MXPA96000235A - Viruses of insects, sequences, insecticidal compositions and methods of use of mis - Google Patents

Abstract

The present invention provides insect viruses capable of destroying at least one target insect pest faster than the previously described viruses and the DNA sequence that confers that faster destruction phenotype. Another improvement in the dissemination of the destruction is obtained when the virus of this invention also contains a non-functional egt gene to reduce feeding by the infected larvae, inhibit the growth and further mediate the early death of the infected insect. A faster destruction insect virus, specifically exemplified is the V-8 strain of AcMNPV: The fastest destruction phenotype is carried in an MluI to EspI fragment of 1.93 to 3.27 map units within the AcMNPV genome and its sequences are they provide in the present as the SEC. FROM IDENT. NO: 3 V8vEGTDEL is the inactivated egt derivative of AcMNPV V-8, the combination of increased virulence of the V-8 genotype, for example, and the inactivation of the gene encoding the ecdysteroid glycosyltransferase provides another improvement (such as further decrease in time). after the infection until the death of the insect). Additionally, such baculovirus deficient in EGT can still be modified to express a protein which affects ecdysis. Methods for producing the insect virus for faster destruction, improved insecticidal compositions and improved methods for controlling insects are also included within the scope of this invention.

Description

"INSECTICIDE COMPOSITIONS AND METHODS OF USING THEM" Inventor (s): LOIS K. MILLER, North American, domiciled in 125 Doe Run, Athens, Georgia 30605, E.U.A .; BRUCE CHRISTIAN BLACK, North American, domiciled at 286 Forrest Road, Yardley, Pennsylvania 19067, E.U.A .; PETER MICHAEL DIERKS, North American, domiciled at 262 Daleview Drive, Yardley, Pennsylvania 19067, E.U.A .; NANCY C. FLEMING, North American, domiciled at 7 Princeton Ave., Rocky Hill, New Jersey 08553, E.U.A. and FAKHRUDDIN AHMED, North American, domiciled in 8 Cedar Court, Princeton Junction, New Jersey 08550, E.U.A ..

Causaire: AMERICAN CYANAMID COMPANY, Maine State Corporation, E.U.A., domiciled at One Cyanamid Plaza, Wayne, New Jersey 07470-8426, E.U.A. and UNIVERSITY OF GEORGIA RESEARCH FOUNDATION, INC., entity of the State of Georgia, E.U.A., domiciled in Boyd Gradúate Studies Research Center, DW Brooks Drive, Athens, Georgia 30602, E.U.A.

TECHNICAL FIELD The present invention relates to methods and compositions that use baculoviruses and sequences thereof for the biological control of insect pests. More particularly, the present invention relates to a recombinant baculovirus, which has improved properties in the control of insects and the segment thereof that confers improved properties, ie faster death for at least one target insect. The present invention also relates to genetically modified baculoviruses with improved destruction properties and methods of use.

BACKGROUND OF THE INVENTION There has been an interest in the biological control of insect pests as a result of the disadvantages of conventional chemical insecticides. Chemical insecticides usually affect beneficial species as well as non-beneficial species. Insect pests tend to acquire resistance to such chemicals, so that new populations of insect pests that are resistant to these insecticides can rapidly develop. In addition, chemical waste has environmental hazards and possible health interests. Biological control presents an alternative means of pest control which can reduce dependence on chemical insecticides. The main strategies for biological control include the deployment of organisms that occur naturally, which are pathogenic for insects (entomopathogens) and the development of crops that are more resistant to insect pests. Approaches include the identification and characterization of insect genes or gene products, which can serve as suitable targets for agents for insect control, identification and exploitation of microorganisms without prior use (including modification of non-target microorganisms). pathogens that occur in a natural way to make them pathogenic for insects), the modification and refinement of the entomopathogens currently used and the development of crops manipulated by genetic engineering, which present greater resistance to insect pests. Viruses that cause natural epizootic diseases within insect populations are among the entomopathogens that have been developed as biological insecticides. Baculoviruses are a large group of viruses which can infect only arthropods (Miller, LK (1981) in Genetic Engineering in the Plant Sciences, N. Panapoulous, (ed.), Praeger Publ., New York, pp. 203-224; Carstens, (1980) Trends in Biochemical Science 52: 107-110; Harrap and Payne (1979) in Advances in Virus Research, Vol. 25, Lawfer et al., (Eds.), Academic Press, New York, p. 273-355; The Biology of Baculoviruses, Vol. I and II, Granados and Federici (eds.), CRC Press, Boca Raton, Florida, 1986). Many baculoviruses infect insects which are pests of commercially important agricultural and forestry crops. Such baculoviruses are potentially valuable as biological control agents. Four different baculoviruses have been registered for use as insecticides by the United States Environmental Protection Agency. Among the advantages of baculoviruses as biological insecticides is their specificity for the host. Not only do baculoviruses as a group infect only arthropods, but also strains of individual baculoviruses usually infect only one or a few insect species. In this way, they pose no risk to man or the environment and can be used without adversely affecting beneficial insect species. Baculoviruses, including AcMNPV, have been found in approximately 400 different species among different orders of different insects; the vast majority of these viruses occur in the order Lepidoptera. It is known that baculoviruses infect insects in both natural ecosystems (eg, forests and grasslands) and agro-ecosystems of monocultures (eg, cotton fields). Nuclear polyhedrosis virus Autographa californica, (AcMNPV) is the most widely known baculovirus characterized. The AcMNPV belongs to the family Baculoviridae, subfamily Eubaculovirinae, genus Virus of Nuclear Polyhedrosis and the subgenus Virus of the Multiple Nucleocapsid, which are characterized by the formation of viral occlusion bodies (or polyhedra) in the nuclei of infected host cells . The virus was first isolated more than 20 years ago from a caterpillar measuring alfalfa, Autographa californica, during an epizootic infection that occurred naturally in California. Since then, the virus has been extensively characterized using biochemical and molecular techniques and the important DNA sequence within 128 kbp of the genome is known. The AcMNPV has been designated as the type species for the subgenus of the Multiple Nucleocapsid Virus. Subgroups of baculoviruses include nuclear polyhedrosis virus (NPV), granulosis virus (GV) and non-occluded baculovirus. In the occluded forms of baculoviruses (GV and NPV), the virions (enveloped by nucleocapsids) are embedded in a crystalline protein matrix. This structure, referred to as an inclusion or occlusion body, is the form found outside of the organism in nature and is responsible for spreading the infection between organisms. The characteristic feature of NPVs is that many virions are embedded in each occlusion body. The occlusion bodies of NPV are relatively large (up to 5 micrometers). The occlusion bodies of the GV viruses are smaller and contain only one virion each. The crystalline protein matrix of the occlusion bodies of both forms is composed mainly of a single polypeptide of 25,000 to 33,000 Dalton units, which is known as polyhedrin or granulin. The baculoviruses of the non-occluded subgroup do not produce a polyhedrin or granulin protein and do not form occlusion bodies. In nature, infection is initiated when an insect ingests food contaminated with baculovirus particles, usually in the form of occlusion bodies for an NPV such as AcMNPV. The occlusion bodies dissociate under alkaline conditions of the insect's midgut, releasing individual virus particles, which then invade the epithelial cells lining the intestine. Within a host cell, the baculovirus migrates to the nucleus where replication takes place. Initially, certain specific viral proteins are produced inside the infected cell through the transcription and translation of the so-called "early genes".

Among other functions, these proteins are required to allow the replication of viral DNA, which begins 4 to 6 hours after the virus enters the cell. Extensive viral DNA replication continues until approximately 24 hours post-infection (pi). From about 8 to 20 hours pi, the infected cell produces large amounts of "late viral gene products". These include components of the nucleocapsid, which surrounds the viral DNA during the formation of progeny virus particles. The production of progeny virus particles starts around 12 hours pi. Initially, the progeny virus migrates to the cell membrane where they acquire an envelope as an outbreak from the surface of the cell. These non-occluded viruses can then infect other cells within the insect. The synthesis of the polyhedrin begins approximately 18 hours after infection and increases to very high levels in approximately 24 hours pi. At this time, there is a decrease in the number of virus particles that form the outbreak and then the progeny viruses are inserted into the occlusion bodies. The formation of the occlusion body continues until the cell dies or lyses. Some baculoviruses infect virtually every tissue in the host insect, such that at the end of the infection process, the entire insect is liquefied, releasing extremely large amounts of occlusion bodies, which can then spread the infection to other insects. (Reviewed in The Biology of Baculoviruses, Vol. I and II, Granados and Federici (eds.), CRC Press, Boca Raton, Florida, 1986). Larvae become increasingly resistant to viral infection as they grow and mature. Both of the adult tissues and tissues of the nymphs appear to be refractory to viral infection. The main means of AcMNPV infection appears to be through horizontal transmission. Insects typically acquire AcMNPV by consuming contaminated feed. The occlusions dissolve in the midgut of the insect and release virions which establish a primary site of infection in the midgut cells. The ability of the AcMNPV to persist and disseminate in the environment is governed by many interrelated factors (reviewed by Evans, H. (1986) The Biology of Baculoviruses, Ecology and Epizoology of Baculoviruses, Granados, RR and Federici, BA (eds.) pp. 89-132). Factors such as the relative sensitivity of the host insect to the virus, as well as the development determined by the sensitivity to AcMNPV, are important. Host density also seems to play an important role in determining the persistence and spread of baculoviruses. There are important implications that are related to the role of biotic and abiotic forces that determine the environmental transmission and persistence of AcMNPV. For example, predators compete with the virus for available host insects and tend to reduce the productivity of the potential virus by eliminating these susceptible hosts to the virus from the environment. On the other hand, predators can also indirectly increase the survival and dissemination capacity of MNPV, increasing the spread of the virus and making the use of the virus more efficient. the guest-available populations. This transmission aided by the predator is usually by the passage of infectious MNPVs through the intestine of insects, birds and predatory mammals. Likewise, abiotic factors (such as ultraviolet light (UV), rain, temperature and pH) have a major influence on the survival and spread of the virus in the environment. For example, baculoviruses appear to be particularly sensitive to UV irradiation and alkaline pH. The persistence of the virus applied to the field without UV protection can be as little as 1-2 days in the field. The soil appears to be a particularly important reservoir for the persistence of baculoviruses. The decrease of viruses on earth is slow and broad ranges of time have been reported for persistence and viability. The association of ubiquity and harmlessness between baculoviruses and humans and other species due to dietary exposure underscores their safety and value as insecticides. A potential disadvantage to using baculoviruses as pesticides is the prolongation of time between the ingestion of the virus and the death of the insect. During this time, the insect pest continues to feed and damage the crops. Because insecticides generally only apply after an infestation is apparent, it is critical that the feeding time has been minimized. One approach to decrease insect feeding time in insect control by viral infection is the use of baculovirus deficient in ecdysteroid glycosyl transferase (O'Reilly and Miller (1991) Biotechnology 9: 1086-1089; U.S. Patent No. 5,180,581, to Miller and O'Reilly; U.S. Patent No. 5,352,451, issued October 4, 1994, all of which are incorporated for reference). Other approaches include the insertion of genes that code for toxins or insect hormones in the viral genome (Hammock et al., (1993) Arch. Insect Biochem. Physiol. 22: 315-344; McCutchen et al., (1991) Bio / Technology 9: 848-852; Tomalski and Miller (1991) Nature 352: 82-85; Tomalski and Miller (1992) Bio / Technology 0-545-549 and Stewart et al., (1991) Nature 352: 85-88). Another approach is the incorporation of an insect-specific paralytic neurotoxin gene into a baculovirus genome (see, e.g., U.S. Patent No. 5,266,317 issued November 30, 1993 to Tomalski and Miller, which describes toxins. of insect predator mites; U.S. Patent Application Serial No. 08 / 009,625, filed January 29, 1993; Canadian Patent Application 2,005,658 to Zlotkin et al., Zlotkin et al., (1971) Toxin 9: 1-8, which describe sequences for Androctonus australis toxin). There is a need for biological insecticides, specifically insect viruses, which reduce feeding by the insect before death and / or which result in a shorter time between infection and death when compared to insect viruses of the prior art. A biological insecticide is preferred because it creates less of an environmental hazard than a chemical insecticide. The exploitation of a recombinant insect, which results in the faster destruction of the insect than the available viruses, will allow for improved biological control of insect pests.

