MXPA06003214A - Phenyl - carboxamide compounds useful for treating pain - Google Patents

Abstract

The present invention discloses compounds of formula:(I) (II) where Ar1, Ar2, X, R1, R2, R3, m, and n are as disclosed herein or a pharmaceutically acceptable salt thereof (aâÇ£Phenylene CompoundâÇØ);compositions comprising an effective amount of a Phenylene Compound;and methods for treating or preventing pain and other conditions in an animal comprising administering to an animal in need thereof an effective amount of a Phenylene Compound.

Description

For two-letter codes and other abbreviations, refer to the "Guidance Notes on Codes Arid Abbreviations" appearing at the beginning of the regular issue of the PCT Gazette.

PHENYL-CARBOXAMIDE COMPOUNDS USEFUL FOR THE TREATMENT OF PAIN Field of the Invention The present invention relates to Phenylene Compounds, compositions comprising an effective amount of a Phenylene Compound and methods for treating or preventing a Condition such as pain comprising administering to an animal in need thereof an effective amount of a Phenylene Compound.

Background of the Invention Pain is one of the most common symptoms for which patients seek medical advice and treatment. The pain can be acute or chronic. While acute pain is usually self-limited, chronic pain persists for 3 months or longer and can produce significant changes in the patient's personality, lifestyle, functioning ability, and overall lifestyle (KM Foley, Pain, in Cecil Textbook of Medicine 100-107 (JC Bennett and F. Plum eds., 20th ed., 1996)). In addition, chronic pain can be classified as either nociceptive or neuropathic. Nociceptive pain includes pain from tissue damage and inflammatory pain such as that associated with arthritis. Neuropathic pain is caused by damage to the peripheral or central nervous system and is maintained by injurious somato sensory processes. There is a wide range of evidence related to activity in both Group I mGluRs (mGluRl and mGluR5) (ME Fundytus, CNS Drugs 15: 29-58 (2001)) and vanilloid receptors (VR1) (V. Di Marzo et al, Current Opinion in Neurobiology 12: 372-379 (2002)) for the pain process. Inhibiting mGluRl or mGluR5 reduces pain, as demonstrated by in vivo treatment with selective antibodies to either mGluRl or mGluR5, where the neuropathic pain in rats was attenuated (ME Fundytus et al, NeuroReport 9: 731-735 (1998)). ). It has also been demonstrated that the collapse of mGluRl antisense oligonucleotides alleviates both neuropathic pain and inflammatory pain (ME Fundytus et al, British Journal of Pharmacology 132: 354-367 (2001); ME Fundytus et al, Pharmacology, Biochemsitry & Behavior 73: 401-410 (2002)). Small antagonistic molecules for attenuated pain mGluR5 in animal models in vivo are described in, for example, K. Walker et al, Neuropharmacology 40: 1-9 (2000) and A. Dogrul et al, Neuroscience Letters 292: 115-118 (2000)). Traditionally, nociceptive pain has been managed by administration of non-opioid analgesics, such as acetylsalicylic acid, magnesium choline trisalicylate, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and oxymorphone. Id. In addition to the treatments indicated above, neuropathic pain, which may be difficult to treat, has also been treated with anti-epileptics (eg, gabapentin, carbamazapine, valproic acid, topiramate, phenytoin), NMDA antagonists (eg, ketamine, dextromethorphan), topical lidocaine (for post-herpetic neuralgia), and tricyclic anti-depressants (eg, fluoxetine, sertraline, and amitriptyline). Traditionally, pain has been managed by the administration of non-opioid analgesics such as acetylsalicylic acid, magnesium trisilica colic, acetaminophen, ibuprofen, fenoprofen, diflusinal, and naproxen; or opioid analgesics, including morphine, hydromorphone, methadone, levorphanol, fentanyl, oxycodone, and oxymorphone. Id. Urinary incontinence ("Ul") is uncontrollable urination, usually caused by instability of the detrusor muscle of the bladder. Ul affects people of all ages and levels of physical health, both in the health area and in the community as a whole. Physiological contractions of the bladder are produced in large part by the acetylcholine-induced stimulation of post-ganglionic muscarinic receptors in the soft muscles of the bladder. Treatments for Ul include administering drugs with relaxing bladder properties, which help to control the over activity of the detrusor muscle of the bladder. For example, anticholinergics such as propantheline bromide and glycopyrrolate, and combinations of mild muscle relaxants such as a combination of racemic oxybutynin and dicyclomin or an anticholinergic, have been used to treat Ul (See, for example, AJ Wein, Urol Clin. N. Am. 22: 557-577 (1995); Levin et al, J. Urol 128: 396-398 (1982); Cooke et al, S. Afr. Med. J. 63: 3 (1983); R.K. Mirakhur et al, Anesthesia 38: 1195-1204 (1983)).

