MXPA06004311A - Direct nucleic acid detection in bodily fluids - Google Patents

Abstract

The present invention provides methods and routines for developing and optimizing nucleic acid detection assays for use in basic research, clinical research, and for the development of clinicaldetection assays. In particular, the present invention provides methods for designing oligonucleotide primers to be used in multiplex amplification reactions. The present invention also provides methods to optimize multiplex amplification reactions. The present invention also provides methods for combined target and signal generation assays.

Description

DIRECT DETECTION OF NUCLEIC ACID IN BODY FLUIDS The present application claims the priority of the following provisional applications: provisional US application 60/51 1, 955, filed on October 16, 2003; US provisional patent application 60/549, 527, filed on March 2, 2004; and US provisional application 60 / 554,669, filed on March 9, 2004; all of which are incorporated as a reference. The present application incorporates as reference to US provisional application 60/51 1, 955, filed on October 16, 2003. FIELD OF THE INVENTION The present invention provides methods for combining objective amplification reactions with signal amplification reactions. to achieve rapid and sensitive detection of small amounts of nucleic acids, particularly in non-purified body fluids (eg blood). The present invention also provides methods for optimizing multiplexing amplification reactions. The present invention also provides methods for performing highly multiplexed PCR in combination with the INVADER assay. The present invention further provides methods for performing PCR in combination with the INVADER assay in a single reaction vessel (for example using unpurified body fluids such as blood) without the need for invasive manipulations or additions of reagents. ANTEC EDENTS OF THE INVENTION Upon completion of the nucleic acid sequence of the human genome, the demand for rapid, reliable, cost-effective and easy-to-use tests for genomic research and related drug design efforts has greatly increased. Several institutions are currently studying the available information on genetic sequences to identify the correlation between genes, gene expression and phenotypes (eg pathological states, metabolic response, and the like). These analyzes include an attempt to characterize the effect of genetic mutations and genetic heterogeneity and gene expression in individuals and populations. Advances in the extraction and amplification of nucleic acid have greatly expanded the types of biological samples from which genetic material can be obtained. In particular, the polymerase chain reaction (PCR) has made it possible to obtain sufficient amounts of DNA from fixed tissue samples, archaeological specimens, and quantities of many cell types amounting to single digits. Similarly, projects to form SN P genotypes on a large scale require quantities of genomic DNA that may be difficult to obtain from standard biological samples. A method of attacking this problem is based on the amplification of targets based on PCR. Although PCR allows the analysis of minute quantities of nucleic acids, its practical application in a number of environments and for a number of types of problems remains problematic. Because small amounts of the target nucleic acid are already amplified by the reaction, PCR applications are highly susceptible to carry contamination from one assay to another. This vulnerability often necessitates the establishment of special installations or the configuration of workflows that minimize the number of post-amplification manipulations. In some cases, specialized instrumentation is used that allows the reactions to be monitored in real time without opening the reaction vessels. What is needed then is a method that limits the need for amplification of the target by maximizing the generation of signals from small quantities of amplified sequences. SUMMARY OF THE INVENTION The present invention provides methods and routines for the development and optimization of nucleic acid detection assays for use in basic research., clinical research and for the development of clinical detection trials. In some embodiments, the present invention pdes methods that consist of: a) pding information of the target sequence for at least Y target sequences, wherein each of the target sequences presents: i) a fingerprint region, ii) a fingerprint region, 'immediately upstream of the fingerprint region and iii) a 3' region immediately downstream of the fingerprint region, and b) processing the target sequence information such that a series of primers is generated, that set of primers presents sequences of forward and backward primers for each of at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] ] -... -N [4] -N [3] -N [2] -N [1] -3 ', where N represents a nucleotide base, x is at least 6, N [1] is a nucleotide A or C, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary. N [2] -N [1] -3 'of any of the forward and reverse primers in the series of primers. In other embodiments, the present invention pdes methods that consist of: a) pding target sequence information for at least Y target sequences, wherein each of the target sequences; i) a track region, ii) a 5 'region immediately upstream of the track region, and iii) a 3' region immediately downstream of the track region, and b) process the target sequence information in such a way that a series of primers is generated, that series of primers presents sequences of forward and backward primers for each of at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by '-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3', wherein N represents a nucleotide base, x is at least 6, N [1] is a nucleotide G or T, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1 -3 'of any of the forward and reverse primers in the primer series. In particular embodiments, one method consists in: a) providing information of the target sequence for at least Y target sequences, wherein each of the target sequences presents: i) a fingerprint region, ii) a 5'upstream immediately upstream of the fingerprint region and iii) a 3 'region immediately downstream of the fingerprint region, and b) processing the target sequence information such that a series of primers is generated, that set of primers presents i) a sequence of direct primers identical to at least a portion of the 5 'region of each of the AND target sequences, and ii) a reverse primer sequence identical to at least a portion of a sequence complementary to the 3' region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -...- N [4] -N [3] -N [2] -N [1] -3 ', wherein N represents a nucleotide base, x is at least 6, N [1] is a nucleotide A or C, and N [2] -N [1] -3' of each of the forward and reverse primers is not complementary to N [2] -N [1] -3 'of any of the forward and reverse primers in the primer series. In other embodiments, the present invention provides methods that consist of: a) providing target sequence information for at least Y target sequences, wherein each of the target sequences has: i) a fingerprint region, ii) a fingerprint region, 'immediately upstream of the fingerprint region and iii) a 3' region immediately downstream of the fingerprint region, and b) processing the target sequence information such that a series of primers is generated, that set of primers presents i) a forward primer sequence identical to at least a portion of the 5 'region of each of the Y target sequences, and ii) a reverse primer sequence identical to at least a portion of a sequence complementary to the 3' region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [ x] -N [x-1] -... -N [4] -N [33-N [2] -N [1] -3] wherein N represents a nucleotide base, x is at least 6, N [1] is a G or T nucleotide, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1] -3' of either of the forward and reverse primers in the series of primers. In particular embodiments, the present invention provides methods that consist of a: a) providing an objective sequence information for at least Y target sequences, wherein each of the target sequences comprises a single nucleotide polymorphism, b) determining where in each one of the target sequences would hybridize one or more test probes in order to detect the single nucleotide polymorphism in order to detect the single nucleotide polymorphism such that a fingerprint region is localized in each of the target sequences, c) processing the information of the target sequence in such a way that a series of primers is generated, that series of primers presents i) a sequence of direct primers identical to at least a portion of the 5 'region of each of the Y target sequences, and ii) a reverse primer sequence identical to at least a portion of a sequence complementary to the 3 'region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3 \ where N represents a nucleotide base, x is at least 6, N [1] is a n N or A nucleotide, and N [2] - N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1] -3 'of any of the forward and reverse primers in the primer series. In some embodiments, the present invention provides methods comprising: a) providing an objective sequence information for at least Y target sequences, wherein each of the target sequences comprises a single nucleotide polymorphism, b) determining where in each one of the target sequences would hybridize one or more test probes in order to detect the single nucleotide polymorphism in order to detect the single nucleotide polymorphism in such a way that a fingerprint region is located in each of the target sequences, c ) process the information of the target sequence in such a way that a series of primers is generated, that series of primers presents i) a sequence of direct primers identical to at least a portion of the 5 'region of each of the Y target sequences , and ii) a sequence of reverse primers identical to at least a portion of a sequence complementary to the 3 'region for one of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3 ', wherein N represents a nucleotide base, x is at least 6, N [1] is a nucleotide G or T, and N [ 2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1] -3' of any of the forward and reverse primers in the primer series. In certain embodiments, the primer series is configured to perform a multiplex PCR reaction that amplifies at least Y amplicons, wherein each of the amplicons is defined by the position of the forward and reverse primers. In other embodiments, the series of primers is generated as digital or printed sequence information. In some embodiments, the primer series is generated as oligonucleotides from physical primers. In certain embodiments N [3] -N [2] -N [1] -3 'of each forward and reverse primer is not complementary to N [3] -N [2] -N [1] -3' of any primers direct and inverse in the series of primers. In other embodiments, the process initially consists of selecting N [1] for each of the direct primers as most of the A or C of 3 'in the 5' region. In certain embodiments, the processing consists of initially selecting N [1] for each of the forward primers as the majority of the 3 'G or T in the 5' region. In some embodiments, the processing consists of initially selecting N [1] for each of the direct primers as most of the 3 'A or C in the 5' region and where the processing also consists of changing the N [ 1] to the next as most of the A or C of 3 'in the 5' region. for primer sequences that do not meet the requirements that each N [2] -N [1] -3 'of the forward primers is not complementary to N [2] -N [1] -3' of any of the primers direct and inverse in the primary series.

In other embodiments, the processing consists of initially selecting N [1] for each of the reverse primers as the majority of A or C of 3 'in the complement of the 3' region. In some embodiments, the processing comprises initially selecting N [1] for each of the reverse primers as the majority of G or T of 3 'in the complement of the 3' region. In other modalities, the process consists of initially selecting N [1] for each of the reverse primers as most of the A or C of 3 'in the 3' region and where the processing also consists in changing the N [1]. ] to the next as most A or C of 3 'in region 3'. for primer sequences that do not meet the requirements that each N [2] -N [1] -3 'of the forward primers is not complementary to N [2] -N [1] -3' of any of the primers direct and inverse in the primary series. In particular embodiments, the fingerprint region comprises a single nucleotide polymorphism. In some modalities, the footprint has a mutation. In some embodiments, the fingerprint region of each of the target sequences presents a portion of the target sequence that hybridizes with one or more test probes configured to detect the single nucleotide polymorphism. In certain modalities, the trace is the region where the probes hybridize. In other embodiments, the footprint further includes additional nucleotides at either end. In some embodiments, processing also consists of selecting N [5] -N [4] -N [3] -N [2] -N [1} -3 'for each of the forward and reverse primers such that less than 80 percent of the homology is present with a sequence of test component. In preferred embodiments, the assay component is a FRET probe sequence. In certain embodiments, the target sequence is approximately 300-500 base pairs in length, or approximately 200-600 base pairs in length. In certain modalities, and is an integer between 2 and 500, or between 2-10,000. In certain embodiments, the process consists of selecting x for each of the forward and reverse primers in such a way that each of the forward and reverse primers has a melting temperature with respect to the target sequence of approximately 50 degrees Celsius, (per example 50 degrees Celsius, or at least 50 degrees Celsius, and no more than 55 degrees Celsius). In a preferred embodiment, the melting temperature of a primer when hybridizing to the target sequence is at least 50 degrees Celsius, but at least 10 degrees different than an optimum reaction temperature selected for the detection assay. In some embodiments, the optimized concentrations of the pairs of forward and reverse primers are determined for the series of primers. In other modalities, processing is automated with a processor. In other embodiments, the present invention provides a kit consisting of a series of primers generated by means of the methods of the present invention, and at least one other component (e.g., a rupture agent, polymerase, INVADER oligonucleotide). In certain embodiments, the present invention provides compositions consisting of primers and sets of primers generated by means of the methods of the present invention. In particular embodiments, the present invention provides methods consisting in: a) providing: i) a user interface configured to receive sequence data; ii) a computer system having a multiplex PCR PCR software application stored, and b) transmitting the sequence data from the user interface to the computational system, wherein the sequence data presents an objective sequence information for at least And target sequences, wherein each of the target sequences consists of: i) a fingerprint region, ii) a 5 'region immediately upstream of the fingerprint region, and iii) a 3' region immediately downstream of the fingerprint region., and b) processing the target sequence information with the software application for multiplexer PCR primers to generate a series of primers, that series of primers presents i) a direct primer sequence identical to at least a portion of the target sequence immediately 5 'of the fingerprint region of each of the AND target sequences, and ii) a reverse primer sequence identical to at least a portion of a sequence complementary to the target sequence immediately to 3' of the region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -... -N [4] - N [3] -N [2] -N [1] -3 ', wherein N represents a nucleotide base, x is at least 6, N [1] is a nucleotide A or C, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1] -3' of any of the ceb direct and inverse adores in the series of primers. In some embodiments, the present invention provides methods that consist of: a) providing: i) a user interface configured to receive sequence data; ii) a computer system having a multiplex PCR primer software application stored, and b) transmitting the sequence data from the user interface to the computational system, wherein the data is sequenced with an objective sequence information for at least Y target sequences, wherein each of the target sequences consists of: i) a fingerprint region, ii) a 5 'region immediately upstream of the fingerprint region, and iii) a 3' region immediately downstream of the fingerprint region. of footprint, and b) process the information of the target sequence with the software application for primers with multiplexer PCR to generate a series of primers, that series of primers presents i) a sequence of direct primers identical to at least a portion of the target sequence immediately 5 'of the fingerprint region of each of the Y target sequences, and ii) a reverse primer sequence identical to when or less a portion of a sequence complementary to the target sequence immediately to 3 'of the region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3 ', wherein N represents a nucleotide base, x is at least 6, N [1] is a G or T nucleotide, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [ 1] -3 'of any of the forward and reverse primers in the primer series. In certain embodiments, the present invention provides systems consisting of: a) a computer system configured to receive data from a user interface, wherein the user interface is configured to receive sequence data, wherein the sequence data contains the Target sequence information for at least Y target sequences, wherein each of the target sequences presents i) a fingerprint region, ii) a 5 'region immediately upstream of the fingerprint region and ip) a 3' region immediately downstream of the fingerprint region, and b) a software application of primer pairs with multiplexer PCR linked to a user interface, the software application for multiplexer PCR primers is configured to process the target sequence information for generate a series of primers, that series of primers presents i) a sequence of direct primers identical to at least a portion of the target sequence immediately 5 'of the fingerprint region of each of the Y target sequences, and i) a sequence of reverse primers identical to at least a portion of a sequence complementary to the target sequence immediately downstream of the region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence represented by 5'-N [x] -N [x-1] -...- N [4] -N [3] -N [2] -N [1] -3 ', wherein N represents a nucleotide base, x is at least 6, N [1] is a nucleotide A or C, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] -N [1] -3' of any of the forward and reverse primers in the primer series, and c) a computer system having the multiplexer PCR primer software application stored, wherein the computer system comprises a computer memory and a computer processor. tadora. In some embodiments, the present invention provides systems consisting of: a) a computer system configured to receive data from a user interface, wherein the user interface is configured to receive sequence data, wherein the sequence data contains the target sequence information for at least Y target sequences, where each of the target sequences presents i) a fingerprint region, ii) a 5 'region immediately upstream of the fingerprint region and iii) a 3' region immediately downstream of the fingerprint region, and b) a software application of primer pairs with ultimiexora PCR bound to a fingerprint interface. user, the software application for multiplexer PCR primers is configured to process the target sequence information to generate a series of primers, that series of primers presents i) a direct sequence of primers identical to at least a portion of the target sequence immediately 5 'of the fingerprint region of each of the AND target sequences, and ii) a reverse primer sequence identical to at least a portion of a sequence complementary to the target sequence immediately to 3' of the region for each of the at least Y target sequences, wherein each of the forward and reverse primer sequences comprises a nucleic acid sequence set by 5'-N [x] -N [x-1] -... -N [4] -N [3] - N [2] -N [1] -3 ', where N represents a base nucleotide, x is at least 6, N [1] is a nucleotide G or T, and N [2] -N [1] -3 'of each of the forward and reverse primers is not complementary to N [2] - N [1] -3 'of any of the forward and reverse primers in the primer series, and c) a computer system having the primer pair software application for multiplex PCR, wherein the computer system comprises a computer memory and a computer processor. In certain embodiments, the computer system is configured to regress the series of primers to the user interface. In some embodiments, the present invention provides methods for conducting amplification reactions of targets and signals in a single reaction vessel. In some preferred embodiments, the amplification reactions of the target are PCR reactions. In some particularly preferred embodiments, the signal amplification reactions are the invading rupture tests (I NVADER). In other embodiments, reagents for the combined target amplification and signal reactions are added before starting any of the reactions. In certain embodiments, the target amplification reactions are terminated after 20 cycles. In some preferred embodiments, some components are pre-introduced into the reaction vessel prior to the addition of the remaining components of the assay. In preferred embodiments, the pre-introduced reagents are dried in the reaction vessel. In particularly preferred embodiments, the pre-introduced reagents consist of one or more reagents for the I NVADER assay. In some embodiments, the reaction vessel comprises a microfluidic card. In preferred embodiments, the reaction vessel comprises a microfluidic card configured for the centrifugal or centripetal distribution or manipulation of the reactions of the fluid and the reaction components. In yet other embodiments, the present invention provides methods and compositions for performing FRET I NVADER multiplexer assays with multiple dyes, for example in a single reaction or in a single reaction vessel. In some preferred embodiments, multiplexer FRET assays are performed on synthetic targets. In other preferred embodiments FRET multiplexer assays are performed on nucleic acid fragment targets, eg PCR amplicons. In some preferred embodiments, FRET multiplexer assays are performed on genomic DNA targets. In still other preferred embodiments, FRET multiplexer assays are performed on RN objectives. In some particularly preferred embodiments, multiplexer FRET assays are tetraplex reactions. In some embodiments no or more I NVADER assay reagents may be provided in predetermined format (this is previously measured for use in a process step without re-sizing or re-introduction). In some modalities, certain components of I NVADER test reagents are mixed and pre-introduced together. In other embodiments, the components of the test reagents previously introduced and introduced are pre-introduced and provided in a reaction vessel (including but not limited to test tubes or a well, such as in a microtiter plate). In particularly preferred embodiments, the components of previously introduced NVADER test reagents are dried in a reaction vessel (eg, dissected or lyophilized). In some modalities, the INVADER assay reagents are provided as a team. As used herein, the term "equipment" refers to any supply system for supplying materials. In the context of the reaction assay, such delivery systems include systems that allow storage, transport from one location to another or supply of reaction reagents (eg, oligonucleotides, enzymes, in appropriate containers) and / or support materials ( for example shock absorbers, written instructions to perform the test, etc.). For example, the equipment includes one or more wrappings (eg boxes) containing the important reaction reagents and / or the support materials. As used herein, the term "fragmented equipment" refers to delivery systems that contain two or more separate containers each containing a sub-portion of the total components of the equipment. The containers can be supplied to the recipient in question, jointly or separately. For example, a first container may contain an enzyme for use in the assay, while the second container contains oligonucleotides. The term "fragmented equipment" is intended to include equipment that contains analyte-specific reagents (ASR) regulated in accordance with section 520 (e) of the Federal Law on Food, Drugs or Cosmetics, but is not limited thereto. In fact any supply system containing two or more separate containers each containing a sub-portion of the total components of the equipment is included in the term "fragmented equipment". In contrast, "combined equipment" refers to a supply system that contains all the components of a reaction test in a single container (for example in a case of a box for each of the desired components). The term "team" includes fragmented and combined teams. In some embodiments, the present invention provides I NVADER test reaction kits that purchase from one or more of the components necessary to practice the present invention. For example, the present invention provides equipment for storing or supplying enzymes and / or reaction components necessary for the practice of an I NVADER assay. The kit can include any and all necessary or desired components for the assays, including but not limited to the reagents themselves, buffers, control reagents (e.g., tissue samples, positive and negative control target oligonucleotides, etc.) solid support , labels, written instructions and (or in pictures and information about the product, inhibitors, labeling and / or detection reagents, environmental controls of the packaging (eg ice, blotters, etc.) and the like. a sub-group of the required components, where the user is expected to provide the remaining components In some modalities the equipment comprises two or more separate containers where each container houses a sub-group of the components to be applied. For example, a first container (for example, a box) could contain an enzyme (for example, a rupture enzyme with a specific structure). ca in a suitable storage buffer and the container), while a second box may contain oligonucleotides (for example the oligonucleotides I NVADER, The probe oligonucleotides, or the control target oligonucleotides, etc). DESCRIPTION OF FIGURES The following figures form part of the present description and are included to demonstrate certain aspects and embodiments of the present invention. The invention can be better understood by referring to one or more of those figures in combination with the description of the specific embodiments presented herein. Figure 1 shows a schematic diagram of an I NVADER assay modality. In the primary reaction the target molecule (dotted rectangle) forms the upper fin structure with the invading probe (open rectangle) and the primary probe that includes the specific region target (open rectangle) and fin 5 '(solid rectangle). The upper fin breaks with the 5'-nuclease specific to the structure. The rupture site of the upper fin structure shown by the date is located after the 5 'terminal nucleotide of the region specific to the target of the primary probe. For SNP identification, the overlap between the probes is placed on the opposite side to the polymorphic site (X) If nucleotide X is not complementary to the primary probe, no specific break is made. In the secondary reaction, the split 5 'fin forms the overlapping fin structure with the FRET cartridge (gray line) labeled with a dye (D) and a choke (Q). The rupture of the FRET cartridge by means of the 5 'nuclease releases the unstuffed dye. The semicircular arrows indicate the transformation process of the oligonucleotide essential for the amplification of the signal. A similar cascade (not shown) is used for the detection of! alternative SNP nucleotide in the INVADER biplex assay. Figure 2 is a graph showing the dependence of the logarithm of the amplification factor IgF on the number of PCR cycles n for PCR 5. Figure 3A is a graph showing the effect of the IgF primer concentration c for PCR 1 (•), PCR 2 (o), PCR 4 (-), and PCR 5 (p). Figure 3B is a graph showing the relationship between ln (2-¡= 0 05) and c using the data shown in 3A. Figure 4 shows scatter plots of the net signals of the FAM and RED INVADER assays for eight genomic samples of DNA in reactions as described in example 7. Figure 5 shows the net RED fluorescence signal normalized by allele for the 161 successful I NVADER assays as a function of the length of the PCR target, in reactions described in Example 7. Figure 6 shows scatter plots of the FAM and RED net signals for eight DNA samples in reactions described in Example 7 .

Figure 7 shows a graph showing the results of a combined objective and signal amplification reaction according to the methods of example 8. Figure 8 shows a flow chart indicating the steps that can be performed in order to generate a series of useful primers in the multiplexer PCR. Figure 9 shows a graph showing the results of a combined multiplexer amplification reaction of target and signal according to the methods of example 8. Figure 10 shows a graph showing the results of an INVADER tetraflex assay as shown in FIG. FIG. 1A-1 1 G shows graphs showing the results of the detection by the INVADER assay of the target DNA amplified by multiplex PCR on a multifluid card. Figures 12A-1 2G show graphs showing the results of amplification reactions of multiplexer and I NVADER PCR test signals combined in a microfluidic card. DEFINITION In order to facilitate an understanding of the present invention, various terms and phrases are defined below: As used herein the terms "SN P", "SNPs" or "single nucleotide polymorphisms" refer to unique base changes in a specific place in the genome of an organism (for example a human). The "SNP" may be located in a portion of a genome that does not encode a gene- Alternatively, an "SNP" may be located in the coding region of a gene. In this case, the "SNP" can alter the structure and function of the RNA or protein with which it is associated. As used herein, the term "allele" refers to a variant form of a sequence used (for example including but not limited to genes that contain one or more S NP). A large number of genes are present in multiple allelic forms in a population. A diploid organism that carries two alleles of a gene is said to be heterozygous for that gene, while a homozygote carries two copies of the same allele. As used herein the term "link" refers to the proximity of two or more markers (eg, genes) on a chromosome. As used herein, the term "allele frequency" refers to the frequency of occurrence of a given allele (e.g., a sequence containing a SNP) in a given population (e.g., a specific genus, race, or ethnic group). Certain populations may contain a given allele within a high percentage of its members than other proportions. For example, a particular mutation in the breast cancer gene called BRCA1 is present in one percent of the general Jewish population. In comparison, the percentage of people in the general population of the United States who have any mutation in BRCA 1 has been estimated between 0.1 to 0.6 percent. Two additional mutations, one in the BRCA1 gene and the other in the breast cancer gene called BRCA2, have a high prevalence in the Ashkenazi Jewish population. , raising the overall risk of carrying one of those three mutations to 2.3 percent. As used herein, the term "silicon analysis" refers to the analysis performed using processors and computer memories. For example, "SNP analysis in silicon" refers to the analysis of SNP data using processors and computer memories. As used herein the term "genotype" refers to the current genetic conformation of an organism (for example in terms of the particular alleles carried at a genetic point). The expression of the genotype gives a growth to appearances and physical characteristics of the organism - the "phenotype". As used herein, the term "disease" or "pathological condition" refers to a deviation from the condition considered normal or average for members of a species and that is detrimental to an affected individual under conditions that are not hostile to the majority of the individuals of that species (for example diarrhea, nausea, fever, pain and inflammation, etc.). As used herein the term "treatment" with reference to a medical course of action refers to the steps or actions taken with respect to the individual affected as a consequence of a pathological, suspected, anticipated or existing condition, or where there is a risk or suspected risk of a pathological condition. The treatment may be provided in anticipation or in response to a pathological condition or suspicion of a pathological condition, and may include but is not limited to preventive, ameliorating, palliative or curative stages. The term "therapy" refers to a particular course of treatment.

