MXPA06007726A - Non-nucleotide reverse transcriptase inhibitors - Google Patents

Abstract

where;A is CH orN;R1 is a substituent to a carbon atom in the ring containing A selected from -S(=O)pRa, where Ra is -C1-C4 alkyl, -ORx, -NRxRx, -NHNRxRx, - NHNHC(=O)ORx, -NRxOH;-C(=O)-Rb, where Rb is -CT-C4-alkyl, ORx, -NRxRx, -NHNRxRx, -NHC1-C3-alkyl-C(=O)Orx -NRxRc, where Rc is H, C1-C4 alkyl, -NRxRx;-C(=0)Rd, -CN, S(=O)pRx where Rd is Rd is C1-C4-alkyl, -ORx, -NRxRx C1-C3-alkyl-O-Cl-C3alkylC(=O)ORx, -C1-C3-alkyl-COORx;-C1-C3alkyl-OH or C1-C4 alkyl ethers or esters thereof (O-Cl-C3alkyl)q-O-Rx a 5 or 6 membered aromatic ring having 1-3 hetero atoms p is 1 or 2;Rx is independently selected from H, C1-C4 alkyl or acetyl;or a pair of Rx can together with the adjacent N atom form a ring;L is -0-, -S(=O),- or -CH2-, where r is 0, 1 or 2;R3-R7 are substituents as defined in the specification;X is -(CR8R8')n-D-(CR8R8')m-;D is a bond, -NR9-, -0-, -S-, -S(=0)- or -S(=0)2-;and pharmaceutically acceptable salts and prodrugs thereof, have utility as HIV antivirals.

Description

INVERSE TRANSCRIPTASE INHIBITORS, NON-NUCLEOTIDE TECHNICAL FIELD This invention relates to inhibitors of non-nucleotide reverse transcriptase (NNRTIs) active against HIV-1 and having an improved resistance and pharmacokinetic profile. The invention also relates to novel intermediates in the synthesis of such compounds and the use of the compounds in antiviral methods and compositions.

BACKGROUND OF THE INVENTION Our PCT applications filed above WO02 / 070516 & WO03 / 020705 claim new NNRTIs of the formula I where; RT is O, S; R2 is a nitrogen-containing, optionally substituted heterocycle such as pyridyl; R3 is H, Ci-Cs alkyl, R-R7 are independently selected from H, C2-C6 alkenyl alkyl, C2-C6 alkynyl, Ci-Cß haloalkyl, C ^C alca alkanoyl, C ^C halo haloalkanoyl, Ci-Ce alkoxy, haloalkoxy C-Ce, C 1 -C alkyloxy C 1 -C 6 aminoalkyl carboxyalkyl, cyanoalkyl amino, carboxy, carbamoyl, cyano, halo, hydroxy, keto and the like; X is - (CH2) nD- (CH2) m- or X is - (CRaRb) cD is -NRβ-, -O-, -S-, -S (= O) - or -S (= O) 2- R 8 is H, C 1 -C 3 alkyl R a and R b are independently H, C 1 -C 8 alkyl, OH or R a and R together are = O n and m are independently 0 or 1; c is 1, 2 or 3 and pharmaceutically acceptable salts and prodrugs thereof. Example 20 of WO 02/070516 describes the compound which is stated to have an ED50 of 7 nM against VI H wild type (HIVI I I B). Our co-pending request, but as of PCT unpublished in the priority date W002 / 021 969 discloses compounds generally of formula I above, but wherein R2 is 2-yl-substituted-2-yl with a group of the formula - (CHRn) pE- (CHRn) qR? o wherein E is -CH2-, -CHOH-, -C = O-, -NR9-, -O-, -S-, -S (= O) 2 -; p and q are independently 0, 1 or 2, where p + q < 2; R1 0 is a monocyclic ring that is optionally substituted with halo, cyano, morpholinomethyl- or morpholinocheto-; and R n is independently H, C 1 Cs alkyl, substituted C 1 -C 3 haloalkyl or hydroxy. Although N NRTIs of urea and thiourea described in the above documents are exquisitely active against reverse transcriptase, especially that of. VI H-1, the nature of the VI H virus with its extreme lack of replication fidelity and consequent trend with rapid resistance development indicates a demand for additional antiretroviral agents with increased antiviral performance against problematic drug escape mutants, notably in the positions RT 1 00, 103 and / or 181.

BRIEF DESCRIPTION OF THE INVENTION According to a first aspect of the invention, compounds of the formula Z are provided: where; A is CH or N; Ri is a substituent for a carbon atom in the ring containing A selected from -S (= O) pRa, where Ra is C? -C4 alkyl, -ORx, -NRxRx, -NHNRxRx, -NHN HC (= O) ORx, -NRxOH; -C (= O) -R b, wherein R b is C 1 -C 4 alkyl, OR x, -NR x R x, -NR x NR x R x, -NH-d-C 3 -C alkyl (= O) OR x; -NR x R c, wherein R c is H, C 1 -C 4 alkyl, -NR x R x; -C (= O) Rd, -CN, S (= O) pRx where Rd is C1-C4 alkyl, -ORx, -NRxRx-alkyl d-Cs-O-C1-C3 alkyl (= O) ORx; -alkyl C ^ Ca-COORx; -alkyl d-Cs-OH or C1-C4 alkyl ethers or esters thereof; - (O-alkyl d-Cs O-Rx; an aromatic ring of 5 or 6 members having 1 -3 heteroatoms; p and q are independently selected from 1 or 2; R x is independently selected from H, C 1 -C 4 alkyl, or acetyl; or a pair of Rx can together with the adjacent N atom form a ring of pyrrolidine, piperidine, piperazine or morpholine, R2 is a substituent for a carbon atom in the ring containing A and is H, halo, cyano, C1-C alkyl , haloalkyl C -? - C4; L is -O-, -S (= O) r- or -CH2-, wherein r is 0, 1 or 2; R3 is H, C -? - C3 alkyl; R 7 are independently selected from H, C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, haloalkyl d-Ce, alkanoyl d-Ce, haloalkanoyl, C 1 -C 6 alkyloxy, d-Ce alkyl, haloalkyloxy aminoalkyl, d- Ce, C? -C6 carboxyalkyl, cyanoalkyl amino, carboxy, cyano, halo, hydroxy, keto; X is - (CRßRßVD-ÍCRßRß ') * -; D is a bond, -NR9-, -O-, -S-, -S (= O) - or -S (= O) 2-; n and m are independently 0, 1 or 2, provided that both are not 0 when D is a link; R8 and R8 'are independently H, C1O3 alkyl, C1-C3 haloalkyl, hydroxy, or R8 and R8' together with their adjacent C atom is -C (= O) - R9 is independently H, C ^ Cs alkyl; and pharmaceutically acceptable salts and prodrugs thereof, with the proviso that R2 as -C (= O) Rb is not morpholinocheto-. The currently preferred value for Ri is O, ie a urea derivative, although R-i as S (ie a thiourea derivative) is also highly potent. The currently preferred value for R3 is H. Preferably R4 is hydrogen, halo, haloalkyl d-Cs, or hydroxy, especially fluoro. Preferably R.sub.5 is halo, C.sub.1-3 alkylcarbonyl, C.sub.1 -C.sub.3 haloalkyl, alkyloxy.d.sub.C or H, especially fluoro and more preferably H. Preferably R.sub.6 is hydrogen, halo, C.sub.1 -C.sub.3 haloalkyl, alkyloxy.d.sub.C, alkylcarbonyl C. -Ca, cyano or ethynyl, especially methoxy or fluoro and more preferably H.

Preferably R7 is hydrogen, haloalkyl d-d, halo, C1-C3 alkyloxy, or C1-C3 alkylcarbonyl, more preferably fluoro. Preferably R5 and R6 are H and R4 and R7 are halo, more preferably both are fluoro. Alternative preferred configurations include those wherein R5 and R6 are H, R is fluoro and R7 is acetyl or cyano. A suitable value for at least one of R4-R7 is haloalkyl d-Cs, such as -CF2H, -CFH2, -CH2CF3 or -CF2CF3, and especially -CF3. Groups -S (= O) pRa favored for R1 include those wherein p is 2 or especially 1, and wherein Ra is alkyl, such as cyclopropyl, methylcyclopropyl, and most preferably methyl. In this manner, preferred groups include methylsulfonyl or methylsulfinyl. Additional favored -S (= O) pNRxRx groups include those wherein Rx is each H or Me or wherein one is H and the other is Me, cyclopropyl or methylcyclopropyl, more preferably NH2. In this way, preferred groups include sulfonamide. Groups -C (= O) -Rb for R! they include those wherein Rb is NRxRx or NHNRxRx, especially N-methylcarboxamide, hydrazinocarbonyl and -C (= O) NHNHC (= O) Me. Additional preferred -C (= O) -Rb groups include -C (= O) NRx'-N-morpholine, -C (= O) NRx'-N-piperidine, -C (= O) NRx'-N-pyrrolidine , -C (= O) NRx'-N-piperazine, wherein Rx is methyl, acetyl or preferably H. Groups -NRxRc favored for Ri include those wherein Rx is H or Me and those where Rc is -C (= O) Rd, where Rd is alkyl and S (= O) pRx, especially cyclopropylamide and acetamide. Preferred alkyl-Ci-Cs-COORx groups for R ^ include carboxyethyl and C?-C2 alkyl esters thereof. C 1 -Cs-OR x -alkyl groups favored for R 1 include hydroxyethyl and C 1 -C 2 alkyl esters and esters thereof. Groups - (O-alkyl C -? - C3) q-O-Rx favored for R-y include ethoxy containing species especially 2- (methoxyethoxy) ethoxy. Exemplary heteroatomic rings for Ri include furyl, thienyl, pyranyl, pyrrolyl, pyrrolinyl, pyrrolidinyl, pyrazolyl, pyrazolinyl, pyrazolidinyl, imidazolyl, imidazolinyl, imidazolidinyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, oxazolyl, oxazolidinyl, isoxazolyl, isoxazolidinyl, thiazolyl, thiazolidinyl, isothiazolyl, isothiazolidinyl, especially 5-membered rings such as thiazolyl, thiadiazolyl, pyrazolyl, diazolyl and more preferably triazolyl. The currently preferred value for L is -O-. The compounds of the formula Z can be administered as a racemic mixture, but preferably the intermediate compound with cyclopropyl half the function (thio) urea, X and the phenyl ring (denoted Y below) is at least 75% such as about 90% enantiomerically pure with respect to conformation: The preferred optical isomers of the compounds of formula I show a negative optical rotation value. Such isomers, for example, when X is -O-CH2-, tend to elute less rapidly from a chiral chromatogram, for example, chiral AGP 150 x 10 mm, 5 μm; Crom Tech LTD Colomn, flow rate 4 ml / min, mobile phase 89% vol 1 0mM HOAc / NH4OAc in acetonitrile. In the basis of preliminary X-ray crystallography analysis, an absolute configuration currently favored seems to be: The currently preferred value for D is -O-. Convenient values for n and m include 1: 0 and 1: 1. Preferred values of n: m include 0: 2 and especially 0: 1, i.e. a chroman derivative. Conveniently each R8 and R8 'is H. Alternatively, in the case where n is 0 and m is 1, R8 is advantageously H and R8' is OH. Particularly preferred compounds have corresponding stereochemistry: X (1S, 1 aR, 7bR) -1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl. For clarity, it should be noted that the structure: The term C ^ Cn alkyl wherein n is 3 or 4 or lower alkyl includes such group as methyl, ethyl, n-propyl, isopropyl, cyclopropyl, n-butyl, s-butyl, t -butyl, cyclopropyl, methylcyclopropyl and the like. The term halo refers to chlorine, bromine, fluorine and iodine, especially fluoro. "alkoxy" refers to groups such as methoxy, ethoxy, propoxy, cyclopropoxy, t-butoxy and the like. C2-Cn alkenyl refers to groups such as vinyl, 1-propen-2-yl, 1-buten-4-yl, 1-penten-5-yl, 1-buten-1-yl and the like. C ^ Cn alkylthio includes methylthio, ethylthio, t-butylthio and the like. C ^ Cnalkyloxy includes acetoxy, propionoxy, formyloxy, butyryloxy and the like. C2-Cn alkenoxy includes ethenyloxy, propenyloxy, iso-butoxy-ethenyl and the like. Haloalkyl d-Cn (including complex substituents comprising this portion such as haloalkyloxy C - γ-Cn) includes alkyls as defined herein 1 to 3 times by a halogen including trifluoromethyl, 2-dichloroethyl, 3,3-difluoropropyl and the similar. The term "amine" includes groups such as NH2, NHMe, N (Me) 2 which may optionally be substituted with halogen, acyloxy dC ?, C -? - C6 alkyl, C ^ Ce alkoxy, nitro, carboxy, carbamoyl, carbamoyloxy, cyano, methylsulfonyloamino and the similar. Carboxy, carboxymethyl and carbamoyl include corresponding pharmaceutically acceptable C 1 -C 6 alkyl and aryl esters. The prodrugs of the compounds of the formula I are those compounds which, after administration to a patient, release a compound of the formula I in vivo. Typical prodrugs are pharmaceutically acceptable ethers and especially ethers (including phosphate esters) when either R4-R7 or R1 or R2 represent a hydroxy function, pharmaceutically acceptable amides or carbamates when any of the R or R4-R7 substituent represents an amine or pharmaceutically acceptable esters when the substituent R1, R2 or R4-R7 represent a carboxy function. Pharmaceutically acceptable esters include alkyl esters, including acetyl, ethanoyl, butyryl, t-butyryl, and pivaloyl, phosphate esters, and sulfonic esters (ie, those derived from RSO2OH, wherein R is aryl or lower alkyl). Pharmaceutically acceptable esters include lower alkyl esters and the ethers described in WO00 / 47561, especially methoxyaminoacyl and ethoxyaminoacyl. The compounds of formula Z can form salts that form a further aspect of the invention. Suitable pharmaceutically acceptable salts of the compounds of formula I include salts of organic acids, especially carboxylic acids, including but not limited to acetate, trifluoroacetate, lactate, gluconate, citrate, tartrate, maleate, malate, pantothenate, isethionate, adipate, alginate , aspartate, benzoate, butyrate, digluconate, cyclopentanate, glucoheptanate, glycerophosphate, oxalate, heptanoate, hexanoate, fumarate, nicotinate, palmoate, pectinate, 3-phenylpropionate, picrate, pivalate, proprionate, tartrate, lactobionate, pivolate, camphorrate, undecanoate and succinate , organic sulfonic acids such as methanesulfonate, ethanesulfonate, 2-hydroxyethane sulfonate, camphorsulfonate, 2-naphthalenesulfonate, benzenesulfonate, p-chlorobenzenesulfonate and p-toluenesulfonate; and inorganic acids such as hydrochloride, hydrobromide, hydroiodide, sulfate, bisulfate, hemisulfate, thiocyanate, persulfate, phosphoric and sulphonic acids. The hydroxy protecting group as used herein refers to a substituent that protects hydroxyl groups against undesirable reactions during synthetic procedures such as those O-protecting groups described in Greene, "Protective Groups I n Organic Synthesis," (John Wiley & amp; Sons, New York (1981)). The hydroxy protecting groups comprise substituted methyl ethers, for example, methoxymethyl, benzyloxymethyl, 2-methoxyethoxymethyl, 2- (trimethylsilyl) ethoxymethyl, t-butyl and other internal alkyl ethers, such as isopropyl, ethyl and especially methyl, benzyl and triphenylmethyl; tetrahydropyranyl esters; substituted ethyl ethers, for example, 2,2,2-trichloroethyl; silyl ethers, for example, trimethylsilyl, t-butyldimethylsilyl and t-butyldiphenylsilyl; and esters prepared by reacting the hydroxyl group with carboxylic acid, with acetate, propionate, benzoate and the like. Similarly, the N-protecting group as used herein refers to those conventional N-protecting groups described in Greene, "Protective Groups in Organic Synthesis," John Wiley & Sons New York 1 981. The invention further provides pharmaceutical compositions comprising the compounds of the invention and pharmaceutically acceptable diluents or vehicles therefor. Additional aspects of the invention provide methods for inhibiting VI H comprising administering a compound of formula Z to a subject afflicted with or exposed to HIV-1. HIV-1 may comprise a drug escape mutant, such as strain VI H comprising mutations in mutations 1 00, 1 03 and / or 1 81, especially mutants K103N and / or L1001. The invention also extends to the use of the compounds of the formula Z in therapy, such as in the preparation of a medicament for the treatment of LV infections. To treat conditions caused by HIV, the compounds of the formula Z are preferably administered in an amount to achieve a plasma level of about 1000 to 5000 nM, such as 300 to 2000 nM. This corresponds to a dosage rate, depending on the bioavailability of the formulation, of the order 0.01 to 10 mg / kg / day, preferably 0.1 to 2 mg / kg / day. A typical dosage rate for a normal adult will be about 0.05 to 5 g per day, preferably 0.1 to 2 g such as 500-750 mg, in one to four dosage units per day. As with all pharmacists, dosing rates will vary with the patient's size and metabolic condition as well as the severity of the infection and may need to be adjusted for concomitant medications. To maintain the usual practice with HIV inhibitors it is advantageous to co-administer one to three antivirals to provide synergistic responses and to ensure complementary resistance patterns. Such additional antivirals may include AZT, ddI, ddC, D4T, 3TC, DAPD, alovudine, abacavir, adefovir, adefovir dipivoxil, bis-POC-PMPA, GW420 867X, foscarnet, hydroxyurea, Hoechst-Bayer HBY 097, efavirenz, trovirdine, MIV -150, capravirine, nevirapine, delaviridin, tipranavir, emtricitabine, PFA, H2G (omaciclovir), MIV-606 (valomaciclovir stearate), TMC-126, TMC-125, TMC-120, efavirenz, DMP-450, loviride, ritonavir, (including kaletra), lopinavir, saquinavir, lasinavir, indinavir, amprenavir, amprenavir phosphate, nelfinavir and the like, typically at molar proportions reflecting their respective activities and bioavailabilities. Generally, such a ratio will be in the order of 25: 1 to 1: 25, relative to the compound of formula 1, but may be lower, for example, in the case of cytochrome p450 antagonists such as ritonavir. Compounds of the invention are typically prepared as follows: Scheme 1 (a) DPPA, Et 3 N, toluene; (b) substituted 2-aminopyridine; (c) Aqueous HCl, dioxane; (d) substituted 2-pyridyl isothiocyanate. Compounds of the general formula (I), wherein T is O (urea) or S (thiourea), Re is the oxyphenyl or oxypyridyl portion (substituted), or the thio, sulfine, sulfone or methylene analog of such ethers and R3 is H, are prepared by methods shown in Scheme 1. The cyclopropanecarboxylic acid 1-Scheme-1 is converted to the acyl azide and heated to 120 ° C to induce Curtius reinstallation and provide the isocyanate 2-Scheme-1. Urea 3-Scheme-1 is obtained by coupling the isocyanate with the 2-aminopyridine, which is substituted. Hydrolysis of the isocyanate as in step (c) resulting in the cyclopropylamine 4-Scheme-1, cleaved by reaction with a 2-pyridyl isothiocyanate provides the thiourea 5-Scheme-1. The isothiocyanate can be prepared from the optionally substituted 2-aminopyridine ring by known methods, such as treatment with thiophosgene or thiocarbonyldiimidazole. Variants R3 of formula I are prepared correspondingly using amine-substituted pyridine substituted with amine in an appropriate manner, ie, 2- (N-methylamino) pyridine for R3 as methyl. Many 2-aminopyridines are commercially available and others are described in the literature or are easily derived from it, for example, those shown in Scheme 2. Compounds T = S can alternatively be prepared from the isothiocyanate corresponding to 2-Scheme 2A or amine 3, 3a-Scheme 2 and amino-R2 together with an RC (= S) R 'both as described in WO 9303022. Scheme 2A 3rd 3a (a) base, DMF, heat; (b) reduction; (c) oxidation; (d) base, Cu catalyst, heat The preparation of 5-O-or 5-S-substituted 2-aminopyridines is emphasized in Scheme 2A. 1-Scheme-2A with appropriate R1 and R2 substituents, or precursors (syntheses) for these substituents, is reacted in step (a) with 5-bromo-2-nitropyridine and a base, such as NaH or Cs2CO3, to provide replacement of bromine and give the compound nitro 2-Scheme-2A. The nitro group is then reduced to the amine in step (b), typically by hydrogenation at atmospheric pressure in the presence of catalysts such as Pd or Raney nickel. The transformation of precursors into the substituents R.sup.1, R.sup.2 can be done in the nitro compound 2 ^ Scheme-2A before the reduction step (b). In the case of sulfanyl 2-Scheme-2A, different oxidizing agents, for example, hydrogen peroxide, convert the sulfide group to S = (O) r in step (c), followed by reduction of the nitro group to give 5- Scheme-2A. The thio 3a-Scheme-2A compounds can also be prepared directly as in step (d) by coupling 2-amino-5-bromopyridine with the thiol 1 a-Scheme-2A in the presence of copper catalysts, for example by heating 150 ° C with Cu or Cul in DMF with a base such as K2CO3. Scheme 2B (a) NH3, EtOH, heat; (b) Et3SiH, TFA, H2SO4 The preparation of suitable 5-substituted methyl-2-aminopyridines is indicated in Scheme 2B. Metanone 1-Scheme-2B with appropriate R1 and R2 substituents, or precursors (syntheses) for these substituents, is reacted in step (a) with ammonia to provide chlorine replacement and give the amino compound 2z Scheme-2B. The quete group is then reduced in CH2 in step (b) to give 3-Scheme-2B. Scheme 3 (a) ethyl diazoacetate, catalyst, CH2Cl2; (b) chromatography and then reflux with LiOH, H2O, MeOH; (c) reflux with LiOH, H2O, MeOH and then chromatography; (d) rt, NaOH, H2O, MeOH and then reflux with LiOH, H2O, MeOH Compounds of the general formula (I), wherein T is O (urea) or S (thiourea), R1, and R2, are R1 and R2, protected as necessary with conventional hydroxyl, carboxy of amino protecting groups, or conventional synthons for R1 / R2, R3 is H, X is -D-CH2, and wherein the cyclopropyl moiety has the relative configuration are prepared by methods shown in Scheme 3. Cyclopropanation of the double bond in chromene 1-Scheme-3 with ethyl diazoacetate is catalyzed by rhodium (I I) or cuprous salts such as, (CuOTf) 2-benzene, and Rh2 (OAc) 4 in solvents such as dichloromethane, 1,2-dichloroethane, or chloroform. The reaction affords a diastereomeric mixture of the ethyl esters of cyclopropanecarboxylic acid 2-Scheme-3, with all the relative cis configuration, and its trans isomer 3-Scheme-3. The separation by column chromatography of the cis and trans diastereomers can be carried out in this step, followed by hydrolysis of the isolated 2-Scheme-3, such as by refluxing in aqueous metabolic LiOH, to produce a racemic mixture of all the cyclopropanecarboxylic acid 4 ^ Scheme-3, as described in step (b). Alternatively, the diastereomeric mixture of ethyl esters may be subjected to hydrolysis, and separation conducted in the mixture of cyclopropanecarboxylic acids to provide all of the isolated cis isomer, as in step (c). Step (d) includes cis-2-Scheme-3 ethyl ester isolation which can also be done by selective hydrolysis of the trans-3-Scheme-3 at lower temperatures, such as treatment with aqueous metabolic NaOH at room temperature. The isolated cis ethyl ester can then be hydrolysed in the usual manner to the cyclopropanecarboxylic acid 4-Scheme-3. The cyclopropanecarboxylic acid is subjected to the methods outlined in Scheme 1 to obtain the urea or thiourea 5-Scheme-3. The phenomena 1-Scheme-3 are prepared by methods shown in Schemes 4, 5, and 6. Although this scheme 3 has been illustrated with a variant D = 0 it will be apparent that the corresponding manipulations will be available for the D = S variants, S = O; S (= O) 2 and D = NR8. When R8 is H, the nitrogen is typically protected with a conventional secondary amine protecting group, such as those described in Greene & Wuts Protective Groups in Organic Synthesis 2nd ed, Wiley NY 1991). Scheme 4 (a) 3-bromopropin, K2CO3, acetone; (b) N. N-diethylaniline or PEG-200, 225 ° C Scheme 4 describes the preparation of crypoms, including many of the commercially available disubstituted phenols, such as those wherein the substitution pattern in the benzene ring is as follows: R4 and R7 are halo; R4 and R6 are halo; R5 and R7 are halo; R4 is halo and R7 is C3_3 alkylcarbonyl; and R4 is hydroxy while R5 is C1-3 alkylcarbonyl. The reaction of the available disubstituted phenol 1-Scheme-4 with 3-bromopropin in the presence of a base, such as K2CO3 in acetone or NaH in DMF, results in nucleophilic substitution of the halide to provide the ether 2-Scheme-4. Ring closure can be performed by heating the ether in N. N-dimethylaniline or polyethylene glycol to produce chromene 3-Scheme-4. Scheme 5 NaBH 4, EtOH; (b) p-toluenesulfonic acid, toluene, reflux; Scheme 5 describes the preparation of chromosomes, used as starting material in Scheme 3, of appropriately substituted chromanones, which are easily obtained from commercially available chromanones, for example those in which one of the positions in R4 to R7 is replaced with halo or C1-3 alkoxy. Conversion of the carbonyl group to 4-chromanone 1-Scheme-5 and to the corresponding alcohol by a suitable reducing agent such sodium borohydride in ethanol gives 2-Scheme-5. Refluxing the alcohol with small amounts of acid, such as p-TsOH in toluene, causes dehydration of 2-Scheme-5 to the desired chromene 1-Scheme-3. Corresponding manipulations will be available for other variants D. For example, corresponding 2H-1-benzothiopyran is readily prepared from commercially available (substituted) thiochroman-4-ones by reaction with a reductant such as a metal hydride, for example, aluminum hydride of lithium in an organic solvent such as ether, followed by dehydration such as reflux with an acid, for example, potassium acid sulfate or the like. Scheme 6 (a) allyl bromide, K2CO3, acetone; (b) Ph3PCH3Br, NaH, THF; (c) CI2 [Pcy3] 2Ru = CHPh, CH2Cl2 (d) Ph3P + CH = CH2 Br, DBU Chromos, to be used as starting material in Scheme 3, are prepared from substituted o-hydroxybenzaldehydes as shown by underlined methods in the Scheme 6. Reaction of 1 ^ Scheme-6 with allyl bromide in the presence of a base, such as K2CO3 in acetone, results in nucleophilic substitution of the halide to provide the ether 2-Scheme-6. Witting reaction transforms the aldehyde group into the olefin and provides 3-Scheme-6. The pair of terminal double bonds can undergo metathesis intramolecularly by treatment with a catalyst such as the Grubb catalyst of the ruthenium catalyst complex in step (c) to produce the chromene. Alternatively 1-Scheme-6 can be cyclized directly as shown in step d) in the previous legend. Scheme 7 (a) Pd (0), DPPP, Et3N, (b) Pd (0), vinyl butyl ether, DMF; (c) Pd (0), Zn (CN) 2, DMF; (d) NaOH, H2O, MeOH Coupling catalyzed by Pd (0) of triflate 1-Scheme-7 leads to the replacement of the trifluoromethanesulfonyloxy group and the introduction of other substituents in R6. In this manner, Scheme 7 provides for the preparation of synthetic intermediates to be used in Scheme 3 to give the urea or thiourea 5 ^ Scheme-3 wherein R 6 is cyano, ethynyl, or C1-3 alkylcarbonyl.

