MXPA06011082A - Cry1f and cry1ac transgenic cotton lines and event-specific identification thereof - Google Patents

Abstract

This invention relates to plant breeding and the protection of plants from insects. More specifically, this invention includes novel transformation events of cotton plants comprising one or more polynucleotide sequences, as described herein, inserted into specific site(s) within the genome of a cotton cell. In highly preferred embodiments, said polynucleotide sequences encode“stacked”Cry1F and Cry1Ac lepidopteran insect inhibitory proteins. However, the subject invention includes plants having single cry1F or cry1Ac events, as described herein. Additionally, the invention is related to cotton plants derived from that transformation event and to assays for detecting the presence of the event in a sample. More specifically, the present invention provides DNA and related assays for detecting the presence of certain insect-resistance events in cotton. The assays are based on the DNA sequences of recombinant constructs inserted into the cotton genome and of the genomic sequences flanking the insertion sites. These sequences are unique. Based on these insert and border sequences, event-specific primers were generated. PCR analysis demonstrated that these cotton lines can be identified in different cotton genotypes by analysis of the PCR amplicons generated with these event-specific primer sets. Thus, these and other related procedures can be used to uniquely identify these cotton lines. Kits and conditions useful in conducting the assays are also provided. These materials and methods can also be used to assist breeding programs to further develop traits in cotton.

Description

TRANSGENIC LINES OF COTTON CRY1F AND CflYI AC AND IDENTIFICATION OF THE SAME OF SPECIFIC EVENTS BACKGROUND OF THE INVENTION Cotton is an important fiber crop. Conical reproduction and biotechnology have been applied to cotton in order to improve its agronomic traits and product quality. One of these agronomic traits is the resistance to insects, the venies of which are easily appreciable. Genes encoding insecticidal proteins have been introduced into cotton buds. To alleviate any concern that a given insect group might develop resistance to a single insect protein group, plants that produce two types of insecticidal proteins are often developed. In that way, the probabilities that an insect is hypothetically capable of developing resistance to two different insecticidal proteins are extremely low. The CrylAc insecticidal proteins and genes are known in the art. See, for example, US Pat. Nos. 6,114,138, 5,710,020, 6,251, 656 and 6,229,004. Cry1 F insecticidal proteins and genes are also known in the art. See, for example, United States Patent Nos. 5,188,960, 5,691, 308, 6,096,708 and 6,573,240.

The expression of foreign genes in plants is influenced by the place where the foreign gene is inserted into the chromosome. This could be due to the structure of the chromatin (for example heterochromatin) or to the proximity of the transcription regulation elements (for example, enhancers) near the integration site (Weising et al., Ann. Rev. Genet 22: 421- 477, 1988). For example, the same gene in the same type of transgenic plant (or other organism) may exhibit a wide variation in expression level between different events. There may be spatial or temporal differences in expression patterns. For example, differences in the relative expression of a transgene in various vegetale bodies may not correspond to the patterns estimated by the regulatory elements present in the introduced gene construct. Therefore, there is a need to create and select a large number of events in order to identify an event that optimally expresses a gene of interest introduced. From the commercial point of view, it is common to produce hundreds to thousands of different events and to select, among those events, a single event that has the levels and patterns of transgenic expression desired. An event having the levels and / or patterns of expression of advantageous transgenes serves to incorporate the transgene to other genetic bases by means of sexual exogamy using conventional breeding methods. The progeny of said crosses maintains the expression characteristics of the transgene of the original transformant. This strategy is used to ensure safe expression of the gene in a number of varieties that are well adapted to local growing conditions. It would be advantageous to be able to detect the presence of a particular event in order to determine if the progeny of a sexual cross contains a transgene of interest. In addition, a method to detect a particular event would be useful, for example to comply with the regulations that require approval prior to market presentation and the approval and labeling of foods derived from recombinant crop plants. It is possible to detect the presence of a transgene by means of any well known method of detection of nucleic acids such as the chain reaction of the polymerase (PCR) or DNA hybrition using nucleic acid probes. These detection methods usually point to frequently used genetic elements, such as promoters, terminators, genetic markers and so on. As a result, these methods may not serve to discriminate between different events, especially those produced using the same DNA construct, unless the sequence of the chromosomal DNA adjacent to the inserted DNA ("flanking DNA") is known. A PCR assay of specific events is the one described, for example, by Windels et al. (Med. Fac. Landbouww, Univ. Gent 64 / 5b: 459462, (1999) .This was related to the identification of the event 40-3- 2 in soybeans with glyphosate tolerance by PCR using a set of primers that spanned the junction between the insert and the flanking DNA.

More specifically, one primer included the insert sequence and the second primer included the flanking DNA sequence. The US patent applications Nos. 20020120964 A1 and 20040009504 A1 relate to the event PV-GHGT07 (1445) in cotton and to compositions and methods for the detection thereof. WO 02/100163 relates to the event MON15985 in cotton and to compositions and methods for the detection thereof. WO 2004/011601 relates to corn plants with the MON863 event and to compositions and methods for detection thereof. The document WO 2004/072235 relates to corn plants with the event MON88913 and with compositions and methods for the detection thereof. However, none of these processes and materials that could serve to specifically identify cotton with the addition of Cryl F and / or CrylAc described below were known to date.

BRIEF DESCRIPTION OF THE INVENTION This invention relates to the controlled reproduction of plants and the protection of plants against insects. More specifically, the present invention includes novel transformation events of cotton plants, comprising one or more polynucleotide sequences, as described herein, inserted into one or more specific sites within the genome of the cotton cell. In highly preferred embodiments, said polynucleotide sequences encode the "accumulated" proteins Cryl F and Cryl ac lepidopteran insect inhibitors. However, the present invention includes plans that have unique Cryl F or CrylAc events, as described in this document. In addition, the present invention provides tests for determining the presence of one or more of the events in question in a sample. The present invention presented DNA and related assays to eliminate the presence of certain insect resistance events in cotton. The assays are based on the DNA sequences of the recombinant constructs inserted into the cotton genome and of the genomic sequences flanking the insertion sites. Equipment and advantageous conditions are also presented to carry out the tests. Accordingly, the present invention relates, in part, to the cloning and analysis of the DNA sequences of a complete cryl F insert, full crylAc inserts, and flanking regions thereof (in the transgenic cotton lines). These sequences are unique. Based on these insert and flanking sequences, specific event initiators were generated. The PCR analysis showed that these events can be identified by the analysis of the PCR amplicons generated with these sets of specific event initiators. Accordingly, these and other related procedures can be used to uniquely identify the cotton lines comprising one or more events according to the present invention.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 illustrates the inserted cryl F transgene and the flanking sequences for event 281-24-236 in cotton. This figure also exhibits the amplicons and primers described herein. Figure 2 illustrates the inserted crylAc transgene and the flanking sequences for event 3006-210-23 in cotton. This figure also exhibits the amplicons and primers described herein.

BRIEF DESCRIPTION OF THE SEQUENCES I KNOW THAT. ID. NO: 1 is the DNA sequence for the Cryl F insert of event 281-24-236 and its flanking sequences. I KNOW THAT. ID. NO: 2 is the DNA sequence for the Qy1 Ac insert of event 3006-210-23 and its flanking sequences. I KNOW THAT. ID. NO: 3 is the sequence of the forward primer "281-14" used with the reverse primer "281-15" to amplify a 603 bp amplicon spanning the 5 'junction between the flanking and inserted regions of the event 281-24-236 of cryl F.

I KNOW THAT. ID. NO: 4 is the sequence of the reverse primer "281-15" used with the forward primer "281-14" to amplify a 603 bp amplicon spanning the 5 'junction between the flanking and inserted regions of the event 281-24-236 of cryl F. SEQ. ID. NO: 5 is the 603 bp sequence of the amplicon produced using the SEQ primers. ID. Nos: 3 and 4. SEQ. ID. NO: 6 is the sequence of the forward primer "281-9" used with the reverse primer "281-10" to amplify a 562 bp amplicon spanning the 3 'junction between the insert and the flanking regions of event 281 -24- 236 of cryl F. SEQ. ID. NO: 7 is the sequence of the reverse primer "281-10" used with the forward primer "281-9" to amplify a 562 bp amplicon spanning the 3 'junction between the flanking and inserted regions of the event 281-24-236 of cryl F. SEQ. ID. NO: 8 is the 562 bp sequence of the amplicon produced using the SEQ primers. ID. Nos. 6 and 7. SEQ. ID. NO: 9 is the sequence of the forward primer "3006-20" used with the reverse primer "3006-22" to amplify a 614 bp amplicon spanning the 5 'junction between the flanking and inserted regions of the event 3006-210-23 of c / y1 Ac. I KNOW THAT. ID. NO: 10 is the sequence of the reverse primer "3006-22" used with the reverse primer "3006-20" to amplify a 614 bp amplicon spanning the 5 'junction between the flanking and inserted regions of the event 3006-210-23 of crylAc. I KNOW THAT. ID. NO: 11 is the 614 bp sequence of the amplicon produced using the SEQ primers. ID. Nos. 9 and 10. SEQ. ID. NO: 12 is the sequence of the forward primer "3006-9" used with the reverse primer "3006-12" to amplify a 662 bp amplicon spanning the 3 'junction between the flanking and inserted regions of the event 3006-210-23 of sylAc. I KNOW THAT. ID. NO: 13 is the sequence of the reverse primer "3006-12" used with the reverse primer "3006-9" to amplify a 662 bp amplicon spanning the 3 'junction between the flanking and inserted regions of the event 3006-210-23 of crylAc. I KNOW THAT. ID. NO: 14 is the 662 bp sequence of the amplicon produced using the SEQ primers. ID. Nos. 12 and 13. SEQ. ID. NO: 15 is a segment of cotton genomic DNA for event 281-24-236 (53 missing bases). I KNOW THAT. ID. NO: 16 is a segment of cotton genomic DNA for event 3006-210-23 (16 bases faltanies).