The term "gene" refers to a nucleic acid (e.g., DNA) sequence comprising the coding sequences necessary for the production of a polypeptide, RNA (e.g., rRNA, tRNA, etc.) or precursor. The polypeptides, RNA, or precursor can be encoded by a full length coding sequence or by a portion of the coding sequence as long as the desired activities or functional properties (eg, ligand binding, signal transduction, etc.) are retained. The total length or fragments are retained. The term also includes the coding region of a structural gene and includes the sequences located adjacent to the coding region at both 5 'and 3' ends over a distance of about 1 kb at either end such that the gene corresponds to the length of the total length mRNA. Sequences that are located 5 'from the coding region and that are present in the mARB are referred to as 5' untranslated sequences. The sequences that are located 3 'or downstream of the coding region and that are present in the mRNA as referred to in the 3' untranslated sequences. The term "gene" includes both cDNA and the genomic forms of a gene. A genomic form or clone of a gene contains the uninterrupted region with non-coding sequences called "introns" or "participating regions" or "participating sequences". Introns are included segments when a gene is transcribed in heterologous nuclear RNA (hnRNA); the introns may contain regulatory elements such as promoters. The voyeurs are removed or "trimmed" from the nuclear or primary transcript; the introns so far are generally absent in the messenger RNA transcript (mRNA). The mRNA functions during translation to specify the sequence or order of the amino acids in the nascent polypeptide. Variations (eg, mutations, SNPS, insertions, deletions) in transcribed portions of the genes are reflected in and can be detected in corresponding portions of the produced RNAs (eg hnRNAs, mRNAs, rRNAs, tRNAs). When the phrase "amino acid sequence" is mentioned to refer to an amino acid sequence of a naturally occurring protein molecule, amino acid sequence and similar terms, such as polypeptides and proteins are not intended to limit the amino acid sequence to the native amino acid sequence complete associated with the mentioned protein molecule. In addition to containing introns, genomic forms of a gene can also include sequences located at the 5 'and 3' ends of the sequences that are present in the RNA transcript. These sequences are called "flanking" sequences or regions (those flanking sequences are located 5 'or 3' to the non-translated sequences present in the mRNA transcript). the 5 'flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3 'flanking region may contain sequences that direct the completion of transcription, post-transcription disruption and polyadenylation. The term "native type" refers to a gene or gene product that has the characteristics of that gene or gene product when it is isolated from the natural source. A native type gene is the most frequently observed in a population and is therefore arbitrarily designated as the "normal" or "native type" of the gene. In contrast, the terms "modified", "mutant" and "variant" refer to a gene or gene product that shows modifications in the sequence and / or functional properties (this is altered characteristics) when compared to the gene or product genetic type native, if it is noted that the nafral mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the gene or the native type genetic product. As used herein the terms "coding to the nucleic acid molecule", "DNA sequence encoder" and "DNA coding" refers to the order or sequence of deoxyribonucleotides along a strip of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order of the amino acids along the polypeptide chain (protein). In this case, the DNA sequence as encodes the amino acid sequence. The DNA and RNA molecules are said to have "5 'ends" and "3' ends" because the mononucleotides are reacted to produce oligonucleotides or polynucleotides in such a way that the 5 'phosphate of the pentose mononucleotide ring is attached to the 3 'oxygen of its neighbor in one direction by means of a phosphodiester bond. Therefore one end of an oligonucleotide or polynucleotide, called as the "5 'end" if its 5' phosphate is not bonded to the 3 'oxygen of a mono-nucleotide pentose ring and as the "3' end" if its oxygen 3 is not linked to a 5 'phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if it is internal to an oligonucleotide or major polynucleotide, can also be said to have 5 'and 3' ends. In a linear or circular DNA molecule, the discrete element elements are said to be "upstream" or 5 'of the "downstream" or 3' elements. This terminology is reflected in the fact that transcription proceeds in a 5 'to 3' fashion along the DNA strip. The promoter and enhancer elements that direct the transcription of a ligated gene are generally located 5 'or upstream of the coding region. However, the enhancer elements can exert their effect even when they are located 3 'of the promoter element and the coding region. The signals of transcription termination and polyadenylation are located 3 'or downstream of the coding region. As used herein, the term "an oligonucleotide having a nucleotide sequence coding that encodes a gene" and "polynucleotide having a nucleotide sequence encoding a gene" means a nucleic acid sequence having the coding regions of a gene. a gene or in other words, the nucleic acid sequence that codes for a genetic product. The coding region can be present either in the form of cSDNA, genomic DNA, or RNA. When present in a DNA form, the oligonucleotide or polynucleotide may have a single strip (this is the sense strip) or have a double strip. Suitable control elements such as enhancers / promoters, separation bonds, polyadenylation signals, etc. they can be placed in close proximity to the coding region of the gene if it is needed to allow proper initiation of the transcription and / or correct processing of the primar RNA transcript. Alternatively, the coding region used in the expression of the vectors of the present invention may contain promoters / enhancers, separation junctions, intervening sequences, polyadenylation signals, etc. or a combination of both endogenous and exogenous control elements. As used herein, the terms "complementary" or "complementarity" are used in reference to the polynucleotides (this is a sequence of nucleotides) related by the rules of base pair formation. For example for the sequence "5'-A-G-T-3" it is complementary to the sequence "3-T-C-A-5" '. Complementarity can be "partial" in which only some nucleic acid bases coincide according to the rules of base pair formation. Or it can make "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between the nucleic acid strips has significant effects on the efficiency and strength of the hybridization between the nucleic acid strips. This is of particular importance in amplification reactions, as well as detection methods that depend on the link between the nucleic acids. The term "homology" refers to a degree of complementarity. There may be partial homology or complete homology (this is identity). A partially complementary sequence is one that at least partially inhibits a completely complementary sequence from hybridization to a target nucleic acid and refers to the use of the term "substantially homologous". The term "link inhibition" when used in reference to the nucleic acid linkage, refers to the inhibition of the bond caused or the competition of the homologous sequences to bind to an objective sequence. The inhibition of hybridization of the sequence completely complementary to the target sequence can be examined using a hybridization assay (Southern or Northern blot, solution hybridization and the like) under conditions of low stringency. A substantial homologous sequence or probe will compete for the binding and inhibit the binding (ie, hybridization) of a fully homologous target under conditions of low stringency. This does not mean that the conditions of low astringency are such that it is allowed in non-specific link; Low stringency conditions require that the link of two sequences to each other can be a specific interaction (this is selective). The absence of non-specific binding can be proved for the use of a second cash that lacks up to a partial degree of complementarity (eg less than about 30%); in the absence of a non-specific link, the probe will not hybridize to a second non-complementary target. The technique is well aware that numerous equivalent conditions can be employed that exhibit low stringency conditions; factors such as the length and nature (DNA, RNA, base composition) of the probe and the nature of the target (DNA, RNA, base composition, present in solution or immobilized, etc.) and the concentrations of the salts and other components (eg the presence or absence of formamide, dextran sulfate, polyethylene glycol) are considered and the hybridization solution can be varied to generate different but equivalent low stringency conditions of the conditions listed above. In addition, the art knows conditions that promote hybridization under conditions of high stringency (for example increasing the temperature of the hybridization and / or the washing steps, the use of formamide in the hybridization solution, etc.). When used in reference to a double-stranded nucleic acid sequence such as cDNA or genomic clone, the term "substantially homologous" refers to any probe that can hybridize to one or both strips of the low double-stranded nucleic acid sequence low stringency conditions as described above. A gene can produce multiple RNA species that are generated by differential splicing of the primary RNA transcript. The cDNAs that are the splice variants of the same gene will contain regions of sequence identity or complete homology (representing the presence of the same exon or portion of the same exon in both CADN) and regions of complete non-identity (eg, representing the presence of xon "A" in cDNA 1 where cDNA 2 contains exon "B"). Because the two cDNAs contain regions of sequence identity that both hybridize a probe derived from the entire gene or portions of the gene containing sequences found in both cDNAs; the two splice variants are therefore substantially homologous to that probe and to each other. When used in reference to a single-stranded nucleic acid sequence, the term "substantially homologous" refers to any probe that can hybridize (this is the complement of) the double-stranded nucleic acid sequence under conditions of low stringency as described before. As used herein the term "hybridization" is used in reference to the formation of complementary nucleic acid pairs. Hybridization and the strength of hybridization (this is the strength of the association between nucleic acids) is impacted by such factors as the degree of complementarity between the nucleic acids, the astringency of the conditions in question, the Tm of the hybrid formed and the G: C ratio within the nucleic acids. As used herein the term "Tm" is used in reference to the "melting temperature". The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules semi-dissociated into single strips. The equation for calculating the Tm of nucleic acids well known in the art. As indicated by the standard references, a simple estimate of the Tm value can be calculated by means of the equation: Tm = 8.14 + 0.41 (% G + C), when a nucleic acid is in aqueous solution at 1 M NaCl. (See, for example, Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization [1985]). Other references include more more sophisticated calculations that take into account the structural characteristics as well as the sequence characteristics for the calculation of Tm. As used herein, the term "astringency" is used in reference to temperature conditions, ionic strength and the presence of other compounds such as organic solvents, under which nucleic acid hybridizations are performed. Those skilled in the art will recognize that the conditions of "astringency" can be altered to various parameters recently described either individually or in conjunction With the conditions of "high stringency", the formation of nucleic acid pairs only occurred between acid fragments nucleic acids that have a high frequency of complementary base sequences (for example hybridization under conditions of "high stringency" can occur between homologs with approximately 85-1 00% identity, preferably approximately 70-100% identity). With medium stringency conditions, nucleic acid pairing will occur between nucleic acids with an intermediate frequency of complementary base sequences (eg hybridization under "medium stringency" conditions will occur between homologs with approximately 50-70% identity). Thus, conditions of "weak" or "high" astringency are often required with nucleic acids that are derived from organisms that are genetically different, since the frequency of complementary sequences is generally less.When "High stringency conditions" are used in reference to Hybridization consists of conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH2PO4H2O and 1.85 g / l EDTA, the pH is adjusted to 7.4 with NaOH) , 0.5% SDS, Denhardt 5X reagent and 1 00 μg / ml denatured salmon sperm DNA followed by washing in a solution containing 1.0X SSPE, 1.0% SDS at 42 ° C when a probe is used of approximately 500 nucleotides in length "Low stringency conditions" present conditions equivalent to bonding or hybridization at 42 ° C in a solution consisting of 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH2PO4H2O and 1.85 g / l) l EDTA, the pH is adjusted to 7. 4 with NaOH), 0.1% SDS, Denhardt 5X reagent [Denhart 50X reagent contains per 500 ml: 5 g Ficoll (type 400, Pharmacia), 5 g BSA (fraction V; Sigma)] and 100 g / ml of denatured salmon sperm DNA followed by washing in a solution containing 5X SSPE, 0. 1% SDS at 42 ° C when a probe of approximately 500 nucleotides in length is employed. The following terms are used to describe the sequence relationships between two or more polynucleotides: "reference sequence", "sequence identity", "percentage of sequence identity" and "substantial identity". A "reference sequence" is defined as a sequence used as the basis for a sequence comparison; a reference sequence may be a subgroup of a larger sequence, eg, a segment of a full-length cDNA sequence given in a sequence listing or may consist of a complete genetic sequence. Generally a reference sequence is at least 20 nucleotides in length, frequently at least 25 nucleotides in length and frequently at least 50 n nucleotides in length. Since two polynucleotides may each contain (1) a sequence (this is a portion of the complete polynucleotide sequence) which is simulated between the two polynucleotides, and (2) may further contain a sequence that is divergent between the two polynucleotides, Sequence comparisons between two (or more) polynucleotides are typically performed by comparing the sequences of the two polynucleotides through a "comparison window" to identify and compare the local regions of sequence similarity. A "comparison window" as used herein, refers to the conceptual segment of at least 20 contiguous nucleotide positions where the polynucleotide sequence can be compared to a reference sequence of at least 20 contiguous nucleotides and wherein the portion of the sequence The polynucleotide compared to the window may contain additions or deletions (that is hollow spaces) of 20 percent or less compared to the reference sequence (which contains no additions or deletions) for optimal alignment of the two sequences. The optimal alignment of the sequences to align a comparison window can be conducted by means of the local homology algorithm of Smith and Waterman [Smith and Waterman, Adv. Appl. Math. 2: 482 (1981)] by means of the homology alignment algorithm of Needleman and Wunsch [Needleman and Wunsch, J. Mol. Biol. 48: 443 (1 970)] in the search for the Pearson and Lipman similarity method ÑPearson and Lipman, Proc. Nati Acad. Sci. (USA) 85_2444 (1988)], through the computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA, in the Wisconsin Genetics Software package, version 7.0, Genetics Computer Group, 575 Science Dr. , Madison, Wis.) Or by means of inspection and the best alignment is selected (this is resulting in the highest percentage of homology through the comparison window) generated by the different methods. The term "sequence identity" means that two polynucleotide sequences are identical (that is, one base per nucleotide per nucleotide) throughout the comparison window. The term, percentage of sequence identity "is calculated by comparing two optimally aligned sequences during the comparison window, determining the number of positions in which the identical n-nucleic acid base is presented (e.g. A, T, C, G , U) in both sequences to give the number of matching positions, divide the number of matching positions by the total number of positions in the comparison window (for example the size of the window) and multiply the result by 100 to give the percentage Sequence identity When applied to polynucleotides the term "substantial identity" denotes a characteristic of a polynucleotide sequence, wherein the nucleotide polynucleotide contains a sequence having at least a sequence identity of 85 percent, preferably at least one identity of sequence from 90 to 95 percent, more generally at least 99 percent sequence identity compared to a reference sequence through a comparison window of at least 20 nucleotide positions, often in a window of at least 25-50 nucleotides, wherein the Percentages of sequence identity is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions totaling 20 percent or less of the reference sequence through the comparison window. The reference sequence can be run subgroup of a larger sequence, as a splice variant of the full length sequences. When applied to polypeptides the term "substantial identity" means that two peptide sequences when optimally alienated such as by means of the GAP or BESTFIT programs using default free space weights share at least 80 percent sequence identity, preferably at least 90 percent sequence identity, more preferably at least 95 or more percent sequence identity for example 99 percent sequence identity). Preferably residue positions that are not identical differ in the amino acid substitutions. Conservative amioacid substitutions refer to the exchange capacity of residues that have similar side chains. For example, a group of amino acids that have aliphatic side chains is formed by glycine, alanine, valine, leucine and soluecina; an amino acid group that has aiiphatic hydroxide side chains is serine and threonine; an amino acid group having side chains containing amide is asparagine and glutamine; A group of amino acids that have aromatic side chains is phenylalanine, tyrosine. and tryptophan, a group of amino acids that have amide-containing side chains is asparagine and glutamine; a group of amino acids that have side chains is phenylalanine, tyrosine and tryptophan; a group of minocids that have basic side chains is lysine, arginine, and histidine and a group of amino acids that have side chains containing sulfur is cysteine and methionine. The preferred conservative amino acid substitution groups are: valine-leucine-isoieucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine and asparagine-glutamine. "Amplification" is a special case of nucleic acid repiration that includes the specificity of the template. It must be contrasted with non-specific template replication (this is replication that is dependent on the template but not dependent on a specific template). The specificity of the template is distinguished from the fidelity of replication (ie, the synthesis of the appropriate polynucleotide sequence) and the (ribo- and deoxyribo-) nucleotide specificity. The specificity of the templates is often described in terms of "target" specificity. The target sequences are "objective" in the sense that you want to differentiate them from other nucleic acids. The amplification techniques have been designed primarily for selection. The specificity of the templates is achieved in most of the amplification techniques by means of the selection of the enzyme. Amplification enzymes are enzymes that under the conditions in which they are used, will only process specific nucleic acid sequences in a heterogeneous mixture of nucleic acid. For example in the case of a replicase Q, MDV-1 RNA is the specific template for the replicase (D. L. Kacian et al., Proc. Nati, Acad. Sci, USA 69: 3039 [1972]). Other nucleic acids will not be replicated by this amplification enzyme. Similarly in the case of the T7 RNA polymerase, this amplification enzyme has an astringent specificity for its own promoters (M. Chamberlin et al., Nature 228: 227 (1970).) In the case of ligase ligase. of T4 DNA, the enzyme will not seligate the two oligonucleotides or polynucleotides, when there is a mismatch between the oligonucleotide substrate or polynucleotide and the template at the binding junction (DY Wu and RB Wallace, Genomics 4: 560 [1989]). Taq and Pfu polymerases, by virtue of their capacity to operate at high temperature, have been found to show high specificity to the ligated sequences and thus defined by the primers, the high temperature results under thermodynamic conditions that favor the hybridization of the primers with target sequences and not hybridization with non-target sequences (HL Erlich (ed.) PCR Technology, Stockton Press [1989]). As used herein, the term "amplified nucleic acid e "is used with reference to nucleic acids that can be amplified by any method of amplification. It is contemplated that the "amiable nucleic acid" will usually contain the "sample template". As used herein the term "sample template" refers to nucleic acid originating from a sample that is analyzed for the presence of the "target" (defined below). In contrast, "base template" is used in reference to nucleic acid other than the sample template that may or may not be present in a sample. The base template most of the time is unnoticed. It may be the result of entrainment or it may be due to the presence of nucleic acid contaminants that are purged from the sample. For example, nucleic acids from organisms other than those to be detected may be present as a base in a test sample. As used herein the term "primer" refers to an oligonucleotide either naturally as in a purified restriction digest or synthetically produced, which is capable of acting as a starting point of the synthesis when placed under conditions in which the synthesis of a primer extension product is induced which is complementary to a nucleic acid strip (ie, the presence of nucleotides and an inducer agent such as DNA polymerase and a suitable temperature and pH). The primer is preferably a single strip for maximum efficiency in the amplification, but may alternatively have a double strip. If you have a double strip, the primer is first treated to separate its strips before being used to prepare extension products. Preferably, the primer is an oligodeoxyribunucleotide. The primer should be long enough to prime the synthesis of the extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors including temperature, source of the primer and the use of the method. As used herein the term "probe" or "hybridization probe" refers to an oligonucleotide (this is a nucleotide sequence) whether they occur naturally as a purified restriction digest or have been produced synthetically, by recombination by means of of PCR amplification, this is able to hybridize at least in part to other oligonucleotides of interest. A probe can have a single strip or a double strip. The probes are useful in the detection, identification and isolation of the particular sequences. In some preferred embodiments, the probes used in the present invention will be labeled with a "reporter molecule," such that they can be detected in any detection system, including but not limited to enzyme systems (eg, ELISA, as well as histochemical assays). to enzymes), fluorescent, radioactive and luminescent. The present invention is not intended to be limited to any particular detection system or label. As used herein the term "objective" refers to a sequence or structure of nucleic acid that is to be detected or characterized. As used herein the term "polymerase chain reaction" ("PCR") refers to the KB Mullis method (see for example U.S. Patent Nos. 4, 683, 1 95, 4,683,202 and 4,965,188 incorporated by reference), which describes a method for increasing the concentration of a segment of an objective sequence in a genomic DNA mixture without cloning or purification. This process for amplifying the target sequence consists in introducing large excess nucleotide primers into the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycles in the presence of a DNA polymerase. The two primers are complementary to their respective strips of the double-strip target sequence. To effect the amplification, the mixture is denatured and the primers are thermally fixed to their complementary sequences within the target molecule. After thermal fixation, the primers are extended with a polymerase to form a new pair of complementary ones. The stages of denaturation, thermal fixation of primers and the extension of polymerase can be repeated many times (ie denaturation, thermal fixation and extension constitute a "cycle", there can be numerous cycles ") to obtain a high concentration of an amplified segment of The desired target sequence The length of the amplified segment to the desired target sequence is determined by the relative positions of the primers with each other, and therefore this length is a controllable parameter.In virtue of the repetitive aspects of the process, the method it is called "polymerase chain reaction" (hereafter "PCR"). Because the amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be "amplified" by PCR. "With PCR, it is possible to amplify a single copy of a specific target sequence in geonomic DNA at a level detectable by several different methodologies (e.g. hybridization with a labeled probe); incorporation of biotinylated primers followed by detection of the avidin-enzyme conjugate; incorporation of 32 P-labeled deoxynucleotide triphosphates, such as dCTP or dATP, into the amplified segment). In addition to the genomic DNA, any oligonucleotide or polynucleotide sequence can be amplified with the appropriate set of primer molecules. In particular, the amplified segments created by the PCR process itself are efficient templates for the subsequent PCR amplifications. As used herein the terms "PCR product", "PCR fragment" and "amplification product" refer to the resulting mixture after two or more cycles of the PCR steps of denaturation, thermal fixation and extension have been completed. . Those terms include the case in which there has been an amplification of one or more segments of one or more target sequences. As used herein the term "amplification reagents" refers to those reagents (deoxyribonucleotide triphosphates, buffer, etc.) necessary for amplification except primers, nucleic acid templates, and amplification enzymes.

Typically, the amplification reagents along with other reaction components are placed and contained in a reaction vessel (micro test tube, etc.). As used herein the term "reaction vessel" refers to a system in which the reaction can be conducted, including but not limited to test tubes, wells, microprobes (e.g. wells in microtiter test plates such as plates). of 96-well, 384-well, and 1,536-well assays), capillary tubes, fiber ends such as optical fibers, microfluidic devices such as chips, cartridges and fluid cards / including but not limited to those described for example in the patent North American no. 6,126,899 to Woudenberg, et al. , US patents us. 6, 627, 159, 6,720, 1 87 and 6,734,401 of Bedinham et al, US Pat. Nos. 6,31 9,469 and 6, 709, 869 of Mian et al. , U.S. Patent Nos. 5, 587, 128 and 6, 60, 517 to Wilding et al.) or a test site on any surface (including but not limited to glass, plastic or silicon surfaces, a granulate, a microchip, or a non-solid surface, such as a gel or a dendrimer). As used herein, the term "recombinant DNA molecule" as used herein refers to a DNA molecule consisting of segments of DNA linked therebetween by means of molecular biological techniques. As used herein the term "antisense" is used in reference to RNA sequences that are complementary to an RNA sequence (e.g., mRNA). The term "antisense strip" is used with reference to a strip of nucleic acid that is complementary to the "sense" strip. The designation (-) (this is "negative") is sometimes used in reference to the antisense strip, with the designation (+) sometimes used as reference to the strip in the direction (this is "positive"). The term "isolated" when used in relation to a nucleic acid, as in "an isolated oligonucleotide" or "isolated polynucleotide" refers to a nucleic acid sequence that is identified and separated from at least one contaminating nucleic acid, with the which is normally associated in the natural source. The isolated nucleic acid is present in a form or placement that is different from that found in nature. In non-isolated nucleic acid contrasts are nucleic acids such as DNA or RNA found in the state that exist in nature. For example, a given DNA sequence (eg, a gene) is located on the chromosome of the host cell in proximity to the neighboring genes; RNA sequences, such as the specific mRNA sequence encoding a specific protein, are found in the cell as a mixture of numerous different RNAs encoding a multiplicity of proteins. However, isolated nucleic acids encoding a polypeptide, include, by way of example, those nucleic acids in cells that generally express the polypeptides wherein the nucleic acid is in a chromosomal location different from that of natural cells, or in another case it is flanked by a nucleic acid sequence different from that found in nature. The isolated nucleic acid, oligonucleotide, or polynucleotide can be present in single or double strip form. When an isolated nucleic acid, oligonucleotide or polynucleotide should be used to express a protein, the oligonucleotide or polynucleotide will contain one of the coding sense strip (that is, the oligonucleotide or polynucleotide sequence can be single-stranded), but can contain both the sense and antisense strip (this is the oligonucleotide or polynucleotide can be double strip). As used herein, the term "portion" when referring to a nucleotide sequence (as in "a portion of a given nucleotide sequence") refers to fragments of that sequence. Fragments can have sizes in the range of four nucleotides to the entire nucleotide sequence minus one nucleotide (for example 10 nucleotides, 1 1, .., 20, ...). As used herein the term "purified" or "purify" refers to the removal of contaminants from a sample. As used herein, the term "purified" refers to molecules (eg, nucleic acid or amino acid sequences that are removed from their natural environment, isolate or separate.) An "isolated nucleic acid sequence" is therefore a sequence. of purified nucleic acid "Substantially purified" molecules are at least 60% free, preferably 75%, and more preferably at least 90%, of other components with which they are normally associated. "or" recombinant polypeptide "as used herein refers to a protein molecule that is expressed from a recombinant DNA molecule The term" native protein "as used herein to indicate that a protein does not contain amino acid radicals encoded by sequences of vectors; this is the native protein only contains those amino acids found in the protein as it occurs in nature. A native protein can be produced by recombinant means that can be isolated from a natural source. As used herein the term "portion" when used in reference to a protein (as in "a portion of a given protein") refers to fragments of that protein. The fragments can be found in the range of four amino acid residues consecutive to the entire amino acid sequence minus an amino acid. The term "Southern blot" refers to DNA analysis on agarose or acrylamide gels to fractionate the DNA according to size followed by transfer of the DNA from the gel to a solid support such as nitrocellulose or an nlon membrane. The immobilized DNA is then probed with a labeled probe to detect DNA species complementary to the probe used. The DNA can be cut with restriction enzymes before electrophoresis. After electrophoresis, the DNA can be partially depurinated and denatured before or during transfer to the solid support. Southern blot analysis is a standard tool of molecular biologists (J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, pp. P.31 -0.58 [1989]). The term "Western blot" refers to the analysis of protein (s) (or polypeptides) immobilized on a support such as nitrocellulose or a membrane). The proteins are flowed onto acrylamide gels to separate the proteins, followed by the transfer of the protein from the gel to a solid support, such as nitroceiulose or a nylon membrane. The immobilized proteins are then exposed to antibodies with reactivity against an antigen of interest. The binding of the antibodies can be detected with several methods, including the use of labeled antibodies. The term "test compound" refers to any chemical entity, drug, medicament, and the like that is being tested with the assay (e.g., a drug screening assay) for any desired activity (e.g., including but not limited to the ability to treat or prevent a disease, disorder, disorder of a bodily function, or that otherwise alters the physiological or cellular status of a sample). It can be determined that the test compounds are therapeutic by means of research using the research methods of the present invention. A "known therapeutic compound" refers to a therapeutic compound that has been shown (e.g., by animal testing or previous experience with administration to humans) that will be effective in that prevention treatment. The term "sample" as used herein is used in its broadest sense. A sample suspected of containing a human chromosome or sequences associated with a human chromosome may contain a cell, chromosomes isolated from a cell (eg an expansion of metaphase chromosomes) genomic DNA (in solution or attached to a solid support such as Southern blot analysis), RNA (in solution or bound to a solid support as in the case of Northern blot analysis), cDNA (in solution or attached to a solid support) and the like. A sample of which is suspected to contain a protein may contain a cell, a portion of a tissue, an extract containing one or more proteins and the like. Samples include but are not limited to, sections of tissue, blood, blood fractions (eg, serum, plasma, cells), saliva, brain-spiral fluid, pleural fluid, milk, lymph, phlegm, semen, urine, stool, fluid amniotic, samples of chorionic villus (CVS), cervical smears and oral swabs. The term "label" as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect and which can bind to a nucleic acid or protein. Labels include but are not limited to dyes; radiolabels such as 32P, binding portions such as biotin; haptens such as dogoxgenin; luminogenic, phosphorescent or fluorogenic portions; and fluorescent dyes alone or in combination with portions that can suppress or displace the emission spectra by means of fluorescence resonance energy transfer (FRET). The labels can provide detectable signals by means of fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity and similar. A label can be a charged portion (with negative or positive charge) or alternatively, it can have a neutral charge. The labels may include or consist of a nucleic acid or protein sequence, as long as the sequence presenting the label is detectable. The term "signal" as used herein refers to any detectable effect, such as that which would be caused by a label or a test reaction. As used herein, the term "detector" refers to a system or component of a system, for example an instrument (e.g., a camera, fluorometer, charge coupled device, scintillation counter, etc.) or a reactive medium. (film for X-ray or camera, pH indicator, etc.) that can lead to a user or another component of a system (for example a computer or controller) the presence of a signal or effect. A detector can be a photometric or spectrophotometric system, which can detect ultraviolet light, visible or infrared light, including fluorescence or chemiluminescence, a radiation detection system; a spectroscopic system such as nuclear magnetic resonance spectroscopy, mass spectrometry or intense Rman spectrometry on the surface; a system such as gel electrophoresis or capillary gel exclusion chromatography, or other detection system known in the art or combinations thereof.

