MXPA96003532A - System of supply of nucleic acid, method of synthesis and its u - Google Patents

Abstract

A nucleic acid delivery system is described. The delivery system contains a fusion protein having a target portion and a nucleic acid binding portion and a nucleic acid sequence linked to the nucleic acid binding portion of the fusion protein. The target portion can be an antibody or a ligand. The use of this nucleic acid delivery system to transiently or stably express a desired nucleic acid sequence in a cell is described. It also describes the use of this delivery system for the target cell and supplying a desired product

Description

NUCLEIC ACID SUPPLY SYSTEM. SYNTHESIS METHOD AND ITS USES In recent years, a new form of therapy, gene therapy, has been proposed to treat a variety of diseases including cystic fibrosis (CF) [Rosenfeld, MA, et al., CelJ 68: 143- 155 (1992); Rosenfeld, M.A. , et al., Science 252: 431-434 (1991), Ferkol, T., et al., J. Clin. Invest. 92: 2394-2400 (1993)], tumors such as retinoblastoma, diseases caused by infection by a virus such as human immunodeficiency virus (HIV), eg, HIV-1 infection [Baltimore, D., Na ture 335, 395-396 (1988)], etc. In this form of therapy, a gene is introduced into the cells, such that the cells will express that gene. The gene can positively potentiate the cells, for example, by supplying a lost protein, stimulate the immune system or can act in a negative way, for example by expressing a viral inhibitor, which can result in the inhibition of the virus such as the replication of the virus. HIV-1 and in this way the infection. Several approaches including antisense RNA, ribozymes and dominant-negative mutants, have been shown to be capable of inhibiting HIV-1 infection at the cellular level [Hasseloff, J, et al., Na ture 334: 585-591 (1988); Von der Krol, A.R., et al., BioTechniques 6: 958-976 (1988); Malim, M.H., et al., Cell 58: 205-214 (1989); Trono, D., et al., Cell 59: 113-120 (1989); Sullenger, B., et al., Cell 63: 601-608 (1990); Green, G., et al., Cell 58: 215-223 (1989); Buonocore, L., et al., Na ture 345: 625-628 (1990)]. The delivery and intracellular expression of a human antibody, such as a single chain anti-gpl20 antibody, is capable of inhibiting viral replication, etc. For example, the anti-gpl20 antibody inhibits the maturation and function of the envelope glycoprotein of HIV-1 [Marasco, .A. , et al., PCT Application? o. PCT / US93 / 06735, presented in July 1993]. However, despite these advances, a major impediment to the development of gene therapy protocols for the treatment and prevention of malignancies, diseases, etc., using any of these strategies is a relatively inefficient means to effectively transduce the desired genes within the desired target cells. Although murine retroviral vectors have been widely used to transfer the gene into cells, they indiscriminately infect many types of cells and in limited form the desired, infected target cells. In addition, retroviral vectors potentially contain AD? dangerous viral along with the therapeutic genes. Therefore, these vectors can not be optimal as an efficient transfer system for human gene therapy of eg AIDS [Miller, A.D., Na ture 357: 455-460 (1992); Eglitis, M.A., et al., Science 230: 1395-1398 (1985); Dizerzak, E.A., et al., Nature 331: 35-41 (1988)]. To solve the specific supply problem for cells infected with HIV, vectors Defective HIV which can specifically transfer a gene into cells susceptible to HIV have been developed [Poznansky, M., et al., J. Virol. 65: 532-536 (1991); Shimada, T., et al., J. "Clin Invest. 88: 1043-1047 (1991)]. However, this approach can not be practical with all viruses and malignancies. In addition, the theoretical potential for recombinant rescue of the defective vector, however, low, may prevent its use. The delivery and expression of a recombinant gene within cells has also been achieved using liposomes, lipofectin and calcium phosphate precipitated methods, either in vi tro or in vivo [Nicolau, C, et al., Proc. Nati Acad. Sci. USA 80: 1068-1072 (1983); Brigham, K. L, et al., Am. J. Med. Sci. 298: 278-281 (1989); ? abel, E. G., et al., Science 249: 1285-1288 (1990); Benvenisty,? et al., Proc. Nati Acad. Sci. USA 83: 9551-9555 (1986); Chen, S.-Y., et al., "Virol. 65: 5902-5909 (1991).] These methods have several advantages over retroviral systems for gene therapy. The constructs of AD? Plasmid containing elements suitable promoters, are technically easier and consume less time to prepare and test than retroviral vectors. The AD? Plasmids are more suitable for large-scale preparation than are infectious retroviruses. Plasmid DNAs can also allow the delivery of DNA segments of larger size than is possible with retrovirus-based systems. A further advantage is that the plasmid DNA can exclude deleterious side effects of retroviral vectors such as virus infection or cancer in a small percentage of patients. However, the potential for in vivo gene delivery using these methods is limited by a lack of specificity and efficiency of the cell. In an attempt to overcome the problem of cell-specific gene transfer, Wu and Wu, J. "Biol. Chem. 262: 4429-4432 (1987) have proposed a gene transfer system mediated by a chemically bound receptor, which uses receptor-mediated endocytosis to transport the DNA or RNA molecule into target hepatocytes or primary hematopoietic cells.The strategy of this system is based on the fact that such cells have unique asialoglycoprotein receptors on their surfaces, which bind internalize asialoglico-proteins, its ligand Proteins (ligands) are preferably linked to poly-L-lysine, which can bind DNA or RNA to form soluble complexes by a strong electrostatic interaction This system has been reported to transfer genes within target hepatocytes or primary hematopoietic cells at the cellular level, as well as in animal studies [Wu, GY, et al., J. Biol. Chem. 263: 1462 1-14624 (1988); Zenke, M., et al., Proc. Na ti, Acad. Sci. 87: 3655-3659 (1990); Wu, G. Y., et al., J. Biol. Chem. 266: 14338-14342 (1991); Curiel, D. T., et al., Proc. Na ti. Acad. Sci. USA 88: 8850-8854 (1991); Wagner, E., et al., Proc. Na ti. Acad. Sci. USA 87: 3410-3414 (1990); Curiel, D.T., et al., Human Gene Therapy 2: 230-238 (1992)]. However, the overall efficiency of this method has been reported to be relatively low, because endocytosis is relatively inefficient in that DNA frequently does not leave the endosomal compartment and is ultimately degraded in liposomes. In this way, multiple administrations are necessary and the antigenicity of this system can be a problem. In addition, the synthesis of the delivery system is relatively time-consuming since first the poly-L-usin has to be joined to the asialoglycoprotein and then subsequently bind the ligand-polylysine complex to the exogenous DNA. Furthermore, in its typical application, the exogenous DNA introduced into the cell is not presented in a manner which has been stably incorporated into the chromosomes. In this way, the expression is transient. Therefore, repeated administration is also necessary for this reason. However, as mentioned, the polylysine portion as an artificial moiety can activate an antigenic reaction by limiting the ability for repeated use of this system. Another form of therapy that has been proposed is to deliver a protein already expressed for the target cell. In a common form of cancer therapy, cytopathic or cytotoxic agents are introduced into the malignant cells to destroy them. However, care must be taken to minimize damage to healthy tissues and cells. In this way, strategies have been developed to specifically target unhealthy cells. The use of immunotoxins is a method of such therapy. An immunotoxin is a class of cytotoxic agents that consist of a toxin protein bound to a monoclonal antibody or a ligand, which binds specifically to a target on the cell surface [Vitetta, E.S., et al. Science 238: 1098 (1987); Pastan, I., et al., Cell 47: 641 (1986); Pastan, I., et al., Science 254: 1173 (1992)]. Due to the predicted specificity for the cell and for potential efficacy, this therapy has been predicted to play an important role in therapy against cancer and various diseases. However, in practice this has not been proven to be the case. On the contrary, toxins are highly antigenic proteins. Neutralizing antibodies against these toxins usually occur two weeks after the first exposure, severely limiting their effectiveness after only one or two therapy sessions. In this way, strategies, such as the use of immunosuppressive agents to suppress immunoreaction have been proposed. However, this is not only difficult to achieve, but may not be beneficial for the final result of the therapy, since the immune system can not perform its function, such as attacking the infection, other tumor and pathogen cells. Accordingly, it would be advantageous to have a nucleic acid delivery agent that can be assembled more simply than other nucleic acid delivery systems such as the Wu and Wu delivery system. It would also be advantageous, if such a delivery system could be synthesized more easily than is possible with a chemical coupling process. It would also be advantageous if the nucleic acid delivery system could be easily adapted to be used to specifically target a variety of target cells. It would also be advantageous if the supply system had less antigenicity than many currently available supply systems. For example, it could be desired if it could be used to supply a cytotoxic agent, for example, an immunotoxin, to a cell without the antigenicity currently associated with such systems. It would also be beneficial, if the system does not have the potential to cause disease by itself, by malignant transformation of a cell, as can occur with viral delivery systems. BRIEF DESCRIPTION OF THE INVENTION A highly efficient nucleic acid delivery system for a desired target cell has now been developed. This system can be used, for example, to deliver a gene that codes for the essential portion of a protein toxin. The nucleic acid, either DNA or RNA, is bound to a fusion protein. The fusion protein consists of a target portion and a binding portion of the nucleic acid, for example, a DNA binding portion. For example, the target portion of preference may be an antibody, more preferably a single chain antibody, a Fab portion of the antibody or a segment (Fab ') 2- If the target animal is a human, the binding portion of the DNA preferably must be a binding portion of human DNA, such as protamine. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of one embodiment of the use of the nucleic acid delivery system according to the present invention.