BRIEF DESCRIPTION OF THE INVENTION This invention specifically provides a purified and isolated recombinant baculovirus (referred to herein as "AcMNPV V-8"), which has improved killing properties when compared to strains of the Autographa californica Nuclear Polyhedrosis Virus, against at least one pest. of insects including, but not limited to, Spodoptera frugiperda. The subject baculovirus has been deposited in the American Type Culture Collection as ATCC VR-2465 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD). Improved destruction properties against at least one insect pest means that at least one species of insect pest is infected, the time between infection and insect death is shorter than with a Comparison AcMNPV, for example AcMNPV E2 (ATCC VR-1344). Another specific object of the present invention is an AcMNPV V-8 derivative which has been engineered to inactivate the gene encoding the ecdysteroid glycosyltransferase (egrt). A preferred embodiment is VdvEGTDEL, which is the AcMNPV V8 derivative in which a portion of the egrt is removed, with the result that a functional ecdysteroid glycosyltransferase is not produced during the viral infection process. A further object of the present invention is a DNA segment of the insect virus, which confers the improved (ie, faster) destruction phenotype when incorporated into the genome of a heterologous insect virus. As specifically exemplified, such a DNA fragment is the Mlul to EspI fragment from the AcMNPV V-8 genome region of 1.93 to 3.27 map units (or of the V1000 nuclear polyhedrosis virus, which appears to be intimately related to or identical to the Nuclear Polyhedrosis Virus Rachiplusia ou); the DNA sequence of the exemplified V-8 fragment is given in Figure 4 (SEQ ID NO: 3). This segment of DNA carries sequences, which. encode, for a late expression factor (lef-2) and. he . polypeptide of 603 amino acids (unknown function) and the sequences towards the 5 'end of the polyhedrin gene. Within this Mlul to EspI fragment of V-8 there is a smaller region which is capable of conferring the improved destruction phenotype, when incorporated into the genome of an AcMNPV (recombinant); this smaller region is between nucleotide 3026 and 4231 (sequence V-8) of Figure 4, which corresponds to nucleotides 194-826 of SEQ. FROM IDENT. NO: 3. Also within the scope of the invention are other recombinant insect viruses, including baculoviruses, in which such DNA fragment conferring the improved destruction phenotype, has been incorporated into the genome with the result that at least one insect pest is destroyed faster after infection than the corresponding baculovirus. which has not been genetically engineered or which in any other way does not contain a related heterologous DNA segment, which confers increased virulence. The present invention also provides methods for improving the destruction properties of a baculovirus by introducing a DNA segment that confers an improved destruction phenotype, eg, faster death of the insect from at least one species of insect pest, after infection for example and confirming the enhanced destruction property by determining that the CFTA (time required for the destruction of 50% of the test larvae at a standard virus dose, using a 90% kill dose of the larvae of test for the time set post infection) is shorter for the strain engineered than for the parent baculovirus. The genetically engineered strain can be produced by molecular biological techniques using an insect virus selected from the group consisting of nuclear polyhedrosis viruses including, but not limited to, NPV Lymantria dispar, NPV Autographa californica, NPV Synographa falcifera, NPV Spodoptera li turalis, NPV Spodoptera exigua, NPV Spodoptera frugiperda, NPV Heliothis armigera, NPV Afamestra brassicae, NPV Choristoneura fumiferana, NPV Trichoplusia ni, NPV Helicoverpa zea and NPV Manduca sexta; granulosis viruses including, but not limited to GV Cydia pomonella, GV Pieris brassicae and GV Trichoplusia ni. Baculovirinae not included viruses can also be genetically modified to improve their destruction properties for particular target insects; examples of such non-occluded baculovirinae include, but are not limited to, those of non-occluded Baculovirinae Orcytes rhinoceros and Heliothis zea. Functionally equivalent sequences that confer improved destruction properties. They can be isolated. of viruses other than those specifically exemplified herein and incorporated into viral genomes which do not contain them naturally to produce insect viruses with improved insect control properties. Alternatively they can be produced by coinfection of a first baculovirus with a second baculovirus, whose genome comprises the DNA fragment, in which the first and second baculoviruses are sufficiently related (ie, they have sufficient identity of the DNA sequence in at least limited distances in regions flanking the sequences conferring the improved destruction phenotype) such that recombination occurs to result in a recombinant baculovirus being produced, which incorporates the DNA conferring the improved destruction phenotype. Other objects of the present invention are insecticidal compositions, comprising baculoviruses with improved destruction properties against at least one insect pest. Preferred viruses include VQvEGTDEL, AcMNPV V-8, vEcoRIhybbl, vEcoRIHybIFS and the nuclear polyhedrosis viruses and the granulosis viruses and the baculovirinae viruses without occluding in a non-limiting manner as set forth in the foregoing. , in which it is a segment of DNA that confers the improved destruction phenotype has been engineered or recombined. Preferred insecticidal compositions of the present invention are formulated as wettable powders. The composition of a preferred wettable powder insecticide composition is as follows: Ingredients Nominal Percent (p / p) Polyhedrin inclusion body V8vEGTDEL 10. 0% Morwet D425 30. 0% Morewet EFW 20. 0% Kaolin clay 16. 0% Microcel E 16.0% Oxybenzone UV-9 or charcoal 5.0% Eudragit S100 2.0% Citrus acid 0.9% Polyethylene glycol of MW400 0.1% Optionally, a stilbene polish can be added to the formulation to increase infectivity or potentiate the insecticidal effects of the insect virus. The preferred composition described in the above is formulated as follows: a) prepare an aqueous suspension of Eudragit S100 (1% w / v); b) dissolving the Eudragit S100 by adding the pH of the suspension of step (a) from 9.0 to 9.5; c) add the viral PIB and UV-9 oxybenzone or vegetable charcoal to the solution of step (b) and mix to produce a uniform suspension; d) air drying the uniform suspension of step (c); e) grinding the dry material from step (d) to produce a ground material; and f) dry-mix the ground material from step (e) with Morwet D425, the Wetwet agent Morewet EFW, the Clay Kaolin as a bulking agent, Microcell E as an agent for the flow, citric acid and polyethylene glycol MW400 to provide flexibility to the ground material.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic representation of the AcMNPV genome showing the location of the egt gene and genes. The AcMNPV genome is presented in map units and as the restriction maps EcoRI and HindIII. Figure 2A 'is a schematic representation of the structures in the egt gene region of AcMNPV with the restriction sites; Figure 2B shows the location of the egt gene. Figure 3A-3D represents the partial restriction maps of the ORF 327, lef-2, the ORF 603 and the polyhedrin gene region (polh) of the AcMNPV strains. Figure 3A is the map for the wild type AcMNPV L-1 (the thin line represents DNA L-1). Figure 3B is the AcMNPV V-8 map (The thick line represents the DNA of V-8). The extra HindIII site in lef-2 is a distinctive (physical) feature of V-8 The V-8 is losing both of the Mlul site within the ORF 603 and the EcoRV site between the ORF 603 and polh. The ORF 603 of V-8 has a premature stop codon generated by an insertion and is predicted to produce a non-functional, incomplete polypeptide product (note "X" through ORF 603). Figure 3C is the map of the recombinant virus vEcoRIHybl containing the portion of the V-8 genome indicated by the thick bar. Although the transfer plasmid used to construct this hybrid contains the sequence V-8 for the Mlul site at 1.93 u.m., the allelic replacement limited by the V-8 sequences for the indicated portion of lef-2. Figure 3D is the map of the recombinant vEcoRIHybIFS virus containing the complete V-8 Mlul (1.93 u.m.) for the EspI fragment (3.27 u.m.). The Nael site in which the ORF 603 has been destroyed by a four-base pair deletion (the asterisk represents the lost Nae I site). Figure 4 represents the DNA sequence of AcMNPV L-1 (SEQ ID NO: 1) of the Mlul site of the ORF 327 (nucleotide 2470) to the EspI site of polh (nucleotide 4186) aligned with the corresponding sequence of the variant V-8 AcMNPV (SEQ ID NO: 3). The V-8 sequence has a multitude of mutations per point and four insertions when compared to the L-1 sequence. The identities are indicated by a vertical line. The differences of the sequence and insertions are in highlighted type. The start points of lef-2, the ORF 603 and polh are marked with asterisks (*). The natural termination codons of lef-2 of L-1 and ORF 603 are marked with signs of pounds. The cross-linking in vEcoRIHybl occurred in the dotted region between the two dollar signs at nucleotides 3003 and 3027. The premature stop codon generated by the insertion in the ORF 603 of V-8 is indicated by three intercalation signs. The numbering of the sequence in parentheses corresponds to that in O'Reilly et al., (1992) Baculovirus Expression Vectors: A Laboratory Manual, W.H. Freeman & Co., NY. Figure 5 presents the predicted amino acid sequences of the products of the lef-2 gene of L-.l and V-8 of AcMNPV (SEQ ID NO: 2 and SEQ ID NO: 4, respectively). The identities are designated by vertical lines. The differences are designated by the highlighted type and a point between the different amino acid residues. The differences in the DNA sequence between L-1 and V-8 are responsible for the six amino acid differences between the two products of the lef-2 gene. The amino acid differences occur at residues 14, 89, 101, 114, 153 and 190. The recombinant virus vEcoRIHybIFS is expected to contain all these amino acid differences lef-2, but vEcoRIHybl is predicted to contain only the mutations in the residues 153 and 190. The cross-linking event in vEcoRIHybl occurred in the region of DNA that codes for residues marked by a line of asterisks. Figure 6 depicts the nucleotide sequence of the AcMNPV DNA in the region of the egt gene (SEQ ID NO: 5). The codons for the initiation of translation (atg) and termination (taa) for the open reading frame egt are indicated above the sequence. The 1094 bp fragment removed in the EGTDEL virus is underlined. The positions from which the oligonucleotide primers (EGTDE.L1 and EGTDEL2) are used are shown. for PCR amplification. Figure 7 shows the DNA sequences for the AcMNPV E2 virus strains (SEQ ID NO: 6), AcMNPV V-8 (SEQ ID NO: 7) and V1000 (SEQ ID NO. : 8) that start at the Esp31 site towards the 5 'end of the polyhedrin gene and that extends into the region coding for the polyhedrin (up to the nueclotide 4907). The sequences were from a chain using the Inverse PVl primer and the nucleotides indicated as N were not identified.

DETAILED DESCRIPTION OF THE MODALITIES DESCRIBED Because insect viruses that act more rapidly as insect control agents are advantageous, a study was conducted to investigate strains of baculoviruses with such improved killing properties. For this purpose, a deposit of AcMNPV virus (in insect larvae) in minimal passages was amplified, plated in cultures to obtain clone isolates and these isolates were examined for restriction site polymorphisms and for increased virulence in the larvae of insects. A deposit of minimal passes is used as the initial material for this examination, partly because it is known that serial passages in the cell culture lead to mutations and perhaps reductions in virulence in the AcMNPV (see, for example, Kumar and Miller (1987) Virus Research 7. : 335-349). The genotypic variants of the AcMNPV are co-grown (Lee and Miller (1978) J. Virol. 27: 754-767). AcMNPV was the baculovirus for which a more virulent (ie faster destruction) variant was sought because it is known to infect a relatively large number of insect pests of particular economic importance in agriculture. The V-8 isolate of AcMNPV was one of ten viral clones plates purified in monolayers of SF-21 cells inoculated with diluted hemolymph of Heliothis virescens larvae that had been orally infected with a minimum passage deposit of the original Vail AcMNPV isolate.

(Vail et al., (1971) Proc. IV Int. Collog, Insect Pathology, College Park, MD pp. 297-304). All ten viral isolates, from V-1 to V-10, were initially characterized by restriction endonuclease analysis with Ba HI, BglII, EcoRI, HindIII, PstI and Xhol and compared with AcMNPV L-1. The pattern of V-10 is identical to that of L-1. The Vl, V-2, V-3, V-6, V-7, V-8 and V-9 profiles all lack approximately 8.5 kb of the HindIII-F fragment and instead contain two new fragments of approximately 7.4 kb and 1.1 kb. The two isolates V-4 and V-5, have an intermediate restriction pattern between the first two viral types (containing submolar quantities of the .HindIII-F fragment and both of the new 7.4_ kb and 1.1 kb fragments). The presence of submolar fragments suggests that V-4 and V-5 are incompletely purified viral deposits, since all samples were plated purified only once to conserve the virulence of the isolates. No differences were detected in the restriction profiles between any of these ten L-1 clones using digestion with BamHI, BglII, EcoRI, PstI and Xhol. The V-8 isolate of AcMNPV was selected as representative of the predominant genotype of the ten isolates and was further characterized using bioassays in Spodoptera frugiperda neonates. Data from representative bioassays assessing oral infectivity (LC50) and virulence (TL50) are presented in Table 1. CL5Q is the amount of virus in which 50% of infected larvae die within ten days after of the infection. The TL50 is the time after infection when 50% of the infected larvae die when exposed to the virus at CL90 unless indicated otherwise in the following. In neonates of S. frugiperda and Trichoplusia ni, the LC50 of strains L-1 and V-8 of AcMNPV were very similar, but the TL50 were significantly different in neonates of S. frugiperda. For strains E-2 and L-1, of AcMNPV, death by infection usually occurs at approximately the same time after infection, whereas V-8 causes death more rapidly post-infection than strains L-1 and E2. There is a variability in real-time to death from experiment to experiment, but the results are consistent from experiment to experiment for comparisons of the difference in percent to time of death in comparisons of V-8 versus L-1 or E-2. The average of TL50 to CLg0 of isolate V-8 in S neonates. frugiperda is consistently about 12% shorter than the average TL ^ Q of L-1. Initial restriction analysis of AcMNPV V-8 against AcMNPV L-1 with a battery of different restriction endonucleases (BamHI), BglII, EcoRI, HindIII, PstI and Xhol) showed only the HindIII restriction polymorphism discussed in the foregoing. The six restriction endonucleases used to characterize AcMNPV V-8 recognize a total of 95 sites in the AcMNPV genome, each with an EcoRI hr region (six short regions with highly repetitive DNA sequences and multiple EcoRI sites) as a site. Since each recognition site is a hexanucleotide, a total of 570 bp has been sieved for the mutations by restriction endonuclease analysis. The only difference found in this screening was a HindIII restriction polymorphism in lef-2 (a mutation index of 0.18% (1/570).) Strain V-8 subsequently showed that it lacks the ÉcoRV site which is located in approximately 90 pb towards the 5 'end of the polyhedrin translation initiation site (see, for example, Figure 7.) Analysis of the 1.72 kb sequence in the region surrounding the HindIII polymorphism revealed numerous nucleotide differences between the sequences of L-1 and V-8 in and around lef-2, the ORF 603 and the polyhedrin gene (polh) (1.93 map units (um) to 3.27 um) (Figure 2). There are 73 nucleotide changes in the sequenced region of 1.72 kb. The restriction polymorphism HindIII in V-8 is due to a mutation of C to T in nucleotide 3243. Both of the Mlul site (3389) in the ORF 603 and the EcoRV site (4001) between the polyhedrin gene and the ORF 603 were destroyed by individual nucleotide changes (Figures 4 and 5). Several nucleotide substitutions in this region result in amino acid sequence changes in the predicted polypeptide products of lef-2, whereas insertions and substitutions substantially alter the 603 ORF. The six predicted amino acid changes in lef-2 are shown in Figure 5. A 26 bp insert in ORF 603 creates a stop codon within the open reading frame of ORF 603 and is predicted to cause premature termination during translation of ORF 603. No differences in sequence were found in the ORF 327 as long as it is towards the 5 'end of the Mlul site. Only three differences in the DNA sequence between V-8 and L-1 in polh were discovered. These are changes in the third base pair which do not change the encoded amino acids. The region at approximately 90 bp towards the 5 'end of the polh polyhedrin translation initiation site was generally unchanged, although the EcoRV site present in L-1 is absent in V-8. Therefore, based on the analysis of the restriction sequence, this region of V-8 contains an unusually high density of mutations using L-1 as a comparison with the wild type. Without wishing to be bound by any particular theory, it is postulated that AcMNPV V-8 produced by recombination between AcMNPV and a relatively distant virus related to AcMNPV. Furthermore, considering the mutation density of V-8 in this region, the differences in nucleotides 2703 and 4194 of V-8 (Figure 4) may be the limits of recombination, since no differences were found towards the 3 'end. from the BamHI site in polh and to the 5 'end of the Mlul site of the ORF 327 (starting at nucleotide 1 in SEQ ID NO: 3) at nucleotide 2469 (Figure 4). Most of the mutations were concentrated in the ORF 603 and to a lesser extent, in the lef-2. In addition, analysis of the V-8 sequence against L-1 of the relatively distant ORF 504 (a phosphatase gene located between 0.0 u.m. and 0.4 u.m.) did not reveal differences between L-1 and V-8. The colony of H. virescens in the American Cyanamid Agricultural Research Center, Princeton, NJ, was derived from a field isolate (Stoneville, MS) in 1966 and has been maintained since 1966. Air, water, and diet were not sterilized completely before being in contact with H. virescens. It has been discovered that there are sporadic viral outbreaks in this colony. The virus, named V1000, has been isolated from this colony, the sequence of the partial genomic DNA has been determined and various properties of the virus have been characterized. The V1000 Nuclear Polyhedrosis Virus seems to be closely related to the Rachiplusia Nuclear Polyhedrosis Virus (RoNPV) based on the restriction endonuclease analysis.