As used herein, the term "distribution system" refers to systems capable of transferring and / or delivering materials from one entity to another or from one location to another. For example, a distribution system for transferring detection panels from the manufacturer or distributed to a user may consist of, but not limited to, a packing department, a mailroom, and a mail delivery system. Alternatively, the distribution system may include, but is not limited to, one or more delivery vehicles and the associated shipping personnel, an exhibitor, a distribution center. In some embodiments of the present invention the interested parties (for example the manufacturers of the detection panel) use a distribution system to the transfer detection panels to the users without cost, at a subsidized cost or at a reduced cost. As used herein, the term "at a reduced cost" refers to the transfer of items or services at a reduced direct cost to the recipient (for example, the user). In some modalities, "at a reduced cost" refers to the transfer of items or services at no cost to the results. As used herein, the term "at a subsidiary cost" refers to the transfer of goods or services, where at least a portion of the recipient's costs are deferred or paid for by another person. In some modalities "at a subsidiary cost" refers to the transfer of article or services at no cost to the recipient. As used herein the term "free of charge" refers to the transfer of goods or services without direct financial expense to the recipient. For example, when detection panels are provided by a manufacturer or distributor to a user (for example, scientific researcher) at no cost, the user does not pay for the exams directly. The term "detection" as used herein refers to identifying an analyte (e.g., DNA, RNA or protein) within a sample. The term "detection assay" as used herein refers to an equipment, test, or preformed procedure for the purpose of detecting a nucleic acid analyzed within a sample. Detection assays produce a detectable signal or effect when performed in the presence of the target analyte, and include but are not limited to assays incorporating the processes of hybridization, nucleic acid cleavage (e.g. exo- or endonuclease), acid amplification nucleic acid, nucleotide formation, primer extension, or nucleic acid ligand. As used herein the term "functional detection oligonucleotide" refers to an oligonucleotide that is used as a component of a detection assay, wherein the detection assay is capable of successfully detecting (that is, producing a detectable signal) an acid target nucleic acid when the functional detection oligonucleotide provides the oligonucleotide component of the detection assay. This is in contrast to the non-functional detection oligonucleotides, which do not produce a detectable signal in a detection assay for the particular target nucleic acid when a non-functional detection oligonucleotide is provided as the oligonucleotide component of the detection assay. The determination of whether the oligonucleotide is a functional oligonucleotide can be performed experimentally by testing the oligonucleotide in the presence of a particular target nucleic acid using the detection assay. As used herein the term "derived from a different subject" such as samples or nucleic acids derived from different subjects refers to samples derived from multiple different individuals. For example, a blood sample containing genomic DNA from a first person and a blood sample comprising genomic DNA from a second person are considered blood samples and samples of genomic DNA that are derived from different subjects. A sample containing five nucleic acids derived from different subjects is a sample that includes at least five samples from five different individuals. Nevertheless, the sample may also contain multiple samples of a given individual. As used herein the term "treat together" when used in reference to experiment or tests refers to performing concurrently or sequentially experiments, where the results of the experiments are produced, collected or analyzed together (that is during the same period of time). weather). For example, a plurality of different target sequences located in wells separately from a multiple well plate or in different portions of a microarray are treated together in a detection assay in which the detection reactions are performed simultaneously or sequentially on the samples and where the data collected from the trials are analyzed together. The terms "test data" and "test result data" as used herein refer to data collected from the performance of an assay (for example to detect or quantify a gene, SNP or RNA). These test results can be of any form, that is, they can be raw test data or test data analyzed (for example, previously analyzed by means of a different process). The collected data that has not been processed or analyzed subsequently is called here the "raw" test data (for example a number corresponding to a measurement of the signal, such as a fluorescence signal from a point on a chip or a reaction vessel, a number corresponding to the measurement of a peak, such as the height of the peak or area, such as for example a mass spectrometer, H PLC, or capillary separation device), while the test data which have been processed through another step or analysis (for example, normalized, compared or otherwise processed by means of a calculation) are called "analyzed test data" or "output test data". As used herein the term "database" refers to the collection of information (for example data) arranged to facilitate recovery, for example stored in a computer memory. A "genomic database" is a database that contains genomic information, which includes but is not limited to information polymorphism (this is information regarding genetic polymorphisms), genome information (this is genomic information), information from links (this is the information related to the physical location of a nucleic acid sequence with respect to another nucleic acid sequence, for example on a chromosome), and disease association information (this is information correlated to the presence of or susceptibility to a disease to a physical feature of a subject, for example an allele of a subject). "Database information" refers to information that is going to be sent to a database, stored in a database, processed in a database or retrieved from a database. The "sequence database information" refers to the database information that relates to nucleic acid sequences. As used herein, the term "different sequence database" refers to two or more databases that contain different information than the other. For example, the databases dbSNP and Gen Bank are databases of different sequences because it contains information that is not found in another. As used herein, the term "processor" and "central processing unit" or "CPU" are used interchangeably and refer to a device that is capable of reading a program from a computer memory (e.g. ROM and other memory). computer) and preforms a group of stages according to the program. As used herein, the terms "computer memory" and "computer memory device" refer to any storage medium readable by a computer's processor. Examples of computer memory include but are not limited to RAM, ROM, computer chips, digital video discs (DVD), compact discs (CD), hard disk readers (HDD), and magnetic tape. As used herein, the term "computer-readable medium" refers to any device or system for storing or providing information (eg, data and instructions) to a computer processor. Examples of computer-readable media include but are not limited to DVDs, CDs, hard drive readers, magnetic tape and servers for transmitting media over networks. As used herein, the term "hyperlink" refers to a navigation link from one document to another, or from a portion (or component) of one document to another. Typically a hyperlink is displayed as a highlighted word or phrase that can be selected by clicking on it using a mouse to jump to the associated document or document portion. As used herein, the term "hypertext system" refers to a computer-based information system in which documents (and possibly other types of data entities) are linked together by means of hyperlinks to form a "network". "navigable by a user. As used herein the term "internet" refers to a collection of networks using standard protocols. For example the term includes a collection of interconnected networks (public and / or private) that are linked together by means of a group of standard protocols (such as TCP / I P, http, and FTP) to form a distributed global network. While this term is intended to refer to what is now commonly referred to as the internet, it is also intended to include variations that may be made in the future including changes and additions to existing standard protocols or integrations with other media (eg television, radio , etc.). The term is intended to include non-public networks such as private (for example, corporate) networks. As used herein, the term "World wide web" or "network" generally refers to both (i) a distributed collection of hypertext documents visible to the interlinked user (commonly referred to as documents or web pages) that are accessible through the internet and (ii) the client and the. server software components that provide access to those documents using standardized itnernet protocols. Currently the primary standard protocols to allow applications to locate and acquire network documents is http, and network pages are encoded using HTML. However, the terms "network" and "global network" are intended to include future languages and transport protocols that may be used instead of (or in addition to) HTML or HTPP. As used herein the term "network site" refers to a computer system that presents information content through a network using the standard protocols of the worldwide network. Typically, a network site corresponds to a particular internet domain name and includes the content associated with a particular organization. As used herein, the term is generally intended to include both (i) the hardware / software server components that prepare the information content through the network, and (ii) the "After" hardware / software components, including any non-standard or specialized components, which interact with the server components to perform the services of network users. As used herein, the term "HTML" refers to the hypertext marker language which is a standard encoding coding convention and sets the codes for joining presentations and linking attributes for the content of information within the documents. HTML is based on SGML, the standardized generalized marker language. During an authoring stage document, HTML codes (referred to as "tags") are included within the information content of the document when the network document (or HTML document) is subsequently transferred from a server to a browser, the codes are interpreted by the browser and used to classify and display the document. In addition to specifying how the network browser should display the document, HTML tags can be used to create links to other network documents (commonly referred to as "hyperlinks"). As used herein, the term "XML" refers to extensible marker language, an application profile that as HTML is based on SGML. XML differs from HTML because information providers can define a new tag name and attributes at their will; Document structures can be nested at any level of complexity; any XML document can contain an optional description of its grammar to be used by means of applications that need to perform structural validation. XML documents are made up of storage units called entities, which contain classified data or not. The classified data is made up of characters, some of which form the marker. The marker encodes a description of the storage plan of the document and its logical structure. XML provides a mechanism for imposing storage plan constraints and logical structure, to define restrictions in the logical structure and to support the use of predefined storage units. A software module called an XML processor is used to read XML documents and provide access to their content and structure. As used herein, the term "http" refers to the hypertext transport protocol which is the client server protocol of the global network used for the exchange of information (in such a way that HTML documents and client requests for those documents) between a browser and a network server. The HTPP includes several types of messages that can be sent from the client to the server. For example, a "GET" message that has the GET message causes the server to return the document or file located at the specified URL. As used herein, the term "URL" refers to the uniform resource locator which is a unique address that completely specifies the location of a file or other resource on the internet. The general format of a URL is protocol: // machine address: port / path / file name. The port specification is optional and if nothing is entered, the browser defaults to the standard port of the service specified as the protocol, for example, if HTPP is specified as a protocol, the browser will use the default http port of 80.

As used herein, the term "PUSH technology" refers to an information dissemination technology used to send data to its users through a network. Contrary to the global network (which is a "Puli" technology) in which the client's browser requests a network page before it is sent, the PUSH protocols send the information content to the user's computer automatically, typically in based on information pre-specified by the user. As used herein, the term "communication network" refers to any network that allows information to be transmitted from one point to another. For example, a communication network for the transfer of information from one computer to another includes any public or private network that transfers information using electrical transmission, optics, satellite transmission, and the like. Two or more devices that are part of a communication network in such a way that they can transmit directly or indirectly from one to another are considered to be in electronic communication with each other. A computer network that contains multiple computers can have a central computer ("central node") that processes information from a sub-computer that performs specific tasks ("sub-nodes.") Some networks include computers that are in different geographical locations. among themselves, meaning that the computers are located in different physical locations (that is, they are not physically the same computer, for example they are located in different countries, city states, quarters, etc.). As used herein the term "detection assay component" refers to a component of a system capable of performing a detection assay. Detection test components include but are not limited to hybridization probes, buffers, and the like. As used herein, the term "detection assays configured for target detection" refers to the collection of assay components that are capable of producing a detectable signal when performed using the target nucleic acid. For example, a detection assay that has been empirically demonstrated to detect a single unique nucleotide polymorphism is considered a detection test configured for the detection of targets. As used herein, the phrase "single detection assay" refers to a detection assay having a different collection of test components relative to other detection assays located on the same detection panel.A single assay does not necessarily detect a different assay. target (for example SNP) than other assays on the same detection panel, but has at least one difference in the collection of components used to detect a given component (for example a single detection assay may employ a sequence of probes that is more short or longer than the other assays in the same detection panel.) As used herein the term the term "candidate" refers to an assay or analyte, for example a nucleic acid which is suspected of having a characteristic or property A "candidate sequence" refers to a nucleic acid suspected of containing a particular sequence, whereas an "oligonucleotide" "candidate" refers to an oligonucleotide which is suspected of having a property such as presenting a particular sequence, or which has the ability to hybridize to a target nucleic acid or function in a detection assay. A "candidate screening assay" refers to detection assays of which a valid detection assay is suspected. As used herein the term "detection panel" refers to a substrate or device that contains at least two unique candidate detection tests configured for the detection of targets. As used herein, the term "valid detection assay" refers to detection assays that have been shown to accurately predict an association between the detection of an objective and a phenotype (e.g., a medical condition). Examples of valid detection tests include but are not limited to, detection tests that when a target is detected, accurately predict the medical phenotype 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8% or 99.9% of the time. Other examples of valid detection assays include but are not limited to screening assays that qualify as and / or are marketed as specific reagents for the analyte (this is as defined by FDA regulations) or in vitro diagnostics (this is approved by the FDA). As used herein, the term "equipment" refers to any supply system for supplying materials. In the context of the reaction assay, such delivery systems include systems that allow storage, transport from one location to another or supply of reaction reagents (eg, oligonucleotides, enzymes, in appropriate containers) and / or support materials ( for example shock absorbers, written instructions to perform the test, etc.). For example, the equipment includes one or more wrappings (eg boxes) containing the important reaction reagents and / or the support materials. As used herein, the term "fragmented equipment" refers to supply systems that contain two or more separate containers each containing a sub-portion of the total components of the equipment. The containers can be supplied to the receiver in question, jointly or separately. For example, a first container may contain an enzyme for use in the assay, while the second container contains oligonucleotides. The term "fragmented equipment" is intended to include equipment that contains analyte-specific reagents (ASR) regulated in accordance with section 520 (e) of the Federal Law on Food, Drugs or Cosmetics, but is not limited thereto. In fact any supply system containing two or more separate containers each containing a sub-portion of the total components of the equipment is included in the term "fragmented equipment". In contrast, "combined equipment" refers to a delivery system that contains all the components of a reaction test in a single container (for example in a case and a box for each of the desired components). The term "equipment" includes fragmented and combined equipment. As used herein, the term "information" refers to any collection of facts or data. In reference to information stored or processed using a computer system including but not limited to the internet, the term refers to any data stored in any format (eg analog, digital, optical, etc.). As used herein, the term "information related to a subject" refers to facts or data related to a subject (for example, human, plant or animal). The term "genomic information" refers to information related to a genome including, but not limited to, nucleic acid sequences, genes, allele frequencies, RNA expression levels, protein expression, phenotypes correlated to genotypes, etc. "Allele frequency information" refers to facts or data related to allele frequencies, including but not limited to allele identities, statistical correlations between the presence of an allele and the characteristics of a subject (e.g., a human subject), the presence or absence of an allele in an individual or population, the percentage chance that an allele is present in an individual that has one or more particular characteristics, etc. As used herein, the term "assay validation information" refers to genomic information and / or allele frequency information that results from processing the test result data (eg, processed with the aid of a computer). The information validation information can be used for example to identify a screening test for a particular candidate as a valid screening assay. DETAILED DESCRIPTION OF THE INVENTION Detection in biological samples One objective in molecular diagnosis has been to achieve accurate and sensitive detection of analytes in the shortest time possible with the least amount of work and possible steps. One way in which this is achieved is multiplexer detection of samples in samples allowing multiple detection in a single vessel or reaction solution. However many of the existing diagnostic methods, including the multiplexing reaction still requires many stages, including sample preparation caps that contribute to the time, complexity and cost of performing the reactions. The present invention in some embodiments provides solutions to those problems by providing an assay that can be conducted directly on unpurified or untreated biological samples (eg blood). Direct detection in biological samples (eg blood, saliva, urine, etc.) has been excluded due to the presence of numerous biological factors in the natural samples that may interfere with the functioning, accuracy, and consistency of diagnostic reactions . For example many nucleic acid detection technologies employ enzymes and other reagents that are sensitive to specific salt and pH conditions or that are subject to proteolysis or inhibition by natural factors. The present invention provides systems and methods for use in the NVADER I assay, alone or in combination with PCR or related technologies, for the direct detection of nucleic acid target sequences in unpurified body fluids. Example 12 below provides an example of that type. These methods can be used as individual reactions or can be used as multiplex reactions. Several multiplexing modalities are described in detail below.

Thus in some embodiments, the present invention provides systems of composition, equipment, and methods for detecting one or more nucleic acids in unpurified (or partially purified) body fluids that exhibit the step of exposing an unpurified body fluid to reagent assays. detection under conditions such that the target nucleic acid is detected if it is present. In preferred embodiments, the method is carried out in a single reaction step. For example, once the sample is exposed to the reagents, there is no need for additional reagents before the detection step. Thus the method can be carried out in a reaction vessel (for example a closed reaction vessel) without the need for human or other intervention. In preferred embodiments the method includes an invasive cleavage reaction with or without the polymerase chain reaction. Because the signal amplification, sensitivity and ability to quantify the signal using an invasive cleavage reaction where the polymerase chain is used, only limited cycles are needed (eg 20, 15, 12, 10 or less) . The equipment to perform or assist these methods may consist of one or more of the reagents useful in the methods. For example, in some embodiments, the kits comprise a polymerase, a 5 'nuclease (eg, FEN-1 endonuclease) and a buffer that allows for the detectable amplification of the target nucleic acid in an unpurified body fluid. Since its introduction in 1988, Chamberlain, et al. Nucleic Acids Res., 16: 1 1 141 (1988)), multiplexer PCR has become a routine means of amplifying multiple gene products, in a single reaction, as well as in clinical applications. Multiplexer PCR has been described for use in diagnostic virology (Elnifro, er al. Clinical Microbiology Reviews, 13: 559 (2000)), paternity tests (Hidding and Schmitt, ForenSci. Int., 1 1 3: 47 (2000), Bauer et al., Int. J. Legal Med. 1 16: 39 (2002)), genetic diagnosis prior to implantation (Ouhibi, er al., Curr Womens Health Rep. 1: 1 38 (2001) ), microbial analysis in environmental and food samples (Rudi et al., Int J Food Microbiology, 78: 171 (2002)), and veterinary medicine (Zarlenga and Higgíns, Vet Parasitol. 101: 21 5 (2001)), between others. More recently, the expansion of genetic analyzes at all genome levels, particularly for individual nucleotide polymorphisms, or SNPs, has created a need for high capacity multiplexer PCR. Genome-wide association studies and comparative candidate genes require genotype capacity between 1,00,000-500,000 SNP per individual (Kwok, Molecular Medicine Today 5: 538-5435 (1,999), Kwok, Pharmacogenomics, 1: 231 (2000); Risch and Merikangas, Science, 273: 1 51 6 (1 996)). In addition, SNPs in the coding or regulatory regions alter gene function in an important way (Cargill et al., Nature Genetics, 22: 231 (1999), Halusbka et al., Nature Genetics, 22: 239 (1999)). making those SNPs useful tools in personalized medicine (Hagmann, Science, 285: 21 (1 999); Cargill, al., Nature Genetics, 22: 231 (1 999); Halushka, al., Nature Genetics, 22: 239 (1 999) Similarly, validating the medical association of a group of SNPs previously identified by their potential clinical relevance as part of a diagnostic panel will mean testing thousands of individuals with respect to hundreds of markers ai at a time. Because of its attractiveness and usefulness, several factors complicate multiplexer PCR amplification, the most important of which is the phenomenon of PCR or amplification polarization, in which certain products are amplified more than others.Two kinds of amplification polarization have been described. One, called as a PCR drift, is ascribed to stochastic variation in stages such as thermal fixation of primers during the early stages of the reaction (Polz and Cavanaugh, Applied and Environmental Microbiology, 64: 3724 (1998)), is not reproducible and may be more prevalent when very small amounts of the target molecules that are being amplified are amplified (Walsh et al., PCR Methodos and Applications 1: 241 (1992)). The other referred to as PCR selection. It refers to the differential amplification of certain products based on the characteristics of the primer, amplicon length, G-C content and other genome sporbidities (Polz, above). Another factor that affects the extent to which PCR reactions can be multiplexed is the inherent tendency of PCR reactions to reach the plateau phase. The plateau phase is observed in the subsequent PCR cycles and reflects the observation that the amplicon generation moves from exponential to pseudo-linear accumulation and then eventually stops growing. This effect seems to be due to the non-specific interactions between the AN polymerase and the double strip products themselves. The molar ratio of the product to enzyme in the plateau phase is typically consistent for different DNA polymerases, even when different amounts of enzyme are included in the reaction, and it is approximately 30: 1 product: enzyme. This effect thus limits the total amount of the double strip product that can be generated in a PCR reaction in such a way that the number of different amplified sites must be balanced against the total amount of each amplicon desired for the subsequent analysis, this by means of electrophoresis , extension of primers, etc. Because of these and other considerations, although a multiplexed PCR report including 50 genetic digits has been reported (Lindblad-Toh et al., Nature Genet, 4: 381 (2000)), multiplexing is typically limited to fewer than ten different products. However, given the need to analyze less than ten different products. However, given the need to analyze up to 1,000,000 to 450,000 SNP from a single DNA genomic sample, there is a clear need for means to expand the multiplexing capabilities of PCR reactions. The present invention provides methods for the substantial multiplexing of PCR reactions for example by combining the INVADER assay with multiplexer OCR amplification. The INVADER assay provides a detection stage and a signal amplification which allow a very large number of targets to be detected in a multiplexing reaction. As desired, hundreds to thousands of hundreds to thousands to hundreds of thousands of targets can be detected in a multiplexing reaction. The formation of genotypes directly by means of the INVADER assay typically uses 5 to 200 ng of human genomic DNA per SNP, depending on the detection platform. For a small number of assays the reactions can be performed directly with genomic DNA, without objective pre-amplification, however, more than 1000 000 I NVADER assays have been developed and an even larger number of association studies of the whole genome, the amount of DNA can become a limiting factor Because the I NVADER assay provides an amplification of the signal from 1 06 to 1 07 times, the multiplexed PCR in combination with the I NVADER assay will only use a limited target amplification compared to a typical PCR. Consequently the low level of target amplification relieves the interference between the individual reactions in the mixture and reduces the inhibition of PCR by means of its accumulation of its products, thus providing a more extensive multiplexing. Additionally, it is contemplated that low amplification levels reduce the likelihood of cross-contamination of the target and reduce the. number of mutations induced by PCR. The non-uniform amplification of different genetic sites presents one of the major challenges in the development of multiplexed PCR. The difference in the amplification factors between the genetic sites can result in a situation in which the signal generated by an NVIDER reaction with a slow amplification genetic site is below the detection limit of the assay., whereas the signal of the rapid amplification genetic site is beyond the saturation level of the assay. This problem can be attacked in different ways. In some modalities the I NVAD ER reactions can be read at different time points, for example in real time, thus significantly extending the detection range. In other modalities, multiplexer PCR can be performed under conditions that allow different genetic sites to reach more similar levels of amplification. For example, primer concentrations can be limited, thus allowing each genetic site to reach a more uniform level of amplification. In still other embodiments, the concentrations of PCR primers can be adjusted to balance the amplification factors of different genetic sites. The present invention provides the design and characteristics of highly multiplexer PCR including hundreds to thousands of products in a single reaction. For example, the preamplification of targets provided by the hundredplexora PCR reduces the amount of genomic DNA required for the formation of SNAP-based SNAP genotypes to less than 01 ng per assay. The particularities of highly multiplexing PCR optimization and a computer program for the design of the primer are described below. In addition to providing methods for highly multiplexer PCR, the present invention further provides methods for conducting objective amplification and signal reactions in a single reaction vessel without subsequent manipulations or additions of the reagent beyond the initial adjustment of the reaction. Some combined reactions are suitable for the quantitative analysis of limited amounts of target in very short reaction times.

The following description provides a preferred illustrative embodiment of the present invention and is not intended to limit the scope of the present invention. I. Design of primers with multiplexer PCR The NVADER I assay can be used for the detection of single nucleotide polymorphisms (SNPs) with up to 1 00-10 ng of genomic DNA without the need for target pre-amplification. However, with more than 50,000 developed NVADER assays and the potential for whole-genome association studies involving hundreds of thousands of SNPs, the amount of DNA in the sample becomes a limiting factor for large-scale analysis. Due to the sensitivity of the I NVADER assay in human genomic DNA (hgDNA) without target amplification, multiplexer PRC coupled with the INVADER assay only requires a limited amplification of the target (103-104) compared to typical multiplex PCR reactions that require amplification extensive (109-1012) for conventional gel detection methods. The low level of amplification of targets used for the INVADERtm detection provides a more extensive multiplexing avoiding the inhibition of amplification that commonly results from the accumulation of targets. The present invention provides methods and selection criteria that allow primer arrays to be generated for multiplexer PCR (eg, that can be coupled with a detection assay, such as the I NVADER assay). In some embodiments, the software applications of the present invention perform the selection of automatic multiplexer PCR primers, allowing highly multiplexed PCR with designed primers. Using the Medically Associated Panel (MAP) with I NVADER as a corresponding platform for SNP detection. As shown in example 2, the methods, software, and selection criteria of the present invention allow the formation of precise genotypes of 94 out of the possible 01 amplicons (-93%) from a single pCR reaction. The original PCR reaction uses only 1 0 ng of hgDNA as a template, corresponding to less than 150 pg hgDNA per I NVADER assay. The INVADER assay allows the simultaneous detection of two different alleles in the same reaction using an isothermal format of simple addition. The discrimination of alleles takes place by means of a "structure-specific" break in the probe, releasing a 5 'fin corresponding to a given polymorphism. In the second reaction, the released 5 'fin mediates signal generation by breaking the appropriate FRET cartridge. The creation of one of the primer pairs both a forward and reverse primer for a series of 1 01 primers from the sequences available for medically associated panel analysis of INVADER using a software application mode of the present invention includes a entry file of single-entry samples (for example, target sequence information for a single target sequence containing an SN P that the method and software of the present invention are processed). The target sequence information includes the S NP # of Third Wave Technologies, identifier cut name and sequence with the SNP location indicated in parentheses. The output file of the sample of a same input (for example shows the target sequence after being processed by the systems and methods and software of the present invention includes the sequence of the fingerprint region (uppercase letters flanking the SNP site, showing the region where the INVADER test probes hybridize in this target sequence in order to detect the SNP of the target sequence), the sequences of forward and reverse primers (in bold) and their corresponding Tms. the primers for making a series of primers capable of multiplexing PCR are performed automatically (for example by means of a software application) The automatic selection of multiplexer PCR primers can be achieved by employing a software program designed as shown in the flow chart in Figure 8. Multiplexer PCR commonly requires extensive optimization to avoid amplification. polarization of selected amplicons and the amplification of residual products resulting from the formation of dimeros primers. In order to avoid those problems, the present invention provides methods and software application that provides selection criteria for generating a set of primers configured for multiplexer PCR, and subsequent use in a detection assay (e.g., I NVADER detection assays). In some embodiments, the methods and software applications of the present invention begin with user defined sequences and corresponding SNP locations. In certain embodiments, the methods and the software application determine a fingerprint region within the target sequence (the minimum amplicon required for the detection of the I NVADER) for each sequence. The fingerprint region includes the region in which the test samples hybridize, as well as additional user-defined bases that extend outward (for example, 5 additional bases included on each side from where the test samples hybridize). Next, primers are designed outward from the fingerprint region and evaluated against several criteria, including the power for forming primer primers with the previously designed primers in the current multiplexing equipment. This process can be continued by means of multiple iterations of the same group of sequences until the primers can be designed against all the sequences in the current muitiplexing group. Once the set of primers is designed, multiplexer PCR can be performed for example under standard conditions using only 10 ng of hgDNA as a template. After 10 minutes at 95 ° C, Taq (2.5 units) can be added to 40 μl of reaction and the PCR performed for 50 cycles. The PCR reaction can be diluted and loaded directly onto an I NVADER MAP plate (3 ul / well). An additional 3 μl of 15 μM MgCl 2 can be added to each reaction on the INVADER MAP plate and covered with 6 μl of mineral oil. The whole plate can then be heated at 95 ° C for 5 minutes, and incubated at 63 ° C for 40 minutes. The FAM and RED flouorescence can then be measured in a Cytofluor 400 fluorescent plate reader and "Times above zero" (FOZ) values can be calculated for each amplicon. The results of each SNP can be color-coded in a table as "accepted" (green), "rejected" (pink), or "not accepted" (white) (See example 2 below). In some embodiments, the number of PCR reactions is from about 1 to about 10 reactions. In some embodiments, the number of PCR reactions is from about 10 to about 50 reactions. In other embodiments, the number of PCR reactions is from about 50 to about 1 00 reactions. In additional embodiments the number of PCR reactions is from about 1000 to about 1000 reactions. In other embodiments, the number of PCR reactions is greater than 1000. The present invention also provides methods for optimizing multiplexer PCR reactions (eg, once a series of primers has been generated, the concentration of each primer or pair of primers can be optimize). For example, once a series of primers has been generated and used in a multiplexer PCR at equimolar concentrations, the primers can be evaluated separately in such a way that a concentration of optimal primers is determined in such a way that the multiplexer primer series works better . Multiplexer PCR reactions are recognized in the scientific, research, clinical and biotechnology industries as potentially effective in time and less expensive means of obtaining nucleic acid information compared to standard monoplex PCR reactions. Instead of performing only a single amplification reaction per reaction vessel (tube or well in a multi-well plate for example), numerous amplification reactions are performed in a single reaction vessel. The cost per objective is theoretically reduced by eliminating the technical time in the preparation of the trial and in data analysis, and through the substantial savings of reagents (especially the cost of enzymes). Another benefit of the muitiplexing method is that less objective sampling is required. In whole-genome association studies involving hundreds of thousands of single nucleotide polymorphisms (SNPs), the amount of sample or test sample is limited for large-scale analysis, such that the concept of performing a single reaction, using a sample aliquot to obtain for example 1 00 results, using 1 00 sample aliquots to obtain the same group of data in an attractive option. To design primers for a successful multiplex PCR reaction, the problem of aberrant interactions between the primers must be taken into account. The formation of primer dimers, even if only a few bases in length, can inhibit both primers to correctly hybridize to the target sequence. In addition, if the dimers are formed at or near the 3 'ends of the primers, amplification or very low levels of amplification will not occur, since the 3' end is required for the priming event. Clearly, among more primers used for the multiplexer reaction, more interactions of aberrant primers are possible. The methods, systems and applications herein help to prevent primer dimeros in a large series of large-scale primer dimeros, making it suitable for highly multiplexed PCR. When primer pairs are designed for numerous sites (eg, 1000 sites in a multiplexer PCR reaction), the order in which the primer pairs are designed can influence the total number of pairs of compatible primers for a reaction. For example, if a first set of primers is designed for a first target region that turns out to be a target region rich in A / T, that primer will be rich in A / T. If the second objective region selected is also a target region rich in A / t, it is more likely that the primers designed for those two series will be incompatible due to aberrant interactions, such as the primer dimer. If, however, the second selected target region is not rich in A / T, it is more likely that a primer can be designed in such a way that it does not interact with the first A / T rich series. For any given group of target entry sequences, the present invention randomizes the order in which the sets of primers are designed (see Figure 8). In addition, in some embodiments, the present invention rearranges the series of target input sequences into a plurality of different random commands to maximize the number of sets of compatible primers for a given multiplexer reaction (see FIG. 8). The present invention provides criteria for the design of primers that minimizes 3 'interactions while maximizing the number of pairs of compatible primers for a given set of reaction targets in a multiplexer design. For the primers described as 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3 ', N [1 ] in an A or C (in alternative modes, N [1] or G or T). N [2] -N [1] of each of the designated direct and reverse primers must not be complementary to N [2] - N [1] of any other oligonucleotide. In certain modalities N [3] -N [2] - N [1] must not be complementary to N [3] -N [2] -N [1] of any other oligonucleotide. In preferred embodiments, if those criteria are not met with a given N [1], the next base in the 5 'direction for the forward primer or the next base in the 3' direction for the reverse primer may be evaluated as an N site. [1 ] . This process is repeated in conjunction with the object randomization, until the criteria for all, or a large majority of the target sequences are met (for example, 95% of the target sequences may have primer pairs made for the primer series which meet those criteria). Other challenges that must be overcome in a multiplexer primer design is the balance between the current restrictions of the required nucleotide sequence, the length of the sequence, and the melting temperature of the oligonucleotide. It is important since the primers in a series of multiplexer primers in a reaction must operate under the same reaction conditions of the buffer, the salts and temperatures therefore need to therefore have Tm substantially similar, despite the richness in GC or AT of the region of interest. The present invention allows for the design of primers that meets the minimum and maximum Tm requirements, and the minimum and maximum length requirements. For example in the formula for each primer 5'-N [x] -N [x -1] -... -N [4] -N [3] -N [2] -N [1] -3 \ x is selected such that the primer has a predetermined melting temperature (for example, bases in the primer until the primer has a calculated melting temperature of about 50 degrees celcius). Frequently the products of the PCR reaction are used as the target material for other nucleic acid detection means such as for hybridization type detection assays, or the I NVADER reaction assay. The location of the primer placement to allow the secondary reaction to occur successfully must be considered and again the aberrant interactions between the amplification primers and the secondary reaction oligonucleotides must be minimized to obtain accurate results and data. The selection criteria can be employed in such a way that the primers designed for the multiplexer primer series do not react (eg, hybridize with, or trigger reactions) with oligonucleotide compounds from a detection assay. For example, in order to prevent the primers from reacting with the FRET oligonucleotide of an I NVASOR bi-plexer assay, a certain homology criterion is employed. In particular if each of the primers in the series are defined as 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [ 1] -3 ', then -N [4] -N [3] -N [2] -N [1] -3' is selected such that it is less than 90% homologous with the FRET or I oligonucleotides NVADER. In other embodiments -N [4] -N [3] -N [2] -N [1] -3 'is selected for each primer such that it is less than 70% homologous with the FRET or I NVADER oligonucleotides. By employing the criteria of the present invention to develop a series of primers, some primer pairs may not meet all of the indicated criteria (these may be rejected as errors). For example, in a series of 100 objectives, 30 are designed and meet all the criteria listed, however the 31 fails. In the method of the present invention, the 31 of the series can be marked as failure and the method could continue through the list of 100 targets, again marking those series that do not meet the criteria (see figure 8). Once all the 1 00 target had their opportunity in the design of the primers, the method will notice the number of failed series, reorder the 1 00 targets in a new random order and repeat the entire design process (see figure 8) . After a configurable number of runs, the series with the most accepted pairs of primers (the series with the lowest number of faults) are selected for the multiplex PCR reaction (see figure 8). Figure 8 shows a flowchart with the basic flow of certain modalities of the methods and the software application of the present invention. In preferred embodiments, the processes detailed in Figure 8 are incorporated into a software application for ease of use (although, the methods can also be performed manually using for example Figure 8 as a guide). The sequences of targets and / or primer pairs are introduced into the system shown in Figure 8. The first group of boxes show how the target sequences are added to the list of sequences that have a certain footprint (see "B" in the figure 8), while other sequences are immediately accepted in the first source of primer sets (eg PDPass, those sequences that have been previously processed and shown to work together forming primer dimers or that have reactivity to the FRET sequences), as well as DimetTest entries (for example, pairs or primers that a user wishes to use but have not been provided even with respect to primer dimers or FRET reactivity). In other words, the initial group of boxes that lead to the "end of the entries" classify the sequences in such a way that they can subsequently be processed appropriately. Starting at "A" in Figure 8, the source of primers is basically cleared or "emptied" to start a new run. The target sequences are then sent to "B" to be processed, the DlmerTest pairs are sent to "C" to be processed. The target sequences are sent to "B", where a user or software application determines the fingerprint region for the target sequence (e.g. when the test probes will hybridize in order to detect the mutation (e.g., SNP) in the objective sequence). It is important to design this region that the user can subsequently expand by defining the additional bases beyond the hybridization region that is attached) in such a way that the primers that are designed fully encompass this region. In Figure 8, the I NVADER CREATOR software application is used to design the NAVADER oligonucleotide I and the downstream probes that will hybridize to the target region (although any type of system program could be used to create any type of probes that a user would be interested in designing probes, and thus determine the region of footprint in the target sequence). Thus the nucleus of the fingerprint region is thus defined by the location of those two test probes in the target. Then the piece system from the 5 'edge of the footprint and travel in the 5' direction until it reaches the first base or until the first A or C (or G or T) is reached: This is established as the point initial starting to define the sequence of the forward primer (that is, it serves as the initial site N [1]). From this initial site N [1], the sequence of the primer for the forward primer is the same as those bases found in the target region. For example, if the default size of the primer is set at 12 bases, the system starts with the bases selected as N [1] and then adds the following 1 1 bases found in the target sequences. This 12-mer primer is then tested with respect to the minimum and maximum melting temperature by default (e.g. about 50 degrees Celsius, and not more than 55 degrees Celsius). For example, the system uses the formula 5'-N [x] -N [x-1] -... -N [4] -N [3] -N [2] -N [1] -3 'and x is initially 12. Then the system adjusts xa to a larger number (eg longer sequences) until the predetermined melting temperature is found. In certain embodiments, a maximum primer size is used as the default parameter to serve as the upper limit on the length of designed primers. In some embodiments, the maximum primer size is about 30 bases (eg 29 bases, 20 bases or 31 bases). In other modes, the default settings (for example the minimum and maximum primer size, and the minimum and maximum Tm) are capable of being modified using the database manipulation tools.