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the conyrolate reproduction of plants and to the protection of plants against insects.

More specifically, the present invention includes novel transformation events of cotton plants (e.g., Gossypium hirsutum and Gossypium barbadense) comprising one or more polynucleotide sequences, as described herein, inserted at one or more sites specific within the genome of a cotton cell. In highly preferred embodiments, said polynucleotide sequences encode the "accumulated" proteins Cryl F and Crylac inhibiting lepidopteran insects. However, the present invention includes plants that have unique Cryl F or CrylAc events, as described herein. Also, the present invention presents tests for the detection of the presence of one or more of the events in question in a sample. Among the aspects of the present invention are methods for designing and / or producing any of the nucleic acid molecules for diagnosis exemplified or proposed herein, especially those that are based, in whole or in part, on the present flanking sequences. More specifically, the present invention relates, in part, to two transgenic cotton events (cryl F 281-24-236 and crylAc 3006-210-23), with plant lines comprising these events and with the cloning and analysis of the DNA sequences of this cryl F insert, these crylAc inserts and / or the border regions thereof. The plant lines of the present invention can be detected using the sequences described and proposed in the present.

In the preferred embodiments, the present invention relates to insect-resistant cotton lines and identification thereof, which produce two "accumulated" insecticidal proteins known as Cryl F and CrylAc. In the preferred embodiments, a plant line of the present invention comprises the event of cryl F 281-24-236 and the event of crylAc 3006-210-23. However, the plants of the present invention can comprise any one or, preferably, both events described herein. As noted earlier in the background section, the introduction and integration of a transgene into the genome of a plant involves certain random events (hence the name "event" for a given insert that is expressed). In other words, with numerous transformation techniques such as transformation with Agrobacterium, "the gene gun" and WHISKERS, it can not be predicted where an íransgene will be inserted into the genome. Accordingly, the de fi nfication of the flanking genomic DNA of the plant on both sides of the insert may be important to identify a plant having a given insertion event. For example, PCR primers that generate a PCR amplicon can be designed from the binding region of the insert and the host genome. This PCR amplicon can be used to identify a singular or distinctive type of insertion event. Since "events" are random events and in general can not be duplicated, as part of this description, at least 2500 seeds of a cotton line comprising the event of cryl F 281-24-236 and the event of crylAc 3006-210-23, made available to the public without restrictions (although subject to patent rights), in the American Type Culture Collection (ATCC), Rockville, Md. 20852. The deposit has been designated as an ATCC Deposit No PTA-6233 The deposit shall remain unrestricted with the ATCC depositary, which is a depository open to the public, for a period of 30 years, or five years after the most recent request, or during the term of the patent, whichever lasts the longest, and it will be replaced if it becomes non-viable during that period. The seeds deposited are part of the present invention.

As is evident, cotton plants can be grown from these seeds and said plants are part of the present invention. The present invention also relates to DNA sequences contained in these cotton plants, which serve to detect these plants and the progeny thereof. The detection methods and equipment of the present invention can be oriented towards the identification of any one, two or even the three events, depending on the final purpose of the analysis. In this document definitions and examples are presented for the purpose of helping to describe the present invention and to guide people normally trained in the art to practice the invention. Unless otherwise indicated, the terms should be taken in accordance with the conventional use given by persons ordinarily skilled in the art. The nomenclature of the DNA bases set out in 37 CFR §1.822 is used. A transgenic "event" is produced by the transformation of plant cells with heterologous DNA, i.e., a nucleic acid construct that includes an inert transgene, resulting in the regeneration of the pneumonia population as a result of the insertion of the transgene into the genome. of the plant, and by the selection of a specific plant characterized by the insertion in a specific site of the genome. The term "event" refers to an original transformant and the progeny of the transformant that includes the heterologous DNA. The term "event" also refers to the progeny produced by an exogamic cross between the transformant and another variety that includes the geonomic / transgenic DNA. Even after backcrossing repelled to a recurrent parent, the inserted transgene DNA and the flanking genomic DNA (genomic / transgenic DNA) of the transformed parent is present in the progeny of the cross and in the same chromosomal location. The term "event" also refers to the DNA of the original transformant and the inserted DNA that, as expected, would be transferred to a progeny that receives the inserted DNA that includes the transgene of interest as a result of the sexual crossing of a parental line that it includes the inserted DNA (that is, the original transformant and the progeny that results from inbreeding) and a parental line that does not contain the inserted DNA.

"A binding sequence" encompasses the point at which the DNA inserted into the genome is linked to the DNA of the native cotton genome flanking the insertion point, the identification or detection of one or the other binding sequence in the DNA being sufficient. genetic material of a plant to diagnose the event. DNA sequences spanning the insertions in the cotton events described here and similar stretches of flanking DNA are included. Specific examples of said diagnostic sequences are presented herein; however, other sequences that overlap the junctions of the insertions or junctions of the inserts and the genomic sequence are also diagnostic and could be used according to the present invention. The present invention relates to the identification of said flanking, binding and insertion sequences. The PCR primers and consequent amplicons are included in the invention. According to the present invention, PCR analysis methods utilizing amplicons spanning all the inserted DNA and its edges (from CryF1 281-24-236 and / or CrylAc 3006-210-23) can be used to detect or identify transgenic cotton varieties marketed or lines derived from the present patented phronesic cotton lines. We present here the complete sequences of each of these insertions, together with the respective flanking sequences, under the name SEQ. ID. DO NOT. 1 (281-24-236 of Cryl F) and SEQ. ID. NO: 2 (3006-210-23 of crylAc). Table 1 presents the coordinates of the insertion and flanking sequences corresponding to these events.

TABLE I Event For the SEQ. ID. DO NOT. indicated: residual location of: Flanking Event 5 'Flanking Insertion 3' Cryl F 281-24-236 1-2074 2,075-12,748 12,749-15,490 (SEQ ID NO: 1) CrylAc 3006-210-23 1-527 528-8,900 8,901-93,382 (SEQ ID NO: 2) These insertion events and other components thereof are illustrated in more detail in Figures 1 and 2. These sequences (in particular the flanking sequences) are unique. Based on these insertion and edge sequences, specific event initiators are generated. The PCR analysis showed that these cotton lines can be identified in other genotypes other than cotton by analyzing PCR amplicons generated with these sets of specific event initiators. Accordingly, these and other related procedures can be used to unmistakably identify these cotton lines. The sequences identified here are unique. For example, searches for BLAST in the GENBANK databases did not reveal any significant homology between the cloned border sequences and the sequences contained in the database.

