MXPA96004024A - Recombinant virus, preparation and utilization in gene therapy - Google Patents

Abstract

The present invention relates to recombinant adenoviruses possessing a heterologous DNA sequence encoding the neurotrophic factor derived from glial cells (GDNF), its preparation, its use for treatment and / or the prevention of neurodegenerative diseases.

Description

RECOMBINANT VIRUS, PREPARATION AND UTILIZATION IN GENE THERAPY The present invention relates to recombinant adenoviruses possessing a DNA sequence encoding the neurotrophic factor derived from glial cells. The invention also relates to the preparation of these vectors, to pharmaceutical compositions containing them, and to their therapeutic use, mainly in gene therapy for the treatment and / or for the prevention of neurodegenerative diseases. The increase in the duration of life in Western countries is accompanied by a regular growth of neurodegenerative diseases of the type of Alzheimer's disease, Parkinson's disease, Huntington's chorea, arniotrophic lateral sclerosis, etc. Thus, Parkinson's disease, for example, affects 4% of people over 65 years of age, and Alzheimer's disease affects 10% of people over 70 years of age and 30% "those of More than 80. In general, all these diseases result from a progressive loss of neuronal cells in the central nervous system, even in very localized structures such as Parkinson's disease. recent years, have been REF: 22970 developed numerous investigations with a view to understand the mechanisms of these degenerations linked to aging, with the perspective of putting to the point the means of treatment, but also the means of prevention, through gene therapy. , neurodegenerative diseases are translated into a progressive death of neuronal cells, the stimulation of the production of growth factors, involved in the development of this s neuronal cells, appears as a possible way to prevent and / or oppose this degeneration. The main purpose of the present invention is to propose vectors that directly promote the survival of neuronal cells, involved in this pathology, by the efficient and localized expression of certain trophic factors. Trophic factors are a class of molecules that have properties of neuritic growth stimulation or survival of nerve cells. The first factor that possesses neurotrophic properties, the NGF ("NERVOUS GROWTH FACTOR"), has been characterized some forty years ago (for review see Levi-Montalcini and Angelleti Physiol Rev. 48 (1968) 534). It has only been recently that other neuro-trophic factors have been identified, and mainly the neurotrophic factor derived from glial cells (GDNF) (L.-F. Lin, D. Doherty, J. Lile, S. Basketsh. Collins, Science, 260, 1130-1132 (1993)). GDNF is a 134 amino acid protein with a molecular weight of 16 kD. Its essential function is to promote in vitro the survival of dopaminergic neurons. The present invention is particularly advantageous for the application of GDNF as a therapeutic agent. More precisely, the present invention considers the development of particularly efficient vectors for distributing in vivo and in a localized manner, therapeutically active amounts of the specific gene coding for GDNF in the nervous system. In co-pending application PCT / EP93 / 02519, it has been shown that adenoviruses can be used as a vector for the transfer of a foreign gene in vivo, in the nervous system and the expression of the corresponding protein. The present invention relates more particularly to novel constructs, particularly adapted and effective for the transfer of glial cell-derived neurotrophic factor (GDNF). More precisely, this refers to a recombinant adenovirus comprising a DNA sequence encoding GDNF or one of its derivatives, its preparation, and its use for the treatment and / or prevention of neurodegenerative diseases. The applicant in this way has shown that it is possible to construct recombinant adenoviruses that contain a sequence encoding GDNF, administering these invovo recombinant adenoviruses, and that this administration allows a stable and localized expression of therapeutically active amounts of GDNF in vivo, and in particular in the nervous system, and without cytopathological effects. A first objective of the invention therefore lies in a defective recombinant adenovirus comprising at least one DNA sequence encoding all or an active part of the neurotrophic factor derived from glial cells (GDNF) or one of its derivatives. The cell-derived neurotrophic factor Glial (GDNF) produced within the framework of the present invention can be human GDNF or an animal GDNF. The cDNA sequences encoding the human GDNF and the rat GDNF have been cloned and sequenced (L. F, Lin, D. Doherty, J. Li, S. Besktesh, F. Collins, Science, 260 , 1130-1132 (1993)). The DNA sequence coding for GDNF, used within the framework of the present invention can be cDNA, a genomic DNA (gDNA), or a hybrid construct consisting for example of a cDNA in which one or more introns will be inserted. It can also be synthetic or semi-synthetic sequences. In a particularly advantageous manner, the sequence of the present invention codes for the GDNF preceded by the pro-native regon (pro-GDNF). In a particularly advantageous manner, a cDNA or a gDNA is used. According to a preferred mode of the invention, it is a gDNA sequence coding for GDNF. Its use may allow a better expression in human cells. Of course, prior to their incorporation into an adenoviral vector according to the invention, the DNA sequence is advantageously modified, for example by means of site-directed mutagenesis, in particular for the insertion of appropriate restriction sites. The sequences described in the prior art are not in fact constructed for use according to the invention, and previous adaptations may be necessary to obtain important expressions. In the sense of the present invention, a GDNF derivative is understood to be any sequence obtained by modification and coding for a product that preserves at least one of the biological properties of GDNF (trophic and / or differentiating effect). By modification, any mutation, substitution, deletion, addition or modification of a genetic and / or chemical nature must be understood. These modifications can be made * by techniques known to the expert in the field (see general techniques of molecular biology below). Derivatives in the sense of the invention can also be obtained by hybridization from nucleic acid libraries, using as a zonda the native sequence or a fragment thereof. These derivatives are mainly molecules that have a higher affinity for their binding sites, sequences that allow improved expression in vivo, of the molecules that have a greater resistance to proteases, molecules that have a greater therapeutic efficacy or side effects minor, or eventually new biological properties. Among the preferred derivatives, mention may be made more particularly of the natural variants, the molecules in which one or more residues have been replaced, the derivatives obtained by suppressing regions that do not intervene or intervene little in the interaction with the considered sites of interest, or that express an undesirable activity, and the derivatives that possess in relation to the native sequence additional residues, such as for example a secretion signal and / or a binding peptide.