The following box in Figure 8 is used to determine whether the primer that has been designed so far will cause primer dimer and / or FRET activity (for example with the other sequences already in the source). The criteria used for this determination are explained above. If the primer passes this stage, the forward primer is added to the source of primers. However, if the forward primer fails with these criteria as shown in Figure 8, the starting point (N [1] moves) a nucleotide in the 5 'direction (or the next A or C, or following G or T) ). The system first checks to ensure that the offset leaves enough space in the target sequence to successfully produce a primer. If so, the system returns and checks the melting temperature of this new primer. However, if a sequence can not be designed then the target sequence is marked as an error (for example, indicating that a direct primer can not be produced for this purpose). This same process is then repeated to design the reverse primer, as shown in Figure 8. If the reverse primer is successfully produced, then the pair of primers is placed in the primer source, and the system returns to "B" (if there are more target sequences to process) or go to "C" to test the DimerTest pairs. Starting at "C" in Figure 8 it is shown how the primer pairs that are introduced as primers (DimerTest) are processed by the system. If there are no pairs of DimerTest, as shown in Figure 8, the system goes to "D". However, if there are no DimerTest pairs, they are screened for primer dimers and / or FRET reactivity as described above. If the DimetTest pair does not meet these criteria, they are marked as errors. If the pair DimerTest passes the criteria, they are added to the source of the series of primers, and then the system returns to "C" if there are no more DimerTest pairs that need to be evaluated, or go to "D" if there are no more DimerTest pairs to evaluate. Starting at "D" in Figure 8, the source of primers that has been created is evaluated, the first step in this section is to examine the number of errors (faults) generated by this random sequence run. If there were no errors, this series would be the best one that could be presented to a user. If there are more than zero errors, the system compares this run to any previous run to see how much run resulted in fewer errors. If the current run has fewer errors, it is designed as the best current series. At this point the system can return to "A" to start the run with another random series of the same sequences, or the maximum predetermined number of runs (for example 5 runs) may have been reached in this run (for example this was the 5th run, and the maximum number of runs was fixed at 5). If the maximum has been reached then the best series is provided as the best series. This best set of primers can then be used to generate a physical array of oligonucleotides such that a multiplex PCR reaction can be performed. Another challenge to overcome with multiplex PCR reactions is the unequal concentrations of amplicons that result in a standard multiplexer reaction. The different genetic sites marked for amplification can each behave differently in the amplification reaction, giving very different concentrations of each of the different amplicon products. The present invention provides methods, systems, software applications, computer systems and computer data storage means that can be used to adjust the concentrations of primers with respect to the first read detection assay (for example the I NVADER assay read) , and then with balanced concentrations of primers approaching substantially equal concentrations of different amplicons. The concentrations of the different pairs of primers can be determined experimentally. In some modalities, a first run is conducted with all the primers in equimolar concentrations. Then readings of time are made. Based on the time readings, the amplification factors for each amplicon are determined. Then based on a unifying correction equation, an estimate of which concentration of primers should be obtained to obtain the closest signals within the same time point. These detection assays can be found in an array of different sizes (384-well plates). It is appreciated that by combining the invention with detection assays and detection assay arrays, substantial processing deficiencies are provided. Employing a balanced mixture of primers on pairs of primers created using the invention, a single-point reading can be performed in such a way that an average user can obtain high efficiency when performing tests that require high sensitivity and specificity through an array of different objectives. Having optimized the concentrations of primer pairs in a single reaction vessel allows the user to conduct the amplification for a plurality or multiplicity of amplification targets in a single reaction vessel and in a single step. The performance of the single-step process is then used to successfully obtain the test result data for example, several hundred trials. For example, each well in a 384-well plate may have a different detection test. The results in a PCR reaction has amplified 384 different genomic DNA targets and provides 384 test results for each plate. Where each plate has a plurality of tests, even greater efficiency can be obtained. Therefore, the present invention provides the use of the concentration of each series of primers in highly multiplexed PCR as a parameter to obtain a non-polarized amplification of each PCR product. Any PCR includes thermal fixation of primers and extension steps. Under standard PCR conditions, high primer concentrations in the order of 1 uM ensure rapid kinetics of the thermal binding of the primers while the optimal time for the primer extension stage depends on the size of the amplified product and may be increased. of the thermal fixation stage. By reducing the concentration of primers, the kinetics of thermal binding of primers can become a limiting step in the rate and the PCR amplification factor would strongly depend on the concentration of primers, the constant of the association rate of the primers and the time of thermal fixation. The link of the primer P with the objective T can be described by means of the following model: where ka is the constant of the association rate of the thermal fixation of the primer. We assume that thermal fixation occurs at temperatures below the fusion of primers and the reverse reaction can be ignored. The solution for this kinetics under the conditions of an excess primer is well known: where ["PT] is the concentration of the target molecules associated with the primer, T0 is the initial target concentration, c is the initial concentration of primers, and f is the time of thermal fixation of the primer Assuming that each target molecule associated with the primer is replicated to produce the full-length PCR product, the target amplification factor in a single PCR cycle is: The total PCR amplification factor after n cycles is given by F = _. * = 2 ~ -_ - * 1- '' (4) As can be seen from equation 4, under the conditions in which the kinetics of fixation The primer is the stage that limits the PCR rate, the amplification factor must depend strongly on the concentration of the primer. Thus, the amplification of polarized genetic sites, whether caused by individual association rate constants, primer extension steps or any other factor, can be corrected by adjusting the primer concentration for each primer series in the multiplexer PCR . Adjusted primer concentrations can also be used to correct the polarized performance of the INVADER assay used for the analysis of genetic preamplifier sites by PCR. Using this basic principle. The present invention has demonstrated a linear relationship between the efficiency of amplification and the concentration of primers and uses this equation to balance the primer concentrations of different amplicons, resulting in equal amplification of ten different amplicons in Example 1. This technique can be used in any size of series of multiplexer primer pairs. II. Design of the Detection Test The following section describes the detection assays that may be employed with the present invention. For example, many different assays can be used to determine the footprint in the target nucleic sequence and then used as the run of the multiplexed PCR exit test (or the detection assays can run simultaneously with the PCR reaction). multiplexer). There is a wide variety of detection technologies available to determine the sequence of a target nucleic acid in one or more places. For example, there are numerous technologies available to detect the presence or absence of SNP. Many of these techniques require the use of an oligonucleotide to hybridize to the target. Depending on the assay used, the oligonucleotide is broken, stretched, ligated, dissociated or altered in another way, its performance in the assay being monitored as a means to characterize the target nucleic acid sequence. Several of these technologies are described in detail in section IV, below. The present invention provides system and methods for the design of oligonucleotides for use in detection assays. In particular, the present invention provides systems and methods for the design of oligonucleotides that successfully hybridize to appropriate regions of target nucleic acids (e.g., target nucleic acid regions that do not contain secondary structure) under the desired reaction conditions (e.g. temperature, damping conditions, etc.) for the detection test. The systems and methods also allow for the design of multiple different oligonucleotides (eg, oligonucleotides that hybridize to different portions of a target nucleic acid or that hybridize to two or more different target nucleic acids) that all function in the detection assay under the same or substantially the same reaction conditions. These systems and methods can also be used to design control samples that work under experimental reaction conditions. While the systems and methods of the present invention are not limited to any particular detection assay, the following description illustrates the invention when used in conjunction with the NVADER I assay (Third Wave technologies, Madison, Wl; see for example North American patents). Nos. 5,846, 717, 5,985, 557, 5,994,069, and 6, 001, 567, PCT publications WO97 / 27214 and WO 98/42873, and Arruda et al, Expert. Rev. Mol. Diagn. 2 (5), 487-496 (2002), all of which are incorporated as a reference) to detect SNP. Essay INVADER provides levels of ease of use and sensitivity that when used in conjunction with the systems and methods of the present invention have their use in detection panels, ASR and clinical diagnostics. One skilled in the art will appreciate that the specific and general characteristics of this illustrative example are applicable to other detection tests generally. A. INVAD ER Assay The NVADER I Assay provides means for forming a nucleic acid cleavage structure that depends on the presence of a target nucleic acid and breaking the nucleic acid cleavage structure to release different breakdown products. The 5 'nuclease activity for example is used to break the target-dependent cleavage structures and the resulting breakdown products indicate the presence of a specific target nucleic acid sequence in the sample. When two strips of nucleic acid or oligonucleotides both hybridize to a strip of target n-nucleic acid such that they form an invasive burst structure overlap as described below, invasive rupture may occur. By means of the interaction of a cleavage agent (for example a 5 'nuclease) and the upstream oligonucleotide, the cleavage agent can be caused to break the oligonucleotide downstream at an internal site such that a distinctive fragment is produced. In some embodiments, the I NVADER assay provides detection assays in which the target nucleic acid is reused or recycled during multiple cycles of hybridization with oligonucleotide probes and probe cleavage without the need to use temperature cycles (this is for displacement). based on the polymerization of the target nucleic acid strips or probe). When a breakdown reaction is carried out under conditions in which the probes are replaced in the target strip (for example by means of the displacement between probes or by means of a balance between the probe / target association and dissociation, or by means of a combination comprising those mechanisms, (Reynaldo et al, J. Mol. Bioi 97: 51 1 -520 [2000]), multiple probes can hybridize to the same target, allowing multiple breaks, and the generation of multiple break products. Oligonucleotide designs for the INVADER assay In some embodiments in which the oligonucleotide is designed to be used in the INVADER assay to detect a SNP, the sequence (s) of interest are entered into the NVADERCREATOR program I (Third Wave technologies, Madison, Wl.) As described above, sequences can be entered for analysis from a number of sources, either directly on the computer hosting the INVADERCREATOR program, or by e a remote computer linked through a communication network (for example, a LAN, Intranet, or internet network). The program designs probes for the sense and antisense strip. The selection of bands is generally based on the ease of synthesis, the minimization of secondary structure formation, and the manufacturing capacity. In some modalities, the user selects the strip for the sequences that are going to be designed. In other modalities, the software automatically selects the strip. By incorporating thermodynamic parameters for optimal probe cycles and signal generation (Allawi and SantaLucia, Biochemistry, 36: 10581 [1 997]), oligonucleotide probes can be designed to operate at a preselected assay temperature (for example 63 ° C). Based on these criteria, a series of final probes is selected (for example the primary probes for 2 alleles and an oligonucleotide I NVADER) In some modalities the I NVADECREATOR system is a network-based program with access to a secure site containing a link to BLAST (available at the National Center for Biotechnology Information, National Library of Medicine, website of the National Institute of Health) and which can be linked to RNAstructure (Matthews et al, RNA 5. 1458 [1 999]) a software program that incorporates mfold (Zuker, Science, 244_48 [ 1989]). The RNAstructure tests the proposed oligonucleotide designs generated by INVADERCREATOR for the potentiation of uni- and bimolecular complexes. The I NVADERCREATOR complies with the open database connectivity (ODBC) and uses the Oracle database for export / integration. The INVADERCREATOR system was configured with Oracle to work well with the UN IX system, since most of the genomic centers are based on UNIX.

In some modalities the INVADERCREATOR analysis is provided in a separate server (for example a Sun server) in such a way that it can handle the analysis of large workloads. For example, a customer can send up to 2000 SNP sequences in an email. The server passes the batch of sequences to the INVADERCREATOR software and when it is initialized, the program designs the detection of the groups of the test oligonucleotides. In some modalities, the seríes designs of probes are returned to the user within 24 hours of the reception of the sequences. Each I NVADER reaction includes at least two unlabeled oligonucleotides specific to the target sequence for the primary reaction: an upstream NVADER oligonucleotide I and a downstream probe oligonucleotide. The INVADER oligonucleotide is generally designed to bind stably to the reaction temperature while the probe is designed to associate and disassociate freely with the target strip, with disruption occurring when an uncut probe is hybridized adjacent to an overlapping INVADER oligonucleotide. In some embodiments, the probe includes a 5 'fin or "arm" that is not complementary to the target, and this fin is released from the probe when the break occurs. In some embodiments, the released fin participates as an I NVADER oligonucleotides in a secondary reaction. The following description provides an example of how a user interface can be configured for an INVADERCREATOR program.

The user opens a work screen, for example by clicking on an icon on the screen of a computer desktop (for example, a Windows desktop). The user enters the information related to the target sequence for which a test must be designed. In some modalities the user enters an objective sequence. In other modalities, the user enters a code or number that produces the recovery of a sequence from a database. In yet another embodiment, additional information may be provided such as the user's name, the identification number associated with an objective sequence, and / or an order number. In preferred embodiments, the user indicates (for example by means of a box or drop-down menu) that the target nucleic acid is DNA or RNA. In other preferred embodiments, the user indicates the species from which the nucleic acid is derived. In particularly preferred embodiments, the user indicates whether the design is for monoplexora detection (this is an objective sequence or allele per reaction) or multiplexer (that is, multiple target sequences or alleles per reaction). When the requirements and entries are completed, the user begins with the analysis process. In a modality the user presses the button "Go Design It - Design it" to continue. In some modalities the software validates the time entries before advancing. In some modalities the software verifies that the required fields have been completed with the appropriate type of information. In other modalities, the software verifies that the input sequence complies with the selected requirements (for example minimum or maximum length, DNA or RNA content). If the entries in any entry are found to be invalid, an error message or dialog appears. In preferred embodiments, the error message indicates that the field is incomplete and / or incorrect. Once the sequence entry is verified the software proceeds to the trial design. In some modalities, the information supplied in the order entry fields specifies what type of design will be created. In preferred embodiments, the target sequence and the multiplexer marking box will specify what type of design to create. Design options include but are not limited to the SNP assay, multiplexed SNP assay (eg where the sample series for different alleles that are to be combined in a single reaction), the multiple SNP assays (for example, where an input sequence has multiple variation sites for which sample beings are going to be designed), and a multi-probe arm assay. In some modalities, the INVADERCREATOR software is initiated by means of a network order entry process (WebOE) (this is an intra / inernet browser interface) and those parameters are transferred from WebOW via applet tags <; param > , and they are not entered through menus or dialing boxes. In the case of multiple SNP designs, the user selects two or more designs with which to work. In some modalities this selection opens a new screen view (for example, multiple design selection view S NP). In some modalities the software creates designs for each genetic site in the target sequence, qualifies them and presents them to the user of this screen view. The user can then select any of the two designs to work with. In some modalities the user selects a first and second design (for example by means of a menu or buttons) and "Go Design It - Design it" to continue. To select a sequence of probes that has an optimal performance at a pre-selected reaction temperature, the melting temperature (Tm) of the SNP to be detected is calculated using the nearest neighbor model and the published parameters for the formation of DNA duplex (Allavi and SantaLucia, Bíochemistry, 36: 1 0581 [1 997]). In embodiments in which the target strip is RNA, appropriate parameters can be used for RNA / DNA heteroduplex formation. Because the concentrations of test salts are often different from the solution conditions in which the closest neighbor parameters were obtained (1 M NaCl and no divalent metals), and due to the presence and concentration of the enzyme they influence At the optimum reaction temperature, an adjustment must be made to the calculated Tm to determine the optimum temperature at which to perform a reaction. One way to compensate for these factors is to vary the value provided for the concentration of the salt within the calculations of the melting temperature. This adjustment is called a "salt correction". As used herein the term "salt correction" refers to a variation made in the value provided for a salt concentration for the purpose of reflecting the effect in a calculation of Tm for a nucleic acid duplex of a non-saline parameter or condition that affects the duplex. The variation of the values provided for the concentrations of the strip will also affect the result of those calculations. When using a value of NaCI O.5M (SantaLucia, Proc. Nati. Acad. Sci. USA. 95: 1460 [1998] and strip concentrations of approximately 1 mM from the probe and 1 fM objective, the algorithm used to calculate the melting temperature of The target probe has been adapted for use in the prediction of the optimal reaction temperature of the NVADER I test. probes, the average deviation between the optimal test temperatures calculated by this method and those experimentally determined is approximately 1.5 ° C. The length of the probe downstream at a given SNP is defined by the temperature selected to perform the reaction (for example 63 ° C). Starting from the position of! nucleotide variant in the Target DNA (the target base that is matched with the 5 'nucleotide of the probe from the intended cleavage site), and aggregated at the 3' end, an iterative procedure is used whereby the length of the target binding region The probe is increased by one base pair each time until the optimum calculated reaction temperature (Tm plus salt correction to compensate for the enzymatic effect) is reached that matches the desired reaction temperature. The non-complementary arm of the probe is preferably selected to allow the secondary reaction to cycle at the same reaction temperature. All oligonucleotide from the probe is screened using programs such as mfold (Zuker, Sciece, 244: 48 [1989]) or Oligo 5.0 (Rychlik and Rhoads, Nucleic Acids Res., 17: 8543 [1989]) for possible training of complexes dimers or secondary structures that could interfere with the reaction.

The same principles are also followed for the design of oligonucleotides I NVADER. Briefly, starting from the N position in the target DNA, the 3 'end of the INVADER oligonucleotide is designed to have a nucleotide non-complementary to any allele suspected of being contained in the sample to be tested. The mismatch does not adversely affect the rupture (Lyamichev et al., Narture Biotechnology, 1 7: 292 [199]), and may promote the probes' cycles, presumably by minimizing the effects of coaxial stabilization between the two probes. The additional residues complementary to the target DNA starting from the N-1 residue are then added in the 5 'direction until the stability of the oligomerotide-target hybrid I NVADER exceeds that of the probe (and therefore the reaction temperature of the planned assay) , generally 1-5-20 ° C. In one aspect of the assay design, all probe sequences can be selected to allow the primary and secondary reactions to be carried out at the same optimum temperature, such that the reaction steps they can be done simultaneously. In an alternative embodiment, the probes can be designed to operate at different optimal temperatures, so that the reaction stages are not simultaneously at their optimum temperatures. In some modalities, the software provides the user with the opportunity to change different aspects of the design including but not limited to the sound, the optimal temperature and the concentrations of the target oligonucleotide and I NVADER; blunder groups; probe arms; dyes, cover groups and other adducts; the individual bases of probes and targets (for example by adding or deleting bases from the ends of the targets and / or the probes, or changing the internal bases in the I NVASOR and / or the probe and / or the target oligonucleotides). In some modalities, they are carried out through the selection of a menu. In other modalities, changes are made in the text or dialogue boxes. In preferred modes, this option opens a new screen (for example a list in the Designer Worksheet - Designer Worksheet). In some modalities, the software provides a rating system to indicate the quality (for example, the possibility of performance) of the trial designs. In one modality the rating system includes an initial score of points (for example 100 points) where the initial score indicates an ideal design, and where the known or suspected design characteristics have an adverse effect on the performance of the test are the assigned penalty values. The penalty values may vary depending on the test parameters other than the sequences, including but not limited to the type of test for which the design is intended (eg, monoplexor, multiplexer) and the temperature at which the test will be conducted. of reaction. The following example provides an illustrative rating criterion to be used with some modalities of the I NVADER trial based on an intelligence defined by experimentation. Examples of design features that may incur qualifying penalties include but are not limited to the following [the penalty values are indicated in parentheses, the first number is for lower temperature tests (eg 62-64 ° C), secondly for higher temperature tests (eg 65-66 ° C)]: 1. [100: 100] 3 'end of the oligonucleotide INVADER resembles the probe arm: ARM SEQUENCE PENALITY GIVEN IF THE INVADER ENDS IN : Arm 1: CGCGCCGAGG 5..GAGGX or: 5..GAGGXX Arm ATGACGTGGCA0AC 5 \ _. CAGAC or 5..CAGACXX Arm 3 ACGGACGCGGAG 5, .GGAGX or 5..GGAGXX Arm 4; TCCGCGCGTCC 53 ... GTGCX c- 5..GTCCXX 2. [70:70] a probe extends 5 bases (this is 5 of the same bases in a row) that contains the polymorphisms: 3. [60:60] a probe extends 5 bases adjacent to the polymorphism; 4. [50:50] a probe extends 5 bases adjacent to the polymorphism; 5. [40:40] a probe extends 5 bases adjacent to the polymorphism; 6. [50:50] a probe extends 5 bases is G - additional penalty; 7. [100: 100] a probe extends 6 bases anywhere; 8. [90:90] a sequence of two or three bases repeats at least four times; 9. [100: 100] a degenerate base is presented in a probe; 10. [60:90] the hybridization region of the probe is short (13 bases or less for designs of 65-67 ° C, 12 bases or less for designs of 62-64 ° C) 11. [40:90] the hybridizing region of the probe is long (29 bases or more for designs of 65-67 ° C, 28 bases or more for designs of 62-64 ° C) 12. [5: 5] length of the hybridizing region of the probe - by base additional penalty 13. [80:80] Design I ns / Del with little discrimination in the first three bases after the probe arm 14. [1 00 : 1 00] Tm calculated for oligonucleotide I NVADER is within 7.5 ° C of the Tm of the sonar target (designs 65-67 ° C with oligonucleotide I NVADER is less than <70.5 ° C, designs 62-64 ° C with oligonucleotide INVADER> 69.5 ° C 1 5. [20:20] the Tm of the calculated probes differ by more than 2.0o C 16. [1 00: 1 00] a probe has a Tm calculated 2 ° C lower than its target Tm 17. [1 0: 1 0] the target of a strip is 8 bases longer than the other strip 1 8. [30:30] the oligonucleotide I NVADER has an extension of 6 bases anywhere - initial penalty 1 9. [70:70] the oligonucleotide I NVADER has an extension of 6 bases of G- additional penalty 20. [ 15: 1 5] hybridizing region of the probe is 14, 1 5, or 24-28 bases in length (65-67 ° C) or 13, 14, or 26.27 (62-64 ° C) 21. [15: 15] the probe has an extension e 4 bases of G that contain the polymorphism. In particularly preferred embodiments, the temperatures for each of the oligonucleotides are recomputed and the ratings are recomputed since changes are made. In some modalities the descriptions of the qualification can be observed by clicking on the "description" button. In some modalities, a BLAST search option is provided. In the preferred modalities, a BLAST search is performed by pressing a "BLAST Design" button. In some modalities this action produces a dialog box that describes the BLAST process. In the preferred modes, the search results are displayed as a highlighted design in a Designer Worksheet. In some modalities, a user accepts a design by pressing the "Accept-Accept" button. In other modalities the program approves a design without the intervention of a user. In the preferred modalities the program sends the approved design to the next stage of the process (for example in production, in a file or database). In some modalities, the program provides a screen view (for example, an Output Page), allowing the revision of the final design created and allowing the design to be annexed. In the preferred modalities, the user can return to the Designer Worksheet (for example by pressing the "Go Back - Return" button) or save the design (for example by pressing the "Save It" button) and continuing (for example to send the olinonucleotides designed for production). In some embodiments, the program provides an option to create a screen view of a design optimized for printing (for example, a text-only view) or another export (for example, an output view). In preferred embodiments, the exit view provides a description of the design particularly suitable for printing, or to export in another application (for example when copying and pasting into another application). In the particularly preferred embodiments, the exit view opens in a separate window. The present invention is not limited to the use of the INVADERCREATOR software. In fact, a variety of software programs are contemplated and commercially available, including but not limited to GCG Wisconsin Package (Genetics computer Group, Madison, WI) and Vector NTI (Informax, Rockville, Maryland). Other detection assays can be used in the present invention. 1. Direct sequencing assays In some embodiments of the present invention, variant sequences are detected using a direct sequencing technique. In those assays, the region of interest is cloned into an appropriate vector and amplified by growth in a host cell (e.g., a bacterium). In other embodiments, the DNA in the region of interest is amplified using PCR. After amplification of DNA in the region of interest (e.g., the region containing the SNP or the mutation of interest) it is sequenced using any suitable method, including but not limited to manual sequences using radioactive label nucleotides, or automated sequences. The results of the sequences are shown using any known method. The sequence is examined and the presence or absence of a given SNP or mutation determined. 2. PCR assay In some embodiments of the invention, variant sequences are detected using a PCR-based assay. In some embodiments, the PCR assay consists of the use of oligonucleotide primers that hybridize only to the variant or native type allele (e.g., to the region of polymorphism or mutation). Both sets of primers are used to amplify a DNA sample. If only the mutant primers result in a PCR product, then the patient has the mutant allele. If only native type primers are found in the PCR product, then the patient has the native type allele. 3. Fragment Length Polymorphism Assay In some embodiments of the present invention, variant sequences are detected using the fragment length polymorphism assay. In a fragment length polymorphism assay, a single DNA strand pattern based on the breakdown of DNA at a number of positions is generated using an enzyme (eg, a restriction enzyme or a CLEAVASE I enzyme [Third ave Technologies, Madison, Wl.] DNA fragments from a sample containing a SNP or a mutation will have a band-forming pattern different from the native type .. RFLP assay In some embodiments of the present invention, variant sequences are detected using a restriction fragment length polymorphism assay (EFLP) The region of interest is first isolated using PCR The PCR products are then disrupted with restriction enzymes of which a fragment with unique length is known to yield a given polymorphism. The PCT products digested with restriction enzymes are generally separated by means of gel electrophoresis and can be visualized by means of dyeing with bromide The length of the fragments is compared to the molecular weight markers and the fragments generated from the native and mutant type controls. b. FLP C assays In other modalities, variant sequences are detected using a CLAVASE fragment length polymorphism assay (CFLP; Third Wave Technologies; Madison Wi, see for example the American patents no. 5,843,654; 5,843, 669; 5,719,208 and ,888,780, each of which is incorporated as a reference. This essay is based on the observation that when simple strips of DNA fold in on themselves, assume higher order structures that are highly individual from the precise sequence of the DNA molecule. these secondary structures involve partially duplexed regions of DNA that these single-strip regions are juxtaposed with the double-stranded DNA hairpins. The enzyme CLEAVAS E I, is a thermostable nuclease, specific to the structure that recognizes and breaks the junctions between these regions of single strip and double strip. The region of interest is first isolated, for example using PCR: In preferred embodiments, one or both of the strips are labeled. Then, the DNA strips are separated by heating. The reactions are then cooled to allow the secondary structure to form between the strips. The PCR products are then treated with the CLEAVASE I enzyme to generate a series of fragments that are unique to a given SNP or mutation. The PCR products treated with the enzyme CLEAVASE are separated and detected (for example by means of denaturing gel electrophoresis) and visualized (for example, imaging or dyeing by autoradiography or fluorescence). The length of the fragments is compared to the molecular weight markers and the fragments generated from the native and mutant type controls. 4. Hybridization assays In preferred embodiments of the present invention, variant sequences are detected in a hybridization assay. In a hybridization assay, the presence or absence of a given SNP or mutation is determined based on the ability of the DNA of the sample to hybridize to the complementary DNA molecule (e.g., an oligonucleotide probe). There is a variety of hybridization assays that use a variety of technologies for hybridization and detection. A selection of essays is provided below. to. Direct Detection of Hybridization In some embodiments, hybridization of a probe to a sequence of interest (eg, a SNP or a probe) is detected directly when a bound probe is displayed (eg a Northern or Southern assay, see for example Ausabel et al. (eds), Current Protocols in Molecular Biology, John Wiley &Sons, NY [1991]). In one of these assays the genomic DNA (Southern) or genomic RNA (Northern) is isolated from the subject. The DNA or RNA is then broken up with a series of restriction enzymes that break up very rarely in the genome and not close to any of the assays being tested. The DNA or RNA is then separated (for example on an agarose gel) and transferred to a membrane. A probe or probes labeled (for example by incorporating a radionucleotide) specific for the SNP or the mutation being detected is allowed to contact the membrane under conditions of high, medium or low stringency. The unbound sample is removed and the presence of the link is detected by viewing the labeled probe. b. Detection of a Hybridization using "Chip" assays DNA "In some embodiments of the present invention variant sequences are detected using a DNA hybridization assay In this assay a series of oligonucleotide probes are fixed to a solid support.The oligonucleotide probes are designed to be runic for a SNP or The DNA samples are designed to be unique to a given SP or mutation.The DNA sample of interest is contracted with the DNA "chip" and hybridization is detected.In some embodiments, the chip assay of DNA is a GeneChip assay (Affymetrix, Santa Clara, CA, see for example U.S. Patent Nos. 6,045,996, 5,925,525 and 5,848,659, each of which is incorporated by reference.) GeneChip technology uses miniaturized high density arrays. of oligonucleotide probes attached to a "chip." Probe arrays are manufactured by means of a light-directed chemical synthesis process Affymetrix, which combines the chemical synthesis of solid phase with photolithographic manufacturing techniques in the semiconductor industry. Using a series of photo-lithographic masks to define the chip exposure sites, followed by means of specific chemical synthesis steps, the process builds arrays of high oligonucleotide density, each probe being in a predefined position in the array. The arrays of multiple probes are synthesized simultaneously in a large glass wafer. The wafers are then cut, and the individual probe arrays are packed in injection molded plastic cartridges that protect them from the environment and serve as chambers for hybridization. The nucleic acid to be analyzed is island, amplified by PCR and labeled with a fluorescent reporter group. The labeled DNA is then incubated with an array using a fluid station. The array is then inserted into the browser, where the hybridization patterns are detected. Hybridization data are collected as light emitted from fluorescent reporter groups already incorporated in the target, which binds to the probe array. Probes that perfectly match the target usually produce stronger signals than those that do not match. Since the sequence and position of each test in the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined. In other embodiments, a DNA microchip containing electronically captured probes (Nanogen, San Diergo, CA) is used (see for example patents Nos. 6, 017, 696).; 6, 068, 81 8; and 6,051, 380, each of which are incorporated by reference). Although the use of microelectronics, Nanogen technology allows the active movement and concentration of charged molecules to and from the designated test sites in their semiconductor microchip. The unique DNA capture probes for a given SNP or mutation are electronically placed on, or "routed" to, the specific sites on the microchip. Since DNA has a strong negative charge, it can move electronically to an area of positive charge. First a test site or a row of test sites on the microchip is electronically activated with a positive charge. Next, a solution containing DNA probes is introduced into the microchip. The negatively charged probes move rapidly to the positively charged sites, where they are concentrated and chemically linked to a site on the microchip. The microchip is then washed and another solution of different DNA probes is added until the array of specifically ligated DNA probes is complete. A test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize with the DNA in the test sample (for example a gene amplified by PCR of interest). An electronic charge is also used to move or concentrate the target molecules to one or more test sites in the microchip. The electronic concentration of the sample DNA at each test site promotes rapid hybridization of sample DNA with complementary capture tests (hybridization can occur in minutes). To remove the unbound or non-specific bound DNA from each site, the polarity or charge of the site is reversed negatively, thus forcing the unbound or nonspecifically bound DNA back into the solution away from the probes from capture. A laser based Ifuorescence scanner is used to detect the link.