Figure 2 is a schematic representation of one embodiment of the expression vector for the fusion protein. It is a schematic representation of a mammalian expression vector, bicistronic, which will code for an antibody to the HIV gpl20 protein fused to a protamine protein. Figure 3 is an autoradiogram showing the radiolabelling and immunoprecipitation of the expressed Fabl05 -protamine fusion proteins. Figure 4 shows the purification and analysis by SDS-PAGE of the recombinant fusion proteins. Figure 5 shows the binding activity of the purified fusion proteins for HIV gpl20. Figure 6 is an autoradiograph showing the DNA binding activity of the Fabl05-protamine fusion proteins under various concentrations. Figure 7 is an autoradiograph showing the DNA binding activity of the Fabl05-protamine fusion proteins under various concentrations. Figure 8 is FACS analysis showing the binding capacity of the Fabl05-promatin DNA complexes to the gpl20 protein when compared to those of the Fabl05 complexes in both uninfected cells and HIV-infected cells. Figure 9 is a schematic of the expression vectors of the PEA catalytic fragment, which schematically shows the gene coding for PEA and two vectors made containing partial domains of this gene. Figure 10 is a graph showing selective cytotoxicity of one of the nucleic acid delivery systems of the present invention, Fab05-protamine, toxin-expressing, for cells infected by HIV and shows the viability of the cell. Figure 11 is a graph showing a selective cytotoxicity of Fabl05-protamine complexes, toxin expressor for HIV-infected cells and shows an inhibition assay of the protein. Figure 12 shows selective cytotoxicity of Fabl05-protamine complexes, toxin expressor for the HIV infected cell as measured by ADP-ribosylation activity. DETAILED DESCRIPTION OF THE INVENTION A new nucleic acid delivery system is described. The system comprises a fusion protein, which binds to the desired nucleic acid sequence. The fusion protein comprises a target portion and a binding portion. The target portion is preferably a protein that will specifically bind to a site in the target cell. For example, it can be a ligand for a ligand-specific receptor, for example, the fibroblast growth factor receptor (FGF-R) and the receptor-specific FGF, for example, basic FGF for a basic FGR-R. Alternatively, the protein may be an antibody specific for the target cells. For example, it may be an antibody to an envelope protein of HIV, an antibody to an oncogenic determinant, such as the extracellular ligand-binding domain of an activated receptor, (eg, erbB, ki t, fms, neu ErbB 2), etc. It can also be an antibody to a receptor, for example, an antibody to the GM-CSF receptor. Preferably, the target portion is an antibody. Even more preferably, the antibody is a single chain antibody, which comprises the antibody binding sequence, segment (Fab ') 2 ° Fab fragment of the antibody. More preferably, the antibody is a single chain or segment (Fab ') antibody 2- The particular target portion chosen can be determined empirically based on the present disclosure depending on the target cell. For example, with somatic cell therapy or in vivo with easily accessible cells or tissues such as an intravascular target, the important attributes of the target portion are affinity and selectivity. In such cases, the use of single chain antibodies as the target portion is preferable. However, when the target cell is not easily accessible, such as when the cell is part of a large solid tumor mass with a deficient blood supply and high interstitial pressure, the serum half-life is extremely important to be considered. In such cases, the complete antibody and the segments (Fab ') 2- are typically preferred. In a preferred embodiment, the fusion protein could be synthesized, such that the binding portion binds to the carboxyl terminus of an intact immunoglobulin such as IgG- ^. To limit the antigenic reaction, the portion to be targeted is preferably selected to take into account the host animal, whose cells will be targeted. Thus, if the target animal is a mouse, murine antibodies are preferably used, whereas if the target animal is a human, preferably a human antibody or a humanized antibody is used. The second part of the fusion protein consists of a binding portion of the nucleic acid, either a DNA or RNA binding moiety. Preferably, a portion that can bind to either DNA or RNA is used. This binding portion can be any protein of the target animal, which will bind to either DNA or RNA. For example, it may be protamine, which is a small basic DNA binding protein, which serves to condense the animal's genomic DNA to pack it into a restrictive volume of a sperm head [Warrant, RW, et al., Na ture 271: 130-135 (1978); Kra etz, S.A., et al., Genomics 5: 639-645 (1989)]. The positive charges of protamine can strongly interact with negative charges of the nucleic acid phosphate backbone such as AD? resulting in a neutral and stable AD? -protamine complex. The nucleic acid can be either AD? or AR? depending on the purpose. For example, the nucleic acid to be transferred can be used to express an intracellular antibody, dominant negative mutants, AR? antisense, ribozymes or a cytotoxic agent. For example, the cytotoxic agent may be a portion of a bacterial or plant toxin, which is extremely potent, such as ricin, the catalytic fragment of Pseudomonas exotoxin A (PEA), etc. The nucleic acid can be used for transient or stable transfection of the cell. For example, when the nucleic acid codes for a factor which is lethal to the cell, such as a fragment of AD? which codes for a toxin, transient expression is sufficient. In contrast, where it expresses a factor such as a suppressor gene (e.g., retinoblastoma), or a protein that is not being expressed at sufficient levels, e.g., adenosine deaminase (ADA) [Belmont, J.W., et al. Mol. & Cel l. Biol. 8: 5116-5125 (1988); Palmer, T.D., et al., Proc. Na ti. Acad. Sci USA: 1055-1059 (1982), uridine diphosphate (UDP) -glucuronyl transferase [Ponder, K.P., et al., Proc. Na ti. Acad. Sci USA 88: 1217-1221 (1991)], or insulin, stable integration into the chromosome of the cells may be advantageous. In these cases where stable integration is desired, the nucleic acid can be a segment of AD? wherein the gene encoding the desired factor is inserted into a cassette or fragment that will facilitate integration into the cell. For example, the integration cassette which surrounds the gene may be a 5 'and 3' LTR (repeated fragment of the long terminal) of a retrovirus, i.e., MMLV, an ITR (inverted terminal repeat unit, i.e. associated with adeno), etc. [See, for example, Scherdin, U., et al. , J. Virol. 64: 907-912 (1990); Stief, A., et al., Na ture 341: 343-345 (1989); Phi-Van, L., et al., Mol. & Cell. Biol. 10: 2302-2307. (1990); Phi-Van, L., et al., The EMBO Journal 7: 655-664 (1988)]. This cassette can be prepared by standard techniques. For example, mammalian expression vectors where a gene of interest can be inserted between the LTRs or ITRs. A cassette containing the flanking LTR or ITR regions can be constructed at either end, a promoter / enhancer, preferably, with a polyadaptator for the gene of interest to be inserted between and when a desired selectable marker based on the present description using known techniques. This cassette with the desired nucleic acid, for example, I b gene or genes of interest is the segment of the nucleic acid. The target portion specifically carries the delivery system to the target cell. Locating sequences can also be used to deliver the released RNA or DNA intracellularly to a cell site of interest. Then, the target cell can internalize the delivery system, which is attached to the cell. Typically, the delivery system binds to a specific receptor on the cell. For example, membrane proteins on the surface of the cell, including receptors and antigens, can be internalized by receptor-mediated endocytosis after interaction with the ligand to the receptor or antibodies. [Dautry-Varsat, A., et al., Sci. Am. 250: 52-58 (1984)]. This endocytic process is exploited by the present supply system. Because this process can damage the DNA or RNA when it is being internalized, it is preferable to include a strong promoter for the nucleic acid to be expressed. Similarly, the use of a segment containing multiple repeat fragments of the gene of interest may be advantageous. It may also include sequences or portions that disintegrate the endosomes and liposomes. See, for example, Cristiano, R.J., et al., Proc. Na ti. Acad. Sci. USA 90: 11548-11552 (1993); Wagner, E., et al., Proc. Na ti. Acad. Sci. USA 89: 6099-6103 (1992); Cotten, M., et al., Proc. Na ti. Acad. Sci. USA 89: 6094-6098 (1992). In deciding which type of nucleic acid segment to use, the technician will skillfully take into account the protein that is expressed in light of the present specification. For example, when one is introducing a protein toxin, due to its extreme cytotoxicity, the expression of only a few molecules are necessary to destroy a cell. In other cases, such as with ADA expression, larger amounts of expression proteins are necessary and the use of the LTR, ITR as part of the DNA cassette and / or liposomal disintegrating agents such as defective replication of the adenoviruses may be used. The particular protein chosen for the target portion will depend on the target cell. For example, if an infected cell, such as an HIV-infected cell, is targeted, a monoclonal antibody that specifically targets HIV-infected cells may be used. This included an antibody against the envelope glycoprotein. Any of many known antibodies can be used against HIV-1 gpl20 or HIV-2 gpl20, such as 15e, 21h [Thali, M., et al., J. Virol. 67: 3978-3988 (1993)], F105, 176 and 48d. If it is desired to deliver the nucleic acid sequence prophylactically, such as a gene for the intracellular expression of an antibody, decoy, etc., decoys of highly susceptible cells can be formed by the target receptors present on such cells, such as the CD4 receptor for cells susceptible to HIV. In such a situation, the protein may be a ligand that will preferably bind to the receptor, for example, CD4, as well as using an antibody to the receptor, such as an antibody to the CD4 receptor. This strategy for choosing the target portion is very adaptable. For example, certain tumors are often associated with cells that possess a large amount of a particular surface, cellular receptor (e.g., peu with breast cancers), or an abnormal form of a particular protein. Other receptors of interest include those for lymphokines such as interleukins and interferons, for example, the interleukin-2 receptor (IL-2), (IL-2R). The a chain of IL-2R, p55, is also mentioned as the Tac protein is associated with Ag or the T cells activated with the mitogen, but not with the inactive T cells. It was expressed at high levels of malignant cells of lymphoid cancers such as adult T cell leukemia, cutaneous T-cell lymphoma, and Hodgkins disease. The anti-Tac antibody will bind to this protein. The humanized version of such antibodies are known and described in Queen, C., et al. , Proc. Nati Acad. Sci. C75A.-10029-10039 (1989); Hakimi, J. et al., J. of Immun. 151: 1075-1085 (1993) (ikSl which is a Mab against the β chain of IL-2R); Kreitman, R.J., et al., J. of Im a. 149: 2810-2815 (1992); Hakimi, J., et al., J. of Immun. 147: 1352-1359 (1991). Antibodies to these various proteins are known and available. These antibodies can be easily adapted for use in this system, following the general procedures described herein and substituting the gene encoding the desired binding site for the exemplified gene. For example, where the target cell is an HIV-infected cell, the target portion can target the envelope glycoprotein HIV. Any number of antibodies for this protein can be used. For example, a recombinant antibody based on the F105 antibody is made by the techniques of known teachings [Posner, M.R., et al., J. Im unol. 146: 4325-4332 (1991); Thali, M., et al., J. Virol. 65: 6188-6193 (1991); Marasco, W.A. , et al., Proc. Na ti. Acad. Sci. USA 90: 1889-1893 (1993)] other antibodies that can be made include, 15e, 21h, 17b, 48d, etc.A vector for the expression of the antibody can be made as described herein. For example, a bicistronic mammalian expression vector, which will express the Fd portion of the antibody (VH and Cu) and the binding region of the light chain (e.g., the kappa chain) for example, of the F105 antibody can be constructed using an Fd fragment without a stop codon and amplifying the segment by standard techniques, for example, by the polymerase chain reaction (PCR). The primer towards the 5 'end will preferably correspond to the leader sequence of the animal's immunoglobulin from which the cells of the delivery agent will be used (e.g., where the target cell is a human cell or a human immunoglobulin). 1-6 amino acids), with an additional convenient cloning site, such as the HindIII site. The initiator towards the 3 'end may correspond to the amino acids by the carboxyl terminal of the constant region of the heavy chain. For example, with an antibody based on F105, amino acids 226-233 of the CHI domain of the human heavy chain with a convenient inserted cloning site, such as the Xbal site. The PCR reaction is carried out according to standard means. By this means, the gene or segments of the gene encoding the target portion of the fusion protein is prepared.