Based on the comparison of the sequence of the polyhedrin V-8 and V1000 regions, but without wishing to be bound to any particular theory, it is postulated that the V-8 strain of AcMNPV is a recombinant between the AcMNPV virus and the virus V1000 A sequence comparison between AcMNPV E-2 (ATCC VR-1344, American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD), V1000 and AcMNPV V-8 is presented in Figure 7. The last difference in sequence between strains AcMNPV V-8 and E-2 occur in the twentieth codon of the coding sequence of the polyhedrin. Two recombinant viruses, vEcoRIhybbl and vEcoRIHybIFS, were constructed by allelic replacement (see Example 3 and Figure 2) to determine whether the reduced TL5Q of AcMNPV V-8 was correlated with the difference in observed sequence in the lef-2 region. The analysis of the sequence established which differences of the characteristic sequence of V-8 that these recombinants possess after the allelic recombination. Both recombinants had the Kpnl site recombined towards the 3 'end in polh as evidenced by its positive occlusion phenotype. The parent virus vSynVI "gal lacks the polh sequences towards the 5 'end of the Kpnl site.VecoRIHybIFS virus contains the full 1.72 kb Mlul for the EspI fragment (1.93-3.27 um) with a four bp deletion at the Nael site in what was the ORF 603. The elimination in the ORF 603 of V-8 was destined to destroy the function of the product of the ORF 603, but analysis of the subsequent sequence revealed that the ORF 603 of V-8 had already been interrupted. In this way, it is expected that this elimination has no additional effect on viral infectivity and virulence. The crossover during the allelic replacement event that generates V? CoRIHybl occurred at the same point between nucleotides 3003 and 3027 of the AcMNPV sequence in Figure 4 (between nucleotides 535 and 559 of SEQ ID NO: 3; Figures 4 and 6) and before the Kpnl site within the polyhedrin gene. In this way, the product of the lec-2 gene of VEcoRIHybl is predicted to be a hybrid containing amino acid residues similar to L-1 towards the 5 'end of the cross-linking and the V-8 like residues towards the 3' end of the cross-linking (Figures 4 and 6). The bioassays to determine the infectivity and virulence of the L-1, V-8, VEcoRIHybl and VEcoRIHybIFS viruses were carried out in Spodoptera frugiperda neonates. Both of the LC50 and TL50 are calculated using probit analysis (unit of probability) (Daum (1970) Bulletin of the Entomological Society of America 16: 10-15) for each virus (Table 1) . The CL5u of all four viruses were statistically equivalent. As previously observed, V-8 has 12.4% shorter from TL5Q to C 9Q than L-1, reflecting increased virulence. The differences between TL50 to CL90 of V-8, vEcoRIHybl and vEcoRIHybIFS are not statistically significant. However, the differences between the TL50 to CL90 of L-1 and each of the three viruses containing the V-8 DNA are statistically significant; V-8 and the two hybrid viruses each have an L5Q significantly shorter than L-1. The hybrid virus vEcoRIHybl contains only a small region of the V-8 sequences from the half of lef-2 to the 5 'end of polh but possesses the enhanced virulence characteristic of V-8. The fact that the product of the lef-2 gene of vEcoRIHybl has an amino-terminal similar to L-1 and a carboxy-terminal V-8 but still retains the virulence phenotype V-8 indicating that increased virulence (TL50 decreased) of V-8 is due to either or both of the carboxy-terminal amino acid differences of lef-2 or to the absence of a functional ORF 603 gene product or some combination thereof. Alternatively, the faster destruction phenotype of V-8 (increased virulence) may be due to effects on the cis-acting sequence. If the two differences in the carboxy-terminal amino acids lef-2, the nonfunctional ORF 603 or a combination of these differences, are responsible for the increased virulence of V-8 remains to be determined. Gearing and Possee (1990) J. Gen. Virol. 71: 251-262 determined that ORF 603 is not essential for virus production in the form of cell culture shoot, polyhedra production or infectivity (CL5Q) of AcMNPV. However, Gearing and Possee did not present important data for virulence as measured by the TL5Q of their mutant by elimination ORF 603, so that it is not known what effects the destruction of ORF 603 has on the virulence of its mutants. Passarelli and Miller (1993) J. Virol. 67: 2149-2158 reported that lef-2 and its 630 amino acid expression product is required for late and very late gene expression in passenger expression assays. Without wishing to be bound by any particular theory, it is postulated that one or both of the V-8 alleles lef-2 and ORF 603 affect the replication rate of the virus and therefore the virulence of the virus. It is possible that the faster destruction by strain V-8 is due to a cis or trans effect. It is believed that the phenotype is carried within the region between nucleotides 3027 and 4231 in the V-8 sequence shown in Figure 4.

Table ÍA. Bioassays of the infectivity of AcMNPV variants in S. frugiperda neonates.

The L5T (# PIB / ml diet, polyhedrin inclusion bodies / ml) for L-1, V-8, vEcoRIHybl and vEcoRIHybIFS were statistically equivalent.

Table IB. Virulence bioassays of AcMNPV variants in S. frugiperda neonates.

(B) The TL5Q (in hours) to CL9Q of V-8, vEcoRIHybl and vEcoRIHybIFS were 10-12% faster than the TL5Q of L-1 to CL90; This difference is statistically significant, as evidenced by the upper and lower confidence limits. The AcMNPV V-8 was genetically modified to inactivate the egt gene (egt encodes for the ecdysteroid glycosyltransferase) following substantially the same procedure as described in U.S. Patent No. 5,180,581. Then the values were determined TL50 using S. frugiperda neonates for AcMNPV L-1, the deficient egt derivative of L-1 (vEGTDEL), AcMNPV V-8 and the V-8 derivative in which the egt gene was inactivated (V8vEGTDEL). The results are shown in Tables 2 and 3. Clearly, the AcMNPV V-8 destroyed faster than L-1 and VdvEGTDEL destroyed even faster than the AcMNPV V-8.

TABLE 2 Bioassays in neonates of S. frugiperda A. DOSAGE: 2 x 107 PTB / ml / 0Pide mortality) Virus isolated Yfi i L¿ vESTPE isolated 2 VBvEGTDEL VSvEGTDEI.

Upper limit 90 75 .7 106 86 .8 77 TLBO 84 - * 70. 6 103. 6 81. 5 72 Lower limit 84 66 101 76. 5 68 B. Dosage: 2 x 103 PBI / ml (92 to 100% mortality! Virus already isolated 1 Ll vEGTDEL isolated 2 VdyEQTEE V8.VBQTDBL Upper limit 91. 8 83 109 101 85 .5 TLso 86.4 76 .5 105 93 79 Lower limit 81 70 .6 102 85. 6 73 TABLE 3 Bioassays of the TL5Q of V8, L-1 and eliminations of egt in S. frugiperda neonates k. from Virus Upper limit TLSD Lower limit Destruction VßvSGTDEL 81.6 75 .4 69 .8 96 V8 99.6 95 91 90 B. L-1 106 102 98 90 vEGTDEL 89.7 84.2 78.9 96 In the bioassays of a diet layer using larvae of the second stage of H. virescens, the TL50 values for VdvEGTDEL were lower than for the corresponding virus V-8 and V-8 had lower values of TL50 than the strain L-1. VEGTDEL and V-8 had similar TL5Q values and V8vEGTDEL had TL50 less than vEGTDEL (L-1). Using the diet layer tests with Helicoverpa zea second stage larvae, V8vEGTDEL showed significantly faster destruction than AcMNPV E2. In the tests of insect larvae, VdvEGTDEL seems to destroy infected insects faster than the egt AcMNPV L-1 elimination strain (vEGTDEL). The LC50 values calculated in the PIB / 16 cm2 of sand in the diet layer bioassays for the strains of wild type AcMNPV (knob E2 or L-1) were from 1 x 105 to 1 x 106 for S, frugiperda and H zea 1 x 103 to 1 x 104 for S. eridania; and 1 x 101 to 1 x 102 for T. ni, S. exigua and H. virescens. In this way, the preferred viruses for the control of insects that both carry a genetic region that confers the phenotype of increased virulence and a genetic modification that inactivates the gene coding for the ecdysteroid glycosyltransferase. Preferred regions bearing the increased virulence phenotype are those of the lef-2 and ORF 603 region of the RoNPV genome. The functional equivalents of these regions of other baculoviruses can be easily identified, isolated and manipulated using the teachings of the present disclosure and the technology well known in the art.

The insects of Lepidopteran support a well characterized sequence of events during the development of the egg to the adult insect (see Comprehensive Insect Physiology, Biochemistry and Pharmacology, Vols. 7 and 8, Kerkut and Gilbert (eds.), Pergamon Press, Oxford, 1984 for detailed reviews). After incubation, insect larvae enter an extended feeding period during which time they will mutate several times to allow continued growth. The stages between the successive changes are known as stages. At the end of the larval growth period, the larvae form nymphs and finally emerge as an adult insect. The processes of molting and the formation of nymphs (collectively called ecdysis) are regulated by concerted actions of several different groups of hormones. The initial stimulus is the release of protoracicotropic hormone (PTTH) by certain brain cells. This stimulates the prothoracic glands to produce and secrete ecdysteroids, often referred to as hormones for insect shedding. In the presence of the juvenile hormone, a molt of the larvae will be ensured, while in the absence of the juvenile hormone, the larvae will form nymphs. Hatching hormone is also important in mediating various behavioral changes associated with ecdysis. The AcMNPV, which is used as a model system for such baculovirus research, interferes with the process of insect development. Insect larvae infected with AcMNPV are no longer able to move or form nymphs because the AcMNPV directs the synthesis of an enzyme, known as ecdiesteroid UDP-glycosyltransferase (EGT), which inactivates specifically to insect ecdysteroids by conjugating them to galactose in vivo (O'Reilly et al (1991) Insect Biochem.Molec. Biol. 22: 313-320) or glucose in vi tro (O'Reilly et al., Science 245: 1110) -1112). Other baculoviruses also carry the egt genes. The AcMNPV gene encoding EGT extends from 8.4 to 9.6 'map units in the AcMNPV genome (Figures 1 and 2). Figure 2 shows the restriction map of the egt region of the genome. The nucleotide sequence of the egt gene of AcMNPV (strain Ll) and the deduced amino acid sequence of 506 amino acids are shown in SEQ. FROM IDENT. NO: l and 2, respectively. The coding sequence of egt extends from nucleotide 149 to approximately nucleotide 1670. In a preferred embodiment of the present invention, the egt gene of AcMNPV strain V-8 is inactivated by replacing a portion of the egt gene with a bacterial sequence that it codes for ß-galactosidase. This recombinant baculovirus is designated VdvEGTDEL herein. In a second preferred embodiment, part of the egt gene of the V8 strain of AcMNPV is removed without replacement, for example, by deleting an EcoRI / Xbal segment within the egt coding sequence (See Figure 6).; U.S. Patent No. 5,180,581; Example 7 below). An alternative mechanism for the inactivation of the egt gene of the insect virus is the insertion of a gene that codes for an insect hormone that affects ecdysis, an enzyme which inactivates an insect hormone that affects ecdysis, which gene is expressible in an insect cell infected with the insect virus or a gene of a specific toxin for the insect. Using the egt gene of AcMNPV as a probe, an egt gene has been identified in the nuclear polyhedrosis virus Orgyia pseudotsugata (OpMNPV). It will be recognized by those skilled in the art that with the benefit of this disclosure, that the egt gene of any baculovirus can be characterized and isolated in a similar manner as AcMNPV (see, for example, the United States Patent No. 5,180,581, incorporated herein by reference in its entirety). Egt genes with at least 70% nucleotide sequence homology for the coding sequence of egt in Figure 6 of nucleotides 149-1666 (and in SEQ ID NO: 1, nucleotides 149 to 1666) are considered equivalent for the sequence, they provided those homologous genes that code for an enzyme which is an ecdysteroid UDP-glycosyltransferase and their identification, isolation and manipulation will be easily achieved by the worker with skill using the information of the sequences and the test provided, taken together with what is well known in the art. Functional equivalents of the egt gene are those which also catalyze the inactivation of ecdysteroids such as ecdysone, by the transfer of a glucose or galactose portion of the UDP-glucose to the ecdysteroid or ecdysteroids. Those functional equivalents of .egt can be identified using the test methods described herein. By inhibiting shedding and nymph formation by the effects of the ecdysteroid glycosyltransferase, infection with wt AcMNPV can actually prolong the feeding time of the larvae. Baculoviruses lacking a functional egt gene do not prolong the feeding time of larvae. Larvae infected with egt-deficient baculoviruses can form nymphs and succumb to viral infection even more rapidly than infected larvae, with the corresponding wt virus. The faster destruction by a baculovirus lacking a functional egt gene is observed more dramatically when larvae from the first stage of hatching are infected with wt AcMNPV and with vEGTZ. Larvae infected with vEGTZ succumb to viral infection 3 to 4 days faster than larvae infected with wt AcMNPV. Therefore, baculoviruses lacking an egt functional gene are considerably more effective as insect control agents than wild-type baculoviruses. It will be apparent to those with skill in the technique, with the benefit. of description, that the egt gene may become non-functional in any baculovirus by any means known in the art. Although the length of time of the progeny virus can accumulate in the. larvae, infected with. The .b.aculoviruses that lack a functional egt gene, are little shortened and infected insects show reduced growth, there is substantial production of progeny virus. The amount of virus obtained per larva after infection with vEGTZ of the larvae in the last stage is approximately 15 to 50% that obtained with the wt virus. This is sufficient to allow the cost-effective preparation of large quantities of virus particles. In another embodiment of the present invention, an insect virus lacking a functional egt gene is modified by genetic engineering technique, such that its effectiveness as an agent for biological control is further increased by the incorporation of a second gene. whose product affects the development of the insect.

The gene coding for PTTH (a peptide hormone) can be inserted into the viral genome with the inactivated egt gene and PTTH can be expressed at sufficiently high levels to affect ecdysis. The larvae of insects infected with such virus undergo an extreme interruption in the hormonal control of development. These insects become rapidly sick resulting in severely compromised growth and development, reduced feeding and faster death. The PTTH sequences are described in Kawakami et al. (1990) Science 247: 1333). It is important to note that although all of the above genes could be added to the wild-type virus genome using the description provided herein and / or in the United States Patent 5, 180,581 and techniques well known in the art, could not be expected to significantly affect the behavior of insects in the wild-type virus since expression of the egt gene by the wild-type virus inactivates the ecdysteroid shedding hormones and ecdysis it is avoided, without considering the production of other hormones. In this way, successful strategies involving the generation of viruses designed to interfere with insect ecdysis depend on the previous inactivation of the egt gene.