In other embodiments, an arrangement technology based on fluid surface segregation (chip) is used for differences in surface tension (ProtoGene, Palo Alto, CA) (see U.S. Patents Nos. 6,001, 31 1; 4,985,551). and 5,474, 796, each of which is incorporated by reference). The technology of Portogene is based on the fact that fluids can be segregated on a flat surface by means of differences in the surface tension that has been imparted by means of chemical coatings. Once secreted oligonucleotide probes are synthesized directly on the chip by means of inkjet printing of the reagents. The arrangement with its reaction sites defined by means of surface tension is mounted in a X / Y translation stage under a group of four piezoelectric nozzles one for each of the four standard DNA bases. The translation stage moves along each of the rows of the array and the appropriate reagent is supplied to each reaction site. For example, amidite A is only supplied to sites where amidite A must be coupled during the synthesis stage and so on. Common reagents and washes are supplied by flooding the entire surface and then removing them by centrifugation. The unique DNA probes for the SNP or mutation of interest are fixed to the chip using Protogene technology. The chip is then contacted with genes amplified by PCR of interest. After hybridization, the unbound DNA is then removed and hybridization is detected using any suitable method (for example by means of fluorescence quenching of a fluorescent group).

In other embodiments, a "granulate array" is used for the detection of polymorphisms (Illumina, San Diego, CA, see for example PCT publications WO 99/67641 and WO 00 39587, each of which is incorporated by reference) lllumina uses a BEAD ARRAY technology that combines fiber optic bundles and granules to self-assemble in the array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the beam. The granules are coated with a specific oligonucleotide for the detection of a given SNP or mutation. The batches of granules are combined to form a specific source to the arrangement. To perform a test, the BEAD ARRAY is contacted with a sample prepared from the subject (eg DNA). Hybridization is detected using any suitable method. c. Enzymatic Hybridization Detection In some embodiments of the present invention, hybridization is detected by means of enzymatic cleavage of specific structures (INVADER assay, Third Wave technologies, Madison, Wl; see for example U.S. Pat. Nos. 5, 846, 717, 6,001, 567, 5,985,557 and 5,994,069, each of which is incorporated by reference). The INVADER assay detects specific DNA and RNA sequences using structure-specific enzymes to break a complex formed by the hybridization of overlapping oligonucleotide probes. The elevated temperature and the exceedance of one of the samples allows several probes to be broken for each target sequence present without temperature cycles. Those broken probes then direct the rupture of a second labeled probe. The oligonucleotide of the secondary probe may be labeled at the 5 'end with a fluorescent dye that is quenched by means of a second dye or other smothering portion. After rupture, the product labeled with de-inked dye can be detected using a standard fluorescence plate reader or an instrument configured to collect fluorescence data during the course of a reaction (this is the "real-time" fluorescence detector, such as an ABI 7700 Sequence detection System, Applied Biosustems, Foster City, CA). The I NVADER assay detects specific mutations and SPN in the unamplified genomic DNA. In one embodiment of the INVADER assay used to detect SNP in genomic DNA, two oligonucleotides (a specific primer probe for either a SNP / mutation or a native-type sequence and an NVADER oligonucleotide 1) hybridize in series to the genomic DNA to form an overlapping structure and break the primary probe. In a secondary reaction the broken primary probe combines with a secondary probe labeled fluorescence to create another overlapping structure that is broken by the enzyme. The initial and secondary reactions can be performed concurrently in the same container. The rupture of the secondary probe is detected by using a fluorescence detector, as described above. The signal of the test sample can be compared to known positive and negative controls. In some embodiments, hybridization of the ligated sample is detected using a TaqMan assay (PE Biosystems, Foster City, CA; see for example the American patents nos. 5,962,233 and 5,538,848, each one is incorporated as reference). The assay is performed during a PCR reaction. The TaqMan assay exploits the 5'-3 'exonuclease activity of DNA polymerase polymerases such as AMPLITAQ DNA polymerase. A probe, specific for a given allele or mutation, is included in the PCR reaction. The probe consists of an oligonucleotide with a 5 'reporter dye (for example a fluorescent dye) and a 3' quenching dye. During PCR, if the probe binds to or targets the 5'-3 'nucleolytic activity of the MAPLITAQ polymerase breaks the probe between the reporter and the smothering dye. The separation of the reporter dye from the smothering dye results in an increase in fluorescence. The signal accumulates with each PCR cycle and can be monitored with a flow meter. In still other embodiments, polymorphisms are detected using the SNP-iT primer extension assay (Orchid biosciences, Princeton, NJ, see for example U.S. Patent Nos. 5,952, 1 74 and 5, 91 9, 626, each of which is incorporated as a reference). In this assay, SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA strand via a base at the site where SNP is suspected. The DNA in the region of interest is amplified and denatured. The polymerase reactions are then performed using miniature systems called microfluidics. Detection is achieved by adding a label to the oligonucleotide which is suspected to be in the S NP or processing site. Incorporation of the label into the DNA can be detected by any suitable method (for example, if the nucleotide contains a biotin label, detection is made through a fluorescently labeled antibody specific for biotin. User Interfaces Sequences can be entered for analysis from a number of sources.In many modalities, sequence information is entered into a computer.The computer does not need to be the same computer system that performs the analyzes in silicon. preferred modalities the candidate target sequences can be entered into a computer linked to a communication network (for example the area of local network, intranet or internet) In these modalities users anywhere in the world with access to the communication network ( for example a user interface based on the global network www) that contains input fields a for the information required by the silicon analysis (for example the sequence of the candidate target sequence). The use of a user interface based on the network has several advantages. For example, by providing an auxiliary input wizard, the user interface can ensure that the user enters the required amount of information in the correct format. In some embodiments, the user interface requires that the sequence information for an objective sequence covers a minimum length (for example 20 or more, 50 or more, 1 00 or more nucleotides) and may have a simple format (for example FASTA) . In other embodiments, the information may be entered in any format and the systems and methods of the present invention edit or alter the input information in a manner suitable for analysis. For example, if an input target sequence is too short, the systems and methods of the present invention search public databases for the short sequence, and if a single sequence is identified, it converts the short sequence into an appropriately long sequence. add nucleotides in one or both of the ends of the target entry sequence. Similarly, if the sequence information is entered in an undesirable format or containing strange characters, without sequence, the sequence can be modified to a standard format (for example FASTA) before the subsequent silicon analysis. The user interface may also collect information about the user, including but not limited to the user's name and address. In some embodiments, the entries in the target sequence are associated with an identification code. In some modalities the sequences are entered directly from the trial design software (for example the I NVADERCREATOR software). In the preferred embodiments, each sequence is given an ID number. The ID number is linked to the target sequence that is being analyzed to avoid duplicate analyzes. For example, if the analysis of silicon determines that an objective sequence corresponding to the input sequence has already been analyzed, the user is informed and given the option of avoiding a silicon analysis and simply receiving the previously obtained results. Systems and Methods ordered by the Internet Users who wish to order detection tests, have designated detection tests, or have access to databases or other information of the present invention can use an electronic communication system (for example, the Internet). In some embodiments, a system for ordering and information of the present invention is connected to a public network to allow any user to have access to the information. In some modalities, private electronic communication networks are provided. For example, when a customer or user is a repeat customer (for example a distributor or a diagnostic laboratory) the full-time dedicated private connection can be provided between a customer's computer system and the computer system of the system of the present invention. . The system can be arranged to minimize human interaction. For example, in some modalities the inventory control software is used to monitor the number and type of detection tests in the possession of the client. A request is sent at defined intervals to determine whether the customer has the appropriate number and type of screening tests, if inventory shortcomings are detected, instructions are issued to design, produce and / or provide additional testing to customers. In some modalities, the system also monitors the seller's levels and in preferred modalities, they are integrated with the production systems to manage the capacity and production time. In some modalities, a user-friendly interface is provided to facilitate the selection and ordering of detection tests. Because hundreds of thousands of available detection assays and / or polymorphisms that the user may wish to investigate, the user-friendly interface allows navigation through the complex array of options. For example, in some modalities, a series of stacked databases to guide users to the desired products. In some embodiments, the first layer provides a representation of all the chromosomes of an organism. The user selects the chromosome (s) of interest. The selection of the chromosomes provides a more detailed map of the chromosome, indicating regions of band formation on the chromosome. The selection of the desired bands leads to a map showing the placement of the genes. One or more additional layers of details provide polymorphism positions, gene names, genome database identification tags, annotations, regions of the chromosome with pre-existing developed detection assays that are available for purchase, regions where there are no pre-existing developed tests but they are available for their design and production, etc. The selection of a region, the polymorphism or detection test takes the user to a sorting interface, where the information is collected to initiate the design and / or order of the detection test. In some modalities, a search engine is provided, in which the name of a gene, the sequence rank, polymorphism or other requests are sent to direct the user more immediately to the appropriate stratum of information. In some modalities, the order, design and production of production systems are integrated into a finance system, where the price of the detection test is determined by one or more factors; Whether or not the design is required, the cost of the roasted items in the components in the screening test, the special discounts for certain customers, the discounts for bulk os, discounts for second os, price increases or when the product is covered by intellectual property obligations or contractual payments to third parties and price selection based on use. For example, when screening tests are used for clinical diagnostics or certified for this and not for research applications, the price increases. In some modalities, the price increase for clinical products takes place automatically. For example in some embodiments the systems of the present invention are linked to the FDA database, public publication or other databases to determine whether their product has been certified for clinical diagnosis or ASR use. EXAMPLES The following examples are provided for the purpose of demonstrating and subsequently illustrating certain preferred embodiments and aspects of the present invention and are not intended to limit its scope. In the experimental description that follows, the following abbreviations apply: N (normal); M (molar), MM (millimolar), μm (micromoiar), Mol (moles), mmol (millimoles); μmol (micromoles); nmol (nanomoles); pmol (picomoles), g (grams); mg (milligrams); μg (micrograms); ng (nanograms); 1 or L (liters); ml (milliliters); μl (microliters); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); SD (dextran sulfate); C (degrees Celsius), and Sigma (Sigma Chemical Co., St. Louis, MO). EXAMPLE 1 DESIGN OF A 10-PLEXOR (MAN UAL): TEST OF INVADER TESTS The following experimental example describes the manual design of the amplification primers for a multiplexing amplification reaction, and the subsequent detection of the amplicons by means of the INVADER assay. . Ten target sequences were selected from a series of pre-validated SNP-containing sequences, available in an internal oligonucleotide database TWT. Each target contains a single nucleotide polymorphism (SNP) to which an I NVADER assay has been previously designed. The INVADER test oligonucleotides were designed by means of the I NVADERCREATOR software (Third Wave technologies, Madison, Wl). so the trace region in this example is defined as the "footprint" INVADER, or the bases covered by the I NVADER oligonucleotides and the probe, optimally placed for the detection of the base of interest, in this case a single polymorphism of nucleotide. Approximately 200 nucleotides from each of the 10 sequences were analyzed for design analysis of the amplification primers, the base SNP being approximately at the center of the sequence. The maximum and minimum probe length criteria were defined (normal is 30 and 1 2 nucleotides respectively), as well as a range for the Tm probe melting temperature of 50-60 ° C. In this example, to select A probe sequence that will perform optimally at a pre-selected reaction temperature, the melting temperature (Tm) of the oligonucleotide is calculated using the nearest neighbor model and the published parameters for the DNA duplex formation (Allawi and SantaLucia, Bíochemistry, 36: 1 0581 [1997], incorporated by reference). Because the salt concentration of the test is often different from the solution conditions in which the parameters of the nearest neighbor (1 M NaCl and no divalent metal) were obtained, and because the presence and concentration of the enzyme influences the optimal reaction temperature, and the adjustment must be made at the calculated Tm to determine the optimum temperature at which the pressure should be made. One way to compensate for these factors is to vary the value provided for the concentration of salt within the calculations of the melting temperature. This setting is called "salt correction". The term "salt correction" refers to a variation made in the value provided for a salt concentration for the purpose of reflecting the effect in a calculation of Tm for a nucleic acid duplex of a non-saline parameter or condition affecting the duplex. The variation of the values provided for the concentrations of the strip will also affect the result of those calculations. When using a value of NaCI 2.8 nM (SantaLucia, Proc. Nati Acad. Sci. USA. 95: 1460 [1998] and strip concentrations of approximately 10 pM of the probe and target 1fM, the algorithm used to calculate the melting temperature of the target probe has been adapted for use in the prediction of primer design sequences. optimal. Next, the sequence adjacent to the footprint region was scanned, both downstream and upstream and the first A or C was selected for the start of the design in such a way that the primers described as N [x] -N [x -1] -... -N [4] -N [3] -N [2] -N [1] -3 ', where N [1] must be A or C. Complementarity of the primers was avoided using the rule that N [2] -N [1] of a given oligonucleotide primer is not complementary to N [2] -N [1] of another oligonucleotide and N [3] -N [2] -N [1] it must not be complementary to N [3] -N [2] -N [1] of any other oligonucleotide. If those criteria are not met with a given N [1], the next base at the 5 'address for the forward primer or the next base at the 3' direction for the reverse primer will be evaluated as an N site [1]. In the case of manual analysis, regions rich in A / C were marked in order to minimize the complementarity of the 3 'ends. In this example, an INVADER assay was performed following the multiplexer amplification reactions. Therefore, a section of the oligonucleotide of the secondary I NVADER reaction (the oligonucleotide sequence FGRET) is also incorporated as a criterion for the design of the primer; the sequence of the amplification primer must be less than 80% homologous to the specified region of an FRET oligonucleotide. All primers were synthesized according to the standard chemistry of the oligonucleotides, desalted (by means of standard methods) and quantified by means of absorbance at A260 and diluted to a concentrated 50 μM broth. M ultiplexer PCR was performed using 1-plexer PCR using primer amounts (0.01 uM / primer) under the following conditions; 100 mM KCl, 3 mM MgCl 2, 10 mM tris pH 8.0, 200 uM dNTP, 2. U DNA polymerase Taq, and 1 0 ng human genomic DNA template (hgDNA) in 50 ul reaction. The reaction was incubated for 30 cycles (94C / 30 seconds, 50C / 44 seconds). After incubation, the multiplexer PCR reaction was diluted 1: 10 with water and subjected to I NVADER analysis using FRET detection plates for the INVADER assay, 96-well genomic biplex, 100 ng of CLEAVASE VI II enzyme, the I NVADER assays were assembled as 1 5 ul reactions as follows; 1 ul of the 1: 1 dilution of the PCR reaction, 3 ul of PPI mixture, 5 ul of 22.5 mM MgCl2, 6 ul of dH20, covered with 1.5 ul of liquid wax CH I LLOUT. The samples were denatured in the INVADER biplex by incubation at 95 ° C for 5 minutes, followed by incubation at 63 ° C and fluorescence measured on a Cytofluor 4000 at various times. Using the following criteria to make accurate genotypic calls (FOZ-FAM + FOZ_RED-2> 0.6) only 2 of 1 0 I NVADER test calls can be made after 10 minutes of incubation at 63 ° C, and only 5 of the 1 0 calls could be made following 50 additional minutes of incubation at 63 ° C (60 minutes). At the 60-minute time point, the variation between the detectable FOZ values is more than 100 times between the strongest signal (41646, FOZ-FAM + FOZ_RED-2 = 54.2, which is also far outside the dynamic range). of the reader) and the weakest signal (67356, FOZ-FAM + FOZ_RED-2 = 0.2). Using the same INVADER assays directly against 100 ng of human genomic DNA (where equimolar amounts of each target were available), all readings could be performed in the dynamic range of the reader and the variation in the FOZ values was approximately seven times among the most intense (53530, FOZ-FAM + FOZ_RED-2 = 3.1) and the weakest (53530, FOZ-FAM + FOZ_RED-2 = 0.43) of the trials. This suggests that the dramatic discrepancies in the FOZ values seen between the different amplicons in the same multiplex PCR reactions in a polarized amplification function, and not the variability attributable to the I NVADER assay. Under these conditions, the FOZ values generated by the different I NVADER tests are directly comparable to each other and can be used reliably as indicators of the efficiency of the amplification. Estimation of the amplification factor of a given amplicon using Foz values. In order to estimate the amplification factor (F) of a given amplicon, the FOZ values of the I NVADER assay can be used to estimate the abundance of amplicons. The FOZ of a given amplicon with unknown concentrations at a given time (FOZm) can be compared to the FOZ of a known amount of the target (eg 100 ng of genomic DNA = 30,000 copies of a single gene) at a defined point in time (FOZ24o, 240 min) and are used to calculate the number of copies of the unknown amplicon. In equation 1, FOZm represents the sum of RED_FOZ and FAM_FOZ of an unknown target concentration incubated in an I NVADER assay for a certain amount of time (m). FOZ24o, represents an empirically determined value of RED_FOZ (using the I NVADER 41646 assay), using a known amount of target copy (100 ng of hgADN - 30,000 copies) for 240 minutes.

F = ((FOZm-1) * 500 / (FOZ240-1) * (240 / m)? 2 (equation 1 a) Although equation 1 a is used to determine the linear relationship between the concentration of primers and the factor of F amplification, equation 1 a 'is used in the calculation of the amplification factor for the 10-plexer PCR (both with equimolar amounts of primer and optimized concentrations of the primer), with the value of D representing the dilution factor of the reaction PCR In the case of a 1: 3 dilution of 50 ul of the multiplexer PCR reaction, D = 0.3333.F = ((FOZm-2) * 500 / (FOZ240-1) * (240 / m)? 2 (equation 1 a ') Although equations 1 a and 1 a' would be used in the description of the 1 0-plexor multiplexer PCR, a more correct adaptation of this equation was used in the optimization of the primer concentrations in the 1 07-plexor PCR In this case, FOZ240- average of FAM_ FOZ240 + RED_ FOZ240 during the entire plate of I NVADER MAP using hgDNA as target FOZ240 = 3A2) and the dilution factor D is set to 0.12 5. F = ((FOZm-2) * 500 / (FOZ240-2) * D) * (240 / m)? 2 (equation 1 b) It should be noted that in order for the estimation of the amplification factor F to be more accurate, the FOZ values must be within the dynamic range of the instrument in which the readings are taken. In the case that Cytofluor 4000 is used in this study, the dynamic range is between approximately 1.5 and 12 FOZ. Section 3. Linear relationship between the amplification factor and the primer concentration In order to determine the ratio between the concentration of the primer and the amplification factor (F), four different uniplex PCR reactions were used using the primers 1 1 17-70 -17 and 1 1 17-70-18 at concentrations of 0.01 uM 0.01 2 uM, 0.014 uM, 0.020 uM respectively. The four independent PCR reactions were performed under the following conditions; 100 mM KCl, 3 mM MgCl, 1 0 m, M Tri pH 8.0, 200 uM dNTP using 10 ng of hgDNA as template. Incubation was performed at (94 ° C / 30 seconds, 50 ° C / 20 seconds) for 30 cycles. After PCR, the reactions were diluted to 1: 10 with water and run under standard conditions using FRET detection plates for the NVADER I assay, 96-well genomic biplex, 100 ng of CLEAVASE VI H enzyme. Each 1 5 ul reaction were shaped as follows; 1 ul of the 1: 1 dilution of the PCR reaction, 3 ul of PPI SNP # 47932 mixture, 5 ul of 22.5 mM MgCl2, 6 ul of water, covered with 1.5 ul of CHILLOUT liquid wax. The entire plate was incubated at 95 ° C for 5 minutes, followed by incubation at 63 ° C for 50 minutes and a single reading was taken on a Cytofluor 4000 fluorescent plate reader. For each of the four different concentrations of primer ( 0.01 uM, 0.012 uM, 0.014 uM, 0.020 uM) the amplification factor F was calculated using equation 1 a, with FOZm = ia the sum of FOZ_FAM and FOZ_RED at 50 minutes, n = 60, and FOZ240 = 1 .7. When plotting the primer concentration of each reaction against the logarithm of the amplification factor Log (F), a strong linear relationship was observed. Using these data points, the formula describes the linear relationship between the amplification factor and the primer concentration described in equation 2: Y = 1.84X + 2.6837 (equation 2a) Using equation 2, the amplification factor of a given amplicon Log (F) = Y could be manipulated predictably using a known concentration of primer (2). In a contrary manner, the amplification polarization observed under conditions of equimolar primer concentrations in the multiplexer PCR, could be measured as the "apparent" primer condition (X) based on the amplification factor F. In the multiplexer PCR the concentration of "apparent" primer between the different amplicons can be used to estimate the amount of primer of each amplicon required to equalize the amplification of different genetic sites: X = (Y-2.6837) / 1 .68 (equation 2b) Section 4. Calculation of Primer Concentrations Evident of a Mixed Multiplexer Mix. As described in the previous section, the concentration of creators can influence the amplification factor of a given amplicon. Under conditions of equimolar amounts of primers, the FOZm readings can be used to calculate the "apparent" primer concentration of each amplicon using equation 2. Replacing Y in equation 2 with log (F) of a given amplification factor and solving for X, an "apparent" primer concentration is obtained based on the relative abundance of all primers (provided in an equimolar concentration) in a multiplexer reaction, provides means to normalize the set of primers with each other. In order to derive the relative amounts of each primer that must be added to a mixture of "optimized" multiplexer primers R, each of the "apparent" primer concentrations must be divided into the highest concentration of apparent primers (Xma?), such that the strongest amplicon is adjusted to a value of 1 and the remaining amplicons to values equal to or greater than 1 R [N] = Xmax / X [n] (equation 3) Using the values of R { n] as an arbitrary value of the relative primer concentration, the values of R [n] are multiplied by a constant primer concentration to provide working concentrations for each primer in a given multiplexing reaction. In the example shown, the amplicon corresponding to the SNP 41646 test has a value of R { n] of 41646 which is set at 1 or 0.01 uM. The remaining sets of primers also increased proportionally. The multiplexer PCR results with the "optimized" primer mixture are described below. Section 5 Use of Optimized Concentrations of Primers in Multiplexer PCR, Variation in FOZ Among 10 INVADER Assays Are Largely Reduced Multiplexer PCR was performed using 1-plexer PCR using different amounts of primers based on the volumes (X [max] was SNP41646 , setting 1 x = 0.01 uM / primer). Multiplexer PCR was performed under conditions identical to those used with the equimolar primer mixture; 1 00 mM KCl, 3mM MgCl, 10m, M Tri pH 8.0, 200 uM dNTP, 2.5 U taq, and 10 ng of hgDNA as template in a 50 ul reaction. The reaction was incubated at (94 ° C / 30 seconds, 50 ° C / 44 seconds) for 30 cycles. After incubation, the muitiplexer PCR reaction was diluted to 1: 1 0 with water and subjected to I NVADER analysis. Using FRET detection plates for the I NVADER assay, (96-well genomic biplex, 1 00 ng of CLEAVASE VI H enzyme), the reactions were assembled as 1 5 ul reaction as follows; 1 ul of the 1: 1 dilution of the PCR reaction, 3 ul of suitable PPI mixture, 5 ul of 22.5 mM MgCl2, 6 ul of H2O. To each well, 15 ul of CHI LLOUT liquid wax was added, followed by the incubation at 95 ° C for 5 minutes, the plates were incubated at 63 ° C and the fluorescence was measured in a Cytofluor 4000 for 10 minutes. Using the following criteria to form cell genotypes (FOZ-FAM + FOZ_RED-2> 0.6) 10 out of 10 INVADER assay calls can be made after 10 minutes of incubation at 63 ° C. In addition, the values of FAM + RED- 2 (an indicator of the general signal generation directly related to the amplification factor (see equation 2)) varied by less than seven times the smaller signal (67325, FAM + RED-2 = 0.7) and the greater one (47892, FAM + RED-2 = 4.3).