Scheme 8 (a) BuLi / ZnCl2, THF; Pd (OAc) 2, BrCH = CHCOOEt; DIBAL (b) TsNHN = CHCOCI; PhNMe2, NEt3, CH2CI2 (c) Rh2 (5-R-MEPY), dichloromethane degassed abs (d) 30% HBr, AcOH (e) NaOH, H2O (f) NaOH; CO2; l-Prl / DMSO (g) IPrOH, HCl; DEAD, PPh3, THF (h) NaOH, MeOH: H2O (i) 1.BBr3, CH2Cl22. CH3CN 3. NaOH, water (j) 1. BuLi / ZnCl2, THF; Pd (OAc) 2. cpd 9-Scheme-8 3. Jones reagent (chromic acid, sulfuric acid in acetone) Suitable routes to compounds where X is -CH 2 -O- are represented in Scheme 8, where Ra and Rb are optional substituents R -R7, which are adequately protected with conventional protecting groups as necessary and Rc is a lower alkyl ester. Optionally substituted phene 1-Scheme-8 which is protected with hydroxy with a protecting group such as methyl, MOM and the like is reacted with a base such as BuLi or the like in a solvent such as THF or the like and transformed into a salt of zinc by adding zinc chloride or similar. A catalyst such as Pd (OAc) 2 or the like is added together with an activated acrylate such as lower alkyl-cis-3-haloacrylate, for example BrCH = CHCOOEt or the like. The reaction mixture is cooled and a reducing agent such as DIBAL or the like is added per portion and quenched to produce 2-Scheme-8. A hydrazone such as p-toluenesulfonylhydrazone of glyoxylic acid chloride or the like and a base such as N, N-dimethylaniline or the like is added in a solvent such as CH2Cl2 or the like followed by the addition of another base such as Et3N or the similar to produce 3-Scheme-8. The reaction product is dissolved in a solvent such as dichloromethane or the like which is preferably degassed. A chiral Doyle catalyst such as Rh2 (5-R-MEPy) 4 (US 517531 1, available from Aldrich or Johnson Matthey), or the like is added to produce 4-Scheme-8 in a high enantiomeric excess such as 80, preferably greater than 90% ee. Preferably, this compound is first reacted with BBr3 in dichloromethane followed by the addition of acetonitrile, the reaction mixture and finally sodium hydroxide is added to give 6-Scheme-8. Alternatively, this product (4- Scheme-8) is ring-opened with an electrophile preferably HBr or the like along with an acid such as AcOH or the like. Under acidic conditions a spontaneous ring closure takes place to form chromenone 5-Scheme-8. When subjected to basic conditions such as NaOH or the like, chromenone is rearranged to form the chromencyclopropylcarboxylic acid 6-Scheme-8. Alternatively, 4 ^ Scheme-8, for example when the phenolic protecting group is MOM, may be subjected to basic conditions such as NaOH, carbon dioxide and a lower alkyl halide such as Prl in a solvent such as DMSO to open the lactone. and producing alkyl ester 7_z_ Scheme-8. Displacement of the hydroxy protecting group and ring closure with the free hydroxymethyl portion occurs under acidic conditions such as iPrOH / HCl or the like followed by DEAD; PPH3 in an organic solvent such as THF or similar io. Alternatively, in a convergent approach, compound 1-Scheme-8 is reacted with BuLi and transformed into zinc salt. This salt reacts with cyclopropyl iodide, 9-Scheme-8, in a palladium-catalyzed reaction to give after reaction with the Jone reagent compound 4-Scheme-8. This carboxylic acid is in turn converted to the isocyanate as shown in Scheme 1 and subsequently to the heteroarylurea or heteroaryl thiourea of Formula Z. Variants R3 of the formula Z are prepared accordingly using phenyloxypyridine or substituted pyridoxy appropriately substituted by amine , ie, 5-substituted-2- (N-methylamino) pyridine derivatives for R 3 as methyl. Compounds wherein X is an optionally substituted alkylene are conveniently prepared by Scheme 9: Scheme 9 2 (a) NaBH 4, EtOH; (b) p-toluenesulfonic acid, toluene, reflux; Scheme 9 describes the preparation of tetralins, indanes and homologs, used as starting material in the above schemes of monosubstituted tetralones, etc., wherein the positions R4 to R7 is / are substituted (s), for example with halo or C1-C3 alkoxy . Conversion of the carbonyl group to 1 -tetralone 1 b-Scheme-9 in the corresponding alcohol by a reducing agent such as sodium borohydride in ethanol gives 2-Scheme-9. Refluxing the alcohol with small amounts of acid, such as p-TsOH in toluene, causes dehydration of 2-Scheme-9 to the desired tetralin-1-Scheme-9.

The corresponding reactions are applicable to n = 1 or 3. Although it is possible for the active agent to be administered alone, it is preferable to present it as part of a pharmaceutical formulation. Such formulation will comprise the active agent defined above together with one or more acceptable excipients or vehicles and optionally other therapeutic ingredients. The vehicle (s) must be acceptable in the sense of being compatible with the other ingredients of the formulation and not harmful to the recipient. Formulations include those suitable for rectal, nasal, topical (including buccal or sublingual), vaginal or parenteral administration (including subcutaneous, intramuscular, intravenous and intradermal), but preferably the formulation is an orally administered formulation. The formulations may conveniently be presented in unit dosage form, for example, sustained release tablets and capsules, and may be prepared by any method well known in the pharmacy field. Such methods include the step of associating the active agent defined above with the vehicle. In general, the formulations are prepared by uniformly and intimately associating the active agent with liquid carriers or finely divided solid carriers or both, and then if necessary to form the product. The invention extends to methods for preparing a pharmaceutical composition comprising bringing in conjunction or association a compound of formula Z or its pharmaceutically acceptable salt with a pharmaceutically acceptable carrier or vehicle. If the manufacture of pharmaceutical formulations includes intimate mixing of pharmaceutical excipients and the active ingredient in salt form, then it is often preferred to use excipients that are non-basic in nature, ie, either acidic or neutral. Formulations for oral administration in the present invention may be presented as discrete units such as capsules, sachets or tablets each containing a predetermined amount of the active agent; as a powder or granules; as a solution or suspension of the active agent in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion and as a bolus, etc. With respect to compositions for oral administration (e.g., tablets and capsules), the term "suitable carrier" includes carriers such as common excipients, e.g., binding agents, e.g., syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone ( Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch, fillers and carriers, for example, corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and acid alginic; and lubricants such as magnesium stearate, sodium stearate and other metal stearates, stearic acid, glycerol stearate, silicone fluid, talc waxes, oils and colloidal silica. Flavoring agents such as peppermint, oil of wintergreen, cherry flavor or the like can also be used. It may be desirable to add a coloring agent to make the dosage form easily identifiable. The tablets may also be coated by methods well known in the art. A tablet can be made by compression or molding, optionally with one or more accessory ingredients. Compound tablets can be prepared by compressing in a suitable machine the active agent in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface dispersing or active agent. The molded tablets can be made by molding in a suitable machine a mixture of the wetted powder compound with an inert liquid diluent. The tablets can optionally be coated or sorted and can be formulated to provide slow or controlled release of the active agent. Other formulations suitable for oral administration include dragees comprising the active agent in a flavored base, usually sucrose or acacia and tragacanth.; pills comprising the active agent in an inert base such as gelatin and glycerin, or sucrose and acacia; and mouth rinses comprising the active agent in a suitable liquid vehicle.

DETAILED DESCRIPTION Several aspects of the invention will now be illustrated by way of example only with reference to the following non-limiting examples.

Example 1 N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-l] -N '- [5- (4 - (sulfonamido) phenoxy) -2-pyridinyl] urea a) 5- (4- (Nt-butylsulfonamido) phenoxy) -2-nitropyridine To a solution of 4-hydroxy- (Nt-butyl) benzenesulfonamide (3.01 g, 13.2 mmol) in DMF (48 mL), cesium carbonate (5.67 g, 17.4 mmol) is added, followed by addition of 5-bromo-2 -nitro pyridine (2.36 g, 11.6 mmol) and the mixture is stirred at 50 ° C for 12 hours. The suspension is filtered and the solvent is evaporated and then the residue is extracted between sat. NaHCO3. ac. and methylene chloride. The organic phase is dried over sodium sulphate and evaporated. The resulting mixture is purified by column chromatography on silica gel (0-1 / 2-1% gradient EtOH / methylene chloride) to give 3.47 g material of which about 70% was the title compound (LC-MS, API -ES0 352.4; Cale 351.38) and approximately 30% was 2- (4- (Nt-butylsulfonamido) phenoxy) -5-bromopyridine (LC-MS, API-ES0 386.3; Cale 385.24) as a by-product. 1 H-NMR (CDCl 3): 8.37 (d, 1 H), 8.31 (d, 1 H), 7.98 (d, 2 H), 7.54 (dd, 1 H), 7.20 (d, 2H), 4.51 (s 1 H), 1.28 (s, 9H). b) 5- (4- (N-t-Butylsulfonamido) phenoxy) -2-pyridinamine The product mixture obtained in Example 1a (3.47 g) is dissolved in ethanol (70 ml) and ethyl acetate (18 ml). Then 10% palladium on charcoal (680 mg) is added and the black suspension is hydrogenated with stirring under normal hydrogen pressure for VA hours. The catalyst is filtered and the filtrate is evaporated. The resulting residue is purified by column chromatography on silica gel (0-10% gradient EtOH / methylene chloride) to give 2.42 g of the title compound (57% yield during two steps). (LC-MS, API-ES0322.0; Cale.320.41) 1H-NMR (d6-DMSO): 7.77 (d, 1H), 7.73 (d, 2H), 7.20 (dd, 1H), 7.39 (s, 1H) ), 7.25 (dd, 1H), 6.99 (d, 2H), 6.50 (d, 1H), 5.97 (br, s 1H), 1.06 (s, 9H). c) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-ll] -N'-5- (4- (Nt-butylsulfonamido phenoxy) -2-pyridyl] urea Acid (1S, 1aR, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid, prepared as shown in WO02 / 705163 (68 mg, 0.301 mmol) , 5- (4- (Nt-Butylsulfonamido) phenoxy) -2-pyridinamine (109 mg, 0.0341 mmol) and triethylamine (47 μL, 0.341 mmol) are mixed together in dry toluene (2 mL) and argon atmosphere. enter Then DPPA (74 μl, 0.341 mmol) is added and the reaction solution is stirred at 110 ° C for 3 hours. The reaction mixture is worked up by extractions between methylene chloride and 5% citric acid followed by sat. NaHCO3. ac. Silica gel column chromatography (1-2% gradient EtOH / methylene chloride) gives 143 mg of material which is further purified by preparative TLC chromatography (10% MeOH / CHCl3) to finally give 100 mg of pure product as a powder white (61% production). (LC-MS, API-ES *: 545.0; Cale.544.48). 1 H-NMR (CDCl 3): 9.29 (br s, 1 H), 7.85 (d, 2 H), 7.64 (d, 1 H), 7.62 (s, 1 H), 7.29 (dd, 1 H), 6.96 (d, 2 H), 6.79 (d tr, 1H), 6.70 (d, 1H), 6.59 (d tr, 1H), 4.52 (s, 1H), 4.47 (dd, 1H), 4.33 (dd, 1H), 3.79 (q, 1H) , 2.62 (tr, 1H), 1.98 (m, 1H), 1.26 (s, 9H). d) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (sulfonamido)] phenoxy) -2-pyridinyljurea N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (Nt-butylsulfonamido) dry phenoxy) -2-pyridinyl] urea (36 mg, 0.066 mmol) is dissolved in 1% triflic acid / acetonitrile solution (5.8 ml) and the reaction solution is stirred for 30 minutes at room temperature.

The reaction is quenched with a small amount of pyridine and the acetonitrile is removed by evaporation. The residue is worked up by extractions between methylene chloride and sat. NaHCO3. ac. The organic phase is dried over sodium sulphate, which is evaporated.

Column chromatography on silica gel (1-4% gradient EtOH / methylene chloride) gave 26 mg of pure product as a white powder (71% yield). 1 H-NMR (d 6 -DMSO): 9.41 (s, 1 H), 8.06 (br, s 1 H), 7.77 (d, 2 H), 7.73 (d, 1 H), 7.52 (dd, 1 H), 7.32 (d, 1 H), 7.29 (s, 1 H), 7.05 (d, 2H), 6.79 (d tr, 1 H), 7.02 (d tr, 1 H), 4.32 (dd, 1 H), 4.28 ( dd, 1 H), 3.51 (q, 1 H), 2.47 (tr, 1 H), 2.00 (m, 1 H). Example 2 N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-l] -N '- [5- (4 - (N-methylcarboxyamido) phenoxy) -2-pyridinyl] urea a) 5- (4- (N-methylcarboxyamido) phenoxy) -2-nitropyridine Potassium tert-butoxide (1.91 mg, 1.70 mmol) is added to a solution of 4-hydroxy-N-methylbenzamide (257 mg, 1.70 mmol) in DMF (2.5 mL) and the mixture is stirred for 1 hour at room temperature. The mixture is then heated to 65 ° C and 5-bromo-2-nitro pyridine (305 mg, 1.50 mmol) is added and the mixture is stirred at 65 ° C for 12 hours. Then the solvent is evaporated and the residue is extracted between water and methylene chloride. The organic phase is dried over sodium sulphate and evaporated. The resulting mixture is purified by column chromatography on silica gel (0-1 1% gradient EtOH / methylene chloride) to give 358 mg of material of which about 60% was the title compound (LC-MS, API-ES ": 273.9; Cale 273.25) and about 40% was 2- (4- (N-methylcarboxamido) phenoxy) -5-bromopyridine (LC-MS, API-ES0 307.8, 308.8; Cale 307.15) as a by-product. 1 H-NMR (de-DMSO): 8.46 (br q, 1 H), 8.45 (d, 1 H), 8.34 (d, 1 H), 7.93 (d, 2 H), 7.71 (dd, 1 H), 7.28 (d, 2H), 2.78, 2.77 (2 xs, 3H) b) 5- (4- (N-methylcarboxyamido) phenoxy) -2-pyridinamine The product mixture obtained in step a) (358 mg) is dissolved in ethanol (10 ml). Then 1 0% palladium on charcoal (10 mg) is added and the black suspension is hydrogenated with stirring under normal hydrogen pressure for VA hours. The catalyst is filtered and the filtrate is evaporated. The resulting residue is purified by column chromatography on silica gel (2-6% gradient EtOH / methylene chloride) to give 18 mg of the title compound (32% yield during two steps) (LC-MS, API-ES0 244.4; Cale 243.27) 1 H-NMR (CDCl 3): 7.93 (d, 1 H), 7.71 (d, 2H), 7.21 (dd, 1 H), 7.25 (dd, 1 H), 6.94 (d, 2H ), 6.55 (d, 1 H), 6.01 (br, s 1 H), 4.41 (br s, 2 H), 3.01 (2 x s, 3 H). c) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (N- methylcarboxyamido) phenoxy) -2-pyridinyl] urea The title compound is synthesized analogously to Example 1 of 5- (4- (N-methyl carboxyamido) phenoxy) -2-pyridinamine (37 mg, 0.15 mmol). Column chromatography on silica gel (0-2% gradient EtOH / methylene chloride) gave 41 mg of pure product as a white powder (65% yield). (LC-MS, API-ES0 467.1; Cale. 466. Four. Five). 1 H-NMR (CDCl 3): 9.33 (br s, 1 H), 7.99 (s, 1 H), 7.75 (d, 2 H), 7.61 (d, 1 H), 7.28 (dd, 1 H), 6.93 (d, 2 H), 6.78 (d tr, 1H), 6.72 (d, 1H), 6.57 (d tr, 1H), 6.07 (br q, 1H), 4.45 (dd, 1H), 4.33 (dd, 1H), 3.78 (q, 1H) ), 3. 03 (d, 3H), 3.66 (tr, 2H), 2.61 (tr, 1H), 2.01-1.95 (m, 1H). Example 3 N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (N- methylsulfonamido) phenoxy) -2-pyridinyl] urea a) 5- (4- (N-methylsulfonamido) phenoxy) -2-nitropyridine The title compound is synthesized analogously to Example 1a of N- (4-hydroxyphenyl) methanesulfonamide (150 mg, 0.802 mmol). Column chromatography on silica gel (0-0.75% EtOH / methylene chloride gradient) gave 63 mg of material of which > 90% was the title compound (LC-MS, AP1-ES0 308.0; Cale 307.25). (2- (4- (N-methylsulfonamido) phenoxy) -5-bromopyridine (LC-MS, API-ES0 307.8, 308.8; Cale 307.1 5) is formed as a secondary product). 1 H-NMR (d 6 -DMSO): 8.52 (d, 1 H), 8.36 (d, 1 H), 7.85 (d, 2 H), 7.83 (dd, 1 H), 7.48 (q, 1 H), 7.40 (d d, 2H), 2.43, 2.42 (2 xs, 3H). b) 5- (4- (N-methylsulfonamido) phenoxy) -2-pyridinamine The title compound is synthesized analogously to Example 2b) of (5- (4- (N-methylsulfonamido) phenoxy) -2-nitropyridine (63 mg, 0.204 mmol). Filtration and evaporation gave 73 mg of crude product. MS, API-ES0 280.0; Cale 279.34) .1 H-NMR (d6-DMSO): 7.78 (d, 1 H), 7.70 (d, 2H), 7.25 (dd, 1 H), 7.02 (d, 2H ), 6.50 (dd, 1 H), 5.97 (s 1 H), 2.37, 2.36 (2 xs, 3H) c) N - [(1 S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromen-1 -yl] -N '- [5- (4- (N-methylsulfonamido) phenoxy) -2-pyridinyl] urea The title compound is synthesized analogously to Example 1 c) of 5- (4- (N-methylsulfonamido) phenoxy) -2-pyridinamine (76 mg, 0.204 mmol). Column chromatography on silica gel (1-2 %% gradient EtOH / methylene chloride) gave pure fractions containing 36 mg of pure product as a white powder (40% yield). (LC-MS, API-ES *: 503.0; Cale.502.32). 1 H-NMR (CDCl 3): 9.47 (br s, 1 H), 8.68 (s, 1 H), 7.85 (s, 1 H), 7.57 (d, 1 H), 7.30-7.24 (m, 3 H), 6.83-6.77 (m , 2H), 6.56 (d tr, 1H), 4.45 (dd, 1H), 4.32 (dd, 1H), 3.81 (q, 1H), 3.02 (s, 3H), 2.60 (tr, 1H), 1.99-1.93 (m, 1H). Example 4 N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4-aminophenoxy-2 -pyridinyl] urea a) 5- (4- (Nt-butoxycarbonylamino) phenoxy) -2-nitropyridine The title compound is synthesized analogously to Example 1a) of 4- (N-t-butoxy-carbonylamino) phenol (581 mg, 2.78 mmol). Silica gel column chromatography (0-2% gradient EtOH / methylene chloride) gave 704 mg of material of which about 50% was the title compound (LC-MS, API-ES *: 332.0; Cale 331.25) . The other half consisted of (2- (4- (Nt-butoxycarbonylamino) phenoxy) -5-bromopyridine (LC-MS, API-ES *: 364.9, 366.0; Cale.363.15), which is formed as a secondary product. -NMR (d6-DMSO): 9.47 (br s, 1H), 8.35 (d, 1H), 8.29 (d, 1H), 7.55 (d, 2H), 7.51 (dd, 1 H), 7.15 (d, 2H) ), 1 .47 (s, 9H) b) 5- (4- (Nt-butoxycarbonylamino) phenoxy) -2-pyridinamine The title compound is synthesized analogously to Example 2b) of the mixture obtained from step a), containing (5- (4- (N-t-butoxycarbonylamino) phenoxy) -2-nitropyridine (total 704 mg).

