MXPA06011735A - Process for preparing dipeptidyl iv inhibitors and intermediates therefor - Google Patents

Abstract

A process for production of cyclopropyl-fused pyrrolidine-based inhibitors of dipeptidyl peptidase IV is provided which employs a BOC-protected amine of the structure (3) prepared by subjecting an acid of the structure (1) to reduce amination by treating the acid with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and partially purified phenylalanine dehydrogenase/formate dehydrogenase enzyme concentrate (PDH/FDH) and without isolating treating the resulting amine of the structure (2) with di-tert-butyl dicarbonate to form the BOC-protected amine.

Description

PROCESS FOR THE PREPARATION OF DIPEPTIPIL PEPTIDASE IV INHIBITORS AND INTERMEDIARIES FOR THEM FIELD OF THE INVENTION The present invention relates to a process for the preparation of acid (aS) -a- [[(1,1-dimethylethoxy) carbonyl] -amino] -3-hydroxytricyclo [3.3.1.137] decane-1 acetic which is used as an intermediate for the preparation of pyrrolidine-based inhibitors fused to cyclopropyl dipeptidyl peptidase IV which are used in the treatment of diabetes and complications thereof, hyperglycemia, Syndrome X, hyperinsulinemia, obesity, and atherosclerosis and related diseases, as well as immunomodulatory diseases and inflammatory bowel disease. BACKGROUND OF THE INVENTION Dipeptidyl peptidase IV is a non-classical serine aminopeptidase linked to the membrane, which is located in a variety of tissues including but not limited to the intestine, liver, lung and kidney. This enzyme is also located in the circulating T lymphocytes where it is referred to as CD-26. Dipeptidyl peptidase IV is responsible for the metabolic cleavage of endogenous GLP-K7-36 peptides and glucagons in vivo, and has demonstrated a proteolytic activity against other peptides such as GHRH, NPY, GLP-2 and VIP in vitro.

Ref. No. : 176319 GLP-I (7-36) is a 29 amino acid peptide derived from the post-translational processing of proglucagon in the small intestine. This peptide has multiple actions in vivo. For example, GLP-I (7-36) stimulates insulin secretion and inhibits glucagon secretion. This peptide promotes satiety, and delays gastric emptying. The exogenous administration of GLP-I (7-36) by means of continuous infusion has been shown to be effective in diabetic patients. However, the exogenous peptide degrades very rapidly for continuous therapeutic use. Inhibitors of dipeptidyl peptidase IV have been developed to potentiate the endogenous levels of GLP-1 (7,36). U.S. Patent No. 6,395,767 to Hamann et al. describes inhibitors based on pyrrolidine fused to cyclopropyl dipeptidyl peptidase IV.

Methods for chemically synthesizing these inhibitors are described in US Patent No. 6,395,767 as well as in the literature. For example, see • Sagnard et al. Tet-Lett. 1995 36: 3148-3152; Tverezovsky et al. Tetrahedron 1997 53: 14773-14792; and Hanessian et al. Bioorg. Med. Chem. Lett. 1998 8: 2123-2188. A preferred inhibitor described in US Patent No. 6,395,767 is (SS, 3S, 5S) -2- [(2S) -2-amino-2 - (3-hydroxy tricyclo [3.3. 1. I3'7] dec -1-yl) -1-oxoethyl] -2- azabicyclo [3.1.0] hexane-3-carbonitrile, as described in Formula M and the corresponding monohydrate of (SS, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxy-tricyclo [3.3.1. I3'7] dec-1-yl) -1- oxoethyl] -2-azabicyclo- [3.1.0] hexane-3-carbonitrile (M "). Methods adapted to prepare intermediates used in the production of this dipeptidyl peptidase IV inhibitor are described in EP 0 808 824 A2. See also, Imashiro and Kuroda Tetrahedron Letters 2001 42: 1313-1315, Reetz et al. Chem. Int. Ed. Engl. 1979 18:72, Reetz and Heimbach Chem. Ber. 1983 116: 3702-3707, Reetz et al. Chem. Ber. 1983 116: 3708-3724. The present invention provides novel production methods and compounds for use in the production of pyrrolidine-based inhibitors fused to cyclopropyl dipeptidyl peptidase IV. U.S. Patent No. 6,395,767 for Hamann et al. describes processes for the synthesis of (aS) -a- [[(1,1-dimethylethoxy) carbonyl] -amino] -3-hydroxytricyclo [3.3.1. I3'7] decane-1-acetic, an intermediate to be used in the preparation of the free base M 'or a salt thereof, which involves an eight-step synthesis from adamantane carboxylic acid. The EUA application No. of Series 10 / 716,012 filed on November 18, 2003 (file of attorney-in-fact LA84 NP) describes a method for preparing acid (aS) -a- [[(1, 1-dimethylethoxy) ca bonyl] -amino] -3-hydroxycyclo [3.3.1.l3'7] decane-1-acetic acid using 3-hydroxy-a-oxotricyclo [3.3.1.l3'7] ~ dean -l-acetic acid as the starting material and wherein an enzymatic reductive amination is used to prepare and isolate the acid (OCS) -OC-amino-3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic which becomes to the desired product in a separate step. The enzymatic reduction amination step involves the use of various forms of the phenylalanine dehydrogenase enzyme (PDH) in combination with the formate dehydrogenase enzyme (FDH) in the presence of ammonium formate, DTT and NAD using ammonium hydroxide to adjust the pH . Where excess ammonium ions are present, it may be necessary to remove the ammonia before further processing downstream to avoid possible interference with the introduction of a BOC group.

The cells from which the PDH and / or FDH enzymes are produced are isolated from fermentation broths, stored until they are ready for use. Before use, the cells are microfluidised to release the enzyme from the cells along with cellular debris that must be removed before the enzymes are ready for use in reductive amination. BRIEF DESCRIPTION OF THE INVENTION In accordance with the present invention, there is provided a process for preparing partially purified phenylalanine dehydrogenase concentrates and / or formate dehydrogenase enzyme (PDH / FDH) which includes the steps of: a. preparing a fermentation broth of a microorganism capable of producing phenylalanine dehydrogenase and / or formate dehydrogenase; b. subjecting the broth to microfluidization to release the activity of the resulting cells and form a microfluidized broth having PDH and / or FDH activity; c. clarify the broth by treating the broth with a flocculating agent to coagulate cell debris and remove DNA and unwanted proteins; d. filter the clarified broth; and e. concentrate the broth to give a partially purified enzyme concentrate having a PDH / FDH activity of at least about 400 IU / ml for PDH and at least about 20 IU / ml for FDH.

In addition, in accordance with the present invention, a process for preparing an amine of the structure is provided Formula 2 that includes the stages of a. treat an aqueous solution of a keto acid from the structure Formula 1 with a maximum of about 2 molar equivalents of ammonium formate, adenine dinucleotide nicotinamide, dithiothreitol and phenylalanine dehydrogenase / partially purified formate dehydrogenase enzyme (PDH / PDH); and b maintaining the pH of the reaction at from about 7.0 to about 8.6, preferably at 8.0 +/- 0.2 with sodium hydroxide to form the desired amine that is substantially free of undesirable excess ammonium ions. Still further in accordance with the present invention, there is provided a process for preparing an amine protected by BOC from the structure Formula 3 which includes the stages of a. provide an aqueous solution of the amino acid of (aS) -a-amino-3-hydroxytricyclo [3.3. l.l3,7] decane-l-acetic structure Formula 2 (prepared using partially purified phenylalanine dehydrogenase / formate dehydrogenase enzymes in the reduction of reductive amination of keto acid 1 Formula 1 described above); and b. treating the aqueous solution with di-tert-butyl bicarbonate to form the amine protected by BOC. In another embodiment of the present invention, a process for preparing the BOC-protected amine of structure 3 is provided.

Formula 3 which includes the stages of a. prepare partially purified phenylamine dehydrogenase / formate dehydrogenase (PDH / FDH) enzymes (as described above); b treating an aqueous solution of a keto acid of structure 1 Formula 1 with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and partially purified phenylalanine dehydrogenase / formate dehydrogenase enzymes (PDH / FDH); c. maintaining the pH of the reaction mixture from about 7.0 to about 8.6, preferably at 8.0 +/- 0.2 with sodium hydroxide and forming the desired amine Formula 2 which is substantially free of undesirable excess ammonium ions; and d. without isolating the amino acid intermediate 2, treat the above aqueous solution with di-tert-butyl bicarbonate to form the BOC-protected amine of structure 3. The process of the invention provides significantly improved processing procedures by using partially purified enzymes and employing sodium hydroxide to adjust the pH to the contrary of ammonium hydroxide, reducing processing times and allowing the crystalline product to isolate without requiring intermediate isolate. further, the process of the invention provides for the preparation of partially purified PDH / FDH enzymes employing the reaction conditions that allow a minimum amount of ammonium ions to be present for downstream processing which will interfere with the introduction of a BOC group . On the other hand, the use of PDH / FDH enzyme concentrate partially purified in the amine? Reductive of the acid of Formula 1, allows the elimination of the requirement of a resin column isolate of the aforementioned amino acid intermediate of Formula 2 after the bioconversion reaction. The reaction stream will be suffi- ciently clean (free of cellular debris and having reduced protein level) to continue directly with the BOC reaction, and extraction and crystallization of the BOC-protected intermediate resulted. .

In a preferred embodiment, the compound protected by BOC 3 is used as an intermediate in the process of the invention for the production of the inhibitor of dipeptidyl peptidase IV. (1S, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxy-cyclo [3.3.1.] 3.7] dec-1-yl) -1-oxoethyl] -2-azabicyclo [ 3.1.0] hexane-3-carbonitrile, benzoate (1: 1) as described in Formula M PhCOOH or its free base M ' and monohydrate M "thereof These inhibitors are finally formed from the coupling of two fragments, (aS) -a-amino-3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic acid protected by BOC as described in Formula 3, (prepared using the partially purified PDH / FDH enzyme prepared according to the present invention) and acid salt (SS, 3S, 5S) -2-azabicyclo [3.1.0] hexane-3-carboxamide such as hydrochloride salt or salt of methanesulfonic acid (mesyl salt or MSA). as described in Formula J The pyrrolidine-based compounds fused to cyclopropyl such as (1S, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxytricyclo [3.3.1.13'7] dec-1-yl) -1 -oxoethyl] -2- azabicyclo [3.1.0] hexane-3-carbonitrile ', benzoate (1: 1) and its corresponding free bases and monohydrate thereof are inhibitors of dipeptidyl peptidase IV useful in the treatment of diabetes and complications- of the same, hyperglycemia, syndrome X, hyperinsulinemia, obesity, and atherosclerosis and related diseases, as well as unodulatory diseases and inflammatory bowel disease. In the present invention, compounds protected by BOC (prepared by means of a reductive amination process employing partially purified PDH / PDH enzymes in accordance with the present invention) are employed for use in the production of pyrrolidine-based compounds fused to cyclopropyl such as (1S, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxy-cyclo [3.3.1.13'7] dec-1-yl) -1-oxoethyl] -2-azabicyclo [3.1 .0] hexane-3-carbonitrile, benzoate (1: 1) and their corresponding free bases and monohydrate thereof. DETAILED DESCRIPTION OF THE INVENTION In order to carry out the preparation of partially purified PDH / FDH enzyme concentrate of the invention, a microorganism expressing the PDH and / or FDH activity is fermented. The fermentation broth is passed through a microfluidizer operating under a pressure in the range of from about 8000 to about 30,000 psi, (562.4 to 2109 Kg / cm2) preferably from about 12,000 to about 20,000 psi (843.6 to 1406 Kg). / cm 2) while maintaining the broth at a temperature within the range of from about 4 ° C to 30 ° C, preferably from about 8 ° C to about 15 ° C, more preferably below 40 ° C. The whole broth is clarified by preferably adding a filtration aid to the broth such as diatomaceous earth (for example Dicalite® trademark of Grefco Minerals, Inc., and Celite® trademark registered World Minerals, Inc.) and a flocculating agent such as aqueous polyethyleneimine or other flocculating agent such as heat, to remove DNA and other higher molecular proteins. The mixture is then filtered using a pressure filter and the filtrate recovered. The filter cake is washed with water and the water is recovered and added to the complete filtrate which is referred to as the clarified broth.

