously during the dissolution of ethanol in water In this way a liposomal preparation containing 5.2 mM TC1-12 is obtained, 100 μl of the preparation obtained above are diluted by adding 150 μl of distilled water. 250 μl of an aqueous preparation of plasmid pCB-ureB at a concentration of 2 μg / μl. The load ratio (TC1-12 / nucleotide) is of the order of 0.35. 4.C Immunization protocols.

BalbC mice from 6 to 8 weeks of age were previously anesthetized by injection of a mixture of xylazine + ketamine. These received 3 administrations of 50 μg of pCB-ureB at 3 week intervals. In several immunization protocols, the intranasal route (IN), the intramuscular route (IM), and the intradermal route (ID) are used. For intranasal administration route víanla, 50 .mu.l of a DNA solution at a concentration of 100 ug / ul in physiological saline or in a liposome / DNA, as obtained in 4.B dropwise applied in the nostrils. For administration via the intramuscular route, 50 μl of a DNA solution at a concentration of 500 μg / ml are injected into 5 sites within the previously shaved back skin using a pneumatic powered injector (Mesoflash ™ 10). The immunization protocols are as follows: On days 14, 35 and 56, serum samples were removed from each of the mice. The production of anti-urease antibodies was tested by ELISA (a purified water-soluble extract of H. pylori was used). The results summarized in Figure 9 show that several immunization protocols enable a strong IgG response and a minor IgA response to be induced. Example 5: Induction of a mucosal immune response against H. pylori urease 5.A. Preparation of the immunizing composition. 0.8 g of DC-Chol and 2.4 g of dioleilfosfatidicolino (DOPC) were added to 20 ml of chloroform in a round bottom flask of 1 1. The mixture is evaporated under vacuum to form a lipid film on the flask walls. This film is then dried under high vacuum all night. The film is then taken with 400 ml of a solution of apoenzyme at a concentration of 1.5 mg / ml (prepared as described in Example 3.A.) in 20 mM Hepes buffer, pH 6.2. The mixture is allowed to stir for 6 hours at room temperature. The resulting suspension of multilamellar vesicles is then microfluidized by 10 runs at 500 kPa in a microfluidizer MllOS (Microfluidics Co.) to form a homogeneous population of predominantly unilamellar about 10 nm in diameter containing the apoenzyme. These liposomes are filtered through a Stenivex-HV filter (0.45 μ, Millipore) and then lyophilized after the addition of 20 g of sucrose. The size of the liposomes measured by light scattering (Zetamaster, Malvern Instruments) is 148 ± 52 nm. The degree of encapsulation of the apoenzyme is in the order of 20%; the rest of the total amount is in free form (not encapsulated). 5.B Immunization protocols.

Swiss mice of 6 to 8 weeks were divided into 4 groups (10 mice / group) and received in DO, D28 and D56 several routes, a dose of the preparation obtained previously. Two immunization protocols were tested, these are: 1) Subcutaneous / intragastric + nasal / intragastric + nasal 2) intragastric + nasal, repeated 3 times The dose is as follows: For administration via the nasal route, an amount of lyophilisate corresponding to 10 μg of the total apoenzyme (encapsulated + not encapsulated) was taken immediately before use in 30 μl of physiological saline (0.9% NaCl). The doses applied drop by drop in the nostrils. For administration via the subcutaneous route, the same dose of lyophilizate is formed with 300 μl of saline. For administration via the intragastric route, a quantity of lyophilisate corresponding to 40 μg of the total apoenzyme (encapsulated + not encapsulated) is taken with 300 μl of saline supplemented with 0.2 M NaHCO 3. The dose is administered using a cannula attached to a 1 ml syringe. 15 days after the last administration, the mice were challenged by intragastric gavage with 108 microbes of an H. pylori strain adapted to be removed and tested for urease activity (Jatrox ND) was performed in a quarter of the stomach. 4 hrs after removal, the optical density obtained is measured at 550 nm. the results are presented in figure 10. These results show that even when complete protection is not obtained in the DC-Chol doses used, a significant reduction in the urease activity and therefore in the infection was observed in comparison with the controls positive (mice that received empty liposomes). These results also demonstrate the advantage of a primary immunization via the parenteral route focused on the thoracolumbar region (subcutaneous, the intramuscular route could have been used as well, and advantageously it could have enabled the celiac ganglia to see focused more specifically). SEQUENCE LISTING (1) GENERAL INFORMATION: (i) OWNER: (A) NAME: Pasteur Merieux Serums & Vaccins (B) STREET: 58, Avenue Leclerc (C) CITY: Lyon (D) COUNTRY: France (E) POSTAL AREA: 69007 (G) TELEPHONE: 72 73 79 31 (H) TELEFAX: 72 73 78 50 (ii) TITLE OF THE INVENTION: Composition to induce a mucosal immune response. (Iii) NUMBER OF SEQUENCES: 4 (iv) computer format: (A) AVERAGE: TAPE (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIn Reread # 1.0, Version # 1.30 (EPO). (2) INFORMATION FOR SEC. ID. NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 41 base pairs (B) TYPE: nucleotide (C) CHAIN: double (D) TOPOLOGY: linear (Ü) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: CCCAAATCAT GAAACTCACC CCAAAAGAGT TAGATAAGTT G 41 (2) INFORMATION FOR SEQ ID NO. 2: (i) CHARACTER AGER SEQUENCE: (A) LENGTH: 28 base pairs (B) TYPE: Nucleotide (C) CHAIN: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) DESCRIPTION OF SEQUENCE : SEQ ID NO: 2: GCTTCTACAT AGTTAAGCTT AATGCCTT 28 (2) INFORMATION FOR SEQ ID NO: 3: (i) CHARACTERISTICS OF SEQUENCE: (A) LENGTH: 36 base pairs (B) TYPE: nucleotide (C) CHAIN: double ( D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 3: CGTCTCGAGC CACCATGAAA AAGATTAGCA GAAAAG 36 (2) INFORMATION FOR SEQ ID NO: 4: (i) CHARACTERISTICS OF SEQUENCE: ( A) LENGTH: 49 base pairs (B) TYPE: nucleotide (C) CHAIN: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) DESCRIPTION OF SEQUENCE: SEQ ID NO: 4: ATCGTCCCGG GCAGGCCTCT TAGAAAATGC TAAAGAGTTG CGCCAAGCT 49