According to a preferred embodiment of the invention, the DNA sequence, which codes for GDNF or for one of its derivatives, also integrates a secretion signal that allows directing the synthesized GDNF in the secretion pathways of the infected cells. According to a preferred mode of the invention, the DNA sequence contains a secretion sequence at the 5 'position and in the reading phase of the sequence coding for GDNF. In this way, the synthesized GDNF is advantageously released in the extracellular compartments and can thus activate its receptors. The secretion signal is advantageously the GDNF signal itself (designated below under the name "pre"). However, this can also be a heterologous to artificial secretion signal. Advantageously, the DNA sequence codes for the pre-GDNF and more particularly for the human pre-GDNF. Advantageously, the sequence coding for GDNF is placed under the control of signals that allow its expression in nerve cells. Preferably, they are heterologous expression signals ie d-e signals different from those naturally responsible for the expression of GDNF. It can be treated in particular sequences responsible for the expression of other proteins, or synthetic sequences. Primarily, it can be promoter sequences of eukaryotic or viral genes. For example, it can be promoter sequences of dfl genome outputs of the cell to be infected. Similarly, it can be promoter sequences from the genome of a virus, including the adenovirus used. In this regard, mention may be made, for example, of promoters E1A, MLP, CMV, LTR-RSV etc. On the other hand, these expression sequences can be modified by the addition of activating, regulating sequences, or allowing tissue-specific expression. Indeed, it may be particularly interesting to use the active expression signals specifically or mainly in the nerve cells, so that the DNA sequence is not expressed and produces its effect only in the case when the virus has effectively infected a nerve cell . In this regard, mention may be made, for example, of the promoters of neuron-specific enolase, GFAP, etc. In a first particular embodiment, the invention relates to a defective recombinant adenovirus, comprising a cDNA sequence encoding human pre-GDNF under the control of the LTR-RSV promoter. In another particular embodiment, the invention relates to a defective recombinant adenovirus comprising a gDNA sequence encoding human preGDNF under the control of the LTR-RSV promoter. The Applicant has indeed shown that the LTR promoter of rous sarcoma virus (RSV) allows a durable and important expression of GDNF in the cells of the nervous system, mainly the central nervous system. Still in a preferred mode, the invention relates to a defective recombinant adenovirus comprising a DNA sequence encoding all or an active part of the human GDNF or a derivative thereof, under the control of a promoter that allows a majority expression in the nervious system. A particularly preferred embodiment of practicing the present invention resides in a defective recombinant adenovirus comprising the ITR sequences, a sequence allowing encapsidation, a DNA sequence encoding the human neurotrophic factor derived from glial cells (hGDNF) or a derivative of these, under the control of a promoter that allows a majority expression, in the nervous system, and in which the gene El and at least one of the genes E2, E4, L1-L5 is not functional. Defective adenoviruses according to the invention are adenoviruses unable to replicate autonomously in the target cell. In general, the genome of the defective adenoviruses used in the context of the present invention is therefore devoid of at least the sequences necessary for the replication of the virus in the infected cell. These regions can be either deleted (totally or in part), either made non-functional, or substituted by other sequences and mainly by the DNA sequence encoding the GDNF. Preferably, the defective virus of the invention retains the sequences of its genome that are necessary for the encapsidation of the viral particles. Still more preferably, as indicated above, the genome of the defective recombinant virus according to the invention comprises the ITR sequences, a sequence allowing the encapsidation, the non-functional gene and at least one of the genes E2, E, L1.-L5 not functional. There are different serotypes of adenovirus, where the structure and properties vary a little. Among these serotypes, it is preferred to use adenovirus type 2 or 5 (Ad 2 or Ad 5) or adenoviruses of animal origin within the framework of the present invention (see French application 93 05954). Among the adenoviruses of animal origin used in the context of the present invention, mention may be made of adenoviruses of canine, bovine, murine origin (example: Mavl, Beard et al., Virology 75 (1990) 81), ovine, porcine, avian or even of ape (example: SAV). Preferably, the adenovirus of animal origin is an adenovirus of canine origin, more preferably a CAV2 adenovirus [Manhattan strain or A26 / 61 (ATCC VR-800) for example]. Preferably, the adenovirus of human or canine or mixed origin is used within the framework of the invention. The defective recombinant adenoviruses according to the invention can be prepared by any technique known to those skilled in the art (Levre-ro et al., Gene 101 (1991) 195, EP 185 573; Graham, EMBO J.3 (1984) 2917). In particular, these can be prepared by homologous recombination between an adenovirus and a plasmid which possesses among others the DNA sequence encoding GDNF. Homologous recombination occurs after co-transfection of the adenoviruses and the plasmid into an appropriate cell line. The appropriate cell line should preferably (i) be transformable by said elements, and (ii) possess the sequences capable of complementing the defective adenovirus genome part, preferably under the integrated form to avoid the risks of recombination. As an example of a line, mention may be made of the human embryonic kidney line 293 (Graham et al., J .. Gen. Virol. 