The clarified broth is ultrafiltrated through a membrane of 100,000 COPM (molecular weight cut) to remove impurities of low molecular weight (below 100,000). The clarified filtrate is concentrated to provide an enzyme concentrate with a PDH titration from about 400 to about 1000 IU / ml, preferably from about 500 to about 600 IU / ml, and a FDH titration from about 20 to about 200 IU / ml, preferably from about 75 to about 150 IU / ml. The recovery of the global activity of enzymes in the concentrate will be within the range from around 65 to around 95%, preferably from about 75 to about 90%. The term "partially purified" PDH / FDH enzymes as used herein, refers to PDH / FDH enzymes where at least a portion of DNA and other high molecular weight proteins and low molecular weight impurities have been removed. In carrying out the reductive amination of 3-hydroxy-a-oxotricyclo [3.3.1.l3,7] decane-1-acetic acid (acid of Formula 1), an aqueous mixture of the acid of Formula 1 is prepared and the mixture is adjusted to a pH in the range of from about 7.0 to about 8.6, preferably from about 7.8 to about 8.2 with a strong alkali metal base such as alkali metal hydroxide, preferably NaOH, to form a solution of the Formula 1 acid. Carbon can be added (eg, Darco KB) and the mixture is filtered and the filtrate and the washings combined to give a clear solution. Ammonium formate is added to the solution in an amount to provide a molar ratio of ammonium formate: acid of Formula 1 within the range of from about 1.9: 1 to about 2.5: 1, preferably about 2: 1. The pH of the resulting mixture is adjusted to be in the range of from about 7.0 to about 8.6, preferably from about 7.8 to about 8.2, using a strong alkali metal base, such as alkali metal hydroxide, preferably NaOH. The nicotinamide adenine dinucleotide (NAD) and, optionally, a reducing agent such as dithiothreitol or beta-mercaptoethanol, preferably dithiothreitol, are added using a molar ratio of NAD: acid of Formula 1 within the range of from about 500: 1 up to about 1500: 1, preferably from about 900: 1 to about 1200: 1. After the solids are dissolved, the partially purified PDH / FDH enzyme concentrate (from about 400 to about 600 IU PDH / gram of Formula 1) is added. The pH is adjusted to be within the range of from about 7.0 to about 8.6, preferably from about 7.7 to about 8.2 with a strong base such as NaOH. The mixture is warmed to a temperature in the range of from about 25 to 45 ° C, preferably from about 37 to about 40 ° C and diluted with water and the pH is maintained with an alkali metal base as described above , preferably NaOH, at a pH in the range of from about 7.0 to about 8.6, preferably from about 7.8 to about 8.2 during a period to effect the reductive dressing of the acid of Formula 1 to form the acid (aS) - α-3-hydroxy-cyclo [3.3.1.13'7] decane-1-acetic (amine of Formula 2). The BOC protection of the amine of Formula 2 is carried out without isolating the amine of Formula 2, since amine 2 will be free of cellular debris. The di-tert-butyl carbonate is added to at least a portion of the solution of the amine of Formula 2 using a molar ratio of di-tert-butyl bicarbonate: amine of Formula 2 within the range of about 2. : 1 to about 2.5: 1, preferably from about 2.0: 1 to about 2.2: 1. The pH of the reaction mixture is adjusted to within the range from about 8.5 to about 12.5, preferably from about 9.5 to about 10.5 using a strong base such as NaOH as described above. The resulting BOC-protected compound (Formula 3) is extracted and recovered and crystallized to form the amine of Formula 3 protected by BOC. As noted above, in one aspect of the present invention, the processes are provided for the production of the (aS) -a-amino-3-hydroxytricyclo [3.3.1.l3'7] decane-1-acetic acid fragment ( Formula 2) by reductive amination of the intermediate compound of 3-hydroxy-a-oxotricyclo [3.3.1.13'7] decane-1-acetic acid (Formula 1). In a preferred embodiment of this method, 3-hydroxy-a-oxotricyclo [3.3.1. 13,7] decane-1-acetic acid (Formula 1) is converted to (aS) -a-amino-3-hydroxycyclo acid [3.3.1.13'7] decane-1-acetic (Formula 2) by reductive amination performed enzymatically using the partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme concentrate of the invention as described above. Exemplary phenylalanine dehydrogenase useful in the present invention includes, but is not limited to, those of the species Sporosarcin or a phenylalanine dehydrogenase of the species Thermoactinomyces such as Thermoactinomyces intermedius. It is preferred that the reductive amination be carried out with the phenylalanine dehydrogenase of Thermoactinomyces intermedius, ATCC 33205, expressed in Escherichia. coli or Pichia pastoris. The construction and growth of recombinant strains of E. coli and Pichia pastoris that express phenylalanine dehydrogenase Thermoactinomyces intermedius, ATCC 33205, has been described by Hanson et al. (Enzyme and Microbial Technology 2000 26: 348-358). Growth of Pichia pastoris in methanol also induces formate dehydrogenase production (Hanson et al., Enzyme and Microbial Technology 2000 26: 348-358). E. coli cells containing a plasmid expressing the formate dehydrogenase from Pichia pastoris (ATCC 20864) and a modified version of the phenylalanine dehydrogenase gene Thermoactinomyces intermedius (ATCC 33205) were deposited and accepted by a Depositary Authority International under the conditions of the Budapest Treaty.

The deposit is made on June 25, 2002 to the American Type Culture Collection at 10801 University Boulevard in Manassas, Virginia 20110-2209. The ATCC access number is PTA-4520. All restrictions on public access to this cell line will be irrevocably eliminated once this patent application is granted. The Deposit will be held in a depository for a period of thirty years after the date of deposit or five years after the last request for a sample or during the life of the patent, whichever is longer. The above-referenced cell line was viable at the time of deposit. The deposit will be replaced if viable samples can not be delivered by the depository. More preferred is phenylalanine hydrogenase from Escherichia coli JM110 which contains the plasmid pBMS-2000-PPFDH-PDH mod. expressed in the formate dehydrogenase of Pichia pastoris (ATCC 20864) and a modified version of the phenylalanine dehydrogenase from Thermoactinomyces intermedius (ATCC 33205). Reductive amination of 3-hydroxy-oxo-cyclo [3.3.1.l3'7] decane-1-acetic acid (Formula 1) to (aS) -a-amino-3-hydroxytricyclo [3.3.1.l3'7] ] decane-1-acetic acid (Formula 2) is described in the following Reaction Scheme I: REACTION SCHEME I Coo is shown in Reaction Scheme I, this reaction requires ammonia and reduced nicotinamide adenine dinucleotide CNADH). The nicotinamide adenine dinucleotide (NAD) produced during the reaction is recycled to NADH by the oxidation of formate to carbon dioxide by formate dehydrogenase. The expected yield of (aS) -a-amino-3-hydroxytricyclo [3.3.1. I3'7] decane-1- • acetic (Formula 2) of this reaction is 80 to 100% and the expected enantiomeric excess is greater than 99%. Also see Examples 1 through 7 herein. The intermediate compound 3-hydroxy-a-oxotricyclo [3.3.1.1.37] decane-1-acetic acid (Formula 1) can be produced according to the method detailed in Reaction Scheme II: REACTION SCHEME II NteOtVAcCt B As shown in Reaction Scheme II, in this method, adamantyl bromide (Formula A) is alkylated by means of zinc chloride catalysis to produce a-hydroxythi acid [3.3.1.1.37] decane-1-acetic acid. (Formula B) The α-hydroxytricyclo [3.3.1.1.37] decane-1-acetic acid (Formula B) is then esterified using acetyl chloride in methanol to produce methyl ester of a-hydroxytricyclo [3.3.1.1.37] decane-1. -acetic (Formula C). The methyl ester of a-hydroxy tricyclo [3.3.1.1.37] decane-1-acetic acid (Formula C) was then converted to the methyl ester of a-oxotricyclo [3.3.1.1.37] decane-1-acetic acid (Formula D) by Swern oxidation. The methyl ester of a-oxotricyclo [3.3.1.1, 37] decane-1-acetic acid (Formula D) is then hydroxylated to form the methyl ester of 3-hydroxy-a-oxotricyclo [3.3.1.1.37] decane-1-acetic (Formula la), which is then hydrolyzed to form 3-hydroxy-a-oxotricyclo [3.3.1.1.37] decane-1-acetic acid (Formula 1). Alternatively, the intermediate compound of 3-hydroxy-a-oxotricyclo [3.3.1.137] decane-1-acetic acid (Formula 1) can be produced according to the method detailed in Reaction Scheme III.

REACTION SCHEME III NaOH (1.38 «j> CHsOH / HjO, TA As shown in Reaction Scheme III, (2,2-dichloro-1-methoxy-vinyloxy) -trimethysilane lb was prepared by a minor modification of the method of Kuroda et al. (EP 08 08 824A3; Imashiro and Kuroda Tetrahedron Letters 2001 42: 1313-1315). The treatment of bromoadamantane with lb under the influence of zinc chloride (Reetz et al., Chem. Int. Ed. Engl. 1979 18:72, Reetz and Hei bach Chem. Ber. 1983 116: 3702-3707, Reetz et al. Chem. Ber. 1983 116: 3708-3724) provides the methyl ester of adamantan-1-yl-dichloroacetic acid of Formula VII. The methyl ester of adamantan-1-yl-dichloroacetic acid of Formula VII is then hydroxylated with nitric oxide in concentrated sulfuric acid to provide a quantitative yield of methyl ester of dichloro- (3-hydroxy-adamantan-1) acid. -yl) - acetic of Formula VIII. Hydrolysis of Formula VIII with aqueous sodium hydroxide in methanol at room temperature affords the dichloro- (3-hydroxy-adamantan-1-yl) -acetic acid of Formula IX. The subsequent treatment of dichloro- (3-hydroxy-adamantan-1-yl) -acetic acid (Formula IX) with a weak base, preferably sodium bicarbonate, at elevated temperature results in the exclusive formation of the intermediate compound of 3-hydroxy acid. -a-oxotricyclo [3.3.1.l3,7] decane-l-acetic (Formula 1). REACTION SCHEME II A I (crude) As shown in reaction scheme IIIA, the intermediate compound of 3-hydroxy-< α-Oxotricyclo [3.3.1.1.3 '7] decane-1-acetic (Formula I) can be prepared in a batch process. As noted, treatment of the compound of Formula VIII with aqueous sodium hydroxide in tetrahydrofuran (or other base such as potassium hydroxide or lithium hydroxide) in an inert atmosphere such as argon, provides the corresponding sodium salt. Without recovering the sodium salt, the reaction mixture containing sodium salt is treated with an acid such as hydrochloric acid at a lower pH to less than about 0.50, preferably about 0.20, to form the corresponding acid keto II, which can be recrystallized from water to form crystals of acid keto I.

The fragment (SS, 3S, 5S) -2-azabicyclo [3.1.0] hexane-3-carboxamide (Formula J) used in the production of (1S, 3S, 5S) -2- [(2S) -2 -amino-2- (3-hydroxytricyl [3.3.1. I3'7] dec-l-yl) -1-oxoethyl] -2-azabicyclo [3.1.0] hexane-3-carbonitrile can be produced in accordance with detailed method in Scheme IV shown below.

REACTION SCHEME IV As shown in reaction scheme IV, L-pyroglutamic acid (Formula E) is first esterified to produce the ethyl ester of L-pyroglutamic acid (Formula F, SQ 7539). This ethyl ester of L-pyroglutamic acid is then protected by BOC in the nitrogen to produce the ester of 1- (1,1-dimethylethyl), 5-ethyl ester of (5S) -2-oxopyrrolidine-1,5-dicarboxylic acid (Formula G) The reduction of the superhydride and the removal is then carried out to form the 1- (1,1-dimethylethyl), 5-ethyl ester of 4,5-dihydro-lH-pyrrole-1,5-dicarboxylic acid (Formula G ') . The BOC-DHPEE III is then hydrolyzed by saponification with lithium hydroxide to form BOC-DHP. An amide is then formed in BOC-DHP by means of an anhydride mixture using mesyl chloride followed by ammonia to produce the ester of 1- (1, 1-dimethylethyl) of (5S) -5-aminocarbonyl-4,5-dihydro-lH-pyrrole-l-carboxylic acid (Formula G "). The ester (1-, 1-dimethylethyl) of (5S) acid Aminocarbonyl-4,5-dihydro-lH-pyrrole-l-carboxylic acid (Formula G ") is then processed by cyclopropane by means of the Simmons-Smith reaction to produce the 1,1-dimethylethyl ester of the acid [ ÍS- (la, 3β, 5β] -3-aminocarbonyl) -2-azabicyclo [3.1.0] hexane-2-carboxylic acid (Formula H) The BOC is then removed resulting in the formation of an acid salt such such as the hydrochloride salt or the methanesulfonic acid salt of the fragment (SS, 3S, 5S) -2-azabicyclo [3.1.0] hexane-3-carboxamide (Formula J) As shown in Reaction Scheme IV, the transformation of the ester of 1- (1,1-dimethylethyl) of (5S) -5-aminocarbonyl-4,5-dihydro-lH-pyrrole-l-carboxylic acid (Formula G ") to the 1,1-dimethylethyl ester of [1S- (la, 3ß, 5a] -3-aminocarbonyl) -2-azabicyclo [3.1.0] hexane-2-carboxylic acid (Formula to H) is carried out by cyclopropanation in a Simmons-Smith reaction. In this reaction, the (5S) -5-aminocarbonyl-4,5-dihydro-1H-pyrrole-1-carboxylic acid 1- (1,1-dimethylethyl) ester was dissolved in methylene chloride in a first reactor. In a second reactor, the methylene chloride was cooled to -30 ° C and the dimethoxy ethane and a 30% solution of zinc diethyl in toluene are added followed by the addition of diiodomethane. This mixture is then added to the first reactor followed by the addition of the saturated bicarbonate solution. The resulting reaction mixture is stirred until a precipitate forms. The precipitate is then filtered, washed and resuspended in methylene chloride two or more times. The filtrates are then separated in aqueous or organic phase, and the organic phase is washed with half saturated brine. The solvent is removed and exchanged for heptane to obtain a thick mixture of the crude product of 1,1-dimethylethyl ester of [1S- (la, 3ß, 5a] -3-aminocarbonyl) -2-azabicyclo [3.1.0] ] hexane-2-carboxylic acid (Formula H) in heptane. Alternatively, the ester of 1- (1,1-dimethylethyl) of (5S) -5-aminocarbonyl-, 5-dihydro-lH-pyrrole-l-carboxylic acid (Formula G ") can be prepared as shown in the Scheme of reaction VAT.