As described in the above, the second portion of the fusion protein is the binding portion. Preferably, a single vector is used that contains the gene segments that will express the target portion and the binding portion. However, a vector system can be used to co-transfect a cell with at least two vectors and select for cells expressing the fusion protein. Preferably, only one vector is used. Preferably the sequence encoding the target portion for a gene, or the segment of the gene encoding the binding portion by standard means is attached. For example, a gene for human protamine [Balhorn, J. "of Cell, Biol. 93: 298-305 (1982)]. Other nucleic acid binding proteins include GCN4, Fos and Jun, which bind to DNA by means of a common structural motif consisting of several basic residues and an adjacent region of approximately 30 residues containing a heptad repeat fragment of leucines, "leucine closure" mediating dimerization [Talanian, RV, et al., Science 249: 769-771 (1990)], the nucleic acid binding domain TFIIS, which is observed in the residues 231-280 C-terminal [Qlan, X., et al., Na ture 365: 211-219 (1993)]; the ribonucleoprotein family (R? P) that is present in the human FMRI domains, the yeast HX protein, 14 domains of the chicken vigillin gene, 1 unit, a yeast protein, bacterial polynucleotide phosphorylase and the ribosomal protein S3 [Ashley, CT, et al., Science 262: 563-566]; and the binding motifs in the heat shock protein [Rabindran, S.K., et al., Science 259: 230-234 (1993)]. The host animal of the target cells will be used to determine which protein or protein fragment with a binding motif is used. For example, with a human host and for the expression of the human protein, one can use the known pTZ 19R-HP1 plasmid [Kra etz, S.A., et al., Genomics 5: 639-645 (1989)]. Preferably, an intron in this gene would be eliminated, in such a way that the expression vector can also be used for the expression of the fusion protein in prokaryotic systems, as well as eukaryotic systems. The PCR amplification would be performed by standard means. For example, by using an initiator to the 5 'end which corresponds to the amino terminal sequences, for example, which corresponds to amino acids 1-6 of the protamine protein with a convenient restriction site, such as the Xbal cloning site and an initiator towards the 3 'end corresponding to the carboxy portion of the first exon, for example, amino acids 29-37 with additional sequences complementary to the 5 'amino acids in the second terminal (e.g., amino acids 38-40 in the second exon). A second PCR reaction can then be performed using the primer to the 5 'end corresponding to the amino terminus and the primer to the 3' end corresponding to an overlap portion for the carboxy terminus. For example, using a sequence corresponding to amino acids 31-40 with the sequence of 41 amino acids for the stop codon in the second exon and an additional convenient cloning site such as NotI. The first segment of DNA amplified by PCR can be used as a template. Using convenient restriction sites, the target portion and the binding portion can be cut by known methods, such as by purification using standard techniques, for example, agarose gel. For example, in the example described above, Fd amplified by F105 PCR, without a stop codon, can be cut with HindIII / Xbal and purified by agarose gel. The gene coding for protamine amplified by PCR, without intron can be cut with Xbal / Notl and purified on agarose gel. The Fabl05 plasmid can be cut with HindIII / Notl and the DNA segment purified from an agarose gel. The Fd fragment cut with HindIII / Xbal and the protamine fragment cut with Xbal / Notl can then be cloned into the HindIII / NotI sites of the plasmid containing F105 by three-part binding. See Figure 2. The resulting expression vector thus contains a cartridge of an Fd-protamine fusion gene (in frame) and the kappa chain gene under the control of an independent promoter, such as a CMV promoter. The particular promoter that would be used depends on the cell system desired for the expression of the fusion protein. Promoters are known to a skilled artisan and can be easily selected based on the present disclosure. For example, preferred promoters include CMV, SRa, RSV, MMLV, LTR, SV40 and HIV-1 5 'LTR. This construction or construct can easily be confirmed by standard means, such as DNA sequencing. This expression vector can then be used to stably transform a cell line. The cell line can be any desired cell line, including prokaryotic cells, as well as eukaryotic cells. Preferred cell lines include mammalian cells, including COS cells, kidney cell lines, such as CHO, myeloma cell lines, such as SP / O and SP / 2, HMMA2-11 TG10, and insect cell lines such as Drosophilla Preferably, a mammalian cell line could be used to reduce antigenicity. More preferably, a myeloma cell could be used. Preferred cells include SP / O, SP / 2, Sp2 / 0Agl4, X63Ag8.653, FO, NSI / l-Ag4-l, NSO / l, FOX-NY, YB2 / 0 and 1R983F.