The detection techniques of the present invention are especially advantageous in combination with the controlled reproduction of plants, to determine which plants of the progeny comprise a given event, once a progenitor plant comprising one event of interest is crossed with another line of interest. plants in an attempt to impart one or more additional traits of interest in the progeny. These methods of PCR analysis bring benefits to the programs of controlled reproduction of cotton, as well as to the quality conírol, especially in the case of the seeds of ransgenic cotton existing in the market. Now you can also prepare and use PCR detection equipment for these transgenic cotton lines. This can also bring benefits for product registration and product management. Furthermore, flanking sequences of cotton can also be used for the purpose of specifically identifying the location of each insert in the genome. This information can be used to prepare specific molecular marker systems for each event. These can be used for accelerated reproduction strategies and to establish linkage data. In addition, information on the flanking sequences can be used to study and characterize the processes of transgenic integration, the characteristics of the integration sites in the genome, the classification of events, the stability of the transgenes and their flanking sequences and gene expression ( especially in regard to gene silencing, transgene methylation patterns, position effects and potential elements related to expression such as MARS [matrix binding regions] and so on) In light of the entire description, it should be apparent that the present invention includes the seeds available under deposit No. PTA-6233 of the ATCC. The present invention also includes an insect resistant cotton cloth grown from a seed deposited in the ATCC under accession number PTA-6233. The present invention also includes the parts of said plant, such as leaves, tissue samples, seeds produced by said plant, pollen and others. In addition, the present invention includes the plants of offspring and / or progeny of the plants grown from the deposited seeds, preferably an insect-resistant cotton plant in which said plant has a genome comprising a detectable binding sequence. Wild-type insert DNA / genomic DNA as described herein. In the present context, the term "cotton" refers to Gossypium hirsutum and includes all varieties of plants that can be reproduced with cotton, including Gossypium barbadense. The invention further includes processes for effecting crosses using a plant of the present invention as at least one of the progenitors. For example, the present invention includes a hybrid plant of F-i having as one or both progenitors any of the plants described herein. Also included in the present invention is the seed produced by said F-hybrids. of the present invention. This invention includes a method to produce a hybrid F- seed? crossing a typified plant with a different plant (for example, an inbred parent) and harvesting the hybrid seed thus produced. The present invention includes an exemplified plant that is a female parent or a male parent. The characteristics of the plants thus obtained can be improved by means of the meticulous study of the progenitor plants. It is possible to reproduce a cotton plant that resists insects by crossing it by sexual reproduction, first of all, by the progenitor cotton plant which consists of a cotton plant cultivated from the seed of any of the lines that are made reference in the presence and a second progenitor cotton plant, to thus produce a plurality of plants of the first line of descent; and then selecting a plant from the first line of descent that is resistant to insects (or that has at least one of the occurrences of the present invention) and reproducing the plant of the first line of descent, in order to produce a plurality of plants of the second line of descent and then selecting among the plañías of the second line of descent a plant that is resistant to insects (or that possesses at least one of the events of the present invention). These steps may also include the backcrossing of the plant of the first line of descent or of the plant of the second line of descent with the second progenitor cotton plant or the third progenitor cotton plant. A cotton crop comprising cotton seeds of the present invention, or the progeny thereof, can then be planted. It is to be understood, also, that two different transgenic plantations can also be crossed to produce shoots containing two exogenous genes aggregated separately from one another. The self-reproduction of the appropriate progeny can produce plants that are homozygous for both exogenous aggregates. The backcrossing with a progenitor plant and the exogamic crossing with a non-transgenic plant are also contemplated, as is the vegetative propagation. Other methods of reproduction commonly employed to obtain different traits and culinos are known in the art. Reproduction by backcrossing has been used to transfer genes to obtain a trait inherited simply, highly hereditary in a cultivar or homozygous advantageous inbred line, which is the recurrent parent. The source of the trait to be transferred is called the donor parent. It is estimated that the plant thus obtained must have the attributes of the recurrent parent (for example, cultivate) and the advantageous trait transferred from the donor parent. After the initial cross, the individuals who possess the phenotype of the donor parent are selected and crossed repeatedly (backcrossed) with the recurrent parent. It is estimated that the parent thus obtained has the same attributes of the recurrent parent (for example the cultivar) and the advantageous trait transferred from the donor parent.

The DNA molecules of the present invention can be used as molecular markers in a marker assisted reproduction (MAB) method. The DNA molecules of the present invention can be used in methods (such as AFLP tags, RFLP tags, RAPD tags, SNPs and SSRs) that genetically identify traits useful for agriculture, as is known in the art. The trait of insect resistance in the progeny of a cross can be traced with a cotton plant of the present invention (or the progeny thereof or any other cultivar or variety of cotton) using the MAB methods. DNA molecules are markers of this trait and MAB methods that are well known in the art for tracing the insect resistance trait or traits in cotton plants in which at least one cotton line can be made can be used. of the present invention, or the progeny of the same, was progenitor or predecessor. The methods of the present invention can be used to identify any cotton variety that has the insect resistance event of the cotton line 281-24-236 (crylF) and / or 3006-210-23 (crylAc). The methods of the present invention include a method for producing an insect-resistant cotton plant, wherein said method comprises reproduction with a plant of the present invention. More specifically, said methods may comprise crossing two plants of the present invention, or a plant of the present invention and any other plant. Preferred methods further comprise selecting the progeny of said cross by analyzing said progeny in search of a detectable event in accordance with the present invention. A preferred plant or seed of the present invention comprises in its genome at least one of the inserted sequences, identified in Table I, together with at least 20-500 or more continuous flanking nucleotides on either side of the insert, as identified in Table I. Unless otherwise indicated, "event CrylF cotton 281-24-236" refers to the DNA of the SEQ. ID. NO: 1, which includes the heterologous DNA inserted in the original transformation (nucleophiles 2075-12,748 of SEQ ID NO: 1) and all or part of both flanking SEQ genomic sequences. ID. NO: 1 (nucleotide residues 1-2074 and 12,749-15,490) are immediately adjacent to the inserted DNA, which is estimated to be transferred to the progeny that receives the inserted DNA as a result of a sexual cross of a parental line that includes the event. Likewise, unless otherwise indicated, "event CrylAc cotton 3006-210-23" refers to SEQ DNA. ID. NO: 2, which includes the heterologous DNA inserted in the original transformant (nucleotides 528-8900 of SEQ ID NO: 2) and the totality or part of both genomic sequences flanking SEQ. ID. NO: 2 (residues 1-527 and 8901-9382) immediately adjacent to the inserted DNA which, it is estimated, would be transferred to the progeny that receives the inserted DNA as a result of a sexual cross of a parent line that includes the event.