REACTION SCHEME VAT C? WA IWnNO CWHT weight Mol: 17157 weight Mol: 101. »weight Mol: 27ß.72 > CU * 4K »0.1 ,} , M? < * z * m N-methylmorpholine 4- (4,6-dimethoxy-1,3,5-tria-p-2-ii) chloride - C? SJHC-73-t (rat-T) CM 10t- «(MM) 4-methylmorpholinium OCHA As shown in the VAT reaction scheme, the salt of DCHA of the 4- (1,1-dimethylethyl) ester of 4,5-dihydro-lH-pyrrole-1,5-dicarboxylic acid X is treated with an alkali metal base such as sodium hydroxide to form the corresponding salt, such as sodium salt. The sodium salt of 4,5-dihydro-lH-pyrrole-l, 5-dicarboxylic acid 1- (1,1-dimethylethyl) ester can also be prepared from the corresponding ethyl ester by the ester treatment of ethyl (preferably a solution of the ethyl ester in toluene) with ethanol and sodium hydroxide. A solution of the sodium salt XI is treated with a buffer solution such as ammonium chloride and diacid sodium phosphate to a lower pH of the solution between 7, preferably around 6 to 6.5, and the sodium salt buffer is treated with 4- (4,6-dimethoxy-1,3,5-triazin-2-yl) -4-methylmorpholinium chloride (DMT-MM) to form activated ester-DMT XII which is treated with ammonia or other base such as ammonium sulfate, ammonium chloride or ammonium hydroxide, to form the ester of 1- (1,1-dimethylethyl) of (5S) -5-aminocarbonyl-4,5-dihydro-lH-pyrrole-1 acid -carboxylic G ''. The 4- (4,6- Dimethoxy-1,3,5-triazin-2-yl) -4-methyl-morpholinium chloride (DTM-MM) can be prepared as shown in Scheme VIA by the reaction of 2- C1-4, 6-dimethoxy-1,3,5-triazine (CDMT) and N-methylmorpholine at reduced temperatures in the range from about 0 to about 10 ° C to form DMT-MM. The DCHA salt of the 4- (1,1-dimethylethyl) ester of 4,5-dihydro-lH-pyrrole-l, 5-dicarboxylic acid X can be prepared from the corresponding sodium salt XI by treatment - in aqueous solution of DCHA X salt prepared previously with methyl t-butyl ether (MTBE) by adjusting the pH of the reaction mixture to 2.5-3 using an acid such as H3P0. The organic layer is separated and treated with brine to form the corresponding sodium salt XI. The resulting reaction mixture was cooled and treated with DCHA to form the corresponding DCHA X salt.

IVB REACTION SCHEME 1. EtjZp (1.1 M in toluene) 2. CICH2I 1? C5OO Toluene, -30 to -20 * C and CMH "NO" weight Mol: 241.28 X BOC-MPEE • -BOC-WPEE Ci3H21N0 CuHaNO, weight Mol: 255.31 weight Mol: 255.31 «-BOC-MPEE« -BOC-MP C ^ KiiNO * C11B17NO4 weight Mol: 255.31 weight Mol: 227.26 Compound H of the VAT reaction scheme can also be prepared as shown in Scheme IVB by cyclopropanation of the ethyl ester of N-BOC 4,5-dehydroproline G "as follows. The ethyl ester of β-BOC 4,5-dehydroproline G "is treated with diethyl zinc and chloro iodomethane in the presence of a dry organic solvent such as toluene, methylene chloride or dichloroethane at reduced temperature in the range from about -30 to about 0 ° C to form the ethyl ester of N-BOC 4,5-methanoproline XV. The resultant ethyl BOC 4,5-methanoproline XV ester (mixture of syn and anti-isomers (8: 1)) is separated by treatment with aqueous methyl amine under an inert atmosphere such as a nitrogen atmosphere and the ester is recovered ethyl ester of syn (S) -BOC-4,5-methanoproline XVI (separated from XVII). The ethyl ester of s-BOC-4,5-methanoproline XVI in ethanol or other organic solvent such as toluene or THF is treated with a base such as aqueous lithium hydroxide, sodium hydroxide or potassium hydroxide to form the free acid of corresponding s-BOC-methanoproline XVIII. The free acid XVIII is converted to the corresponding s-BOC-methanoproline H amide by the treatment of free acid XVI11 dissolved in an organic solvent such as THF or methylene chloride; isobutyl chloroformate or mesyl chloride, in the presence of N-methyl morpholine, under reduced temperatures not exceeding about -8 ° C, and then treating the reaction mixture with ammonia to form the amide s-BOC-methanoproline H. Another aspect of this invention relates to a method for the coupling of (aS) -a-amino-3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic acid fragments (Formula 3) and (1S, 3S, 5S) - 2-azabicyclo [3.1.0] hexane-3-carboxamide (Formula J) to produce (SS, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxytricyclo [3.3.1.13'7 ] dec-1-yl) -1-oxoethyl] -2-azabicyclo [3.1.0] hexane-3-carbonitrile, benzoate (1: 1). The coupling of these fragments is detailed in Reaction Scheme V below. REACTION SCHEME V The compound of Formula 2 is used without isolation from a bioconversion using an isolated (partially purified) PDH / FDH enzyme concentration as set forth in Example 3. As shown in Reaction Scheme V, the fragment of the (aS) -a-amino-3-hydroxytricyclo [3.3.1.13,7] decane-1-acetic acid (Formula 2) is first protected by BOC to produce the acid (aS) - a [[(1,1-dimethylethoxy)] ) carbonyl] amino] -3-hydroxycyclo [3.3.1. 13,7] decane-1-acetic acid (Formula 3) by treatment of 2 with BOC20 in the presence of a base such as sodium hydroxide and separated by extraction of isopropyl acetate then crystallized with isopropyl acetate / heptanes to isolate free acid 3 (see Example 3, step 3). Alternatively, free acid 3 is separated by extraction of ethyl acetate (EtOAc) (see Example 8M). A solution of the compound of Formula 3 in an appropriate organic solvent such as tetrahydrofuran (THF) (cooled to a temperature within the range of about -10 to about 0 ° C) is treated with methanesulfonyl chloride (Mesyl 'Cl), and base Hunig (diisopropylethylamine or DIPEA) to form the corresponding methanesulfonic acid salt of VI. A coupling reaction is then used to couple the acid (aS) -a [[(1,1-dimethylethoxy) carbonyl] amino] -3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic, (Formula 3) salt of methanesulfonic acid a (1S, 3S, 5S) -2- azabicyclo [3.1.0] hexane-3-carboxamide (Formula J) in the presence of 1-hydroxybenzotriazole (HOBT) or another known coupling agent to produce the ester of 1,1-dimethylethyl of 3- (aminocarbonyl) -aS) -a- (3-hydroxytricyclo [3.3.1.13'7] dec-1-yl) -β-oxo- (1S, 3S, 5S) -2- azabicyclo [3.1.0] hexane-2-ethancarbamic acid, (Formula K). • The compound of the Formula K is subjected to dehydration by treatment of the compound K with organic base such as pyridine or triethylamine and trifluoroacetic anhydride, and then the reaction is subjected to hydrolysis by cooling to from about 0 to about 10 ° C and Sodium hydroxide or other strong base such as KOH or LiOH is added to form Compound L. The 1,1-dimethylethyl ester of 3-cyano- (aS) -a- (3-hydroxytricyclo [3.3.1.13'7 ] dec-1-yl) -β-oxo- (1S, 3S, 5S) -2-azabicyclo [3.1.0] hexane-2-ethanocarbamic acid, (Formula L), which is then deprotected (and treated with benzoate of sodium) to form the dipeptidyl peptidase inhibitor IV (SS, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxytricyclo [3.3.1.13'7] dec-1-yl) -1 -oxoethyl] -2-azabicyclo [3.1.0] hexane-3-carbonitrile, benzoate (1: 1) (Formula M).