However, these drugs are not effective in patients with non-bladder contractions inhibited. The administration of anticholinergic drugs represents the main basis in this type of treatment. None of the commercially available drug treatments for Ul has achieved total success in all Ul patient classes, nor has treatment been achieved without significant adverse side effects. For example, drowsiness, dry mouth, constipation, blurred vision, headaches, tachycardia, and cardiac arrhythmia, related to the anticholinergic activity of traditional anti-UI drugs, can occur frequently and adversely affect patient compliance. However, despite the prevalence of anticholinergic effects in many patients, anticholinergic drugs are currently prescribed to patients with Ul. The Merck Manual of Medical Information 631-634 (R. Berkow ed., 1997). About 1 to 10 people develop an ulcer. Ulcers occur as a result of an imbalance between acid-secretory factors, also known as "aggressive factors," such as stomach acid, pepsin and Helicobacter pylori infection, and local mucosal protective factors, such as bicarbonate, mucosal secretion and Prostaglandins Treatment of ulcers typically involves reducing or inhibiting aggressive factors. For example, antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate and calcium bicarbonate can be used to neutralize stomach acids. However, antacids can cause alkalosis, producing nausea, headache and weakness. Antacids can also interfere with the absorption of other drugs into the bloodstream and cause diarrhea. H2 antagonists, such as cimetidine, ranitidine, famotidine and nizatidine, are also used to treat ulcers. H2 Antagonists promote the healing of ulcers by reducing gastric acid and the secretion of digestive enzymes produced by histamines and other H2 antagonists in the stomach and duodenum. However, H2 antagonists can cause breast enlargement and impotence in men, mental changes (especially in the elderly), headache, dizziness, nausea, myalgia, diarrhea, rash and fever. Inhibitors H +, K + - ATPase such as omeprazole and lansoprazole are also used to treat ulcers. Inhibitors H *, K + - ATPase inhibit the production of enzymes used by the stomach to secrete acids. Side effects associated with H "1", K + - ATPase inhibitors include nausea, diarrhea, abdominal cramping, pain head, dizziness, drowsiness, skin rash and elevated plasma aminotransferase activity. Sucralfate is also used to treat ulcers. Sucralfate adheres to epithelial cells and is thought to form a protective layer at the base of an ulcer to promote its healing. However, sucralfate can cause constipation, dry mouth and interfere with the absorption of other drugs. Antibiotics are used when Helicobacter pylori is the main cause of the ulcer. Frequently, antibiotic therapy is coupled with the administration of bismuth compounds such as bismuth subsalicylate and bismuth citrate colloid! It is believed that bismuth compounds increase mucosal secretion and HCO3", inhibit peptic activity and act as an antibacterial against H. pylori, however, ingestion of bismuth compounds can produce high plasma concentrations of Bi + 3 and They can interfere with the absorption of other drugs Prostaglandin analogs, such as misoprostatic, inhibit acid secretion and stimulate mucous and bicarbonate secretion and are also used to treat ulcers, especially ulcers in patients requiring non-steroidal anti-inflammatory drugs. Nevertheless, effective oral doses of prostaglandin analogs can cause diarrhea and abdominal pain. Likewise, some prostaglandin analogs are abortive. The carbenoxolone, a mineral corticoid, can also be used to treat ulcers. The carbenoxolone seems to alter the composition and amount of mucosa, thus increasing the mucosal barrier. However, carbenoxolone can cause retention of Na + and fluids, hypertension, hypokalemia and impaired glucose tolerance. Muscarinic cholinergic antagonists such as pirenzapine and telenzapine can also be used to reduce acid secretion and treat ulcers. Side effects of muscarinic cholinergic antagonists may include dry mouth, blurred vision and constipation. The Merck Manual of Medical Information 496-500 (R. Berkow ed., 1997) and Goodman and Gilman's The Pharmacological Basis of Therapeutics 901-915 (J. Hardman and L. Limbird eds., 9 a.m. 1996). Inflammatory bowel disease (IBD) is a chronic disorder in which the intestine becomes inflamed, often producing abdominal pain and diarrhea. The two classes of IBD are Crohn's disease and ulcerative colitis.