The transformation of the cell can be by any of the standard techniques. It is preferred that the cell is transformed stably, although in certain cases, the transient transformation by the DEAE-Dextran technique will be acceptable. Thus, preferably a method is used to stably transform the cell, such as the calcium phosphate precipitation method, followed by the selection of transformed cell lines such as G418 selection. The transformed cell line can be cultured and the fusion protein harvested by standard techniques. For example, the Fd-prota ina protein and the kappa chain of F105 are expressed and secreted in the culture of the COS cells transformed by Fabl05 protamine and detected by radiolabelling and in unoprecipitation with an anti-human IgG antibody. For example, the COSI cell can be transfected with an expression vector, which contains the cartridge of the target portion-binding portion, using lipofectin. Vectors include the vector pCMV-Fabl05-protamine. The transfected cells can then be incubated in DMEM, supplemented with 10% fetal calf serum (FCS) for two days and replaced with a selection medium such as DMEM with 10% FCS and 500 μg of G418. This is easily available, for example, from BRL. Resistant colonies G418 will appear after approximately two weeks and can be easily selected. The colonies can then be cloned with limiting dilution and examined by radiolabelling and immunoprecipitation, ELISA and immunofluorescent staining for the expression of the recombinant fusion protein. The proteins can be secreted and purified in these cells by standard means. For example, transformed COS cells can be grown in a flask with DMEM medium supplemented with 10% fetal calf serum and 500 μg / ml neomycin. After reaching confluence, cultures can be replaced with freshly prepared DMEM without FCS every three days for two weeks. The collected culture media can be clarified, for example, by centrifugation for example, at 500 rpm for 20 minutes at 4 ° C and then concentrated using, for example, a membrane filter with a molecular weight exclusion of 10,000 dalton units such as an Amico concentrator. The concentrated medium can then be loaded into an affinity column coupled with an anti-human IgG kappa chain monoclonal antibody, such as that sold by Kirkegaard & Perry, Inc. The affinity column can be washed with PBS and loaded with the concentrated culture medium. The medium will then pass through the column, followed by washes with PBS until no protein is detected in the eluate. The column is then washed with pre-elution buffer, for example, 10 mM phosphate at pH 8.0 and eluted from the column with 100 mN glycine at pH 2.4. The peak fractions of the protein are detected by standard means such as, for example, the Bradford protein assay (Biolab) and deposited together and dialyzed against 0.2 M NaCl. In a preferred embodiment, the cell could be adapted for growth in a medium without serum. This can be done by a skilled technician. For example, COS and CHO cells can be easily adapted. By doing this, the pure Fab fusion proteins are secreted in the medium. In this way, the purification process is simpler. The purified fusion protein is now ready to be combined with the desired nucleic acid sequence, such as for a positive potentializer (such as a gene for a cytokine, a gene for a lost or defective protein, etc.) or a sequence for a negative potentiator (such as a toxin, an antisense RNA, a suicide gene such as HSV thymidine kinase, a ribozyme, a dominant negative mutant, etc.). For example, when the nucleic acid codes for a toxin, care is taken to alter the toxin gene to minimize its potential to affect the non-target cells. This can be done by standard techniques such as deleting those sequences that code for recognition domains. The toxins are well known and include diphtheria toxin and its cut or truncated versions, pseudomonas exotoxin and its truncated versions, ricin / abrin, ricin / blocked abrin, toxin A ricin chain, protein that inactivates the ribosome, etc. All these proteins have different domains. For example, the gene that codes for PEA has several domains: Domain I is responsible for the recognition of the cell; Domain II for the translocation of the toxin that crosses the membrane and Domain III for the adenosine diphosphate (ADP) -ribosylation of the elongation of factor 2, which is the stage really responsible for the death of the cell. [Gary, G.L., et al., Proc. Nati Acad. Sci. USA 81: 2645-2699 (1984); Allured, V.S., et al., Proc. Nati Acad. Sci. USA 83: 13220-1324 (1986); Siegall, C.B., et al., J. Biol. Chem. 264: 14256-14261 (1989)]. Consequently, by alterations in Domain I or Domain II, what renders these domains incapable of expression, for example, by frame shift mutation, insertion of termination sequences or deletions, can minimize the ability of the toxin to affect nearby or neighboring cells. Then, the skilled technician can use standard techniques to make sure that the other domains, or portions of domains where expression is desired, are used. For example, as indicated in the above, with PEA only Domain III is absolutely required. However, it has been found that including partial sequences from other domains, makes the toxin more effective. For example, two mammalian expression vectors PEA were prepared. This is one in which Domain III (residues 405 to 613 amino acids of mature PEA) only, mentioned as pCMV-PEA III is expressed and one which codes for Domain III and the partial IB Domain, expresses an amino acid sequence 385 to 613 (pCMV-PEAIblII). These sequences must be functionally linked to a promoter, which will allow expression in the target cell. For example, mammalian promoters such as CMV, SRa, RSV, SV40, MMLV LTR, HIV-1 5 'LTR, are preferred. More preferred, CMV, HIV-1 5 'LTR, RSV, and SV40. The toxin proteins encoded by these gene fragments lack a recognition domain. They are not toxic to the surrounding cells and are only toxic when expressed inside a cell. These expression vectors can be easily tested to determine that they also express a product intracellularly by a simple in vi tro assay. For example, the expression of those DNA sequences encoding the PEA toxin fragments can be tested by transforming a cell with the delivery system and observing the cytotoxicity of the cell. It has been found that the vector pCMV-PEIblII shows a higher level of ADP-ribosylation than the expression vector only of Domain III and thus, it is preferred to use it. Figure 1 is a schematic representation showing the use of the nucleic acid delivery system according to the present system, wherein the nucleic acid sequence is a DNA expressing the toxin. In some cases, even with the immunotoxins, resistant mutants can develop. In such cases, a different toxin gene or different types of nucleic acid segments can easily be inserted into the nucleic acid cassette, which is bound to the fusion protein. In this way, the present system allows the production and use of a wide range of DNA and RNA segments. In some preferred embodiments, a mixture of the nucleic acid delivery systems could be administered, where the target portion can be changed to expand the target cell number or alternatively, the nucleic acid segment that is delivered is changed to extend the spectrum of products delivered to the target cell. When the protein is a toxin, the transient expression in the cell is all that is needed. However, when it is desired to stably transform a cell, the gene is placed in a cassette containing the LTR or ITR on either side to reinforce the stable integration. Alternatively, the cassette may be an episomal vector such as one containing an Epstein Barr virus, eg, pEBV His A, B, and C, pREP4, pREP7, pREPlO, which are sold commercially by Invitrogen Corporation. The recombinant fusion proteins are combined with the nucleic acid segment by standard techniques. For example, the fusion protein can be mixed with given amounts of the desired nucleic acid sequence, either DNA or RNA, by known means such as mixing in solution. For example, in 0.2 M NaCl solution. DNA or RNA is easily bound by protamine. Then, the carrier can be administered to the desired cell either by somatic cell therapy or used in vivo. The supply system can be supplied by any number of media. For example, it can be administered by parenteral injection (intramuscular (i.m.), intraperitonal (i.p.), intravenous (i.v.) or subcutaneous (s.c.)), oral or other routes of administration well known in the art. Parenteral administration is preferred. The amount used will typically be in the range of about 0.1 mg to about 10 mg / kg of body weight. The delivery system of preference will be formulated in dosage unit form, based on the nucleic acid or nucleic acids that are supplied. For example, solid dosage forms that can be used for oral administration include capsules, tablets, pills, powders and granules. In such solid dose forms, the active ingredient, ie, the portion that is the target, is mixed with at least one inert carrier such as sucrose, lactose or starch. Such dosage forms may also consist of additional substances other than inert diluents, for example, lubricating agents, such as magnesium stearate. In addition, the dosage forms in the case of capsules, tablets and pills may also consist of buffering agents. Tablets, capsules and pills may also contain release coatings over time. For parenteral administration, sterile or non-aqueous aqueous solutions, suspensions or emulsions are typically included in association with a pharmaceutically acceptable parenteral vehicle. Examples of non-aqueous solvents or vehicles are propylene glycol, polyethylene glycol, vegetable oils such as olive oil and corn oil, gelatin and organic and injectable esters, such as ethyl oleate. These dosage forms may also contain adjuvants such as preservatives, humectants, emulsifiers and dispersants.