The present invention includes tissue cultures of regenerable cells of a plant of the present invention. Also included is a regenerated plant from said tissue culture, especially where said plant has the capacity to express all the morphological and physiological properties of an exemplified variety. The preferred plants of the present invention have all the physiological and morphological characteristics of a plant grown from the deposited seed. This invention further comprises the progeny of said seed and the seed that possesses the quality traits of interest. Manipulations (such as mutation, subsequent transfection and subsequent reproduction) of plants and seeds or parts of them can lead to the generation of what can be called "essentially derived" varieties. The International Union for the Protection of New Varieties of Plants (UPOV) has provided the following guidelines to determine if a variety has been essentially derived from a protected variety. [A] A variety is to be considered essentially derived from another variety ("the initial variety") when (i) it derives predominantly from the initial variety, or from a variety that, in itself, derives predominantly from the initial variety, retaining the At the same time, the expression of the essential characteristics that are the result of the genotype or the combination of genoíipos of the initial variety; (I) can be clearly distinguished from the initial variety and (¡ü) except in the case of the differences that occur as a result of the act of derivation, it conforms to the initial variety in the expression of the essential characteristics that are given as a result of the genotype or the combination of genotypes of the initial variety. UPOV, Sixth Meeting with International Organizations, Geneva, October 30, 1992; document prepared by the Office of the Union. In the present context, a "line" is a group of plants that exhibits little or no genetic variation among the individuals, with respect to at least one trait. Such lines can be generated by several generations of self-pollination and selection, or by vegetative propagation from a single parent using tissue culture techniques or cells. In the present context, the terms "cultivar" and "variety" are synonyms and refer to a line that is used for commercial production. "Stability" or "stable" means that, with respect to the given component, the component is maintained from generation to generation and, preferably, at least three generations at a substantially equal level, for example preferably ± 15%, more preferably ± 10. %, very preferably ± 5%. Stability can be affected by temperature, location, effort and by sowing time. The comparison of subsequent generations under field conditions should produce the component in a similar way. "Commercial Utility" is defined as having good vigor and high fertility in the plant, in such a way that the farmers can produce the crop using conventional agricultural equipment and that the oil of the seed can be extracted with the described components using conventional crushing equipment. and extraction. To be commercially useful, the yield, measured by the weight of the seed, the oil content and the total oil produced by each 0.405 hectares, must be within 15% of the average yield of a variety of commercial cane from another comparable mode without premium value traits grown in the same region. "Agronomically superior" means that the line has suitable agronomic characteristics such as yield, maturity, resistance to diseases and so on, in addition to the resistance to insects due to the present event (or to the present events). As the person skilled in the art will recognize in light of this description, preferred embodiments of detection equipment may include, for example, probes and / or primers directed and / or comprising "binding sequences" or "transition sequences" (where the genomic flanking sequence of the cotton meets the inserted sequence). ). For example, this includes a polynucleotide probe, primer or amplicon comprising a sequence that includes residues 2074-2075 or 12,748-12,749 of SEQ. ID. NO: 1 or residues 527-528 or 8,900-8,901 of SEQ. ID. NO: 2, as indicated in Table I. To have diagnostic utility for these specific events, preferred "binding initiators" should include at least -15 residues of the adjacent flanking sequence and at least -15 residues of the adjacent inserted sequence. With this arrangement, another initiator can be used in the flanking or insert region to generate a detectable amplicon that indicates the presence of an event of the present invention. However, in preferred embodiments, an initiator binds to the flanking region and an initiator binds to the insert, and these primers can be used to generate an amplicon that encompasses (and includes) a binding sequence as indicated above. . A person skilled in the art will further recognize that primers and probes can be designed to hybridize, in a range of normal hybridization and / or PCR conditions, to a segment of SEQ. ID. NO: 1, SEQ. ID. NO: 2 and complements thereof, where the initiator or probe is not perfectly complementary to the exemplified sequence. In other words, some degree of mismatch can be tolerated. In the case of an initiator of about 20 nucleotides, for example, it is typically not necessary for one or two nucleotides more or less to bind to the opposite strand if the uncorrelated base is internal or is at the end of the primer opposite the amplicon. Various suitable hybridization conditions are presented below. They can also be used in synthetic nucleotide analog probes such as inosine. Peptide nucleic acid (PNA) probes as well as DNA and RNA probes can also be used. The important thing is that said probes and primers serve to diagnose (can clearly identify and distinguish) the presence of an event of the present invention. It should also be noted that errors in PCR amplification can occur which can result in minute sequencing errors, for example. That is to say that, unless otherwise indicated, the sequences listed here were determined by generating long amplicons of cotton genomic DNA and then cloning and sequencing the amplicons. It is not unusual to find slight differences and minor discrepancies in the sequences generated and determined in this way, given the numerous amplification cycles that are needed to generate enough amplicon for sequence from genomic DNA. For example, the following differences between the determined sequences of flanking DNAs of events and genomic / wild type / known DNAs are reported. On the 5 'flank of the crylF event in question, it was determined that residue 2037 of SEQ. ID. NO: 1 was / is consigned as "G", in which the corresponding residue of locus 281-24-236 of the known genomic sequence is "A" (R can be used in a consensus sequence, according to the normal conventions of IUPAC-IUB). On the 3 'side of this event, residue 12,781 of SEQ is indicated herein. ID. NO: 1 as T, whereas C is located in the genomic sequence published in the corresponding site (And it is the consensus code). The position 12,811 of SEQ. ID. NO: 1 is C, while T is the one provided in the case of the genome (And it would be the consensus). Position 12,866 appears as C in SEQ. ID. NO: 1, while T appears in the genome (And it is the consensus). Position 12,882 appears as G in SEQ. ID. NO: 1, whereas A appears in the case of the genome (R is the consensus). Position 12,918 is indicated as A in SEQ. ID. NO: 1, while G appears in the genome (R is the consensus). The residue 13,129 is indicated as G in SEQ. ID. NO: 1, while A appears in the genome (R is the consensus). The residue 13,222 is indicated as C in SEQ. ID. NO: 1, whereas T appears in the genomic sequence (And it is the consensus). In position 13,441 of SEQ. ID. NO: 1, a T appears, while there is no corresponding residue in the genomic listing. Therefore, this apparent insertion would change the subsequent numbering of SEQ. ID. NO: 1 consistently, compared to the genomic sequence. A person skilled in the art should recognize and keep in mind that any necessary adjustments due to these types of common sequencing errors or discrepancies are within the scope of the present invention. Similar differences also appear at the 5 'end in the case of the present crylAc event. In positions 149, 153, 159, 165 and 244 of SEQ. ID. NO: 2, the following residues are listed respectively: C, G, C, C and C. In the genomic sequence at locus 3006-210-23, the following residues appear, respectively, in the corresponding locations: A, A , A, A and A. The consensus codes for these substitutions are, respectively, M, R, M, M and M. Consequently, adjustments can be made to probes and primers and the differences in the amplicons can be noted. they cover or include any of the waste cited. It should also be noted that it is not unusual for some genomic sequence to be deleted when inserting a sequence during the generation of an event. This was the case of both events of the present invention. In other words, SEQ. ID. NO: 1 presents a 53-base segment of cotton genomic DNA for event 281-24-236, which was suppressed during insertion. This "anterior segment" takes place between residues 2074 and 12,749 of SEQ. ID. NO: 1 in the genome of untransformed cotton. Similarly, SEQ. ID. NO: 2 presents a 16-base segment of cotton genomic DNA for event 3006-210-23 that was suppressed during insertion. This "inner segment" takes place between residues 527 and 8901 of SEQ. ID. NO: 2 in the genome of untransformed cotton. As illustrated in Figures 1 and 2, the components of each of the "inserts" are as follows. The DNA molecules of the element contained in the present event Cryl F 281-24-236 consist of the promoter of ubiquitin 1 of maize, operatively connected to the phosphinothricin N-acetyltransferase (PAT) of Streptomyces viridochromogenes, operatively connected to the sequences of polyadenylation ORF25 (Baker et al., Plant Molecular Biology 2: 335-350,1983); the chimeric promoter [(40CS) dMAS] which contains a partially suppressed mannopin synthase promoter with 4 enhancer elements of the octopine synthase promoter, operatively connected to Cry1 F (synpro) of Bacillus thuringiensis var. aizawai, operably linked to the ORF25 polyadenylation sequences (Baker et al., Plant Molecular Biology 2335-350, 1983); and the ubiquitin 1 promoter not operatively connected to a pat partial sequence. The DNA polynucleotide sequences or fragments of component complexes can be used as DNA primers or probes in the methods of the present invention. The DNA molecules of the transgenic gene element contained in the present event C / ylAc 3006-210-23 consists of the promoter (40CS) dMAS operatively connected to the PAT (as described above) operafively connected to the ORF25; and the ubiquitin 1 promoter of the maize operative linked to the CrylAc (synpro) of Bacillus thuringiensis var. kursiaki, operatively connected to the ORF25 polyadenylation sequences. The DNA polynucleotide sequences of these components, or fragments thereof, can be used as DNA primers or probes in the methods of the present invention. In some embodiments of the present invention, compositions and methods for detecting the presence of the transgene / genomic insertion region in plants, seeds and the like are presented, from a cotton plant designated WIDESTRIKE comprising the event of Cryl F 281 -24-236 and the CrylAc event 3006-210-23. DNA sequences are presented comprising at least one transgene / genomic insertion region binding sequence provided herein in SEQ. ID. NO: 1, SEQ. ID. NO: 2, segments thereof and complements of the exemplified sequences and any segment thereof. The binding sequence of the insertion region encompasses the insertion between the heterologous DNA inserted into the genome and the DNA of the cotton cell flanking the insertion site. Said sequences are diagnostic of one or more of the given events. Based on these insertion and edge sequences, specific event initiators were generated. The PCR analysis showed that these cotton lines (CrylF 281-24-236 and Cry1 Ac 3006-210-23) can be identified in different cotton genotypes by analyzing the PCR amplicons generated with these sets of primers of specific events. These and other related procedures can be used to identify these cotton lines in a distinctive way. Accordingly, the PCR amplicons derived from said primer pairs are unique and can be used to identify these cotton lines. In some embodiments, DNA sequences comprising at least one of the novel transgenic / genomic insertion regions constitute an aspect of the present invention. DNA sequences comprising a stretch of sufficient length of the polynucleotides of the transgene insertion sequence and a sufficient stretch of the polynucleotides of the cotton genomic sequence of one or more of the three aforementioned cotton plants are included and / or the sequences that serve as starter sequences for the production of an amplicon product useful for the diagnosis of one or more of these cotton plants. The related modalities refer to DNA sequences comprising at least 2, 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 , 20, 21, 22, 23, 24, 25, or more contiguous nucleotides of a transgenic portion of a DNA sequence selected from the group consisting of SEQ. ID. NO: 1 and SEQ. ID. NO: 2 or the complements thereof, and a similar stretch of the DNA flanking sequence of the cotton obtained from these sequences or complements thereof. Said sequences are useful as DNA primers in the methods of DNA amplification. The amplicons produced with the use of these primers have diagnostic utility for any of the cotton events referred to herein. Therefore, the invention further includes amplicons produced by said DNA primers and homologous primers. Below is a table summarizing the specific embodiments of the present invention.