Crohn's disease, which may include regional enteritis, granulomatous ileitis, and ileocolitis, is a chronic inflammation of the intestinal wall. Crohn's disease occurs equally in both sexes and is more common in Jews with Western European ancestry. Most cases of Crohn's disease begin before the age of 30, and most of them start between 1.4 and 24 years of age. The disease usually affects the total thickness of the intestinal wall. Generally, the disease affects the lower portion of the small intestine (ileus) and the large intestine, but it can occur anywhere in the digestive tract. The first symptoms of Crohn's disease are chronic diarrhea, pain from abdominal cramping, fever, loss of appetite and weight loss. Complications associated with Crohn's disease include the development of intestinal obstructions, abnormal connection channels (fistulas) and abscesses. The risk of cancer in the large intestine increases in people with Crohn's disease. Frequently, Crohn's disease is associated with other disorders such as gallstone, inadequate absorption of nutrients, amyloidosis, arthritis, episcleritis, aged stomatitis, erythema nodosa, pyoderma gangrenosum, ankylosing spondylitis, sacroiliitis, uveitis, and primary sclerose cholangitis. There is no known treatment for Crohn's disease. Cramps and diarrhea, side effects associated with Crohn's disease, can be relieved with anticholinergic drugs, diphenoxylate, loperamide, deodorized opium dye or codeine. Generally, the drug is administered orally before meals. A wide range of antibiotics are usually administered to treat the symptoms of Crohn's disease. The antibiotic metranidazole is frequently administered when the disease affects the large intestine or causes abscesses and fistulas around the anus. However, prolonged use of metranidazole can damage the nerves, resulting in a tingling sensation in the arms and legs. Sulfasalazine and chemically related drugs can suppress mild inflammation, especially in the large intestine. However, these drugs are less effective in severe sudden inflammations. Corticosteroids, such as prednisone, reduce fever and diarrhea as well as abdominal pain and tenderness. However, a prolonged corticosteroid therapy inevitably results in serious side effects such as high blood sugar, increased risk of infection, osteoporosis, fluid retention, and skin fragility. Drugs such as azathioprine and mercaptopurine they can compromise the immune system and are frequently effective in patients with Crohn's disease who do not respond to other drugs. However, these drugs generally need between 3 to 6 months before producing benefits and can cause serious side effects such as allergy, pancreatitis and low white cell counts. When Crohn's disease causes the bowel to become clogged or when abscesses or fistulas do not heal, surgery may be necessary to remove diseased sections of the intestine. However, surgery does not cure the disease, and inflammation usually returns when the bowel is reattached. In almost half of the cases, a second surgery is necessary. The Merck Manual of Medical Information 528-530 (R. Berkow ed., 1997). Ulcerative colitis is a chronic disease in which the large intestine becomes inflamed and ulcerated, producing episodes of diarrhea with bleeding, abdominal pain and fever. Ulcerative colitis usually starts between 15 and 30 years; However, a group of people have their first attack between 50 and 70 years. Unlike Crohn's disease, ulcerative colitis never affects the small intestine and does not affect the total thickness of the intestine. The disease usually begins in the rectum and sigmoid colon and eventually extends partially or completely through the large intestine. The cause of ulcerative colitis is not known. The treatment of ulcerative colitis is aimed at controlling inflammation, reduce symptoms and replace lost fluids and nutrients. Irritable bowel syndrome ("IBS") is a mobility disorder of the entire gastrointestinal tract, which causes abdominal pain, constipation, and / or diarrhea. IBS affects three times more women than men. There are two main types of IBS. The first type, spastic colon type, is commonly triggered by eating and usually produces constipation and diarrhea with pain. Usually blood appears in the stool. Pain may occur in attacks of constant weak pain, usually in the lower abdomen. The person suffering from spastic colon IBS may experience swelling, gas, nausea, headache, fatigue, depression, anxiety and difficulty concentrating. The second type of IBS usually produces diarrhea without pain or constipation. Diarrhea can start suddenly and with extreme urgency. Often, diarrhea occurs after a meal and sometimes immediately after waking up.