36 (1977) 59) which contains, in its genome, the left part of the genome of an Ad5 virus Ad5 (12%). The vector construction strategies derived from. Adenoviruses have also been described in the Nss applications. FR 93 05954 and FR 93 08596, which are incorporated by reference. Next, the adenoviruses that are multiplied are recovered and purified according to the classical techniques of molecular biology, as illustrated in the examples. The particularly advantageous properties of the vectors of the invention are derived mainly from the construct used (defective adenovirus, deleted from certain viral regions), from the promoter used for expression of the sequence encoding for, GDNF (viral or tissue-specific promoter, preferably), and methods of administering said vector, allow efficient and appropriate tissue expression of GDNF. The present invention thus provides viral vectors directly usable in gene therapy, particularly adapted and effective for directing the expression of GDNF in vivo. The present invention thus offers a particularly advantageous new method for the treatment and / or prevention of neorodegenerative diseases. The present invention also relates to any use of an adenovirus, such as that described above, for the preparation of a pharmaceutical composition for the treatment and / or prevention of neurodegenerative diseases. More particularly, it relates to any use of these adenoviruses for the preparation of a pharmaceutical composition for the treatment and / or prevention of Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS), disease of Huntington, epilepsy and vascular dementia. The present invention also relates to a pharmaceutical composition comprising one or more defective recombinant adenoviruses, as described above. These pharmaceutical compositions can be formulated with a view to administrations by topical, oral, parenteral, intranasal,. intravenous intramuscular, subcutaneous, intraocular, transdermal etc. Preferably the pharmaceutical compositions of the invention contain a pharmaceutically acceptable carrier for an injectable formulation, primarily for a direct injection into the patient's nervous system. It can in particular be sterile, isotonic or dry-mix solutions, in particular freeze-dried, which, by adding, as the case may be, sterile water or physiological saline, allow the constitution of injectable solutes. Direct injection into the patient's nervous system is advantageous since it allows the therapeutic effect to be concentrated at the level of the affected tissues. The direct injection into the central nervous system of the patient is advantageously carried out by means of a stereotaxic injection device. The use of such an apparatus in fact makes it possible to address the injection site with great precision. In this regard, the invention also relates to a method of treating neurodegenerative diseases, which comprises administering to a patient a recombinant adenovirus as defined above. More particularly, the invention relates to a method of treating neurodegenerative diseases, comprising the stereotaxic administration of a recombinant adenovirus, as defined above. The doses of defective recombinant adenovirus, used for injection, can be adapted according to different parameters, and mainly depending on the mode of administration used, the pathology in question or even the duration of the treatment sought. In a general manner, the recombinant adenoviruses according to the invention are formulated and administered in the form of doses comprised between 10 and 10 pfu / ml, and preferably 10 to 10 pfu / ml. The term pfu ("plaque forming unit") corresponds to the infectious power of a virus solution, and is determined by the infection of an appropriate cell culture, measuring, generally after 48 hours, the number of plaques of infected cells. The techniques for determining the pfu titer of a viral solution are well documented in the literature. Yet another object of the invention relates to any mammalian cell infected by one or more defective recombinant adenoviruses, such as those described. More particularly, the invention relates to any population of human cells infected by these adenoviruses. It can be treated in particular of fibroblasts, myoblasts, hepatocytes, keratinocytes, endothelial cells, glial cells, etc. The cells according to the invention can be produced from primary cultures. These can be taken or obtained by any technique known to the person skilled in the art, then put into culture under the conditions that allow its proliferation.