Referring again to Reaction Scheme V, compound L can be deprotected by treatment with a strong acid such as hydrochloric acid as described with respect to the VIA reaction scheme. VIA REACTION SCHEME With reference to the reaction scheme VIA, the free base monohydrate M "can be formed of the intermediate L protected by BOC as follows. Intermediate L protected by BOC is treated with concentrated hydrochloric acid in the presence of methylene chloride and methanol while maintaining the reaction temperature within the range of about 20 and 25 ° C, to form the hydrochloride salt L '. The hydrochloride salt L 'is treated with hydrochloric acid and then the sodium hydroxide or other strong base to form the free base M'. The free base M 'then is treated with water to form the free base monohydrate M' A The inhibition of the dipeptidyl peptidase IV produced using the compounds and methods of the present invention is useful in the treatment of diabetes and complications thereof , hyperglyceria, syndrome X, hyperinsulinemia, obesity and atherosclerosis and related diseases as well as immunomodulatory diseases and inflammatory bowel disease. The following Examples represent preferred embodiments of the invention. EXAMPLE 1 Construction of plasmid pBMS2000-PPFDH-PDHmod A two-step construction of the expression vector pBMS2000-PPFDH-PDHmod is employed. The FDH gene of P. pastoris is subcloned into the expression vector pBMS2000 (pBMS2000 is described in US Patent No. 6, 068,991, issued May 30, 2000 to S. W. Liu et al.) Using oligonucleotide primers containing the 5 'and 3' end of the FDH gene of P. pastoris together with the compatible restriction endonuclease cleavage sites: 'CGTCATGAAAATCGTTCTCGTTITG 3' (5 'end; sense; SEQ ID? O: 1) BspIH 5' TACTGTTTTTCCAGCGTATTCCTAGGCT3 '(3' end; anti-sense; SEQ ID? 0: 2) BamHl High-fidelity PCR amplification of the gene FDH of P. pastoris is carried out in four aliquots of 100 μl, each containing 1 X TaqPlus reaction buffer (Stratagene, LaJolla, CA), 0.2 mM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, and dTTP) , 0.4 nM of each oligonucleotide, DNA polymerase 2.5 U TaqPlus (Stratagene), and AD? of plasmid 10 pg containing the cloned P. pastoris FDH gene. Amplification conditions include incubation at 94 ° C for 4 minutes, followed by 25 cycles of incubation at 94 ° C for 1 minute; 50 ° C for 1 minute; and 72 ° C for 1.5 minutes, using a Perkin-Elmer Model 480 thermocycler with self-extension. The PCR reaction mixture was extracted with an equal volume of 1: 1 phenol: chloroform (GibcoBRL, Gaithersburg, MD), and centrifuged at 13,000 x g for 5 minutes. The upper aqueous phase is removed and placed in a new microcentrifuge tube. Was the AD precipitated? by the addition of 0.1 volumes of 3M sodium acetate and 2 volumes of ice-cooled ethanol. After centrifugation at 13,000 x g for 5 minutes, the liquid was aspirated from the tube, and the pellet was washed with 0.5 ml of 70% ethanol cooled on ice. The liquid was again aspirated, and the pellet was allowed to air dry for 30 minutes at room temperature. The amplified DNA was digested with 20 units each of BspHI and BamHl for 3 hours at 37 ° C in a total volume of 50 μl. In parallel, the vector pBMS2000 (2 μg) was digested with BspHI and BamHl. The digested samples were processed by electrophoresis in a 1.0% TAE agarose gel for 2 hours at 100 v. The bands correspond to the FDH gene (1100 base pair fragment) and the linearized vector (4700 base pair fragment) that is excised separately from the gel and purified using a QIAquick gel extraction kit (Qiagen, Chats orth, CA). The concentrations of the isolated fragments are again estimated by electrophoresis against the low molecular weight mass scale (Invitrogen Corp., Carisbad, CA) and it is linked in a molar ratio of 5: 1 (insert: vector) in a total volume of 10 μl at, 22 ° C during 2 hours. The DNA was precipitated by the addition of 15 μl of dH20 and 250 μl 1-butanol, and pelleted at 13,000 x g in a microcentrifuge for 5 minutes. The liquid was removed by aspiration, and the DNA was dried in a SpeedVac (Savant Instruments, Farmingdale, NY) for 5 minutes under reduced heating. The pellet was resuspended in 5 μl dH20. The resuspended DNA was transformed by electroporation into 0.04 ml of competent DH10B cells of?. Coli (Invitrogen) at 25 μF and 250 O. The SOC medium (0.96 ml; SOC = 0.5% yeast extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4) was immediately added. 20 no glucose per liter), and the cells were incubated on a shaker for 1 hour at 37 ° C and 225 rpm. Colonies containing the plasmid DNA were selected on LB agar plates containing 50 μg / ml kanamycin sulfate (Sigma Chemicals, St. Louis, MO). Plasmids were identified with the desired insert by colony PCR in capillary tubes using the RapidCycler (Idaho Technology, Salt Lake City, UT). Each reaction mixture contained 50 M Tris-HCl (pH 8.3), 4 mM MgCl2, 0.25 mg / ml bovine serum albumin, 2% sucrose 400, 0.1 mM cresol red, 0.4 nM of each primer (SEQ ID NO: 1 and SEQ ID NO: 2), and 2.5 U Taq of AD? of polymerase (Promega Corp., Madison, Wl). The reaction mixture was divided into 10 μl aliquots, and pipetted into the wells of a round bottom microtiter plate. A kanamycin-resistant colony was collected using a disposable plastic inoculation needle, stirred in the reaction mixture, and transferred to the kanamycin-LB agar. Each aliquot of the reaction mixture was drawn into a 30 μl capillary tube and the tube was sealed to the flame at both ends. The cells and the AD? was denatured by incubation at 94 ° C for 30 seconds; amplification was performed using 30 cycles of incubation at 94 ° C for 0 seconds; 40 ° C for 0 seconds, and 72 ° C for 60 seconds using a RapidCycler Thermocycler (Idaho Technologies, Salt Lake City, UT). The samples were treated by electrophoresis in a 1.0% TAE agarose gel for 2 hours at 100 v. Seven samples of the 17 tested showed a strong band at 1100 base pairs. A colony containing this plasmid (referred to herein as pBMS2000-PPFDH) was chosen for the next step in the construction of the plasmid. "PDHmod" refers to a modified phenylalanine dehydrogenase of Thermoactinomycetes intermedius that differs from the published DNA sequence (Takada et al., J. Biochem.109, pp. 371-376 [1991]) by a change of at least 2 amino acids and 12 additional amino acids at the carboxyl terminus required for the complete conversion of (3-hydroxy-adamantan-1-yl) -oxo-acetic acid to (S) -amino- (3-hydroxy-adamantan-1-yl) acid -acetic. This change was introduced in the plasmid pPDH9? / 10 (described in detail by WO200004179, granted to Donovan et al., 27 of January 2000), which was subsequently transformed into P. pastoris SMD1168 (deposited as strain ATCC 74408). The 3 'end of the native PDH gene and the corresponding amino acids: AAC AGC GCA AGG AGG TAA Asn Ser Ala Arg Arg Detention The 3' end of PDHmod and the corresponding amino acids (changed or new amino acids in bold): AAC AAC GCG GAG GGG TAC CTC GAG CCG CGG Asn Ser Wing Glu Gly Tyr Leu Glu Pro Arg CGG CCG CGA ATT AAT TCG CCT TAG Arg Pro Arg lie Asn Ser Pro Stop Oligonucleotide primers containing the 5 'and 3' end of the PDHmod gene together with the compatible cleavage sites of the restriction endonuclease were prepared i l ^ gggg ^ §gi §gg H 'g ggg§ (gg &? g @ ao33;; a ^? is§enil € to; S§§QI1DN & © 44) P? g io The reaction conditions for the amplification and purification of PDHmod by PCR were identical to those used for the P. pastoris FDH gene except chromosomal DNA prepared from ATCC 74408 was included as template for the reaction. The resulting fragment was digested with 20 units each of Ndel and Smal for 1 hour at 25 ° C, followed by 2 hours at 37 ° C, in a total volume of 50 μl. In parallel, a version of the vector pBMS2000 with a Ndel site at the start codon (2 μg) was digested with Ndel and Smal using identical conditions. Sequences digested in a 1.0% TAE agarose gel were treated separately by electrophoresis for 2 hours at 100 v. The bands corresponding to the PDHmod gene (1200 base pair fragment) and the linearized vector (4700 base pair fragment) were excised from the gel and purified using the QIAquick gel extraction kit (Qiagen). Ligation of the two fragments, transformation of E. coli, and separation by exclusion of the colonies containing inserts with the PDHmod gene (which forms pBMS2000-PDHmod) were carried out as described supra. For the construction of pBMS2000-PPFDH-PDHmod, pBMS2000-PDHmod (2 μg) was unfolded with 10 U each of HindIII and Smal in a 50 μl reaction for 1 hour at 25 ° C, followed by 1 hour at 37 ° C . Ten units of the T4 DNA polymerase (Invitrogen) and 2 μL of the 2.5 mM mixture of all four deoxyribonucleoside triphosphates were added and the sample was incubated at 11 ° C for 20 minutes. The reaction was processed by electrophoresis on a 1.0% agarose gel APR for 2 hours at 100 v. The 1800 base pair fragment was excised and isolated using the gel extraction kit QIAquick (Qiagen). This fragment contains, in order, the tac promoter, the groES gene, and the PDHmod gene (as a transcription fusion). Next, pBMS2000-PPFDH (2 μg) is digested with 10 units of restriction endonuclease Smal in a volume of 50 μL for 2 hours at 25 ° C, then treated with 0.4 U shrimp alkaline phosphatase (United States Biochemicals, Cleveland, OH) for 1 hour at 37 ° C. The plasmid DNA was electrophoresed for 2 hours at 100 v on a 1.0% TAE agarose gel, isolated, and extracted with the QIAquick kit. The two fragments bind in a 6.5: 1 molar ratio (insert: vector) at 16 ° C for 4 hours in a final volume of 10 μL. After extraction and centrifugation of 1-butanol, the DNA is transformed into electrocompetent DH10B cells. The kanamycin-resistant colonies are separated by exclusion for the presence of the PDHmod gene with the two specific PDHmod primers as previously described for FDH. A second round of separation by PCR exclusion is conducted using homologs of DNA primers for the 5 'end of the PPFDH gene and for the 3' end of the PDHmod gene, respectively. Only those constructs capable of supporting the amplification of a fragment of 1400 base pairs possess the 2 genes in the same orientation. One such plasmid was found and orientation is confirmed by diagnostic restriction digestion with Kpnl, which gives the expected fragments of 5422 and 1826 base pairs. This plasmid is designated "pBMS2000-PPFDH-PDHmod". EXAMPLE 2 Expression of FDH and PDHmod pBMS2000-PPFDH-PDHmod is transformed into Escherichia coli JM110. In shake flask studies, the JMllO (pBMS2000-PPFDH-PDHmod) is grown for 18 hours at 28 ° C, 250 rpm in MT5 medium (2.0% Levastamin, 4.0% glycerol, 0.6% sodium phosphate [dibasic ], 0.3% potassium phosphate [monobasic], 0.125% ammonium sulfate, 0.0256% magnesium sulfate [heptahydrate]; added after autoclaving the sterile 1M solution], and 50 μg / ml kanamycin sulfate [added after autoclaving a 50 mg / ml solution sterilized by filtration]). The optical density at 600 nm (OD600) was recorded and the cells sufficient to give the ODβ0e departure from 0.35 were added to the fresh kanamycin / MT5 medium. The flasks are shaken at 250 rpm, 28 ° C until OD600 was 0.8-1.0. The expression of both genes is induced by the addition of isopropylthio-β-D galactopyranoside 1M (IPTG) sterilized by filtration to a final concentration of 35 μM and the fermentation continues for 24-48 hours. The cells are pelleted by centrifugation at 6,500 x g for 5 minutes, washed once with an equal volume of 50 mM ammonium formate pH 7.0, and re-pelleted. The cells are stored by freezing at -20 ° C or used immediately. The pellet is resuspended in 50 mM ammonium phosphate, pH 7.0 at 10 mL / g wet cell weight and sonicated 3 x 15 seconds using a Fisher Scientific Model 50 Sonic Shredder (Fisher Scientific, Pittsburgh, PA), power adjustment to 15 with a microtip. The waste is pelleted by centrifugation at 13,000 x g for 5 minutes at room temperature. The expression was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). One μL of the cell extract was mixed with 5 μL of 4X NuPAGE ™ LDS buffer (Invitrogen) and brought to 19 mL with distilled water. The samples are heated at 70 ° C for 10 minutes. An L of the 1M dithiothreitol solution was added to the mixture and 10 μL was applied to a NuPAGE ™ Bis-Tris 10% polyacrylamide mini gel. Electrophoresis is carried out 200 v for 50-60 minutes and the gel dyeing in a solution consisting of 0.1% (w / v) Coomassie blue (Sigma), 40% (v / v) ethanol, and 10% (v / v) acetic acid.

The gel, immersed in the dye, is heated in a microwave oven until the boiling becomes evident, then it is stirred at 40 rpm in an tal shaker for 15 minutes. The gel was thoroughly washed with deionized water and covered with a destained solution (GelClear ™; Invitrogen). The solution was again heated to the boiling point and stirred gently for at least 2 hours. Two prominent bands are observed at Mr 43,000 and 40,000 during induction, which correspond to the expected molecular weight of the FDH and PDHmod subunits. It is also found that the samples possess both FDH and PDH activities when tested as described in Example 10. This recombinant E. coli strain is given the internal designation of SC 16496. SC 16496 is subsequently fermented to volumes of 15 Y 250 liters. For a 15 liter fermentation, a vial containing 1 L of SC 16496 is thawed at room temperature and added to 1 liter of MT5 medium containing 50 μg / ml kanamycin in a 4 liter flask. The flask is incubated 28 ° C, 250 rpm for 24 hours and transferred to 13 liters of medium MT5 (ingredients grouped based on the final volume of 15 L) in a Braun fermenter. Kanamycin sulfate and magnesium sulfate heptahydrate sufficient to give a final concentration of 50 μg / ml and 0. 0246%, respectively, are dissolved in 500 mL of distilled water and sterilized by filtration through a 0.2 micron cellulose acetate filtration unit.