The treatment of IBS generally involves modifications in the diet of the patient with IBS. It is often recommended that a patient with IBS avoid beans, cabbage, sorbitol and fructose. A diet low in fat and high in fiber can also help some patients with IBS. Physical activity on a regular basis can also help keep the gastrointestinal tract working correctly. Drugs such as propantheline that decrease gastrointestinal tract function are not generally effective in treating IBS. Antidiarrheal drugs, such as diphenoxylate and loperamide, help with diarrhea. The Merck Manual of Medical Information 525-526 (R. Berkow ed., 1997). Certain pharmaceutical agents have been administered to treat addictions. The U.S. Patent No. 5,556,838 to Mayer et al discloses the use of non-toxic blocking agents NMDA co-administered with an addictive substance to prevent the development of withdrawal symptoms. U.S. Patent No. 5,574,052 to Rose et al. describes the co-administration of an addictive substance with an antagonist to partially block the pharmaceutical effect of the addictive substance. U.S. Patent No. 5,075,341 to Mendelson et al. describes the use of an opioid agonist / antagonist mixture to treat addictions to cocaine and opium. U.S. Patent No. 5,232,934 to Downs describes the administration of 3-phenoxypyridine to treat addiction. U.S. Patent Nos. 5,039,680 and 5,198,459 to Imperato et al. describes the use of a serotonin antagonist to treat a chemical addiction. U.S. Patent No. 5,556,837 to Nestler et. to the. describes how BDNF or NT-4 growth factors are infused to inhibit or reverse adaptive neurological changes that correlate with behavioral changes in an addict. U.S. Patent No. 5,762,925 to Sagan discloses implanting adrenal medullary cells encapsulated in the central nervous system of the animal to inhibit the development of opioid intolerance. U.S. Patent No. 6,204,284 to Beer et al. describes (±) -l- (3,4-dichlorophenyl) -3-azabicyclo [3.1.0] racemic hexane for use in the prevention or alleviation of a withdrawal syndrome resulting from drug addiction and for the treatment of chemical dependencies . Without treatment, Parkinson's disease evolves into a rigid akinetic state where patients are unable to take care of themselves. Death occurs frequently as a result of complications resulting from immobility, including aspiration pneumonia or pulmonary embolism. Drugs commonly used for the treatment of Parkinson's disease include carbidopa / levodopa, pergolide, bromocriptine, selegiline, amantadine, and trihexyphenidyl hydrochloride. However, the need for drugs useful for the treatment of Parkinson's disease and with a better therapeutic profile persists. Anxiety is a fear, apprehension or panic of imminent danger commonly accompanied by restlessness, tension, tachycardia and dyspnea. Currently, benzodiazepines are the most used anti-anxiety agents for generalized anxiety disorders. However, benzodiazepines carry the risk of producing cognitive impairments and specialized motor functions, particularly in the elderly, which can lead to confusion, delirium and falls with fractures. Sedatives are also commonly prescribed to treat anxiety. Azapirones, such as buspirone, are also used to treat moderate anxiety. However, azapirones are less useful for treating severe anxiety accompanied by panic attacks. Epilepsy is a disorder characterized by the tendency to have recurrent attacks. Examples of drugs to treat seizures and epilepsy include carbamazepine, ethosuximide, gabapentin, lamotrigine, phenobarbital, phenytoin, primidone, volproic acid, trimethadione, benzodiazepines,? -vinyl GABA, acetazolamide, and felbamate. However, anti-seizure drugs may have side effects such as drowsiness, hyperactivity, hallucinations, inability to concentrate, central and peripheral nervous system toxicity, such as nystagmus, ataxia, diplopia, and vertigo.; gingival hyperplasia; gastrointestinal disturbance such as nausea, vomiting, epigastric pain, and anorexia; endocrine effects such as inhibition of antidiuretic hormone, hyperglycemia, glycosuria, osteomalacia; and hypersensitivity such as scarlatiniform rash, morbilliform rash, Stevens-Johnson syndrome, systemic lupus erythematosus, and hepatic necrosis; and hematological reactions such as red cell aplasia, agranulocytosis, thrombocytopenia, aplastic anemia and megaloblastic anemia. The Merck Manual of Medical Information 345-350 (R. Berkow ed., 1997). The symptoms of heart attacks vary depending on the part of the affected brain. Symptoms include loss or abnormal sensation in an arm or leg or side of the body, weakness or paralysis of an arm or leg or side of the body, partial loss of vision or hearing, double vision, dizziness, slurred speech, difficulty thinking about the correct word or saying it, inability to recognize body parts, unusual movement, loss of bladder control, imbalance, falls and fainting. Symptoms may be permanent and may be associated with coma or stupor. Examples of drugs for treating heart attacks include anticoagulants such as heparin, drugs that dissolve clots such as streptokinase or plasminogen tissue activator, and drugs that reduce swelling such as mannitol or corticosteroids. The Merck Manual of Medical Information 352-355 (R. Berkow ed., 1997). Itching in an unpleasant sensation that induces scratching. Usually, pruritus is treated by ultraviolet B or PUVA phototherapy or by therapeutic agents such as naltrexone, nalmefene, danazol, tricyclics and antidepressants. Selective antagonists of the metabotropic glutamate receptor 5 ("mGluR5") have been shown to exert an analgesic activity in the animal model in vivo (K. Walker et al, Neuropharmacology 40: 1-9 (2000) and A. Dogrul et al, Neuroscience Letters, 292 (2): 115-118 (2000)). Selective antagonists of the mGluR5 receptor have also been shown to exert anxiolytic and anti-depressant activity in the animal model in vivo (E. Tatarczynska et al, Br. J. Pharmacol. 132 (7): 1423-1430 (2001) and PJM Will et al. al, Trends in Pharmacological Sciences 22 (7): 331-37 (2001)). Selective antagonists of the mGluR5 receptor have also been shown to exert an anti-Parkinson activity in vivo (KJ Ossowska et al, Neuropharmacology 41 (4): 413-20 (2001) and PJM Will et al, Trends in Pharmacological Sciences 22 (7): 331 -37 (2001)). Selective antagonists of the mGluR5 receptor have also been shown to exert an anti-dependent activity in vivo (C. Chiamulera et al, Nature Neuroscience 4 (9): 873-74 (2001)). U.S. Patent No. 6,495,550 to McNaughton-Smith et al. describes pyridine substituted benzanilides useful as potassium ion channel cleaners. International Publication No. WO 94/05153 discloses substituted benzene compounds useful as herbicides. International Publication No. WO 04/058762 discloses 9-substituted bicyclic compounds useful as MK-2 inhibitors.

United Kingdom Application No. GB 2 276 162 describes aniline and benzanilide compounds useful for treating central nervous system disorders, endocrine disorders and sexual dysfunction. United Kingdom Application No. GB 2 276 163 describes pyridine compounds useful for treating central nervous system disorders, endocrine disorders and sexual dysfunction. European Application No. EP 533267 describes benzanilide compounds useful as 5-HT1D antagonists. The published application of the United States of America No. US 2003/0153596 to Young Ger Suh discloses thiourea derivatives useful as modulators of vanilloid receptors. There is a need in the art for compounds that are useful for treating or preventing pain, Ul, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, infarction, attack, a pruritic condition, psychosis , memory deficit, restricted brain function, Huntington's disease, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia or depression in an animal. The mention of any reference in Section 2 of the present application should not be considered as an admission that such reference is prior art to the present application.