In more particularly fibroblasts, these can be easily obtained from biopsies, for example according to the technique described by Ham [Methods Cell.Biol. 21a (1980) 255]. These cells can be used directly for infection by the adenoviruses, or conserved, for example by freezing, for the establishment of autologous banks, with a view to further use. The cells according to the invention can also be of secondary cultures, obtained for example from pre-established banks. The cells in culture are immediately infected by the recombinant adenoviruses, to give them the ability to produce GDNF. The infection is performed in vitro according to techniques known to the person skilled in the art. In particular, according to the type of cells used and the number of virus copies per cell desired, the person skilled in the art can adapt the multiplicity of the infection and eventually the number of cycles carried out. It is understood that these steps must be carried out under the appropriate sterility conditions, when the cells are intended for in vivo administration. The doses of recombinant adenovirus used for the infection of cells can be adapted by the person skilled in the art according to the objective sought. The conditions described above for in vivo administration can be applied to infection in vitro. Another object of the invention relates to an implant comprising mammalian cells infected by one or several defective recombinant adenoviruses, such as those described above, and an extracellular matrix. Preferably, the implants according to the invention comprise 10 to 10 cells. More preferably, these comprise 10 to 10. In particular, in the implants of the invention, the extracellular matrix comprises a gelling compound and optionally a support that allows the anchoring of the cells. For the preparation of the implants according to the invention, different types of gelling agents can be used. The gelling agents are used for the inclusion of cells in a matrix that has the constitution of a gel, and to favor the anchoring of the cells on the support, as the case may be. Different cell adhesion agents can then be used as gelling agents, mainly such as collagen, gelatin, glycosaminoglycans, fibronectin, lectins, etc. Preferably, collagen is used within the framework of the present invention. It can be collagen of human, bovine or murine origin. More preferably, type I collagen is used. As indicated above, the compositions according to the invention advantageously comprise a support that allows the anchoring of the cells. The term "anchor" refers to any form of biological and / or chemical and / or physical interaction that involves the adhesion and / or fixation of the cells on the support. On the other hand, the cells can either coat the support used, or penetrate inside this support, or both. Within the framework of the present invention, it is preferred to use a solid, non-toxic, and / or bio-compatible support. In particular, polytetra-, fluoroethylene (PTFE) fibers or a support of biological origin can be used. The implants according to the invention can be implanted in different places of the organism. In particular, implantation can be performed at the level of the peritoneal cavity, in the subcutaneous tissue (subpubic region, - iliac or inguinal fossae, etc.), in an organ, a muscle, a tumor, in the central nervous system, or even under a mucus. The implants according to the invention are particularly advantageous in that they allow to control the release of the therapeutic product in the organism: This is first of all determined by the multiplicity of infection and by the number of implanted cells. Right away, the release can be controlled either by the retraction or contraction of the implant, which definitively stops the treatment, or by the use of adjustable expression systems, which allow to induce or repress the expression of the therapeutic genes. The present invention thus offers a very effective means for the treatment or prevention of neurodegenerative diseases. This is more particularly adapted to the treatment of Alzheimer's, Parkinson's, Huntington's, and ALS diseases. The adenoviral vectors according to the invention also have important advantages, mainly linked to their very high infection efficiency of nerve cells, which allow infections to be made from small volumes of viral suspension. In addition, the infection by the adenovirus of the invention is very localized at the site of the injection, which avoids the risks of diffusion to the neighboring cerebral structures. In addition, this treatment can concern both man and any animal such as sheep, cattle, domestic animals (dogs, cats, etc.), horses, fish, etc. The present invention will be more fully described with the help of the following examples, which should be considered as illustrative and not as limiting.