The solution is added to the tank, followed immediately by the inoculation. The initial OD50o was ca. 0.35. The operating parameters for the fermentation were as follows: Work volume: 16 liters Temperature: 28 ° C Aeration: 1.0 wm Pressure: 690 mbar Agitation: 500 rpm pH controlled at 6.8 with NH4OH as required The foam formation is controlled by the addition of UCON (a flurocarbon solvent mixture produced by the Dow Chemical Company) as required. At OD6oo 0.8-1.0 (approximately two hours after inoculation) sterilized IPTG is added by filtering (dissolved in 500 mL dH20) aseptically to give a final concentration of 35 μM. The fermentation continues for an additional 48 hours, during which the contents of the tank are sub-cooled to 10 ° C. Cells are collected by centrifugation and rinsed once with 50 mM 0.1 vol ammonium formate at pH 7.0. The cell paste is placed in plastic containers and stored at -70 ° C until needed. For 250 L tanks, the inoculate is prepared as follows: 1 mL of frozen SC 16496 is thawed and added to 300 L of medium MT5 with 50 μg / ml of kanamycin. The flask is grown at 28 ° C, 250 rpm for 24 hours. The OD600 is determined and the appropriate volume of cells to give 80 OD units is removed and added to 250 mL of fresh M7T5 medium. The cells are aseptically added to 10 L of medium MT5 / kanamycin in a Braun fermentor (initial ODßoo - 0.008) and grow under the Operating Parameters of Fermentation described above for 16 hours. The culture is then transferred to 250 L of MT5 containing the appropriate concentrations of kanamycin and magnesium sulfate. Based on the double time of 90 minutes of SC 16496 under these conditions, 10 L of inoculated into 250 L would give an OD60o item of 0.30-0.35. The induction, growth, harvest and storage are carried out as described for the 15 L fermentation. EXAMPLE 3 Telescopic production of the acid (aS) -oc ~ [[(1,1-dimethylethoxy) carbonyl] amino] -3- hydroxycyclo [3.3.l.l3,7] decane-1-acetic (Formula 3) to paritr of 3-hydroxy-a-oxotricyclo- [3.3. l.l3,7] decane-1-acetic (Formula 1) to (aS) -a-amino-3-hydroxytricyclo [3.3.1.13,7] decane-1-acetic acid (Formula 2) using an enzyme concentrate PDH / Isolated FDH (partially purified) Step 1: Isolated PDH / FDH enzyme concentration A fermentation broth (30 liters) of Escherichia coli JM110 (ΔBMS2000-PPFDH-PDHmod) is obtained from a 4000 liter tank fermentation (prepared using the procedure similar to Example 2) and passed through a microfluidizer (Microfluidics model M-110Y, operating at pressure 12,000-20,000 psi (843 kg / cm2 to 1406 kg / cm2) (one step) to release the activity of the cells that maintain the broth temperature of 40 ° The PDH / FDH activity of the microfluidized broth was 32 IU / ML for PDH and 8 IU / ml for FDH To clarify the whole broth, 4.5kg of celite was added to a well-stirred broth. Add 0.201 liters of 30% aqueous polyethyleneimine and mix for 30 minutes The mixture is then filtered using a filter press (Ertel Alsop model 8-ESSC-10) and 18 liters of the filtrate are obtained. liters of water to bring the volume back to 30 liters. of the stage was 97% activity that recovered PDH with an activity of 31 IU / l and an FDH activity of 8 IU / ml. The clarified broth is ultrafiltered through a 100,000 MWCO filter cassette (Millipore Pellicon 2 units, polyethersulfone lower protein link cassette, 0.5 m2 filter area). The circulation ratio of the pump was 400 mL / min. The clarified filtrate is concentrated to 1.5 liters and gives an enzyme concentrate and PDH titre of 567 IU / ml and FDH titre of 136 IU / mlI. The permeate is evaluated and no activity is found. The general enzyme activity recovered in the concentrate was 84%. Step 2: Reductive amination 3-Hydroxy-a-oxotricyclo [3.3.1.l3,7] decane-1-acetic acid (Formula 1) (1.00 kg, 4.46 mol) was added to a 20L vessel followed by water (5L). The mixture was stirred and the pH was adjusted to pH-8 with ION NaOH to give a solution. The Darco KBB carbon (100 g) was added and the mixture was stirred for 5 minutes and then filtered through a Buchner funnel with 5 μ filter paper. The filtrate was washed with water (2xlL) and the filtrates and washes are combined to give a clear solution. With stirring, ammonium formate (0.562Kg, 8.92 mol) was added and the pH readjusted to about 7.5 with 10OH NaOH. The nicotinamide adenine dinucleotide (2.65g) and dithiothreitol (1.54g) were added. When the solids are dissolved, a concentrate of PDH / FDH enzyme was added (1.03L, 500,000IU of PDH). The pH was readjusted to about 8.0 with ION NaOH at room temperature. The mixture was then warmed to -40 ° C and diluted to a total volume of 10L with water. The pH is maintained at 7.7-8.3 while stirring for 42 hours. The resulting solution contains 0.955 Kg (95.1%) of the (aS) -a-amino-3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic acid product (Formula 2). Stage 3: BOC protection Di-tert-butyl bicarbonate (1.022kg, 4.68mol) was added for a portion of the solution of the acid (aS) -a-amino-3-hydroxytricyclo [3.3.1.13'7] decane- 1-acetic (Formula 2) (477.5g, 2.12 mol). This mixture was stirred at room temperature, with a pH adjusted to and maintained at 10 with a static pH concentrator using ION NaOH. The reaction was completed 4 hours after the addition of Boc20 when there was less than 1.0% of the remaining starting material. The pH of the mixture was adjusted to about 8 with 35% H2SO4 and i-PrOAc (5.0L) was added to the mixture. The pH of the mixture was then adjusted to 2.0 with 35% H2SO4 and maintained at this pH for 5-10 minutes. The Dicalite (250g) was added; the mixture was stirred during-lOrnin, and then filtered through a Dicalite pad (250g) onto a filter paper in a Buchner funnel. The Dicalite pad was further washed with 2.5L i-PrOAc. The filtrate was adjusted to a pH of 8 with? AOH ION. After standing for 1 hour, the organic layer including an interface was discarded. To the aqueous layer, i-PrOAc (7.5L) was added. The mixture was acidified with 35% H2SO4 to pH of about 2, and then it was heated to and kept at around 40 ° C for 4 hours with gentle agitation. The layers are separated and the organic extract is stored. The aqueous layer with an interphase was extracted with i-PrOAc (3.75 L) and the layers are separated again after 2 hours at 40 ° C. The aqueous layer with an interphase was extracted again with i-PrOAc (3.75L) and the layers are separated after 2 hours at 40 ° C. The combined organic extracts (~15L) are concentrated by distillation at -4.5L. To this solution, heptane (~ 10L) is then added for 10-15 min while the temperature is maintained at ~ 82-89 ° C. The jacket temperature of the reactor was set at 70 ° C and maintained at this temperature for 1 hour. The crystallization occurred shortly after cooling. The temperature of the reactor jacket was then set at 40 ° C and maintained at this temperature for 30 minutes. The suspension was completely cooled to room temperature, and then further cooled to 0-5SC. After 1 hour of stirring at 0-5aC, the product was filtered. The product was washed with heptane (2.5L), then dried in vacuo at 40 ° C to give 607. Og (88% yield) of the acid (aS) -a- [[(1,1-dimethylethoxy) carbonyl] amino] -3-hydroxycyclo [3.3.1.l3,7] decane-1-acetic (Formula 3). EXAMPLE 4 Phenylalanine Dehydrogenase Assay A Assay A of Phenylalanine dehydrogenase contained in 1 ml at 40 ° C: 0.4 mM NADH, 5 mM sodium phenylpyruvate, 0.75 M NH OH adjusted to pH 8.75 with HCl. The reduction in absorbance is monitored at 340 nm. Units of enzyme activity were calculated as μmoles / minute based on the ratio of absorbance change. EXAMPLE 5 Phenylalanine dehydrogenase B assay The P-assay of Phenylalanine dehydrogenase contained in 1 ml at 40 ° C: 1 mM NAD, 10 mM L-phenylalanine, 0.1 M K2HP04 adjusted to pH 10.0 with INOH NaOH. The increase in absorbance is monitored at 340 nm. The units of the enzyme activity are calculated as μmoles / minute based on the ratio of the absorbance change. EXAMPLE 6 Test C of Phenylalanine dehydrogenase The C test of phenylalanine dehydrogenase contained in 1.0 mL at 40 ° C: 0. mM NADH, 50 mM of 3-hydroxy-a-oxotricyclo [3.3.1.13,7] decane-1-acetic acid (dissolved in 1 equivalent of? aOH solution),? H4OH 0.75M adjusted to pH 8.75 with HCl. The reduction in absorbance is monitored at 340 nm. Units of enzyme activity are calculated as μmoles / minute based on the absorbance change ratios. EXAMPLE 7 Formate Dehydrogenase Assay The formate dehydrogenase assay contained in 1.0 ml at 40 ° C: 1 mM AD, 100 mM ammonium format, 100 mM potassium phosphate buffer, pH 8.0. The increase in absorbance is monitored at 340 mm. The units of the enzyme activity are calculated as μmoles / minute based on the absorbance change ratios.

EXAMPLE 8 Preparation of: A. The coupling of adamantyl bromide catalyzed by ZnCl 2 (Formula A) A dry container was charged with 7.5 kg of adamantyl bromide. The methylene chloride (22.5 liters) was then added at room temperature to dissolve the adamantane bromide solid. It was dissolved, endothermically so that before the next step, the temperature of the reaction mixture was allowed to return to 20 ° C. The reaction mixture was then charged with zinc chloride (1.05 kg) and stirred for about 5 minutes at 20 ° C. The reaction mixture was then charged with tris (trimethylsiloxy) -ethylene (15.3 kg) while maintaining the reaction temperature between 20 to 25 ° C and the resulting mixture was stirred for 2 hours. After this mixture, tris (trimethylsiloxy) ethylene (5.10 kg) was added. During this addition, the temperature is kept below 30 ° C. The reaction is maintained for another 12 to 15 hours at 20 to 25 ° C, at which time the reaction mixture was diluted with methylene chloride (15 liters) and cooled to 0 to 5 ° C. The reaction mixture was then treated, starting in a dropwise fashion, with saturated NH 4 Cl solution. During the addition, the temperature was kept below 30 ° C. A thick suspension was obtained. To this suspension was added ethyl acetate (93.75 liters). The mixture was stirred vigorously for 15 minutes and the aqueous and organic phases are divided. The organic layer is stored and the aqueous layer washed twice with ethyl acetate (18.75 liters in each wash). The ethyl acetate washes and the organic layer were then combined and washed with water (37.5 liters) followed by medium water saturated with brine (37.5 liters). The organic layer was separated again and evaporated to form crystals. A solvent exchange to heptane is made to a final volume of 22.5 liters. The resulting suspension was cooled to 5 to 10 ° C for 1 hour and the product of a-hydroxytricyclo [3.3.1. 13,7] decane-1-acetic acid (Formula B) is obtained by filtration. Provided of α-hydroxytricyclo [3.3.1.l3,7] decane-1-acetic acid (Formula B) is 6.96 kg (33.11 mol, 95%).

B. Esterification of α-hydroxytricyclo [3.3.1.13,7] decane-1-acetic acid (Formula B) to form Ester of Formula C. An inert atmosphere is first created in the reactor. The reactor was then charged with methanol (35.00 liters) followed by a-hydroxytricyclo [3.3.1.1.3'7] decane-1-acetic acid (Formula B) (14.00 kg) to form a suspension. The suspension was cooled to 0 to 5 ° C and acetyl chloride was added in such a way that the temperature of the reaction mixture was maintained between 5 and 10 ° C. After completing the addition of acetyl chloride, the reaction mixture was warmed to 20 to 25 ° C and stirred for 2 hours at 20 to 25 ° C. The reaction mixture was concentrated under vacuum at 40 ° C and a thin oil is obtained. The oil is dissolved in ethyl acetate (71.96 liters) and brought to room temperature. The resulting mixture was washed 2 times in water (28.78 liters each wash) and the aqueous and organic layers are separated after each wash. The organic layer is stored while the aqueous layers are combined and the pH is adjusted to 9.5 with 3N NaOH solution. The combined aqueous layers are then extracted twice with ethyl acetate (14.39 liters with each extraction). The organic layers followed by each extraction are separated and combined with the organic layer stored. These combined organic layers are then washed with saturated sodium bicarbonate solution (28.78 liters) followed by brine (43.18 liters). All volatiles are then removed under vacuum at 40 ° C and a colorless to slightly yellow oil was obtained which crystallized upon standing. This oil contains 13.29 kg (59.26 mol, 89%) of the methyl ester of a-hydroxytricyclo [3.3.1.l3,7] decane-1-acetic acid (Formula C). C. Swern oxidation of the methyl ester of a-hydroxytricyclo [3.3.1.13, 7] decane-1-acetic acid (Formula C) to form methyl ester of ocoxotricyclo [3.3.1.13,7] decane-1-acetic acid (Formula D) A 3-necked flask (22 liters) was equipped with a stirrer mechanical, temperature probe and an additional funnel and purged with nitrogen overnight. The oxalyl chloride (500 ml, 5.73 mol) is added followed by CH2C12 (8 liters). The resulting solution was cooled to -69 ° C with an acetone / dry ice bath. A solution of dimethylsulfoxide (DMSO: 700 ml, 9.86 mol) was added slowly for about 30 minutes while keeping the internal temperature below -60 ° C. The solution was stirred for 20 minutes while maintaining the temperature at -60 to -70 ° C. A solution of methyl ester of a-hydroxytrichyclo [3.3.1.13'7] decane-1-acetic acid (Formula C) - (990 grams, 4.42 mol) in CH2C12 (1.7 liters) was added slowly for approximately 30 minutes while maintaining the internal temperature below -60 ° C. The resulting solution was stirred for 30 minutes. NEt3 (3 liters, 21.5 mol) was then added to form a heavy suspension of the triethylamine hydrochloride salt. The reaction mixture was warmed to room temperature and water (1 liter) was added to dissolve the triethyl ammonium salt (TEA salt). The reaction mixture is then transferred to a round bottom flask, and completely concentrated to remove dichloromethane (DCM) and NEt3. EtOAc (12 liters) was added and the resulting organic and aqueous layer are divided. The organic layer is washed 3 times with water (2 liters each wash) followed by the. wash with brine (2 liters). The organic phase was then dried over anhydrous Na 2 SO 4 with evaporation to give a slightly yellow solid of methyl ester of α-oxotricyclo [3.3.1.l 3,7] decane-1-acetic acid (Formula D). The yield is approximately 104%. D. Hydroxylation of methyl ester of a-oxotricyclo [3.3. l.l3,7] decane-l-acetic (Formula D) to methyl ester of 3-hydroxy-a-oxotricyclo [3.3.1.13'7] decane-1-acetic acid (Formula la) An Erlenmeyer flask was charged with 95 up to 98% H2S04 (495 ml) and cooled in an ice bath at 8 ° C. HN03 (47.5 ml at 50% prepared by adding 50 ml of 70% HN03 to 30 ml of water) was then added to the flask and the mixture was again cooled to 8 ° C in the ice bath. The methyl ester solid of a-oxotricyclo [3.3.1. L3,7] decane-1-acetic (Formula D) (100 grams, 0.45 moles) was slowly added to the mixture in portions for 30 to 60 minutes to maintain a temperature of less than 28 ° C. The reaction mixture was stirred while cooling in the ice bath. The progress of the reaction is monitored either by thin layer chromatography (TLC) or high performance liquid chromatography (HPLC). For TLC, a silica gel is used and the solvent is EtOAc / MeOH / Hexane (9/1/10); KMn0. For HPLC, a 4.6 x 50 mm, C18, 3 micron, 120 angstrom column is used with a gradient of 10% acetonitrile / H20 for 100% acetonitrile in 7 minutes at a flow rate of 2.5 ml / minute. The wavelength of the monitoring is 200 nm. When the reaction was complete (after about 1 hour), the reaction was quenched by the addition of cold water (1.5 liters) and EtOAc (500 ml). Additional water and EtOAc (500 ml of each) were added to aid in the separation of the aqueous and organic layers. The aqueous layer was then extracted with 3 aliquots, each 500 ml, of EtOAc. The organic layers are combined and washed with brine (400 ml). The washing of the organic layer was then concentrated under reduced pressure to 130 grams of a yellow oil residue containing methyl ester of 3-hydroxy-a-oxotricyclo [3.3.1.13,7] decane-1-acetic acid (Formula ).