Summary of the Invention The present invention comprises compounds of the formula (I): and pharmaceutically acceptable salts thereof, wherein Aii is Ar2 is X is O or S; Ri is -halo, -CH3, -C (halo) 3, -CH (halo) 2, or -CH2 (halo); each R2 is independently: (a) -halo, -OH, -NH2, -CN, or -NO2; (b) - (d-Cioalkyl, - (C2-C10) aikenyl, - (C2-C10) alkynyl, - (C3-C ^ cycloalkyl, - (C8-C? 4) bicycloalkyl, - (C8-C14) tricycloalkyl , - (C5-C? O) cycloalkenyl, - (C8-C14) bicycloalkenyl, - (C8-C1) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups, or (c) -phenyl, -nanel, - (C? 4) aryl or - (5- to 10-bodies) heteroaryl, each of which it is substituted or not with one or more Re groups; each R3 is independently: (a) -halo, -CN, -OH, -NO2, or -NH2; (b) - (d-Cioalkyl, - (C2-C10) alkenyl, - (C2-C10) alkynyl, - (C3-C10) cycloalkyl, - (C8-C? 4) bicycloalkyl, - (C8-C? 4 ) tricycloalkyl, - (C5-C10) cycloalkenyl, - (Cs-C? 4) bicycloalkenyl, (C8-C14) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle , each of which is substituted or not with one or more R5 groups, or (c) -phenyl, -naphthyl, - (C14) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or not with one or more R $ groups; each R5 is independently -CN, -OH, - (C2-C6) alkenyl, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7 , -S (O) R7, or -S (0) 2R7; each R ^ is independently - (Ci-Cd ^ alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7 each R is independently -H, - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-Cs) cycloalkyl, - (Cs-Csj-cycloalkenyl, -phenyl, - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, or CH2 (halo); each Rs is independently - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3 , -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, - S (O) R7, or -S (O) 2R7; each Ru is independently - (Q-Cealkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, (C3-C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo) 3 , -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each halo is independently -F, -Cl, - Br, or -I; m is an integer in a range from 0 to 4, or is an integer in a range from 0 to 4; p is an integer in a range from 0 to 2; q is an integer in a range from 0 to 6; r is an integer in a range from 0 to 5; and s is an integer in a range from 0 to 4. The invention further comprises compounds of the formula (II): (H) and pharmaceutically acceptable salts thereof, wherein Ar2 is X is O or S; Rx is -halo, -CH3, -C (halo) 3, -CH (haIo) 2, or -CH2 (halo); each R2 is independently: (a) -halo, -OH, -NH2, -CN, or -NO2; (b) - (C? -C? o) alkyl, - (C2-C10) alkenyl, - (C2-C10) alkynyl, - (C3-C10) cycloalkyl, - (C8-C14) bicycloalkyl, - (C8-C14) tricycloalkyl, - (C5-C10) cycloalkenyl, - (C8-C1) bicycloalkenyl, - (C8-C? 4) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups; or (c) -phenyl, -naphthyl, - (C1) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or not with one or more Re groups; each R5 is independently -CN, -OH, - (C? -C6) alkyl, - (C2-C6) alkenyl, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH , '-OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (0) 2R7; each Re is independently - (C? -Ce) alkyl, - (C2-Ce) alkenyl, - (C2-Ce) alkynyl, - (C3C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (0) OR7, -SR7, -S (0) R7, or -S (0) 2R7; each R7 is independently -H, - (C? -Ce) alkyl, - (C2-Ce) alkenyl, - (C2-Ce) alkynyl, - (C3-C8) cycloalkyl, - (C5-Cs) cycloalkenyl, -phenyl , - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, or CH2 (halo); each Rs is independently - (C1-Ce) alkyl, - (C2-Ce) alkenyl, - (C2-Ce) alkynyl, - (C3-C8) cycloalkyl, - (C5-Cs) cycloalkenyl, -phenyl, -C ( halo) 3, -CH (halo) 2, -CH 2 (halo), -CN, -OH, -halo, -N 3, -NO 2, -N (R 7) 2, -CH = NR 7, -NR 7 OH, -OR 7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each Rp is independently - (C1-Ce) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, (C3-Cs) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo ) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, - COR7, -C (O) OR7, -OC () R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each halo is independently -F, -Cl, -Br, or -I; n is an integer in a range from 0 to 3; or is an integer in a range from 0 to 4; q is an integer in a range from 0 to 6; r is an integer in a range from 0 to 5; and s is an integer in a range from 0 to 4.

A compound of formula (I) or (II) or a pharmaceutically acceptable salt thereof (a "Phenylene Compound") is useful for treating or preventing Ul, an ulcer, IBD, IBS, an addictive disorder, Parkinson's disease, Parkinsonism, anxiety, epilepsy, heart attack, an attack, a pruritus condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's disease, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, or depression (each being a "Condition") in an animal. The invention also relates to compositions containing an effective amount of a Phenylene Compound and a pharmaceutically acceptable carrier or excipient. The compositions are useful for treating or preventing a Condition in an animal. The invention also relates to methods for treating a Condition, comprising administering to an animal, in need thereof, an effective amount of a Phenylene Compound. The invention also relates to methods for preventing a Condition, which comprises administering to an animal in need thereof an effective amount of a Phenylene Compound. The invention further relates to methods for inhibiting the function of the Vanilloid Receptor 1 ("VR1") in a cell, which comprises contacting a cell capable of expressing VR1 with an effective amount of a Phenylene Compound. The invention further relates to methods for inhibiting mGluRi function in a cell, which comprises contacting a cell capable of expressing mGluR5 with an effective amount of a Phenylene Compound. The invention further relates to methods for inhibiting the function of the metabotropic glutamate receptor 1 ("mGluRl") in a cell, which comprises contacting a cell capable of expressing mGluRl with an effective amount of a Phenylene Compound. The invention further relates to a method for preparing a composition comprising the step of mixing a Phenylene Compound and a pharmaceutically acceptable carrier or excipient. The invention further relates to a kit comprising a container containing an effective amount of Phenylene Compound.