TABLE II List of primers and their sequences used in the PCR amplification of specific events This invention further includes methods for detecting the presence of DNA in a sample, which corresponds to at least one of the cotton events referred to herein. Said methods may comprise: (a) contacting the sample containing the DNA with a set of primers which, when used in a nucleic acid amplification reaction with DNA from at least one of these cotton events, produces a amplicon that serves as a diagnostic for said or said event (s); (b) performing a nucleic acid amplification reaction, to thereby produce the amplicon and (c) detecting the amplicon. Other methods of detection according to the present invention include a method for detecting the presence of DNA in a sample, corresponding to at least one of the aforementioned events, wherein said method comprises: (a) contacting the sample which contains the DNA with a probe that hybridizes, under stringent conditions of hybridization, with the DNA of at least one of said cotton events and that does not hybridize, under stringent conditions of hybridization, with a control cotton plant ( DNA that is not of the event of interest); (b) subjecting the sample and the probe to stringent hybridization conditions and (c) detecting the hybridization of the probe to the DNA. In further embodiments, the present invention includes methods for the production of a cotton plant comprising a cryl F and / or crylAc event of the present invention, wherein said method comprises the following steps: (a) sexually crossing a first parental line of cotton (comprising an expression cassette according to the present invention, which confers said insect resistance trait to the plants of said line) and a second cotton parental line (which lacks said insect tolerance trait) ) to produce a plurality of plants in the progeny and (b) to select a plant from the progeny by the use of molecular markers. Such methods may optionally comprise the additional step of backcrossing the progeny plaña with the second parental cotton line to produce an actual breeding cotton plant comprising said insect tolerance trait. According to another aspect of the present invention, methods for determining the zygosity of the progeny of a cross with one or more of said three events are presented. Said methods may comprise contacting a sample, comprising cotton DNA, with a set of primers according to the present invention. Such initiators, used in a nucleic acid amplification reaction with genomic DNA from at least one of said cotton events, produce a first amplicon that is diagnostic of at least one of said cotton events. Said methods further comprise the execution of a nucleic acid amplification reaction, to thereby produce the first amplicon; detecting the first amplicon and making the contact of the sample comprising the cotton DNA with said set of primers (said set of primers, when used in a nucleic acid amplification reaction with genomic DNA from cotton plants, produces a second amplicon comprising the genomic DNA of the native cotton homologous to the genomic region of the cotton of an insertion of a transgene identified as one of the aforementioned cotton events) and performing a nucleic acid amplification reaction, to thereby produce the second amplicon . The methods also comprise the detection of the second amplicon and the comparison of the first and second amplicons in a sample, where the presence of both amplicons indicates that the sample is heterozygous for the insertion of the transgene. DNA detection kits can be developed using the compositions described herein and DNA detection methods well known in the art. The equipment serves for the identification of the DNA of the present cotton events in a sample and can be applied to the methods for the controlled reproduction of cotton plants containing this DNA. The equipment contains DNA sequences that are homologous or complementary to the amplicons, for example, those described herein, or of the DNA sequences homologous or complementary with respect to the DNA contained in the transgenic genetic elements of the present events. These DNA sequences can be used in the DNA amplification reactions or as probes in a DNA hybridization method. The equipment can also contain the reagents and materials necessary for the execution of the detection method. A "probe" is an isolated nucleic acid molecule to which a conventional label or reporter molecule is attached (such as a radioactive isotope, ligand, chemiluminescent agent or enzyme). That probe type is complementary to a strand of a target nucleic acid, in the case of the present invention, of a genomic DNA strand of one of said cotton events, either from a cotton plant or from a sample that includes DNA of the event. The probes according to the present invention include not only deoxyribonucleic or ribonucleic acids but also polyamides and other probing materials that specifically bind to a target DNA sequence and which can be used to detect the presence of the target DNA sequence. The "primers" are isolated nucleic acids that anneal to a complementary target DNA strand by hybridizing nucleic acids to form a hybrid between the primer and the target DNA strand, then extend along the target DNA strand by means of a polymerase, for example DNA polymerase. The primer pairs of the present invention relate to their use for the amplification of a target nucleic acid sequence, for example by polymerase chain reaction (PCR) and other conventional means of nucleic acid amplification. The probes and primers generally have a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 , 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 , 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 , 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 , 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125 , 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150 , 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175 , 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193., 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 20 9, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220. 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308. 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362. 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 4 05, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444. 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461 , 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486 , 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499 or 500 polynucleotides or more. Said probes and primers are specifically hybridized with an objective sequence under conditions of high stringency hybridization. Preferably, the probes and primers according to the present invention have complete sequence similarity to the target sequence, although probes can be designed that differ from the target sequence and that retain the ability to hybridize to the target sequences by means of methods conventional Methods for preparing and using the probes and primers have been described, for example, in Molecular Cloning: A Laboratory Manual, 2nd ed., Vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. Pairs of PCR primers can be derived from a known sequence, for example using computer programs intended for that purpose. Initiators and probes based on the flanking and insertion DNA sequences described herein can be used to confirm (and, if necessary, correct) the sequences described by conventional methods, for example by reclining and sequencing said sequences. The nucleic acid probes and primers according to the present invention hybridize under stringent conditions to a target DNA sequence. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA from a transgenic event in a sample. The nucleic acid molecules and the fragments thereof have the ability to hybridize specifically to other nucleic acid molecules in certain circumstances. In the present context, it is said that two nucleic acid molecules can hybridize specifically to each other if the two molecules have the ability to form an anti-parallel double-stranded nucleic acid structure. It is said that one nucleic acid molecule is "complement" of another nucleic acid molecule if both exhibit a total complement. In the present context, it is said that molecules exhibit "total complementarity" when each nucleotide of one of the molecules is complementary to one nucleotide of the other. It is said that two molecules are "minimally complementary" if they can hybridize with one another with sufficient stability to allow them to remain annealed with each other, at least under conditions of "low stringency" conventional. In the same way, it is said that the molecules are "complementary" if they can hybridize to each other with sufficient stability to allow them to remain annealed to each other, in conditions of conventional "alias rigorousness". Conventional stringency conditions are those described by Sambrook et al., 1989. Therefore, deviations from total complementarity are permissible, provided that such deviations do not completely exclude the ability of the molecules to form a double-stranded structure. For a nucleic acid molecule to serve as an initiator or probe, it is only necessary that it has a sequence sufficiently complementary to be able to form a stable double-stranded structure at the concentrations of solvent and specific salts used. In the present context, a substantially homologous sequence is a nucleic acid sequence that hybridizes specifically to the complement of the nucleic acid sequence with which it is being compared under conditions of high stringency. The term "stringent conditions" is defined functionally with respect to the hybridization of a nucleic acid probe with a target nucleic acid (i.e., with a specific nucleic acid sequence of interest) by means of the specific hybridization method described by Sambrook and others, 1989, at 9.52-9.55. See also Sambrook et al., 1989 at 9.47-9.52 and 9.56-9.58. Accordingly, the nucleotide sequences of the present invention can be used for their ability to selectively form duplex molecules with the complementary stretches of DNA fragments. Depending on the application contemplated, varied hybridization conditions can be used to obtain various degrees of selectivity of the probe towards the target sequence. In the case of applications requiring high selectivity, relatively stringent conditions are typically employed to form the hybrids, for example conditions of relatively low salt content and / or high temperature are selected., such as those provided by NaCl 0.02 M to about 0.15 M at temperatures from about 50 ° C to about 70 ° C. Rigorous conditions could involve, for example, washing the hybridization filter at least twice with a high-stringency wash pH regulator (0.2X SSC, 0.1% SDS, 65 ° C). Appropriate stringency conditions that promote DNA hybridization, for example, 6.0X sodium chloride / sodium citrate (SSC) at about 45 ° C, followed by washing 2.0X SSC at 50 ° C, are known to people Capaciíadas in the technique, 6.3.1-6.3.6. For example, a concentration of salts in the wash step can be chosen from a low stringency of approximately 2.0X SSC at 50 ° C to a high stringency of approximately 0.2X SSC at 50 ° C. In addition, the temperature in the wash step can be increased from the conditions of low stringency at room temperature, approximately 22 ° C, to high stringency conditions of approximately 65 ° C. You can vary both the temperature and the amount of salts, or you can keep the temperature or concentration of salts constant and change the other variable. These selective conditions tolerate little, if any, mismatch between the probe and the target template or chain. The detection of DNA sequences by means of hybridization is well known to those skilled in the art and the concepts of U.S. Pat Nos. 4,965,188 and 5,176,995 are exemplary of the methods of hybridization analysis. In a particularly preferred embodiment, a nucleic acid of the present invention hybridizes specifically with one or more of the primers (or amplicons or other sequences) exemplified or proposed herein, including complements and fragments thereof, under high rigorousness In one aspect of the present invention, a marker nucleic acid molecule of the present invention has the nucleic acid sequence set forth in SEQ. ID. NOS: 3-14, or complements and / or fragments of them. In another aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 80% and 100% or 90% and 100% sequence identity with said nucleic acid sequences. In another aspect of the present invention, a marker nucleic acid molecule of the present invention shares between 95% and 100% identity of sequences with said sequence. These sequences can be used as markers in plant breeding methods to identify the progeny of the genetic crosses. Hybridization of the probe to the target DNA molecule can be detected by any number of methods known to those skilled in the art, among which can be included, but not limited to, fluorescent labels, radioactive labels, markers based on antibodies and chemiluminescent markers. Concerning the amplification of a target nucleic acid sequence (eg, by PCR) using a pair of specific amplification primers, the "stringent conditions" are the conditions that allow the primer pair to hybridize, only with the target nucleic acid sequence to which an initiator corresponding to the wild-type sequence (or its complement) would be fixed and preferably produce a single amplification product, the amplicon. The term "specific for (an objective sequence)" indicates that a probe or primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence. In the present context, "amplified DNA" or "amplicon" refers to the product of nucleic acid amplification of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine if the cotton plant obtained by a sexual cross contains genomic DNA of transgenic event of the cotton plant of the present invention., the DNA extracted from a tissue sample of a cotton plant can be subjected to the nucleic acid amplification method using a pair of primers that includes an initiator derived from the flanking sequence of the plant genome adjacent to the DNA insertion site. inserted heterologous and a second primer derived from the heterologous DNA inserted to produce an amplicon that is diagnostic of the presence of the event DNA. The amplicon has a length and a sequence that also diagnoses the event. The amplicon may have a length in the range of the combined length of the pair of primers plus a nucleotide base pair and / or the combined length of the pair of primers plus about 2, 3, 4, 5, 6, 7, 8, 9 , 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 , 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 , 60, 61, 62, 63, 64, 65. 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 , 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 , 110, 111, 112, 113, 114,115,116,117,118,119,120,121, 122,123,124,125,126,127,128,129,130,131, 132, 133, 134, 135, 136, 137, 138, 139, 140;, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244,245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265 , 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 266, 267, 268, 269, 270, 271, 272, 273, 285, 286, 287, 288, 289, 290 , 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315 , 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 3 36, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428., 429, 430, 431, 432, 433, 434, 435 , 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460 , 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485 , 486, 487, 488, 489, 490. 491, 492, 493, 494, 495, 496, 497, 498, 499 or 500, 750, 1000, 1250, 1500, 1750, 2000 or more nucleotide base pairs (more or less any of the increments listed above). On the other hand, a pair of primers of the flanking sequence can be derived on either side of the inserted DNA in order to produce an amplicon that includes the complete inserted nucleotide sequence. A member of a pair of primers derived from the genomic sequence of the plant may be located at a distance from the inserted DNA sequence. This distance can be in the range from a pair of nucleotide bases to approximately twenty thousand pairs of nucleotide bases. The use of the term "amplicon" specifically excludes primer dimers that can be formed in the thermal amplification reaction of DNA. Nucleic acid amplification can be performed by any of the various nucleic acid amplification methods known in the art, including the polymerase chain reaction (PCR). A variety of amplification methods are known in the art and have been described, among other texts, in U.S. Patent No. 4,683,195 and U.S. Patent No. 4,683,202. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA. To implement the present invention these methods can be used, as well as other methods known in the art of DNA amplification. The sequence of the insertion of heterologous transgenic DNA or the flanking genomic sequence of a cotton event in question can be verified (and corrected, if necessary) by amplifying said sequences of the event using primers obtained from the sequences presented here followed by sequencing Plasma DNA of the PCR amplicon or cloned DNA.