After the reaction, the resulting residue after filtration and evaporation is purified by column chromatography on silica gel (2-10% gradient EtOH / methylene chloride) to give 41 8 mg of title compound (57% yield during two steps) (LC-MS, API-ES *: 302.0; Cale. 301.35) 1 H-NMR (CDCl3): 7.69 (d, 1 H), 7.32 (d, 2H), 7.31 (d, 1 H), 6.90 (d, 2H), 6.68 (d, 1 H), 6.47 (br, s 1 H), 4.98 (br s, 2H), 1.51 (s, 9H). c) N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1 -yl] -N '- [5- (4- (Nt-butoxycarbonylamino) phenoxy) -2-pyridinyl] urea The title compound is synthesized analogously to Example 1 c) of 5- (4- (N-t-butoxycarbonylamino) phenoxy) -2-pyridinamine (41 8 mg, 1.39 mmol). Silica gel column chromatography (1-4% gradient EtOH / methylene chloride) gave 479 mg of product as a white powder (74% yield). (LC-MS, API-ES *: 525.1; Cale. 524. 30). 1 H-NMR (CDCl 3): 9.32 (br s, 1 H), 7.34 (d, 2 H), 7.20 (dd, 1 H), 6.88 (d, 2H), 6.79 (d tr, 1H), 6.58 (d tr, 1H), 6.45 (s, 1H), 4.41 (dd, 1H), 4.34 (dd, 1H), 3.75 (q, 1H), 2.59 (tr, 1H), 1.98-1.93 (m, 1H), 1.52 (s, 9H). d) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4-aminophenoxy) - 2-pyridinyljurea N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (Nt-butoxycarbonylamino) phenoxy) -2-pyridinyl] urea dry (242 mg, 0.46 mmol) is dissolved in methylene chloride (2 ml) and then 1M HCl / AcOH (4.6 ml) is added and the reaction solution is stirred for 60 minutes at room temperature ambient. The volatiles are removed by evaporation. The residue is worked up by extractions between methylene chloride and sat. NaHCO3. ac. The organic phase is dried through sodium sulphate and evaporated. Column chromatography on silica gel (1-3% or gradient EtOH / methylene chloride) gave 139 mg of pure product as a white powder (71% yield). 1 H-NMR (CDCl 3): 9.33 (br s, 1 H), 7.44 (d, 1 H), 7.24 (s, 1 H), 7.17 (dd, 1 H), 6.79 (d, 2 H), 6.77 (d tr, 1 H), 6.68 (d, 2H), 6.60-6.54 (m, 2H), 4.40 (dd, 1 H), 4.35 (dd, 1 H), 3.73 (q, 1 H), 3.61 (br s, 2H), 2.57 (tr, 1 H), 1 .98-1 .92 (m, 1 H). Example 5 N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1 -yl] -N '- [5- (4- (methylsulfon) phenoxy) -2-pi ridinyl] urea a) 5- (4- (m-ethylsulfon) phenoxy) -2-nitropyridine The title compound is synthesized analogously to Example 1 a) of 4-hydroxyphenyl methyl sulfone (288 mg, 1.67 mmol). Column chromatography on silica gel (0-2% gradient EtOH / methylene chloride) gave 300 mg of material with more than 90% of the title compound (LC-MS, API-ESX 353.0 (m + AcO "); 294.29) .A little percent of contaminating 2- (4- (methylsulfon) phenoxy) -5-bromopyridine (LC-MS, API-ES *: 327.9, 330.0; Cale 328.19) was present.1H-NMR ( CDCI3): 8.41 (d, 1 H), 8.33 (d, 1 H), 8.04 (d, 2H), 7.58 (dd, 1 H), 7.27 (d, 2H), 3.1 0 (s, 3H). ) 5- (4- (methylsulfon) phenoxy) -2-pyridinamine The title compound is synthesized analogously to Example 2b) of the mixture obtained from step a), containing (5- (4- (methylsulfon) phenoxy) -2-nitropyridine (300 mg) .This material is dissolved with heating in a mixture of ethyl acetate (10 ml), isopropanol (3 ml) and methanol (3 ml) After the reaction, which is continued at room temperature, the resulting residue after filtration and evaporation is purified by gel column chromatography. silica (2-4% gradient EtOH / methylene chloride) to give a pure fraction containing 160 mg of the title compound (LC-MS, API-ES *: 265.0, Cale.264.31) c) N - [(1S , 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (methylsulfon) phenoxy) -2-pyridinyljurea The title compound is synthesized analogously to Example 1 c) of 5- (4- (methyl-sulfon) phenoxy) -2-pyridinamine (31 mg, 0.118 mmol). Silica gel column chromatography (1-3% EtOH / methylene chloride gradient) followed by preparative TLC (10% or MeOH / CHCl3) gave 10.7 mg of pure product as a white powder (19% yield). (LC-MS, API-ES *: 488.0; Cale.487.48). 1 H-NMR (CDCl 3): 9.41 (br s, 1 H), 8.99 (s, 1 H), 7.91 (d, 2 H), 7.68 (d, 1 H), 7.31 (dd, 1 H), 7.04 (d, 2 H), 6.87 (d, 1H), 6.80 (d tr, 1H), 6.58 (d tr 1H), 4.48 (dd, 1H), 4.32 (dd, 1H), 3.82 (q, 1H), 2.62 (tr, 1H), 2.01-1.95 (m, 1H).

Example 6 N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1 -yl] -N '- [5- (4- (2-hydroxyethyl) phenoxy) -2-pyridinyl] urea a) 5- (4- (2-hydroxyethyl) phenoxy) -2-nitropyridine The title compound is synthesized analogously to Example 2a of 2- (4-hydroxyphenyl) ethylalcohol (234 mg, 1.70 mmol). Silica gel column chromatography (0-2% gradient EtOH / methylene chloride) gave 237 mg of material with more than 80% of the title compound (LC-MS, API-ESX 319.0 (m + AcO "); 260.25) Approximately 10-15% of contaminating 2- (4- (2-hydroxyethyl) phenoxy) -5-bromopyridine (LC-MS, API-ES *: 294.0, 296.0; Cale 295.25) was present, b) 5- (4- (2-hydroxyethyl) phenoxy) -2-pyridinamine The title compound is synthesized analogously to Example 2b of the mixture obtained from step a), containing (5- (4- (2-hydroxyethyl) phenoxy) -2-nitropyridine (1 97 mg) .The resulting residue filtration and evaporation is purified by column chromatography on silica gel (2-1 0% gradient EtOH / methylene chloride) to give a pure fraction containing 65 mg of title compound (LC-MS, API-ES *: 231.1; Cale.230.27) c) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N '- [5- (4- (2-hydroxyethyl) phenoxy) -2-pyridinyljurea The title compound is synthesized analogously to Example 1c) of 5- (4- (2-hydroxyethyl) phenoxy) -2-pyridinamine (62 mg, 0.282 mmol). Column chromatography on silica gel (0-4% gradient EtOH / methylene chloride) gave fractions, of which 8 mg of pure product as white powder are obtained, and additionally some mixed fractions (LC-MS, API-ES *: 454.2; Cale.453.45). 1 H-NMR (CDCl 3): 9.38 (br s, 1 H), 8.28 (s, 1 H), 7.54 (d, 1 H), 7.24 (dd, 1 H), 7.20 (d, 2 H), 6.88 (d, 2 H), 6.77 (d tr, 1H), 6.71 (d, 1H), 6.56 (d tr, 1H), 4.43 (dd, 1H), 4.34 (dd, 1H), 3.87 (t, 2H), 3.77 (q, 1H), 2.86 (t, 2H), 2.59 (tr, 1H), 1.98-1.93 (m, 1H), 1.51 (br, 1H). Example 7 N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl3-N '- [5- (4- (2- ( 2-methoxyethoxy) ethoxy) phenoxy) -2-pyridinyl] urea a) 5- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) -2-nitropyridine The title compound is synthesized analogously to Example 2a) of 4- (2- (2-methoxy-ethoxy) ethoxy) phenol (300 mg, 1.42 mmol). Silica gel column chromatography (Q-A% EtOH / methylene chloride gradient) yielded 173 mg of material with more than 70% of the title compound (LC-MS, API-ES *: 335.1; Cale.334.33). Approximately 20-30% of contaminating 2- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) -5-bromopyridine (LC-MS, API-ES *: 368.0, 370.0; Cale 369.33) was present, b ) 5- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) -2-pipdinamine The title compound is synthesized analogously to Example 2b) of the mixture obtained from Example 22, containing 5- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) -2-nitro pyridine (173 mg). The resulting residue after filtration and evaporation is purified by column chromatography on silica gel (0-6% gradient EtOH / methylene chloride) to give a pure fraction containing 92 mg (60% yield) of the title compound (LC- MS, API-ES *: 305.1; Cale 304.35). 1 H-NMR (CDCl 3): 7.85 (d, 1 H), 7.1 6 (dd, 1 H), 6.90-6.85 (m, 4 H), 6.68 (d, 1 H), 6.50 (d, 1 H), 4.40 (br, 2H), 4. 1 1 (t, 2H), 3.85 (t, 2H), 3.72 (t, 2H), 3.58 (t, 2H), 3.39 (s, 3H). c) N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1 -yl] -N '- [5- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) -2-pyridinyl] urea The title compound is synthesized analogously to Example 1c) of 5- (4- (2- (2-methoxyethoxy) ethoxy) phenoxy) - 2-pyridinamine (46 mg, 0.15 mmol). Silica gel column chromatography (0-1 / 4% gradient EtOH / methylene chloride) gave fractions, of which 14 mg of pure product as white powder are obtained, and additionally some mixed fractions (~ 40 mg) (LC -MS, API-ES *: 528.1; Cale 527.53). 1 H-NMR (CDCl 3): 9.35 (br s, 1 H), 7.82 (s, 1 H), 7.48 (d, 1 H), 7.18 (d, 1 H), 6.89 (m, 4 H), 6.77 (d tr, 1 H) , 6.63 (d, 1H), 6.57 (d tr 1H), 4.42 (dd, 1H), 4.35 (dd, 1H), 4.14 (t, 2H), 3.87 (t, 1H), 3.75 (q, 1H), 3.74 (t, 2H), 3.59 (t, 2H), 3.40 (s, 3H), 2.58 (tr, 1H), 1.98-1.92 (m, 1H). Example 8 5- (. {6 - [( { [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl.} oxy) -N-methyl-2-pyridinecarboxamide a) N-methyl-5 - [(6-nitro-3-pi ridinyl) oxy] -2-p ridí naca rboxam gone - [(6-Nitro-3-pyridinyl) oxy] -2-pyridinecarboxylic acid (260 mg, 1 mmol) is refluxed in thionyl chloride (10 ml) overnight. Excess thionyl chloride is evaporated and crude acid chloride is quenched with aqueous methyl amine to give pure N-methyl-5 - [(6-nitro-3-pyridinyl) oxy] -2-pyridinecarboxamide (1 90 mg, 70 %). 1 H NMR (CDCl 3 + MeOD): 8.4 (d, 1 H), 8.32 (d, 1 H), 8.31 (d, 1 H), 7.42. (br s, 1 H), 7.55 (m, 2H). b) 5- ( { 6 - [( { [(1 S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-y ] amino.} carbonyl) amino] -3-pyridinyl.} oxy) -N-methyl-2-pyridinecarboxamide I NSERT ESQU EMA PAG 35 N-methyl-5 - [(6-nitro-3-pyridinyl) oxy] -2-pyridinecarboxamide (190 mg, 0.7 mmol) is dissolved in methanol (20 ml). The mixture is hydrogenated using Ra / Ni under a hydrogen atmosphere. When the initial material is consumed according to TLC (ether), the mixture is filtered through celite and concentrated under reduced pressure. To the crude product was added acid (1S, 1 aR, 7bS) -4,7-difluoro-1, 1 a, 2, 7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid (0.170 mg, 0.76 mmol) and the The mixture is co-evaporated with Toluene (10 ml) at half the volume. Diphenylphosphoryl azide (179 μL, 0.76 mmol), and triethyl amine (106 μL, 0.76 mmol) is added. The mixture is then refluxed for 4 h under an argon atmosphere. The solvent is then removed under reduced pressure and the crude product is dissolved in ethyl acetate and rinsed with small portions of aqueous hydrochloric acid (0.01 M), saturated sodium hydrogen carbonate and water. Purification by flash chromatography (1% methanol in ether) gave the desired compound (158 mg, 48%). 1 H NMR (CDCl 3): -27 (brs, 1H), 8.25 (d, 1H), 8.17 (d, 1H), 8.16-8.10 (br s, 1H), 7.88-7.82 (m, 1H), 7.67 (d, 1H), 7.31 (dd, 1H), 7.26 (dd, 1H), 6.83-6.75 (m, 2H), 6.61-6.55 (m, 1H), 4.48 (dd, 1H), 4.32 (dd, 1H), 3.81 (q, 1H), 3.02 (d, 3H), 2.62 (t, 1H), 2.02-1.94 (m, 1H). Example 9 4- ( {6 - [( { [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl}. oxy) benzamide a) 4 - [(6-nitro-3-pyridinyl) oxy] benzamide 4-hydroxybenzamide (150 mg, 1.1 mmol) and cesium carbonate (394 mg, 1.21 mmol) is dissolved in dimethylformamide (7 ml). 5-Bromo-2-nitropyridine (244 mg, 1.21 mmol) is then added. The mixture is left at 50 degrees until the initial material is consumed according to TLC (1% methanol in ether). Purification by flash chromatography yielded 4 - [(6-nitro-3-pyridinyl) oxy] benzamide (110 mg, 38%) 1 H NMR (CDCl 3): 8.37 (d, 1H), 8.29 (d, 1H), 7.94 (m , 2H), 7.51 (dd, 1H), 7.18 (m, 2H). b) 4- ( {6 - [( { [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl.} oxy) benzamide This compound is prepared essentially by the same procedure as described for Example 8, starting from 4 - [(6-nitro-3-pyridinyl) oxy] benzamide (100 mg, 0.38 mmol) and acid (1S, 1aR, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid (65 mg, 0.29 mmol) to give pure title compound 20mg (12%). 1 H NMR (CDCl 3 + MeOD): 7.82 (m, 2 H), 7.63 (d, 1 H), 7.30 (dd, 1 H), 6.96 (d, 2 H), 6.90-6.76 (m, 2 H), 6.62-5.59 (m , 1H), 4.45 (dd, 1H), 4.35 (dd, 1H), 2.6 (t, 1H), 2.0-1.92 (m, 1H) Example 10 5- ( { 6 - [( { [( 1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] amino.} Carbonyl) amino] -3-pyridinyl.} Oxy) -2 -pyridinecarboxamide a) 5 - [(6-nitro-3-pyridinyl) oxy] -2-pyridinecarboxamide - [(6-Nitro-3-pyridinyl) oxy] -2-pyridinecarboxylic acid (100 mg, 1 mmol) is refluxed in thionyl chloride (5 ml) overnight. Excess thionyl chloride is evaporated and the crude acid chloride is quenched with aqueous methyl amine to give 5 - [(6-nitro-3-pyridinyl) oxy] -2-pyridinecarboxamide (60 mg, 60%) 1H NMR (DMSO) : 8.60 (d, 1H), 8.57 (d, 1H), 8.13 (s, 1H), 8.11 (br s, 1H), 7.67 (brs, 1H). b) 5- ( {6 - [( { [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl.} oxy) -2-pyridinecarboxamide This compound is prepared essentially by the same procedure as described for Example 8, starting from 5 - [(6-nitro-3-pyridinyl) oxy] -2-pyridinecarboxamide (60 mg, 0.38 mmol) and acid (1S, 1aR , 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid (65 mg, 0.29 mmol) to give pure title compound (18mg, 18%). 1 H NMR (CDCl 3 + MeOD): 9.35 (br s, 1 H), 8.28 (d, 1 H), 8.17 (d, 1 H), 7.75 (br s, 1 H), 7.69 (d, 1 H), 7.33 (dd, 1 H) ), 7.27 (dd, 1H), 6.96 (d, 1H), 6.8 (m, 1H), 6.58 (m, 1H), 4.48 (dd, 1H), 4.32 (dd, 1H), 3.80 (q, 1H), 2.62 (t, 1H), 2.02-1.96 (m, 1H). Example 11 N - [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N'-. { 5- [4- (Hydrazinocarbonyl) phenoxy, -2-pyridinyl} urea a) tert-butyl 2- [4- (benzyloxy) benzoyl] hydrazinecarboxylate A mixture of 4-benzyl oxybenzoic acid (0.780 g, 3.42 mmol), tert-butyl carbazate (0.443 g, 3.35 mmol), Et3N (0.5 mL), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (1.05 g, 5.47 mmol) and 1-hydroxybenzotriazole hydrate (0.778 g, 5.76 mmol) in N, N-dimethylformamide (27 mL) is stirred at room temperature for 2 days. The reaction is concentrated and diluted in dichloromethane. The organic phase is rinsed twice with water, dried with MgSO 4 and concentrated. The residue is purified in column chromatography (silica gel, 5% MeOH in CH 2 Cl 2) and tert-butyl 2- [4- (benzyloxy) benzoyljhydrazine carboxylate (O.ggd g, yield: 85%) is identified by NMR spectroscopy. 1 H-NMR (CDCl 3): 8.21 (s, 1 H), 7.76 (d, 2 H), 7.37 (m, 5 H), 6.95 (d, 2 H), 6.76 (s, 1 H), 5.08 (s, 2 H), 1.48. (s, 9H). b) tert-butyl 2- (4-hydroxybenzoyl) hydrazinecarboxylate A solution of tert -butyl 2- [4- (benzyloxy) benzoyl] hydrazinecarboxylate (75 mg, 2.85 mmol) in the presence of catalytic amount of 10% Pd-C in ethanol (40 mL) is hydrogenated for 3 hours. After filtration on celite, the residue is purified on column chromatography (silica gel, 10% MeOH in CH2Cl2) and tert-butyl 2- (4-hydroxybenzoyl) hydrazine carboxylate (0.688 g, yield: 96%) is identified by NMR spectroscopy. 1H-NMR (CD3OD): 7.73 (d, 2H), 6.82 (d, 2H), 4.84 (s, 2H), 1.48 (s, 9H) c) tert-butyl 2-. { 4 - [(6-nitro-3-pyridinyl) oxy] benzoyl} hydrazinecarboxylate To a mixture of tert-butyl 2- (4-hydroxybenzoyl) hydrazinecarboxylate (0.688 g, 2.73 mmol) and 5-bromo-2-nitropyridine (0.554 mg, 2.73 mmol) and cesium carbonate (1.33 g, 4.08 mmol) in N, N-dimethylformamide (7 mL) is stirred overnight at 80 ° C. The solution is concentrated and the residue is taken with dichloromethane and water. The organic phase is dried over MgSO 4 and concentrated. The crude product is purified by column chromatography (silica gel, 5% MeOH in CH 2 Cl 2), to give 736 mg of the mixture of nitropyridine and bromopyridine. d) tert-butyl 2-. { 4 - [(6-amino-3-pyridinyl) oxy] benzoyl} hydrazinecarboxylate The mixture of nitropyridine and bromopyridine (0.700 g) in the presence of catalytic amount of 10% Pd-C in ethanol (20 mL) and EtOAC (20 mL) is hydrogenated for 1 hour. After filtration on celite, the residue is purified in column chromatography (silica gel, 5% MeOH in CH 2 Cl 2) and tert-butyl 2-. { 4 - [(6-amino-3-pyridinyl) oxy] benzoyl} Hydrazinecarboxylate (0.326 g, production: 35%) is identified by NMR spectroscopy. 1 H-NMR (CD3OD): 7.73 (d, 2H), 6.64 (d, 1 H), 7.17 (dd, 1 H), 6.86 (dd, 2H), 6.55 (d, 1 H), 4.74 (s, 4H), 1 .39 (s, 9H). e) tert-butyl 2- [4- (. {6 - [( { [(1S, 1 aS, 7bS) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c ] chromen-1 -yl] amino.}. carbonyl) amino] -3-pyridinyl.} oxy) benzoyl] hydrazine carboxylate A mixture of chiral acid (1 55 mg, 0.687 mmol), tert-butyl 2-. { 4 - [(6-amino-3-pyridinyl) oxy] benzoyl} hydrazinecarboxylate (267mg, 0.776 mmol), diphenylphosphoryl azide 0.162 mL, 0.756 mmol) and Et3N (0.1 05 mL, 0.756 mmol) in toluene (10 mL) are refluxed for 4 hours. The solution is reduced and the residue is diluted in dichloromethane and rinsed once with HCl (0.001 N) and brine. The organic phase is dried with MgSO 4 and evaporated. The residue is purified in column chromatography (silica gel, 5% MeOH in CH 2 Cl 2) to give the title compound (0.227 g, yield: 52%). 1 H-NMR (CDCl 3): 9.36 (s, 1 H), 9.05 (s, 1 H), 8.9 g (s, 1 H), 7.80 (d, 2 H), 7.62 (d, 1 H), 7.28 (s) , 1 H), 7.25 (d, 1 H), 6.89 (d, 1 H), 6.86 (d, 2H), 6.78 (m, 1H), 6.55 (m, 1H), 4.43 (dd, 1H), 4.30 (dd, 1H), 3.76 (m, 1H), 2. 59 (m, 1H), 1.95 (m, 1H), 1.46 (s, 1H). f) N - [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N'-. { 5- [4- (Hydrazinocarbonyl) phenoxy] -2-pyridinyl} urea Tert-butyl 2- [4- (. {6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1 -yl] amino.} carbonyl) amino] -3-pyridinyl.}. oxy) benzoyl] hydrazine carboxylate (49 mg, 0.089 mmol) in a mixture of dichloromethane (0.5 mL) and trifluoroacetic (0.5 mL) is stirred at room temperature. environment for 30 min. The reaction is concentrated and purified on column chromatography (silica gel, 2% MeOH in CH 2 Cl 2) to give the compound N - [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b- tetrahydrocyclopropa [c] chromen-1-yl] -N'-. { 5- [4- (Hydrazinocarbonyl) phenoxy] -2-pyridinyl} Urea (17.6 mg, production: 42%). 1H-NMR (CD3OD): 7.80 (d, 2H), 7.62 (d, 1H), 7.39 (dd, 1H), 6.97 (d, 3H), 6.83 (m, 1H), 6.62 (m, 1H), 4.41 (m, 1H), 4.29 (dd, 1H), 3.61 (m, 1H), 2.59 (t, 1H), 2.02 (m, 1H). Example 12 4- ( {6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopa [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl.} oxy) -N-cyclopropylbenzamide a) 4- (benzyloxy) -N-cyclopropylbenzamide 4- (benzyloxy) -N-cyclopropylbenzamide (0.774 g, 83%) is synthesized analogously to Example 11a of 4-benzyloxybenzoic acid (0.759 g). 1 H-NMR (CDCl 3): 7.70 (d, 2H), 7.38 (m, 5H), 6.97 (d, 2H), 6.17 (s, 1H), 5.10 (s, 2H), 2.88 (m, 1H), 0.85. (m, 2H), 0.6 (m, 2H). b) N-cyclopropyl-4-hydroxybenzamide N-cyclopropyl-4-hydroxybenzamide (0.332 g, 68%) is synthesized analogously to Example 11b of 4- (benzyloxy) -N-cyclopropylbenzamide (0.774 g). 1H-NMR (CD3OD): 8.26 (s, 1H), 7.67 (d, 2H), 6.80 (d, 2H), 4.88 (s, 1H), 2.79 (m, 1H), 0.75 (m, 2H), 0.60 (m, 2H). c) N-cyclopropyl-4 - [(6-nitro-3-pyridinyl) oxy] benzamide The mixture of nitropyridine and bromopyridine is synthesized analogously to Example 11c of N-cyclopropyl-4-hydroxybenzamide (0.330 g). 1H-NMR (CD3OD): 8.33 (d, 1H), 8.32 (d, 1H), 7.92 (d, 2H), 7.66 (dd, 1H), 7.24 (d, 2H), 2.85 (m, 1H), 0.81 (m, 2H), 0.64 (m, 2H). d) 4 - [(6-amino-3-pyridinyl) oxy] -N-cyclopropylbenzamide 4 - [(6-amino-3-pyridinyl) oxy] -N-cyclopropylbenzamide (0.128 g, 25%) is synthesized analogously to Example 11 d of the mixture of nitropyridine and bromopyridine. 1 H-NMR (CDCl 3): 7.92 (s, 1 H), 7.68 (d, 2 H), 7.20 (d, 1 H), 6.92 (d, 2 H), 6.54 (d, 1 H), 6.12 (s, 1 H), 4.41 (s, 2H), 2.8 (m, 1H), 0.81 (m, 2H), 0.64 (m, 2H). e) 4- (. {6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopi [c] chromen-1-yl] amino} carbonyl) amino] -3-pyridinyl}. oxy) -N-cyclopropi I benzamide 4- ( {6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopa [c] chromen-1-yl] amino.}. carbonyl) amino] -3-pyridinyl.} oxy) -N-cyclopropylbenzamide (O.OgO g, 38% >) is synthesized analogously to Example 11e of 4 - [(6-amino-3-pyridinyl) oxy] - N-cyclopropylbenzamide (0.128). 1 H-NMR (CDCl 3): 9.36 (s, 1 H), 8.56 (s, 1 H), 7.73 (d, 2 H), 7.62 (d, 1 H), 7.27 (dd, 1 H), 6.91 (m, 3 H), 6.78 (m, 1H), 6.57 (m, 1H), 6.23 (s, 1H), 4.45 (dd, 1H), 4.33 (dd, 1H), 3.72 (m, 1H), 2.90 (m, 1H), 2.60 ( t, 1H), 1.97 (m, 1H), 0.87 (m, 2H), 0.63 (m, 2H). Example 13 N- [4- (. {6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl. ] amino.} carbonyl) amino] -3-pyridinyl.} oxy) phenyl] acetamide a) N-. { 4 - [(6-nitro-3-pyridinyl) oxy] phenyl} acetamide The title compound is synthesized analogously to Example 11c of N- (4-hydroxyphenyl) acetamide. 1 H-NMR (DMSO-d 6): 10.05 (s, 1H), 8.36 (d, 1H), 8.29 (d, 1H), 7.67 (d, 2H), 7.54 (dd, 1H), 7.18 (d, 2H). 2.03 (s, 3H). b) N-. { 4 - [(6-amino-3-pyridinyl) oxy] phenyl} acetamide The title compound is synthesized analogously to Example 11d of N-. { 4 - [(6-nitro-3-pyridinyl) oxy] phenyl} acetamide. 1 H-NMR (CDCl 3): 7.87 (d, 1 H), 7.41 (d, 2 H), 7.29 (s, 1 H), 7.17 (d, 1 H), 6.89 (d, 2 H), 6.51 (d, 1 H), 4.47. (s, 2H), 2.14 (s, 3H). d) N- [4- ( { 6 - [( { [(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl ] amino.}. carbonyl) amino] -3-pyridinyl.}. oxy) phenyl] acetamide The title compound is synthesized analogously to Example 11e of N-. { 4 - [(6-amino-3-pyridinyl) oxy] phenyl} acetamide. 1 H-NMR (CDCl 3): 9.39 (s, 1 H), 8.82 (s, 1 H), 7.54 (m, 3 H), 7.47 (d, 2 H), 7.20 (dd, 1 H), 6.88 (d, 2 H), 6.79 (m, 2H), 6.55 (m, 1H), 4.42 (dd, 1H), 4.32 (dd, 1H), 3.76 (m, 1H), 2.57 (t, 1H), 2.04 (m, 1H). Example 14 N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N'-. { 5- [4- (1H-1,2,4-trlazol-1-yl) phenoxy] pyridin-2-yl} urea a) 2-nitro-5- [4- (1 H-1, 2,4-triazol-1-yl) phenoxy] pyridine Cesium carbonate (1.3 g, 4.03 mmol) is mixed with 3 ml of dry dimethylformamide, 4- (1H-1,2,4-triazol-1-yl) phenol (0.5g, 3.1 mmol) and 5-bromo-2-nitropyridine (0.63g, 3.1mmol) and the reaction mixture is heated under stirring 70 ° C in a closed bottle. The reaction mixture is then mixed with 40 ml of water and extracted into methylene chloride (3x20 ml). The organic extract is rinsed with water and brine, dried over magnesium sulfate and concentrated by rotary evaporation. The resulting greenish-brown solid is completely rinsed with methylene chloride to give 280 mg of the desired compound (32% yield). 1 H-NMR (DMSO-d 6): 9.3 (s, 1 H), 8.47 (d, 1 H), 8.35 (d, 1 H), 8.24 (s, 1 H), 7.98 (d, 2 H), 7.71 (dd, 1 H) 7.45 (d, 2H). b) 5- [4- (1H-1,2,4-triazol-1-yl) phenoxy] pyridin-2-amine 2-Nitro-5- [4- (1H-1,2,4-triazole-1 -yl) phenoxy] pyridine (100 mg, 0.35 mmol) is mixed with 15-20 ml of ethanol and sparged with argon. Approximately 20 mg of Pd / C is added to the reaction mixture and hydrogen gas is applied at normal room temperature and pressure for 3-12 h. The reaction is monitored by TLC. After the reaction is complete, the reaction mixture is bubbled with argon, filtered through Celite and the obtained solution is concentrated by rotary evaporation to give 42 mg of desired aminopyridine after purification by column chromatography on silica (EtOAc / EtOH 100: 1). Production 47%. 1 H-NMR (CDCl 3): 8.4 (s, 1 H), 8.01 (s, 1 H), 7.85 (d, ~ 1 H), 7.50 (d, 2 H), 7.35 (s, 1 H), 6.06 (d, 2 H), 6.48 (d, 1H), 4.55 (br s, 2H). c) N - [(1S, 1aR, 7bR) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl] -N'-. { 5- [4- (1H-1, 2,4-triazol-1-yl) phenoxy] pyridin-2-yl} urea Acid (1S, 1aR, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid (33mg, 0.15mmol, ~ 95% > ee) is mixed with toluene ( 1.5ml), triethylamine (1.1eq), 5- (3-fluorophenyl) -2-aminopyridine (1.1eq), DPPA (1.1eq) and bubbling with argon for approximately 5 min. The reaction mixture is then heated under stirring at 110 ° C for 3 h in a closed flask. The reaction mixture is concentrated by rotary evaporation and purified by column chromatography on silica (30 g of silica YMC, ethylacetate / hexane 1: 1). Desired product is obtained as beige-white powder (40mg, production 57.5%). 1 H-NMR (CDCl 3): 9.42 (brs, 1H), 9.35 (brs, 1H), 8.52 (s, 1H), 8.10 (s, 1H), 7.65 (m, 3H), 7.30 (dd, 1H), 7.03 (d, 2H), 6.87 (d, 1H), 6.80 (m, 1H), 6.65 (d tr, 1H), 4.45 (dd, 1H), 4.33 (dd, 1H), 3.80 (q, 1H), 2.60 (br tr, 1H), 1.94-2.00 (m, 1H). Additional options The following options are coupled to any of the above new options analogously to Examples 1 to 14. Example 15 a) ethyl ester of + cis-1,1a, 2,7b-Tetrahydro-cyclopropa [c] chromene-1 acid -carboxylic To a mixture of 2 H -chromene (4.89 g, 37 mmol) and (CuOTf) 2-benzene (186 mg, 0.37 mmol) in 1,2-dichloroethane (80 mL) at 20 ° C, is added in drops (3h) to a solution of ethyl diazoacetate (8.44 g, 74 mmol) in 1,2-dichloroethane (20 mL). After 15 min at 20 ° C, the reaction mixture is rinsed with H 2 O (100 mL). The H2O phase is rinsed with CH2Cl2 (50 mL) and the solvent of the combined organic phases is removed under reduced pressure. The crude product is column chromatographed (silica gel, 20? 50% EtOAc in hexane), to give 1.96 g (24%) of ethyl ester of + cis-1,1a, 2,7b-tetrahydro-cyclopropac acid ] chromen-1-carboxylic acid and 3.87 g (48%) of ethyl ester of + -trans-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid as a by-product. 1 H-NMR (CDCl 3): 7.26 (d, 1H), 7.10 (dd, 1H), 6.90 (dd, 1H), 6.78 (d, 1H), 4.48 (dd, 1H), 4.20 (dd, 1H), 3.07 (q, 2H), 2.44 (dd, 1H), 2.14 (dd, 1H), 2.07-1.05 (m, 1H), 1.02 (t, 3H). b) (+) - cis-1,1a, 2,7b-Tetrahydro-cyclopropa [c] chromene-1-carboxylic acid.