E. Hydrolysis of methyl ester of 3-hydroxy-a-oxotricyclo [3.3.1.13'7] decane-l-acetic acid (Formula la) to 3-hydroxy-a-oxotricyclo [3.3.1.13'7] decane- 1-acetic (Formula 1) The yellow oil residue from part D was dissolved in tetrahydrofuran (300 ml) and cooled in an ice bath at 5 ° C. 1 liter of 1N sodium hydroxide was slowly added to the solution to adjust the pH to about 7 while keeping the temperature below 30 ° C. An additional 500 ml of IN NaOH was then added to adjust the pH to about 14. The reaction mixture was then stirred while cooling in an ice bath and the progress monitored by TLC or HPLC as described in Example 23. When the reaction was completed after approximately 30 minutesEtOAc (500 ml) was added and the organic and aqueous layers separated. The aqueous layer was washed with another 500 ml of EtOAc. The aqueous layer was acidified with concentrated HCl. When the solution reached pH 7, EtOAc (500 ml) was added followed by more concentrated HCl until the pH reached 0.7. The total concentrated HCl added was 150 ml. The aqueous layer was then extracted with EtOAc (4 x 400 ml) and the combined organic layers were washed with 400 ml of water followed by 400 ml of brine. The organic wash layer was then dried with MgSO 4 and concentrated. It provides 88 grams of a light yellow solid. Dissolving this solid in 100 ml of EtOAc and 300 ml of heptane with stirring for 30 minutes followed by filtration and air drying provide 85 grams of a brown solid (85% of 3-hydroxy-a-oxotricyclo [3.3.1.l3,7] decane-1-acetic acid (Formula 1)) E Preparation of 3-Hydroxy-α-oxotricyclo [3.3.l.l3,7] decane-1-acetic acid (Formula 1) using a batch procedure 1. Preparation of dichloro- (3-hydroxy) methyl ester -adamantan-l-il) -acetic (Formula VIII) Preparation of 10 NH? 03: A 100 L volumetric flask was charged with concentrated H? 03 (88.25 g, -62.58 mL, -1.0 mol) and cooled in a bath of ice. Water (35 mL) was added. After the heat of mixing was dissipated, the solution was allowed to warm to room temperature. The flask was then brought to the mark with water to give 10 N HN03. A 250 L 3-necked flask equipped with a thermocouple thermometer was charged with H2SO4 (103 g, about 56 mL). After cooling to 0.4 ° C in an ice bath, 10 N H ?3 (5.68 L, 56.8 mmol) was added for -30 minutes. When the temperature of this acid mixture was decreased to ~ 1.0 ° C, the cold bath was removed. The methyl ester of adamantan-1-yl-dichloroacetic acid of Formula VII (15.0 g, 54.11 mmol, lightly ground in a mortar to break the crystals / large pieces) was added in portions (1.25 g every 10 minutes; of addition 1 hour 50 minutes). After -5 hours the reaction mixture is a clear, pale yellow solution. After stirring for -24 hours the reaction mixture is a very pale yellow solution. A 4-necked Morton flask (1 L) eguided with a mechanical stirrer and a thermocouple thermometer was charged with water (250 L) and urea (8.0 g, 0.133 mol, -2.34 equivalents relative to HN03). To the resulting solution was added ethyl acetate (230 mL). The resulting biphasic mixture was cooled to ~ 1.0 ° C in an ice bath. The above reaction mixture was added, during -15 minutes, to the cold mixture of EtOAc / water / urea. The transfer was completed using additional ethyl acetate and water (-50 mL of each). After stirring for -45 minutes, the cold bath was removed and the mixture allowed to warm with stirring. After stirring for 4.5 hours (from the start of shutdown), the resulting mixture was transferred to a separatory funnel (1 L) using additional ethyl acetate (-100 mL) to complete the transfer. The aqueous fraction was removed and extracted with ethyl acetate (1 x 80 mL). The organic fractions are combined and washed with water (2 x 90 mL), 1 N NaHCO 3 (4 x 90 mL), and brine. After drying over anhydrous magnesium sulfate, the solvent was removed under reduced pressure to give methyl ester of dichloro- (3-hydroxy-adamantan-1-yl) -acetic acid of Formula VIII an almost colorless solution: 15.67 g (98.7% crude yield). This crude material can be used to prepare dichloro- (3-hydroxy-adamantan-1-yl) -acetic of Formula IX without purification. If desired, however, the crude material (15.65 g) can be recrystallized from methanol (102 mL) and water (85 L) 'to provide a fluffy cotton-like solid (mp 114.8-115.0 ° C) with 91% recovery . Elemental analysis: C? 3H? 8Cl203: Calculated: C, 53.25; H, 6.18; Cl, 24.18% Found: C, 53.24; H, 6.24; Cl, 24.31% XH NMR (500.16 MHz, CDC13) d 3.857 (s, 3H), 2.298 (br m, 2 H), 1.824 (s, 2 H), 1793 (d, 4 H, = 2.75 Hz), 1682 , 1629 (br AB q, 4 H), 1529 (m, 3 H) ppm 13 C NMR (127.78 MHz, CDC13) d 165,929, 94,281, 68,932, 54,150, 44,478, 44,529, 44,020, 35,750, 34,759, 30,149 ppm Lab CLAR : YMC ODS-A S3 120 Á (4.6 x 50 mm),?. = 200 n, 2.5 ml / minute Solvents: A = 0.2% H3P0 in water B = 90% CH3CN in water Gradient: 20% A up to 100% B for 10 minutes Retention time: area% Identity 2.06 minutes 1.19 not known 4.54 minutes 98.16 dichloro- (3-hydroxy-adamantan-1-yl) -acetic acid methyl ester . 09 minutes 0.65 unknown 8.35 minutes methyl ester adamantan-1-yl-dichloroacetic 2. Preparation of 3-Hydroxy-a-oxotricyclo [3.3.l.l3,7] decane-1-acetic acid A 250-mL 3-necked flask equipped with an argon inlet pressure equalizing and addition funnel, was charged with dichloro- (3-hydroxy-adamantan-1-yl) acetic acid methyl ester (Formula VIII), prepared as described in Step 1 above (15g, 51.16 mmol) followed by the addition of tetrahydrofuran ( 30 mL, unstable). After stirring for several minutes, the volume of Formula VIII of the methyl ester was dissolved to give a cloudy solution. To this solution was added distilled water (30 mL) and a diffused suspension formed. The additional funnel was charged with NaOH 1? (69 mL, 69 mmol, -1.35 eq related to the entry of the compound of Formula VIII). αOH was added dropwise over 70 minutes to give an almost colorless solution which was allowed to stir at room temperature. The HPLC analysis at -16 hours showed the hydrolysis of the compound of the complete Formula VIII. The reaction mixture, a clear colorless solution with a pH of 13.24, was adjusted to pH 7.40 by the addition of 6N HCl (2.8 mL). The solid NaHCO3 (11.2 g, 0.133 mol, 2.60 eq) was added to form a suspension. The HPLC analysis after heating for 4 hours 15 minutes showed that the reaction was complete. After heating for 5 hours, the heat source was removed and the reaction mixture (clear, colorless solution) was allowed to cool. After cooling to room temperature, the reaction mixture is stored in a refrigerator (+ 4 ° C) for 4 days. After storage in the cold for 4 days the reaction mixture was stirred to an almost colorless solution and the HPLC analysis shows little, if any, change during storage. After warming to room temperature, the mixture (pH 7.77) was acidified to pH 0.20 by the careful addition of concentrated HCl (11 mL required, C02 evolution; at pH -1.40 a colorless solid begins to precipitate). The resulting suspension was extracted with EtOAc (x4, -500 mL total volume; HPLC analysis is carried out in an aqueous fraction after each EtOAc extraction). The aqueous layer (pH 0.38) After the first EtOAc extraction the pH was adjusted to 0.18 by the addition of concentrated HCl (-1.6 mL required). The aqueous layer (pH 0.37) after the second extraction of EtOAc is adjusted to a pH of 0.17 by the addition of concentrated HCl (-0.8 mL required). The aqueous layer does not require an additional pH adjustment after the remaining EtOAc extractions (extraction # 3, pH 0.19, extraction # 4, pH 0.19). The organic fractions are combined. After drying (MgSO4), the solvent was removed under reduced pressure to give the compound of Formula II crude title as an almost colorless granular solid which was dried under vacuum (pump) for 16 hours: 11.42 g (99.53% of performance); CLAR, 100% (area%). Elemental analysis: C? 2H? 6Cl203 [55465-020-31, TR46373] Calculated: C, 64.27%; H, 7.19% Found: C, 64.19%; H, 7.09% The compound of the crude formula (5.0 g) was dissolved with heating to -85 ° C in distilled water (19 mL), then removed from the heat source and allowed to cool. At -53 ° C, the material begins to crystallize. After standing at room temperature for 2 hours, the solid was collected by filtration and washed with ice-water cooling. The volume of water was removed by introducing nitrogen through the filter cake. The material was then dried under vacuum (bomb) for 17 hours to give the compound of the Formula the title as large colorless needles: 4.33 g (86.6% recovery); mp 16.55.55.6 ° C (in MettIer FP800 system); CLAR, 100% (% area). Elemental analysis: Ci2H? 6Cl203 [55465-023-15, TR46905] Calculated: C, 64.27%; H, 7.19% Found: C, 64.42%; H, 7.04% F. Esterification of L-pyroglutamic acid (Formula E) to form ethyl ester of L-pyroglutamic acid (Formula F) A reaction vessel was charged with ethanol (49.0 liters) and cooled to -5 ° C. The reaction vessel was then charged with thionyl chloride (4.97 kg) so that the temperature of the mixture does not exceed 0 ° C. After completing the addition of thionyl chloride, the mixture was again cooled to -5 ° C and L-pyroglutamic acid (Formula E) was added in portions so that the temperature was maintained between 0 and -5 ° C during the addition.