It will be understood by those skilled in the art, that mutant organisms that lack an egt gene intact or unable to express a functional egt product and those which are genetically modified to also express another enzyme that modifies the hormone or a hormone for the Peptide development are included as insect control agents of the present invention. An isolated and purified insect virus is one which has been cloned by means of plaque purification in tissue culture, for example, or prepared in any other form from a single viral phenotype. A recombinant insect virus, as used herein, is one which has at least a portion of its genotype derived from a heterologous insect virus, i.e., an insect virus of different taxonomic viral species. A recombinant insect virus can be generated by coinfection of an insect cell or insect with more than one viral species or it can be the result of introducing the genomic DNA of the insect virus and a segment of the insect virus DNA, heterologous in the same insect or insect cell, with the result that a portion of the heterologous DNA becomes incorporated into the genome of the insect virus by the recombination process. It is understood in the art, that such recombinant virus can be recognized by means of restriction endonuclease analysis, DNA sequencing in at least a portion of the putative recombinant genome or by means of a change in phenotype. As specifically exemplified herein, recombinant insect viruses are recognized for their increased virulence phenotype (lower TL5Q) in at least one target insect when compared to the parent insect virus. The phenotype of the recombinant insect virus with the fastest destruction phenotype can also be genetically modified and further improved as an agent for insect control by inactivating, for example, an enzyme that modifies the ecdysteroid. As used herein, an insecticidal composition has at least one active ingredient, which has an adverse effect on insect pests, preferably which kills or destroys pests. The present invention is the use of a recombinant insect virus, which has been isolated or which has been engineered to destroy at least one insect pest faster than the corresponding wild-type comparison using a segment of the DNA of the insect virus, heterologous. The DNA segment of the heterologous insect virus is one which is not normally associated with the genome of the father of the recombinant virus. As specifically exemplified herein, a portion of a baculovirus genome has been isolated and identified and shown to confer a faster insect killing phenotype (as measured using the TL50 assay) when inserted into the AcMNPV genome L-1 with Spodoptera frugiperda as the target insect. When an egt-deficient derivative of that recombinant insect virus is used, insect feeding is reduced in response to recombinant virus deficient in insect egt, the ecdysis of the normal insect is interrupted and the death of the insect is further accelerated in relation to the insect. with isogenic wild-type strain (ie with functional egt). A recombinant virus of this invention can also be an insect virus engineered to inactivate a gene that encodes an enzyme that modifies the ecdysteroid or one which is engineered to further express a heterologous gene encoding a protein. which affects the development of the insect, to minimize the feeding time of the insect or to cause more rapid destruction after infection with the virus. It will be understood by those skilled in the art that insect pests can be exposed to the viruses of the present invention by conventional methods including ingestion, inhalation or direct contact of the insect control agent.

A primary use of the engineered baculoviruses and / or recombinants of the present invention will be as active ingredients of agricultural compositions for application to plants for effecting biological control of insect pests of plants. Many variations for preparing such agriculturally suitable compositions for insect control are known in the art. The insecticidal compositions of this invention are normally administered at doses in the range of 2.4 x 108 to 2.4 x 10 12 PIB / hectare of the recombinant insect virus. Insecticidal compositions suitable for applications to plants for the control of insect pests comprise an agriculturally suitable carrier and an insect control agent, i.e., an insect virus, preferably a baculovirus. The conventional formulation technology known to those skilled in the art is used to prepare the compositions of this invention. The compositions may be in the form of wettable powders, dispersible granular formulations, granules, suspensions, emulsions, aerosol solutions, baits and other conventional insecticidal preparations. Wetting agents, coating agents, agents for promoting physical flexibility, UV light protectors, dispersing agents and for adhesion are advantageous additives in at least some formulations. The compositions will often include an inactive carrier, which may be a liquid such as water, alcohol, hydrocarbons or other organic solvents, or a mineral, animal or vegetable oil, or a powder such as talc, clay, silicate or kieselguhr. A nutrient such as sugar can be added to increase feeding behavior and / or to attract insects. The agents for the flow, for example agents for the clay-based flow can be added to minimize the formation of the agglutination of the wettable powders or other dry preparations during storage. The application of an insecticidal composition of this invention can protect plants from insect pests by producing feed and killing susceptible insects. The skilled technician knows how to choose an insect virus, which is suitable for the control of a particular insect pest. The concentration of the insect control agent that will be required to produce insecticidally effective agricultural compositions for the protection of the plants will depend on the type of crop, target insect, genotype of the virus used and the formulation of the composition. Insecticidal compositions can be formulated, for example, as wettable powders, with about 10% (w / w) of polyhedrin inclusion body. The insecticidally effective concentration of the insect control agent within the composition can easily be determined experimentally by a person of ordinary skill in the art. The agricultural compositions should be suitable for agricultural use and dispersion in the fields. Generally, the components of the composition must be non-phytotoxic and not harmful to the integrity of the occluded virus. Foliar applications should not damage or damage the leaves of plants. In addition to the appropriate solid carriers or liquid carriers, agricultural compositions may include binders and adhesives, emulsifying agents and humectants, but not components which prevent feeding of the insect or any of the viral functions. It is advantageous to add components which protect the agent for insect control from inactivation by UV light. Agricultural compositions for the control of insect pests may also include agents which stimulate the feeding of insects. Reviews that describe the application methods of agents for insect control, biological and agricultural application are available. See, for example, Couch and Ignoffo (1981) in Microbial Control of Pests and Plant Disease 1970-1980, Burges (ed.), Chapter 34, p. 621-634; Corke and Rishbeth, ibid. chapter 39, pp. 717-732; Brockwell (1980) in Methods for Evaluating Nitrogen Fixation, Bergersen (ed.) Pp. 417-488; Burton (1982) in Biological Nitrogen Fixation Technology for Tropical Agriculture, Graham and Harris (eds.) Pp. 105-114; and Roughley (1982) ibid, pp. 115-127; The Biology of Baculoviruses, Vol. II, supra. Field trials in which AcMNPV E-2, V8vEGTDEL and a Bacillus thuringiensis subspecies commercial kurstaki insecticide (DIPEL 2X, Abbot Laboratories, Chicago, IL) were conducted during the autumn growing season in Arizona. Although the infestation by the pest was relatively light, the results of this study indicated that VdvEGTDEL was effective against T. ni in young lettuce (Table 4). After the fourth application of the treatments (approximately at 5-day intervals), the V8vEGTDEL at 1 x 1011 and 1 x 1012 PIB / 0.40 Ha provided better T. control than the similar dose of AcMNPV-E2"wild type" . Additionally, V8vEGTDEL at 1 x 1011 and 1 x 1012 PIB / 0.40 Ha provided control of T. infestation at levels equal to those provided by DIPEL 2X at 0.45 kg / 0.40 Ha. Based on the data collected after only three applications, however, DIPEL 2X provided better pest control than any baculovirus.

After completing data collection, the test site (as well as a perimeter of 3.04 meters wide (10 feet)) is sprayed with an aqueous dilution of 1% (v / v) bleach. The treated crop, as well as a perimeter of 3.04 meters in width (10 feet) were destroyed using the equipment for cultivation work mounted on a tractor. Approximately 3 weeks later, soil samples are collected from several sites located within 30.04 meters (100 feet) of the test site. No VdvEGTDEL virus was detected in the soil surrounding the test site and no further action was taken.

TABLE 4. Efficacy of treatments with the selected baculovirus against Trichoplusia ni in lettuce average ff larvae / 15 plants # average larvae 10 plants Treatment1 Dose / A 'to 3DA3T to 5DA4T -, ..? ÍS * VßvEGTDEL 1x10"GDP 15 a b1 20 a 1x10" GDP 20 a 2 c 1x10"GDP 12 b 7 b c AcMNPV E2 1x10"GDP 10 b 18 a 1x10" GDP 18 a 20 a 1x10"GDP 12 b 10 b DIPEL 2X 0.45 Kg. Form. 0 c 7 b c Untreated 20 a IB a 1 The baculovirus compositions were formulated as water soluble wettable powders (1 x 10 11 PIB / 10 g). 2 Baculovirus compositions were applied at 1 x 109, 1 x 1011 and 1 x 1013 PIB / 0.40 lias on day 15, however due to poor mixing and spray characteristics of the 1 x 1013 dose, both baculoviruses were applied to 1 x 1010, 1 x 1011 and 1 x 1012 GDP / 0.40 Ha in all subsequent applications on days 5, 10 and 15. The DIPEL 2X was also applied in. on days 1, 5, 10 and 15. 3 The measurements within the columns followed by the same letter are not significantly different (DMRT, P = 0.05).

In a second field trial in autumn, the efficacy of VdvEGTDEL, AcMNPV E2 and a commercial B insecticide. thuringiensis subsp. kurstaki (DIPEL 2X, Abbott Laboratories, Chicago, IL) against the cabbage measuring caterpillar in New Jersey. Viral insecticidal compositions were formulated as wettable powders. Due to the slight infestation of the pest in this study, the differences between the treatments in the control of T. ni larvae were very light (and usually not statistically significant). However, all the treatments had significantly fewer live larvae and less defoliation of the plants than the untreated cabbage (Table 5). At 7 days after the last application of the treatments, the untreated parcels of land averaged 18% defoliation whereas the cabbage treated with VdvEGTDEL or AcMNPV-E2 of "wild type" (indices of lxlO9, lxlO11 and lxlO12 PIB / 0.40 Ha) averaged defoliation of 8-10% and cabbage treated with DIPEL (0.45 kg / 0.40 Ha (1 lb / A)) averaged 4% defoliation. At 12 days after the last application, the plots of untreated land had an average of 6.5 live larvae / 10 plants, while the plots of land treated with baculovirus (lxlO11 and lxlO12 PIB / 0.40 Ha) and DIPEL averaged <; 2 larvae / 10 plants. After the data collection is complete, the test site (as well as a perimeter of 3.04 meters wide (10 feet)) is sprayed with an aqueous dilution of 1% (v / v) bleach. The treated crop, as well as a perimeter of 3.04 meters wide (10 feet) is then destroyed using crop equipment mounted on the tractor. Approximately five months after the bleach treatment, the test samples are collected again from various sites located within 30.04 meters (100 feet) of the test site. Also on this date, the test site was treated with AcMNPV-E2"wild type" at a ratio of lxlO12 PIB / 0.40 Ha. VdvEGTDEL was not detected in these latter soil samples.

TABLE 5 Efficacy of treatments with the baculovirus selected against Trichoplusia ni in cabbage # average larvae / 10 plants # average larvae / 10 plants Treatment1 Dosage /? 3 to 7DA3T to 12DA3T VßvSGTDE 1 X 10 'GDP 10 b1 2.0 b 1 x 10"GDP 11 b 1.2 b c 1 x 10" GDP 7 b c 1.7 b c AcMNPV E2 1 X 10 'GDP 8 b c 2.0 b 1 x 10"GDP 8 b c 0.8 b c 1 x 10" GDP 11 b 0.8 b c DIPEL 21 0.45 Kg. Fopp. 4 c 0.2 C.

Untreated _..._ 8 to 6.5 a 1 Both types of baculovirus were formulated as water-soluble wettable powders (1E11 PIB / 10 g of WP). 2 The "eliminated-EGT" and "wild type" (at 1 x 109 and 1 x 1011 PIB / 0.40 Ha) and DIPEL 2X were applied three times. Due to the severe filling of the nozzles, the projected baculovirus was made of 1 x 1013 PIB / 0.40 Ha, in such a way that the "high dose" of baculovirus was applied in the first application and V? VEGTDEL and AcMNPV E2 at 1 x 1012 GDP / 0.40 Ha were applied and subsequently only applied twice (5 and 10 days later). 3 The means within the columns followed by the same reading are not significantly different (DMRT, P = 0.05).

A third field test for the efficacy of V8vEGTDEL, AcMNPV E2 and a B insecticide. Thuringiensis subspecies awaizai commercially available (Xentari, Abbott Laboratories, Chicago, IL) for the control of T. ni in lettuce was carried out in spring in Florida. The data are summarized in Table 5. VdvEGTDEL provided significantly faster control of T. ni or AcMNPV V8. Five days after treatment with V8vEGTDEL (1 x 1012 PIB / 0.40 Ha) caused 100% mortality of larvae while V8 at the same dose caused only 29% mortality of larvae (up to 97% mortality on day 7 ). Also, the VdvEGTDEL (1 x 1011 PIB / 0.40 Ha) presented control of larvae by index equal to that of V8 at 1 X 1012 PIB / 0.40 Ha). The commercial Bt product Xentari (0.45 kg / 0.40 Ha), provided 76% of the control of larvae on day 4 against only 40% of the control of larvae of VdvEGTDEL (1 x 1012 PIB / 0.40 Ha). However, on day 5, the VßvEGTDEL (1 x 1012 PIB / 0.40 Ha) and Xentari (0.45 kg / 0.40 Ha) presented 100%, and 89% mortality of the larvae, respectively.

TABLE 6. Efficacy of the applications in the field of VdvEGTDEL and AcMNPV ("wild type") against Trichoplusia nor in the lettuces Average mortality rate of larvae2 Dose Treatment1 per 0.40 Ha. Day 4 Day S Day ß Day 7 VSvEGTDE 1 x 10"GDP 0 35 88 100 VßvEGTDEL 1 x 10" GDP 40 100 ACMNPV V-8 1 X 10"GDP 4 29 68 97 Xeatari 0.4S Kg. 76 89 92 95 1 The baculovirus compositions were formulated as a wettable powder. 2 The treatments were applied to six true leaf lettuces (4 plots of land / treatment, RCT design). Approximately 3 hours after application, the leaves were harvested from the field-field plots, individually placed in petri dishes containing filter paper moistened with water and then infested with T. ni larvae of three days of age ( approximately 10 larvae / leaves). Two days later, the larvae are placed on CD-International trays containing untreated Stoneville artificial diet (1 larva / diet-well) and the percentage of mortality is classified on each of the various post-treatment days.

The examples provided herein utilize many techniques well known and accessible to those skilled in the arts of molecular biology, in the manipulation of recombinant DNA in plant tissue and in the cultivation and regeneration of transgenic plants. . Enzymes are obtained from commercial sources and are used in accordance with the recommendations of the vendor or other variations known in the art. Reagents, buffers and culture conditions are also known for the art. References that provide standard molecular biological procedures include Sambrook et al. (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plainview, NY; R. Wu (ed.) (1993) Methods in Enzymology 218; Wu et al. (eds.) Methods in Enzy ology 100, 101: Glover (ed.) (1985) DNA Cloning, Vols. I and II, IRL Press, Oxford, UK; and Hames and Higgins (eds.) (1985) Nucleic Acid Hybridization, IRL Press, Oxford, UK. Abbreviations and nomenclature when used are considered standard in the field and are commonly used in professional journals such as those cited herein. All references cited in the present application are expressly incorporated for reference herein. This invention is illustrated by the following examples, which should not be considered in any way as limitations imposed on the scope thereof. It is understood that recourse may be had to various other modalities, modifications and equivalents thereof which, upon reading the description herein may be ssted by those skilled in the art without departing from the spirit of the present invention and / or . the scope of the appended claims.

EXAMPLES Example 1. Isolation of AcMNPV V-8 A deposit of AcMNPV with minimal passages of the original AcMNPV isolated by Pat Vail (Vail et al. (1971) Proc. Intl. Int. Colloq. Insect Pathology, College Park, MD pp. 297-304) was amplified in larvae of Hiliothis virescens from the colony H. virescens in American Cyanamid, Princeton, NJ. H. virescens was grown on a wheat-soybean germ agar diet at 28 ° C under constant fluorescent light. Then the virus was amplified further into larvae of H. virescens. Ten viral clones were purified on plates of the diluted hemolymph of the last larvae of infected H. virescens. Methods for plaque assay, plaque purification, virus amplification and viral DNA preparation are described in O'Reilly et al. (1992) Baculovirus Expression Vectors; A Laboratory Manual, W.H. Freeman & Co. , New York, NY. Unless otherwise indicated, the viruses were propagated in the cell line IPLB-SF-21 (SF-21) (Vaughn et al., 1977) In Vi tro 13_: 213-217) using TC100 medium ( Gibco BRL, Gaithersburg, MD) supplemented with 0.26% tryptose broth and 10% fetal bovine serum (Intergen, -Purshase, NY). SF-21 cells are commercially available (e.g., Invitrogen Corporation, San Diego, CA). The DNA was prepared from each isolate and characterized by restriction endonuclease analysis in parallel with DNA prepared from AcMNPV strain L-1, which is described in Lee and Miller (1978) J. Virol. 27: 754.