A mixture of ethyl ester of (+) - cis-1,1a, 2,7b-tetrahydro-cyclopropa [c] crotnene-1-carboxylic acid (1.06 g, gO mmol), LiOH (530 mg, 22.5 mmol), H 2 O (10 mL) and MeOH (20 mL) is heated at reflux for 2 h. The reaction mixture is concentrated to approximately 10 mL, 4N HCl is added dropwise giving a white precipitate. The reaction mixture is extracted with CH2Cl2 (3x15 mL) and the solvent of the combined organic phases is removed under reduced pressure. The crude product is crystallized from EtOAc / hexane, to give 435 mg (25%) of (+) - cis-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid as a white solid. 1 H-NMR (CDCl 3): 9.80 (br s, 1 H), 7.22 (d, 1 H), 7.10 (dd, 1 H), 6.89 (dd, 1 H), 6.77 (d, 1 H), 4.45 (dd, 1 H), 4.22 (dd, 1H), 2.45 (dd, 1H), 2.14-1.98 (m, 2H). Example 16 a) ethyl ester of (+) - cis-1,1a, 3,7b-tetrahydro-2-oxa-cyclopropa [a] naphthalene-1-carboxylic acid Ethyl ester of (+) - cis-1a, 3,7b-Tetrahydro-2-oxa-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 15a of 1 H-isocromen (3.57 g, 27 mmol ), to give 910 mg (15%) of ethyl ester of (+) - cis-1,1a, 3,7b-tetrahydro-2-oxa-cyclopropa [a] naphthalene or-1-carboxylic acid ester. 1 H-NMR (CDCl 3): 7.34 (d, 1 H), 7.25 (dd, 1 H), 7.18 (dd, 1 H), 7.03 (d, 1 H), 4.81 (d, 1 H), 4.51 (d, 1 H), 4.28 (dd, 1H), 3.95 (q, 2H), 2.43 (dd, 1H), 2.05 (dd, 1H), 1.04 (t, 3H). b) (+) - cis-1, 1a, 3,7b-Tetrahydro-2-oxa-cyclopropa [a] naphthalene-1-carboxylic acid Acid (±) -cis-1, 1a, 3,7b-Tetrahydro-2-oxa-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 15b of ethyl ester of (+) - cis-1, 1a acid , 3,7b-tetrahydro-2-oxa-cyclopropa [a] naphthalene-1-carboxylic acid (436 mg, 2 mmol), to give 86 mg (22%) of (+) - cis-1,1a, 3 acid, 7b-Tetrahydro-2-oxa-cyclopropa [a] -naphthalene-1-carboxylic acid as a white solid. The crude product is column chromatographed (silica gel, 1.5% MeOH in CH 2 Cl 2). 1 H-NMR (CDCl 3): 8.50 (br s, 1 H), 7.39 (d, 1 H), 7.30 (dd, 1 H), 7.21 (dd, 1 H), 7.07 (d, 1 H), 4.87 (d, 1 H), 4.57 (d, 1H), 4.38 (dd, 1H), 2.59 (dd, 1H), 2.15 (dd, 1H). The product of step b Example 17 (±) -cis-1- (5-Cyano-pyridin-2-i0-3- (7-hydroxy-6-propionyl-1,1a, 2,7b-tetrah-idro-cyclopro parejero men-1 -il) -urea a) 1- (2-Hydroxy-4-prop-2-ynyloxy-phenyl) -propan-1-one A mixture of 2 ', 4'-dihydroxy-propiophenone (24. g, 0.15 mol), 3-bromo-propin (24.2 g, 0.20 mol) and K2CO3 (20.7 g, 0.15 mol) in acetone (500 mL) is refluxed for 12 h. The reaction mixture is allowed to subside at room temperature and the precipitate is removed by filtration. The filtrate is concentrated under reduced pressure. The crude product is purified by column chromatography (silica gel, 0-2% MeOH in H2?), To give 26.2 g (85%) of 1- (2-hydroxy-4-prop-2-ynyloxy-phenyl) -propan-1-one. 1 H-NMR (CDCl 3): 12.80 (s, 1 H), 7.60 (d, 1 H), 6.52 (m, 2 H), 4.72 (d, 2 H), 2. 6 (q, 2 H), 2.56 (t, 1 H) , 1.23 (t, 3H). 3b) 1- (5-Hydroxy-2H-chromen-6-yl) -propan-1-one.

A mixture of 1- (2-hydroxy-4-prop-2-ynyloxy-phenyl) -propan-1-one (19.8 g, 97 mmol) and N, N-diethylaniline (100 mL) is heated at reflux for 3 h . The reaction mixture is concentrated under reduced pressure. The crude product is purified by column chromatography (silica gel, 5? 10% EtOAc in Hexane) and then recrystallized from EtOAc / Hexane, to give 8.91 g (45%) of 1- (5-hydroxy-2H-chromen-6-yl) -propan-1-one. 1 H-NMR (CDCl 3): 13.00 (s, 1H), 7.49 (d, 1H), 6.75 (dt, 1H), 6.27 (d, 1H), 5.67 (dt, 1H), 4.86 (dd, 2H), 2.90 (q, 2H), 1.19 (t, 3H). 3c) 7-Hydroxy-6-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid ethyl ester.

To a mixture of 1- (5-hydroxy-2H-chromen-6-yl) -propan-1-one (511 mg, 2.5 mmol) and (Rh (II) Ac2) 2 (11 mg, 0.025 mmol) in 1 , 2-dichloroethane (8 mL) at 20 ° C, a solution of ethyl diazoacetate (571 mg, 5 mmol) in 1,2-dichloroethane (2 mL) is added in drops (3 h).

After 15 min at 20 ° C, the reaction mixture is rinsed with H2O (10 mL). The H2O phase is rinsed with CH2Cl2 (10 mL) and the solvent of the combined organic phases is removed under reduced pressure. The crude product is purified by column chromatography (silica gel, 1.5% MeOH in CH 2 Cl 2), to give 300 mg (41%) of 7-hydroxy-6-propionyl-1,1a, 2-ethyl ester, 7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (a 33/64 mixture of cis and trans isomers). 1 H-NMR (CDCl 3): 13.13-13.07 (m, 1H), 7.57-7.49 (m, 1H), 6.41-6.38 (m, 1H), 4.65-3.92 (m, 4H), 3.01-1.95 (m, 5H ), 1.29-1.08 (m, 6H). 3d) (+) - cis-7-Hydroxy-6-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid.

Acid + cis-7-Hydroxy-6-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid is synthesized analogously to Example 16b of 7-hydroxy-6-propionyl- ethyl ester 1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (29g mg, 1.03 mmol, a 33/64 mixture of cis and trans isomers), to give 30.3 mg (15%) of acid (+ ) -cis-7-hydroxy-6-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid as a white solid and (+) - trans-7-hydroxy-6-propionyl acid -1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid as a by-product. The crude product is purified by column chromatography (silica gel, 1? 5% MeOH in CH2CI2). 1H-NMR (DMSO-de): 7.67 (d, 1H), 6.35 (d, 1H), 4.57 (dd, 1H), 4.36 (dd, 1H), 2.08 (q, 2H), 2.55-2.46 (m, 1H), 2.18-2.00 (m, 2H), 1.10 (t, 3H). Example 18 a) 1- (2-Hydroxy-4-prop-2-ynyloxy-phenyl) -ethanone 1- (2-Hydroxy-4-prop-2-ynyloxy-phenyl) -ethanone is synthesized analogously to Example 17a of 1 - (2,4-dihydroxy-phenyl) -ethanone (20 g, 131 mmol), to give 22 g (88%)) of 1- (2-hydroxy-4-prop-2-ynyloxy-phenyl) -ethanone. 1 H-NMR (CDCl 3): 12.70 (s, 1 H), 7.66 (d, 1 H), 6.52 (m, 2 H), 4.72 (d, 2 H), 2.58-2.55 (m, 4 H). b) 1- (5-Hydroxy-2H-chromen-6-yl) -ethanone 1- (5-Hydroxy-2H-chromen-6-yl) -ethanone is synthesized analogously to Example 46b of 1- (2-hydroxy-4-prop-2-ynyloxy-phenyl) -ethanone (17 g, 88 mmol) , to give 6.0 g (35%) of 1- (5-hydroxy-2H-chromen-6-yl) -ethanone. 1 H-NMR (CDCl 3): 12.02 (s, 1H), 7.51 (d, 1H), 6.7g (dt, 1H), 6.32 (d, 1H), 5.71 (dt, 1H), 4.8g (dd, 2H) , 2.55 (s, 3H). c) 6-Acetyl-7-hydroxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid ethyl ester Ethyl ester of 6-Acetyl-7-hydroxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (a 40/60 mixture of cis and trans isomers) is synthesized analogously to Example 17c of 1- (5-hydroxy-2H-chromen-6-yl) -ethanone. 1 H-NMR (CDCl 3): 13.05-12.07 (m, 1H), 7.54-7.47 (m, 1H), 6.43-6.33 (m, 1H), 4.63-3.04 (m, 4H), 3.02-1.96 (m, 6H), 1.31-1.08 (m, 3H). d) 6-Acetyl-7-hydroxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. 6-Acetyl-7-hydroxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid is synthesized analogously to Example 15b of ethyl ester of 6-acetyl-7-hydroxy-1, 1a , 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (2 g, 8.1 mmol, a 40/60 mixture of cis and trans isomers), to give 300 mg (17%) of 6-ethyl ester acetyl-7-hydroxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (a 40/60 mixture of cis and trans isomers). The crude product is purified by column chromatography (silica gel, 1? 5% MeOH in CH 2 Cl 2) 1 H-NMR (CDCl 3): 7.55-7.45 (m, 1H), 6.45-6.30 (m, 1H), 4.65-4.00 (m, 2H), 3.05-1.95 (m, 6H). Example 19 5a) 1- (4-Fluoro-2-prop-2-ynyloxy-phenyl) -propan-1-one.

To a mixture of NaH (95%, 278 mg, 11 mmol) in DMF (20 mL) at 0 ° C, 1- (4-fluoro-2-hydroxy-phenyl) -propan-1-one (1.68 g) is added. , 10 mmol) in DMF (5 mL). After 15 min at 0 ° C, 3-bromo-propin (3.02 g, 20 mmol) is added to the reaction mixture. After 1 h at 0 ° C, the reaction mixture is allowed to come to room temperature. The reaction mixture is extracted with H2O (100 mL). The H2O phase is rinsed with Et2O (3x100 mL) and the solvent of the combined organic phases is removed under reduced pressure. The crude product is purified by column chromatography (silica gel, CH2Cl2), to give 1.40 g (68%) of 1- (4-fluoro-2-prop-2-ynyloxy-phenyl) -propan-1-one. 1H-HMR (CDCl 3): 7.64 (dd, 1H), 6.69 (dd, 1H), 6.60 (ddd, 1H), 4.68 (d, 2H), 2.85 (q, 2H), 2.58 (t, 1H), 1.03 (t, 3H). b) 1- (5-Fluoro-2H-chromen-8-yl) -propan-1-one. 1- (5-Fluoro-2H-chromen-8-yl) -propan-1-one is synthesized analogously to Example 17b of 1- (4-fluoro-2-prop-2-ynyloxy-phenyl) -propan-1- ona (1.34 g, 6.5 mmol), to give 619 mg (46%) of 1- (5-fluoro-2 H -chromen-8-yl) -propan-1-one. 1 H-NMR (CDCl 3): 7.60 (dd, 1H), 6.67-6.58 (m, 2H), 5.86 (dt, 1H), 4.76 (dd, 2H), 2.93 (q, 2H), 1.23 (t, 3H) . c) ethyl ester of (+) - cis-7-Fluoro-4-propionyl-1a, 2, 7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid.

Ethyl ester of (+) - cis-7-Fluoro-4-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid is synthesized according to method 17c) of 1- (5 -fluoro-2H-chromen-8-yl) -propan-1-one (619 mg, 3 mmol), to give 142 mg (16%) of ethyl ester of (+) - cis-7-fluoro-4- acid propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid ethyl ester (+) - trans-7-fluoro-4-propionyl-1,1a, 2,7b-tetrahydro- cyclopropa [c] chromene-1-carboxylic acid as a by-product. 1 H-NMR (CDCl 3): 7.59 (dd, 1 H), 6.65 (m, 1 H), 4.50-4.46 (m, 2 H), 3.95 (q, 2 H); 2.89 (q, 2H), 2.57 (dd, 1H), 2.20 (dd, 1H), 1.13-1.03 (m, 1H), 1.12-1.01 (m, 6H). d) (+) - cis-7-Fluoro-4-propionyl-1, 1a, 2,7b-tetrahydro-cyclopropa [cjcrom in o-1-carboxylic acid.

Acid (+) - ci As-7-FluoAro-4-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid is synthesized analogously to Example 15b of (+) - cis-7-fluoro-4-propionyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid ethyl ester (140.3 mg, 0.48 mmol), to give 83 mg (65%) of (+) - cis-7-fluoro-4-propionyl-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid as a white solid. The crude product is purified by column chromatography (silica gel, 1? 5% MeOH in CH2CI2). 1 H-NMR (DMSO-d6): 12.15 (br s, 1 H), 7.46 (dd, 1 H), 6.78 (dd, 1 H), 4.57 (dd, 1 H), 4.43 (dd, 1 H) , 2.93-2.80 (m, 2H), 2.55 (dd, 1 H), 2.24 (dd, 1 H), 2.20-2.1 0 (m, 1 H), 1 .02 (t, 3H). Example 20 a) 6-Fluoro-2-hydroxy-3-methoxy-benzaldehyde. 1 M boron trichloride in dichloromethane (25 ml, 25 mmol) is added to a solution of 6-fluoro-2,3-dimethoxy-benzaIdehyde [Cantrell, Amanda S.; Engelhardt, Per; Hoegberg, Marita; Jaskunas, S. Richard; Johansson, Nils Gunnar; et al.; J. Med. Chem.; 39; twenty-one; nineteen ninety six; 4261-4274] (4.26 g, 23 mmol) in dichloromethane (30 ml) maintaining the reaction temperature at -70 C. The reaction mixture is stirred at room temperature overnight and hydrolysed with water. The organic phase is separated, rinse with water and evaporate in vacuo. The residue is chromatographed (silica gel, EA: Hex, 5: 1) to give 3.72 g (94%) of 6-fluoro-2-hydroxy-3-methoxy-benzaldehyde as yellow crystals. 1 H-NMR (CDCl 3): 1 1.61 (s, 1 H), 10.23 (s, 1 H), 7.02 (dd, 1 H), 6.55 (app.t, 1 H), 3.87 (s, 3H ). b) 5-Fluoro-8-methoxy-2H-chromene. 6-Fluoro-2-hydroxy-3-methoxy-benzaldehyde (3.32 g, 19 mmol) is dissolved in acetonitrile (20 ml) and DBU (2.97 ml, 19 mmol) is added followed by vinyltriphenylphosphine bromide (7.2 g, 19 mmol). ).The reaction mixture is heated under reflux for 48 h, diluted with water and extracted with ether (3x50 ml). The organic phase is rinsed with water, 10% sodium hydroxide, water and brine and evaporated in vacuo.