After addition of the acid, the reaction mixture was heated to 20 to 25 ° C and stirred for 5 hours. The reaction mixture was then evaporated under vacuum (T max 45 ° C) to approximately 15% of its original volume. The remaining oil is then dissolved in toluene (49 liters). The toluene solution was then cooled to approximately ° C and triethyl amine (8.45 kg) was added slowly so that the maximum temperature was between 20 and 25 ° C. The resulting suspension was stirred for 30 minutes and then filtered. The filter cake was washed with toluene (about 5 liters). The filtrate was reduced to 50 ° C under vacuum to a total volume of about 10 liters. The crystallization is initiated by the slow addition of cyclohexane (8 liters) at 50 ° C and then cooling to about 30 ° C. After the formation of the seeding the mixture was cooled to 20 to 25 ° C and loaded with a second 8-liter portion of cyclohexane. The mixture was then cooled to 6 to 8 ° C, stirred for 1 hour, and the resulting crystals are filtered completely. The crystals were washed twice with cyclohexane (4 liters each washed). The yield is 4.89 kg (82%) of the ethyl ester of L-pyroglutamic acid (Formula F) as colorless needles. G. BOC protection of L-Pyroglutamic acid (Formula G) The ethyl ester of L-pyroglutamic acid (Formula F) (5.00 kg) was dissolved at room temperature in toluene (24.97 liters) .. 4-Dimethylaminopyridine (0.19 kg) was then added to the solution. The reaction mixture was then charged with a solution of BOC anhydride (7.29 kg) was dissolved in toluene (24.97 liters) so that the reaction temperature does not exceed 25 ° C. After the addition was complete, the reaction temperature was stirred for 3 hours at 25aC. The reaction mixture was then charged with saturated NaHC03 solution (49.94 liters) and stirred vigorously for 10 minutes before separation of the organic and aqueous phases. The separated organic layer was washed 2 times with water (24.97 liters each). The organic layer was then evaporated from the solvent under vacuum at a maximum of 50 ° C. The colorless oil until light yellow remaining crystallized when resting. The theoretical yield is 8.18 kg (31.81 mol) of the (5S) -2-oxopyrrolidine-1,5-dicarboxylic acid (1, 1-dimethylethyl) ester (Formula G). H. Reduction and elimination of superhydride The ester 1- (1,1-dimethylethyl), 5-ethyl (5S) -2-oxopyrrolidine-1,5-dicarboxylic acid (Formula G) (4.80 kg) was dissolved in toluene ( 30.97 liters, Kf max 0.01% water) and cooled to -50 ° C. This solution was charged with superhydride (1M LiEt3BH in THF, 19.96 liters) so that the reaction temperature did not exceed -45 ° C. After the addition was complete, the mixture was stirred at -45 to -50 ° C for 30 minutes. The N-ethyldiisopropylamine (DIPEA, 14.47 liters) was then added to the reaction mixture so that the temperature does not exceed -452C. Dimetiaminopyridine (0.030 kg) was added as a solid to the mixture. The reaction mixture was then charged with trifluoroacetic anhydride (TFAA) (4.70 kg) so that the reaction temperature does not exceed -452C. After the addition was complete, the reaction mixture was warmed to 20 to 25 ° C for 1 hour and held for an additional 2 hours at this temperature. The reaction mixture was then cooled to 0 ° C and charged slowly with water (48.00 liters) so that the reaction temperature did not exceed 5 ° C. The aqueous and organic phases are then separated and the organic phase washed again with 48 liters of water (0 to 5 ° C). The organic layer was then evaporated and degassed at 40 ° C. A yellowish oil is obtained with a yield of 4.5 kg (18.66 mol, 100%) of the 4- (5-dihydro-1H-pyrrol-1, 5-dicarboxylic acid 1- (1-dimethylethyl), 5-ethyl ester ( BOC-DHPEE) (Formula G '). I. Hydrolysis of BOC-DHPEE (Formula G ') A prepared solution of 4- (5-dihydro-1H-pyrrol-1, 5-dicarboxylic acid 1- (1-dimethylethyl) ester, 5-ethyl ester (BOC-DHPEE) (Formula G ') (6.00 kg) and ethanol (24.00 liters) was cooled to 0 to 5 ° C and treated slowly at this temperature with a solution of lithium hydroxide hydrate (2.09 kg) in water (20.87 liters) to produce a turbid solution. This turbid solution was then warmed to 20 to 25 ° C and stirred for 2 hours at this temperature. The reaction mixture was then evaporated to a volume of about 10.5 liters at a maximum temperature of 40 ° C under vacuum and charged with water (24.00 liters) and t-butylmethyl ether (TBME or MTBE), (24 liters) and mixed for 10 minutes. The aqueous and organic phases are separated and the aqueous phase is charged again with 24 liters of TMBE. This mixture then cooled from 5 to 10 ° C, and the pH was adjusted to 2.3 to 2.3 using 85% H3P0-water (1: 4) while stirring vigorously.The temperature is maintained during this process at 5 to 10 ° C for stability The organic and aqueous layers are separated The organic layer is stored and the aqueous layer is extracted again with 24 liters of TBME pre-cooled to 5 to 10 ° C.

The resulting organic layer was combined with the stored organic layer and loaded with diisopropylethylamine (DIPEA) (4.82 kg). The solution was then evaporated and degassed at a maximum temperature of 30 ° C under vacuum. The yield is 7.84 kg (22.88 mol, 92%) [N-BOC dehydroproline * DIPEA (BOC-DHP)]. J. Amide formation in BOC-DHP BOC-DHP, synthesized by saponification as described in part 1 may contain water. Therefore, an azeotropic distillation with toluene is applied before running the reaction. However, due to the excess of reagents, the calculation of raw materials is based on the amount of BOC-DHP before removing any water. For the azeotropic distillation, BOC-DHP was diluted with toluene to a solution of approximately 30%. The toluene was removed under vacuum at 40 ° C. The treated BOC-DHP (6.00 kg) is then dissolved in THF (48.0 liters). The solution was loaded with DIPEA (2.26 kg) and the reaction mixture was cooled to -20 to -25 ° C. Mesyl chloride (3.01 kg) was then added slowly. During this addition, precipitates the DIPEA hydrochloride. The resulting suspension was then stirred for 2 hours at -20 ° C followed by saturation with ammonia by means of a sub-surface gas entry. While the ammonia is added, the reaction is warmed to 0 ° C. After saturation, the reaction mixture is heated to 20 ° C and stirred for 3 hours. After stirring, the reaction mixture was filtered to remove the hydrochloride. The filter cake was washed with THF- (12 liters) in several portions. The filtrate was concentrated under vacuum at a maximum temperature of 40 ° C and then dissolved in methylene chloride. (33.33 liters). The solution was washed with water (26.66 liters). The aqueous and organic phases are separated and the aqueous phase is extracted twice with methylene chloride (20 liters each). The resulting organic layers were combined and concentrated under vacuum and degassed to remove any excess Hünigs base. The yield is 3.35 kg (15.77 mol, 90%) of 1- (1,1-dimethylethyl) ester of (5S) -5-aminocarbonyl-4,5-dihydro-lH-pyrrole-l-carboxylic acid (BOC-DHP) A) (Formula G ''). K. Cyclopropanation of 1- (1,1-dimethylethyl) ester of (5S) -5-aminocarbonyl-4,5-dihydro-1H-pyrrole-1-carboxylic acid (Formula G ") A first reactor, Reactor A, was loaded with BOC-DHPA (Formula IV) (4 kg) dissolved in methylene chloride (18.0 liters) and kept at 20 ° C. A second reactor, Reactor B, was charged with methylene chloride (18.00 liters) and cooled to -30 ° C. Reactor B was then charged with dimethoxy ethane (DME) (3.36 kg), followed by a 30% solution of diethyl zinc (15.36 kg) in toluene, which maintains the temperature between -30 and -25 ° C. Reactor B was then charged with diiodomethane (19.99 kg) while maintaining the reaction temperature between -30 and -25 ° C. After completing the addition of the diiodomethane, the mixture was stirred for 45 minutes at -30 to -25 ° C. This mixture was then charged to Reactor A by means of a cooled tube (-20 to -25 ° C). Charging is carried out slowly in portions of about 5% that the reaction temperature of Reactor A is maintained between 22 and 24 ° C until the reaction is complete. Following completion of the reaction, the mixture of Reactor A was cooled to 5 to 10 ° C. The reaction mixture was then slowly charged with saturated bicarbonate solution (21.6 liters) so that the reaction temperature does not exceed 15 ° C. Followed by the addition, the reaction mixture was stirred for at least 1 hour while forming a precipitate. The suspension was filtered. The resulting filter cake is transferred back to the vessel, stirred again with methylene chloride (14.4 liters) for 30 minutes; and it was re-filtered. Following this second filtration, the filter cake was washed with the addition of methylene chloride (7.2 liters). The filtrates are then separated in the organic and aqueous phases and the organic phase is washed with saturated medium brine (21.6 liters). The solvent was then removed by vacuum at a maximum temperature of 30 ° C and exchanged for heptane. A thick mixture of the crude product in heptane is obtained. The final volume of the suspension after the exchange solvent is 14.4 liters. The crude product is isolated by filtration. The filter cake was washed with heptane (2.9 liters) and then dried under vacuum at a constant weight. The yield of the crude is 2.76 kg (12.2 mol, 72%) ester 1, 1-dimethylethyl of [ÍS- (la, 3ß, 5a] -3-aminocarbonyl) -2- azabicyclo [3.1.0] hexane-2-carboxylic acid (Formula H). To purify, the raw material forms suspension in an amount of 8 so many of a 1: 1 mixture of butyl acetate // heptane at 20 to 22 ° C for 4 hours. The material was filtered and the filter cake was washed with an approximate amount of heptane. The yield is 2.11 kg (9.33 mol, 55%) 1,1-dimethylethyl ester of [ÍS- (la, 3ß, 5a] -3-aminocarbonyl) -2-azabicyclo [3.1.0] hexane-2-carboxylic acid (Formula H) L. Deprotection of [1S- (la, 3ß, 5a)] -3- (aminocarbonyl) -2-azabicyclo [3.1.0] hexane-2-carbonylic acid 1,1-dimethylethyl ester (Formula H) for form (1S, 3S, 5S) -2- azabicyclo [3.1.0] hexane-3-carboxamide (Formula J) A 2-neck 100 ml flask equipped with a mechanical stirrer and a thermocouple was charged with a 1.1- ester. [ÍS- (la, 3ß, 5a] -3-aminocarbonyl) -2-azabicyclo [3.1.0] hexane-2-carboxylic acid dimethylethyl ester (Formula H) (5.0 grams, 22.1 mmol) and THF (20 ml). HCl (2.5 M in EtOAc, 25 mL, 62.5 mmol) was then added to the suspension. The resulting solution was stirred at room temperature for 18 hours during this period of time the precipitation time was observed. The completion of the reaction was monitored by CLAR. The t-butyl methyl ether (MTBE) (30 ml) was added to the suspension and stirred continuously for about 30 additional minutes. The suspension was then filtered under N2 protection to produce a white solid which was washed with MTBE (20 ml). The solid was oven dried under reduced pressure for 48 hours to provide the (1S, 3S, 5S) -2-azabicyclo [3.1.0] hexane-3-carboxamide hydrochloride salt (Formula J, 3.6 grams, 100%) . M. Protection of BOC from (aS) -a-amino-3-hydroxytricyclo [3.3.l.l3,7] decane-1-acetic acid (Formula 2) to form acid (aS) -a [[(1, 1 - dimethylethoxy) carbonyl] amino] -3-hydroxytricyclo [3.3.1.13,7] decane-1-acetic, the acid of Formula 3 A preferred method of preparation of the free acid (Formula 3) is described in Example 3. Alternatively, the following method can be used to make the free acid: The acid (aS) -a-amino-3-hydroxycyclo [3.3.l.l3,7] decane-1-acetic (Formula 2) (469 grams, 2.08 moles) was dissolved in? AOH 1? cooled with ice (5 liters, 5 moles, 2.4 equivalents) in a phase splitter equipped with a temperature probe and a pH probe. The THF (2.5 liters) was added to the solution. The solid BOc20 was then added and the reaction mixture was stirred at room temperature for about 1 hour. The EtOAc (4 liters) was then added with stirring and the resulting aqueous and organic layers are separated. The pH of the aqueous layer was adjusted to 7 with concentrated HCl. The EtOAc (4 liters) was then added and additional HCl was added to lower the pH to about 1. The total volume of concentrated concentrated HCl was 510 ml. The organic and aqueous layers are again separated and the aqueous layer extracted with EtOAc (3 x 3 liters). The organic layers are then combined and washed with water (3 liters) and brine (3 liters). The washed organic layer was then dried with Na 2 SO 4 and concentrated in a rotary evaporator at room temperature until dry. The yield is 542 grams of (aS) -a [[(1,1-dimethylethoxy) carbonyl] amino] -3-hydroxytricyclo [3.3.1.13'7] decane-1-acetic acid (Formula 3). N. Coupling reaction to produce the 1,1-dimethylethyl ester of 3-cyano- (aS) -a- (3-hydroxytricyclo [3.3.1.13'7] ec-l-il) -β-oxo- (ΔS , 3S, 5S) -2- azabicyclo [3.1.0] hexane-2-ethanocarbamic acid (Formula K) A 2-L 3-necked flask equipped with a thermometer, a mechanical stirrer, and a gas inlet was charged with acid ( OS) -a [[(1,1-dimethylethoxy) carbonyl] amino] -3-hydroxy tricyclo [3.3. 1 .3,7] decane-1-acetic acid (Formula 3) (50 grams, 153.8 mmol). The THF (200 mL) was added and stirred to produce a clear solution. The solution was cooled to -6 ° C in an acetone-dry ice-water bath. Methanesulfonyl chloride (Mes-Cl) (13.1 ml, 169 mmol, 1.1 equivalents) was then added as a single portion followed by diisopropylethylamine (94 ml, 539 mmol, 1.1 equivalents). The diisopropylethylamine was added slowly over a period of about 4 weeks to maintain the internal temperature below 8 ° C. The reaction mixture was stirred at 0 ° C until all the acid was converted to a mixed anhydride. The hydrochloride salt of (lS, 3S, 5S) -2-azabicyclo [3.1.0] hexane-3-carboxamide (32.5 grams, 200 mmol, 1.1 equivalents) and hydroxybenzotriazole (HOBT) (1.04 grams, 7.6 mmol. 0.05 equivalents) are then added to a simple portion and the flask was removed from the cooling bath. The reaction mixture was stirred at room temperature for 2 hours and then left overnight at room temperature.