Using the TWT internal oligonucleotide database, 144 sequences less than 200 nucleotides in length were obtained, with the SN P indicated using parentheses to indicate the position of SNP for each sequence (for example NNNNNNNN [N (WT. / N ( MT. NNNNNN), In order to expand the sequence data flanking the SMP of interest, they expanded to approximately 1 kB in length (500 nts flanking each side of the SNP) using BLAST analysis. they could not be expanded by means of BLAST, resulting in a final series of 128 sequences expanded to approximately 1 kB in length.These expanded sequences were provided to the user in Exel format with the following information for each sequence: (1) TWT number, (2) Short name identifier, and (3) sequence.The excel file was converted to a comma delimited format and is used as the input file for the web designer software. I NVADER REATOR v1 .3.3. , (its version of the program does not explore the FRET reactivity of the primers, nor does it allow the user to specify the maximum length of the primer). The primer designer I NVADER CREATOR v.1 .3.3 was run using normal conditions (for example a minimum primer size of 12, maximum of 30), with the exception of Tm? Or which was set at 60 ° C. The output file contained 128 sets of primers (256 primers, four of which were discarded due to excessively long primer sequences (SNP # 47854, 47889, 54874, 67496), leaving 124 sets of primers (248 primers) available for synthesis The remaining primers were synthesized using standard procedures on the 200 nmol scale and purified by desalting After synthesis failures 1 07 sets of primers were available for assembly of an equimolar 107-plexer primer mixture (214). primers) Of the 107 series of primers available for amplification, only 101 were present in the NVADER MAP plate I to evaluate the amplification factor Multiplexer PCR was performed using PCR 101 -p lexora using equimolar amounts (0.025 uM / primers) under the following conditions: 1 00 mM KCl, 3 mM MgCl, 10 m, M Tri pH 8.0, 200 uM dNTP, 2.5 U taq, and 10 ng of hgDNA as template in a reaction of 50 ul. After denaturation at 95 ° C for 10 minutes, 2.5 units of Taq were added and the reaction was incubated for (94 ° C / 30 seconds, 50 ° C / 44 sec), for 50 cycles. After incubation, the multiplexer PCR reaction was diluted 1: 24 with water and subjected to the INVADER assay analysis using the NVADER MAP detection platform. Each I NVADER MAP assay was run as a 6 ul reaction in the following manner; 3 ul of the 1: 24 dilution of the PCR reaction (total dilution 1: 8 equal to D = 0.125), 3 ul of 15 mM MgCl2 covered with 6 ul of CHI LLOUT. The samples were denatured in NVADER MAP plate I by incubation at 95 ° C for 5 minutes, followed by incubation at 63 ° C and fluorescence was measured in a Cytofluor 4000 (reader of 384 wells) at various time points during 1 60 minutes. The analysis of the FOZ values calculated at 10, 20,40,70,70, 160 min, shows the correct calls (in comparison with the genomic calls of the same DNA sample) can be made for 94 of the 01 detectable amplicons by means of the platform I NVADER AP. This provides proof that the NVADER CREATOR I primer designer software can create sets of primers that work in highly multiplexer PCR. By using the FOZ values obtained by means of the 160-minute time course, the amplification factor F and R [n] were calculated for each of the 1-amps. R [nmax] was fixed at 1.6, although lower end corrections were made for amplicons that did not provide a sufficient FOZm signal at 1 60 minutes, assigning an arbitrary value of 1 2 for R [n]. High end corrections for amplicons whose FOZm values in the 10 minute reading, an arbitrary value of 1 was assigned. The optimized primer concentrations of the 01 -plexora were calculated using the basic principles indicated in Example 1 0-plexer and equation 1 b, with an R [n] of 1 corresponding to a 0.025 uM primer (see figure 145). for different primer concentrations). Multiplexer PCR was performed under the following conditions 1 00 mM KCl, 3 mM MgCl, 1 0 m, M Tri pH 8.0, 200 uM dNTP, 2.5 U taq, and 10 ng of hgDNA as template in a 50 ul reaction. After denaturation at 95 ° C for 10 minutes, 2.5 units of Taq were added and the reaction was incubated for (94 ° C / 30 seconds, 50 ° C / 44 sec), for 50 cycles. After incubation, the multiplexer PCR reaction was diluted with water 1: 24 and subjected to the INVADER assay analysis using the NVADER MAP detection platform. Each I NVADER MAP assay was run as a 6 ul reaction in the following way; 3 ul of the 1: 24 dilution of the PCR reaction (total dilution 1: 8 equal to D = 0.125), 3 ul of 15 mM MgCl 2 covered with 6 ul of CHILLOUT. The samples were denatured in NVADER MAP plate I by incubation at 95 ° C for 5 minutes, followed by incubation at 63 ° C and fluorescence was measured in a Cytofluor 4000 (reader of 384 wells) at various time points during 1 60 minutes. The analysis of FOZ values calculated at 1 0, 20, and 40 min, and compared against the limadas made directly against genomic DNA. Comations were made between calls made at 10 minutes, with a PCR 101 -plexora with concentrations of equimolar primers in comparison with calls made at 10 minutes using a PCR run 1 -plexora under optimized primer concentrations. Under an equimolar concentration of primers, the multiplexer PCR will result in only 50 correct calls at the time of 10 minutes, where under the concentration of optimized primers the multiplexer PCR results in only 50 correct calls at the point of 01 minutes, where, under optimized primer concentrations multiplexer PCR results in 71 correct calls resulting in a gain of 21 (42%) of new calls. Although all 1 01 calls could not be made at the 1 0 minute time point, 94 calls could be made at 40 minutes suggesting that the amplification efficiency of most amplicons has been improved. Contrary to 10-plexer optimization that only requires a single round of optimization, multiple rounds of optimization may be required for more complex multiplexing reactions to balance all the genetic sites. EXAMPLE 3 USE OF THE INVADE R TEST TO DETERMINE THE FACTOR OF AMPLIFICATION OF PC R The I NVADER assay can be used to monitor the progress of amplification during PCR reactions, ie to determine the amplification factor F that reflects the amplification efficiency of the particular amplicon in a reaction. In particular, the I NVAER assay can be used to determine the number of molecules present at any time of a PCR reaction by referring to a standard curve generated from the quantified reference DNA molecules. The amplification factor F is measured as the ratio of the concentration of PCR product after amplification to the initial concentration of target. This example demonstrates the effect of varying the concentration of primers on the measured amplification factor. The PCR reactions were conducted for variable numbers of cycles in increments of 5, that is 5, 10, 1, 5, 20, 25, 30 so that the progress of the reaction can be determined using the NVADER I test to measure the accumulated product . The reactions were serially diluted to ensure that the target quantities do not saturate the I NVADER assay, ie the measurements can be performed in a linear range of the assay. The standard NVADER assay curves were generated using a series of dilutions containing known quantities of the amplicon. This standard curve is used to extrapolate the number of DNA fragments in PCR reactions after the indicated number of cycles. The ratio of the number of molecules after a given number of PCR cycles to the number present before the amplification is used to derive the amplification factor F, from each PCR reaction. PCR reactions PCR reactions were formed using equimolar amounts of primers (for example 0.02 μM or 0.1 μM of primers, final concentration). The reactions at each primer concentration were fixed in triplicate for each level of amplification tested, ie, 5.1, 15.20, 25 and 30 PCR cycles. A sufficient master mix for 6 standard PCR reactions (each in triplicate concentrations of X2 primer) plus 2 x 6 control tests (5, 1 0, 15, 20, 25 or 30 PCR cycles) plus sufficient extra reactions to allow the coverage.

Serial dilutions of the PCR reaction products In order to ensure that the amount of PCR product added as target to the NVADER assay reactions does not exceed the dynamic range of the real-time assay in PRESEPTIVE BIOSUSTEMS CYTOFLUOR 4000, the products of PCR reactions are diluted before addition to the NVADER I assay. An initial 20-fold dilution was made of each reaction followed by subsequent five-fold serial dilutions. To create standards, the amplification products generated with the same primers used in the tests of different numbers of cycles were isolated from non-denaturing polyacrylamide gels using the standard methods and quantified using the PICOGREEN assay. A 200 poM working broth was created, and serial dilutions of these concentration standards were created in tRNA containing dH2O at 30 ng / μl for a series with the final amplicon concentrations of 0.5, 1, 2.5, 6.25, 1 5.62, 39 and 1 00 fM. Reactions of the INVADER assay The appropriate dilutions of each PCR reaction and the non-target control were performed in triplicate and were tested in simple standard NVADER assay reactions. A master mix was prepared for all I NVADER assay reactions. In total there were 6 PCR cycle conditions x 24 individual test trials [(1 test of triplicate dilutions CX 2 primer conditions X 3 PCR replicates) = 18-6 controls without target]. In addition, there were 7 dilutions of the quantified amplicon standards and 1 control without objective in the standard series, the standard series was analyzed in replicate in each of two plates, for 32 I NVADER trials. The total number of I NADER trials is 6x24 + 32 = 176 The master mix includes coverage for 32 reactions. The master test mix I NVADER consists of the following standard components: FRET / Cleavasa xi / mg / PPl mixer for 192 plus 16 wells. The following oligonucleotides were incubated in the PPl mixture. 0.25μM I NVADER for trial 2 (GAAGCGGCGCCGGTTACCACCA) 2.5 μM Probe A for assay 2 (CGCGCCGAGGTGGTTGAGCAATTCCAA) 2.5 μM G probe for assay 2 (ATGACGTGGCAGACCGGTTGAGCAATCCA). All the wells were covered with 15 μl of mineral oil, incubated at 95 ° C for 5 minutes, then at 63 ° C read at different intervals, for example 20, 40, 70 or 160 minutes, depending on the level of the signal generated . The reaction plate was read on a CytoFluor® series 4999 fluorescence multi-well plate reader. The values used were: 485/20 nm excitation / bandwidth and 530/25 nm emission / bandwidth for the detection of F dye, and 560/20 nm excitation / bandwidth and 5620/40 mm emission / bandwidth for detection of dye R. The gain of the instrument was adjusted for each dye in such a way that the targetless template produced between 1 00-200 units of absolute fluorescence (AFU). Results: When the results of the I NVADER trials in triplicate were plotted on a log10 graph of the amplification factor (y axis) as a function of the number of cycles (x axis), the concentration of the PCR product was estimated from the I NVADER assays by extrapolation to the standard curve. The data from the replicated trials was not average but rather presented as multiple overlapping points in the figure. These results indicate that the PCR reactions were exponential during the range of cycles tested. The use of different concentrations of primers resulted in slopes such that the slope generated by the INVDAER assay analysis of the PCR reactions performed with the highest primer concentrations (0.1 μM) is more acute than that of the lower concentrations (0.02 μM) . In addition to the slope obtained using the 0.1 μM method that anticipated perfect bending (0.301). The amplification factors of the PCR reactions in each primer concentration were obtained from the slopes: For the primers 0. 1 μM, slope = 0.286, amplification factor 1.93 For the primers 0.2 μM, slope = 0.218, amplification factor 1 .65. The lines do not seem to extend to the origin but rather intercept the X axis between 0 and 5 cycles, perhaps reflecting the errors when estimating the initial concentration of human genetic DNA. Thus, these data show that the concentration of primers affects the extension of the amplification by means of the PCR reaction.

These data further demonstrate that the I NVADER assay is an effective tool for monitoring amplification through the PCR reaction. EXAMPLE 4 DEPENDENCE OF AMPLIFICATION FACTOR ON THE CONCENTRATION OF PRIMER This example demonstrates the correlation between factor F and concentration of primers c. In this experiment F was determined for 2 alleles of each 5 SNP amplified in the monoplexoras PCR reactions, each of the 4 different primer concentrations, that is 6 pairs of primers X 2 genomic samples X 4 primer concentrations = 47 PCR reactions. . Although the effect of the number of PCR cycles was tested in a single amplified region, with two concentrations of primers, in Example 3, in this example all PCR reactions were performed for 20 cycles, but the effect of varying the primer concentration was study in 4 different levels of concentration: 0.01 μM, 0.025 μM, 0.05 μM, 0.1 μM. In addition, this experiment examines the differences in amplification of different genomic regions to investigate (a) whether different genomic regions are amplified to different degrees ( this is PCR polarization) and (b) how the amplification of different different genomic regions depends on the concentration of the primer. As in Example 3, F was measured by generating a standard curve for each genetic site using a series of dilutions of purified, quantified reference amplicon preparations. In this case, 12 different reference amplicons were generated: one from each allele of the SNP contained in the 6 genomic regions amplified by the pairs of primers. Each reference amplicon concentration was tested in an I NVADER assay, and a standard curve of fluorescence count versus amplicon concentration was created. PCR reactions were also run on genomic DNA samples, the diluted products and then tested in an INVADER assay to determine the extent of the amplification, in terms of the number of molecules compared to the standard curve. to. Generation of standard curves using quantified reference amplicons A total of 8 genomic DNA samples isolated from whole blood were screened in standard biplex INVADER assays to determine their genotypes in 24 SNPs in order to identify our homozygous for the native allele or variant of a total of 6 different different genomic sites. Once those genetic sites were identified, native and variant genomic DNA samples were analyzed in separate PCR reactions with primers flanking the genomic region containing each SN P. In each SNP, one allele reported the dye.

DAM and one to RED. The genomic DNA preparations were amplified in individual standard monoplex PCR reactions to generate amplified fragments to be used as PCR reference standards as described in example 3.

After PCR, the amplified DNA was gel isolated using the standard methods and previously quantified using the PICOGREEN assay. The serial dilutions of these concentration standards were created as follows: Each purified amplicon is diluted to create a working broth at a concentration of 200 pM. Those broths were then serially diluted in the following way. A working solution of each amplicon was prepared with a concentration of 1.325 pM tRNA that contained dH2O at 30 ng / μl. The working broth was diluted in 96-well microtiter plates and then diluted in series to give the following final cookings in the NVADER assay: 1, 2.5, 6.25, 1, 5.6, 39, 100 and 250 fM. A plate was prepared for the amplicons to be detected in the I NVADER assay using probe oligonucleotides that report to the FAN dye and a plate for those to be tested with the probe oligonucleotides that report to the RED dye. All dilutions of amplicon were analyzed in duplicate. Aliquots of 100 μl were transferred in this plan to MJ research plates with 96 wells and denatured for 5 minutes at 95 ° C before addition to the I NVADER assays. b. PCR amplification of genomic samples with different primer concentrations PCR reactions were prepared for the individual amplification of the 6 genomic regions described in the previous example of each of 2 alleles at 4 different primer concentrations, for a total of 48 reactions PCR All PCRs were run for 20 cycles.

The following primer concentrations were tested: 0.01 μM, 0.025 μM, 0.05 μM, 0.1 μM. A master mix for all 48 reactions was prepared according to standard procedures with the exception of the modified primer concentration, plus an excess of 23 additional reactions (16 reactions were prepared but not used, and 7 additional reactions were prepared) . c. Dilutions of PCR reactions Before analysis by the NVADER I assay, it was necessary to dilute the products of the PCR reactions, as described in Examples 1 and 2. The serial dilutions of each of the 48 PCR reactions were carried out. using a 96-well plate for each SNP. The left half of the plate contained the SNPs that are going to be tested with the probe oligonucleotides that report to FAM; the right half, with probe oligonucleotides that report to RED. The initial dilution was 1: 20, subsequent dilutions were 1: 5 to 1: 62, 500. d. Analysis of the INVADER assay of PCR dilutions and reference amplicons NVADER I analyzes were performed on all dilutions of the product of each PCR reaction such as the indicated dilutions of each quantified reference amplicon (to generate a standard curve for each amplicon) in assays I NVADER standard biplex. All wells were covered with 1 5 μl of mineral oil. Samples were heated at 95 ° C for 5 minutes to denature and then incubated at 64 ° C. Fluorescence measurements were taken at 40 and 80 minutes on a Cytofluor 4000 fluorescent plate reader (Applied Biosystems, Foster City, CA) . The values used were: 485/20 nm excitation / bandwidth and 530/25 nm emission / bandwidth for detection with F dye and 560/20 nm excitation / bandwidth and 620/40 nm emission / Bandwidth for the detection with dye R. The gain of the instrument was fixed for each dye in such a way that the template without objective produced between 1 00-200 units of absolute fluorescence (AFU): The raw data is the generated by the device / instrument used to measure the performance of the test (real-time or endpoint mode). These results indicate that the dependence of InF on c demonstrates different amplification rates for the 12 PCR under the same reaction conditions, although the difference is much smaller in each pair of objectives that represent the same SNP. The amplification factor strongly depends on c at low primer concentrations with a tendency to level out at higher primer concentrations. This phenomenon can be explained in terms of the kinetics of the thermal fixation of the primer. At high primer concentrations, the rapid thermal binding kinetics ensures that the primers bind to all targets and a maximum amplification rate is obtained, on the contrary, at low primer concentrations the kinetics of the primer's thermal binding become a limiting stage of the speed that reduces F.

This analysis suggests that plotting the amplification factor as a function of a primer concentration at coordinates ln (2- F / n) vs c should produce a straight line with a slope -kata. By regraphing the data in coordinates ln (2-F1 n) vs c we show the expected linear dependence of the low primer concentrations (low amplification factor) that deviates from the linearity of the low primer / low amplification factor ) that deviates from linearity at a primer concentration 0.1 μM (F is 105 or greater) due to a lower than expected amplification factor. The kata values can be calculated for each PCR using the following equation. F = zn = (2-e "kaota) n EXAMPLE 5 REACTION INVADER REVIEW ANALYSIS PCR 192-PLEXORA This example describes the use of the I NVADER assay to detect the products of the highly multiplexed PCR reaction designed to amplify 1 92 genetic sites different in the human genome Extraction of genomic AN D Genomic DNA was isolated from 5 ml of whole blood and purified using Autopure, manufactured by Gentra Systems, Inc. (Minneapolis, MN) The purified DNA was in 500 μl of dH2O Design of primers Series of forward and reverse primers for the 1 92 genetic sites were designed using Primer Designer, verison 1 .2.4 (see the section on Design of Primers, including figure 8.) The target sequences used for the INVADER designs, with no More than 500 bases flanking the relevant SNP site were converted into a comma delimited text file to be used as an input file for the PrimerDesigner. using the default parameters, with the exception of oligo Tm which is fixed at 60 ° C. Synthesis of primers Oligonucleotides primers were synthesized using standard procedures in a Polyplex (GeneMachnes, San Carlos, CA). The scale was 0.2 μmol, desalified only (not purified) in NAP-10 and not dried. PCR reactions Two master mixtures were created. Master mix 1 contained primers to amplify the genetic sites 1-96; the master mix 2, 97-1 92. The mixtures were made according to standard procedures and contained the standard components. All primers were present at a final concentration of 0.025 μM, with 100 mM KCl, and 3 mM MgCl. PCR cycle conditions were as follows in an MJ PTC-100 thermocycle (MJ Reseach, Waltham, MA): 94 ° C for 39 seconds, then 55 ° C 33 seconds x 50 cycles. After the cycles, all 4 PCR reactions were combined and 3 μl aliquots were distributed in a 384 deep well plate using a CYBI-well 2000 automatic pipetting station (CyBio AG, Jena, Germany). This instrument makes individual additions of reagent to each well of the 384 well microplate. The reagents to be added are placed in 384 deep well semiplates. INVADER assay reactions The INVADER assays were prepared using CYBI-well 2000. Aliquots of 3 μl of the genomic DNA target were added to the appropriate wells. The controls without objective consisted of 3 μl of Te (1 0 mM Tris, pH 8.0, 0.1 mM EDTA). The reagents for their suo in the NVADER I assays were standard PPl mixtures, buffer, FRET oligonucleotides, and Cleavase VI II enzyme and were individually added to each well through the CYBI 2000 well. After addition of reagents, 6 μl of oil mineral were placed on each well. The plates were heated in a MJ PTC-200 DNA ENGI NE thermocycle (MJ Research) at 95 ° C for 5 minutes then at the incubation temperature of 63 ° C. The fluorescence was eluted after 20 minutes and 40 minutes using the Safire microplate reader (Tecan, Zurich, Switzerland) using the following initial values 495/45 nm excitation / bandwidth and 520 &5 nm emission / bandwidth for dye detection; and 600/5 nm emission / bandwidth, 575/5 nm excitation bandwidth Z position, 5600 μs; number of flashes 1 0; delay time 0; integration time 40 μsec for the detection of dye R. The gain is fixed for dye F at 90 nm and dye R at 120. The raw data are the degrees by the device / instrument used to measure the performance of the test (in real time mode or end point).