The present invention can be understood in greater depth a. through the following detailed description and illustrative examples, which are intended to exemplify preferred, but not exclusive, embodiments of the invention.

Detailed description of the invention Phenylenes Compound of Formula (I) As indicated above, the present invention comprises Phenylenes Compound of Formula (I) (I) wherein Ari, Ar2, R3, X, and m are defined above for Phenylene Compounds of the formula (I). In one embodiment, Ari is a pyrimidyl group. In another embodiment, Ari is a pyrazinyl group. In another embodiment, Ari is a pyridazinyl group. In another modality, Ar! It is a thiadiazolyl group. In another embodiment, X is O. In another embodiment, X is S. In another embodiment, Ar2 is a benzoimidazolyl group. In another embodiment, Ar2 is a benzothiazolyl group.

In another embodiment, Ar2 is a benzooxazolyl group. In another modality, Ar2 is In another modality, Ar2 is In another modality, Ar2 is In another modality, Ar2 is In another mode, m is 0. In another mode, m is 1. In another mode, m is 2. In another mode, m is 3. In another mode, m is 4. Otherwise, p is 0. In another mode, m is modality, p is 1. In another modality, p is 2.

In another mode, or is 0.

In another modality, or is 1.

In another modality, or is 2.

In another modality, or is 3. In another modality, or is 4.

In another modality, q is 0.

In another modality, q is 1.

In another mode, q is 2.

In another modality, q is 3. In another mode, q is 4.

In another modality, q is 5.

In another modality, q is 6.

In another modality, r is 0.

In another mode, r is 1. In another mode, r is 2.

In another mode, r is 3.

In another modality, r is 4.

In another modality, r is 5.

In another mode, s is 0. In another mode, s is 1.

In another modality, s is 2.

In another modality, s is 3.

In another modality, s is 4.

In another modality, s is 5. In another modality, Ri is -halo.

In another modality, Ri is -Cl.

In another mode, Ri is -Br. In another modality, R) is -I. In another mode, R! is -F. In another mode, Ri is -CH3. In another embodiment, Ri is -C (halo) 3. In another embodiment, R i is -CH (halo) 2. In another embodiment, Ri is -CH2 (halo). In another embodiment, p is 1 and R2 is -halo, -OH, -NH2, -CN, or -NO2. In another embodiment, p is 1 and R2 is - (C? -C? O) alkyl, - (C2-C10) alkenyl, - (C2-C? O) alkynyl, - (C3-C? O) cycloalkyl, - (Cs-C?) Bicycloalkyl, - (C8-C?) Tricycloalkyl, - (C5-C10) cycloalkenyl, - (C8-C14) bicycloalkenyl, - (C8-C14) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups. In another embodiment, p is 1 and R2 is -phenyl, -naphthyl, - (C? 4) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or not with one or more groups Re .

In another embodiment, m is 1 and R3 is -halo, -CN, -OH, -N02, or -NH2. In another embodiment, m is 1 and R3 is - (C? -C1o) alkyl, - (C2-C! O) alkenyl, - (C2-C? O) alkynyl, - (C3-C1o) cycloalkyl, - (Cg) -C?) Bicycloalkyl, - (Cg-C? 4) tricycloalkyl, - (C5-C? O) cycloalkenyl, - (C8-C? 4) bicycloalkenyl, - (C8-C14) tricycloalkenyl, - (3- to 7) -bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups. In another embodiment, m is 1 and R3 is -phenyl, -naphthyl, - (C? 4) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or not with one or more groups Re .

In another embodiment, m is 1 and R3 is - (C? -C?) Alkyl. In another embodiment, m is 1 and R3 is -CH3. In another mode, m is 1 and R3 is -halo. In another mode, m is 1 and R3 is -Cl. In another mode, m is 1 and R3 is -Br.

In another mode, m is 1 and R3 is -I. In another mode, m is 1 and R3 is -F. In another embodiment, Ar2 is a benzothiazolyl group and s is 1. Otherwise, Ar2 is a benzoimidazolyl group and s is 1.

In another embodiment, Ar2 is a benzooxazolyl group and s is 1.

In another modality, Ar2 is (R8) or! and o is 1. In another mode, Ar2 is and o is 1. In another mode, Ar2 is and r is 1. In another mode, Ar2 is and q is 1.