Description of the Figure Figure 1: Representation of the pLTR IX-GDNF vector General techniques of e. molecular biology The methods classically used in molecular biology, such as preparative extractions of plasmid DNA, centrifugation of plasmid DNA in cesium chloride gradient, electrophoresis on agarose or acrylamide gels, purification of DNA fragments by electroelution, extractions of proteins with phenol or with phenol-chloroform, the precipitation of DNA in saline medium by means of ethanol or isopropa-nol, the transformation into Escherichia coli, etc. are well known to those skilled in the art and are abundantly described in literature [Maniatis T. et al ,. "Molecular Cloning, a Laboratory Manual", Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., Ausubel F.M. et al (eds), "Current Protocole in Molecular Biology," John. Wiley & Sons, New York, 1987]. Plasmids of the type pBR322, pUC and fa-'gos of the M13 series are of commercial origin (Bethesda Research Laboratories).

For ligatures, the DNA fragments can be separated according to their size by means of electrophoresis in agarose or acrylamide gel, extracted with phenol or with a mixture of phenol / chloroform, precipitated with ethanol and then incubated in the presence of the DNA-ligase from phage T4 (Biolabs) according to the manufacturer's recommendations. The filling of the prominent ends 51 can be effected by the Klenow fragment of E.Coli DNA-Polymerase-rasa I (Biolabs) according to the supplier's specifications. The destruction of the prominent 3 'ends is carried out in the presence of the DNA-Polymerase of phage T4 (Biolabs) used according to the manufacturer's recommendations. The destruction of the prominent 5 'ends is effected by a treatment provided by the nuclease SI. The in vitro-directed mutagenesis by the synthetic oligogodeoxynucleotides can be carried out according to the method developed by Taylor et al. [Nucleic Acids Res. 13 (1985) 8749-8764] using the equipment distributed by Amersham. Enzymatic amplification of DNA fragments by the technique called PCR [Polymerase-catalyzed Chain Reaction, Saiki R.K. et al, Science 230 (1985) 1350-1354; Mullis. B. and Faloona F. A; Meth. Enzym. 155 (1987) 335-350] can be performed using a "DNA thermal cycler" (Perkin Elmer Cetus) according to the manufacturer's specifications. The verification of the nucleoidic sequences can be carried out by the method developed by Sanger and collaborators [Proc. Nati Acad. Sci. USA, 74 (1977) 5463-5467] using the equipment distributed by Amersham.

Eg emplos Example 1. Construction of the pLTR IX-GDNF vector.

This example describes the construction of the pLTR IX-GDNF vector containing the sequence encoding the rat pre-GDNF, under the control of the RSV virus LTR, as well as the adenovirus sequences that allow recombination in vivo.