The residue is subjected to column chromatography (silica gel, EA: Hex, 1:20) yielding 1.2 g of 5-fluoro-8-methoxy-2H-chromene. (3. 4%). 1 H-NMR (CDCl 3): 6.65 (m, 2H), 6.54 (t, 1H), 5.83 (dt, 1H), 4.88 (dd, 2H), 3.83 (s, 3H). c) ethyl ester of (+) - cis-7-Fluoro-4-methoxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid. The title compound is synthesized analogously to Example 17c of 5-fluoro-8-methoxy-2H-chromene. 1 H-NMR (CDCl 3): 6.7-6.5 (m, 2 H), 4.48 (m, 2 H), 3.99 (m, 2 H), 3.80 (s, 3H), 2.57 (app.t, 1H), 2.20 (app.t, 1H), 2.05 (m, 1H), 1.08 (t, 3H). d) (+) - cis-7-Fluoro-4-methoxy-1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid. The title compound is synthesized analogously to example 15b of ethyl ester of (+) - cis-7-fluoro-4-methoxy-1, 1a, 2,7- b-tetrahydro-cyclopropa [c] chromene-1 acid. -carboxylic 1 H-NMR (CDCl 3): 6.7-6.5 (m, 2 H), 4.48 (m, 2 H), 3.80 (s, 3 H), 2.61 (app.t, 1H), 2.17 (app.t, 1H), 2.06 (m, 1H). e) (+) - cis-1- (5-Cyano-pyridin-2-yl) -3- (7-fluoro-4-methoxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen-1 -il) -urea. The title compound is synthesized analogously to Example 15c of (+) - cis-7-fluoro-4-methoxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (62 mg, 0.17) mmol). Production 38 mg (40%). 1 H-NMR (CDCl 3): 10.06 (br s, 1 H), 9.40 (br d, 1 H), 8.11 (d, 1 H), 7.70 (dd, 1 H), 6.91 (d, 1 H), 6.68 (m, 2 H) , 4.48 (dd, 1H), 4.28 (dd, 1H), 3.90-3.72 (m, 4H), 2.64 (app.T, 1H), 1.96 (m, 1H). Example 21 a) 1-Chloro-4-fluoro-2-prop-2-ynyloxy-benzene. The title compound is synthesized analogously to example 15a) of 2-chloro-5-fluorophenol (2.5 g). Production 2.8 g (90%). 1 H-NMR (CDCl 3): 7.32 (dd, 1 H), 6.85 (dd, 1 H), 6.68 (m, 1 H), 4.77 (d, 2 H), 2.58 (t, 1 H). b) 5-Fluoro-8-chloro-2H-chromene. The title compound is synthesized analogously to Example 15b) of 1-chloro-4-fluoro-2-prop-2-ynyloxy-benzene (2.8 g). Production 0.97 g (35%). 1 H-NMR (CDCl 3): 7.09 (dd, 1H), 6.63 (dt, 1H), 6.56 (t, 1H), 5.84 (dt, 1H), 4.95 (dd, 2H). c) ethyl ester of + cis-7-Fluoro-4-chloro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid. The title compound is synthesized analogously to Example 15c) of 5-Fluoro-8-chloro-2H-chromene. 1 H-NMR (CDCl 3): 7.14 (dd, 1H), 6.60 (t, 1H), 4.51 (m, 2H), 4.01 (m, 2H), 2.60 (app.t, 1H), 2.23 (t, 1H) , 2.00 (m, 1H), 1.08 (t, 3H). d) (+) - cis-7-Fluoro-4-chloro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid.

The title compound is synthesized analogously to example 15d) of ethyl ester of (+) - cis-7-fluoro-4-chloro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid ester ( 850 mg). Production 43 mg (96%). 1 H-NMR (CDCl 3): 8.86 (br s, 1 H), 7.13 (dd, 1 H), 6.59 (t, 1 H), 4.50 (m, 2 H), 2.63 (t, 1 H), 2.23-2.05 (m, 2 H) ). Example 22 a) trifluoromethanesulfonic acid 4-formyl-3-hydroxy-phenyl ester. A solution of triflic anhydride (1.77 ml, 10.5 mmol) in dichloromethane 10 ml) is added to a mixture of 2,4-dihydroxybenzaldehyde (1.38 g, 10 mmol) and pyridine (0.85 ml, 10.5 mmol) in dichloromethane (30 ml). at -70C. Dry ice bath is removed and the reaction mixture is stirred for 2 h at room temperature. The reaction mixture is diluted with dichloromethane, rinsed with water, brine and evaporated in vacuo. The crude product is purified by column chromatography (silica gel, EA: Hex, 1: 6) to give 1.55 g of trifluoromethanesulfonic acid 4-formyl-3-hydroxy-phenyl ester (57%). 1 H-NMR (CDC): 11-28 (s, 1 H), 0.93 (s, 1 H), 7.67 (d, 1 H), 6.95 (m, 2 H). b) trifluoro-methanesulfonic acid 3-allyloxy-4-formyl-phenyl ester. Potassium carbonate (1.6 g, 11.5 mmol) and allyl bromide (1 mL, 11.5 mmol) are added to a solution of trifluoromethanesulfonic acid 4-formyl-3-hydroxy-phenyl ester (1.55 g, 5.7 mmol) in acetone (50 ml). The reaction mixture is stirred at 55C for 2h, it filters and evaporates in vacuo. The residue is chromatographed (silica gel, EA: Hex, 1: 20) to give 1.3 g (73%) of trifluoromethanesulfonic acid 3-allyloxy-4-formyl-phenyl ester. 1 H-NMR (CDCl 3): 1 0.47 (s, 1 H), 7.03 (d, 1 H), 6.05 (d, 1 H), 6.90 (s, 1 H), 6.05 (m, 1 H), 5.47 (d, 1 H), 5.40 (d, 1 H), 4.60 (d, 2H). c) trifluoro-methanesulfonic acid 3-allyloxy-4-vinyl-phenyl ester. Methyltriphenylphosphonium bromide (1.95 g, 5.45 mmol) is added to a suspension of sodium hydride (60% in oil) (0.25 g, 6.3 mmol) in THF (35 mL) at 0 C and stirred for 30 min at room temperature. ambient. To the above solution is added a solution of trifluoromethanesulfonic acid 3-allyloxy-4-formyl-phenyl ester (1.3 g, 4.2 mmol) in THF (1.5 ml), and the reaction mixture is stirred for 2 hrs. room temperature. The reaction mixture is diluted with hexane and extracted with water. The organic phase is rinsed with brine and evaporated. Silica gel column chromatography (EA: Hex, 1: 20) provided trifluoro-methanesulfonic acid 3-allyloxy-4-vinyl-phenyl ester (0.68 g, 53%). 1 H-NMR (CDCl 3): 7.51 (d, 1 H), 7.02 (dd, 1 H), 6.85 (dd, 1 H), 6.77 (d, 1 H), 6.05 (m, 1 H), 5.76 ( dd, 1 H), 5.43 (m, 1 H), 5.32 (m, 2H), 4.58 (dt, 2H). d) trifluoro-methanesulfonic acid 2H-chromen-7-yl ester. To a solution of trifluoromethanesulfonic acid 3-allyloxy-4-vinyl-phenyl ester (0.68 g, 2.2 mmol) in dichloromethane (5 ml) is added Ru catalyst (Grubb catalyst) (36 mg, 2%), and the mixture of reaction is stirred for 2 h at room temperature. After that period the reaction is complete (GC) and the reaction mixture is used in the next step without any elaboration. The analytical sample is obtained after removal of the solvent by silica gel column chromatography (EA: Hex, 1:20). 1 H-NMR (CDCl 3): 6.07 (d, 1H), 6.76 (dd, 1H), 6.68 (d, 1H), 6.30 (dt, 1H), 5.81 (dt, 1H), 4.98 (dd, 2H). e) ethyl ester of + cis-5-trifluoromethanesulfonyloxy-1,1a, 2,7b-tetrahydro-cyclopro [c] chromene-1-carboxylic acid. Rh (OAc) 2 (19 mg, 2 mol%) is added to the above solution (10d) and the EDA solution (0.44 ml, 4.4 mmol) in 1 ml of dichloromethane is added with a syringe pump for 5h at room temperature. ambient. When the reaction is complete (GC) dichloromethane is evaporated, the residue is dissolved in ethyl acetate and rinsed with saturated ammonium chloride solution and brine. The organic phase is evaporated and crude mixture of cis and trans isomers (1: 1.3) is separated by column chromatography (silica gel, EA: Hex, 1: 6) to give 0.4 g (50%) of ethyl ester of acid + cis-5-trif luoro methanes ulf onyloxy-1,1 a, 2, 7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.29 (d, 1H), 6.82 (dd, 1H), 6.73 (d, 1H), 4.51 (dd, 1H), 4.29 (dd, 1H), 3.98 (m, 2H), 2.45 (t, 1H), 2.19 (t, 1H), 2.05 (m, 1H), 1.03 (t, 3H). f) ethyl ester of + cis-5-cyano-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid. Ethyl ester of + cis-5-trifluoromethanesulfonyloxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (154 mg, 0.42 mmol), Pd (OAc) 2 (9 mg, 10 mg) % mol) and PPh3 (44 mg, 40 mol%) are mixed in DMF (4 ml) and a gentle stream of nitrogen passed through the reaction mixture for 10 min. Zn (CN) 2 (74 mg, 0.63 mmol) is added, the flask is sealed and the reaction mixture is stirred at 120 C overnight. The reaction mixture is diluted with ethyl acetate and extracted with saturated ammonium chloride. The organic phase is evaporated and the residue is chromatographed (silica gel, EA: Hex 1: 5) to give 53 mg (52%) of ethyl ester of + cis-5-cyano-1,1a acid, 2,7b- tetrahydro-cyclic propa [c] cyl non-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.33 (d, 1 H), 7.19 (dd, 1 H), 7.05 (d, 1 H), 4.50 (d, 1 H), 4.25 (dd, 1 H), 3.99 (q, 2 H), 2.46 (t, 1H), 2.25 (t, 1H), 2.11 (m, 1H), 1.06 (t, 3H). g) + cis-5-Cyano-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. Ethyl ester of cis-5-Cyano-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (53 mg, 0.22 mmol) and NaOH (35 mg, 0.88 mmol) are dissolved in a mixture of methanol water (1: 1) (5 ml). Reaction mixture is stirred at 60C for 30 min. Methanol is evaporated in vacuo and 20 ml of water is added. The resulting solution is extracted with ether. The water phase is concentrated, acidified with 1M HCl to pH ~ 2 and extracted with ether. The organic phase is rinsed with brine and evaporated to give 42 mg (00%) of + cis-5-cyano-1,1a, 2,7b-tetrahydro-cyclopropa [c] chrom in o-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.33 (d, 1H), 7.19 (dd, 1H), 7.06 (d, 1H), 4.51 (dd, 1H), 4.31 (dd, 1H), 2.53 (app.t, 1H) , 2.27 (app.t, 1H), 2.16 (m, 1H). Example 23 a) ethyl ester of + cis-5-trimethylsilanylethynyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen o-1-carboxylic acid ethyl ester + cis-5-trifluoromethanesulfonyloxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (152 mg, 0.41 mmol), DPPP (38 mg, 20 mol%), Pd (dba) 2 (24 mg, 10 mol%), Cul (3 mg, 4 mol%) are mixed in 3 ml of triethylamine and gentle stream of nitrogen passed through the reaction mixture for 10 min. Trimethylsilyl-acetylene (0.088 ml, 0.62 mmol) is added, the flask is sealed and the reaction mixture is stirred at 120 C overnight. The reaction mixture is diluted with ethyl acetate, rinsed with water, brine and evaporated. The residue is purified by silica gel column chromatography (EA: Hex, 1:15) to give 0.1 g (77%) of + cis-5-trimethylsilanylethylin-1,1a, 2,7b-tetrahydro ethyl ester. -cyclopropa [c] chromen or-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.15 (d, 1 H), 7.01 (dd, 1 H), 6.88 (d, 1 H), 4.47 (d, 1 H), 4.16 (dd, 1 H), 3.96 (q, 2 H), 2.38 (t, 1H), 2.13 (t, 1H), 2.01 (m, 1H), 1.04 (t, 3H), 0.22 (s, 9H). b) + cis-5-Ethynyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. Ethyl ester of acid + cis-5-trimethylsilanylethynyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (0.1 g, 0.32 mmol) and sodium hydroxide (0.076 g, 1.9 mmol) are dissolved in a methanol: water mixture (1: 1) (5 ml). The reaction mixture is heated to 60C for 5h, then acidified with 1M HCl to pH ~ 2 and extracted with ether. The organic phase is rinsed with brine and evaporated to give 66 mg (97% >;) of + cis-5-ethynyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chrom in o-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.17 (d, 1H), 7.03 (dd, 1H), 6.91 (d, 1H), 4.45 (dd, 1H), 4.23 (dd, 1H), 3.02 (s, 1H), 2.46 (t, 1H), 2.13 (t, 1H), 2.07 (m, 1H). Example 24 + cis-1- (5-Acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen-1-yl) -3- (5-cyano-pyridin-2-yl) -urea a) ethyl ester of + cis-5-Acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid ester. Ethyl ester of acid + cis-5-trifluoromethanesulfonyloxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (117 mg, 0.32 mmol), DPPP (7.3 mg, 50 mol%), Pd ( OAc) 2 (2 mg, 25 mol%) and triethyl amine (0.09 ml, 0.64 mmol) were mixed in DMF (3 ml) and a gentle stream of nitrogen passed through the reaction mixture for 10 min. Vinyl butyl ether (0.21 ml, 1.6 mmol) is added, the flask is sealed and the reaction mixture is stirred at 100 ° C for 2 h. 5% HCl (5 ml) is added and the reaction mixture is stirred at room temperature for 30 min. The resulting mixture is extracted with ethyl acetate. The organic phase is rinsed with saturated ammonium chloride and evaporated. The residue is purified by silica gel column chromatography (EA: Hex, 1: 5) to give 76 mg (91%) of ethyl ester of + cis-5-acetyl-1,1a, 2,7b-tetrahydro acid -cyclopropa [c] chromene-1-carboxylic acid. 1 H-NMR (CDCl 3): 7.52 (dd, 1 H), 7.36 (d, 1 H), 7.34 (d, 1 H), 4.51 (dd, 1H), 4.21 (dd, 1H), 3.98 (q, 2H), 2.53 (s, 3H), 2.47 (t, 1H), 2.23 (t, 1H), 2.08 (m, 1H), 1.05 (t, 3H). b) + cis-5-Acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. The title compound is synthesized analogously to example 22g of + cis-5-acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid ethyl ester (76 mg, 20 mmol). Production 66 mg (97%). 1 H-NMR (CDCl 3): 7.52 (dd, 1H), 7.37 (d, 1H), 7.34 (d, 1H), 4.52 (dd, 1H), 4.26 (dd, 1H), 2.55 (s, 3H), 2.53 (t, 1H), 2.25 (t, 1H), 2.13 (m, 1 HOUR). Example 25 Acid + cis-5-Methoxy-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid. The title compound is synthesized analogously to Example 22 of 2-hydroxy-4-methoxybenzaldehyde. Example 26 a) N-Acetyl-1,2-dihydroquinoline. Quinoline (19.37 g, 150 mmol) is dissolved in anhydrous diethyl ether (500 ml) and cooled to 0 ° C under an inert atmosphere. DIBAL, 1.5 M in toluene (100 mL, 150 mmol) is added in drops for 2 hrs and the reaction mixture is stirred at 0 ° C for 30 min. Acetic anhydride (500 ml) is added dropwise for 30 min and the reaction mixture is stirred at 0 ° C for 30 min. H2O is added cautiously. The reaction mixture is extracted with diethyl ether and concentrated to give N-acetyl-1,2-dihydroquinoline (11.5 g, 44%). b) ethyl ester of + cis- (N-acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid ester. ethyl ester of + cis- (N-acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid ester is prepared according to the procedure described in example 15a, of N-acetyl-1 , 2-dihydroquinoline (10 g, 58 mmol) The product is purified by column chromatography on silica (EtOAc / Hexane 5% - »50%) to give ethyl ester of + cis- (N-acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid (2.0 g, 13%). c) + cis- (N-Acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid. Acid + cis- (N-Acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid (425 mg, 24%) is prepared according to the procedure described in example 15b, ester ethyl acid + cis- (N-acetyl-1,1a, 2,7b-tetrahydro-cyclopropa [c] quinoline) -1-carboxylic acid (2.0 mg, 7.7 mmol). Example 27 a) 2, 4-Dif I uoro-2-pro pin iloxy benzene or. 2,5-difluorophenol commercially available (20 g, 0.15 mol), K2CO3 (53 g, 0.38 mol) and commercially available 3-bromopropin (45 g, 0.38 mol) are dissolved in acetone (300 ml), reflux overnight, cool and filter. The solvent is removed and the crude product is dissolved in ether and rinsed with water and brine. The organic phase is evaporated and the crude product is redissolved in a small amount of ether and filtered through a basic AI2O3 column. Evaporation and drying gave 20 g (80%) of 2,4-difluoro-2-prop-inyloxy-benzene b) 5, 8-Difluoro-2H-chromene. 2,4-Difluoro-2-propynyloxybenzene (20 g, 0.12 mol) is dissolved in N, N, -diethylaniline (1 00 ml) and heated under an argon atmosphere to 225 degrees Celcius with an oil bath for 6-8 h . Ether (150 ml) is added and the aniline is removed by extraction using 2 M HCl (aC). Purification by chromatography (silica gel, n-Hexane) gave 5,8-difluoro-2H-chromene 5.8 g (29%) c) ethyl ester of acid + / cis-4,7-Difluoro-1, 1 a, 2 , 7b-tetrahydro-cyclopropa [c] chromen or-1-carboxylic acid ,8-Difluoro-2 H -chromene (5 g, 0.03 mol), (Rh (l 1) Ac 2) 2 (0.39 g, 0.00080 mol) is dissolved in 1,2-dichloroethane (60 ml) or chloroform free of ethanol. Ethyl diazoacetate (9.4 ml, 0089 mol) in the same solvent is added dropwise over a period of about 5 h under N2 atmosphere. The solvent is then removed under vacuum and the mixture is taken up in ethyl acetate, rinsed with NaHCO3 (aq), water and brine and the solvent is removed. The product (33%) cis, 66% trans) is purified by chromatography (Ov-10% ethyl acetate in n-Hexane) to give 2.2 g of the title compound (30%). d) cis-4,7-Dif-luoro-1,1-a, 2,7-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid.

Ethyl ester of cis-4,7-Difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (2 g, 0.008 mol) is heated in 1 M LiOH in methanol-water ( 25%) at 80 degrees for 2 h. The volume is reduced by half and acidified. Extraction with ether followed by chromatography (silica gel, ether) gave pure title compound (35%) Example 28 Additional intermediates a) 6-Fluorochroman-4-ol 6-Fluorochroman-4-one (1.0 g, 61 mmol) is dissolved in ethanol (100 ml). NaBH4 (excess) is added and cooled in an ice bath.