Claims (22)

1. CLAIMS 1. A pharmaceutical composition for inducing in a host mammal a protective immune response against an antigen, at a mucosal effector site, which comprises, for concomitant or consecutive administration: (i) optionally, a first product and (ii) al less a second and third product; these 3 identical or different products each containing an inducing agent for the immune response, selected from the antigen and, provided that the antigen is of a protein nature, an expression cassette capable of expressing the antigen; the first product is formulated to be administered systemically, the second product is formulated to be administered via the naso-oral route, whereby the inducing agent is focused on the site (s) that induces an immunoresponse in the nasopharynx or in the salivary glands; The third product is formulated to be administered via an appropriate mucosal route different from the nasal route, whereby the inducing agent is focused to the site (s) inducing an immune response at the effector site, in which the immune response is sought.
2. 2. The composition according to claim 1, wherein the first product is formulated to be administered via the parenteral route.
3. 3. The composition according to claim 1 or 2, for inducing in a host mammal an immune response against an antigen, in the respiratory system (bronchi, nasopharynx, lungs), in which the third product is formulated for administration via the pulmonary route.
4. The composition according to claim 1 or 2, for inducing in a host mammal an immuno response against an antigen, at a mucosal effector site selected from the group consisting of the mucous membranes of the intestine and genitals, in which the third product is formulated for administration via the urogenital route.
5. The composition according to claim 1 or 2, for inducing in a host mammal an immune response against an antigen, in the stomach or in the intestine, in which the third product is formulated for administration via the oral route including the intragastric route.
6. 6. The composition according to any of claims 1 to 5, wherein the first product contains, in addition, an auxiliary such as aluminum hydroxide or phosphate or an auxiliary of the ISCOM type.
7. The composition according to any of claims 1 to 6, wherein the second product is formulated in the form of particles such as liposomes or microspheres.
8. The composition according to claim 7, wherein the second product is formulated in the form of particles of 0.05 to 5 μm in diameter.
9. 9. The composition according to claims 1 to 8, wherein the third product is formulated in the form of particles such as microsomes or microspheres, for administration via the pulmonary route or via the oral route including the intragastric route.
10. The composition according to claim 9, wherein the third product is formulated in the form of particles of 0.05 to 5 μm in diameter, for administration via the pulmonary route.
11. The composition according to claim 9, wherein the third product is formulated in the form of 0.05 to 5 μm particles for administration via the oral route including the intragastric route.
12. 12. The composition according to any of claims 10 and 11, wherein the second or third product is an aerosol spray.
13. The composition according to any of claims 1 to 12, wherein the third product is an enterically protected preparation.
14. The composition according to any of claims 1 to 13, wherein the second or third product contains, in addition an auxiliary that lacks toxicity, distinct from the non-toxic subunits of the detoxified forms of bacterial toxins and other than liposomes or microspheres.
15. 15. The composition according to any of claims 1 to 14, wherein the second or third product contains in addition MPLA.
16. 16. The composition according to claims 1 to 15, wherein the inducing agent contained in the first, second or third product is the antigen.
17. The composition according to any of claims 1 to 16, wherein the inducing agents contained in the second and third products are the same.
18. 18. The composition according to claim 17, wherein the inducing agents contained in the first, second and third product are the same.
19. 19. The composition according to any of claims 12 to 18, wherein the first product is formulated for administration via the subcutaneous, intradermal or intramuscular route.
20. The composition according to any of claims 1 to 19, wherein the antigen is an antigen of a bacterium that is pathogenic to a mammalian host.
21. 21. The composition according to any of claims 5 to 20, wherein the antigen is a Helicobacter pylori antigen.
22. 22. The composition according to claim 21, wherein the antigen is the apoenzyme form of H. pylori urease. EXTRACT A pharmaceutical composition for inducing a protective immune response to an antigen at a mucosal effector site in a mammalian host is disclosed. The composition includes at least two identical or different components each containing an immuno-inducing agent selected from the antigen, with the proviso that the antigen is a protein antigen, and an expression cassette capable of expressing the antigen, for concurrent administration or consecutive. One of the components is formulated for nasal / oral delivery so that the inducing agent is focused towards the site (s) inducing immune response in the nose / oral cavity / pharynx or in the salivary glands, while the other component is formulated for appropriate mucosal delivery different from the nasal delivery so that the inducing agent is focused towards the site (s) inducing immune response at the effector site when an immune response is desired. Said composition may also optionally include a third component that is identical or different from the first two components and is formulated for systemic administration.