Cloning of a cDNA encoding the pre-GDNF of rat. The cloning takes place using the PCR technique from the cDNA of rat glial cells, obtained by reverse transcription of RNA from these cells, using as primers the following oligonucleotides: 1 Oligonucleotide 5 ': CCGTCGACCTAGGCCACCATGAAGTTATGGGATGTC Oligonucleotide 3': CCGTCGACATGCATGAGCTCAGATACATCCACACC The fragments obtained by the PCR technique, purified on gel, cut with the SalI restriction enzyme have been inserted in a Bluescript plasmid (Stratagene), in the Salí site, An ooliation sequence from SV40 will have been introduced in the Xhol site from the same plasmid. This plasmid O is called SK-GDNF "PoliA The pLTRIX-GDNF vector has been obtained by inserting an insert between the ClaI and EcoRV sites of the plasmid pLTRIX (Stratford, Perricaudet et al. J. Clin.Invest. 90 (1992) 626). obtained by cleavage of 5 SK-GDNF-PoliA by Clal and Kpnl (free Kpnl ends) r Example 2. Construction of recombinant adenoviruses containing a sequence coding for GDNF 0 The pLTRIX-GDNF vector has been linearized and co-transfected with a deficient adenoviral vector, in the cooperating cells (line 293) providing in trans position the functions encoded by the The (ElA 5 and E1B) regions of the adenovirus. 1 More precisely, the Ad-GDNF adenovirus has been obtained by homologous recombination in vivo between the Ad-dll mutant adenovirus "324 (Thimmappaya at al., Cell 31 (1982) 543) and the pLTRIX-GDNF vector of 5 according to the following protocol: the plasmid pLTRIX-GDNF and the adenovirus Ad-dll324, linearized by the enzyme Clal, have been cotransfected with line 293 in the presence of calcium phosphate, to allow homologous recombination.The recombinant adenoviruses generated from this J ~ Q mode have been selected by plaque purification. After isolation, the DNA of the recombinant adenovirus has been amplified in the 293 cell line, which leads to a culture supernatant containing the recombinant, non-purified defective adenovirus having a titer of 10 pfu / ml. The viral particles are then purified by centrifugation on a gradient.

Example 3: In vivo transfer of the GDNF gene by a recombinant adenovirus in rats presenting a lesion of the nigro-striated pathway.

This example describes the. gene transfer GDNF in vivo by means of an adenoviral vector according to 25 to the invention. This shows about an animal model of} the lesion of the nigro-striated pathway, which the vectors of the invention allow to induce the in vivo expression of therapeutic amounts of GDNF. On previously anesthetized rats, the nigro-striated pathway 5 has been injured at the medial sencephalic face (MFB) level by injection of the 6-hydroxy-dopamine toxin (60H-DA). This chemical lesion by injection has been unilateral, following the following stereotaxic coordinates AP: 0 and -1; ML: +16 V: J 0 -8.6 and -9 (the coordinates AP and ML are determined in relation to the bregma, the coordinate V in relation to the dura mater). The inscription bar is set at +5 mm. The recombinant adenovirus GDNF was injected "immediately after the lesion, in the substance 15 black and in the striate body, on the side of the lesion. More particularly, the injected adenovirus is the Ad-GDNF adenovirus prepared above, used in the purified form (3.5x10 pfu / μl), in a phosphate saline solution (PBS). 20 The injections were made with the help of a cannula (external diameter 280 μm) connected to a pump. The injection rate is set at -0.5 μl / min after which, the cannula rests in place for 4 additional minutes before being withdrawn. The injection volumes in the striatum and in the substantia nigra are respectively 2x3 ul and 2 ul. The concentration of the injected adenovirus is 3.5 × 10 pfu / μl. For the injection into the substantia nigra, the stereotaxic coordinates are as follows: AP = -5.8; ML = + 2; V = -7.5 (the coordinates AP and ML are determined in relation to the bregma, the coordinate V in relation to the dura mater). For injections in the corpus striatum, the taxic stereo coordinates are as follows. AP = + 0.5 and -0.5; ML = 3; V = -5.5 (the coordinates AP and ML are determined in relation to the bregma, the coordinate V in relation to the dura mater). The therapeutic effects of the administration of the adenovirus according to the invention are evidenced by three types of analysis: a histological and immunohistochemical analysis, a quantitative analysis and a behavioral analysis.

Histological and immunohistochemical analysis The chemical lesion of the nigro-striated pathway induces a neuronal loss in the substantia nigra, as well as the dopaminergic denervation in the striatum (revealed in immunohistology by an anti-tyrosine-hydroxylase antibody, TH).

The histological analysis of the injected brains is carried out 3 weeks after the intracerebral injection of Ad-GDNF adenovirus under the conditions described in example 6. Serial coronal sections 30 μm thick are made in the substantia nigra and in the striatum . The slices spaced 180μm (one cut out over 6) are colored with cresyl violet (to evaluate the neuronal density) and immunolabelled by an anti-tyrosine-hydroxylase (TH) antibody (to detect the dopaminergic neurons in the substantia nigra and its innervation in the striatum).

Quantitative analysis The number of dopaminergic neurons (TH positive) in the substantia nigra is the parameter for evaluating the effects of Ad-GDNF adenovirus. The count performed on a sample (a cut above 6 over the entire length of the substantia nigra). For each cut, TH-positive neurons are counted separately from the two sides of the substantia nigra. The cumulative results for all the sections expressed in proportion: Number of neurons positive to TH on the injured side in relation to the number of neurons positive to TH on the non-injured side.