O Dehydration and hydrolysis to produce 3-cyano- (aS) -a- (3-hydroxytricyclo [3 .3.1.13,7] dec-1-yl) -β-oxo- (1S-dimethylethyl) ester 3S, 5S) -2- azabicyclo [3 .1.0] hexane-2-ethanocarbamic acid (Formula L) Pyridine (6 equivalents, 922 mmol, 74.6 ml) was added to the reaction mixture of Part N and the mixture The reaction mixture was cooled in a cooling bath to -8 ° C. Trifluoroacetic anhydride (TFAA) (4 equivalents, 616 mmol, 87 ml) was then added slowly for 6 minutes while maintaining the temperature between 10 ° C. The reaction was stirred at 24 ° C for 0.5 h and verified via HPLC (30 ml, 0.5 ml AcN, 0.5 ml H20) during the disappearance of Part N Compound K. The reaction was then cooled in a cooling bath to about -3 ° C. C. NaOH (5 N, 6 equivalents, 0.925 mol, 185 ml) was added to the reaction for 10 minutes (aqueous pH = 9 .9) while maintaining the reaction temperature below 10 ° C. Aqueous K2C03 (319 grams, 15 equivalents, dissolved in 510 ml H20) was added for 5 minutes (temperature = 8 ° C, pH 11.1 aqueous). The reaction was allowed to run for 7 hours 40 minutes. The reaction was completed when all intermediates are hydrolysed to the penultimate as determined by means of HPLC (30 μl, 0.5 ml AcN, 0.5 ml H20). The EtOAc (500 mL) is then added to the reaction mixture and the resulting organic and aqueous layers are separated. The organic layer was washed with 500 ml of buffer (2M H3P0, 1M NaH2P04 1M). The temperature rose to 23 ° C from 15 ° C; additional time: 5 min., aqueous = 560 ml pH = 4.5, 32 mg product pro CLAR; V org = 1.080 ml. The organic was washed with a second buffer solution of 500 ml; V aq = 780 ml, pH = 2.5, 415 mg product by HPLC; Organic V = 800 ml, 1.02 v / v% pyridine. The organic was washed with 300 ml of brine; V aq = 350 ml, pH = 1.8, 20 mg produced by HPLC. The organic was washed with 130 ml of saturated NaHCO 3 solution; V aq. = 176 ml, pH = 6.0, 780 mg product. The organic was washed with 300 ml of saturated medium brine; V aq. = 330 ml, pH = 5.2, 25 mg of product; Organic V = 650 ml, pyridine 0.045 v / v%. 5 g Darco was added to the organic and stirred for 5 minutes, filtered through 50 g of silica, washed with 4 x 25 ml EtOAc, organic V = 750 ml, pyridine 0.04 v / v%. The organic layer was then distilled to approximately 133 ml. The organic was stirred for 1 hour until the solution became turbid. 133 ml of heptane were added for 15 minutes and the thickened mixture was stirred overnight. 133 ml of heptane were added overnight. The mixture was stirred violently for 20 minutes with mechanical agitation. The solids were filtered completely and the cake was washed with 50 ml 5% EtOAc / heptane; 3.4 g of the product was found in crude 8.86 g after the removal of the solvents from the mother liquor. The crystals of the dried product are heated at 50 ° C under vacuum overnight. 467 g of the product is obtained -73%, 96.6 AP.

P. Deprotection to produce (1S, 3S, 5S) -2- [(2S) -2-amino-2- (3-hydroxytricyclo [3.3.1.13'7] dec-1-yl) -1-oxoethyl] - 2-azabicyclo [3.1.0] hexane-3-carbonitrile, benzoate (1: 1) (Formula M) The 1,1-dimethylethyl ester of 3-cyano- (aS) -a- (3-hydroxycyclo [3.3. 1. l3'7] dec-1-yl) -β-oxo- (1S, 3S, 5S) -2- azabicyclo [3.1.0] hexane-2-ethanocarbamic acid (Formula L) (5.0 grams, 12.04 mmol) is charged to a 3-necked flask Equipped with a thermometer, a mechanical agitation, and a gas inlet. EtOAc, approximately 45 to 50 ml, was added until a clear solution was achieved. The concentrated HCl (3.00 ml, 37% w / w%, 36.14 mmoles, 3 equivalents) was added at room temperature and the reaction mixture was stirred until a solid was produced. The water (30 ml) was then added and the mixture was stirred for 1 to 2 minutes. This reaction mixture is transferred to a separatory funnel and the layers of the reaction mixture are allowed to separate into a divided clear phase. The aqueous layer was adjusted to a lower pH of about 6 with 25% NaOH while keeping the temperature below 25 ° C. The salt exchange is then carried out by the addition of isopropyl alcohol (IPA, 2 to 3 ml) to the aqueous layer followed by the addition of sodium benzoate (0.65 ml of sodium benzoate solution prepared by dissolving 2.6 grams per liter). sodium benzoate in 6.5 ml of water). The remaining solution of sodium benzoate was then added in a dropwise fashion by means of an addition funnel. The resulting reaction mixture was stirred at room temperature for 16 to 24 hours. The solids in the reaction mixture were then filtered on a Buchner funnel and washed with water until the solid gave a negative test for Cl- with AgN03. The solids are then washed with heptane (10 ml) to dry completely of water, dried with air in the funnel, dried in a vacuum oven at 35 ° C until KF < 5%. The yield is 79%, 4.1 grams. Q. Desprot to produce a free base M ' The compound (L) of part O (300g, 0.723 mol, 90.6% strength), methylene chloride (3L), methanol (288 ml, 7.23 mol) and concentrated hydrochloric acid (36%) (288 ml, 7.23 mol) are charged to a 12-L 3-necked flask equipped with a mechanical stirrer, temperature probe and N2 gas inlet. The reaction occurs while the reaction temperature is maintained within the range of from about 20 to about 25 ° C. The reaction mixture was stirred for 18 hours, divided into 2 phases and the upper part of the aqueous layer was collected. To the aqueous layer was added methylene chloride (6 L), and water (720 ml), and 5N NaOH (-600 ml) was added dropwise to adjust the pH to 9.0-10.5. The organic phase contains the hydrochloric salt (identified by CLAR) (Formula L ') was treated with methylene chloride (6 L) and water (720 ml), and 5N sodium hydroxide solution (~600 ml) was added dropwise while maintaining the reaction temperature between 20 and 25 ° C to adjust the pH between 9 and 10.5. NaCl (120g) was added and the mixture is stirred for 20 min. to form a divided phase. The organic layer (6.2L) was collected (contained ~ 174g of the compound M ') and the aqueous layer (1.75L) was discarded (contained 6.5g of the compound M'). The organic layer was washed with 1% salmera solution in NH C1 (450 ml). (1% solution of NH4C1 in brine containing 1 g of NH4C1, 25g NaCl and 74g of H20). From the resulting divided phase 6.0 L of the organic layer were recovered (contains -176 g of compound M 'in the solution) and the aqueous layer (0.45 L) containing 1.4 g of compound M' (-0.4%) was discarded. Ethyl acetate (-4L) was added to the organic layer while CH2C12 was completely distilled at 25 ° C / 50 mm Hg. Distillation is discontinued when a final volume of 2.5L is reached. The organic layer was filtered on a polished filter to remove the solid? ACl and concentrated to -1 Kg (~ 170g of the compound M 'in 1L ethyl acetate) GC analysis: DCM < 0.1%. The water (17 ml) was added dropwise and after 10 minutes the crystallization started. 17 ml of water was added and the resulting thick mixture was stirred for 30 min, filtered, the cake was washed with ethyl acetate and dried at room temperature under vacuum to give 186 g of compound M ', yield 81%. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention is that which is clear from the present description of the invention.

Claims (20)

1. CLAIMS Having described the invention as background, the content of the following claims is claimed as property: 1. Process for the preparation of partially purified phenylalanine dehydrogenase and / or formate dehydrogenase enzyme concentrates (PDH (FDH), characterized in that it comprises: a. prepare a fermentation broth of a microorganism capable of the production of phenylalanine dehydrogenase and / or formate dehydrogenase b Submit the broth to microfluidization to release the activity of the resulting cells and form a microfluidized broth containing PDH and / or FDH enzymes c) Clarify the broth by treating the broth with a flocculating agent to coagulate cell debris, and remove undesirable DNA and proteins, filter the clarified broth, and concentrate the broth to give a partially purified enzyme concentrate. who has an activity PDH / FDH of at least about 400 IU / ml for PDH and at least about 20 IU / ml for FDH. Process according to claim 1, characterized in that the broth is subjected to microfluidization under a pressure in the range from about 12,000 (843.7 kg / cm2) to about 20,000 psi (1406 kg / cm2). Process according to claim 1, characterized in that the broth is subjected to microfluidization maintaining the temperature of the broth below about 252C. 4. Process according to claim 3, characterized in that the temperature of the broth is kept below about 25aC 5. Process according to claim 1, characterized in that the phenylalanine dehydrogenase is obtained from the genera, Sporosarcina, thermoactinomyces. 6. Process according to claim 1, characterized in that the phenylalanine dehydrogenase is obtained from Thermoactinomyces intermedius. 1 . Process according to claim 1, characterized in that the phenylalanine dehydrogenase is obtained from Thermoactinomyces intermedius, ATCC 33205, expressed in Escherichia coli or Pichia pastoris. Process according to claim 1, characterized in that the microorganism is Escherichia coli JM110 (pBMS 2000-PPDFDH-PDH-mod.) 9. Process according to claim 1, characterized in that the clarified broth is ultrafiltered. 10. Process for the preparation of an amine of the structure Formula 2 characterized in that it comprises a. treat an aqueous solution of an acid keto structure Formula 1 with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme (PDH / FDH); and b. adjusting the pH of the reaction mixture with sodium hydroxide to form the desired amine which is substantially free of undesirable excess ammonium ions. Process according to claim 10, characterized in that a partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme is prepared by the process as defined in claim 1. Process according to claim 10, characterized in that the aqueous solution of 3-hydroxy-a-oxotricyclo [3.3.1. l3,7] decane-1-acetic acid, ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and phenylalanine dehydrogenase / formate dehydrogenase enzyme was aged at a temperature in the range from about 35 to about 40aC and maintained at a pH within the range from about 7.8 to about 8.2 for a period within the range of about 24 to 48 hours to produce the amine. 13. Process for preparing an amine protected by BOC from the structure Formula 3 characterized in that it comprises a. provide an aqueous solution of the amino acid of (aS) -a-amino-3-hydroxytricyclo [3.3.1. l, 7] decane-l-acetic structure Prepared using partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme in reductive amination of keto acid in accordance with claim 12; and b. Treat the above aqueous solution with di-tert-butyl bicarbonate to form the amine protected by BOC. Process according to claim 13, characterized in that the pH of the mixture of the aqueous solution of (aS) -a-amino-3-hydroxy-tricyclo [3.3.1.I3'7] decane-1-acetic acid and di-tert-butyl bicarbonate is kept within the range from about 8. 5 to around 12.5. Process according to claim 13, characterized in that it also includes the steps of isolating the BOC-protected amine from the reaction mixture and scting the protected BOC amine to crystallization. 16. Partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme, characterized in that it is prepared by the process according to claim 1. 17. Partially purified phenylalanine dehydrogenase / formate dehydrogenase, characterized in that it has PDH and FDH activity. 18. Process is provided for the preparation of the protected amine by BOC of the structure Formula 3 characterized in that it comprises a. prepare a partially purified phenylamine dehydrogenase / formate dehydrogenase enzyme concentrate; b. treat an aqueous solution of an acid keto structure Formula 1 with ammonium formate, nicotinamide adenine dinucleotide and dithiothreitol and partially purified phenylalanine dehydrogenase / formate dehydrogenase enzyme concentrate (PDF / FDH); c. adjust the pH of the reaction mixture with sodium hydroxide to form the desired amine, Formula 2 which is substantially free of undesirable excess ammonium ions; and d. without isolating the free acid intermediate, treat the above aqueous solution with di-tert-butyl bicarbonate to form the BOC-protected amine of the structure Formula 3 19. Process according to claim 18, characterized in that the enzyme phenylalanine dehydrogenase / formate dehydrogenase is prepared by the following steps: a. preparing a fermentation broth of a microorganism capable of the production of phenylalanine dehydrogenase and / or formate dehydrogenase; b. scting the broth to microfluidization to release the activity of the resulting cells and form a microfluidized broth having PDH and / or FDH activity. c. Clarify the broth to treat the broth with flocculating agent to coagulate cell debris; d. Filter the clarified broth; and e. Concentrate the broth to give a purified concentrated enzyme having a PDH / FDH activity of at least about 400 IU / ml for PDH and at least about 20 IU / l for FDH. 20. Method to form a free base compound of the structure characterized in that it provides the supply of a compound protected by BOC from the structure prepared according to claim 13. treating the compound protected by BOC with mesyl chloride and Huning base and the compound J of the structure and 1-hydroxybenzotriazole (HOBT) to form an intermediate compound protected by BOC of structure K dehydrate intermediary K in the presence of pyridine and trifluoroacetic anhydride, and then hydrolyze the reaction product in the presence of a strong base to form compound L. and treating compound L with hydrochloric acid to form the corresponding hydrochloric acid salt L ' Treat compound L 'with hydrochloric acid and sodium hydroxide to form the free base of compound M'. SUMMARY OF THE INVENTION A process for the production of pyrrolidine-based inhibitors fused to cyclopropyl dipeptidyl peptidase IV is described which employs a BOC-protected amine of the structure prepared by submitting an acid to the structure for reductive amination to treat the acid with ammonium formate, nicotinamide adenine dinucleotide, dithiothreitol and enzyme concentrate phenylalanine dehydrogenase / formate dehydrogenase (PDH / FDH) and without isolation to treat the amine resulting from structure 2 with di-tert-butyl bicarbonate to form the amine protected with BOC.