Of the 1 92 reactions, genotype calls could be performed for 157 after 20 minutes and 158 after 40 minutes, or a total of 82%. For 88 of the trials, the results of genotype formation were available for comparison of the previously obtained data using either monoplex PCR followed by the NVADER I analysis or the INVADER results obtained directly from the genomic DNA analysis. For 69 results, no corroborating genotype results were available. This example shows that it is possible to amplify more than 1 50 genetic sites in a single multiplexed PCR reaction. This example further shows that the amount of each fragment generated in that multiplexed PCR reaction is sufficient to produce discernible genotype calls when used as a target in an I NVADER assay. In addition, many of the amplicons generated in this PCR multiplexer test gave a high signal, measured as FOZ, in the I NVADER assay, while others gave such a low signal that it could not be called a genotype. In addition, other amplicons were present at such low or zero levels that they gave no signal in the I NVADER assay. EXAMPLE 6 OPTIMIZATION OF CONC ENTRY OF CEBERS TO IMPROVE THE EMISSION OF REACTIONS PCR ALTAM ENTE MUTIPLEXADOS The competition between the individual reactions in the multiplexer PCR can aggravate the amplification polarization and cause a general reduction in the amplification factor compared to uniplexer PCR. The dependence of the amplification factor on the concentration of primers can be used to alleviate PCR polarization. The different levels of signals produced from the different genetic points amplified in the 1 92-perora PCR of the previous example, taken with the results of example 3 showing the effect of the concentration of the primer on the amplification factor, it is also suggested that it may be possible to improve the percentage of PCR reactions that generate sufficient target to be used in the INVADER assay by modulating the primer concentrations. For example, a particular sample analyzed in Example 5 gave FOZ results after 40 minutes of incubation in the NVADER I trial, of 29.54 FAM and 66,987 RED, while another sample gave FOZ results after 40 minutes of 1.09 and 1. .22, respectively, showing a determination that there was an insufficient signal to generate a so-called genotype. The modulation of the primer concentrations, even in the case of the first sample and even in the case of the second, should make it possible to bring the amplification factors of the two samples closer to the same value. It is anticipated that this type of mine < dulation can be an iterative process that requires more than one difficulty to bring the amplification factors close enough together to allow most or all of the genetic sites in a multiplex PCR reaction to be amplified with approximately the same equivalent efficiency . EXAMPLE 7 EXAMPLE OF M ULTIPLEXION In principle PCR amplification can be carried out in a multiplexer format in which multiple genetic sites are amplified in the same tube. In practice, however, this method can result in highly variable yields of individually amplified products due to PCR polarization. This example describes the optimization of multiplex reaction conditions to minimize the amplification polarization. Amplification polarization is caused by the variable amplification rate between individual reactions that lead to a significant difference in PCR product yields over a large number of cycles. In this example, the PCR target amplification was analyzed throughout the entire reaction range and the parameters that affect the PCR performance were investigated using the quantitative NVADER I assay. From this work, a model was developed that describes the dependence of the amplification factor on the concentration of primers and the time of thermal fixation of the primer, which elucidates a mechanism that is the base of the polarization of amplification. Using a 6-plexor PCR as a model system to test different conditions by minimizing polarization, two methods were identified. The first is based on adjusting the primer concentrations to balance the amplification factors of different genetic sites. In a second method, the concentration of the primer remains the same for all individual reactions, but the thermal fixation time of the primers and the number of amplification cycles were optimized to minimize the amplification polarization. Optimized PCR conditions were used to perform a PCR 1 92-plexer amplification of 8 samples of genomic DNA and to be used in the formation of genotypes using NVADER I assays. MATERIALS AND M ETHODS Materials: Chemical materials and shock absorbers were from Fisher Scientific unless otherwise indicated. Cleavase enzyme (RR) of structure-specific 5 'nuclease (Third Wave technologies) was purified as described (50. The enzyme was dialyzed and stored in 50% glycerol, 20 mM Tris HCl, pH 8.40 mM KCl, 0.5% Tween 20, 0.5% Nonidet P40, 1 00 μg / ml BSA Unless otherwise indicated A, G, C and T refer to deoxyribuculotides Preparation of genomic DNA Eight samples of genomic DNA G 1 were prepared , G2, G3, G4, G5, G6, G7 and G8 from 10 ml of leukocytes using an AutoPure LS instrument (Gentra Systes, Minneapolis MN) The purified DNA is diluted to 13.3 ng7μl in buffer containing 1 0 mM Tris HCl pH 8.01, 0.1 mM EDTA Oligonucleotide synthesis The oligonucleotides in the INVADER assay with the monoplexora and 5-plexora PCR reactions were synthesized using a PerSeptive Biosystems instrument and standard phosphoramidite chemistry including A, G, C dye, T, 6-carboxyfluorescin (FAM) (Glen research), Redmond RED® (RED) dye (Epo) ch Biosciences, Redmond, WA), and Eclipse® Dark Quencher (Z) (Epoch Biosciences). Primary probes and FRET cartridges were purified by means of ion exchange HPLC using a Columan Resource Q (Amersham-Pharmaci Biotech, Newark, NJ) and the invsorean probes were purified on desalting on NAP-10 columns (Amersham 17-0854- 02). The primary probes used in the PCR 1 92-plexer assay were synthesized by means of Biosearch Technology, Novato, CA, BG 1 -SD 14-1) and purified using columns (Biosearch, SP-2000-96). Invasive probes from the 192-plexer assays were synthesized and purified by means of Biosearch Technologies using 5 'trityl-on capture purification. PCR primers were synthesized by Integrated DNA Technologies, Chicago, I L. Oligonucleotide concentrations were determined using absorption at 260 nm (A26_) and extinction coefficients of 15,400, 7,400, 1 1, 500 and 8,700 A260 M "1 for A , C, G and T, respectively Design of multiplexer PCR primers A computer program, the software PrimerDesigner (Third Wave Technologies, Madison Wl, see figure 9 and the previous discussion of the design of primers) has been developed to assist in the PCR primer design for multiplexer PCR and to reduce the likelihood of primer primer formation The PCR primers for the multiplexer format were designed with the PrimerDesigner software using the following parameters in conjunction with the above description of the primer design in Figure 9. For each of the genetic sites to be amplified, 500 nucleotides were included on each side of the SNP for a total of 1001 bases per site For each genetic site, the sequence of 60-80 nucleotides required for the binding of the invasive and primary probes was determined and the PCR direct and reverse candidate primers were identified by "logging out" of this region. The candidate primers are selected based on the following criteria: (1) the fencers should have an A or C at the 3 'end to avoid primer primer formation (2) Tm of the primers was 60 ° C (1) 1, 12): (3) the primers must have a length of 1 2 and 30 nucleotides in length; (4) the two and three 3 'end bases of any primer should not be complementary to the two and three 3' end bases of any other primer in the multiplexer PCR mix; (5) no primer should have a similarity greater than 80% with the broken 5 'arm sequence of any primary I NVADER probe. The algorithm was started by designing the first two primers for a randomly selected genetic site and proceeding by iteration to add more primers to the source. If primers can not be designed for one of the genetic sites, the algorithm starts from the beginning using a new randomly selected genetic site. Design of the INVADER trial. The primary and invasive probes of the I NVAER assay were designed with the NVADERCreator algorithm described elsewhere (Lyamichev, V. and Neri, B. (2003) an INVADER assay for the formation of SNP genotypes.) Methods Mol. Biol. 212, 229-40, incorporated by reference). The probe sequences for the I NVADER 1 -6 assays correspond to PCR 1-6, respectively. The sequences of the INVADER 1 -6 assays correspond to the PCR 1 6 respectively. The sequences for the 1 92 NVADER assays for the PCR 1 92-plexer experiments were designed using the same algorithm. Quantitative analysis of PCR with the INVADER assay. PCR 1-6 was performed in uniplex or 6-plex format in 50 μl of GeneAmp PCR buffer (PE Biosystems, Foster City, CA) containing primers at concentrations specified in the text, 0.2 mM dNTP, 1 μl (5U / μl) Amplitaq DNA polymerase (PE Biosystems, N808-0171), 1 μl (1.1 μg / μl) TaqStart antibody (Clontehc, catalog number 5400-2, Palo Alto, CA) and 50 ng of human genomic DNA or 3.8 μi of Te cushion for non-objective control. To prevent evaporation, each well was covered with 1 5 μl of transparent Chill-out (MJ Research, catalog number CHO-141 1, Las Vegas, NV) and the plates were covered with a film seal (Neckman Coulter, number catalog BK 538619, Fullerton, CA). The number of cycles and the time-temperature profile for each cycle are specified in the text. Each PCR included in the denaturation stage of the initial sample of 1 5 minutes at 95 ° C and the final incubation stage of 1 0 m inutes at 99 ° C each reaction was performed in triplicate in a 96-well well. The PCR products were serially diluted 20 times in a first step followed by the subsequent fivefold dilution in the Te buffer containing 30 μg / ml of tRNA (Boehringer Mannheim, cat.No.BK 538619, I ndianapolis, IN). product to concentrations within the dynamic range of the INVADER assay. I NVADER reactions with diluted PCR products were performed in 1 5 μl containing 0.06 μM of invasive oligonucleotide, 0.5 μ; of each primary probe, 0.33 μM of each FREET cartridge, 5.3 ng / μl of Cleavase XI enzyme, 12 mM of MOPS (pH 7.5), 5.3 mM MgCl2, 2.5 & PRG 8000. 0.02% NP40, 0.02% Tween 20 covered with 1 5 μl of mineral oil (Sigma) in 96-well plates. The PCR products constituted 7.5 μL of the reactions. For the non-target controls, 7.5 μL of the Te buffer was used instead of the PCR product. The reactions were incubated at 95 ° C for 5 minutes to denature the target and then at 63 ° C for a period of time from 20 minutes to 3 hours. The reactions were stopped by cooling the plates to room temperature, the fluorescence signal was detected with a fluorescence plate reader Cutofluor 4000 (PE Biosystems) using excitation of 485/20 nm and 520/25 nm emission filters to FAM dye and excitation of 560/20 nm and 620/40 emission filters for RED dye. Each PCR replica was analyzed with the corresponding I NVADER assay in triplicate, therefore for each PCR reaction, nine data points were collected. To determine the concentration of PCR products, standard curves were obtained for each of the INVADER 1-6 assays using standard concentrations of the corresponding PCR products. The PCR standards for assays 1-6 were prepared by PCR amplification of the G 1 DNA samples, G2, G6 or G8. The amplified products were concentrated by ethanol precipitation, purified using ether electrophoresis on 8% non-denaturing polyacrylamide gel and quantified using the PI COGREEN dsDNA kit (Molecular Probes, Eugene, OR, catalog No. P7589). I NVADER reactions for the standard curves were performed with 0 to 100 fM of the PCR standards in duplicate in the same microtitre plate as the PCR products analyzed. The concentration of the analyzed PCR products was determined from the fluorescence signal by means of a linear regression using the three data points of the standard curve closest to the fluorescence signal value of the PCR samples. The concentration of the PCR product and the variation were estimated for each of the PCR replicates of the means of the triplicate I NVADER assays. The concentration of the PCR product for triplicate PCRs was estimated by using average values for each of the replicates weighted by the variation of the analysis of the I NVADER assay. The initial concentration of the AN D genomic samples used in the PCR was determined by the INVADER assay in triplicate using the same standard curves. The amplification factor F was determined as the estimated concentration of the PCR product multiplied by the dilution factor and divided by the concentration of genomic DNA used for the PCR. The 192-plexer PCR was performed in a single replicate under the conditions described for PCR 1-6 for 1 7 cycles with the DNA samples G 1 -G 8, each primer concentration of 0.2 μM, the primer binding time 1 .5 min, the extension time of primers 2.5 and the initial denaturation stage of samples of 2.5 minutes at 95 ° C. For the purposeless control of 1 92-plexer PCRs, Te buffer was used instead of genomic DNA. PCR 1 92-plexor reactions are diluted 309-fold in Te buffer containing 30 μg / ml tRNA (Boehringer Mannheim, 1 09, 525) and heated at 95 ° C for 5 minutes before addition to I NVADER reactions. The INVADER reactions were performed as described for tests 1-6 except that the invasive probe is at 0.07 μM, and each probe is at 0.7 μM. The FAM and RED fluorescence signals were collected after 15, 30 and 60 minutes or as specified in the test for the PCR genomic samples and the non-target PCR controls. The net fluorescence signal was determined by subtracting the non-target signal from the sample signal for each of the 1 92 INVADER assays. The following algorithm was applied to the analysis by means of the genotype software. (1) The signals of the values of passage over zero for FAM (FOZF) or RED (FOZR) were determined for each I NVADER test by dividing the sample signal by the control signal without aim. (2) For each I NVADER test, a value of proportion H was determined as (FOZF-1) / (FOZR-1). (3) A sample was defined as heterozygous (H ET) if 0.25 >; H > 4 and both FOZF and DOZR > 1 .3; one sample was defined as homozygous FAM if H > 4 and FOZF > 1.6; and a sample was defined as homozygous RED if H > 0.25 and DOZR > 1 .6 (4). In all other cases a sample was called a "mistake". To investigate the parameters that affect PCR, a method was developed to use the quantitative INVADER assay to determine the amplification factor F over the entire range of the reaction. The factor f was defined as a ratio of the concentration of the amplified product and the initial genomic DNA, both measured with the I NVADER assay using standard curves obtained with known quantities of the PCR products described in "Materials and Methods". First F was analyzed as a function of the number n of cycles PCR The uniplexer PCR 5 was carried out with a primer concentration c of 0.1 μN using DNA G2, and F was determined after n of 5, 10, 15, 20, 25, 30 and 35 (Figure 2). As shown in Figure 2, PCR 5 reveals a linear dependence of IgF at n for the first 25 cycles with a slope of 0.296 + 0.001 6, demonstrating that the amplification of the target is exponential for 7 orders of magnitude. The average amplification factor per PCR cycle determined from the slope of the linear dependence is equal to 1.98 + 0.007, indicating that the amount of the target almost doubles after each cycle. The entry in Figure 2 shows the IgF dependence at n for cycles 1, 2.3 and 5 of PCR 5 under the same conditions except a large amount of G2 DNA that is used as the target. This dependence can also be approximated by a linear function with IgF vs n of 0.283. After 25 cycles, PCR5 reaches a plateau at F 2x1 08 corresponding to a target concentration of 0.06 μM as determined from the initial genomic DNA concentration of 0.28 fM. The plateau could be explained either by depletion of the primers used in the PCR at a concentration of 0.1 μM or by an inhibition of the PCR by means of its own product. Similar to PCR 5, quantitative analyzes of PCR 2 show a linear dependence of IgF at n for the first 25 cycles with a slope of 0.295 + 0.004 and a plateau at F of 3x1 08 (data not shown). These results establish that the I NVADER assay is a quantitative method for the amplification analysis of the PCR target and demonstrates that the PCR advances exponentially during 7 orders of magnitude or during at least 25 cycles. To investigate the effect of c on F as a means to adjust F and thus reduce the polarization of the amplification (Henegariu, O., et al, Biotechniques, 23, 504-1 1, 1 997) the Uniplex PCRs 1-6 were investigated using the quantitative INVADER assay. Each PCR was performed for 20 cycles with c of 0.01. 0.025, 0.04, 0.05 or 0.1 μM. The logarithm of F as a function of c is shown for PCR 1, 2.4 and 5 in Figure 3A. Figure 3A shows the effect of the concentration of primers c on IgF for PCR 1 (•), PCR 2 (o), PCR 4 (»), and PCR 5 (a). The PCR amplifications were performed in 50 ml with c of 0.01, 0.025, 0.04, 0.05 or 0.1 mM and with 50 ng of the G2 of genomic DNA for PCR 1, 4 and 5 or the GE of genomic DNA for PCR 2. Each PCR was performed for 20 cycles using the template denaturation step for 30 seconds at 95 ° C, the primers heat setting step for 44 s at 55 ° C and the primer extension stage for 60 s at 72 ° C for each cycle . The IgF value for PCR 1 with c of 0.01 mM was too low to give reliable measurements. The standard error was estimated when carrying out the PCR in triplicate and when analyzing each replica by means of the corresponding quantitative assay I NVADER also in triplicate. PCRs 3 and 6 were performed in a manner very similar to PCRs 5 and 2 respectively and are not shown for brevity. There is a significant difference in F between PCRs performed under the same reaction conditions. The difference is more pronounced at a low c; however, it becomes less important at higher c where IgF approaches the theoretical maximum value of lg (220) or 6.0. As shown in the previous section, PCR can be considered as an exponential reaction of 20 cells, and F can be used to determine the target z-amplification factor in a single PCR cycle such as F1 / p. As previously described above, the observed effect of c on F can be described by means of a model which assumes that the thermal binding of primers is the limiting step of PCR at one c less. In this model, the link of the primer P to the target T is described by means of a second-order reaction with the constant of the rate of association ka P + 2 --- > > - > PT (1) Assuming that thermal fixation occurs at temperatures below the fusion of primers and the reverse reaction can be ignored, the solution for reaction (1) is: where ['PT] is the concentration of the target molecules associated with the primer, T0 is the initial target concentration, c is the initial concentration of primers, and i is the time of thermal fixation of the primer. Assuming both the PCR primers have the same ka, and the time of the therapeutic fixation ta is what is sug- gestedly prolonged to complete the duplication of each objective molecule primed, z can be determined as z ^ Sx: S = .2- e ^) and F after n cycles is given by _F = Z? = / 2- £ r ** or / '(4) According to equation 4, ln (2-F1 p) must be a linear function of c with a slope equal to -kata. The transformation of the data shown in Figure 3A using the coordinates ln (2-F1 p) vs c demonstrates the expected linear dependence for each of the PCRs (Figure 3B) providing strong support for the model. In Figure 3B, the straight lines show the least squares fit for each of the PCRs. The data points for PCRs 2 and 5 with c of 0.1 mM were not used due to the high standard error. The slope of ln (2-F1 n) vs c can be used to determine an apparent association rate constant of ka pp of the heat setting step of the primer which is mostly defined by the primer with the minor ka. The kaapp values of PCRs 1, 2,4 and 5 determined in Figure 3B using a ta of 44 s are 0.34 1 06, 0.73 1 06, 0.45 106, and 1 .2 1 06 s "1 M'1 respectively. These values are close to the ka values of 1 .5 106 s'1M ~ 1 and 2.6 106 s "1M" 1 obtained for the short oligonucleotides under similar conditions of damping.There is at least a threefold difference between kg for the slowest (PCR1) and the fastest (PCR 5) suggesting that the kinetics of thermal fixation can contribute significantly to the polarization of amplification.The results of the quantitative analysis of the amplification PCR suggests two methods for the balanced amplification of multiplexed PCR targets: (1) adjustment of c for each individual using the IgF vs. c and (2) increase c and ta. to achieve the maximum amplification of all the targets with fixed c as equation 4. The concentrations of adjusted primers cadi that provide an expected value F of 1 04 for each of the PCR 1-6 (table 1) were determined of the data shown in Figure 3A.

Table 1 . Logarithm of the amplification factor IgF for multiplexed PCR, 1, 2, 3,4,5 and 6 under conditions of adjusted primer concentrations. a Multiplexed PCR 1, 2, 3,4,5 and 6 were performed in 50 μl with 50 ng of G2 or G6 genomic DNA for 20 cycles using the denaturation step for 30 s at 95 ° C, the primer binding step for 44 s at 55 ° C and primer extension stage for 60 s at 72 ° C for each cycle. b ca j was determined for each of PCR 1, 2,3,4,5 and 6 of Figure 2 to provide the expected IgF value of 4. c IgFadj e lgFo.025 for PCR 1, 3, 4, 5 and PCRs 2,6 were determined using the FAM signal from the quantitative assay I NVADER and the 6-plexor PCR performed with the genomic DNAs G2 and G6, respectively. The standard error was determined from the triplicate PCR reactions analyzed by means of the corresponding I NVADER assay also in triplicate. PCR 6-plexora 1 -6 were performed with the adjusted concentrations cadJ or a 25% of 0.25 μM for each of the PCR under the same conditions as in Figure 3 using a target DNA G2 or G3. As shown in table 1, under the conditions all six objectives were amplified approximately 1 04 times with an average IgF of 4.15 + 0.17 and a difference of 2.75 times in F the fastest (PCR 3) and the most slow (PCR1). Under conditions c0.025 the amount of the total product amplified in the multiplexer PCR was similar to the PCR with cadj with an average IgF of 3.89 + 0.91, however there was a significant polarization of amplification as illustrated by a difference of 26.3 times in F between the fastest and the slowest PCR (3 and 1, respectively). PCRs 1-6 were also performed in a uniplex format with cadJ or a c0_02d under the conditions of the 6-plexor format and the F-values were very similar to the corresponding F values shown in table 1. This result suggests that there is no significant interference between the individual PCRs in the 6-plexor format. The balance of the PCR when adjusting c is a powerful method that minimizes the polarization of amplification; however, it uses a known dependence of F on c for each of the PCRs or the iterative optimization of the concentration of primers. An alternative method is to use a fixed c value, but perform the PCR under conditions that minimize polarization. Both the experimental data (figure 3) and the theoretical analyzes (equation 3) suggest that z should approximate asymptotically to 2 as the value of cta. Therefore the multiplexer PCRs are performed with a fixed c of 0.1 μM, the maximum concentration used under the conditions shown in Figure 3, or 0.2 μM and the heat setting step of the primer of 90 s instead of 44 s. 6-plexer PCRs 1-6 were performed for 17 cycles to provide the theoretical maximum IgF value of 5.1 using the G1, G2, G6 or G8 DNA as a target. The quantitative analysis of F with the NVADER I -6 assays was performed using both the FAM and RED signals (for the genotypes of the genomic DNAs see table S3) and the IgF values are shown in table 2. Table 2. Logarithm of the amplification factor IgF for multiplexed PCR 1, 2,3,4, 5 and 6 under conditions of fixed primer concentrations. a Multiplexed PCR 1, 2,3,4,5 and 6 were performed in 50 μl with 50 ng of the G 1, G2, G6 or G8 genomic DNA for 17 cycles using the denaturation step for 30 s at 95 ° C, the stage of thermal setting of primers for 90 s at 55 ° C and primer extension stage for 150 s at 72 ° C for each cycle. The standard error was determined from the triplicate PCR reactions analyzed by means of the corresponding I NVADER assay also in triplicate. ° Reports the fluorescent dye of the I NVADER assay. The difference between the IgF values obtained with the FAM and RED signals were not statistically significant for the PCR conditions of 0.1 and 0.2 μM with the test t p values of 0.88 and 0.77, respectively suggesting that the analysis of F was independent of the type of I NVADER trial. The IgF values for PCR 1-6 with c of 0.2μM were 4.55 ± 9, 19, 5.03 ± 0.1 1, 4.96 + 0.1 1, 4.80 + 0.10, 5.42 + 0.18 and 5.15 + 0.1 1, respectively, or very close to the expected value of 5.1. It is not clear because the IgF value of 5.42 for PCR 5 was statistically higher than expected although the I NVADER 4 assay demonstrated a relatively low performance with all genomic DNA samples compared to the other assays that may result in a artificially increased PCR product and Adn concentrations and overestimated IgF values. The difference between the mean IgF values obtained with c from 0.2 and 0.1 μM was 0.32, 0. 1 3, 0.1 8 and 0.17 for PCR 1, 2.4 and 6 respectively. The differences were statistically significant with the p values of the t test of > 0.0001, 0.04, 0.01 and 0.02. The difference between 0.2 and 0.1 μM mean IgF values for the fastest PCR (3 and 5) was 0.07 and 0.08, respectively, with the p values of the test t of 0.37 and 0.47 assuming that there is no statistical significance. This analysis demonstrates that the increase in the term cta improves the performance of the slower PCRs and does not affect the performance of the fast PCRs in the multiplexing reaction that apparently have approached the amplification plateau. The next part of this example was the development of PCR 1 92-plexora, essentially doubling the multiplexing factor of 100 achieved by (Ohnishi et al., J Hum Genet, 46, 471 -7, 2001) for the SNP genotype with the INVADER assay. The 1 92 SNP representing chromosomes 5, 11, 14, 15, 16, 17 and 1 9 were randomly selected and an INVADER assay was designed for each of the SNPs. During the selection process, there was no discrimination against SNP in repetitive regions. Therefore, some of the 1 92 SNPs could be amplified in multiple genetic sites. The PCR conditions developed for the balanced amplification were used with a fixed primer concentration due to its simplicity and short development time. The genomic samples of G 1 -G8 DNA were amplified with 192-plexus PCR for 17 cycles with a fixed c of 0.2 μM, thermal fixation time of primers of 1.5 minutes, primer extension time of 2.5 minutes, and then were analyzed with INVADER 192 biplexer tests described in "Materialees y Methods". The RED and FAM net signals were obtained by subtracting the control signal without aiming from the sample signal. One way to identify the genotypes of the net signals is to use the universal call criterion for each of the tests described in the "Materials and Methods". These criteria assume that the homozygous samples have only signals from one of the alleles with little or no cross-reactivity signal from one to the other, and these heterozygous samples produce approximately the same signals for both alleles. These rigid criteria can often lead to wrong calls in the otherwise functional I NVADER trials. Alternatively, the genotypes were called by plotting the FAM and RED net signals for all eight DNA samples as a scatter plot for each I NVADER assay and to visually identify the clusters corresponding to the homozygous and heterozygous samples. Scatter graph analysis can be performed if too few samples are included; This analysis also contains an element of subjectivity, since this type of visual analysis depends on the judgment of the operator. In this work it was determined that eight samples are sufficient to make visual calls for most of the 192 INVADER trials. Example of successful and failed scatter plot analysis are shown in Figure 4. Figure 4 shows scatter plots of the FAM and RED I NVADER assay signals for eight genomic DNA samples. The FAM and RED net signals from the INVADER assay were plotted for the G1, G2, G3, G4, G5 G6, G7 and G8 DNA samples amplified with the 196-plexer PCR. A-C, successful genotypes with trials 7, 9 and 25 assigning all samples to different clusters identified as homozygous FAM (o), RED homozygous RED (p) or heterozygous (x). D-F, genotype failed. In trial 6 (D), the sample closest to the origin of the co-ordinates can be assigned to none of the clusters; in test 47 (E), the samples form three different groupings but there is no FAM signal for any of the samples; in the 54 (F) assay, the samples can not be distinguished between homozygous NETs with high cross reactivity of high FAM signal and hematozygous with a RED / FAM ratio. RFU - relative fluorescence units. Conservative criteria were used for visual analysis, excluding a whole series of samples if only one of the samples could not be assigned to a cluster. Also the series with the strongest signals in both channels were not considered to give precise genotypes, assuming a high cross-reactivity of the I NVADER assay, more probably the amplification of multiple homologous genetic sites by means of PCR. Using these criteria, calls were made for 161 or 84% of the 1 92 trials. Calls were made using the genotype software described in "Materials and Methods" coincided with 82.5% of those calls. The 31 failed I NVADER trials were investigated to determine if the failure was due to a low PCR amplification factor, poor performance of the INVADER assay, or amplification of the highly homologous sequences by PCR. The target PCR sequences were analyzed using BLAT to determine if any of the individual PCRs amplified more than one genetic site. Eight of the 31 trials apparently failed because, for each of them, multiple genetic sites could be amplified by PCR and each of the genetic sites could be detected by means of the I NVADER assay. The remaining 23 trials were assumed to fail due to one or a combination of the following reasons: low PCR amplification, design failures and oligonucleotide manufacturing, or unrecognized repeat sequences not included in the human genome assembly of April 2003. Excluding the 8 trials that failed due to repeated sequences in the genome, the efficiency of the 192-piexora PCR with the genotype of the I NVADER assay was estimated as 161/1 84 or 87.5%. To estimate the polarization of amplification in the PCR 1 92-plexora, the net NET fluorescence signal normalized by allele was plotted for 161 successful NVADER I assays performed on eight DNA samples versus the PCR target length as shown in Figure 5 Figure 5 shows the net RED fluorescence signal normalized per allele for the 161 successful INVADER assays as a function of the length of the PCR target. The INVADER reactions were performed for 60 minutes with eight DNA samples amplified each with PCR 1 96-plexora. The line shows a linear regression of the net signal as a function of the length of the PCR target. There is a significant variability in the net signal that includes the variability in the PCR amplification and the performance of the INVADER assay. Similar results were obtained for the FAM signal net. There is a weak correlation between the net signal and target length suggesting that PCR targets greater than 700 bp will have a low probability of allowing successful genotypes. Surprisingly, despite 'high variability in the net signal, genotyping was performed successfully at the high and low ends of the signal distribution. To investigate the observed robustness of the genotyping of the INVADER assay, the net signal for the same 92 I NVADER reactions was measured after 5, 30 and 60 minutes. Because the amplification of signals in the I NVADER test is quadratic with time (1) the time points of 30 and 60 minutes would be equivalent to the 15 minutes of reaction performed with objective level 4 and 1 6 times higher, respectively, thus modeling the PCR amplification low, intermediate and high level. As an example scatter plots for the I NVADER 1 1 0 test obtained with time points 15, 30 and 60 minutes are shown in figure 6. Figure 6 shows scatter plots of the net FAM and RED signals for the eight samples of DNA The INVADER 1 10 assay was performed with the DNA samples amplified with the PCR 1 96-plexer and the signal was measured after 1 5 (A), 30 (B) and 60 minutes (C). The samples were identified as homozygous FAM (o), RED homozygous RED (°) or heterozygous (x). By means of dispersion graph analysis. RFU - relative fluorescence units. Dispersion graphs demonstrate genotyping INVADER by means of cluster analysis not affected by a strong net signal and can be interpreted even for the 60 minute reaction, where both net FAM and RED signals reach saturation. As a result of this effect, more calls can be made with longer INVADER reactions, because more signal is generated for slow PCR, improving the identification of genotypes, but at the same time the higher signal for rapid PCR does not affect the grouping of the samples. EXAMPLE 8 PCR AMPLIFICATION AND INVADER TEST ANALYSIS IN A SINGLE REACTION CONTAINER This example describes a method for using PCR to amplify small amounts of an objective followed by the analysis of the I NVADER assay in a single reaction vessel. In particular, this example describes the conduct of those reactions without the need for manipulations or additions of reagents after the need for manipulations or additions of reagent after a single preparation of the reaction. Unless otherwise indicated the following examples were made with the reagent indicated for the assays to detect the sequences in the DLEU gene (chromosome 13) and the gene -actin (chromosome 1: 1 0 mM buffer, pH 7.5 7.5 mM MgCl2 dNTP, 25 μM each 109 ng genomic DNA PCR primers, 200 nM each Primary probes 0.5 μM oligos I NVADER 0.05 μM probes FRET 0.05 μM enzyme CLEAVASE (VI II or X ) 1 00 ng DNA polymerase of Tq Stoffel or native 1 u PCR primers for DLEU: Direct primer 1 71 6-14-1 (SEQ ID NO: 1) 5'-CCCGACATTTTTACGCATGCGCAAACTCCAACC-3 ', Tm = 73.8 ° C Primer Inverse 1 71 6-14-2 (SEQ ID NO: 2) 5'-TACACGCACGCGCAAGAAGCAAGAGGACT-3 ', Tm = 74.1 ° C PCR primers for a-actin: Direct primer 1 71 6-14-3 (SEQ ID NO: 3) 5'-CTGGGTTCAACAGGCGAAAAGGCCCT -3 ', Tm = 73.4 ° C Inverse primer 171 6-14-4 (SEQ. NO: 4) 5'-GCGTGAGGGTGGAAGGAGATGCCCATGG -3 ', Tm = 74.7 ° C Probes, I NVADER oligos, FRET cartridges (underlined bases indicate fin sequences, bold letters indicate position 1 in the assay INVADER) Probe of a-actin 1 734-57 ACGGACGCGGAGAGGAACCCTGTGACAT-hex (SEQ ID NO: 5) INVADER Oligo of a-actin 1734-57 CCATCCAGGGAAGAGTGGCCTGTT (SEQ ID NO: 6) Probe DLEU CGCGCCGAGGTTCTGCGCATGTGC-HEX (SEQ ID NO: 7) Oligo from I NVADER from DLEU AGGGAGAGCCGTGCACCACGATGAC (SEQ.

ID. NO: 8) DLEU FAM FRET 23-428 Fam-CT-Z28-AGCCGGTTTTCCGGCTGAGACCTCGGCGCG-hex (SEQ ID NO: 9) a-actin RED FRET Network-TCT-Z28-TCGGCCTTTTGGCCGAGAGCCCCGCGTCCGT-hex (SEQ ID NO. 10).

A. Configuration of the combined PCR-INVADER reactions In some cases, it may be desirable to temporarily separate the PCR and I NVADER reactions, for example by performing the PCR reaction under conditions that do not favor the NVADER reaction and then modifying the reaction conditions for allow the INVADER reaction to progress. One such means for creating differential reaction conditions is through the use of antibodies to the enzymes used in the reaction, such as the Light Cycler TaqBlock antibody (Roche Applied Sciences). Other means is by means of temperature. In the present example, the PCR primers were designed with thermal fixation temperatures > 70 ° C while the oligonucleotides of the probe for use in the I NVADER assay were designed with Tm of approximately 63 ° C, such that the probes should not be able to react with target molecules during thermal fixation, extension or denaturation of the PCR cycle. In addition it was determined that while the Stubel fragment of Taq DNA polymerase and native Taq DNA polymerase can be inactivated by prolonged exposure to elevated temperature (in this case 99 ° C for 10 minutes), some CLEAVASE enzymes retain the activity after that treatment. In particular, CLEAVASE Vi l appears to be highly stable to such heating and is used in subsequent experiments. Reactions were performed in which all reagents were combined in a final volume of 10 μl using the components described above and coated with mineral oil. The PCR was allowed to advance for 1 1 -20 cycles (95 ° C for 30 seconds; 72 ° C for 30 seconds to 2 minutes). After these cyclic reactions, the mixtures were heated at 99 ° C for 10 minutes to inactivate the Ta DNA polymerase. The reaction mixtures were then incubated at 63 ° C for 30 minutes to 3 hours to allow the NVADER reactions to proceed. B. Evaluation of the inhibition of the signal generation of the INVADER assay. The initial results indicated that there seems to be an inhibition that limits the generation of the signal from the I NVADER assay. The following experiments were conducted to evaluate the possible contribution of various reaction components to this inhibition. Partial reactions were assembled in order to examine the effects of various reaction components. Specifically, several I NVADER reaction components were omitted from the initial reaction adjustment and then added to the reactions after thermal inactivation of the DNA polymerase. In the following tables, "+" indicates that a component was included in the initial preparation of the reaction; "-" indicates that a component was added after the thermal denaturation of Taq DNA polymerase in order to allow the I NVADER reactions to proceed. 1 2 3 4 5 6 7 8 9 10 11 12 Mops 100 mM 1 ul + + + + + + + + + + + + MgCl2 1 ul + + + + + + + + + + + + dNTP 1.25 mM ea 0.2 ul + + + + + + + + + + + + Primers 1716-14-1 / 2 5 uM aa 0.4 ul + + + + + + + + + + + + Primers 716-14-3 / 4 5 UM ea 0.4 ul + + + + + + + + + + + + Stoffel 10 u / ul 0.1 ut + + + + + + + + + + + + gDNA 03-422 100 pg / ul 1 ul + + + + + + Dleu / a-acti PPl-FRET 5X (-Dleu Inv ) 3 ul - + - - + - - + - - + - Invader Dleu 2.5 uM 0.6 uM - - - + + + - - - + + + Cleavase VIll 100 ng / ul 1 ul - - + - + + - - + - + + Volume 10 ul (95 C 30"-> 72 C 30") 20- > 98 C 5 ' After the PCR add the missing components (-) in 5 ul 1 0 mM Mops 7.5 mM MgCl2 and run at 95 ° C 3'- > 63 ° C, 3h. Ex: 485/20 1478 80 1158 1519 67 1250 88 61 53 68 68 55 Em: 530/25 Gain: 45 Ex: 560/20 1977 1233 1810 2039 512 860 70 78 70 87 98 57 Em: 620/40 Gain: 50 The comparison of the results in columns 2 and 5, in which the FRET mixtures are included during the PCR reaction, are shown in columns 1, 3-4 and 6, in which the FRET probes were not added until after that the PCR reaction has been stopped by appearing that the signal generated in the I NVADER assay is inhibited by the presence of the PPI-FRET mixtures. Subsequent experiments (see below) in which each occluder of the PPI-FRET mixtures was omitted was omitted during the PCR reaction confirming that the FRET probes were inhibitory.