The amplicon produced by these methods can be detected by a plurality of techniques. The electrophoresis in agarose gels and the elimination with ethidium bromide is a well-known current method for detecting DNA amplicons. Another such method is the Genetic Bit Analysis (Genetic Bit Analysis) in which a DNA oligonucleotide is designed that overlaps both the flanking genomic DNA sequence and the inserted DNA sequence. The oligonucleotide is immobilized in the wells of a microwell plate. After PCR of the region of interest (using an initiator in the inserted sequence and one in the adjacent flanking genomic sequence), a single-stranded PCR product can be hybridized to the immobilized oligonucleotide to serve as a template for a reaction of extension of a single base using a specific labeled DNA polymerase and ddNTPs for the next expected base. The reading can be based on fluorescence or ELISA. A signal indicates the presence of the inserted / flanking sequence due to favorable single base amplification, hybridization and extension. Another method is the pyrosequencing technique described by Winge (Innov, Pharma, Tech. 00: 18-24, 2000). In this method, an oligonucleotide is designed that is cross-linked with the junction of the adjacent genomic DNA and the inserted DNA. The oligonucleotide is hybridized with a single-stranded PCR product of the region of interest (an initiator of the inserted sequence and one of the flanking genomic sequence) and incubated in the presence of a DNA polymerase, ATP, sulfurylase, luciferase, apirasa, adenosine 5 'phosphosulfate and luciferin. DNTPs are added individually and the incorporation results in a light signal that is measured. A luminous signal indicates the presence of the inserted / flanking sequence due to the favorable amplification, hybridization and extension of a single or multiple bases. Fluorescence polarization is another method that can be used to detect an amplicon according to the present invention. Following this method, an oligonucleotide is designed that is cross-linked with the junction of the adjacent genomic DNA and the inserted DNA. The oligonucleotide is hybridized with a single-stranded PCR product of the region of interest (an initiator of the inserted sequence and one of the flanking genomic sequence) and incubated in the presence of a DNA polymerase and a ddNTP with a fluorescent label. The single base extension results in the incorporation of the ddNTP. Incorporation can be measured as a function of a polarization change using a fluorimeter. A change in polarization indicates the presence of the insertion / flanking sequence due to the favorable amplification, hybridization and single base stress. TAQMAN (PE Applied Biosysiems, Fosíer City, California) is a method for the detection and quantification of the presence of a DNA sequence. Briefly, an FRET oligonucleotide probe is designed that overlaps with the binding of genomic and inserted flanking DNA. The FRET probe and the PCR primers (an initiator of the inserted DNA sequence and one of the flanking genomic sequence) are cyclized in the presence of a thermostable polymerase and dNTP. Hybridization of the FRET probe results in excision and release of the fluorescent portion of the extinction portion of the FRET probe. A fluorescent signal indicates the presence of the flanking / transgenic insert sequence due to favorable amplification and hybridization. Molecular Signatures have been described for use in the deification of sequences. In summary, a FRET oligonucleotide probe is designed that overlaps with the junction of the flanking and inserted genomic DNA. The unique structure of the FRET probe makes it contain a secondary structure that keeps the fluorescent and extinction portions in close proximity. The FRET probe and the PCR primers (one primer in the inserted DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. After the favorable amplification by PCR, the hybridization of the FRET probe with the target sequence results in the elimination of the secondary structure of the probe and the partial separation of the fluorescent and exclusion portions. A fluorescent signal is produced. A fluorescent signal indicates the presence of the inserted flanqueanfe / lransgenic genomic sequence due to favorable amplification and hybridization. Having described two general locations in the cotton genome that are excellent for inserts, the present invention further comprises a cottonseed and / or a cotton plant comprising at least one insert that is not cryl F and is not crylAc in the general vicinity of one or both of the mentioned locations. One option is to replace the insertion of Cryl F and / or crylAc exemplified herein by a different insertion. In these general aspects, homologous directed recombination according to the present invention can be used, for example. This type of technology is the subject, for example, of WO 03/080809 A2 and the corresponding published United States patent application (USPA 20030232410). All patents, patent applications, provisional applications and publications referenced or cited herein are incorporated herein by reference in their entirety to the extent that they do not depart from the explicit principles of this specification. The following examples are included to illustrate the procedures for practicing the invention and to demonstrate certain preferred embodiments of the present invention. These examples should not be considered restrictive. Those skilled in the art should appreciate that the techniques described in the following examples represent specific approaches employed to illustrate the preferred modes of putting them into practice. However, experts in the art should appreciate, in the light of the present description, that numerous changes can be made to these specific modalities and still obtain equal or similar results in departing from the spirit and scope of the present invention. . Unless stated otherwise, all percentages are reported by weight and all proportions of solvent mixtures are expressed by volume unless otherwise indicated.

EXAMPLE 1 Production of the deposited seed Insect resistance of the WideStrike ™ brand for cotton is a transgenic trait developed by Dow AgroSciences, which produces resistance in pineapple against lepidopteran insects. It contains two insect tolerance genes, crylAc and cryl F, which were obtained from the subspecies kurstaki of Bacillus thuringiensis and the subspecies aizawai from Bacillus thuringiensis, respectively. Bacillus thuringiensis (B.t.) is a common gram-positive bailiwick, transported in the earth. In its stage of forming spores, it produces several insecticidal protein crystals (known as delfa-endohioxins), including CrylAc and Cryl F. These proteins are toxic to certain lepidopteran insects. In susceptible insects, they bind to specific receptors in the epithelial cells of the midgut, forming pores that break the osmotic balance and eventually lead to cell death and lysis. It has been shown that CrylAc and Cryl F are non-toxic to humans, the hacienda and beneficial insects, which do not have binding sites for delta-endotoxin. The use of two delia-endotoxins instead of one produces an improved resistance to insects since the two Cry proteins confer a broader spectrum of control than a single one of them and have differentiated aclivity with the lepidopteran pests against which they are effective More importantly, it can contribute to delaying the development of resistant insects. WideStrike CrylAc and CrylF genes were introduced using Agrobacterium-mediated transformation in GC-510 cotton plants (Gossypium hirsutum L.) at two separate transformation events, 3006-210-23 and 281-24-36. After crossing into a superior cotton variety, these events were combined by conventional controlled reproduction to produce cotton that carries the WideStrike insect resistance trait. WideStrike also contains the pat gene of Streptomyces viridochromagenes, a common aerobic soil bacterium. The pat gene codes for the enzyme Phosphinothricin Acetyltransferase (PAT), which detoxifies glufosinate ammonium in an inactive compound by acetylation. The pat gene was included to allow the selection of transformed cotton plants.