Example 2. Analysis of the Region lef-2 and ORF 603 of AcMNPV Molecular biology techniques were used as previously described (Maniatis et al., 1989). Plasmid pRI-I contains the 7.33 kb EcoRI-I fragment AcMNPV L-1 cloned in the EcoRI site of pBR322. Plasmid pEcoRI-IV8 contains the EcoRI-I fragment of V-8 at the EcoRI site of Bluescript KS + (Stratagene, La Jolla, CA). Plasmid pEcoRIHybl was constructed by replacing the 1.72 kb fragment from Mlul to EspI (1.93-3.27 u.m.) in the EcoRI-I fragment of L-1 with the corresponding V-8 fragment. The hybrid EcoRI-I fragment was re-cloned into a pUC19 vector, which produces pUC19HybI, a plasmid with a unique Nael site in the ORF 603. A plasmid with a frame shift mutation at this Nael site, pUC19HybIFS was produced by digestion of pUC19HybI with NgoAIV (an isoschisomer of Nael which produces the cohesive ends), form blunt ends of the ends that protrude with the chickpea nuclease and religation of the blunt ends to produce an elimination of four base pairs that destroys the Nael site and disrupts the ORF 603 reading frame. This frame shift, which is confirmed by the sequencing of dideoxynucleotides (United States Biochemical Corp. Sequenase kit, Cleveland, OH), is predicted based on the DNA sequence of L-1 published from the AcMNPV [Possee et al., (1991) Virology 185: 229-241], to provoke the premature termination of the translation of ORF 603 at a site of fourteen amino acids towards the ext Row 3 'of the elimination.

Example 3. Virus Bioassays The polyhedra inclusion bodies (PIB) of L-1, V-8, vEcoRIHybl and vEcoRIHybIFS were prepared simultaneously from Trichoplusia larvae or infected as previously described (O'Reilly et al., 1992). The CL5Q data (the virus concentration [PIB / ml of diet] required for half of the larvae to die within ten days of infection) and the TL5Q data (the time taken at a specific viral concentration, to die half of the larvae) are collected from bioassays of neonates carried out in larvae of Spodoptera frugiperda. The neonates are allowed to feed for 24 hours in the diet containing various concentrations of the PIB of the viruses that are tested and then transferred to individual containers containing a diet without virus. The seven doses of each virus tested were 5xl04, 2xl05, 5xl05, lxlO6, 2xl06, 5xl06 and 2xl07 PIB / ml. Sixty larvae were tested per dose. Mortality of larvae was recorded at 48, 72, 84, 90, 96, 102, 108, 120, 132 and 144 hours post infection (p.i.). A final mortality account was made ten days after infection. The L50 and CL5Q values were determined using the probit analysis (Daum (1970) Bulletin of the Entomological Soc. Of America 16: 10-15).

The alternate virulence test was done as follows: The trays were obtained from C-D International, Inc., and had 32 fields separated by tray. Each field of 4x4 cm (16 cm2) had 5 ml of appropriate artificial diet. Adhesive, ventilated, transparent lids from C-D International, Inc., enclosed the insect in the field after treatment and infestation. These transparent covers allow easy sorting. The surface of the Stoneville diet (wheat / soybean germ diet) or mottled bean diet. (Bio-Serv, Inc., Frenchtown, .NJ 'Diet # 9393) were contaminated with 0.4 ml of aqueous viral solution. Dilutions in the range of 1 x 108 to 1 x 101 PIB / ml in 10-fold dilutions, depending on the species of insect tested. The applications were distributed evenly by rotating the tray and the solutions are allowed to dry in a laminar flow hood. The bioassay trays were maintained at 28 ° C in continuous fluorescent light throughout the study period. The readings were taken twice a day to observe the time of onset of infection. The CL5Q values are calculated from the log / probit BASIC statistics package and based on mortality against the dose at 8 days post-treatment. The TQ (time at 0 o'clock) was based on the initial average time when the larva was exposed to the treated diet. TL ^ Q values are calculated from the log / probit BASIC statistics package based on mortality against hours. The calculated TL50 data were derived from the DL95 value (based on a dose that was preferably less than 2 logarithmic phases greater than the CL5Q value).

Example 4. Construction of the Recombinant Virus Recombinant viruses are prepared essentially as described in O'Reilly et al. (1992) supra. Recombinant viruses vEcoRIHybl and vEcoRIHybIFS were constructed by cotransfection of SF-21 cells with vSynVI "gal DNA (Wang et al (1991) Gene 100: 131-137) and either the plasmid DNA pUC19HybI (for vEcoRIHybl) or the plasmid DNA pUC19HybIFS (for vEcoRIHybIFs) (See Example 2). The vSynVI "gal virus expresses the lacZ gene of E. coli in place of the polyhedrin gene and forms blue, occlusion negative (OCC") plates in the presence of the chromogenic X-gal β-galactosidase indicator. Both pUC19HybI and pUC19HybIFS contain a polyhedrin gene; in this way, recombination between the plasmid DNA derived from the polyhedrin region and the viral DNA produced positive, occlusion, white plaques (OCC +). The viruses that form the OCC + white plates have lost the lacZ gene and acquired a functional polyhedrin gene through allelic replacement.

Example 5. Field Test of the Baculovirus Variant The field test program evaluated the efficacy of V8vEGTDEL in relation to the wild type of AcMNPV against major lepidopteran pests which attack plants. The target pest organisms in these field trials include the cabbage measuring caterpillar, Trichoplusia ni; beet soldier worm, Spodoptera exigua; autumn soldier worm, Spodoptera frugiperda; worm soldier from the southeast, Spodoptera eridania; worm of the. shoots of 'tobacco, Heliothis virescens; corn earworm, Helicoverpa zea, diamondback moth, Plutella xylostella; cabbage worm, Pieris rapae. Each test was carried out on land currently used for row crop growth / production (ie, commercial or research farms). The crop used in each test is a leafy vegetable (eg, lettuce) or a crucifera plant (eg, cabbage). Each field test consists of the following eight treatments: V8vEGTDEL (see Examples 6 and 7 below) at 1 x 109, 1011 and 1013 PIB / 0.40 Ha; AcMNPV at 1 x 109, 1011 and 1013 PIB / 0.40 Ha and untreated control. In a given test, each treatment will be applied to the culture no more than six times (6); the treatments will be applied on a "as needed" basis (ie, as required by the pest populations, probably at intervals of 5 to 14 days). Within each test, there is a maximum of six applications of each treatment. Treatments are applied to the parcels of land in each test using ground equipment, either small tractor sprinklers or backpack pump sprinklers powered by C02. The treatments are diluted in water and applied by means of rolling bars and agricultural hydraulic sprinkler nozzles, standard. The maximum size of a plot of treatment land (ie, replicated) in each test is 0.007 hectares (0.018 acres) (ie, 4 rows wide x 18.24 meters long (60 feet), with the separation of The rows of 1.0 meters (40 inches) The maximum number of terrain plots (ie, replicated) per treatment in each test is 4. Each test is verified on at least one weekly basis for the duration of the study. One of these tests will be performed on the land of a private farm or secure research farm (without handover by unauthorized individuals) At the end of each test, the test area and the untested test perimeter 3. 0 meters (10 feet) suffered the "destruction of the crop" (ie, instead of being harvested for commercial use, the treated and adjacent crop is crushed and buried).

The earth is perhaps the most important reservoir for the persistence of the virus in the environment. The verification program consists of the collection of 4 soil samples (each 7.6 cm deep) totaling 500 g from the test site and from an area of 30.4 meters (100 feet) outside the treatment area. Samples are taken approximately in the middle of the test. A second series of samples is collected at the end of the test after all disinfection procedures have been completed (as described in the following). Verification or monitoring for viable infectious virus is important since immunodetection and PCR methods do not distinguish between infectious occlusion bodies and nonviable remnants of viral particles. The only reliable method to determine if infectious, viable viral particles are present in the soil samples is to perform bioassays of the samples on a highly susceptible host insect such as Heliothis virescens. Of every 500 g of soil sample, 25 g are used in the bioassay. A standard method is used for the isolation of viral occlusion bodies from the earth. This method efficiently recovers approximately 46% polyhedra from the earth. The CL5Q for AcMNPV in the standard diet layer assay is 300-1000 polyhedra / sand for H. virescens.

Therefore, if each larva that is going to be bioassayed is fed the isolate of 1 g of soil, this assay reliably detects 600-2000 viral occlusion bodies per gram of soil tested. Larvae that show typical symptoms of viral infection in the bioassay are examined for the presence of occlusion bodies using a light microscope. If the polyhedra are observed, they are isolated from the cadaver for the isolation of DNA from the occlusion bodies and a standard PCT assay (performed routinely in the laboratory) is done using flanking primers for the clearance of vEGTDEL (See, for example, example, Figure 6). The recovery efficiency of the DNA and the PCR assay is close to 100%. If the virus present is vEGTDEL, then a fragment of DNA of a characteristic size is observed, which allows the unambiguous identification of the virus as vEGTDEL. Other viruses generate DNA fragments of different sizes. AcMNPV variants that have deletions in the egt gene can occur spontaneously in nature and such viruses are subject to a severe replication disadvantage, which will not allow them to compete effectively with native viruses in the environment. In addition, since the inactivated virus in egt produces 30% -50% less polyhedra after a successful infection, the environmental persistence is further compromised. Contaminated plants within the test site and the intermediate zone of 3.0 meters (10 feet) wide, tools and implements of the farm are topically sterilized with a 1% bleach wash to avoid unnecessary dispersion of the viral insecticide. The formulation of VdvEGTDEL for the field test program is in the form of a wettable powder. On a basis in weight: weight, the ingredients of this formulation are as follows:. % By weight V8vEGTDEL 10.00 Eudragit S100 0.45 Oxybenzone UV-9 2.50 polyethylene glycol MW400 0.10 MiraSperse 39.10 REAX ATN lignin sulfonate 4.90 10X Sugar 19.45 Morewet EFW 19.60 Microcel E 3.90 100.00 Eudragit S100 (Rohm Phar a Co.) comprises methyl methacrylic and methyl methacrylate. It is a pH dependent coating agent which maintains UV9 over PIB and slightly prolongs the photostability of the formulation. Oxybenzone UV-9 (Cytech Ind.) Also provides light photostability, to the formulation. Polyethylene glycol MW400 (Aldrich Chemical Co.) provides flexibility to UV protective coatings. MiraSperse (Staley Co.) is a "starch-based" adhesive and 'provides rain resistance to the formulation after it is applied to the crop. REAX ATN (West Waco Co.) is a lignin sulfonate and is used as a dispersant and keeps the separated particles in the liquid phase (ie in the water diluent). Sugar is used as a stimulant for feeding the insect and / or as an attraction agent. Morewet EFW (Witco Co.) is a wetting agent, in such a way that the formulation can be spread more effectively through the surface of a treated leaf. Microcel E (Manville Co.) is an agent for clay-based flow that prevents the wettable powder from clumping during storage. For use in test formulations, PIB (polyhedrin inclusion bodies) are milled with air less than 10 μm in size and coated with an organic solution containing Eudragit S100, UV-9 and MW400. The other mentioned inert materials are mixed and ground in Fitz to form a premix. The coated PIB and the premix are mixed together and ground in a Fitz and then the formulation is packaged. No foreign microorganisms will be present in the formulation, since production in tissue culture requires the use of sterile procedures. In each 10 g of wettable powder formulation there is 1 g (2 x 1011 PIB) of VßvEGTDEL. A preferred wettable powder insecticide composition is as follows: Ingredient Nominal Percent (p / p) Polyhedrin inclusion bodies from V? VEGTDEL 10,. 0% Morwet D425 30. . 0% Morewet EFW 20. . 0% Kaolin clay 16. . 0% Microcel E 16. . 0% Oxybenzone UV-9 or charcoal 5. . 0% Eudragit S100 2,. 0% Citrus Acid 0. 9% Polyethylene glycol MW400 0,. 1% The active ingredient is VßvEGTDEL. The Morewet D425 is used as a dispersing agent and keeps the separated particles in the liquid phase (ie in the water diluent). Morewet EFW (Witco Co.) is a wetting agent, in such a way that the formulation can be spread more effectively through the surface of a treated leaf. Clay Kaolin is an agent for bulking. Microcel E (Manville Co.) Is an agent for flow that prevents the wettable powder from clumping together. UV-9 (or charcoal) provides light photostability to the formulation. Eudragit S100 (Rohm Pharma Co.) also slightly prolongs the photostability of the formulation. Citric acid is used for pH adjustment. MW400 (Aldrich Chemical Co.) provides flexibility for protective coatings against UV light. Optionally, a stilbene polish is added (at about 5% w / w) to the PIBs in preferred, alternative wettable powder formulations and the percentages of other inert ingredients are adjusted accordingly.

Stilbenes provide some protection against inactivation by UV light and can also serve to increase or potentiate the ineffectiveness of the virus, particularly in insects which are less susceptible to the insect virus, see, for example, U.S. Patent No. 5,246,936 (issued September 21, 1993, Treacy et al.), Which is incorporated herein by reference. In this formulation the PIBs are first coated using an aqueous coating process. A 1% (w / v) suspension of Eudragit S100 is prepared in water. The Eudragit is dissolved by adjusting the pH to between 9.0 and 9.5. Viral GDPs are added, Blankophor BBH (stilbene brightener, Miles Inc, if used) and UV-9 oxybenzone or vegetable charcoal in the right proportions. The mixture is stirred to create a uniform suspension and then air dried. Coated, dry PIBs are milled in an air mill to achieve a small particle size. Then this dry material mixed with the prescribed amounts of Morwet 425, Morewet EFW, Clay Kaolin, Microcel E, Citric Acid and Polyethylene Glycol MW400 and then packaged as the final formulation. The size of. preferred particle, the 'mixed material is less than 20 μm.

Example 6 The position of the egt gene in the AcMNPV genome is illustrated in Figure 2B. A scale in the map units is presented above the map of the AcMNPV genome in Figure IA. The nucleotide sequence of the egt gene of AcMNPV L-1 and the flanking regions has been determined (Figure 6, SEQ ID NO: 5). Figure IA shows a linear map of the AcMNPV L-1 genome after cleavage with the restriction endonucleases EcoRI and HindIII. Figure IB is an enlargement of the AcMNPV genome from 7.6 to 11.1 map units showing the location of the egt gene. Strain L-1 of AcMNPV has been described (Lee and Miller (1978) J. Virol. 27: 754). The cloned L-1 DNA fragments and the names of the resulting plasmids are shown in Figure 1C. Fragment 1, which extends from the PstI site at 7.6 um to a BamHI site at 11.1 um, is cloned into the plasmid vector pUC19; fragments 2 and 3 (from PstI (7.6 um) to EcoRI (8.65 um) and EcoRI (8.65 um to Salí (10.5 um), respectively) are both cloned into the Bluescript vectors M13 + and Bluescript M13- (Stratagene, San Diego, California). Fragment 5 (BstEII (8.35 um) to BstEII (8.7 um) is cloned in Bluescript M13 +.