Mops 100 rpM 1 tfl + • • + - + + + + * MgCß 1 ül + + + + + + + + dNTP l.2S my ea 0.2 ül + + + + + + + + - Primers 17 6-14-1 / 25 uM ßa 0.4 üi + + + * + * 4- + + Primers171d-14-3 / 45 uU ea 0.4 u! + + + + * + + + + • Stoffel 10 u ul 0.1 u. + + • Í- + * + + + gDNA 03-422 100 ng? T l uí * > + + + + + + + Dleu probe - 15 uM 0.5 ut - + - - - - - + A-acine probe 5 0,5 0,5 0.5 ul. - + - - - - + Dleu fnvader 2.5 uM 0.5 ul - - - + - - - "f- a-acfin invader2.5 uM 0.5 ul - - - - + - - + Dfeu FRET 23-4287.5 uM 0.5 uj - - - - - + - - + a-actln FRET 23-7557.5 uM 0.5 ul - - - - - - + + Volume 0 u. (95 C 30t '~> 72 C 30".2Q-: > cs' After adding the missing components (-) in 5 ul 10mM Mops 7.5 mM MgCl2 and run at 95 ° C 3'->. 63 ° C 3h.

Ex: 485/20 108 1782 1800 1602 1720 100 94 8D Em: 530/25 Gain 45 Hx: 560/20 2363 3313 3053 3243 2950 2284 170S 5B6 Em: 620/40 Gain 50 The examination of the rightmost columns in the table indicates that the signal generation of the I NVADER assay was reduced for those reactions in which both FRET probes were present ("+") from the beginning of the reaction in relation to which in which it was omitted. Additional experiments in which the amount of Taq polymerase was increased showed that a double increase in the Stoffel DNA polymerase resulted in a recent generation of signals in the I NVADER assay. Based on these experiments, it was determined that the increase in the length of time during which the PCR reaction as well as the Taq DNA polymerase concentration receives the impact of this inhibition. C. Optimization of the combined reaction conditions of PCR and the INVADER assay Experiments were performed to optimize the amounts of various reaction components at the times of several steps in the combined assays. The concentration of MgCl2 was varied in a range from 1.7 mM to 7.5 mM; the dNTP concentration was tested in a range of 25-75 mM; the concentration of primers was varied from 0.2 μM-0.4 v v.M. The exemplary data obtained using native Taq polymerase are presented below and generate that a generation of FAM signals depends on the presence of the NLEU INVADER oligo and that both INVADER reactions generate signals after 17 cycles of PCR followed by 10 minutes 1 99Q C for denaturing the polymerase followed by 30 minutes of INVADER reaction at 61 ° C. Mops IGO rpM 1.5 til 4 • * • + MgCJ225 mM 1-5 ul + + + • b Dieu / a-actírt PFI-FRE? 5X (-E eu Inv) 3 ul -t- * + + Dleu fnvader 2.6 u, 0.05 uM final 0.3? L 4- + - 4- Cleaußse VII1 100 pg /? F 1 u. + + - -V - TaqPsl (native) 5 u / ÜI 0.2 Ul -f + + -r Primers 1716-14-1 / 25uM 83, Mu final 1.2 ul + + • + + Primers f 716-1 -3/4 Sufvl ßa, üM fipaS 1.2 ul + + - + + - dNTP 1, 2S ea, 25 uM final 0.3 ui + •! • + gPNA 03-422 10 ng / ul 1 ul + * + Volume 15 ul (TS C 3G '* - 72 C 2!)? 7- > && amp; C 10- > 61 C 30 ' Ex: 485/20 110 1744 115 87 em; 530/20 Gain 45 Be 680/20 123 2 @ 42 2700 112 Em: 620/40 Gain 50 D. Response to the dose of the combined PCR-INVADER assay The experiments were performed to monitor signal generation in the combined NVADER I-PCR assay in a range of initial concentrations of target genomic DNA. The reactions were prepared in the following way: 1 2 3 4 5 6 7 8_ Mops 100 M 1.5 ul + + + + + + + + MgCl275 mM 0.75 ul + + + + + + + • + Dleua-e? Ctín PPi'.FRET 5X S ul + +. -_- + + + .. + Cfeayase Viíi 100 rig / ul 1 uf + * + + + +. + * TaqPol (native) 5 u / ul 0.1 ul + + + + + + + + Primers 1716-14-1 / 26uM O ^ u Sil 0.6 ül + + + + + + + + Primers 1716-14-3 / 45uM Q.2UM ÍI ?! O.S ül + + - + + * * + + dNTP 1.25 mM ea, 25 uM final 0.3 ul + + + + + * * + gDNA S ng 02948A - 2 1.5 1 0.75 0.5 0.3 0.1 Volume 15 ul. { S5C 3Q "> 7ZC 2'.12-99C 10'-> 60C eo 'I NVADER reactions were allowed to continue for 120 minutes, and the results were read after 60 minutes or 120 minutes. 1 20 minutes are presented in Figure 7. These results indicate that the combined PCR-INVADER reaction is linear in a range of DNA concentrations and is sensitive enough to detect from 1.5 ng of human genomic DNA.

E. Multiplexer PCR combined with detection by the INVADER biplexer assay. Additional experiments were conducted to analyze the multiplex PCR reactions in combination with the INVADER assay. 20-plexus PCR reactions were prepared as described below. The PCR CF mixture contained each of the primers in the following table below at a concentration of 1 μM. The genomic DNA samples were obtained from Coriel as indicated in the following table. val (u!) 10X vol MgCfe (50 mM) 2.25 22.5 Cleavase VH1 100 ng / ul 1.00 10.0 Native Taq polymerase (5 units? il) 0.1 G 1.0 (dNTP key 1.25 mM 0.30 3.0 PCT primer set (1 $ 6? - S0) (1 uM each 33., 0000 30.0 gDNA DNA IQng? JL 1.00 1O »0 H2G 4.35 43.5 Total 12-00 120.00 The Coriel samples were numbered in the following manner (for example "C" n) C trfetl # Genotype 1 NAU277 B07 delBET 2 NA11280 711 + 1 G > T / 62M-1G > T HET 3 NAG1531 DIFFUSES HOM 4 NA04539 AFSOS HOM 5 NA07381 ddF50 $ / 3849 + 10 £ bHET 6 NA07441 3120-MG > A o21 + lG > THBT 7 NA07469 of? F5ÜS¿R553X 8 NÁ11283 A455B / HBT 9 NA11284 R5ßOT delE508 / delF508 HET 10 NA11286 deUP508 / HBT 11 NA11290 G551D + iG A455Efó21 THET 12 NA07552 deiF5QS / JLS53X 13 NA0S342 ddF508G551DHET 14 NAÍ12753659delCdo1508 BDBT 15 NA127S5 G551D / R347P HET 16 NAI1472 G1349D / N1303KHET 17 NA1? 495 G542XHOM 38 KA11497 G542 BET 19 NAJ1723 W12S2XHET 20 NAÜ761 GS51DR553XHET 21 N? 11282 G85B / 621 +? OTHBT 22 NA12960 34W unknown muting HET 23 NA13032 I506V 24 NA13033 F508C 5 NA13423 GS5E / Í152HHET 6 NA11859278 + 5G > AHOM 7 NAU8603849 + 101 * HOM 8 NA? 24441717 ~ Í > AHET 9 NA125S5 1162 HET 0 NA1359! of 508 / R117HHET 1 SFAÜ8338 G551D 2 NAH281 621 + 1 G > T / delF5G8 4 NA12961 V52QP 5 NA1I27S Q493X / ddF50S 6 NA11285 Y1092X (C> A) / del? T508 8 NAOÜ5M6 AN1 9 NA00130 AN2 PCR primers were chosen from the following: tíñt exop 3 TGQTCCCACrrTTTTATTsrTTTGCAGA cfir exon 4 GTCACCAAAGCAGTACAGCC cftr exop GCTGTCMGCCGTGTTCTAGATAAA cftr exon 7 OGGAATTOAGCCTATGTGAT cftr exon 9 CATGTßCCATGTGCTTTTCAAAC cftr oxon 09.01 CATGGGCCATGTGCTTTTGAAAC cftr exon 9-2 CTTCTTGGTÁCTCCTGTCCTGAAAGA cfErexonlO ATTATGGGAGAACTGGAGCCTTCA EXOP cftr exon 11 GATTACATTAGAAGGAAGATGTGCCTTTCAA cftr exon 12 T 13 T GGCAAATCATCTACACTAGATGACCA offr CTGAGACCTTAGACCGTTTGTCA cftr exon 14B ATGGGAGGAATAGGTGAAGATGTTAGAA cftrexon 10 TCTGAATGCTTCTACTGTGATCCA cftr exon 17A 17B CCTGCACAATGTGGAGATGTACC CFIR exoii GGACTATBGACACTTCGTGCC cffr exort 18 GGAGAAGGMGAGTTGGTATTATCCTGAC cfírßxon 19 GCATOAMCTAÁTTGTGAA tTGTCTGCC cftr exon 19-1 GGATCA CTAATTGTGAAATTGTCTGCC cftrexon 19-2 GAAGGTGGAAATGCCATATTAGAGAACA Cfír exor. 20 GTACCTATATGTCACAGAAGTGATCCCA oftr exon 1 GATTAGAAAAATGTTCACAAGGGACTCCA CFIR 3849 + 1 O b CAGT TACGGGGTCATCTTGATTTCTGGA cftr exon 17A-2 CCTCGACAATGTGCACATGTACC primer cftr primary cfirexon S AQCGATTCACCAGATTTCGTAGTCTTTTCA EXOP 4 TGTAGQAGCTCACTACCTAATTTATGACA cftr exon 5 GAGCTTAGCAAGACTTAACCACTAATTAC CFLR cftr exon 7 GTGAACATTCCTAGTATTAGCTGGCAAG cftr exon 9 Exon CTCCAAA TACCTTCCAGCACTACAAA GAAATTACTGAAGAAGAGGCTGTCATCAC 01.09 02.09 CTCGAAAAATACCTTCCAGCACTACAAA cft Gf_r Exon Exon 10 GACTAACCGATTGAATATGGAGCCAAA cf fr exon 11 CTTAAATGTGATTGTTAACCCACTAGCCA cftrexon 12 AGGTAAAATGCAATCTATGATGGGACA CFIR exon 13 TAAGGGAGTCTTTGGGACAATGGAAAA cftrexon cftr exon 14B ACCTCAGCCAACTAATGGTCATOA 18 TAGAGAGGACTTCAACCCTCAATCA CFLR exon 7 A 6AGTATCGCACATTCACTGTCATACC cftr exon 1? B AAGGTAACAGCAATGAAGAAGAtßACAA? Cf eXGF} 10.02 GCTGCAGGCTACTGGGATTCAC cftr exon 20 TTGTTTC? AATTCCrrfTßCTCAG cnr © xon 21 CATTTCAGTTAGCAGCCTTACCTCA cftr 3849 + 1 okb TCCTCCCTGAGAATGTTGGATCM Vst lnt Vs1 Int std F TGATGGTGGTATGTTTTCAGGCTAfíA SFD R GTTCTCCCCTGTCCCAGTTTTAAG Reactions were performed as described above with an extension of 2.5 minutes at 72 ° C and 45 seconds of denaturation at 95 ° C for 14 cycles. The mixtures were heated at 99 ° C for 10 minutes and then cooled to 63 ° C for 1 hour. The results are presented in figure 9. The sample of F508 was Coriel # 3, the G85E / 621 + 1 G > T was Coriel 21; 171 7-1 G > A, Coriel 28; delF508 / R 1 1 7H was Coriel 30; delF508 / 3849 + 10kb, Coriel 5; A455E / delkF508, Coriel 8, and R506T / delF508 Coriel 9. These results indicate that the PCR assay combined with INVADER can be performed with multiplex PCR reactions. EXAMPLE 9 TETRAPLEX INVADER TEST: 4-DYE SYSTEM Another means to increase the effectiveness of the analysis is to increase the number of I NVADER reactions that can be run and analyzed in a single reaction or reaction vessel. The present example describes the implementation of the I NVADER 4-plexer assay in which four sets of oligonucleotides are included in a single reaction. In this case the reaction also includes four different target sequences: the native type and the variant versions of two different SNPs. Alternative configurations are also contemplated, including four different genetic sites, three different genetic sites and an internal control, etc. A variable in the configuration of the I NVADER assay for FRET multiplexer analysis refers to the selection of dyes for inclusion in the FRET probes. Numerous combinations of dyes and suffocators are known in the art (see for example in the patents 4,925,517, 5,691, 146 and 6, 103,476 which are incorporated by reference). In some embodiments it is desirable to select combinations of dye quenchers that exhibit minimal interference with the. cleavage activity of the CLEAVASE enzyme. Such bleach dye combinations when used with the INVADER assay can favor a more optimal productivity step. Another consideration that affects the selection of dyes related to their spectral characteristics. In some embodiments, for example for assays detected in a fluorescent plate reader, it is preferred that the fluorescent signals of each dye can be spectrally resolved together by the instrument. If they are not spectrally distinct enough, the fluorescence output of a dye might interfere with or "bleed" on the signal attributed to another dye. This "interference can lead to a lower sensitivity of the test or a higher error rate." Some instruments have the substantial ability to resolve the detection of the signal that is detected in multiple channels (for example through the use of optical filtering and / or software manipulations of the collected signal), thus the selection of various combinations of dyes refers to the instrument that will be used to detect the multiplexed reaction.The fluorescence output of a given dye from the scan of the fluorescence plate reader is proportional to its concentration in the following way: Fluorescence = a • [dye] + b (1) Where o is a constant that varies with the wavelengths of emission and excitation and the values adjusted for the gain of the reader of plate and b is the background.If there are multiple dyes, then each dye contributes to the total fluorescence in the following way: Fluorescence = a • [tintea] + ß • [tin teb] + and • [tint.] + n • [tntent] + background (2) or Fluorescence - background: • [tintea] + ß • [tint] + Y • [tintec] + n • [tinten] (3) When multiple scans are performed, the fluorescence of each scan can be written as follows: Fluorescence! - background. : cti • [tintea] + ß. »[Tinteb] +? 1» [tintent] + n. • [tinten] Fluorescency2- background2: a2 • [tintea] + ß2 * [tintent] +? 2 «[tintec] + n2 • [tinten] Fluorescence3- background3: a3 • [tintea] + ß3 * [tinteb] +? 3» [tintec] + n • [tinten] Fluorescence4- background: a • [tintea] + ß4 # [tinteb] +? * [tintec] + n4 • [tinten] where the numerical subscripts represent the fluorescence readings, the dye coefficients and the background component for each scan. This series of linear equations can be written in the form of a matrix like r Fi-b. «1 ßi fi HJ cc2 02 fa. na a3. { Jj and * HJ Fp "p? OCH ft. Tu OR F ~ ád (4) where the elements of the linear matrix F are the fluorescence readings minus the background, A is the two-dimensional coefficient matrix and d is the linear matrix whose elements are the quantities of each of the free dyes released from the I NVADER test . The elements of matrices F and A can be determined by providing a certain type of calibration using pure dyes and templates for each different scan. Therefore, the solution of d can be found by multiplying to the left both sides of equation (4) by the inverse of A. That matrix is derived from the series of dye-4-plexor as follows. The T10 dye oligonucleotides, this is oligos with 10 dT residues with a 5 'terminal dye, were used to determine the emission characteristics of the free dye. Different proportions of those oligos dT1 0 were combined with FRET probes consisting of the corresponding dye and a suffocator to mimic the generation of INVADER test signals over time. The 500 mm working broths were each produced from dT1 0 and free probe, respectively. The total volumes of the sample were 15 μl, and each sample was covered with 15 μl of mineral oil. The proportions studied were 0% dT10 / 1 00% FRET probe; 25% dT10 / 70% FRET probe: 50% dT10 / 50% FRET probe; 75% dT1 0/25% FRET probe; and 1 00% dT1 0/100% FRET probe. The dyes studied were (FAM), Cal-Gold and Cal-Orange (Biosearch Technologies, Inc., Novato, CA), and REDMOND RED (Synthetic Genetics). The tubes were read on a Tecan Safire XFLUOR 4 at appropriate excitation and emission wavelengths for each dye. In each case, the observed fluorescence of each dye increased the linearity by increasing the proportions of the oligo dT10, and the signals were additive. The slopes of the linear regressions were entered into the coefficient matrix in the following way.

A corresponding matrix was generated by taking the inverse value of each value to obtain A "1, as described above and thus derive d, the percentage of free dye in each case.

The I NVADER trials were run in the following way. Standard reactions were initiated with a final volume of 1 5 μl as described above with the enzyme CLEAVASE VI I I and 5 pM (final) synthetic target. Four different synthetic targets were used in the present example: the native and mutant type for SNP 1 and 2. The FRET probes were used in the following way: The assays were incubated at 63 ° C and the fluorescence readings at the indicated wavelengths were then performed after 20 minutes. The results of these combined reactions are presented in Figure 10, showing the detection of various combinations of target molecules. EXAMPLE 10 PREFERRED MICROFLUID CARD WITH INVASIVE TEST REAGENTS FOR DETECTION OF OBJECTIVES The following example describes the use of a microfluidic card containing the NVADER assay reagents I for the interrogation of DNA samples. In this example the target material has been prepared separately by PCR. The 3M microfluidic card has 8 charging ports, each of which is configured to deliver liquid reagent to 48 individual reaction chambers after centrifugation of the card. The reaction chamber contains pre-distributed and dry test reaction components INVADER for the detection of one or more particular alleles (for example as shown in example 1 1, then). Those reagents were dissolved when they could be contacted with the fluid reagents after centrifugation on the card. Multiplexer PCR reaction mixtures were prepared using the following components (the concentrations shown in their final concentration in the PCR reaction): genomic DNA at 2 ng / uL, mixer multiplexer PCR primer at 0.2 uM, PCR buffer plus MgCI2 at 1 X , 0.2 mM dNTP, and native Taq polymerase at 0.2 Y / rxn. The final volume of the reaction was 20 uL. These mixtures were heated for 2.5 minutes at 95 ° C, then subjected to 20 one-stage cycles of 30 seconds at 95 ° C, one of 1.5 minutes at 55 ° C, and a 2.5 minute stage at 72 ° C. Finally, the samples were incubated at 99 ° C for 10 minutes to destroy the polymerase activity. After PCR, the amplicons were diluted 1: 125 with dH2O and 50 uL of this sample was mixed with 50 μl of a solution containing 28 μM MgCl2 and CLAAVASE X enzyme at 4 ng / μl. The mixture was then added to one of the 8 individual ports of the microfluidic 2M CF card described in the previous example. The I NVADER assay was performed at 63 ° C for 20 minutes, and the fluorescence of the assay was detected on a microplate fluorometer. The results are shown in Figures 1A-1 1 G. The genotype of the genomic sample is indicated at the top of each panel, and each of the mutations tested is indicated along the X axis. EXAMPLE 1 1 INVADER MAS PCR IN MICROFLUI DAS 3M CF CARDS The following example described by the use of a microfluidic card containing the NVADER assay reagents to study DNA samples. In this example, the target material is amplified and detected in a single reaction. The reactions were performed on a 3M microfluidic card, as described above. The reaction chambers of the microfluidic card contain reaction components of the INVADER assay (ie, the oligonucleotide, the primary probe, and the FRET cartridge) to perform the 48 different, dry INVADER assays on the card. To prepare these cards, 2 μl of 1 X PPI FF-MOPS mixture (0.25 μM of each primary probe oligonucleotide, 0.125 μM of each FRET oligonucleotide, 0.025 μM of oligonucleotide I NVAR, in 10 mM of MOPS buffer) is distributed in the wells of the microfluidic card. The cards are then allowed to air dry in an air box through which filtered HEP air is passed. Generally it is not necessary to control the temperature or relative humidity of the air. The volume of each reaction chamber in the assembled microfluidic card is approximately 1.7 μL, such that the final concentrations of these components during the reaction are about 1.118 times that of the 1X PPI FF-MOPS mixture). The allelic variants detected by these oligonucleotide series in the I NVADER assay were the following: A master mix containing all the materials necessary for multiplex PCR amplification of the INVADER assay targets, together with the CLEAVASE Vi l enzyme required for the I NVADER assay, was prepared and divided into 8 sources. Up to 7 of these 8 sources were added to a single sample of genomic DNA and the remaining sample was used as a control that did not contain a template. 1 00 UL of each of these 8 samples was added to a loading port on the card, and the wells of the card were loaded by means of centrifugation. The final concentration of the components in these mixtures was as follows: 7.5 mM MgCl2, 6.67 ng / ul Cleavase I I, 0.033 U / ul native Taq-pol, 25 uM dNTP mixture, 0.2 uM multiplex PCR primers. The combined PCR and I NVADER assay reactions were incubated as follows: 95 ° C for 15 seconds and 72 ° C for 2 minutes, 14 seconds for 1 5 cycles, followed by a single step at 99 ° C for 10 minutes. minutes to destroy the native Taq-pol activity, followed by 60 ° C for 1 hour for the INVADER assay reaction. The fluorescent signal from the IVADER assay was detected in a fluorescent microplate reader, and the results are presented in Figures 12A-12G (control samples are omitted without purpose). The genotype of each genomic sample DNA is indicated at the top of each panel, and each of the mutations tested is indicated along the X axis. EXAMPLE 12 DIRECT DETECTION IN UNPURIFIED BLOOD SAMPLES WHOLE This example describes obtaining direct detection of an objective sequence in a sample of unpurified whole blood. In particular, this example, similar to the previous example, describes the combination of PCR amplification and the detection of the INVADER assay in a single reaction vessel for detecting genomic DNA. This example however also extends the above examples by applying the single-vessel reaction method, the combined NVADER PCR-I, to a sample of whole blood without purification. The reaction mixture of the PCR / INVADER assay, in a total volume of 20 ul, is prepared in the following manner. For the buffer, approximately 4 ul of either 0.5X of MAPDI RECT-A from Shimadzu without 5X Amp Addition-1) or 10 mM of biological buffer TAPS (3- [[tris (hydroxymethyl) methyl] amino acid] were used] Propanesulfonic acid) approximately at a pH of 9. It should be noted that it is unexpected to find that RAPS with pH 9, and not only AMPDIRECT-A, serves as the buffer to direct the detection of PCR and I NVADER in whole blood. Also, additional details of the AMPDI RECT-A buffer and PCR in whole blood can be found, for example in the US patent publications 20020102660 and 20020142402, as well as by Nishimura et al. , Clin. Lab., 2002, 48: 377-84 and Nishimura et al. , Ann. Clin. Biochem, 200, 37: 674-80, which are incorporated by reference). The following additional reagents are used: 6.25 uM of sNTP of each dNTP, 0.2 uM of each PCR primer, 0.3 units of Taq polymerase (native), 40 ng of CLEAVASE VI II, 3 mM MgCl2 (in addition to any MgCI2 in the AMPDIRECT buffer, if this buffer is used), 0.5 uM of primary probe for each target can be detected (for example for target genomic DNA and for internal control), 0.05 uM of INVADER oligonucleotide for each allele to be detected (for use with multiple probes primary, if SNP should be detected) or 0.05 uM INVADER oligonucleotide for each target to be detected (to be used, for example, when quantifying a variable target against an internal control objective), 0.25 uM of each FRET probe (for target reactions) and control) and distilled water for a total reaction volume of 20 uL. The whole liquid human blood sample to be tested is first treated with an anticoagulant such as sodium citrate, potassium EDTA, or sodium heparinate. Approximately 0.4 ul (or less) of this treated whole human blood is added to the NVADER PCR / I reaction mixture by charging it to the bottom of the reaction tube without mixing. The mineral oil can be coated if needed. Then, a PCR is carried out in the sample for a total of 28 cycles. The PCR can be performed for example using the following temperature profile which is suitable for whole human blood: preheat at 80 ° C for 15 minutes, then at 94 ° C for 4.5 minutes, followed by 28 cycles of 94 ° C for 30 seconds , thermal fixation temperature for 1 minute, 72 ° C for 1 minute and 72 ° C for 7 minutes. After these cyclic reactions, the mixture is heated at 999 C for 10 minutes to inactivate the Taq DNA polymerase. The reaction mixture is then incubated at 63 ° C for about 20 minutes at about 3 hours to allow the INVADER assay reactions to proceed. The results of this example show successful PCR amplification of a target sequence in genomic DNA within whole blood, as well as detection by successful INVADER assay of the target sequence of interest. Successful detection of the target nucleic acid of this whole blood is possible whether MPDIRECT or TAPS ph9 is used as the buffer. Direct DNA detection with the combined PCR and INVADER assays can also be performed using cards with blood spots: 10 mM TAPS buffer with pH 9.3 mM MgCl2, 0.2 uM of each PCR primer, 6.25 uM of each dNTP, 0.5 uM of primary probe for each target to be detected (for example, target genomic DNA and for internal control), 0.05 uM of INVADER oligonucleotide for each allele to be detected (to be used with multiple primary probes if a S NP), or 0.05 uM of NVADER oligonucleotide I for each target to be detected (to be used for example when quantifying a variable target against an internal control objective) 0.25 uM of each FRET probe (for target and target reactions). control), 0.06 ul of TaqPol (native, 5 u /), 0.2 ul of CLEAVASE HIV 200 ng / ul, and distilled water for a final volume of 20 ul. From a WHATMAN FTA Gene card with a drop of blood, take 1 millimeter extraction containing blood, and another perforation of the same diameter taken from a spot on the bloodless card. The paper perforations are then washed in 1 ml of water for approximately 10 minutes, with occasional stirring. The PCR and INVADER assays are performed as described above. The results of this procedure show the successful PCR amplification of the target sequence from the genome within the whole blood, as well as the successful detection of the INVADER assay of the target sequence of interest.

All publications and patents mentioned in the foregoing description are incorporated by reference as expressly indicated herein, various modifications and variations of the described method and system will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in relation to the specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to those specific embodiments. In fact, various modifications of the forms for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims (23)

1. CLAIMS 1. A method for detecting a target nucleic acid in non-purified body fluids consisting in: exposing an unpurified body fluid to the detection assay reagents under conditions such that the target nucleic acid, if present, is detected in a single stage of reaction.
2. 2. The method of claim 1, wherein the single-step reaction comprises a polymerase chain reaction.
3. 3. The method of claim 1, wherein the single-step reaction comprises a polymerase chain reaction and an invasive burst assay reaction.
4. The method of claim 1, wherein the single-step reaction comprises an invasive burst assay reaction.
5. 5. The method of claim 3, wherein the polymerase chain reaction has less than 20 amplification cycles.
6. 6. The method of claim 3, wherein the polymerase chain reaction has less than 15 amplification cycles.
7. The method of claim 3, wherein the polymerase chain reaction has less than 12 amplification cycles.
8. 8. The method of claim 1, wherein the target nucleic acid is mammalian genomic DNA.
9. 9. The method of claim 1, wherein the target nucleic acid is derived from a pathogen.
10. The method of claim 1, wherein the target nucleic acid is derived from a plant. eleven .
11. The method of claim 1, wherein the body fluid consists of blood.
12. The method of claim 1, wherein the target nucleic acid is detected by means of fluorescence.
13. The method of claim 1, wherein the reagents consist of a polymerase, a 5 'nuclease and a buffer.
14. The method of claim 13, wherein the buffer consists of TAPS with pH 9.
15. 1 5. A device for detecting a nucleic acid in non-purified body fluids: a polymerase, a 5 'nuclease, and a buffer that allows the detectable amplification of the target nucleic acid in an unpurified body fluid.
16. 16. The kit of claim 1 wherein the 5 'nuclease consists of a FEN-1 endonuclease.
17. 17. The kit of claim 15 wherein the buffer consists of TAPS with pH 9.
18. 18. The kit of claim 15 further having amplification primers.
19. The equipment of claim 1 which further contains oligonucleotides configured to create an invasive cleavage structure in the presence of the target nucleic acid.
20. 20. A method for nucleic acid multiplex detection, which consists of: a) providing reagents for the polymerase chain reaction and invasive disruption in a microfluidic card, wherein said reagents are configured to amplify and detect nucleic acids objective; b) exposing a sample suspected of containing the target nucleic acids to the reagents using centrifugal force; and c) detecting the presence or absence of those nucleic acids. twenty-one .
21. The method of claim 20, wherein the exposure consists of conducting 20 or fewer polymer chain reaction cycles.
22. 22. The method of claim 20, wherein the reagents consist of a polymerase and 5 'nuclease.
23. 23. The method of claim 22, wherein the 5 'nuclease consists of endonuciease FEN-1.