EXAMPLE 2 Diagnostic test for cotton C / yl F event 281-24-236 DNA was extracted from event 281-24-236 of Cryl F and event 3006-210-23 of CrylAc and non-transgenic cotton PCS355 of cotton leaves using the equipment PLant DNeasy of QIAGEN (# catalog 69181, Qiagen, Valencia, CA , USA). The protocol suggested by the manufacturer was followed. Briefly, leaf discs were broken in a pre-heated pH regulator supplemented with RNAse using a tungsten carbide bead (0.125 mm in diameter) and a Retsh MM3000 Mixer Mill. The mixture was centrifuged at room temperature and then the supernatant was captured by passing it through a DNeasy 96 plate. The DNA was eluted in an elution pH buffer and stored frozen until the time of use. The DNA extracted from the foliar tissue of the cotton was used in a DNA amplification by PCR of the genomic / insertion sequences of the 5 'transgene of event 281-24-236 of Cryl F using the primer 281-14 (SEQ ID NO. : 3, 5TGTCGGCTGAAGGTAGGGAGG3 ') and primer 281-15 (SEQ ID NO: 4, 5' CCGGACATGAAGCCATTTAC3 *), and flanking genomic / insertion sequences using the initiator 281-9 (SEQ ID NO: 6, 5TCTCTAGAGAGGGGCACGACC3") and primer 281-10 (SEQ ID NO: 7, 5'CGAGCTGGAGAGACCGGTGAC3 '). DNA amplification analysis by PCR was carried out using genomic DNA extracted from the Cryl F 281/24/236 cotton event. and the non-transgenic cotton line PCS355.The amplification reaction was carried out for the 5 'flanking genomic sequence using QIAGEN HotStarTaq PCR equipment (catalog # 203203 or 203205)., QIAGEN, Valencia, Ca, E.U.A.) with a final concentration of 0.4 μM in the case of the initiator 281-14 and Primer 281-15 in a reaction volume of 50 μl. The reactions were carried out using a GenAmb 9600 PCR arrangement (Applied Biosystems, Foster City, Ca) under the following cycling conditions: 1 cycle at 95 ° C for 15 minutes, 35 cycles of 94 ° C for 30 seconds, 57 ° C for 30 seconds, 72 ° C for 60 seconds, 1 cycle at 72 ° C for 10 minutes. PCR of the 3 'flanking genomic sequence was carried out using the Takara ExTaq kit (# Catalog RR001A, Panvera, Madison, Wl) in a 50 μl reaction volume containing a final concentration of 0.4 μM of the primer 281-9 and the Initiator 281-10. The reactions were carried out using a PCR Arrangement GenAmp 9600 ((Applied Biosystem, Foster Ciíy, CA) in the following cyclization conditions: 1 cycle at 95 ° C for 5 minutes, 35 cycles of 94 ° C for 30 seconds, 60 ° C for 30 seconds, 82 ° C for 60 seconds; 1 cycle at 72 ° C for 10 minutes. The PCR products were separated using electrophoresis in 1.0% agarose gels at 100 V for about 1 hour and visualized by staining with ethidium bromide. The DNA sequence of the 5 'PCR product was determined yielding a nucleotide sequence of 603 base pairs which represented the genomic / insertion sequence of the 5' transgene of the Cryl F event of cotton 281-24-236 and he identified it as SEQ. ID. NO: 5. The DNA sequence of the 3 'PCR product was determined resulting in a nucleotide sequence of 562 base pairs representing the genomic / insertion sequence of the 3' transgene of the cotton Cryl F event 281-24 -236 and it was identified as SEQ. ID. NO: 8 The genomic / transgene binding sequences, SEQ. ID. NO: 5 and SEQ. ID. NO: 8, are novel DNA sequences in the event of Cryl F 281-24-236 that are diagnostic for the event in Cryl F 281-24-236 cotton plants and their progeny.

EXAMPLE 3 Diagnostic Test for event 3006-210-23 of CrylAc cotton DNA extracted from foliar cotton tissue was used in a DNA amplification by PCR of the genomic / insertion sequences of the 5 'transgene of Cry1 Ac 3006-210-23 using the primer 3006-20 SEQ. ID.

NO: 9, 5TTCCAACCTTTAACTATTATCCTGC3 ') and initiator 3006-22 (SEC.

ID NO. 10 5'GCTGCGGACATCTACATTT3 '), and genomic / transgene insert sequences of 3' flanking using primer 3006-9 (SEQ ID NO: 12, 5'GACATGCAATGCTCATTATCTCTA3 ') and primer 3006-12 (SEQ .

ID NO: 13, 5"AGTCTCTGCCTTCTACCCTGG3 '). DNA amplification analyzes by PCR were carried out using genomic DNA extracted from the CrylAc 3006-210-23 cotton event and the non-transgenic cotton line PCS355. Was carried out the amplification reaction for the genomic sequence 5 'flanking using the PCR kit HotStarTaq QIAGEN (catalog # 203203 or 203205, QIAGEN, Valencia, CA, USA) with a final concentration of 0.4 .mu.M in the case of initiator 3006-20 and the Initiator 3006-22 in a reaction volume of 50 μl. The reactions were carried out using a GenAmp 9600 PCR arrangement (Applied Biosystem, Foster City, Ca) under the following cyclization conditions: 1 cycle at 95 ° C for 15 minutes, 35 cycles of 94 ° C for 30 seconds, 53 ° C for 30 seconds, 72 ° C for 60 seconds, 1 cycle at 72 ° C for 10 minutes. Was carried out PCR of genomic sequence flanking 3 'using the PCR kit HotStarTaq (Catalog No. 203203 or 203205, QIAGEN, Valencia, CA, USA) in a reaction volume of 50 .mu.l containing a final concentration of 0.4 uM of initiator 3006-9 and Initiator 3006-12. The reactions were carried out using a PCR Arrangement GenAmp 9600 ((Applied Biosystem, Foster City, CA) under the following cycling conditions: 1 cycle at 95 ° C for 5 minutes, 30 cycles of 94 ° C for 30 seconds, 56 ° C for 30 seconds, 72 ° C for 60 seconds, 1 cycle at 72 ° C for 10 minutes, PCR products were separated using electrophoresis in 1.0% agarose gels at 100 V for approximately 1 hour and visualized by staining with ethidium bromide. the DNA sequence of the PCR product 5 'resulting in a nucleotide sequence of 614 bp represeníaba genomic / insertion sequence íransgén 5' event CrylAc cotton it was determined 3006 -210-23 (identified herein as SEQ ID NO: 11) The DNA sequence of the 3 'PCR product was determined resulting in a nucleotide sequence of 662 base pairs representing the genomic / insertion sequence of the 3 'transgene of the cotton CrylAc event 3006-210-23 (identified here as SEQ. ID. NO: 14) The genomic / transgene binding sequences, SEQ. ID. NO: 11 AND SEQ. ID. NO: 14 are novel DNA sequences in the event of CrylAc 3006-210-23 that are diagnostic for the event in CrylAc 3006-210-23 cotton plants and their progeny.