The mixture is then left at room temperature for 2 h, followed by reflux for 4 h. Purification by chromatography (silica gel, ether-hexane, 1: 5) gave 8 g (80%) pure 6-fluoro-chroman-4-ol, b) 6-Fluoro-2H-chromene 6-Fluorochroman-4-ol (8 g, 48 mmol) and toluene-4-sulfonic acid (1 g) are dissolved in toluene and refluxed overnight with subsequent water removal. The mixture is then cooled and rinsed with NaHCO3 (aq) and purified by chromatography (silica gel, n-hexane) to give 4.2 g (52%) of pure 6-fluoro-2H-chromene. c) ethyl ester of + / cis-6-Fluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid This compound is prepared analogously to the ethyl ester of cis-4,7-Difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid but using 6-fluoro-2H-chromene to give 1 .9 (29%) of the title compound, d) cis-6-Fluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid This compound is prepared analogously to cis-4 acid , 7-difluoro-1, 1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid but using ethyl ester of cis-6-fluoro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid (1.0 g, 8 mmol) to give 350 mg (21%) of cis-6-fluoro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid e) 1 -Bromo-4-fluoro-2-prop-2-ynyloxy-benzene This compound is prepared analogously to 2,4-difluoro-2-propynyloxy-benzene but using 2-bromo-5-fluorophenol (15 g, 78 mmol) to give 1-bromo-4-fluoro-2-prop-2 -iniloxy-benzene 15.6 g (87%). f) 2-Bromo-4-fluoro-1-prop-2-ynyloxy-benzene This compound is prepared analogously to 2,4-difluoro-2-propynyloxy-benzene but using 2-bromo-4-fluoro-phenol (15 g, 78 mmol) to give 2-bromo-4-fluoro-1-prop -2-inyloxy-benzene 15 g (84%). g) 1,3-difluoro-5-prop-2-ynyloxy-benzene This compound is prepared analogously to 2,4-difluoro-2-propynyloxybenzene but using 3,5-difluoro-phenoxy (14 g, 107 mmol) to give 1, 3-difluoro-5-prop-2-ynyloxy-benzene 12 g (67%). h) 8-Bromo-6-fluoro-2H-chromene This compound is prepared analogously to 5,8-difluoro-2H-chromene but using (1 5 g, 65 mmol) of 2-bromo-4-fluoro-1-prop-2-ynyloxybenzene to give the title compound (7 g , 46%) i) 8-Bromo-5-fluoro-2H-chromene This compound is prepared analogously to 5,8-difluoro-2H-chromene but using (1 5 g, 65 mmol) of 1-bromo-4-fluoro-2-prop-2-ynyloxybenzene to give the title compound (3.7 g , 25%) j) 5,7-Difluoro-2H-chromene This compound is prepared analogously to 5,8-difluoro-2H-chromene but using (1 8 g, 1 07 mmol) 1,3-difluoro-5-prop-2-ynyloxybenzene and PEG-200 as the solvent to give the compound of the title (4 g, 23%). k) ethyl ester of acid +/- cis-4-Bromo-6-fluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chrom in o-1-carboxylic acid This compound is prepared analogously to the ethyl ester of +/- cis-4,7-difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid but using 5 g (22 mmol) of 8-bromo 6-fluoro-2H-chromene to give 1.9 g (30%) of ethyl ester of cis-6-fluoro-1,1-a, 2,7-b-tetrahydro-cyclopropa [c] chromen o-1 -carboxylic. I) ethyl ester of acid +/- cis-4-Bromo-7-fluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chrom in o-1-carboxylic acid This compound is prepared analogously to the ethyl ester of +/- cis-4,7-difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid but using 3.5 g (15.3 mmol) of 8-bromo-5-fluoro-2H-chromene to give 1.6 g (33%) of ethyl ester of acid +/- cis-4-bromo-7-f luoro- 1, 1 a, 2, 7 b- tetrahydro-cycle pro pa [c] chromene-1-carboxylic acid m) ethyl ester of acid +/- cis-5,7-Difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid This compound is prepared analogously to the ethyl ester of + / cis-4,7-difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid but using 2 g (12 mmol) of , 7-difluoro-2H-chromene to give 0.0 g (29%) of ethyl ester of acid +/- cis-5,7-difluoro-1, 1 a, 2, 7b-tetrahydro-cyclopropa [c] chromen or- 1 -carboxylic. Example 29 a) Resolution of cis-7-fluoro-4-chloro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chrom in racemic o-1-carboxylic acid 0.32 g (1.32 mmol) of acid Racemic cis-7-fluoro-4-chloro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromene-1-carboxylic acid is dissolved in hot acetonitrile (50 ml) and (1 R, 2R) -2- Benzyloxycyclopentylamine (0.25 g, 1.32 mmol) is added. The resulting solution is left for crystallization. After a few hours the mother solution is decanted and the crystals are rinsed with acetonitrile. The second crystallization of acetonitrile gave 02 mg of pure diastereomeric salt. The salt is treated with 1 M HCl and the resulting mixture is extracted with ethyl acetate. The organic phase is rinsed with water, brine and evaporated to give 0.05 g of cis-7-fluoro-4-cl-1, 1 a, 2, 7 b-tetrahydro-cyclopropa [c] chromene-1 - enantiomeric carboxylic acid Example 30 +/- cis-N- (5-cyano-2-pyridinyl) -N '- (4,7-dichloro-1,1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-yl) urea a ) 1,4-dichloro-2- (2-propynyloxy) benzene 2,5-Dichlorophenol (8 g, 49 mmol) is mixed with potassium carbonate (13.6 g, 98 mmol) and 80% > solution of propargyl bromide in toluene (11 ml, 98 mmol) in acetone (100 ml) and stir overnight at room temperature. The precipitate is removed by filtration and rinsed with acetone. The acetone solution obtained is concentrated by rotary evaporation and kept under vacuum for 5 h. The product is obtained as yellow oil with quantitative production. It is used for additional transformations without further purification, b) 5, 8-dichloro-2H-chromene 1,4-Dichloro-2- (2-propynyloxy) benzene is degassed and heated under agitation under argon for 4 h at 224 ° C. The reaction mixture is then distilled in Kugelrohr apparatus (150-175 ° C / 4.1 × 10 -2 mbar) to give 3.58 g of desired product as a white solid. Production 36% of initial dichlorophenol. c) +/- cis-ethyl 4,7-dichloro-1,1 a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylate ,8-Dichloro-2 H -chromene (3.15 g, 16 mmol), (Rh (ll) Ac 2) 2 (30 mg, 0.1 mol%) is dissolved in degassed dry methylene chloride (3 ml). Ethyl diazoacetate (3 ml, 2 eq.) In the same solvent is added via a syringe at the flow rate 0.4 ml / h for a period of about 5 h under N2 atmosphere. The reaction mixture is then rinsed with NH 4 Cl (aq), water and brine and the solvent is removed. The product (45%> cis, 55% trans) is purified by chromatography on silica (200g, ethyl acetate / n-hexane 1:15) to give 0.9 g of pure cis product (racemate). Production 20%. M * = 287. 1 H-NMR (CDCl 3): 7.15 (d, 1H, J = 8.5Hz), 6.91 (d, 1H, J = 8.8Hz), 4.5g (dd, 1H, J1 = 12.02, J2 = 7.03), 4.48 (dd) , 1H, J1 = 12.02, J2 = 4.10), 4.07-3.94 (m, 3H), 2.62 (t, 1H, J = 8.8Hz), 2.27 (t, 1H, J = 8.36Hz), 2.20-2.12 (m , 1H), 1.1 (t, 3H). d) +/- cis-4,7-dichloro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid +/- cis-Ethyl 4,7-dichloro-1,1a, 2,7b- -80-tetrahydrocyclopropa [c] chromene-1-carboxylate is mixed with methanol (3 ml) and a water solution of NaOH (1. 5 eq., 3 ml) and heated under stirring for 1.5 hours at 60 ° C. Extraction of the basic reaction mixture in hexane showed that no initial material was present. The reaction mixture is acidified with excess 3M HCl solution (pH = 1). The formed precipitate is collected by suction and rinsed with water. The white solid obtained is dried under high vacuum (80% yield). Example 59A a) 5-chloro-2-fluorophenol -Chloro-2-fluoroaniline (10g, 68 mmol) is dissolved in 6M sulfuric acid and cooled in an ice / brine bath at -5 ° C. The NaNO2 solution (5.2 g, 76 mmol) in minimal amount of water is added dropwise to the stirred suspension at a temperature no higher than -2 ° C. After the addition, light yellow solution formed is left to stir for 30 min more in cooling. CuSO4 is dissolved in water (80 ml) and mixed with sulfuric acid (32 ml). The diazonium salt solution is added dropwise to the preheated cuprous sulfate solution (160 ° C) and the product is removed from the reaction flask by steam distillation. The reaction takes approximately 2 hours to complete. The water / phenol solution is extracted into ether, rinsed with brine and dried over Na 2 SO 4. Concentration gave 4g of crude phenol (40%). b) 4-chloro-1-fluoro-2- (2-propi or loxi) benzene 4-Chloro-1-fluoro-2- (2-propynyloxy) benzene is synthesized analogously to Example 33a of (4 g, 27 mmol) 4-chloro-1-fluorophenol to give 4.6 g of product (purified by column chromatography on silica, ethyl acetate / n-hexane 1: 15) as a yellow oil. Production 90%. c) 5-chloro-8-fluoro-2H-chromene -Chloro-8-fluoro-2H-chromene is synthesized analogously to Example 33b) of 4-chloro-1-fluoro-2- (2-propynyloxy) benzene (4.6 g, 25 mmol) to give 1 g of product (purified by column chromatography on alumina, ethyl acetate / n-hexane 1: 15) as a colorless oil. Production 22%. d) ethyl +/- cis-7-chloro-4-fluoro-1, 1 a, 2,7b-tetrahydrocyclopropane] chromene-1-carboxylate Ethyl +/- cis-7-chloro-4-fluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylate is synthesized analogously to Example 33c of 5-chloro-8-fluoro-2H-chromene (1 g, 5.4 mmol) to give 360 mg of +/- cis product (purified by column chromatography on silica, ethyl acetate / n-hexane 1:20) as a white solid. Production 25%. e) acid +/- cis-7-chloro-4-fluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromen or-1-carboxylic acid +/- cis-7-Chloro-4-fluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid is synthesized analogously to Example 33d of ethyl +/- cis-7-chloro-4- fluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylate (360 mg, 1.3 mmol) to give 259 mg of +/- cis acid (80%). Example 31 N - [(1S, 1aR, 7bR) or (1R, 1aS, 7bS) -1.1a, 2,7b-tetrahydrocyclooprna [c] - [1] benzothiopyran-1-yl] -N '- (5- cyano-2-pyridinyl) urea a) 3,4-dihydro-2H-1-benzothiopyran-4-ol A solution of thiochroman-4-one (9g) in ether (27 ml) is slowly added to a mixture of lithium aluminum hydride (0.53 g) in ether (54 ml). After the completion of the addition, mixture 2 is refluxed for 2 hours. The reaction mixture is cooled and ice is added, followed by water and by a solution of 20% H2SO4. The water phase is rinsed twice with ether. The ether phase is rinsed twice with 2N NaOH, and once with water, dried over MgSO and evaporated. The clear oil (8.0 g) crystallizes after a few hours. Rdt = 97%. b) 2H-1-benzothiopyran and 4H-1-benzothiopyran 4-Thiocrotnanol (8.9 g) and potassium acid sulfate (0.89 g) were placed in a flask and evacuated to 1 mm. The flask is placed in a hot bath at T0 ° C until the alcohol is fused. The magnetic stirrer is started and the bath is slowly brought to 120 ° C. the dehydration was rapid and a mixture of the product and water is distilled and collected in an ice-cooled receiver. The product is taken up in ether and dried. The crude product (7g, Rdt = 88%) is not purified. The NMR showed the presence of 10% of the 4H-1-benzothiopyran. c) ethyl ester of 1,1-a, 2,7b-tetrahydro-cyclopropa [c] [1] benzothiopyran-1-carboxylic acid, (1S, 1 aR, 7bR) or (1R, 1 aS, 7bS) COzEt Ethyl diazoacetate is added slowly to 500 mg of thiochromen at 140 C. The reaction was followed by gas chromatography and stopped when all initial material was consumed (approximately 7 hours). The residue is purified by flash chromatography (5% ether in hexane). The cis isomer (46.5 mg, Rdt = 6%) is identified by NMR spectroscopy. d) 1, 1 a, 2,7 b, tetrahydro-cyclopropa [c] [1] benzothiopyran-1-carboxylic acid, (1 S, 1 aR, 7 b R) or (1 R, 1 a S, 7 b S) A mixture of cis isomer (46.5 mg), LiOH (4eq., 10 mg) in 5 ml of methanol / 25% H2O is refluxed for 1 hour. After evaporation of the solvent under vacuum, the residue is dissolved in water and rinsed with ether. The water phase is acidified with concentrated HCl, and extracted twice with dichloromethane. After drying, the organic phase was evaporated and gave the desired acid (30 mg). Rdt = 73%. Example 32 Acid (1S, 1 aR, 7bS) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromene-1 -carboxylic a) (2Z) -3- (3,6- difluoro-2-methoxyphenyl) -2-propen-1-ol.

Solution of BuLi (2.5M) in hexane (0.6 ml, 0.024 mol) is added to a stirred solution of 2,5-difluoroanisole (2.88 g, 0.02 mol) - 04 - in dry THF (30 ml) at -70C, followed after 2h by zinc chloride solution (3.6 g; 0.026 mol) in dry THF (50 ml). The reaction temperature is allowed to rise to room temperature and then the stirring is maintained at room temperature for 30 min. Pd (OAc) 2 (8 mg, 0.2 mol%) is added, followed by ethyl cis-3-bromoacrylate (3.58 g, 0.02 mol). The reaction mixture is placed in a preheated oil bath and heated under reflux for 1 h. The resulting reaction mixture is cooled to -78 C and 60 ml (0.06 mol) of DI BAL (1 M solution in hexanes) is added dropwise. Stirring is continued at -78 C for 2 h and 1 h at room temperature. The reaction is quenched with water and all solids are dissolved by the addition of HCl. The organic phase is diluted with ether, separated, rinsed with 5N HCl, brine and evaporated in vacuo. The residue is distilled in Kugelrohr (1.5x1 0"2 mbar, 150 C) to give 3.7 g (02%) of crude (2Z) -3- (3,6-difluoro-2-methoxyphenyl) -2-propen -1-ol containing -6% of other regioisomers The crude product is used in the next step without further purification 1 H-NMR (CDCl 3): 7.00 (m, 1 H); 6.77 (m, 1 H); 6.31 (app.d, 1 H), 6.12 (app.d., 1 H), 4.08 (br.t, 2H), 3.80 (d, 3H), 1.80 (br.t, 1 H) b) (2Z) -3- (3,6-difluoro-2-methoxyphenyl) prop-2-enyl diazoacetate Mw = 20Q Mw = 268 The p-toluenesulfonylhydrozone of 5-glyoxylic acid chloride (5.16 g, 0.02 mol) is added to a solution of (2Z) -3- (3,6-difluoro-2-methoxyphenyl) -2- propen-1 -ol (3.6 g, 0.01 mol) in dry CH2Cl2 (50 ml) at -5 C, and N, N-dimethylaniline (2.5 ml, 0.02 mol) is added slowly. After stirring for 30 min at -5 C, Et3N (12 ml, 0.00 mol) is added slowly. The resulting mixture is stirred for 15 min at -5 C and then for 30 min at room temperature, where water (-50 ml) is added. The organic phase is separated, rinsed with water, brine and concentrated in vacuo. Flash chromatography (silica, EA: Hex; 1: 15) gave 3.86 g (80%) of product as a yellow solid. 1 H-NMR (CDCl 3): 7.00 (m, 1 H); 6.76 (m, 1 H); 6.41 (app.d, J = 12.2 Hz, 1 H); 6.00 (app. Dt, J = 12.2, 6.1 0 Hz, 1 H); 4.71 (br.s, 1 H); 4.67 (dt, 2H); 3.80 (d, 3H). c) (1S, 5R, 6S) -6- (3,6-difluoro-2-methoxyphenyl) -3-oxabicyclo [3.1.0] hexan-2-one. (2Z) -3- (3,6-difluoro-2-methoxyphenyl) prop-2-yl diazoacetate (3.45 g, 0.013 mol) is dissolved in 100 ml of dry degassed dichloromethane and added dropwise to the solution of chiral Doyle catalyst ( Aldrich, also available from Johnsson Matthey, 10 mg, 0.1% mol) in 50 ml of dichloromethane under argon at room temperature for a period of ~ 6 h. The initial blue color turned olive at the end of the addition. The reaction mixture is concentrated in vacuo and the crude product is purified by flash chromatography (silica, EA: Hex, 1: 5 → 1: 1) to give 2.72 g (88%) of (1S, 5R, 6S) -6 - (3,6-difluoro-2-methoxyphenyl) -3-oxabicyclo [3.1.0] hexan-2-one as uncoloured solid. Enantiomeric purity could be verified in this stage using Chiracel OD column, 10% IPA in hexane-04% ee. 1 H-NMR (CDCl 3): 7.00 (m, 1H); 6.72 (m, 1H); 4.33 (dd, 1H); 4.10 (d, 1H); 4.02 (d, 3H); 2.66 (m, 2H); 2.37 (t, 1H). d) (1S, 1aR, 7bS) -1- (bromomethyl) -4,7-difluoro-1a, 7b-dihydrocyclopropa [c] chromene-2 (1H) -one. (1S, 5R, 6S) -6- (3,6-difluoro-2-methoxyphenyl) -3-oxabicyclo [3.1.0] hexan-2-one (130 mg, 0.55 mmol) is mixed with 1.2 ml of 30% HBr / AcOH (6 mmol) and heated in a sealed container under stirring for approximately 4 h at T0 ° C. The reaction mixture is then cooled, mixed with water and extracted into diethyl ether (3x20 ml). Ether extract is rinsed with sodium bicarbonate solution aq. and brine. Dry over magnesium sulfate. Concentration gave 160 mg of white solid material. 98% production. 1 H-NMR (CDCl 3): 7.08 (m, 1H); 6.88 (m, 1H); 3.44 (dd, 1H); 3.06 (t, 1H); 2.96 (dd, 1H); 2.64 (dd, 1H); 2.46 (m, 1H). e) (1S, 1aR, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] chromene-1-carboxylic acid.

M = 289 w = 226 (1S, 1aR, 7bS) -1- (bromomethyl) -4,7-difluoro-1a, 7b-dihydrocyclopropa [c] chromen-2 (1H) -one (360mg, 1.2 mmol) is mixed with the NaOH solution (0.1 g, 2.5 mmol) in 5 ml of water and heat under stirring for 1 h at 90 ° C. After completion the reaction mixture is cooled and extracted into diethyl ether (2 × 20 ml). The water phase is acidified with conc. HCl. The formed precipitate is collected by filtration to give 180 mg of pure product. Stock solution is extracted in ether and rinsed with brine, dried over magnesium sulfate. Concentration gave 70 mg more of product (containing up to 15%) of impurities). Total production approximately 92%. 1 H-NMR (CDCl 3): 6.86 (m, 1H); 6.54 (m, 1H); 4.48 (m, 2H); 2.62 (t, 1H); 2.20 (t, 1H); 2.11 (m, 1H). Example 33 a) cis ester of ethyl ester 1a, 6b-dihydro-1H-benzo [b] cyclopropa [d] thiophene-1-carboxylic acid, (1S, 1aS, 6bR) or (1R, 1aR, 6bS) Ethyl diazoacetate is added slowly to 10 g of thiophene at 140 ° C. The reaction is verified by gas chromatography and stopped after 7 hours. The residue is purified by flash chromatography (5% ether in hexane). The cis isomer (017 mg, Rdt = 6%) is identified by NMR spectroscopy. Reference: Badger G.M. et al, J. Chem. Soc, 1058, 1179-1184. Badger G.M. et al, J.Chem. Soc, 1958, 477-4779. b) cis 1a, 6b-dihydro-1H-benzo [b] cyclopropa [d] thiophene-1-carboxylic acid, (1S, 1aS, 6bR) or (1R, 1aR, 6bS) A mixture of the cis isomer (443 mg), LiOH (193 mg) in ml of methanol / 25% H2O is refluxed for 1 hour. After evaporation of the solvent under vacuum, the residue is dissolved in water and rinsed with ether. The water phase is acidified with concentrated HCl, and extracted twice with dichloromethane. After drying, the organic phase was evaporated and gave the desired acid (313.6 mg). Rdt = 81%. Example 34 (1S, 5R, 6S) -6- (3,6-difluoro-2-methoxyphenyl) -2-methoxy-3-oxabicyclo [3.1.0] hexane a) Iodo-3-oxabicyclo [3.1.0] hexan-2-one The title compound is synthesized in the stereochemistry depicted as described in Doyle J Amer Chem Soc 1 17 (21) 5763-5775 (1993) b) Iodo-2-methoxy-3-oxabicyclo [3, 1, 0] hexane The title compound is synthesized in the stereochemistry depicted as described in Martin et al. Tett Lett 39 1 521 -1524 (19g8). c) (1S, 5R, 6S) -6- (3,6-difluoro-2-methoxyphenyl) -2-methoxy-3-oxabicyclo [3.1.0] hexane 2,4-difluoroanisole (00 mg, 0.62 mmol) is dissolved in degassed, anhydrous THF (7 ml) and cooled to -78 ° C under N2. nBuLi, 2.5 M in hexane, (0.30 ml, 0.77 mmol) is added and the reaction mixture is stirred at -78 ° C for 2 hrs. ZnCl 2 (150 mg, 1.1 mmol), as a solution in anhydrous THF (7 ml), is added and the reaction mixture is allowed to warm to room temperature for 2 hrs. Iodine-2-methoxy-3-oxabicyclohexane (1 50 mg, 0.63 mmol), Pd (OAc) 2 (1.5 mg, 6.2 μmol), and ligand Tris (2,4-di-tert-butylphenyl) phosphite (40 mg, 62 μmol) are mixed in anhydrous THF (7 ml) and added to the reaction mixture. The reaction mixture is refluxed for 3 days and quenched with H2O. Diethyl ether is added and the layers separated, the organic layer is rinsed with H2O and NaCl aq. sat , dried over MgSO4, filtered and concentrated to give the title compound, otherwise denoted 2,4-di-fluoro-5- (cyclopropylacetal) anisole. Column chromatography on silica (EtOAc / Hexane 1: 3) gave (4) 50 mg, 31%. 1 H NMR (CDCl 3) d (ppm): 6.88-6.04 (m, 1 H, Ar H), 6.68-6.73 (m, 1 H, Ar H), 4.82 (s, 1 H, CHOCH 3), 3.g7-3.98 (m, 1 H, CHOCH) 3.94 (s, 3H, OCH3), 3.79-3.81 (m, 1 H, CHOCH) 3.30 (s, 3H, OCH3), 2.13-2.19 (m, 2H, 2x CH-cyclopropyl) , 1.89 (tr, J = 7.81 Hz, 1 H, CH cyclopropyl). Example 35 Cis-4, 7-Dif luoro-1, 1 a, 2,7 b-tetrahydro-cyclopropa [c] chromen o-1-carboxylic acid.