Behavioral analysis In order to evaluate the protective functional effects of an Ad-GDNF adenovirus injection on the lesion of the nigro-striated pathway, the sensory-motor functioning of the animals is analyzed in the course of 2 behavioral tests: The rotation test induced by the dipole agonists (apo-morphine, amphetamine and levodopa), and the prehension test ("leg reach").

It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Having described the invention as above, property is claimed as contained in the following:

Claims (26)

1 CLAIMS

1. A defective recombinant adenovirus, characterized in that It comprises at least one DNA sequence coding for all or an active part of the GDNF or one of its derivatives.

2. The adenovirus according to claim 1, characterized in that the DNA sequence contains in the 5 'position and in the reading phase of the , GDNF coding sequence, a secretion sequence.

3. The adenovirus according to claim 1 or 2, characterized in that the DNA sequence is a cDNA sequence.

4. The adenovirus according to claim 1 or "2, characterized in that the DNA sequence is a gDNA sequence.

5. The adenovirus according to any of claims 1 to 4, characterized in that the DNA sequence encodes the human GDNF.

6. The adenovirus according to any one of claims 1 to 5, characterized in that the DNA sequence is placed under the control of signals that allow its expression in the nerve cells.

7. The adenovirus according to claim 6, characterized in that the expression signals are chosen from among the viral promoters, preferably between the promoters ElA, MLP, CMV and LTR-RSV.

8. The defective recombinant adenovirus according to claim 1, characterized in that it comprises a cDNA sequence encoding the human pre-GDNF under the control of the LTR-RSV promoter.

9. The defective recombinant adenovirus according to claim 1, characterized in that it comprises a gDNA sequence encoding the human pre-GDNF under the control of the LTR-RSV promoter.

10. The defective recombinant adenovirus according to claim 1, characterized in that it comprises a DNA sequence coding for all or an active part of the human neurotrophic factor derived from the glial cells (hGDNF) or a derivative thereof, under the control of a promoter that allows a majority expression in nerve cells.

11. The defective recombinant adenovirus according to the rei indication 10, characterized in that the promoter is chosen from the neuron-specific enolase promoter and the GFAP promoter.

12. The adenovirus according to any of claims 1 to 11, characterized in that it is devoid of the regions of its genome that are necessary for its replication in the target cell.

13. The adeno irus according to claim 12, characterized in that it comprises the ITRs and a sequence that allows encapsidation, and in which the gel El and at least one of the genes E2, E4, L1-L5 are non-functional.

14. The adenovirus according to claim 12 < S 13, characterized in that it is a human adenovirus of the type Ad2 or Ad5, or canine of the CAV-2 type.

15. The use of an adenovirus according to any of claims 1 to 14, characterized in that it is for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of neurodegenerative diseases.

16. The use according to claim 15, c? This is because it is for the preparation of a pharmaceutical composition intended for the treatment and / or prevention of Parkinson's, Alzheimer's, Huntington's or ALS diseases.

17. A pharmaceutical composition, characterized in that it comprises one or more defective recombinant adenoviruses according to any of claims 1 to 14.

18. The pharmaceutical composition according to claim 17, characterized in that it is in the injectable form.

19. The pharmaceutical composition according to claim 17 or 18, characterized in that it comprises between 10 4 and 1014 ul: p / ml, and preferably 10 to 10 pfu / ml of recombinant adenoviruses. i defectives.

20. A mammalian cell infected by one or more defective recombinant adenoviruses, according to any one of claims 1 to 14.

21. The cell according to claim 20, characterized in that it is a human cell.

22. The cell according to claim 20, characterized in that it is a human cell of the fibroblast, myoblast, hepatocyte, endothelial cell, Glial cell or keratinocyte type.

J O 23. An implant, characterized in that it comprises infected cells according to claims 20 to 22 and an extracellular matrix.

24. The implant according to claim 23, characterized in that the extracellular matrix comprises a gelling compound selected from collagen, gelatin, glycosaminoglycans, fibronectin and lectins.

25. The implant according to claim 23 or 24, characterized in that the extracellular matrix also comprises a support that allows the anchoring of the infected cells. 25

26. The implant according to claim 25, characterized in that the support is preferably constituted by polytetrafluoroethylene fibers.