They can be sterilized for example, by filtration by means of a filter that retains the bacteria, by incorporation of sterilization agents in the composition, by irradiation of the compositions, etc., while taking care to inactivate the antibody. They can also be manufactured in a sterile water medium or some other sterile injectable medium before use. Other examples of these vehicles include saline, Ringer's solution, dextrose solution and 5% human serum albumin. Liposomes can also be used as carriers. Additives, such as substances that increase isotonicity and chemical stability, for example, buffers and preservatives can also be used. The preferred range of the active ingredient in such vehicles is in concentrations of about 1 mg / ml to about 10 mg / ml. More preferably, from about 3 mg / ml to about 10 mg / ml. Although the delivery of the gene mediated by the receptor in certain embodiments may be relatively inefficient, by the use of the present delivery system of the gene, one does not have to worry about the antigenic reactions that occur by the use of higher doses or repeated injections. This is because the target portion and the DNA binding portion can be designed in such a way that they are either of the animal that is injected, such as a human, or prepared to be similar to that animal, i.e. using a humanized murine antibody or a binding protein for a human. DNA by itself is weak or is not immunogenic. In this way, the entire agent is not immunogenic or is weakly immunogenic. Since the supply system can be efficiently produced and adapted to have high binding activity, it can be used repeatedly. Additionally, as discussed in the above, there are methods that can be used in the present system to improve the efficiency of the supply system. For example, one can include target sequences such as the target sequences associated with the nucleic acid segment to more efficiently deliver the nucleic acid to its desired target. The target sequences are known in the art and include for example, the nuclear localization signal in HIV gag pl7 between positions 25 and 33 (SEQUENCE OF IDENTIFICATION NO: 1) (KKKYYKLK). In this way, an objective sequence, preferably within a liposome, can be included as part of the fusion portion to more effectively target the DNA. The present invention is further illustrated by the following examples. These examples are provided to aid in the understanding of the invention and should not be considered as a limitation thereof.

EXAMPLES A mammalian cell expression vector, bi-cistronics (pCMV-Fabl05-Protamine) which contains a chimeric gene coding for Fd of F105 fused to the human protamine protein in an expression cassette and the gene coding for the The F105 kappa chain in another expression cassette (Figure 2) is constructed as follows. Construction of the Mammalian Expression Vector for the Fabl05-Protamine Fusion Protein The pCMV-Fabl05 plasmid was constructed as described in the following. This plasmid contains the bi-cistronic expression cassettes for the Fd gene and the kappa chain gene derived from the hybridoma F105. To construct an expression vector of the fusion protein, the Fd fragment of F105 without a stop codon was amplified by PCR using pCMV-Fabl05 as a template. The primer towards the 5 'end (SEQUENCE OF IDENTIFICATION NO: 2) (5'-TTTGAATTCAAGCTTACCATGGAACATCTGTGGTTC-3') which corresponds to the leader sequence of the human immunoglobulin of amino acids 1 to 6 with an additional HindIII cloning site (Kabat, et al., 1987) and the primer towards the 3 'end (SEQUENCE OF IDENTIFICATION NO: 3) (5'-GGTACCGAATTCTCTAGAACAAGATTTGGGCTC-3') corresponding to the amino acids 226 to 233 of the constant region of the human heavy chain, with an additional Xbal cloning site, 3b used for PCR amplification. The PCR reaction was performed as previously described [Marasco, et al., J. of Clin. Invest. 90: 1467-1478 (1992)]. The human protamine gene was amplified from the pTZ19R-HPl plasmid [Krawetz, S.A., et al., Genomics 5: 639-645 (1989)]. To eliminate an intron in the protamine gene in this clone (for expression also in the prokaryotic system) the first PCR amplification was performed using the PI primer towards the 5 'end (SEQUENCE OF IDENTIFICATION NO: 4) < 5'-GGTACCGAATTCTCTAGAATGGCCAGGTACAGATGC-3 '), which corresponds to the sequence of amino acids 1 to 6 of the protamine protein with an additional Xbal cloning site and the primer to the 3' end (SEQUENCE OF IDENTIFICATION NO: 5) (51 -TTTAGGATCCTTAACAACACCTCATGGCTCTCCTCCGTGTCTGGCAGC-3 ') which corresponds to amino acids 29 to 37 with additional complementary sequence for amino acids 38 to 40 in the second exon. The second PCR reaction was performed using the Pl primer towards the 5 'end and the primer towards the 3' end (SEQ ID NO: 6) (5 '-TTAATTGCGGCCGCTTAGTGTCTTCTAC- ATCTCGGTCTGTACCTGGGGCTGACACCTCATGGCTCTCCTCCGTGTCTG3'), corresponding to the amino acid sequence 31 a 40 with the amino acid sequence 41 for the stop codon in the second exon and an additional Notl cloning site. 3 b The first DNA amplified by PCR was used as a template. To construct an expression vector of the bi-cistrionic fusion protein, the Fd of F105 amplified by PCR without stop codon is cut with HindIII / Xbal and purified from an agarose gel. The gene coding for the complete protamine, amplified by PCR, without intron, is cut with Xbal / Notl and purified from an agarose gel. The plasmid pCMV-Fabl05 is cut with HindIII / Notl and the DNA fragment of approximately 7.0 kd units is purified from an agarose gel. The Fd fragment cut with HindIII / Xbal and the protamine fragment is cut with Xbal / Notl is then cloned into the HindIII / Notl sites of pCMV-Fabl05 by ligation of three pieces. The resulting expression vector, designated pCMV-Fabl05-Protamine, contains the Fd-protamine fusion gene (in frame) and the kappa chain gene under the control of the independent CMV promoter. This construct was confirmed by DNA sequencing. The DNA fragments of human protamine and FIO5 Fd, which were cloned into the vector pCMV-Fabl05, are shown in Figure 2. The resulting bi-cistron expression vector (pCMV-Fabl05-Protamine) containing an expression cassette for the fusion protein Fdl05 -protamine and another cassette for the kappa chain of F105.