BBr 3 1 M solution in CH 2 Cl 2 (5.8 ml, 5.8 mmol 2.1 eq) is added to the initial lactone, (1 S, 5R, 6S) -6- (3,6-difluoro-2-methoxyphenyl) -3-oxabicyclo [3.1. 0] Example hexane-2-one 42c) (0.66 g, 2.75 mmol) at 0 ° C. The reaction mixture is stirred at 0 ° C for 1 h. Acetonitrile (5.8 ml) is added and stirring is continued for 3 h at 0 ° C. The reaction mixture is quenched by the addition of water and the organic phase is separated. The water phase is extracted with CH2Cl2 and the combined organic phases are evaporated. NaOH (0.33 g, 8.25 mmol, 3 eq) in water (~5 mL) is added to the resulting residue and stirred at 80 ° C for 45 min. The reaction mixture is extracted with ether to remove acid impurities. The residual ether in the water phase is evaporated in vacuo and conc. HCl. it is added at a pH of ~ 3. After ~ 1 h the solid is filtered to yield 0.407 g (80%)) of crude final acid as a brown solid. The crude acid is dissolved in 6 ml of EtOH / H2O (40/60 v / v) and treated with activated carbon. The hot solution is filtered and left for crystallization. Production 0.4 g (64%). 1 H-NMR (CDCl 3): 10.32 (br s, ~ 1 H), 7.68 (d, 2 H), 7.37 (s, 1 H), 7.32 (d, 2 H), 6.06 (s, 1 H), 6.87 ( m, 1 H), 6.62 (dt, 1 H), 4.44 (dd, 1 H), 4.33 (dd, 1 H), 3.53 (m, 1 H), 2.56 (m, ~ 1 H), 1 .06 (m, 1 H). LC-MS: M * 434. Example 36 a) ethyl ester of 1,1-a, 66a-tetrahydrocyclopropa [a] indene-1-carboxylic acid. Idefinition is diluted in 1 00 ml dichloroethane. Approximately 10 mg of Cul and approximately 10 mg of Pd (OAc) 2 is added. 25 ml of the resulting mixture is added dropwise to 25 ml ethyldiazoacetate and refluxed for 30 minutes. The solution is filtered through AI2O3 which is eluted with an EtOAC / hexane gradient. The eluate is vigorously evaporated at 1 00 °, 2mmHg to yield the title compound (36 g). b) 1, 1 a, 66a-tetrahydrocyclopropa [a] indene-1 -amine. The product of step a) is boiled with approximately 50 g NaOH in 200 ml 1 0: 1 MeOH: H2O for 2 hours. The mixture is diluted with water, rinsed with dichloroethane, evaporated with HOAc, extracted with dichloroethane, rinsed with water, dried with sulfate, filtered and evaporated to yield 25 g of the acid, 95% pure. DPPA 275.2 d = 1 .128 10 ml, 46.5 mmol TEA 7.1 ml 1.1 ee and 7.3 g of the acid (mass 174.12, 0.9 ee) is mixed in 200 ml toluene and refluxed for about 2 hours. The product is evaporated and dissolved in dioxane 200 ml. 25 ml HCl (aq) and 25 ml water is added and the mixture is stirred for 60 minutes at room temperature. The solution is divided with acid / base in water / dichloroethane. The organic phase is dried, filtered and evaporated. The product is chromatographed through a silica 60 column to yield 660 mg of 85% pure cis amine, mol weight 145.1 1. Example 37 + cis-1 - (5-Cyano-pyridin-2-yl) -3- (1, 1 a, 6,6a-tetrahydro-cyclopropa [a] inden-1-yl) -urea. a) ethyl ester of + cis-1, 1 a, 6,6a-Tetrahydro-cyclopropa [a] indene-1-carboxylic acid To a mixture of indene (1.1 g, 100 mmol) and Cu2Br2 (0.10 g, 0.35 mmol) in 1,2-dichloroethane (200 mL) at 80 ° C, a solution of diazoacetate is added in drops (3 h). of ethyl (17.1 g, 150 mmol) in 1,2-dichloroethane (35 mL). After 15 min at 80 ° C, the reaction mixture is rinsed with H 2 O (200 mL). The H2O phase is rinsed with CH2Cl2 (50 mL) and the solvent of the combined organic phases is removed under reduced pressure. The crude product is column chromatographed (silica gel, 5-10% EtOAc in hexane), to give 3.63 g (18%) of ethyl ester of + cis-1,1a, 6,6a-tetrahydro-cyclopropa [a] ] indene-1-carboxylic acid and 6.68 g (33% >) of ethyl ester of + trans-1,1a, 6,6a-tetrahydro-cyclopropa [a] indene-1-carboxylic acid as a by-product. 1 H-NMR (CDCl 3): 7.30-7.05 (m, 4H), 3.81 (q, 2H), 3.36 (d, 1H), 3.18 (dd, 1H), 2.92 (m, 1H), 2.24 (m, 1H) , 1.99 (dd, 1H), 0.92 (t, 3H). b) acid + cis-1, 1a, 6,6a-Tetrahydro-cyclopropa [a] indene-1-carboxylic acid Acid + cis-1,1a, 6,6a-Tetrahydro-cyclopropa [a] indene-1-carboxylic acid is synthesized from ethyl ester of + cis-1,1a, 6,6a-tetrahydro-cyclopropa [a] indene-1 acid -carboxylic acid (3.53 g, 15.5 mmol), LiOH (539 mg, 22.5 mmol), H 2 O (10 mL) and MeOH (20 mL) which are refluxed for 2 h, concentrated and acidified to precipitate 1.62 g (62%) of + cis- 1,1 a, 6,6a-tetrahydro-cyclopropa [a] indene-1-carboxylic acid as a white solid. The product does not crystallize. 1 H-NMR (CDCl 3): 10.95 (br s, 1 H), 7.35-7.02 (m, 4 H), 3.20 (d, 1 H), 3.14 (dd, 1 H), 2.96 (m, 1 H), 2.27 (m, 1 H) ), 1.91 (dd, 1H). The reaction mixture is concentrated under reduced pressure, benzene (20 mL) is added and the reaction mixture is rinsed with 1 N HCl (30 mL), H 2 O (30 mL) and brine (30 mL). The solvent of the organic phases is removed under reduced pressure. The crude product is column chromatographed (silica gel, 4-5% MeOH in CH 2 Cl 2), to give 25 mg (5%) of; + cis-1- (5-cyano-pyridin-2-yl) - 3- (1,1a, 6,6a-tetrahydro-cyclopropa [a] nden-1-yl) -urea. 1 H-NMR (DMSO-d 6): 9.58 (s, 1H), 8.18 (d, 1H), 7.96 (dd, 1H), 7.40-7.25 (m, 3H), 7.17-7.05 (m, 3H), 3.27- 3.13 (m, 2H), 2.80-2.73 (m, 2H), 2.05 (dd, 1H). Example 38 + cis-1- (5-Cyano-pyridin-2-yl) -3- (1a, 2,3,7b-tetrahydro-cyclopropa [a] naphthalen-1-yl) -urea. a) ethyl ester of 1a, 2,3,7b-Tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid Ethyl ester of 1a, 2,3,7b-Tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 37 of 1,2-dihydronaphthalene (3.01 g, 30 mmol), to give 688 mg ( 11%) of ethyl ester of 1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid (a 56/30 mixture of cis and trans isomers). 1 H-NMR (CDCl 3): 7.35-6.95 (m, 4H), 4.30-3.85 (m, 2H), 2.00-1.00 (m, 10H). b) 1a, 2,3,7b-Tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylic acid 1a, 2,3,7b-Tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 37b of ethyl ester of 1a, 2, 3, 7b-tetrahydro-1H-cyclopropa [a] ] naphtha log-1-carboxylic (688 mg, 3.18 mmol, a 56/39 mixture of cis and trans isomers), to give 540 mg (90%) of 1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid (a 56/30 mixture of cis and trans isomers). The product does not crystallize. H-NMR (CDCl 3): 11.36 (br s, 1H), 7.30-6.95 (m, 4H), 2.80-1.65 (m, 7H). Example 68 a) ethyl ester of 1, 1a, 2,3,4, 8b-Hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid Ethyl ester of 1,1a, 2,3,4, 8b-Hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid is synthesized analogously to Example 37a of 6,7-dihydro-5H-benzocycloheptane (4.40 g , 30.5 mmol), to give 3.43 g (49%) of ethyl ester of 1,1a, 2,3,4,8b-hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid (a mixture 1 / 10 of cis and trans isomers). 1 H-NMR (CDCl 3): 7.40-6.00 (m, 4H), 4.30-4.00 (m, 2H), 3.30-0.50 (m, 12H). b) 1,1a, 2,3,4,8b-Hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid 1,1a, 2,3,4, 8b-Hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid is synthesized analogously to Example 37 of ethyl ester of acid 1a, 2, 3, 4,8b -hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid (3.43 g, 14.8 mmol, a 1/10 mixture of cis and trans isomers), to give 2.81 g (93%) of acid 1.1a, 2 , 3,4, 8b-hexahydro-benzo [a] cyclopropa [c] cycloheptene-1-carboxylic acid (a 1/10 mixture of cis and trans isomers). The product does not crystallize. 1 H-NMR (CDCl 3): 10.76 (br s, 1H), 7.40-7.00 (m, 4H), 3.30-0.50 (m, 9H). Example 40 a) 6-methoxy-1, 2,3,4-tetrahydronaphthalene-1-ol 6-Methoxytetralone (10g, 0.057mol) is mixed with 150 ml of dry ethanol and sodium borohydride (1.2 eq) is added in portions to the stirred mixture. The reaction mixture is allowed to stir at room temperature for 15 h. The reaction mixture is then concentrated by rotary evaporation, mixed with 100 ml of water and heated for 1 h at 45 ° C. The resulting mixture is extracted into diethyl ether (3 x 80ml). Combined organic extract is dried over Na2SO4 and concentrated by rotary evaporation to give 0.30 g of yellow oil which is used in the next step without further purification, b) 7-methoxy-1,2-dihydronaphthalene 6-methoxy-1,2,4,4-tetrahydronaphthalen-1-ol crude (1 0.3 g, 0.058 mol) is dissolved in 1 ml of toluene and heated in an oil bath (1 15 ° C). P-tolylsulfonic acid (20mg) is added to the reaction mixture and refluxed for about 1 h. The reaction is monitored by GC. The reaction mixture is then cooled and rinsed with sat. NaHCO3 solution. , water and brine and organic layer is dried over Na2SO4. Concentration gave 8.87g of light brown oil. Production 06%. c) Ethyl 5-methoxy-1 a, 2,3,7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylate 7-Methoxy-1,2-dihydronaphthalene (8.8g, 0.055mol) is mixed with 10ml of degassed absolute methylene chloride and 20mg of rhodium acetate (0.1 wt% mol). The reaction mixture is bubbled with nitrogen and ethyl diazoacetate (2eq, 50% degassed abs. Methylene chloride solution) is added slowly through the syringe (flow rate about 1 ml / hour) to the stirred solution at room temperature. ambient. Gas evolution started in the addition. The reaction is monitored by GC. The additional amount of catalyst is added during the reaction (approximately 20 mg). GC ratio of cis / trans isomers was 21:48. After the reaction is complete according to GC data the reaction mixture is rinsed with saturated NH CI solution and brine. The methylene chloride solution is dried over Na2SO. Concentration gave 1 3g of crude product as yellow oil. Purify by column chromatography on silica (200g, ethyl acetate / hexane 1: 20). Only trans isomer is obtained in pure form. The required cis form could not be purified by the technique used. The fractions that were more enriched with the required product are combined (200mg, cis / trans ratio 70:30 according to GC) and used for additional transformations, d) 5-Methoxy-1a, 2,3,7b-tetrahydro acid -1 H-cyclopropa [a] naphthalene-1 -carboxylic Ethyl 5-methoxy-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylate (0.2g, O.dmmol) is dissolved in 2ml of methanol and the sodium hydroxide solution ( 0.2 g, 50 mmol) in 2 ml of water is added to the reaction mixture and stirred at room temperature overnight. The extraction of basic reaction mixture in hexane showed that no initial material was present. The reaction mixture is acidified with excess 3M HCl solution (pH = 1), and extracted into ethyl acetate (3x1 5ml). The combined extracts are rinsed with water and brine, dried over Na2SO4 and concentrated by rotary evaporation to give 0.15g of cis / trans mixture as white solid. Example 41 a) 7-methoxy-1, 2,3,4-tetrahydro-1-naphthalenol 7-Methoxy-3,4-dihydro-1 (2H) -naphthalenol is synthesized analogously to Example 60a of 7-methoxy-1, 2,3,4-tetrahydro-1-naphthalenone (5 g, 28 mmol), to give about 5 g of crude product (quantitative production), which is used in the next step without further purification, b) 6-methoxy-1,2-dihydronaphthalene 6-Methoxy-1,2-dihydronaphthalene is synthesized analogously to Example 40b of 7-methoxy-1, 2,3,4-tetrahydro-1-naphthalenol to give 4.4 g of product as brown yellow oil (06% yield of 7- methoxy- 1,2, 3, 4-tetrah id ro-1 -naphtha lenone). c) Ethyl 6-methoxy-1a, 2,3,7b-tetrahydro-1H-cycloopropyl [a] naphthalene o-1-carboxylate Ethyl 6-methoxy-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylate is synthesized analogously to Example 38 of 6-methoxy-1,2-dihydronaphthalene (4.4 g, 28 mmol) at speed of 0.7 ml / h addition to give 0.68 g of raw product as orange-brown oil. Purify by column chromatography on silica (200 g, ethylacetate / hexane 1:10). Three fractions are collected: fraction enriched with cis isomer (75% by GC) -0.16g, mixed fraction -1.76 g, and fraction containing trans-1 g isomer. Total production 45%). d) 6-methoxy-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid 6-Methoxy-1 a, 2,3,7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 6? D) of ethyl 6-methoxy-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylate (0.16 g, 0.65 mmol) to give 0.1 g of product as white crystals. Production 71%.

Example 42 a) 7, 8-dihydro-2-naphthalenol 7-Methoxy-1,2-dihydronaphthalene (6.4 g, 40 mmol) is dissolved in DMF abs. and bubbling with sodium ethylthiolate argon (2.5 eq) is added and the reaction mixture is heated under stirring at 160 ° C for about 4 h. The reaction is monitored by GC. Reaction mixture is diluted with water, acidified with 3M HCl and extracted into ethyl acetate. Organic extract is rinsed with water and salted, dried over Na2SO4 and concentrated by rotary evaporation. Purification by column chromatography on silica (200 g, ethyl acetate / hexane) gave 5.36 g of the desired phenol. Production 02%. b) 7, 8-dihydro-2-naphthalenyl trifluoromethanesulfonate 7,8-Dihydro-2-naphthalenol (5.3 g, 37 mmol) is mixed with triethylamine (6.2 ml, 44 mmol) in methylene chloride abs. and cooled under nitrogen in the ice / brine bath. Triflic anhydride (7.4 ml, 44 mmol) is added to the stirred solution via syringe for 10 min. The temperature is allowed to slowly rise to room temperature. The reaction mixture is then rinsed with water and brine and dried over Na2SO4. The crude product is purified by column chromatography on silica. 9 g of brown liquid are obtained. 88% production. c) Ethyl 5-. { [(trifluoromethyl) sulfonyl] oxy} -1 a, 2,3,7b-tetrahydro-1 H-cyclopropa [a] naphthalene o-1-carboxylate Etil 5-. { [(trifluoromethyl) sulfonyl] oxy} -1 a, 2,3, 7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylate is synthesized analogously to Example 40 of 7,8-dihydro-2-naphthalenyl trifluoromethanesulfonate (9 g, 32mmol) at addition rate 1 ml / h to give 13 g of crude product as orange-brown oil. Purify by column chromatography on silica (200 g, ethylacetate / hexane 1: 15). Fraction enriched with cis isomer (80% > by GC) -0.64g is collected and used for further transformations. d) Ethyl 5-cyano-1 a, 2,3,7b-tetrahydro-H-cyclopropa [a] naphthalene-1-carboxylate OOEt Etil 5-. { [(trifluoromethyl) sulfonyl] oxy} -1 a, 2,3,7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylate (0.2g, O.dmmol) is mixed with Zn (CN) 2 (0.82mmol) and Pd (Ph3P) 4 (56 mg, 1.0 mol%) in DMF (4 ml), bubbling with argon for 5 min and heating under stirring in a closed bottle for 14 h at 1000 ° C. The reaction is monitored by GC. The reaction mixture is concentrated by rotary evaporation, mixing with saturated NH 4 Cl and extracted into ethyl acetate (3 x 15 ml). The organic extract is rinsed with water and brine, dried under Na2SO. The concentration gave 0.12g of product as an oil (production 90%). d) 5-cyano non-1a, 2,3,7 b-tetrahydro-1H-cyclopropa [a] naphthalene or-1-carboxylic acid -Cyano-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 69d of ethyl 5-cyano-1a, 2,3,7b-tetrahydro-1H- cyclopropa [a] naphthalene-1-carboxylate (0.12 g, O.dmmol) to give 0.1 g of product as white crystals. 04% production. 1 H-NMR (DMSO-de): 0.70 (br s, 1 H), 8.32 (br s, 1 H), 8.03 (dd, 1 H), 7.46-7.63 (m, 4 H), 7.32 (br s, 1 H), 3.18 -3.10 (m, 2H), 2.76-2.65 (m, 1H), 2.62-2.51 (m, 1H), 2.34 (t, 1H), 2.01-1.80 (br m, 2H), 1.78-1.69 (br m, 1 HOUR). Example 42A a) Ethyl 5 - [(trimethylsilyl) ethynyl] -1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene o-1-carboxylate Etil 5-. { [(trifluoromethyl) sulfonyl] oxy} -1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylate (0.2 g, O.dmmol) is mixed with trimethylsilylacetylene (0.2 ml, 1.337 mmol), DPP (35 mg, 10 mol%), Pd (dba) 2 (30 mg, 10 mol%) and Cul (3 mg) in Et 3 N (2.5 ml), bubbling with argon for 5 min and heating under agitation in a closed bottle for 14 h at T 5 ° C. The reaction is monitored by GC. The reaction mixture is concentrated by rotary evaporation, mixing with saturated NH 4 Cl and extracted into ethyl acetate (3 x 15 ml). Organic extract is rinsed with water and brine, dried under Na2SO4. Concentration gave 0.15g of product as an oil (87% yield). b) 5-Ethynyl-1 a, 2,3, 7b-tetrahydro-1 H-cyclopropa [a] naphthalene or-1-carboxylic acid Ethyl 5 - [(trimethylsilyl) ethynyl] -1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylate (0.2 g, 0.64 mmol) is dissolved in 4 ml of methanol and the solution of Sodium hydroxide (0.05 g, 1.2 millol) in 2 ml of water is added to the reaction mixture and stirred under heating at 65 ° C for 6 h. The extraction of basic reaction mixture in hexane showed that no initial material was present. The reaction mixture is acidified with excess 3M solution HCl (pH = 1), and extracted into ethyl acetate (3x15ml). The combined extracts are rinsed with water and brine, dried over Na 2 SO 4 and concentrated by rotary evaporation to give 0.12 g of cis / trans (85: 15) mixture as a white solid. 88% production. Example 43 a) 5, 8-difluoro-4-methyl-3,4-dihydro-1 (2H) -naphthalenone 1,4-Difluorobenzene (22 ml, 210 mmol) is mixed with y-valerolactone (4 ml, 42 mmol) and AICI3 (28 g, 210 mmol) is added portionwise to the stirred reaction mixture. The reaction mixture is then refluxed with stirring for 16 h (oil bath 1 1 0 ° C). The reaction mixture is cooled (ice bath / brine) and ice / conc. HCl is added and stirred until the homogeneous mixture is obtained. The reaction mixture is then extracted into methylene chloride, rinsed with water (4x10 ml) and sodium bicarbonate solution (3x100 ml). The organic extract is dried over Na2SO. Concentration by rotary evaporation gave 6.7 g of product as a yellow powder. Production 81%. b) 5, 8-difluoro-4-methyl-1, 2,3,4-tetrahydro-1-naphthalenol 5,8-Difluoro-4-methyl-1, 2,3,4-tetrahydro-1-naphthalenol is synthesized analogously to Example 69a of 5,8-difluoro-4-methyl-3,4-dihydro-1 (2H) -naphthalenone to give 1.8 g of crude product, which is used in the next step without further purification, c) 5, 8-dif I uoro-1-methyl-1, 2-d ihidron afta leño ,8-Difluoro-1-methyl-1,2-dihydronaphthalene is synthesized analogously to Example 40b of 5,8-difluoro-4-methyl-1,2,3,4-tetrahydro-1-naphthalenol (1.8 g, 0.1 mmol) to give 1.5 g of product as brown yellow oil (90% production of 5,8-difluoro-4-methyl-1,2,3,4-tetrahydro-1-naphthalenone). d) Ethyl 4,7-difluoro-3-methyl-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylate Ethyl 4,7-difluoro-3-methyl-1a, 2,3,7b-tetrahydro-1H-cyclopropa [a] naphthalene-1-carboxylate is synthesized analogously to Example 40c of 5,8-difluoro-1-methyl-1 , 2-dihydronaphthalene (3.5 g, 19 mmol) at 0.5 ml / h addition rate to give crude product as brown yellow oil. Purify by column chromatography on silica (200 g, ethyl acetate / hexane 1: 1 5) to give 5.2 g of the mixture of diastereomeric esters together with EDA dimers as colorless oil (GC: anti-45% ratio: 40% / trans: cis /, syn-1 1%, 2.3% / trans: cis). e) acid +/- anti-cis-4,7-difluoro-3-methyl-1 a, 2,3,7b-tetrahydro-1 H-cyclopropapha] naphthalene or-1-carboxylic acid Ethyl 4,7-difluoro-1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylate (5.25 g, 20 mmol, -50: 50 mixture of cis and trans isomers) is dissolved in 2.5 ml of methanol and the sodium hydroxide solution (0.4 g, 10 mmol) in 2.5 ml of water is added to the reaction mixture and stirred at room temperature overnight. The reaction mixture is extracted into hexane (3x30 ml). The combined extracts are rinsed with water and brine, dried over Na2SO4 and concentrated by rotary evaporation to give 1.12g of cis-esters as colorless oil (mixture of ethyl and methyl esters-04%) according to GC). The obtained mixture is dissolved in 1.5 ml of methanol and the sodium hydroxide solution (0.2 g, 5 mmol) in 1.5 ml of water is added to the reaction mixture and stirred at T5 ° C for 40 min.