In another mode, Ar 2 is a benzothiazolyl group, s is 1, and R 8 is -halo or - (Ci-Cß) alkyl. In another embodiment, Ar2 is a benzoimidazolyl group, s is 1, and Rs is -halo or - (Ct-C6) alkyl. In another embodiment, Ar2 is a benzooxazolyl group, s is 1, and Rs is -halo or - (C \ - C6) alkyl. In another modality, Ar2 is or is 1, and Rs is -halo or - (Ci-Cß) alkyl. In another mode, Ar2 is or is 1, and Rs is -halo or - (Ci-Cß) alkyl. In another mode, Ar2 is. r is 1, and Rs is -halo or - (-Cd) alkyl. In another modality, Ar2 is q is 1, and Rp is -halo or - (Ci-Cß) alkyl. In another mode, Ar2 is r is 1, and Rs is in the para-position of the phenyl ring. In another embodiment, Aiy is a pyrazinyl group, X is O, m is 0, and Ar2 is a benzothiazolyl group. In another modality, Ar! is a pyrazinyl group, X is O, m is 0, and Ar2 is a benzooxazolyl group. In another embodiment, A ^ is a pyrazinyl group, X is O, m is 0, and Ar2 is a benzoimidazolyl group. In another mode, Ar! is a pyrazinyl group, X is O, m is 0, and Ar2 is In another mode, Ar! is a pyrazinyl group, X is O, m is 0, and Ar2 is In another mode, Ari is a pyrazinyl group, X is O, m is 0, and Ar2 is In another mode, Ar! is a pyrazinyl group, X is O, m is 0, and Ar2 is In another embodiment, Ari is a pyrazinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is a - (dC ^ alkyl.) In another embodiment, the - (C? -Ce) alkyl is substituted in the ara-position of the phenyl group In another embodiment, the - (C? -Ce) alkyl is a tert-butyl group In another embodiment, the - (C! -Ce) alkyl is a tert-butyl group and is substituted at the p-group position. In a different mode, the - (C! -Ce) alkyl is a ¿me-propyl group and is substituted in the ara-position of the phenyl group.

In another modality, Ar! is a pyrazinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -CF3. In another embodiment, -CF3 is substituted at the 4-position of the phenyl group.

In another mode, Ari is a pyrazinyl group, X is O, r is 1, m is 0, Ar2 is and R8 is -halo. In another embodiment, the -halo is substituted in the para-position of the phenyl group. In another modality, -halo is -Cl. In another embodiment, -halo is -Cl and it is substituted in the ara-position of the phenyl group. In another modality, -halo is -Br, In another modadad, -halo is -Br and is substituted in the para-position of the phenyl group. In another modality, -halo is -I. In another modality, -halo is -I and is substituted in the para-position of the phenyl group. In another mode, -halo is -F. In another embodiment, -halo is -F and it is substituted in the para-position of the phenyl group.

In another embodiment, An is a pyrimidinyl group, X is O, m is 0, and Ar2 is a benzothiazolyl group. In another modality, Ar! is a pyrimidinyl group, X is O, m is 0, and Ar2 is a benzooxazohlo group. In another embodiment, Ari is a pyrimidinyl group, X is O, m is 0, and Ar2 is a benzoimidazolyl group. In another mode, Arj is a pyrimidinyl group, X is O, m is 0, and Ar2 is In another modality, Ar! is a pyrimidinyl group, X is O, m is 0, and Ar2 is In another embodiment, Aii is a pyrimidinyl group, X is O, m is 0, and Ar2 is In another mode, An is a pyrimidinyl group, X is O, m is 0, and Ar2 is In another modality, Ar! is a pyrimidinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is a - (C! -Ce) alkyl. In another embodiment, the - (C! -C6) alkyl and is substituted in the para-position of the phenyl group. In another embodiment, the - (C? -Ce) alkyl is a tert-butyl group. In another embodiment, the - (C -Calkyl is a tert-butyl group and is substituted in the para-position of the phenyl group.) In another mode, the - (C? -Ce) alkyl is a so-propyl group. modahdad, the - (C? -Ce) alkyl is a ys-propyl group and is substituted in the para-position of the phenyl group.

In another embodiment, Ari is a pyrimidinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -CF3. In another mode, -CF3 is substituted at the 4-position of the phenyl group.

In another modality, Ar! is a pyrimidinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -halo. In another embodiment, the -halo is substituted in the para-position of the phenyl group. In another modality, -halo is -Cl. In another modality, -halo is -Cl and it is substituted in the para-position of the phenyl group. In another modality, -halo is -Br. In ofra modality, -halo is -Br and is substituted in the / rare-position of the phenyl group. In ofra modality, -halo is -I. In another modality, -halo is -I and is substituted in the para-position of the phenyl group. In other modality, -halo is -F and it is substituted in the para-position of the phenyl group.

In other embodiment, Ari is a pyridazinyl group, X is O, m is 0, and Ar 2 is a benzothiazolyl group. In other embodiment, Ari is a pyridazinyl group, X is O, m is 0, and Ar2 is a benzooxazolyl group. In another mode, Ar! is a pyridazinyl group, X is O, m is 0, and Ar2 is a benzoimidazolyl group. In another modality, Ar! is a pyridazinyl group, X is O, m is 0, and Ar2 is In another embodiment, Ari is a pyridazinyl group, X is O, m is 0, and Ar2 is In ofra modality, Ari is a pyridazinyl group, X is O, m is 0, and Ar2 is In another mode, Ari is a pyridazinyl group, X is O, m is 0, and Ar2 is In another embodiment, Ari is a pyridazinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is a - (C? -Ce) alkyl. In another embodiment, the - (C? -Ce) alkyl is substituted in the para-position of the phenyl group. In another embodiment, the - (C? -Ce) alkyl is a tert-butyl group. In other embodiment, the - (C! -Ce) alkyl is a tert-butyl group and is substituted in the para-position of the phenyl group. In another embodiment, the - (C? -Ce) alkyl is an ss-propyl group. In another embodiment, the - (C? -Ce) alkyl is an io-propyl group and is substituted at the ara-position of the phenyl group.

In ofra modality, Ari is a pyridazinyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -CF3. In modernity, -CF3 is substituted in the jara-position of the phenyl group.