A line of mammalian cells was generated, transformed COS-Fabl05-Protamine after transfection of the DNA and selection with G418. Construction of Transformed Cell Lines To generate transformed cell lines, COS-1 cells are grown in 6-well plates and transfected with pCMV-Fabl05-Protamine using lipofectin as previously described [Chen, S.-Y., et al. . J. Virol. 65: 5902-5909 (1991)]. The transfected cells are incubated in DMEM supplemented with 10% FCS for two days and replaced with selection medium (DMEM with 10% FCS and 500 μg / ml of G418 (BRL).) Colonies resistant to G418 appear after two weeks. Three weeks of selection The colonies were subcloned with limited dilution and examined by radiolabelling and immunoprecipitation, ELISA and immunofluorescent staining for the expression of the recombinant proteins as described [Marasco, WA, et al., Proc. Nati. Acad. Sci USA 90: 1889 (1993).] The Fd-protamine protein and the kappa chain of F105 are expressed and secreted in the culture medium of COS-Fabl05-Protamine cells as detected by radiolabelling and immunoprecipitation with the IgG antibody. anti-human See Figure 3. Purification of Fusion Proteins Transformed COS cells (COS-Fabl05-Protamine) are grown in flasks with DMEM medium supplemented with 10% fetal calf serum (F CS) and 500 μg / ml of neomycin. After reaching the confluence, cell cultures were replaced with fresh DMEM without FCS, every three days for two weeks. The collected culture medium is clarified by centrifugation at 5000 rpm for 20 minutes at 4 ° C, and then concentrated using an Amico concentrator with a molecular weight exclusion membrane filter of 10,000 Dalton units. The concentrated medium is then loaded onto an affinity column coupled with monoclonal antibodies to the anti-human IgG kappa chain (Kirkegaard &; Perry Inc.). The preparation of the affinity column was made by mixing 2 mg of the purified monoclonal antibody with 1 ml of wet beads of A-sepharose CL-4B proteins (Pharmacia Inc. Uppsala, Sweden) as described. Briefly, the protein-A-sepharose 4B beads were washed with PBS and then mixed with antibodies purified in PBS at 4 ° C overnight. The mixture is washed with 10 volumes of 0.2 M sodium borate (pH 9.0) and added with dimethylpimelimidate to a final concentration of 20 mM. The mixture is stirred for 30 minutes at room temperature on a shaker, washed once with 0.2 M ethanolamine (pH 8.0) and then incubated for 2 hours at room temperature in 0.2 M ethanolamine on a shaker. After the final wash, the beads copied with l > the antibodies are resuspended in PBS with 0.01% merthiolate. The affinity column was washed with PBS, and loaded with the concentrated culture medium. The medium passed through the column followed by a PBS wash until no eluate protein was detected. The column was washed with pre-elution buffer (10 mM phosphate, pH 8.0) and eluted from the column with glycine 100 mN pH 2.4. Peak or maximum protein fractions were detected by the Bradford protein assay (Biol-Lab) and deposited together and dialyzed against 0.2 M NaCl. The DNA binding portion of the fusion protein was examined by incubation of the DNA- cellulose with the culture medium of the radiolabeled cells. The transformed cell line (COS-Fabl05-Protamine) was generated with the selection of G418 (Gibco-BRL) after transfection with pCMV-Fabl05 -Protamin DNA [Warrant, RW, et al., Nature 271: 130-135 (1978)]. The COS-Fabl05 cell line was established as previously described [Warrant, R.W. , Nature 271, supra]. To examine the expressed proteins, the transformed cells were radiolabelled for 4 hours and precipitated with antihuman IgG (Sotuhern Biotech) and protein beads A-Sepharose 4B or with AD? -cellulose (Pharmacia) and analyzed by SDS-PAGE as described previously [Chen, S.-Y. et al., J. Virol. 65: 5902-5909 (1991)]. To purify Fab05-Protamine secreted in serum-free medium, the culture medium of COS-Fabl05-Protamine cells was clarified, concentrated and loaded onto an affinity column of protein-A-Sepharose 4B beads bound with a monoclonal antibody. Anti-human IgG, which will be prepared according to the described methods [Wintr, G., et al., Na ture 349: 293-299 (1992)]. The bound proteins in the column were eluted by 100 mM glycine (pH 7.5) and then concentrated and dialyzed against a 0.20 M? -aCl solution. For the ELISA, the microtiter plates are coated with recombinant gpl20 (American Biotechnology Inc.) and are incubated with a known concentration of Fabl05 or Fabl05-Protamine proteins, followed by incubation with antihuman IgG conjugated with alkaline phosphatase (Sigma) [Warrant, RW , et al., Nature 271, supra]. Figure 3 shows the radiolabelling and imunoprecipitation of the expressed fusion proteins. The transformed cell line (COS-Fabl05-Protamine) was generated as discussed in the above. Cells in 6-well plates were radiolabelled continuously with 5S-cysteine for 4 hours and the cell culture medium was precipitated with either the anti-human IgG antibody (Southern Biotech) followed by Sepharose-protein-A or with AD? cellulose (Pharmacia). The samples were analyzed by SDS-PAGE under reducing conditions. Lane 1, COS-Fabl05-Protamine, precipitated with anti-human IgG; lane 2, COS-vector precipitated with anti-human IgG and DNA-cellulose; lane 3, COS-Fabl05-Protamine precipitated with DNA-cellulose; Lane 4 and 5, COS-Fab05 precipitated with DNA-cellulose (4) or with anti-human IgG (5). The DNA-cellulose co-precipitated the Fd-protamine fusion proteins and the kappa chain, but not the Fabl05 fragment, suggesting that the DNA binding portion of the Fd-protamine fusion protein retains its DNA binding capacity and the fusion proteins are associated together. The binding activity against HIV gpl20, approximately 0.1 μg / ml / 24 hours, was detected in the culture medium of the COS-Fabl05-Protamine cells by an enzyme-linked immunosorbent assay (ELISA), whereas it was not observed no activity in the medium of the cells transformed with the vector. The secreted recombinant fusion proteins are purified from the culture medium without serum, using an affinity column coupled with monoclonal antibody of the anti-human IgG kappa chain (Figure 4). The fusion proteins bound to the column were eluted by 100 mM glycine (pH 2.4), concentrated and analyzed by SDS-PAGE following non-reducing or reducing conditions, as shown in Figure 2., under the reducing condition, two protein bands corresponding to the Fd-protamine fusion protein and the kappa chain appear in the gel. While under reducing or reducing conditions, most of the proteins moved to a higher molecular weight band, which probably represents the assembled Fab fragments. The specific binding activity of purified Fabl05-Protamine to gpl20, although slightly less than that of Fabl05, was detected by ELISA. Figure 4 shows the purification and analysis by SDS-PAGE of the recombinant fusion protein. The Fabl05-Protamine fusion proteins in the culture medium were purified by an affinity column coupled or linked with monoclonal antibodies to the kappa chain of antihuman IgG (Kirkegaard and Perry Lab) as described. The proteins bound to the column are eluted by 100 mM glycine (pH 2.4) and then concentrated and dialyzed against 0.20 M NaCl solution. The purified proteins were analyzed by SDS-PAGE under reducing or non-reducing conditions following the blue stain. of coomassie. Lane a, 100 ng (left), Lane a '10 ng (right) of Fabl05-purified Protamine under reducing conditions; Lane b 100 ng of Fabl05-purified Protamine under non-reducing conditions. The Gpl20 binding or binding activity of the purified fusion protein is shown in Figure 5. ELISA plates coated with recombinant HIV-1 gpl20 (American Biotechnology, Inc.) were incubated with Fabl05 or Fabl05-Protamine proteins, followed by human IgG conjugated with alkaline phosphatase (Sigma). Gpl20 binding activity was detected at an OD405 after incubation with the substrate (Bio-Lab). The data shown are the average values of the duplicate determination. Lane a, 10 ng / ml of Fabl05 or Fabl05-Protamine, lane b, 1 ng / ml; Lane c, 0.1 ng / ml and Lane, 0.01 ng / ml. The first column in each lane is Fab-105, while the second column is Fab-105-Protamine. These results indicate that the Fabl05 -Protamin fusion proteins, which are assembled and secreted into the culture medium, have specific binding activity for HIV-1 gpl20. The DNA binding activity of Fabl05-Protamine was examined by a gel shift assay [Wagner, E., et al-, PNAS USA: 89.-6099-6103 (1992)]. DNA Binding or Linkage Assay The gel shift assay used to analyze the binding or DNA binding activity of the recombinant fusion proteins. The increased amounts of the purified fusion proteins in 0.2 N NaCl solution are mixed with a given amount of DNA either radiolabeled or not radiolabeled in a 0.2 N NaCl solution. Radiolabelling of the DNA with 32 P-dATP (Amrasham) is made using a nick translation team (Promega). The protein-DNA mixtures are allowed to stand at room temperature for 30 minutes and are filtered through a 0.45 μM pore size membrane to remove the DNA-protein precipitates and then loaded onto a 1.0% agarose gel. for TAE shock absorber IX electrophoresis. To analyze the cytotoxicity of the DNA-expressor of the toxin, the fusion protein-DNA mixtures were dialyzed against normal saline at 4 ° C overnight, before adding to the cell cultures. The binding activity of the protein's DNA Fab05 -Protamine is shown in Figure 6. The binding or DNA binding capacity of Fabl05-Protamine was examined by the gel mobility shift assay [Wu, G. Y., et al., J. Biol. Chem. 262: 4429-4432 (1987)]. The fragments of DNA cut with HindIII / Xbal from pCMV-Fabl05-Protamine were radiolabelled with 32P-dATP using a nick translation kit (Pharmacia) 20 ng of labeled DNA for each sample, incubated with an increased amount of Fabl05-Protamine proteins in 0.20 N NaCl solution DNA was incubated with Fabl05 proteins as control The complete plasmid DNA pCMV-Fabl05-Protamine (0.2 μg of each sample) was also incubated with an increased amount of pCMV-Fabl05 proteins - Protamine in NaCl 0.20 N (See Figure 7.) The samples were analyzed by electrophoresis in 0.8% agarose gels.

After autoradiography, the gel was dried and exposed on an X-ray film. Figure 6: lane 1, only DNA (5 ng); lanes 2 to 4, DNA (5 ng) with 0.5 ng of Fab-Protamine (2); with 1.0 ng of Fab-Protamine (3); with 10 ng of Fab-protamine (4); lane 5, DNA (5 ng) / 10 ng of Fabl05 as control. Figure 7, lane 1, only DNA (0.2 μg); lane 2, DNA (0.2 μg) /2.0 μg of Fabl05 control; lanes 3 to 6, DNA (0.2 μg) with 0.1 μg of Fab-Protamine (3); with 0.2 μg of Fab-Protamine (4); with 0.4 μg of Fab-Protamine (5); with 0.6 μg of Fab-Protamine (6), lane 7, only Fabl05-Protamine (0.6 μg); and lane 8, DNA (0.2 μg) with 0.6 μg of Fabl05-Protamine / phenol extract before loading into the gel. As shown in Figures 6 and 7, when increasing amounts of fusion proteins are mixed with radiolabeled DNA fragments or whole plasmid DNA, decreasing amounts of DNA fragments or whole plasmid DNA migrate in the agarose gels and the DNA that enters the agarose gels migrate slower, while the DNA incubated with the Fabl05 proteins showed no significant change in their mobility in the agarose gels. The binding or binding activity of the fusion proteins to gpl20 on the surface of the cell, after coupling with DNA, was further examined by fluorescent activity cell sorting (FACS). 4 The binding capacity of the Fabl05-Protamine-DNA complexes to GP120 on the cell surface are shown in Figure 8. HIV-infected or pseudo-infected Jurkat cells were incubated with Fabl05 or Fabl05-Protamine complexes, protein-DNA followed by antihuman IgG Fab [grastan, I., et al., Science 254: 1113 (1992)] conjugated to Fitc. Fluorescent staining on the surface of the cell was analyzed by FACS. The DNA mobility shift assay was performed as described [Wu, G.Y., et al., J. Biol. Chem. 262: 4429 (1987); Wagner, e., Et al., Proc. Nati Acad. Sci. USA 89: 6099 (1992)]. The increased amounts of the purified fusion proteins were mixed with given amounts of the DNA in the NaCl 0.2 M solution. The mixtures were allowed to stand at room temperature for 30 minutes and then filtered through a 0.45 μM membrane.