The reaction mixture is acidified with excess 3M solution HCl (pH = 1), and extracted into ethyl acetate (3x15ml). The combined extracts are rinsed with water and brine, dried over Na 2 SO 4 and concentrated by rotary evaporation to give 0.03 g anti-acid +/- cis as slightly orange crystals. Production 20% (Quantitative apr, if calculated for initial cis isomer). Example 44 a) 4,7-D-fluoro-3-methyl-1-indanone 4,7-Difluoro-3-methyl-1-indanone is synthesized analogously to Example 43a of butyrolactone (4 ml, 52 mmol) to give 7.19 g of yellow powder (85: 1 5 mixture of indanone and corresponding tertralone according to GC ). The product is purified by column chromatography on silica (200 g, ethyl acetate / hexane) to give 3.7 g (40% yield) of pure product together with mixed fraction and fraction containing pure tetralone, b) 4,7-difluoro-3- methyl-1-indanol 4,7-Difluoro-3-methyl-1-indanol is synthesized analogously to Example 40 of 4,7-difluoro-3-methyl-1-indanone (3.7 g, 20 mmol), - 10 - to give approximately 3.75 g of crude product (quantitative production), which is used in the next stage without further purification. c) 4, 7-Dif I uoro-1 -methyl-1 H-indene 4,7-Difluoro-1-methyl-1 H-indene is synthesized analogously to Example 37 of 4,7-difluoro-3-methyl-1-indanol (3.75 g, g. 1 mmol) to give 2.36 g of product as beige liquid (70% yield), d) Ethyl 2,5-difluoro-6-methyl-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate Ethyl 2,5-difluoro-6-methyl-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate is synthesized analogously to Example 40c of 4,7-difluoro-1-methyl-1 H-indene (1.32 g, 7.0 mmol) at 0.4 ml / h addition rate to give crude product as yellow-brown oil. Purify by column chromatography on silica (1 00 g, ethyl acetate / hexane 1: 15) to give 0.61 g of the mixture of diastereomeric esters, cis and trans esters as colorless oil (cis / trans ratio: 84: 16 in accordance to NMR). Production 30%. e) anti-acid +/- cis-2,5-difluoro-6-methyl-1, 1 a, 6,6a-tetrahydrocyclopropa [a] ndene-1 -carboxylic acid anti-acid +/- cis-2,5-Difluoro-6-methyl-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylic acid is synthesized analogously to the previous one of ethyl 2,5-difluoro-6 -methyl-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate (0.61 g, 2.4 mmol) by first step hydrolysis with 20 mol% of NaOH and then with excess NaOH in heating to give 380 mg of product as white crystals. Production 70% (quantitative amount if calculated for initial cis isomer). Example 45 a) 5,8-difluoro-3,4-dihydro-1 (2H) -naphthalenone ,8-Difluoro-3,4-dihydro-1 (2H) -naphthalenone is synthesized together with 4,7-difluoro-3-methyl-1-indanone according to the procedure described in Example 44a. It is separated by column chromatography on silica. 0.77 g of pure product yields 8% yield. b) 5,8-difluoro-1, 2,3,4-tetrahydro-1-naphthalenol ,8-Difluoro-1, 2,3,4-tetrahydro-1-naphthalenol is synthesized analogously to Example 40a of 5,8-difluoro-3,4-dihydro-1 (2H) -naphthalenone (0.77 g, 4.2 mmol ), to give crude product (quantitative production), which is used in the next stage without further purification, c) 5,8-difluoro-1,2-dihydronaphthalene ,8-Difluoro-1,2-dihydronaphthalene is synthesized analogously to Example 40b of 5,8-difluoro-1, 2,3,4-tetrahydro-1-naphthalenol to give 0.67 g of crude product as a brown liquid (00% production of 5,8-difluoro-3,4-dihydro-1 (2H) -naphthalenone). The additional amount of product is also obtained from the mixture of 5,8-difluoro-3,4-dihydro-1 (2H) -naphthalenone and 4,7-difluoro-3-methyl-1-indanone by reduction followed by dehydration . The mixture of corresponding indene and naphthalene is easy to separate by column chromatography on silica (ethyl acetate / hexane 1: 20). d) ethyl 4,7-difluoro-1 a, 2,3,7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylate Ethyl 4,7-difluoro-1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylate is synthesized analogously to Example 40c of 5,8-difluoro-1,2-dihydronaphthalene (0.7 g, 4.2 mmol) at addition rate 0.4 ml / h to give crude product as yellow-brown oil. Purify by column chromatography on silica (100 g, ethyl acetate / hexane 1: 1 5) to give 0.45 g of the mixture of cis and trans esters as colorless oil (cis / trans ratio: 33:67 according to GC) . 4,7-Difluoro-1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene or-1-carboxylic acid. e) 4,7-Difluoro-1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylic acid 4,7-Difluoro-1 a, 2,3,7b-tetrahydro-1 H -cyclopropa [a] naphthalene-1-carboxylic acid is synthesized analogously to Example 43e of ethyl 4,7-difluoro-1 a, 2,3 , 7b-tetrahydro-1 H-cyclopropa [a] naphthalene-1-carboxylate (0.45 g, 1.8 mmol) by first step hydrolysis with excess NaOH at rt and then with excess NaOH in heating (60 ° C, 1.5 hours) to give 80 mg of product as white crystals (cis / trans ratio 78:22 according to HPLC). Example 46 a) 6-Bromoindene This compound is prepared analogously to Examples 40a & 40b of 5-bromo-1-indanone (4.0 g, 18.8 mmol) to give 2.4 g (65% >) of 6-bromoindene. b) (+) - cis-Ethyl 4-bromo-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate This compound is prepared analogously to Example 40c of 6-bromoindene (1.05 g, 10 mmol). Purification on silica gel starting with hexanes followed by hexanes with 2% diethyl ether and finally hexanes with 5% diethyl ether gave 670 mg (24%) of cis-ester. c) (+) - cis-4-Bromo-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylic acid This acid is synthesized analogously to Example 40d by starting with 330 mg (1.77 mmol) of the compound of Example 75b to give 232 mg (70%) of (+) - cis-4-Bromo-1, 1 a, 6 acid, 6a-tetrahydrocyclopropa [a] indene-1-carboxylic acid. Example 47 a) (±) -cis-Ethyl 4-cyano-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate This compound is prepared analogously to Example 42d of (+) - cis-ethyl 4-bromo-1,1-a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate (200 mg, 0.7 mmol) to give, after purification on silica gel using hexanes with 10% ethyl acetate as the eluent, 73 mg (46%) of (+) - cis-ethyl 4-cyano-1, 1 a, 6,6a-tetrahydrocyclopropa [a] i nden o-1-carboxylate. b) (+) - cis-4-Cyano-1,1-a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylic acid This acid is synthesized analogously to Example 40d by starting with 73 mg (0.32 mmol) of the compound of Example 47a to give 59 mg (95%) of (+) - cis-4-cyano-1, 1 a, 6, 6a- tetrahydrocyclopropa [a] indene-1-carboxylic acid. Example 48 a) 4,7-Difluoro-1-indanone 2, 5-Difluoro-cinnamic acid (5.0 g, 27.2 mmol) is dissolved in 25 ml of ethanol and a catalytic amount of 10% > Pd on carbon is added. The reaction mixture is hydrogenated at normal pressure for a period of 3 hrs. Filtration through celite and evaporation of the solvent gave pure 3- (2,5-difluorophenyl) -propanoic acid. This acid is dissolved in 75 ml of toluene and 5 ml of thionyl chloride is added. The reaction mixture is heated at +1 10 ° C for a period of 2 hrs. Evaporation of the solvent gave crude 3- (2,5-difluorophenyl) -propionyl chloride, which is dissolved in 25 ml of carbon disulfide and added dropwise to a suspension of 4 g of aluminum chloride in 100 ml of disulphide carbon. The reaction mixture was refluxed for 2 hrs and then worked up and re-crystallized from ethanol 075 mg (22%) of 4,7-difluoro-1-indanone. b) 4,7-Difluoroindene This compound is prepared analogously to Examples 40a & 40b of 4,7-difluoro-1-indanone (075 mg, 5.8 mmol) to give 475 mg (54%) of 4,7-difluoroindene. c) (+) - cis-Ethyl 2,5-difluoro-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylate This compound is prepared analogously to Example 40c of 4,7-difluoroindene (475 mg, 3.13 mmol). Purification on silica gel starting with hexanes followed by 2% hexanes > diethyl ether and finally hexanes with 5% > diethyl ether gave 205mg of the cis-ester contaminated with 22% of the trans-ester. d) (+) - cis-2,5-Difluoro-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene-1-carboxylic acid This acid is synthesized analogously to Example 40d by starting with 205 mg cis-ester of Example 77c to give 120 mg of (+) - cis-2,5-difluoro-1, 1 a, 6,6a-tetrahydrocyclopropa [a] indene -1-carboxylic containing a corresponding trans-acid minor fraction. Example 49 4 - [[6 - [[[[(1S, 1 aS, 7bS) -4,7-difluoro-1, 1 a, 2, 7b-tetrahydrocyclopropa [c] [1] benzopyran-1 -yl] amino] carbonyl] amino] -3-pyridinyl] oxy] -N- (4-morpholinyl) -benzamide a) N- (4-morpholinyl) -4- (phenylmethoxy) -benzamide A mixture of 4-benzyloxybenzoic acid (0.5 g, 2.19 mmol), 4-aminomorpholine (0.2 mL, 2.1 3 mmol), Et3N (0.316 mL), 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (0.671 g, 3.5 mmol) and 1-hydroxybenzotriazole hydrate (0.5 g, 3.7 mmol) in N, N-dimethylformamide (17 mL) is stirred at room temperature for 2 days. The reaction is concentrated and diluted in dichloromethane. The organic phase is rinsed twice with water, dried with MgSO 4 and concentrated. The residue is purified in column chromatography (silica gel, 5% MeOH in CH 2 Cl 2) and N- (4-morpholinyl) -4- (phenylmethoxy) -benzamide (0.615 g, production: 00%) is identified by NMR spectroscopy. 1 H-NMR (CD3OD): 7.09 (s, 1 H), 7.78 (d, J = 8.6 Hz, 2H), 7.45 (m, 2H), 7.39 (m, 2H), 7.33 (m, 1 H), 7.07 (d, J = 8.6Hz, 2H), 5.1 6 (s, 2H), 3.82 (m, 4H), 2.91 (m, 4H). 1 b) 4-hydroxy-N- (4-morpholinyl) -benzamide 4-hydroxy-N- (4-morpholinyl) -benzamide (0.288 g, 66%) is synthesized analogously to Example 1 1 b of N- (4-morpholinyl) -4- (phenylmethoxy) -benzamide (0.615 g). 1H-NMR (CD3OD): 7.67 (d, J = 8.6Hz, 2H), 6.81 (d, J = 8.6Hz, 2H), 3.80 (m, 4H), 2.8 (m, 4H). 1 c) N- (4-morpholinyl) -4 - [(6-nitro-3-pyridinyl) oxy] -benzamide The mixture of nitropyridine and bromopyridine (0.328 g) is synthesized analogously to Example 11c of 4-hydroxy-N- (4-morpholinyl) -benzamide (0.288 g). 1d) 4 - [(6-amino-3-pyridinyl) oxy] -N- (4-morpholinyl) -benzamide 4 - [(6-amino-3-pyridinyl) oxy] -N- (4-morpholinyl) -benzamide (0.234 g, 57%) is synthesized analogously to Example 11 d of the mixture of nitropyridine and bromopyridine (0.328 g). 1H-NMR (CD3OD): 7.77 (d, J = 8.2, 2H), 7.73 (d, J = 2.73Hz, 1H), 7.28 (m, 1H), 6.95 (d, J = 8.2 Hz, 2H), 6.65 (d, J = 8.6 Hz, 1H), 3.80 (m, 4H), 2.89 (m, 4H). 1e) 4 - [[6 - [[[[(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] [1] benzopyran-1-yl] amino] carbonyl ] amino] -3-pyridinyl] oxy] -N- (4-morpholinyl) -benzamide - 120 - 4 - [[6 - [[[[(1S, 1aS, 7bS) -4,7-difluoro-1,1a, 2,7b-tetrahydrocyclopropa [c] [1] benzopyran-1-yl] amino] carbonyl] amino] -3-pyridinyl] oxy] -N- (4-morpholinyl) -benzamide (0.015 g, 21% >) is synthesized analogously to Example 11e of 4 - [(6-amino-3-pyridinyl) oxy] ] -N- (4-morpholinyl) -benzamide (0.041 g). 1H-NMR (CD3OD): 7.82 (d, J = 8.6 Hz, 2H), 7.63 (d, J = 2.73Hz, 1H), 7.40 (m, 1H), 6.08 (d, J = 8.6 Hz, 3H), 6.84 (m, 1H), 6.63 (m, 1H), 4.42 (d, J = 11.3 Hz, 1H), 4.29 (dd, J = 11.7, 2.73 Hz, 1H), 3.80 (m, 4H), 3.62 (t , J = 7.2 Hz, 1H), 2.91 (m, 4H), 2.6 (t, J = 8.4 Hz, 1H), 2.03 (m, 1H). (LC-MS, API-ES *: 538.2; Cale.537.5) Example 50 1- (4,7-Difluoro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen-1-yl) -3- [5- (4-methanesulfinyl-phenoxy) -pyridin-2-yl] -urea a) 4-methanesulfinyl-phenol: H2O4 (0.020 g, 0.114 mmol) is stirred in H2O (10 mL). 50% NaOH (0.040 ml) is added first (pH> 12) and then AcOH (0.040 ml) to reach pH 5. 4-Methylsulfani-phenol (4 g, 0.029 mol) is added and the reaction mixture is heated to 65 ° C. 30% H2O2 in H2O (3 ml) is added in portions for 10 minutes. The reaction mixture is allowed to stir at room temperature for 1 h. 50% NaHSO3 is added to quench the reaction. Methylene chloride is added and the compound is rinsed with brine and purified by chromatography (0-> 1 0%> EtOH in methylene chloride) to give 1.9 g of 4-methanesulfinyl-phenol (1) (42%) and 1.5 g of 4-methanesulfonyl-phenol (2) (30%). b) 5- (4-Methanesulfinyl-phenoxy) -2-nitro-pyridine: To a solution of 4-methanesulfinyl-phenol (1.52 g, 9.7 mmol) in DMF (30 ml) cesium carbonate (4.2 g, 12.9 mmol) is added, followed by the addition of 5-bromo-2-nitro pyridine ( 1.75 g, 8.6 mmol) and the mixture is stirred at 50 ° C overnight. The suspension is filtered and evaporated + co-evaporated with toluene. The compound is purified by chromatography (0 → 10% EtOH in methylene chloride to give 1.5 g (56% >) of 5- (4-methanesulfinyl-phenoxy) -2-nitro-pyridine c) 5- ( 4-methanesulfinyl-phenoxy) -pyridin-2-ylamine: - (4-Methanesulfinyl-phenoxy) -2-nitro-pyridine (1.27g, 4.56 mmol) is dissolved in EtOH (30 mL) and EtOAC (8 mL). Pd / C (1.0%) (400 mg) is added and the nitro group is reduced to the amine by hydrogenation at atmospheric pressure for 3 h. The catalyst is filtered and the filtrate is evaporated to give 0.6 g of 5- (4-methanesulfinyl-phenoxy) -pyridin-2-ylamine. d) 1 -4,7-Difluoro-1, 1 a, 2,7b-tetrahydro-cycloproparclromen-1-yl) -3- [5- (4-methanesulfinyl-phenoxy) -pyridin-2-yl] -urea: - (4-methanesulfinyl-phenoxy) -pyridin-2-ylamine (0.049 g, 0. 197 mmol) is dissolved in toluene (2 ml). (1S, 1aR, 7bS) -4,7-difluoro-1,1 a, 2, 7b-tetrah id rociclopropa [c] chromene-1-carboxylic acid, prepared as shown in WO02 / 705163 (0.041 g, 0.179 mmol) DPPA (0.04 ml, 0.189 mmol) and TEA (0.025 ml, 0.180 mmol) are added. The reaction mixture is heated to 110 ° C and allowed to stir at the same temperature overnight. The reaction mixture is worked up by extractions between methylene chloride and 5% citric acid followed by sat. NaHCO3. ac. Column chromatography on silica gel (5% MeOH in chloroform) gave 25 mg (30%) 1- (4,7-Difluoro-1,1a, 2,7b-tetrahydro-cyclopropa [c] chromen-1-yl) -3- [5- (4-methanesulfinyl-phenoxy) -pyridin-2-yl] -urea. 1 H-NMR (CDCl 3): 9.30 (br s, 1 H), 7.65 (m, 2 H), 7.30 (m, 2 H), 7.05 (m, 2 H), 6.80-6.70 (m, 2 H), 6.60 (d tr, 1H), 4.47 (dd, 1H), 4.32 (dd, 1H), 3.80 (q, 1H), 2.75 (s, 3H), 2.60 (tr, 1H), 1.99 (m, 1H). Biological results Extensive guidance in the assay of compound tests at the enzyme level and in cell culture, including the isolation and / or selection of mutant strains of HIV and mutant RTs, is found in the Manual of Virology DAIDS for validated HIV Laboratories by the Division of AIDS, NIAID USA 1997. Resistance studies, including rational for several drug escape mutants, are described in the Data Analysis Plan of Collaborating Group Resistance to VI H for Resistance Studies, reviewed on 31 August 1999. The compounds of the invention are tested for VI H activity, for example, using multiple determinations with XTT in MT-4 cells (Weislow et al, J Nat Cancer Inst 1989, vol 81 no 8,577 and sec), preferably including determinations in the presence of 40-50% human serum to indicate the contribution of protein binding. In short, the XTT assay uses MT4 cells of human T-cell line developed in RPMl 1640 medium supplemented with 10% fetal bovine serum (or 40-50% human serum as appropriate), penicillin and streptomycin placed in microplate 96 cavities (2-104 cells / cavity) infected with 10-20 TCID50 per vial of VI H-1 mB (wild type) or mutant virus, such as those carrying RT mutations Me 100, Cys 181 or Asn 1 03. The compounds Serially diluted samples are added to respective cavities and the culture is incubated at 37 ° C in an atmosphere enriched with CO2 and the cell viability is determined on day five or six with vital XTT dye. The results are typically presented as ED50 μM. The compounds are preferably potent against wild-type virus and HIV-like virus VI, especially viruses comprising drug escape mutations. Drug escape mutations are those that originate in patients due to the selective pressure of an antiviral of the prior art and which confer improved resistance to the antiviral. The aforementioned Data Analysis Plan identifies drug escape mutants for each of the antiviral classes currently on the market. The drug escape clones are easily isolated from VI H patients who fall into a particular antiviral therapy. Alternatively, the preparation of RT mutations in a known genetic background is shown in W0T7 / 2731 T, W0T9 / 61658 and WO00 / 7351 1 which also show the use of such mutants in sensitivity profiling. K103 N is a drug release mutant particularly relevant in the context of NNRTI therapy and compounds of the invention preferably have a low ED50 against this mutant and even more preferably the double mutant L1001, K103 especially in assays mimicking the presence of human serum. Suitable reverse transcriptase assays utilize key drug leakage mutations carrying reverse transcriptase prepared broadly as described in Unge et al Eur. J. Biochem. 269, 1670-1677 (2002). For example, a K103N mutant is prepared using this methodology and the primers CATCCCGCAGGGTTAAAAAAGAACAAATCAGTAACAGTACTGGATG CATCCAGTACTGTTACTGATTTGTICTTTTTTACCCTGCGGGATG The mutant L1001 / K103N is prepared by mutation of L1 00 enzyme K103N: CCACATCCCGCAGGGATTAAAAAGAACAAATCAGTAAC GTTACTGATTTGTTCTTTTTAATCCCTGCGGGATGTGG Mutations are made in the clone HIVRT DH 10 cDNA in the pET1 1 d expression vector. Mutations are generated by amplification of the mutated DNA with the help of the Pfu enzyme. The cloning is then carried out in E coli TOP1 0 cells and the expression of the mutated enzyme is carried out in E coli BL21 cells (DE3) after induction with IPTG. The HIV-1 reverse transcriptase assay used a SPA system (scintillation proximity assay) based on fluomicrospheres coated with the streptividine receptor molecule (Flashplates, PerkinElmer Life Science) which is capable of binding radiolabelled ligands in the reaction solution. In the assay, a biotinylated primer (5'-GTC ATA GCT GTT TCC TG-3 ') is pre-tempered with a heterogeneous DNA tuning (synthesized by GENSE) giving a sequence of 5'-CG UCU GGC AUU GCG AGC GGA UAA CAA UU U CAC ACÁ GGA AAC AGC UAU GAC-3 'in an environment free of RNasa. RNA-dependent DNA activity catalyzed by reverse transcriptase VI H-1 (such as L1001 + K1 03N) is measured in the presence of 50mM Tris-HCl pH = 8.0, 80mM KCl, 1mM MgCl 2, 1mM Dithiothreitol, 5mg / ml BSA and 0.05% Nonidet P40 wherein the incorporation of tritium-labeled dGTP (Amersham, 35 Ci / mmol) and 1 1 uM of dNTP (dATP, dCTP and dTTP) is monitored at room temperature. The concentration of dGTP is used at a Km value of 0.25uM, 10nM of RNA tempering is used and MUTATING RT (such as L1001 + K103N) is used at 1 80ng / ml in 1 0Oul reaction volume for 120min reaction . Compounds of the invention are tested for VI H activity against mutant L1 001, K1 03N problematic in an in vitro assay as outlined above. For reference, the closest prior art compound, cis-1 - (4,7-difluoro-1, 1 a, 2,7b-tetrahydro-cyclopropa [c] chromen-1-yl) -3- (5- phenoxy-pyrridin-2-yl) -urea, example 20 of WO 02/070516 as shown above, is tested in the same system.

In this way, it is readily apparent that the addition of the substituent in the right-hand column according to the invention dramatically improves activity against the problematic double-escape mutant L1 001 & K1 03N.

Claims (8)

1. CLAIMS 1. A compound of the formula Z: where; A is CH or N; Ri is a substituent for a carbon atom in the ring containing A selected from -S (= O) pRa, wherein Ra is C1-C alkyl, -ORx, -NRxRx, -NHNRxRx, -NHNHC (= O) ORx, -NRxOH; -C (= O) -Rb, wherein Rb is C1-C4 alkyl, ORx, -NRxRx, -NHNRxRx, -NH-C-, -C3-C alkyl (= O) ORx; -NR x R c, wherein R c is H, C 1 -C 4 alkyl, -NR x R x; -C (= O) Rd, -CN, S (= O) pRx where Rd is alkyl -OR x, -NR x R x -alkyl d-Cs-O-C 1 -C 3 alkyl (= O) OR x; -alkyl d-Cs-COORx; -alkyl d-C3-ORx- (O-alkyl d-CsJq-O-Rx; a 5- or 6-membered aromatic ring having 1 -3 heteroatoms; p and q are independently selected from 1 or 2; R x is independently selected from H, C 1 -C 4 alkyl, or acetyl; or a pair of Rx can together with the adjacent N atom form a pyrrolidine, piperidine, piperazine or morpholine ring; R 2 is a substituent for a carbon atom in the ring containing A and is H, halo, cyano, C 1 -C 4 alkyl, C 1 -C haloalkyl; L is -O-, -S (= O) r- or -CH2-, wherein r is 0, 1 or 2; R3 is H, alkyl dCS; R 4 -R 7 are independently selected from H, C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C 1 -C 6 haloalkyl, CrC 6 alkanoyl, C 1 Ce haloalkanoyl, C 2 Ce alkoxy, C 2 Ce haloalkoxy, Alkyloxy C -Ce alkyl d-Ce, haloalkyloxy C- | -C6 alkyl d-Ce, hydroxyalkyl C ^ Ce, aminoalkyl C- | -C6, carboxyalkyl CrC6, cyanoalkyl C ^ Ce, amino, carboxy, carbamoyl, cyano, halo, hydroxy, keto; X is - (CR8R8 ') n-D- (CR8R8') m-; D is a bond, -NR9-, -O-, -S-, -S (= O) - or -S (= O) 2-; n and m are independently 0, 1 or 2, provided that both are not 0 when D is a link; R8 and R8 'are independently H, C1-C3 alkyl, haloalkyl d-Ca, hydroxy, or R8 and R8' together with their adjacent C atom is -C (= O) -Rg is independently H, alkyl d-Cs; and pharmaceutically acceptable salts and prodrugs thereof, with the proviso that R2 as -C (= O) Rb is not morpholinocheto-.
2. 2. A compound according to claim 1, characterized in that T is O.
3. 3. A compound according to claim 1, characterized in that R3 is H.
4. 4. A compound according to claim 1, characterized in that the cyclopropyl moiety has an enantiomeric excess of the conformation represented in the partial formulas: wherein X is as defined, Y is the bridge to the (substituted) phenyl ring represented in formula I and Z is linked to the (thio) urea-pyridyl moiety represented in formula Z. A compound according to claim 1 , characterized in that the compound of the formula Z comprises an enantiomeric excess of the isomer exhibiting negative optical activity. 6. A compound according to claim 1, characterized in that D is -O-. 7. A compound according to claim 6, characterized in that n is 0 and m is 1. 8. A compound according to claim 1, characterized in that R4 is hydrogen, fluoro or hydroxy. A compound according to claim 1, characterized in that R5 is hydrogen, fluoro, C1-3 alkylcarbonyl or C1.3 alkyloxy. 1 0. A compound according to claim 1, characterized in that R6 is hydrogen, halo, C1-3 alkyloxy, C3 alqu3 alkylcarbonyl, cyano or ethynyl. eleven . A compound according to claim 10, characterized in that R6 is hydrogen, methoxy or fluoro. 12. A compound according to claim 1, characterized in that R7 is hydrogen, cyano, halo, C-? 3 alkyloxy, or C1-3 alkylcarbonyl. 1 3. A compound according to claim 12, characterized in that R7 is cyano, fluoro or acetyl. 14. A compound according to claim 1, characterized in that R5 and R6 are H and R4 and R7 are fluoro.
5. 5. A compound according to claim 1, characterized in that R4 is fluoro, R5 and R6 are H, and R7 is cyano or acetyl. 16. A compound according to claim 1, characterized in that L is -O-. 17. A compound according to claim 1, characterized in that R1 is -S (= O) 2NRxRx, S (= O) 2 C1-4alkyl, or S (= O) C1-4alkyl. 1 8. A compound according to claim 17, characterized in that R ^ is -S (= O) 2 NH2, -S (= O) 2NMe2 or -S (= O) 2 NH-cyclopropyl. 1 0. A compound according to claim 17, characterized in that R-, is -S (= O) 2Me or -S (= O) Me. 20. A compound according to claim 1, characterized in that R ^ is -C (= O) ORx, -C (= O) NRxRx, C (= O) NHNRxRx or -C (= O) NHCH2COORx. twenty-one . A compound according to claim 20, characterized in that R-, is -C (= O) OH, -C (= O) OMe, -C (= O) NH2, -C (= O) NHMe, -C (= O) NHNH2, -C (= O) NHCH2COOH. 22. A compound according to claim 20, characterized in that R-y is -C (= O) NRx'-N-morpholine, -C (= O) NRx'-N-piperidine, -C (= O) NRx'- N-pyrrolidine or -C (= O) NRx'-N-piperazine, characterized in that Rx is methyl, acetyl or preferably H. 23. A compound according to claim 1, characterized in that R-, is -NRxRx, -N (C = O) C 1-4 alkyl or -NHC (= O) CH 2 O-C 1-3 alkyl-COORx. 24. A compound according to claim 23, characterized in that Ri is -NH2, -NHC (= O) Me or NHC (= O) CH2OCH2C (= O) OH. 25. A compound according to claim 1, characterized in that R ^ is -C1-3 alkyl-COORx; - C1 -3-ORxalkyl, - (O-C1 -3alkyl) q-O-Rx or a 5-membered ring having 1 -3 heteroatoms. 26. A compound according to claim 25, characterized in that R ^ is carboxyethyl or a methyl ester thereof, 2-methoxyethoxyethoxy or triazolyl. 27. A compound according to claim 1, characterized in that R ^ is para in the ether bond. 28. A compound according to claim 1, characterized in that the ring containing A is phenyl or pyrid-3-yl. 20. A compound according to claim 1, characterized in that R2 is hydrogen or fluoro. 30. A compound according to claim 1, characterized in that R2 is meta to the ether linkage. 31 A compound according to claim 1 denotes N - [(1S, 1 aR, 7bR) -4,7-difluoro-1, 1 a, 2,7b-tetrahydrocyclopropa [c] chromen-1-l] -Nl- [ 5- (4- (sulfonamido) phenoxy) -2-pyridinyl] urea. 32. A pharmaceutical composition comprising a compound as defined in any of the preceding claims and a pharmaceutically acceptable carrier or diluent therefor. 33. A composition according to claim 32, further comprising 1 to 3 additional antivirals VI H. 34. A composition according to claim 32, further comprising a cytochrome P450 modulator, such as ritonavir. 35. Use of a compound as defined in any of claims 1-31 in the manufacture of a medicament for the prophylaxis or treatment of HIV-1 infections. 36. Use according to claim 35, characterized in that the infection by VI H-1 is a drug escape mutant. 37. Use according to claim 36, characterized in that the drug escape mutant comprises mutations L1001 and K1 03N.