EXAMPLE 4 Other diagnostic tests Pairs of DNA event primers were used to produce a diagnostic amplicon for the Cryl event F 281-24-23 and the CrylAc event 3006-210-23. These pairs of initiators for events include, but are not limited to, SEQ. ID. NO: 3, SEQ. ID. NO: 4, SEQ. ID. NO: 6, SEQ. ID. NO: 7, SEQ. ID. NO: 9, SEQ. ID. NO: 10, SEQ. ID. NO: 12 and SEQ. ID. NO: 13. When used in a DNA amplification (PCR) method, these primers produce a diagnostic amplicon for the event of Cryl F 281-24-236 and the event of CrylAc 3006-210-23 and its progenies. In addition to these primer pairs, other aspects of the present invention include any primer pair derived from the SEQ amplicon product. ID. NO: 5, I KNOW THAT. ID. NO: 9, SEQ. ID. NO: 11 and / or SEQ. ID. NO: 14 which, in a DNA amplification reaction, produces a diagnostic amplicon for the event of Cryl F 281-24-236 and the event of CrylAc 3006-210-23 and its progenies. Any modification involving the use of DNA primers to produce a diagnostic amplicon for the event of Cryl F 281-24-236 and the event of CrylAc 3006-210-23 and its progenies is within the reach of the person ordinarily skilled in the art. , with the help of the present description. The analysis of the plant tissue sample from the Cryl event F 281-24-236 and the event of CrylAc 3006-210-23 and its progenies should include a posiive positive confrol of these events, a negative control of a cotton plañía that It is not any of these events and a negative conigol that does not contain DNA template cotton. Those skilled in the art of DNA amplification methods can derive other sequences of SEQ primers. ID. NO: 1 and / or SEQ. ID. NO: 2. Conditions optimized for the production of an amplicon may differ from the methods described in the above Examples. The use of these DNA primer sequences with modifications to the methods described in these Examples is within the scope of the present invention. The amplicons and primers derived from SEQ. ID. NO: 1 and / or SEQ. ID. NO: 2 which are diagnostic for the event of Cryl F 281-24-236 and the event of CrylAc 3006-210-23 and their progenies are aspects of the present invention. The analysis of the event amplicons of Cryl F 281-24-236 and the event of CrylAc 3006-210-23 and their progenies can be carried out using a Royacycler Straiagen Motor, MJ or the Eppendorf Mastercycler Gradient thermal cycler, or by methods and apparatuses known to those skilled in the art.

Having illustrated and described the principles of the present invention, persons with capacitation in the art should consider it evident that the invention can be modified in its arrangement and detail without departing from said principles. We claim all the modifications that are within the spirit and scope of the appended claims.

Claims (25)

NOVELTY OF THE INVENTION CLAIMS

1. - A cotton seed that includes in its genome the cotton cryl F 281-24-236 and the crylAc 3006-210-23 cotton and that have a representative seed deposited in the American Type Culfure Collecíion (ATCC) with the Access No. PTA-6233.

2.- A cotton seed that includes, in its genome, the cotton cryl event F 281-24-236.

3.- A cotton seed that includes, in its genome, the cotton crylAc 3006-210-23.

4. A cotton plant that is produced by cultivating the seed of claim 1.

5.- A cotton plant of the progeny of the plant of claim 4.

6.- A cotton plant of the progeny that resists insects of the plant of claim 4.

7. The plan according to claim 4, further characterized in that said cotton plant comprises a genome comprising a DNA sequence selected from residues 2055-12,768 of SEQ. ID. NO: 1 and 508-8920 of SEQ. ID. NO: 2

8. - The plant according to claim 4, further characterized in that said cotton plant comprises residues 2055-12,768 of SEQ. ID. NO: 1 and 508-8920 of SEQ. ID. NO: 2.

9.- A piarte of the cotton plant of claim 4, wherein said part is selected from the group formed pollen, ovule, flowers, pods, fluff, buds, roots and leaves.

10. A transgenic cotton plant comprising an insert that interrupts a genomic sequence selected from the group consisting of: a) a first DNA sequence comprising a 5 'end comprising nucleotides 1-2074 of SEQ. ID. NO: 1, a first interior segment comprising SEQ. ID. NO: 15, and a 3 'end comprising nucleotides 12,749-15,490 of SEQ. ID. NO: 1; and b) a second DNA sequence comprising a 5 'end comprising nucleotides 1-527 of SEQ. ID. NO: 2, a second interior segment comprising SEQ. ID. NO: 16, and a 3 'end comprising nucleotides 8,901-9,382 of SEQ. ID. NO: 2.

11.- An isolated polynucleotide molecule, wherein said molecule comprises at least 15 nucleotides and maintains hybridization under stringent wash conditions with a nucleic acid sequence selected from the group formed by residues 1-2074 of SEQ. ID. NO: 1, residues 12,749-15,490 of SEQ. ID. NO: 1, residues 1-527 of SEQ. ID. NO: 2, residues 8,901-9,382 of SEQ. ID. NO: 2, and complements thereof.

12. - The polynucleotide according to claim 11, further characterized in that said polynucleotide comprises a nucleotide sequence selected from the group consisting of SEQ. ID. NO: 3, SEQ. ID. NO: 7, SEQ. ID. NO: 9 and SEQ. ID. NO: 13.

13. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of residues 2060 to 2090 of SEQ. ID. NO: 1, residues 12,733 to 12,765 of SEQ. ID. NO: 1, residues 512-543 of SEQ. ID. NO: 2, and residues 8,885 to 8,916 of SEQ. ID. NO: 2.

14. The polynucleotide according to claim 13, further characterized in that said polynucleotide is an amplicon generated by polymerase chain reaction and said amplicon comprises a sequence selected from the group consisting of SEQ. ID. NO: 5, SEQ. ID. DO NOT: 8, SEQ. ID. NO: 11 and SEQ. ID. NO: 14.

15. A method for detecting the presence of a cotton event in a sample comprising cotton DNA, wherein said method comprises contacting said sample with at least one polynucleotide that is diagnostic for an event. of cotton selected from the group formed by the cotton event of Cryl F 281-24-236 and the cotton event of CrylAc 3006-210-23, present in the seed deposited in the American Type Culture Collecfion (ATCC) with the number of access PTA-6233.

16. The method according to claim 15, further characterized in that said method comprises contacting said sample with: a) a first primer that binds to a flanking sequence selected from the group formed by residues 1-2074 of SEQ. ID. NO: 1, residues 12,749-15,490 of SEQ. ID. NO: 1, and accessories thereof; and b) a second primer that binds to an inserted sequence selected from the group consisting of residues 2075-12,748 of SEQ. ID. NO: 1, and complements thereof; and subjecting said sample to a polymerase chain reaction; and analyze in search of an amplicon generated between said initiators.

17. The method according to claim 15, further characterized in that said method comprises contacting said sample with: a) a first primer that binds to a flanking sequence selected from the group formed by residues 1-527 of SEQ . ID. NO: 2; residues 8,901-9,382 of SEQ. ID. NO: 2 and accessories thereof; and b) a second primer that binds to an inserted sequence selected from the group consisting of residues 528-8,900 of SEQ. ID. NO: 2, and complements thereof; and subjecting said sample to a polymerase chain reaction and analyzing for an amplicon generated between said initiators.

18. The method according to claim 16, further characterized in that said second initiator is selected from the group formed by SEQ. ID. NO: 4 and SEQ. ID. NO 6.

19. - The method according to claim 17, further characterized in that said second initiator is selected from the group formed by SEQ. ID. NO: 10 and SEQ. ID. NO: 12.

20. The method according to claim 15, further characterized in that said polynucleotide comprises at least 30 nucleotides and hybridizes under stringent conditions with a sequence selected from the group consisting of residues 2060 to 2090 of SEQ. ID. NO: 1, residues 12,733 to 12,765 of SEQ. ID. NO: 1, residues 512-543 of SEQ. ID. NO: 2, residues 8,885 to 8,916 of SEQ. ID. NO: 2, and complements thereof; and wherein said method further comprises subjecting said sample and said polynucleotide to stringent hybridization conditions; and analyzing said sample to detect the hybridization of said polynucleotide with said DNA.

21. A DNA detection device comprising a first initiator and a second initiator, wherein said initiators are as defined in claim 16.

22. A DNA detection device comprising a first initiator and a second initiator. , wherein said primers are as defined in claim 17.

23. A DNA detection equipment comprising a polynucleotide as defined in claim 20.

24.- A polynucleotide comprising a sequence selected from the group consisting of SEQ. ID. NO: 1 and SEQ. ID. NO: 2

25. - A plant comprising a genomic sequence, which it comprises a polynucleotide according to claim 24. SUMMARY OF THE INVENTION The present invention relates to the cultivation of plañís and to the protection of the plañís of the insects; more specifically, the present invention includes novel transformation events of cotton plants comprising one or more polynucleotide sequences, as described herein, inserted at one or more specific sites within the genome of a cotton cell; in highly preferred embodiments, said polynucleotide sequences encode the "accumulated" lepidopteran insect inhibitor proteins Cryl F and CrylAc, however, the present invention includes plants having unique cryl F or crylAc events, as described herein; furthermore, the invention relates to cotton plants derived from that transformation event and to assays for the detection of the presence of the event in a sample, more specifically, the present invention presents DNA and related assays to detect the presence of certain events of resistance to insects in cotton, the assays are based on the DNA sequences of recombinant constructs inserted in the cotton genome and the genomic sequences flanking the insertion sites, these sequences are unique; based on these insertion and edge sequences, specific primers were generated for the events; PCR analysis showed that these cotton lines can be identified in different cotton genotypes by PCR analysis of the amplicons generated with these sets of initiators specific for the events; therefore, these and other related procedures can be used to distinguish these cotton lines in a distinctive way; equipment and useful conditions to carry out the epsayos are also presented; These materials and methods can also be used to assist in growing programs to further develop traits in cotton. P06 / 1566F