(Millipore) before loading on 0.8% agarose gels for electrophoresis. To detect the binding capacity of the fusion protein-DNA complexes for gpl20 on the cell surface, 1 μg of purified Fabl05-Protamine was mixed with 0.5 μg of plasmid DNA pCMV-Fabl05 in 100 μl of 0.2 N NaCl for 30 minutes , and the mixture is diluted 1:20 in 0.9% N NaCl solution and incubated with Jurkat cells infected with HIV-1 and if infected, followed by anti-human IgG-Fitc conjugates. The Fabl05 fragments were used as a control. Fluorescent staining is then analyzed by FACS. As shown in Figure 8, cells infected with HIV-1 reacted with either Fabl05 or the Fabl05-Protamine-DNA complexes, showed positive staining, while uninfected cells incubated with the complexes showed negative staining. Infected cells incubated directly with the conjugated antibody, also showed negative staining (not shown). In this way, the Fabl05-Protamine fusion proteins maintain the binding activity for gpl20 after binding to the DNA molecules. The gene encoding PEA was selected to construct mammalian toxin expression vectors, due to the accumulated knowledge of the coding-function relationship gene sequence [Gary, G.L., et al., Proc. Na ti. Acad. Sci USA, 81 supra; Allured, V.S., et al., Proc. Na ti. Acad. Sci. USA 83, supra; Siegall, CB, et al., J ". Biol. Chem. 264, supra] PEA has several functional domains: Domain I is responsible for the recognition of the cell: domain II, for the translocation of the toxin that crosses the membrane; and domain III, for adenosine diphosphate (ADP) -bibosylation of elongation factor 2, the stage currently responsible for cell death [Allured, VS, Proc. Na ti.Acid Sci USA 83, supra; Siegall, CB, et al., J. Biol. Chem. 264, supra.] Two PEA mammalian expression vectors were designed and constructed, in which domain III (amino acid residues of mature PEA from 405 to 613) only (pCMV -PEAIII) or domain III and partial Ib domain sequence (amino acids 385 to 613) only (pCMV-PEAIb-III) are placed under the control of protomor CMV and T7 Construction of Expression Vectors of Toxin A plasmid pJH8 which contains the gene coding for PEA is obtained from the American Type Culture Colle ction, 12301 Parklawn Drive, Rockville, MD 20852, having the ATCC deposit No. 67208. See, Figure 9 for a scheme showing the domains. that code for PEA. The DNA sequences encoding the catalytic fragment of PEA were obtained by PCR amplification using pJH8 DNA as a template. To construct the toxin expressor designated pCMV-PEIII, an initiator towards the 5 'end (Pl, (SEQUENCE OF IDENTIFICATION NO: 7) 5'TTTAAGCTTATGGGCGACGTCAGCTTCAGCACC-3') containing additional HindIII and an initial codon followed by the sequences complementary to amino acids 405 to 411 of mature PEA and an initiator towards the 3 'end (P-2, (SEQUENCE OF IDENTIFICATION NO: 8) 5 • -TTTTCTAGATTACTTCAGGTCCTCCGG-3') that 4 < > contains the complementary sequence for amino acids 609 to the stop codon of PEA followed by an additional Xbal site, where it was used to amplify domain III of PEA. The amplified DNA fragments were purified with Geneclean equipment (Bio 101 Inc.), digested with HindIII / Xbal and cloned into the pRc / CMV expression vector (Invitrogen) under the control of the CMV promoter. The resulting constructs were confirmed by DNA sequencing. These constructs ensure that any of the toxin fragments expressed without the recognition domain are non-toxic to the surrounding cells, unless they are expressed within a cell. To detect the toxin fragments expressed from the vectors, the pCMV-PEAIII or pCMV-PEAIblII plasmids (See Figure 9) were first transformed into bacterial BL21 (DE3) expression hosts (Novagen), which expressly express T7 DNA polymerase for the transcription of the gene under the control of the T7 promoter. ADP-ribosylation activity was detected from the transformed bacteria after induction (not shown). When toxin expressors were transfected into mammalian cells (COS-1 and HeLa) using lipofectin [Chen, S.-Y., Et al., J. Virol. 65: 5902-6909 (1991)], fragments of the toxin were produced and cytotoxicity was observed for the transfected cells (not shown). The vector pCMV-PEIblII, which showed a higher activity level of ADP-ribosylation, than pCMV-PEIII was used for other experiments. To investigate whether Fabl05 -Protamin can function as a gene carrier to transfer the toxin expressor into target cells. The purified Fabl05-Promatima fusion proteins were incubated with plasmid DNA pCMV-PEAIblII at a ratio of 2: 1 (determined by titration) in 0.2 N NaCl solution to form the fusion protein-DNA complexes (see Figures 10-12). Jurkat lymphocytes infected with HIV-1, which showed to be more than 95% positive by immunofluorescent staining with the antibody against gpl20, were used as the target cells. The target cells were incubated with the Fabl05-Protamine-toxin-expressing complexes, only the toxin expressors or only the Fabl05-protamine proteins. Normal lymphocytes were also incubated with these molecules as a control. After 48 hours of incubation, the viability of the cell (Figure 10), the protein synthesis (Figure 11), and the ADP-ribosylation activity (Figure 12) in the culture cells were examined. The selective cytotoxicity of the Fabl05-Protamine-toxin-expressing complexes for HIV-infected cells is shown in Figure 10-12.

The Jurkat cells were infected with HIV-1 virus and on the day after infection, the expression of gpl20 on the surface of the cells is examined by immunofluorescent staining. Cells with more than 95% gpl20 positive (0.5 x 10 6) were incubated with the DNA-fusion protein complexes, or only the fusion protein, or only DNA at 37 ° C for 48 hours. Figure 10 shows the viability of the cells in the culture, examined by Trypane Blue staining. The percentage of viable cells was calculated from the determination in duplicate. Figure 11 shows a protein inhibition assay, cells (0.5 x 106) were replaced with leucine-free medium (See, Allured, VS, et al., Proc. Nat. Acad. Sci. USA 83: 1320 (1986) Siegall, CB, et al., ". Biol.