The nucleotide sequence of the egt gene is presented in the SEC. FROM IDENT. NO: 6 and in the SEC. FROM IDENT. NO: 5 from nucleotide 149 to nucleotide 1669.

Example 7 To construct AcMNPV recombinant viruses (eg, V-8) unable to express a functional egt gene, another manipulation of the plasmid clones described in Example I is required. The plasmid pUCBCPsB is cut with the restriction endonucleases EcoRI and Xbal (see Figure 3 for sites within the egt gene) and the small fragment is discarded. The lacZ gene from Escherichia coli, cut from pSKS104 (Casadaban et al (1983) Methods Enzymol 100: 293-303) with EcoRI and AhalII, is then inserted between the EcoRI and Xbal sites after the protruding ends of Xbal are they fill using the T4 DNA polymerase. The resulting plasmid is designated pEGTZ. In this plasmid, the inserted lacZ gene is in a frame with the preceding egt coding sequences. Alternatively, the pEGTDEL plasmid is constructed by simply ligating the EcoRI and Xbal sites together (after both sites have been formed with blunt ends) without inserting any sequence therebetween. . Plasmid pEGTZ is then cotransfected with the AcMNPV V-8 DNA in SF cells as described in Miller et al. (1986) supra. This procedure allows homologous recombination to be carried out between the sequences in the viral and plasmid DNA, resulting in the displacement of the egt viral gene with the fusion of the egt-lacZ gene of the plasmid. Because the remaining egt coding sequence is in frame with the lacZ sequences, such a recombinant virus will produce a fusion protein comprising the first 84 amino acids of egt bound to the β-galactosidase. The recombinant virus, called vEGTZ, can be identified since the expression of β-galactosidase gives an increase to the blue viral plaques in the presence of a chromogenic indicator such as 5-bromo-4-chloro-3-indolyl-β-D -galactopyranoside (X-gal). The recombinant virus V8vEGTDEL is obtained by cotransfection of plasmid pEGTDEL and DNA of vEGTZ virus in SF cells. Homologous recombination results in the replacement of the egt-lacZ fusion gene in VdvEGTZ with the egt gene removed from pEGTDEL. The vEGTDEL recombinant virus is identified by its failure to form blue plates in the presence of X-gal. In a specific embodiment of an AcMNPV V-8 virus in which the egt is inactivated, a DNA fragment of 7.6-11.1 map units on the physical map of AcMNPV is cloned into a plasmid vector as described in the Patent of the United States No. 5,180,581 incorporated for reference herein.

This AcMNPV fragment contains the egt gene and flanking viral DNA. An internal deletion is made in the egt gene and the lacZ gene of E. coli is fused in the frame. Virus deleted in initial egt, designated vEGTZ, was constructed using this fusion plasmid to replace the egt gene in AcMNPV by allelic recombination mediated by cellular recombination mechanisms. The presence of a functional lacZ gene facilitated the identification of the recombinant virus by its blue color in plaque assays in the presence of an appropriate chromogenic indicator. A deleted virus was constructed in additional egt, vEGTDEL eliminating an internal portion of the egt gene from the plasmid vector containing the region of 7.6-11.1 map units of the AcMNPV genome using PCR-mediated mutagenesis. The sequence of the coding region of egt and the flanking sequences are shown in Figure 6 together with the locations of the PCR primers. The elimination at the precise sites indicated in Figure 3 results in the formation of two new and easily characterized restriction enzyme sites (EcoRl and Xhal) and the binding of the elimination. This plasmid with the deletion is then used to replace the deleted lacZ gene in egt.

Example 8 The enzyme activity protein egt can be determined as follows: SF cells are infected with AcMNPV as described above. Twelve hours post infection, cells and extracellular media are collected and processed separately. The uninfected cells are treated in parallel. Cell lysates or extracellular media are incubated in the presence of UDP-glucose, 1 mM UDP-galactose and 0.25 μCi [3 H] ecdysone as described in O'Reilly and Miller (1989) Science 245: 1110-1112.

The activity of the ecdysteroid UDP-glucosyl transferase in cell lysates or media, catalyzes the transfer of glucose from UDP-glucose to ecdysone to form an ecdysone-glucose conjugate. The ecdysone and the ecdysone-sugar conjugate are separated from each other by thin-layer chromatography on silica gel (Bansal and Gessner (1988) Anal. Biochem. 109: 321) and visualized by autoradiography. The ecdysone-glucose (G) conjugates are formed only when the cell lysate or the extracellular medium infected with wt AcMNPV is tested. No conjugates were observed when using cell lysates or media infected with the inactivated virus in egt or not infected, which show that the activity is due to the expression of egt. The majority of the activity is located in the extracellular medium. It should be understood that the foregoing relates only to the specific preferred embodiments of the present invention and that numerous modifications or alterations may be made therein without departing from the spirit and scope of the invention as set forth in the appended claims.

LIST OF SEQUENCES (1. GENERAL INFORMATION (i) APPLICANTS: Miller, Lois K. Black, Bruce C. Dierks, Peter M. Fleming, Nancy C. Ahmed, Fakhruddin (ii) TITLE OF THE INVENTION: Insect Virus, Sequences, Insecticide Compositions and Methods (üi) SEQUENCE NUMBER: 10 (iv) ADDRESS THE CORRESPONDENCE: (A) RECIPIENT: Greenlee and Winner, P.C. (B) STREET: 5370 Manhattan Circle, Suite 201 (C) CITY: Boulder (D) STATE: Colorado (E) COUNTRY: USA (F) ZIP: 80303 (v) READING FORM ON THE COMPUTER: (A) TYPE OF MEDIUM: Soft disk (B) COMPUTER: compatible with an IBM PC (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: PatentIn Relay # 1.0, Version # 1.30 (vi) DATA OF THE CURRENT APPLICATION: (A) NUMBER OF APPLICATION: US (B) DATE OF SUBMISSION: June 2, 1995 (C) CLASSIFICATION: (vii) DATA FROM THE PREVIOUS APPLICATION: (A) APPLICATION NUMBER: US 08 / 281,916 (B) DATE OF SUBMISSION: July 27, 1994 (viii) INFORMATION OF THE APPORTER / AGENT: (A) NAME: Ferber, Donna M. (B) REGISTRATION NUMBER: 33,878 (C) REFERENCE / FILE NUMBER: 29-94A (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: (303) 499-8080 (B) TELEFAX: (303) 499-8089 (C) TELEX: 49617824 [2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 1 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1721 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (Üi) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 194..826 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 1 ? CGCCTTCCG GCACG? GCTT TG? TT? TA? T A? GTTTTTAC? -? CGATG? CATG? CCCCC 60 CTAGTG? C ?? CC? TCACGCC C ?????? CT GCCGACTACA ??? TT? CCG? TG? TGTCGGT 120 GACGTTAAA? CTATTAAGCC ATCCAATCGA CCGTTAGTCß A? LC? GGACC GCTGGTGCG? 180 GA? GCCGCG? AGT ATO GCG AAT GC? TCG TAT AAC GTG TGG AGT CCG CTC 229 Met Al *? Sn To »Ser Tyr Aßn Val Trp Ser Pro Leu 1 9 10 ATT AGA GC? TCA TGT TTA GAC AAG ??? GCT ACA TAT TTA ATT CAT CCC 277 II *? Rg? The Ser Cy? Leu? Ap Ly? Ly? Ala? Thr? T? Leu?? P? Pro 1S 20 25 CAT GAT TTT ATT GAT ??? TTß ACC CTA ACT CCA TAC ACÓ GTA TTC TAC 325 Aßp? ßp Phe lie? ßp Lyß Leu Thr Leu Thr Pro Tyr Thr Val Phe Tyr 30 35 40 AAT GGC GGO GTT TTG GTC ??? ? TT TCC GGA CTG COA TTQ TAC ATG CTG 373? ßn Gly Gly Val Leu Val Lyß Xle Ser Gly Leu? Rg Leu Tyr Met Leu 45 50 55 60 TTA? CG GCT CCG CCC ACT? TT AAT G ?? ? TT ??? AAT TCC AAT TTT ??? 421 Leu Thr? Pro Pro Thr He Aßn Glu Zle Lyß Aßn Ser Aßn Phe Lyß 65 70 75 ??? CGC AGC AAG AC? AAC ATT TGT ATO ??? GAA TGC GT? GAA GGA AAG 469 Lyß? Rg Ser Lyß? Rg Aßn He Cyß Met Lyß Glu Cyß Val Glu Gly Lyß 80 85 90 ??? AAT GTC GTC GAC ATG CTO ?? C ?? C ?? ß? TT AAT ATO CCT CCG TGT 517 Lyß? ßn Val Val? ßp Met Leu? Sn? ßn Lyß? Le? ßn Met Pro Pro Cy? 95 100 IOS ATA? ?? AAA ATA TTA AAC GAT TAT AAA GAA AAC AAT ATA OTA CCG CCC GGC 565 Zle Lyß Lyß Zle Leu? ßn? ßp Leu Lyß Glu? ßn? ßn Val Pro? Rg Gly 110 115 120 GGT ATG TAC? GG ?? C? ßß TTT ? TA CT? AAC TGT TAC ATT GC? ?? GTG 613 Gly Met Tyr Arg Lyß? Rg Phe He Leu? An Cys Tyr He? La? ßn Val 125 130 135 140 GTT TCG TGT GCC ?? G TGT G ?? ?? C COA TCT TT? ? TC A? GCT CTG? C? 661 Val Ser Cys? The Ly? Cys Glu? An? Rg Cy? Leu He Ly?? The Leu Thr 145 150 155 CAT TTC T? C CAC GAC TCC ?? G TOT OTO GGT? GTC ATG CAT CTT 709 Bis Phe Tyr? ßn Ble? ßp Ser Lyß Cyß Val ßly Glu Val Met Bis Leu 160 16S 170 TTA ATC AAA TCC CAA GAT GTG TAT? AACCACCAAACTGCCAAAAAAATG 757 Leu He Lys be Gln? Sp Val Tyr Lys Pro Pro? ßa Cys ßln Lys Met 175 180 185 ??? ? CT GTC GAC AAO CTC TOT CCG TTT GCT CGC ?? C TGC ?? Gt CTC 805 Lyß Thr Val? ßp Ly? Leu Cys Pro Ph?? ßly? ßn Cys Lys Oy Leu 190 198 200 AAT CCT ATT TGT AAT TAT TGA AT ?? T ??? AC AATTATAAAT GCTAA? TTTG 856 TTTTTTATTA ACG? TAC ?? A CCAAACGCAA CAAGAACATT TGTAGTATTA TCTATAAITG 9 6 AA ?? CGCGT? CTTATAATCG CTG? GGTAAT ATTTA ??? lC ATTTTCAA? T GATTCACAGT 976 TAATTTGCGA CAATATAATT TTATTTTCAC? T ??? CTAG? CGCCTTGTCG TCTTCTTCTT 1036 CGTATTCCTT CTCTTTTTCA TTTTTCTCCT CAT ????? TT AACATAGTTA TTATCGTATC 1096 C? TATATGTA TCTATCGTAT AG? GT ??? TT TTTTGTTGTC AT ??? TAT? T ATGTCTTTTT 1156 TAATGGGGTG TATAGTACCG CTßCGCAT? G TTTTTCTGTA ATTIACAACA GTGCTATTTT 1216 CTGGTAGTTC TTCGGAOTGT GTTGCTTTAA TTATTAAAIT TATATAATCA? TG ?? TTTGG 1276 GATCGTCGGT TTTGT C? L ATGTTGCCGG CATAOTACGC AGCTTCTTCT AGTTCAATTA 1336.

CACCATTTTT TAGCAGCAGC GGATTA? C? T? ACTTTCC ?? AATGTTGTAC C ?? CCGTT ?? 1396 AC AAA? CAG TTC? CCTCCC TTTTCTATAC TATTGTCTGC GAGCAGTTGT TTGTTGTTA? 1456 A? TA? CAGC C? TTGTAATG AGACGCACAA ACTAAIATCA CAAACTGG ?? ATGTCTATCA 1516 ATATATAGTT GCTGATATCA TGGAGATAAT T ???? TG? L? ACCATCTCGC ??? T ?? AT ?? 1576 GTATTTTACT GTTTTCßTAA CAGTTTTGTA ATAAAA ??? C CTATAAATAT GCCGOATTAT 1636 TCATACCßTC CCACCATCGG GCGTACCTAC GTGTACG? C? ACA? GT? CT? C ????? TTT? 1696 GGTGCCGTT? TCAAGAACGC T ?? GC 1721 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 2 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 211 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 2: Het Ala? ßn? The Ser Tyr? ßn Val Trp Ser pro Leu lie Arg Ala be 1 5 10 15 Cyß Leu? ßp Lyß Lyß? The Thr Tyr Leu le? ßp Pro? ßp? ßp Phe lie 20 25 30? ßp Lyß Leu Thr Leu Thr Pro Tyr Thr Val Phe Tyr? ßn Gly Gly Val 35 40 45 Leu Val Lyß Ha Gly Leu? Rg Leu Tyr Mßt Leu Leu Thr? Pro 50 SS 60 Pro Thr Zle? ßn Glu Zle Lyß? ßn Ser? ßn Phe Lyß Lyß? Rg S t Lyß 65 70 75 80? Rg? ßn Zle Cyß Met Lyß ßlu Cyß Val ßlu ßly Lya Lyß? ßn Val Val 85 90 95? ßp Het Leu? ßn? ßn Lyß lie? ßn Ket Pro Pro Cyß Zle Lyß Lyß Zle 100 IOS 110 Leu? ßn? ßp Leu Lyß Glu? ßn? ßn Val Pro? Rg Gly Gly Ket Tyr Arg 115 120 125 Lya? Rg Phe Zle Leu? ßn Cyß Tyr? e? la? ßn Val Val Ser Cyß? 130 135 140 Lyß Cyß ßlu? ßn? rg Cyß Leu Zle Lyß? Leu Thr Hia Phe Tyr? ßn 145 150 155 160 Hiß? ßp Ser Lyß Cyß Val ßly and Glu Val Met His Leu Leu Zle Lyß Ser 165 170 175 Gln? ßp Val Tyr Lya Pro Pro? ßn Cyß Gn Lyß Ket Lyß Thr Val? ßp 180 185 190 Lyß Leu Cyß Pro Phe? The Gly? An Cyß Lyß Gly Leu? An Pro Zle Cy? 195 200 205? ßn Tyr * (2 ) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 3 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 1763 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (ix) FEATURE: (A) NAME / KEY: CDS (B) LOCATION: 194..826 (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 3 ACGCGTTCCG GCACCAGCTT TG? TTGT ?? T? ACTTTTTAC GAACCGATGA CATGACCCCC 60 CTAGTG? C ?? CG? TC? CGCC C ???? ß ?? CT CCCO? CT? C? ??? TTACCO? TG? TGTCGGT 120 GACGTT ???? CTATTAAOCC? TCC ?? TCß? CCGTTAGTCG A? TC? ßC? CC GCTGGTCC? 180 G ?? GCCGCß? AGT ATO CCG AAT GC? TCG TAT ?? C GTÃ TG TGÃ A AOT CCG CTC 229 Met? The? ßn? The Ser Tyr? ßn Val Trp be Pro Leu 215 220? TT AGC GCG TCA TGT TT? G? C ?? G ??? CCT ACÁ T? T TT? ? TT OAT CCC • 277 I Will Be the Ser Cyß Leu? ßp Lyß Lyß? The Thr Tyr Leu He? ßp Pro 225 230 235 G? T G? T TTT? TT GAT A ?? TTG? CC CT? CT CT? T? C? CG GTA TTC TAC 325? ßp? ßp phe He? ßp Lyß Leu Thr Leu Thr ro Tyr Thr to Phe Tyr 240 245 250 255 AAT GCC CCC GTT TTG GTC ??? ATT TCC OCA CTC CC? TTO TAC ATß CTß 373? ßn ßly Gly Val Leu Val Lyß He Ser ßly Leu? Rg Leu Tyr Met Leu 260 265 270 TT? ACG GCT CCG CCC ACT ATT AAT G ?? ? TT ??? AAT TCC AAT TTT ??? 421 Leu Thr? Pro Pro Th Zl? ßn Clu? L? Ly??? Ser A? Rv Phe Ly? 275 280 28 S ??? COC ACC AAG AG? AAC ATT TOT ATG ??? H.H?? TGC CCA OA? Oß? ? Aß 469 Lyß Arg Ser Lyß? Rg? ßn He Cyß Mee Lyß ßlu Cyß? The Olu Gly Lyß 290 295 300 ??? AAT CTC OTT G? C ATO CT? AAC ACC A? O ATC AAT ATC CCT CCC TGT 517 Lyß Aßn al Val? Ap Met Leu? ßn S s Lyß He? ßn Met Pro Pro Cy? 305 310 315 ATA A ?? ??? ATA TTG GGC GAT TTO ??? G ?? AAC AAT CTA CC? COC OOC 565 He Lyß Lyß He Leu Cy? ßp Leu Lyß ßlu? ßn? ßn Val Pro? Rg Gly 320 325 330 335 GGT ATO T? C ACG AAG AGA TTT? T? TT? AAC TOT T? C ATT CCA AAC CTG 613 Gly Met Tyr Arg Lya? Rg Phe He Leu? ßn Cy? Tyr? Le? ßn Val 340 345 350 GTT TCG TGT CCC ??? TOT G ?? AAC CCA TOT TTA ATC AAT OCT CTG ACG 661 Val Smr Cyß the Lyß Cyß Clu? ßn? Rg Cyß Leu He? ßn? The Leu Thr 355 360 365 .CAT-JrrC T? C AAC C? CC? T TCC ?? ? TCT ßlß GCT O ?? ßTC? TC CAT CTT 709 Hia Phe Tyr? ßn Bis? ßp Ser Lyß Cyß Val Cly Olu Val Met Hiß Leu 370 375 380 TT? ? TT ??? TCC C? C? T OTT T? T ??? DC? DC? AAC TOC CAÁ A ?? ATC 757 Leu He Lyß Ser ßln? ßp Val Tyr Lyß Pro Pro? ßn Cyß cln Lyß Met 385 390 395 ??? AAT OTC O? C AAC CTT TGC CCG TTT OCT OOC AAC TOC? OOT CTC 805 Lyß? ßn Val? ßp Lyß Leu Cye Pro Phe? The ßly? An Cyß Lyß ßly Leu 400 405 410 415 AAT CCT ATT TQT AAT T ? T TCA AT? AT ???? C AATTATA? AT CCT ??? TTTß 856? ßn Pro He Cyß? ßn Tyr • TTTTTTATT? ? CGATAC? A? CC ??? CßCAA CAAGAACATT TGTAG ?? TTA TCTATAATTG 916 AAAACCCATA ATTATAATCG TC ?? GGT ?? T GTTTAAAATC ATTTTC ??? T GATTCACAGT 976 TAATTTGCGA CAGT? T ?? TT TTGTTTTCAC? X ??? CTAG? CGCCTTTATC TGTCTGTCGT 1036 CTTCTTCGT? TTCTTTITCT TTTTC? TTTT TCTCTICATA AAAATTCACA TAATTATTAT 1096 CGTATCC? TA TATGTATCTG TCGT ??? GAG T ?? ATTTTTT GTTGTCATAA ATATATATGT 1156 CTTTTTTTAAT GGGGTGTATA GT? CCGCTGC GCATAGTTTT TC? TTAATTT AAACCAGTGC 1216 TATTTTCTGG TAATTCTTCC CAST6T0TTC CTTTAATTAT TAAATTT? T? T ?? TC ?? TGA 1276 ATTTGGGATC GTCGGTTTTβ T? C ?? T? TGT TGCCßOCATA ßTACGCAGCT GGCTCTAAAT 1336 CAATATTTTT TA? ACA? CCA CTGSATC? AC ATTACCATTT TTTAGCAACA CTGGATTAAC 1396 AT ?? TTTTCC A ?? ATGC? ßT ACGAAGCGTT T ?? CAA ??? C AGTTC? CCTC CCTTTTCTAT 1456 ACTATCCTCT GCO? ßC? ßTT GCTTGTTOTT A ???? T ?? CG GCCATTGT ?? TCA ?? CGC? C 1516 A ?? CTA? TAT TACACACTAA AAAAATCTAT C? TTTCGGCT TAATATATAG TTGCTGATAT 1576 TATGTA ?? TA? TT ???? TG? T ?? CCATCTC GC ??? T ??? T AAGTATTTT? CTGTTTTCGT 1636 A? C? GTTTTG T ?? TAAAA ?? ACCTAT ??? T? TGCCGGATT ATTCAT? CCG TCCCACCAIC 1696 GGGCGTACCT? CGTGT? CGA C ?? CA ?? TAT T? C ????? TT TAGGTGCCGT TATCAAGAAC 1756 GCTAAGC 1763 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 4: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 211 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 4: Met Ala? ßn? The Ser Tyr? ßn Val Trp Smr Pro Leu lie Ser Ala 1 5 10 15 Cys Leu Asp Lys Lys Ale Thr Tyr Leu He? ßp Pro? ßp? ßp Phe He 20 25 30 Aep Lye Leu Thr Leu Thr Pro Tyr Thr Val Phe Tyr Aen Gly Gly Val 35 40 45 Leu Val Lys lie Smr Gly Leu? Rg Leu Tyr Met Leu Leu Thr Ala Pro 50 55 60 Pro Thr? Le? ßn Glu Zle Lyß? ßn ser? ßn Phe Lyß Lyß Arg Ser Lye 65 70 75 80? Rg? ßn lie Cyß Met Lyß Glu Cyß? Glu Gly Lyß Lyß? ßn Val val 8S 90 95? ßp Mßt Leu? ßn Ser Lyß Ile? ßn Ket Pro Pro Cys le Lyß Lyß lie 100 IOS 110 Leu Gly? ßp Leu Lyß Glu? ßn? ßn Val Pro? Rg ßly ßly Ket Tyr? rg 115 120 125 Lys Arg Phe Zle Leu Aßn Cyß Tyr He? La? ßn Vel Val Ser Cyß Ale 130 135 140 Lye Cys Glu? ßn? Rg Hey Leu Xle? In? The Leu Thr Ble Phe Tyr? On 145 150 155 160 His? ßp Ser Lyß Cys Val ßly ßlu Val Met Hls Leu Leu Zle Lye Ser 165 170 175 oln? ßp Val Tyr Lys Pro Pro? ßn Cyß ßln Lyß Ket Lyß? ßn Vel Asp 180 185 190 Lye Leu Cye Pro Phe Ala ßly Aen Cye Lyß ßly Leu? In Pro Zle Cys 195 200 205? ßn Ty * (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 5 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 210 amino acids (B) TYPE: amino acid (C) FORM OF THE CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 5 Met? La? Sn Ala Ser Tyr? In Val Trp Sar Pro Leu He Arg Ala be 1 5 10 15 Cys Leu Aap Lyß Lyß Ala Thr Tyr Leu Zle? Ep Pro Aßp? ßp Phe Zle 20 25 30? ßp Lyß Leu Thr Leu Thr Pro Tyr Thr Val Phe Tyr? ßn ßly ßly Val 35 40 45 Leu Val Lye li Ser ßly Leu? rg Leu Tyr Ket Leu Leu Thr Wing Pro 50 55 60 Pro Thr Zle? ßn Olu Zle Lyß? ßn Ser? ßn Phe Lyß Lyß? rg Ser Lys 65 70 75 80? rg? in He Cye Met Lys ßlu Cys Val Glu ßly Lys Lys? In Val Val 85 90 95 Asp Ket Leu Aßn? In Lyß Zle? Sn Met Pro Pro Cys Zle Lys Lys Zle 100 105 110 Leu Aen? Ep Leu Lyß Clu Aßn Asn Val Pro Arg ßly and Gly Ket Tyr Arg 115 120 125 Lye Arg Phe Zle Leu Aßn Cye Tyr Zle Wing? ßn Val Val Ser Cys? La 130 135 140 Lys Cyß ßlu Aen? Rg Cyß Leu Zle Lyß? The Leu Thr Ble Phe Tyr? ßn 145 1S0 155 160 Hiß Aßp Ser Lye Cyß Val ßly Glu Val Met Ble Leu Leu Zle Lys Ser 165 170 175 ßln Aßp Val Tyr Lya Pro Pro? An Cyß ßln Lyß Ket Lye Thr Val? Ep 180 185 190 Lya Leu Cyß Pro Phe? La Cly Asn Cys Lyß ßly Leu? ßn Pro Zle Cye 195 200 205? In Tyr 210 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 6: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 210 amino acids (B) TYPE: nucleic acid (C) FORM OF THE CHAIN: simple (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: protein (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO 6 Ket? La? ßn? The Ser Tyr? ßn Val Trp Ser Pro Leu lie Ser? La s «r 1 5 10 15 Cyß Leu? ßp Lyß Lyß? Thr Tyr Leu He? ßp Pro? ßp? ßp Phe Zle 20 25 30? ßp Lyß Leu Thr Leu Thr Pro Tyr Thr Val Phe Tyr? ßn Gly ßly Val 35 40 45 Leu Val Lyß Zle Smr ßly Leu? rg Leu Tyr Ket Leu Leu Thr? Pro 50 55 60 Pro Thr Zle? ßn ßlu Zle Lyß? ßn Ser? ßn Phe Lyß Lyß? rg ser Lyß 65 70 75 80 Arg? ßn Zle cyß Ket Lyß ßlu Cyß? La ßlu ßiy Lyß Lyß? An Val Val? ßp Het Leu? ßn be Lyß Zle? ßn Mßt Pro Pro Cyß Zle Lyß Lyß Zle 100 105 110 Leu Gly? ßp Leu Lyß Glu? ßn ? ßn Val Pro? rg ßly ßly Het Tyr? rg 115 120 125 Lya? Rg Phe Zle Leu? ßn Cyß Tyr Zle? La? ßn Val Val Ser Cya? 130 135 140 Lyß Cyß Glu? ßn? Rg Cyß Leu Zle? ßn? Leu Thr Hiß Phe Tyr? ßn 145 150 155 160 Hiß? ßp Ser Lyß Cyß Val Gly Glu Val Het Hiß Leu Leu Zle Lyß Ser 165 170 175 Gln? ßp Val Tyr Lyß Pro Pro? ßn Cyß ßln Lyß Het Lyß? ßn Val? ßp SO 185 190 Lyß Leu Cyß Pro Phe? Gly? ßn Cyß Lyß Gly Leu? ßn Pro Zle Cyß 195 200 205? ßn Tyr (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 7 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 2793 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRITION OF THE SEQUENCE: SEC. FROM IDENT. NO: 7: GTCGACGCGC TTCTGCGTAT? ATTGC? C? C TAACATGTTG CCCTTTGAAC TTGACCTCGA 60 TTGTGTTAAT TTTTGGCTAT ????? GGTC? CCCTTTAAAA TTTCTTACAT AATCAAATTA 120 CC? ßTACAßT TATTCGGTTT GA? GC ???? T GACTATTCTC TGCTGGCTTÂ CACTGCTGTC 180 T? C? TCT? CT GCTGTA ?? TG CGGCC ?? T? T? TTOGCCGTG TTTCCT? CGC CACCTTACAG 240 CCACCATAIA GTßTAC ??? G TGTATATTGA AGCCCTTGCC GA ???? TGTC ACAACGTTAC 300 GGTCGTCA? G CtXAAACTOT TTGCGTATTC ?? CT ???? CT TATTGCGGTA ATATCACGGA 360 A? TTAATGCC GACATGTCTG TTGAGC ?? T? C ?? A ??? CT? GTGGCGAATT CGGC ?? TGTT 420 T? GAAAGCGC GGAGTGGTGT CCCATAC? G? CACGOTAACC GCCGCTAACT ACCTAGGCTT 480 G? TTG ??? Tß TTC ?? AGACC AGTTTG? C ?? TATC ?? CGTG CCCAATCTCA TTCCCAACAA 540 CCAGACGTTT G? TTTAGTCG TCGTGG ?? GC GTTTGCCGAT TATGCGTTGG TGTTTGGTCA 600 CTTGTACGAT CCGOCGCCCß TAATTCAAAT CGCGCCTßGC T? CGGTTTGG CGG ???? CTT 660 TG? CACGGTC GGCGCCCTGG CGCGGC? CCC CGTCCACCAT CCT ?? C? TTT GGCGCAGC ?? 720 TTTCGACGAC? CGGAGGC ?? ? CGTGATO? C GGAAATGCGT TTGTATAAAG AATTTAAAAT 780 TTTGGCCAAC ATGTCC ?? CG CGTTGCTC ?? ACAAC? GTTT GGACCC ?? C? C? CCG? C? 840 Tß ??? A? CT? CGCAACAAGG TGCAATTOCT TTTßCT ??? C CTOCATCCCA T? TTTGACAA 900 C? CCG? CCC GTGCCGCCC? GCGTGCAOTA TCTTGGCGGA GGAATCCATC TTGT ??? ß? ß 960 CGCGCCGTTG ACCAAATTAA GTCCGGTC? T C ?? CGCGC ?? ATGAACAAGT C ????? GCGG 1020 A? CG? TTTAC GT? GTTTrG GGTCGAGC? T TGAC? CCA ?? TCGTTTGCAA ACGAGTTTCT 1080 TTACATGTTA ATCAATACOT TC ???? CGTT GGAT ?? TTAC ACCATATTAT GG ???? TTG? 1140 CGACGAACTA GT ??? A ?? C? T ?? CGTTCCC CGCCAACOTA ATCACGCAAA ATTGGTTT ?? 1200 TC ?? CGCGCC GTGCTGCGTC ATAAAAAAAT GGCGGCGTTT AT? ACßCAA? GCGGACTACA 1260 ATCGAGCGAC GAGGCCTTGG A? ßCCGGGAT ACCC? TGGTG TGTCTGCCC? Tß? TGGßCG? 1320 CC? ßTTTT? C C? TGCGCAC? AATTACAGCA ACTCGGCGTA GCCCßCßCCT TGGAC? CTGT 1380 TACCGTTTCC AGCGATCAAC TACTAGTGGC OATAAACOAC GTOTTGTTTA ACGCGCCT? C 1440 CT? C ?????? CACATGGCCG? GTTAl? TGC GCTCATCAAT C? TG? T ??? G CAACOTTTCC 1500A ?? GCC? TCA AATTCACAGA ACGCGT? ATT CGATATAGAC? TGACATCAG 1560 TCGTCAATTG TATTCATT ?? A ?? C ?? C? GC TGCCAATGT? CCGTATTC ?? ATTACTACAT 1620 GTATAAATCT GTGTTTTCT? TTGTAATGAA TCACTTAACA CACTTTTAAT TACGTC ?? l? 1680 AATGTTATTC ACCATTATTT ACCTGGTTTT? TTCAG? GGS GCTTTGTGCG ACTGCGCACT 1740 TCCAGCCTTT AlAA? CGCTC ACC ?? CC ??? GCAGGTC? TT? TTGTGCCAG GACGTTCAAA 1800 GGCGAAACAT CßAAATGGAG TCTGTTC ??? CGCSCTTATG TGCCAGTAGC AATCAATTTG 1860 CTCCGTTC ?? A ?? GCGCC? Fi CTTGCCGTGC CGGTCGGTTC TGTGAAC? GT TTG? C? C? C? 1920 CCATCACCTC C? CCACCGTC ACCAGCGTGA TTCCA ????? TTATCAAGAA A ?? CGTCAG? 1980? A? T? TGCC? CATAAIATCT TCGTTGCGT? ACACGC? CT? GAATTTC? AT AAGATACAGT 2040 CTGTACAT ?? A? GAA? Ct? CGGCATTTGC AAAATTTGCt A? G ?????? G AACG ?? ATT? 2100 TTGCCG? GTT GGTT? G ???? CTTG ??? GTG CACAGAAGAA ß? C ?? CGC? C AGAAATAIT? 2160 GTAAACCAGC TCATTGCAAA TACTTTGS? G T? GTCAGAIG T? C? CACA ATTCGCACAA 2220 TTATTGGC ?? CG ???? ßTTT GTAAGG? G? C GTTTGßCCGA GCTGTGC? C? TTCTACAACG 2280 CCGAGT? CGT GTTTTGCC ?? GC? CGCGCCG ATGCACACM AGATCGACAG GC? CT? GCS? 2340 CtCTCCTGAC GGCGGCGTTT GGTTCGC3AG TCATAGTTT? TG ??? ATAGT CCCCGGTTCG 2400 AGTTT? T ??? TCCGGACGAG ATTGCTAGTG GT ??? CGTTT ?? T ?? TT ??? CATTTGCAAG 2460 ATG ?? TCTCA A? GTGAT? TT AACGCCTATT AATTTG ??? G GTGAGG ?? G? GCCCAATTGC 2520 GTTGAGCGC? TT? CCAT? T GCCAT? TATT TTAATAGATA CTGAGATCTG TTTAAATGTC 2580 AGATGCCGTT CTCCTTTTCC C ??? TTC ??? GTATTGATT? TTGTAGATG6 CTTTGATAGC 2640 GCTTATATTC ACßCTACCTT TTGTAGCATT AßCCAT? GTG TAACAATTGT TAACAAATCT 2700 A? C? TG? TG? TGT ?? CGTT TGACGGGTTT GTAAGGCCGG? CGATG ?? GG TACAACAATG 2760 CCTTATGTC TTGGACCATT ATATTCTGTC G? C 2793 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 8 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 341 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 8: TGAGACGCAC ??? CTAATAT CACAAACTGG AAATGTCAT CAATATATAß TTGCTGATAT 60 CATGG? G? T? ATTAAA? TG? TAACCATCTC GC ??? T ??? T AAGTATTTTA CTGTTTTCGT 120 A? C? GTTTT? TAATAAAAAA ACCTAT ??? T ATGCCGGATT ATTCATACCG TCCCACCATC 180 GGCCGT? CCT? CGTGTACG? C ?? CAAGTAC TAC ????? TT TAGGTGCCGT T? TCAAG ?? C 240 GCTAAGCGCA AGA? CC? CTT CßCCGAACAT G? G? TCß ?? G AGGCT? CCCT CGACCCCCT? 300 GAC ?? CT? CC T? GTGGCTG? Gß? TCCTTTC CTGGGACCCG G 341 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 9 (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 9: Tß ??? CGCAC A ?? CTAAT? T T? C? C? CT ?? A ?? TGTCT? T CATTTCGGCT TAATATATAG_60_TTOCTß? T? T TATGT ??? T? ATTAAAATGA TAACCATCTC GC ??? T ??? T A? ßTATTTTA 120 CTGTTTTCGT AAC? ßTTTTß T ?? T ?? AA ?? ACCTAT ??? T ATGCCGGATT? TTCATACCß 180 TCCCACCATC GGGCGTACCT ACGTOTACGA C? CAAAT? T T? C ????? TT T? GGTGCCGT 240 T? TC ?? ß ?? C GCT ?? GCGC? ACAAGCACTT CGCCGAACAT G? GATCß ?? ß AGßCTACCCT 300 CG? CCCCCT? G? C ?? CTACC TAGTGGCTGA GGATCC? TTC CTGGGACCCG G 351 (2) INFORMATION FOR IDENTIFICATION SEQUENCE NO: 10: (i) CHARACTERISTICS OF THE SEQUENCE: (A) LENGTH: 351 base pairs (B) TYPE: nucleic acid (C) CHAIN FORM: double (D) TOPOLOGY: linear (ii) TYPE OF MOLECULE: DNA (genomic) (iii) HYPOTHETICAL: NO (xi) DESCRIPTION OF THE SEQUENCE: SEC. FROM IDENT. NO: 10: TG ??? CGC? C A ?? CT ?? T? T T? C? CACTA? ????? TCTAT CATTTCGGCT TAATATATAG_60_TTGCTß? T? T TATGTAAATA? TT ???? TG? TAACCATCTC GCA? AT ??? T A? GT? TTTT? 120 CTGTTTTCGT AACAßTTTTG rAAT ?????? ACCTATAAAT ATGCCGß? TT ATTCATACCG 180 TCCGACCATC GGGCGTACCT? CGTGTACGA CAACAAATAT T? C ????? CT TGGGTTCTGT 240 TATT ??? AAC GCC ?? GCGC? AGAAGCACCT AATCCAACAT G ?? GAAG? Gß AGAAGKACTT 300 GCATCCCTTA GACAATTACA TGGTTGCCNIf AG? TCCTTTT CTAGGACCTG G 351 It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention. Having described the invention as above, property is claimed as contained in the following:

Claims (29)

1. An isolated DNA molecule characterized in that it comprises a nucleotide sequence as given in Figure 4 from nucleotide 3002 to 4231, the sequence of V-8 (nucleotides 534 to 1763 in SEQ ID NO: 3), that the nucleotide sequence confers improved destruction properties for at least one insect pest when the nucleotide sequence is incorporated into an insect virus genome.

2. The isolated DNA molecule according to claim 1, characterized in that it comprises the nucleotide sequence as given in Figure 4 from nucleotide 2469 to 4231 (SEQ ID NO: 3).

3. An insect virus with improved destruction properties for at least one insect pest, the insect virus is characterized in that it is engineered to contain the nucleotide sequence of claim 1.

4. The insect virus according to claim 3, characterized in that it is a baculovirus.

5. The insect virus according to claim 4, characterized in that it is a virus of nuclear polyhedrosis or a virus of granulosis.

6. The insect virus according to claim 5, characterized in that the baculovirus is a virus of nuclear polyhedrosis.

7. The insect virus according to claim 6, characterized in that the baculovirus is the Nuclear Polyhedrosis Virus of Autographa californica, which has been engineered to contain the sequence.

8. The insect virus according to claim 7, characterized in that the baculovirus engineered is one of vEcoRIHybl and vEcoRIHybIFS.

9. The insect virus according to claim 1, characterized in that it has been further engineered to inactivate a gene encoding the ecdysteroid glucosyltransferase.

10. The baculovirus according to claim 9, characterized in that the gene of the ecdysteroid glucosyltransferase has been inactivated by eliminating at least a portion thereof.

11. An isolated and purified recombinant baculovirus characterized in that it has incorporated within its genome a segment of the DNA of insect viruses, heterologous that confers improved destruction properties, which recombinant baculovirus effects the destruction, faster for at least one insect pest when it is compared to an isogenic parent baculovirus that lacks the DNA segment.

12. The recombinant baculovirus purified and isolated according to claim 11, characterized in that it is a nuclear polyhedrosis virus of Autographa californica.

13. The recombinant baculovirus according to claim 12, characterized in that the improved destruction properties are reflected in a lower TL5Q value than is observed for the Nuclear Polyhedrosis Virus of Autographa californica, father.

14. The recombinant baculovirus according to claim 13, characterized in that the DNA segment is derived from the Nuclear Polyhedrosis Virus of Rachiplusia ou or the Nuclear Polyhedrosis Virus of V1000.

15. The recombinant baculovirus according to claim 14, characterized in that the DNA segment comprises a nucleotide sequence as given in Figure 4 from nucleotide 3002 to nucleotide 4231 (nucleotides 523 to 1763 in SEQ ID NO: 3) ).

16. The recombinant baculovirus according to claim 14, characterized in that the DNA segment comprises a nucleotide sequence as given in Figure 4 from nucleotide 2469 to 4231.

17. The baculovirus according to claim 16, characterized in that it is the AcMNPV V-8.

18. The baculovirus according to claim 11, characterized in that it has been further improved as an agent for the control of insects by the inactivation of a gene coding for the ecdysteroid glucosyltransferase.

19. The baculovirus according to claim 18, characterized in that the baculovirus in which the gene coding for the ecdysteroid glucosyltransferase has been inactivated, is the AcMNPV V-8.

20. An insecticide composition characterized in that it comprises an effective amount of the baculovirus according to claim 11 and a suitable carrier.

21. The insecticidal composition of. according to claim 20, characterized in that the improved destruction properties of the baculovirus are determined in a shorter time between the infection of the newly born larvae of the insect pest and the time when half of the infected larvae die, than the one that It is observed for the comparison of the Nuclear Polyhedrosis Virus of Au tographa cali forni ca.

22. The insecticidal composition according to claim 21, characterized in that the baculovirus is at least one of AcMNPV V-8 and VdvEGTDEL.

23. The insecticidal composition according to claim 22, characterized in that the baculovirus is AcMNPV V-8, which has been engineered to inactivate a gene coding for the ecdysteroid glucosyltransferase.

24. A powdered, wettable insecticidal composition characterized in that it comprises: 10% by weight of polyhedrin inclusion bodies of VdvEGTDEL; 0.45% (w / w) of a pH dependent coating agent, methacrylic methacrylate methyl; 2.5% (w / w) of oxybenzone UV-9; 0.10% (w / w) of polyethylene glycol of molecular weight 400, 39.1% (w / w) of the agent for the agglutination or adhesiveness based on starch; 4.90% (w / w) of lignin sulfonate; 19.45% (w / w) sugar; 19.60% (w / w) of wetting agent; and 3.90% (w / w) by weight of agent for clay-based flow.

25. A method for preparing the insecticidal composition according to claim 24, the method is characterized in that it comprises the steps of: a) VdvEGTDEL polyhedrin inclusion bodies ground in an air mill to a size less than 10 μm; b) coating the ground polyhedrin inclusion bodies in the air mill of step (a) with an organic solution comprising a pH dependent coating agent, oxybenzone and polyethylene glycol of molecular weight 400 to produce the coated particles; c) mixing the binder based on starch, the lignin sulphonate, the sugar, the wetting agent, and the agent for the clay-based flow to prepare a pre-mix; d) mixing together the coated particles of step (b) and the pre-mix of step (c) whereby a powdered, wettable insecticidal composition is produced.

26. The powdered, wettable insecticidal composition characterized in that it comprises. 10% p weight of VDVEGTDEL polyhedrin inclusion bodies; 2.0% (w / w) of the pH-dependent coating agent of methacrylic methacrylate methyl; 5.0% (w / w) of UV-9 oxybenzone or charcoal; 0.10% (w / w) of polyethylene glycol of molecular weight 400; 20% (w / w) of the wetting agent and 16% (w / w) of the agent to give volume of kaolin clay; 0.9% citric acid; 30.0% (w / w) of the dispersant and 16.0% (w / w) of the agent for the clay-based flow.

27. The insecticidal composition according to claim 26, further characterized in that it comprises a stilbene brightener at a final concentration of about 5% (w / w).

28. The method for preparing the insecticidal composition according to claim 26, the method is characterized in that it comprises the steps of: a) preparing an aqueous suspension of Eudragit S100 (1% w / v); b) dissolving the Eudragit S100 by increasing the pH of the suspension of step (a) from 9.0 to 9.5; c) add the viral PIB and UV-9 oxybenzone or vegetable charcoal to the solution of step (b) and mix to produce a uniform suspension; d) air drying the uniform suspension of step (c); 'e) milling the dry material from stage (d) to produce the ground material; and f) dry mix the ground material of the stage (e) with the wetting agent Morwet D425, Morewet EFW, Clay Kaolin as a bulking agent, Microcel E as a flow agent, citric acid and polyethylene glycol MW400 to provide flexibility to the ground material.

29. The method according to claim 28, characterized in that a stilbene brightener is added in step (c > In testimony of which I sign this in this City of Mexico, D.F., on January 15, 1996. By: AMERICAN CYANAMID COMPANY and FCUNDATICN, INC. Representative SUMMARY OF THE INVENTION Insect viruses capable of destroying at least one target insect pest are provided faster than the previously described viruses and the DNA sequence that confers that faster destruction phenotype. Another improvement in the dissemination of the destruction is obtained when the virus of this invention also contains a non-functional egt gene to reduce feeding by the infected larvae, inhibit the growth and further mediate the early death of the infected insect. A faster destruction insect virus, specifically exemplified is the V-d strain of AcMNPV. The faster destruction phenotype is carried in a Mlul to EspI fragment of 1.93 to 3.27 map units within the AcMNPV genome and their sequences are provided herein as SEC. FROM IDENT. NO: 3. VdvEGTDEL is the inactivated derivative in egt of AcMNPV V-8; the combination of increased virulence of the V-8 genotype, for example, and inactivation of the gene encoding the ecdysteroid glycosyltransferase provides another improvement (such as further decrease in time after infection until death of the insect). Additionally, such baculovirus deficient in EGT can still be modified to express a protein which affects ecdysis. Methods for producing the insect virus for faster destruction, improved insecticidal compositions and improved methods for controlling insects are also included within the scope of this invention.