Chem. 264: 14256 (1989) and added with 4 μg of 3H-leucine for 4 hours. The cells were centrifuged at 3,000 rpm for 5 minutes and lysed for scintillation counting. Figure 12 shows the detection of ADP-ribosylation activity in the culture cells [Collier, R. M. et al., J. Biol. Chem. 246: 1496 (1971)]. Cells (1 x 10 ^) are spliced by centrifugation and lysed in a solution of 4 M urea. The supernatants of the lysates are then subjected to the ADP-ribosylation assay and PEA proteins (Gibco-BRL) were used for the control. positive. The mean of the scintillation counts of the samples are shown as calculated from the determination in duplicate. In Figures 10-12, lane a: Normal Jurkat cells incubated with the Fab-Protamine-toxin expressor complexes (10 μg of Fabl05-Protamine / 5 μg of the DNA expressor, 10: 5 μg); lanes b to e: Jurkat cells infected with HIV incubated Fab-Protamine only (b); with the toxin-expressing DNA only (c); with the complexes of Fabl05-Protamine-Toxin Expression (10: 5 μg) (d); with the complexes of Fabl05-Protamine-toxin expressor (5: 2.5 μg) (3); lane f: ADP-ribosylation activity of 1.0 ng of the PEA control denatured with urea. As shown in Figure 10-12, after incubation with the complexes. Fabl05-Protamine-toxin expression for 48 hours, cells infected with HIV-1 showed a significant decrease in cell viability (< 1.5%) and protein synthesis capacity (< 0.2%); whereas the cells incubated with the toxin-expressor or Fabl05-Protamine alone, only showed slightly decreased cell viability and the capacity for protein synthesis. In addition, the uninfected lymphocytes showed no significant decreases in cell viability and protein synthesis capacity after incubation with the Fabl05-Protamine-toxin-expressing complexes. The selective cytotoxicity observed for HIV infected cells should be a result of the ADP-ribosylation activity of the expressed toxin fragments, since the ADP-ribosylation activity, almost equal to 1.0 ng of PEA proteins, was detected of the lysates of the HIV infected cells (1 X 106) incubated with the complexes. In this way, the Fabl05- Protamine-toxin-expressing complexes selectively intoxicate HIV-1-infected celia in tissue culture. A major obstacle of immunotoxins as effective agents in the treatment of human cancer and other diseases is the response of host antibodies to xenogeneic antibodies and toxin molecules. [Byers, V.S., et al., Immunol. 65: 329 (1988); Durrant, L.G., et al., Clin. Exp. Immunol .75: 258 (1989), - Pai, L.H. , et al., J. Clin. Oncol. 9: 2095-2103 (1992)]. The use of humanized murine antibodies or human antibodies can solve the problem of the portion for the target [Rybak, S.M., et al., Proc. Na ti. Acad. Sci. USA 89: 3165-3169 (1992)], but for the highly immunogenically toxin portion, the problem still remains. In this study, it is demonstrated that the Fabl05-Protamine, anti-gp120 fusion proteins can serve as a gene carrier to deliver the toxin-expressing plasmid DNAs within HIV-1 infected cells by endocytosis mediated by the receptor, resulting in the selective description of the target cells. The extreme potency of the toxin molecules is compensated by the poor efficiency of the gene delivery mediated by the receptor [Wu, GY, et al., J. "Biol. Chem. 262: 4429-4432 (1987); Wagner, E ., et al., PNAS USa 89: 6099 -6103 (1992)] to efficiently achieve the therapeutic goal, since the antibody molecules or ligands (target portion) and the DNA binding portion of the bifunctional fusion proteins, can be of human origin, and the toxin-expressing DNAs are very weakly immunogenic or are not immunogenic, the complete toxin-protein complexes will be weakly immunogenic, therefore, these complexes must be able to be administered repeatedly in patients without the development of significant antibody response In addition, bifunctional recombinant fusion proteins as a gene carrier also have the advantage over chemically linked ones [Wu, GY, et al., J. Biol. Chem. 262: 4429-4432 (1987); Wagner, E., et al., PNAS USA 89: 6099-6103 (1992)], such as efficient production and potentially better binding activity. In summary, this form of therapy of this immunotoxin gene, herein called "clandestine immunotoxins" has significant advantages over the immunotoxins described above for the treatment of cancers and other diseases. In addition, the Fabl05-Protamine-expressor complexes of the anti-gpl20 toxin have selective toxicity for cells infected with HIV-1, which also represents a new therapeutic agent for the treatment of AIDS. All references described herein are incorporated by reference. It is evident that those skilled in the art, given the benefit of the foregoing description, can make numerous other uses and modifications thereof and depart from the specific embodiments described herein, without departing from the inventive concepts, and the present invention. it will be limited only by the scope and spirit of the appended claims. LIST OF SEQUENCES (1) GENERAL INFORMATION (i) APPLICANT: MARASCO, WAYNE A CHEN, SI-YI (Ü) TITLE OF THE INVENTION: NUCLEIC ACID SUPPLY SYSTEM, SYNTHESIS METHOD AND ITS USES (iii) NUMBER OF SEQUENCES: 9 (iv) ADDRESS THE CORRESPONDENCE: (A) RECIPIENT: DAVID G. CONLIN; DIKE, BRONSTEIN, ROBERTS & CUSHMAN (B) STREET: 130 WATER STREET (C) CITY: BOSTON 5 (- (D) STATE: MASSACHUSETTS (E) COUNTRY: USA (F) ZIP: 02109 (v) READING FORM ON THE COMPUTER: (A) TYPE OF MEDIA: SOFT DISC (B) COMPUTER: COMPATIBLE WITH AN IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patentln Relay # 1.0, Version # 1.25 (vi) CURRENT REQUEST DATA: (A) REQUEST NUMBER: US 08 / 199,070 (B) DATE OF SUBMISSION : FEBRUARY 2, 1994 (C) CLASSIFICATION: (viii) INFORMATION OF THE ATTORNEY / AGENT: (A) NAME: CONLIN, DAVID G. (B) REGISTRATION NUMBER: 27026 (C) REFERENCE / FILE NUMBER: 43471 (ix) ) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (617) 523-3400 (B) TELEFAX: (617) 523-6440 (C) TELEX: 200291 STRE UR (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 1: ( i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 8 amino acids (B) TYPE: amino acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 1: Lys Lys Lys Tyr Tyr Lys Leu Lys 1 5 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: acid nucleic (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: TTTGAATTCA AGCTTACCAT GGAACATCTG TGGTTC (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3 GGTACCGAAT TCTCTAGAAC AAGTTTGGG CTC (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4: GGTACCGAAT TCTCTAGAAT GGCCAGGTAC AGATGC (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 48 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 5: TTTAGGATCC TTAACAACAC CTCATGGCTC TCCTCCGTGT CTGGCAGC (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 78 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 6 TTAATTGCGG CCGCTTAGTG TCTTCTACAT CTCGGTCTGT ACCTGGGGCT GACACCTCAT GGCTCTCCTC CGTGTCTG (2) INFORMATION FOR SEQUENCE OF IDENTIFICATION NO: 7: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) ) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7: TTTAAGCTTA TGGGCGACGT CAGCTTCAGC ACC (2) INFORMATION FOR THE SEQUENCE OF IDENTIFICATION NO: 8: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 8: TTTTCTAGAT TACTTCAGGT CCTCCGG (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: unknown (D) TOPOLOGY: unknown (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9 TTTAAGCTTA TGGCCGACGT GGTGAGCCTG

Claims (16)

1. A nucleic acid delivery system, characterized in that it comprises: a fusion protein containing (i) a target portion, which specifically binds to a site on a target cell, and (ii) a binding or binding portion which it will bind to the nucleic acid segment, and the nucleic acid segment containing a nucleic acid sequence of interest.

2. The nucleic acid delivery system according to claim 1, characterized in that the portion for the target is an antibody.

3. The nucleic acid delivery system according to claim 2, characterized in that the antibody is an antibody to a viral envelope protein, cellular receptor, an extracellular domain of an activated receptor.

4. The nucleic acid delivery system according to claim 2, characterized in that the antibody is a single chain antibody, an Fab portion of an antibody or a segment (Fab ') 2-

5. nucleic acid according to claim 1, characterized in that the Gl "binding portion" is a protein or the nucleic acid binding domain of the protein, and the binding portion is fused to the carboxy portion of the target portion.

6. The nucleic acid delivery system according to claim 5, characterized in that the binding portion is the nucleic acid binding domain of a protein selected from the group of nucleic acid binding domains present in the proteins, selected from the group consisting of GCN4, Fos, Jun, TFIIs, FMRI, yeast protein Hx, Vigillin, Merl, bacterial polynucleotide phosphoylase, ribosomal protein S3, and heat shock protein.

7. The nucleic acid delivery system according to claim 5, characterized in that the binding portion is the protamine protein.

8. The nucleic acid delivery system according to claim 1, characterized in that the nucleic acid sequence of interest encodes an antibody, a dominant negative mutant, an antisense RNA, ribozymes or a cytotoxic agent.

9. The nucleic acid delivery system according to claim 1, characterized in that the nucleic acid segment comprises the repeated regions of the long 5 'and 3' flanking terminal (LTR) in the inverted terminal repeat regions (ITR). ), a promoter operably linked to a desired gene in the nucleic acid sequence of interest.

10. A nucleic acid delivery system, characterized in that it comprises a fusion protein, wherein a portion of the fusion protein comprises an antibody, which will selectively bind to a desired site on a cell, and the other portion of the fusion protein comprises a protamine protein, capable of binding to a nucleic acid segment; and the nucleic acid segment.

11. The nucleic acid delivery system according to claim 10, characterized in that the nucleic acid segment is a corresponding DNA sequence for a cytotoxin gene or a fragment thereof, which will encode a cytotoxic protein.

12. The nucleic acid delivery system according to claim 11, characterized in that the nucleic acid segment encodes at least Domain III of Pseudomonas exotoxin A.

13. A method for transforming a target cell, which is characterized in that comprises adding an effective amount of the nucleic acid delivery system according to claim 1 to a medium containing the target cell and waiting until the nucleic acid sequence of the nucleic acid delivery system transforms the cell. A method for preparing a nucleic acid delivery system, characterized in that it comprises transforming a cell with a vector containing a DNA segment which codes for the fusion protein according to claim 1, operably linked to a promoter, incubate the cell and collect the expressed fusion protein. A method of using a nucleic acid delivery system, characterized in that it comprises administering an effective amount of the nucleic acid delivery system according to claim 1, to a target containing a target cell, and waiting until the system of nucleic acid supply makes contact with the target cell. 16. A method of using a nucleic acid delivery system, characterized in that it comprises administering an effective amount of the nucleic acid delivery system according to claim 10, to serum containing a target cell and waiting until the system nucleic acid supply makes contact with the target cell.