In another embodiment, Ari is a pyridazinyl group, X is O, r is 1, m is 0, Ar2 is and Rg is -halo. In another embodiment, the -halo is substituted in the jara-position of the phenyl group. In another modality, -halo is -Cl. In other modality, -halo is -Cl and it is substituted in the para-position of the phenyl group. In ofra modahdad, -halo is -Br. In another modality, -halo is -Br and is substituted in the / jara-position of the phenyl group. In another modality, -halo is -I. In other modality, -halo is -I and it is substituted in the para-position of the phenyl group. In ofra modahdad, -halo is -F. In another modality, -halo is -F and is substituted in the p ara-position of the phenyl group.

In another modality, Ar! is a thiadiazolyl group, X is O, m is 0, and Ar2 is a benzothiazolyl group. In another modality, Ar! is a thiadiazolyl group, X is O, m is 0, and Ar2 is a benzooxazolyl group. In another modality, Ar! is a thiadiazolyl group, X is O, m is 0, and Ar2 is a benzoimidazolyl group. In other modality, Ari is a thiadiazolyl group, X is O, m is 0, and Ar2 is In ofra modality, Ar! is a thiadiazolyl group, X is O, m is 0, and Ar2 is In ofra modality, Ari is a tiadiazohlo group, X is O, m is 0, and Ar2 is In other modality, Ari is a thiadiazolyl group, X is O, m is 0, and Ar2 is I av.

In ofra modality, Aii is a thiadiazolyl group, X is O, r is 1, m is 0, Ar2 is and Rs is a - (C! -Ce) alkyl. In another mode, the - (C! -Ce) alkyl is substituted in the para-position of the phenyl group. In another embodiment, the - (d-C-alkyl) is a tert-butyl group In another embodiment, the - (C [beta] -e) alkyl is a tert-butyl group and is substituted at the p-group position. embodiment, the - (C? -Ce) alkyl is a wo-propyl group In another embodiment, the - (C? -Ce) alkyl is a so-propyl group and is substituted on the para-position of the phenyl group.

In another modality, Ar! is a thiadiazolyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -CF3. In another embodiment, -CF3 is substituted in the / ra-position of the phenyl group.

In another modality, Ar! is a thiadiazolyl group, X is O, r is 1, m is 0, Ar2 is and Rs is -halo. In another embodiment, the -halo is substituted in the para-position of the phenyl group. In another modality, -halo is -Cl. In ofra modahdad, -halo is -Cl and is substituted in the ra-position of the phenyl group. In another modality, -halo is -Br. In another modality, -halo is -Br and it is substituted in the para-position of the phenyl group. In another modality, -halo is -I. In another mode, -halo is -I and is substituted in the para-position of the phenyl group. In another modality, -halo is -F. In another embodiment, -halo is -F and it is substituted in the para-position of the phenyl group.

In the compounds Phenylenes having a group R3, the group R3 can be attached to a carbon atom in the 2-, 3-, 5- and / or 6- position of the phenylene ring. In one embodiment, a group R3 is attached to the carbon in the 2- position of the phenylene ring. In another embodiment, a group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, a group R3 is attached to the carbon of the 5-position of the phenylene ring. In another embodiment, a group R3 is attached to the carbon in the 6-position of the phenylene ring. In another embodiment, a group R3 is a group - (C? -C?) Alkyl and the group R3 is attached to the carbon at the 2- position of the phenylene ring. In another embodiment, one group R3 is a group - (C! -do) alkyl and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In other mode, a group R3 is a group - (C? -do) alkyl and the group R3 is attached to the carbon in the 5- position of the phenylene ring. In another embodiment, a group R3 is a group - (d-C? O) alkyl and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another modality, a group R3 is -CH3 and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In another mode, one group R3 is -CH3 and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, one group R3 is -CH3 and the group R3 is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, a group R3 is -CH3 and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another embodiment, a group R3 is -halo and the group R3 is attached to the carbon at the 2-position of the phenylene ring. In other mode, a group R3 is -halo and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, a group R3 is -halo and the group R3 is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, a group R3 is -halo and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another embodiment, a group R3 is -Cl and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In other mode, a group R3 is -Cl and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In other mode, a group R3 is -Cl and the group R3 is attached to the carbon in the 5- position of the phenylene ring. In another embodiment, one group R3 is -Cl and the group R3 is attached to the carbon in the 6- position of the phenylene ring.

In another embodiment, one group R3 is -Br and the group R3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, a group R3 is -Br and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In the present case, a group R3 is -Br and the group R3 is attached to the carbon in the 5- position of the phenylene ring. In another embodiment, a group R3 is -Br and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another embodiment, a group R3 is -F and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In another embodiment, a group R3 is -F and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, a group R3 is -F and the group R3 is attached to the carbon at the 5-position of the phenylene ring. In another embodiment, a group R3 is -F and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another embodiment, a group R3 is -I and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In other mode, a group R3 is -I and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In other mode, a group R3 is -I and the group R3 is attached to the carbon in the 5- position of the phenylene ring. In another embodiment, a group R3 is -I and the group R3 is attached to the carbon in the 6- position of the phenylene ring. In another embodiment, m is 1, the group R3 is a group - (C? -C?) Alkyl, and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In another embodiment, m is 1, the group R3 is a group - (C? -C?) Alkyl, and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, m is 1, the group R 3 is -CH 3, and the group R 3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the group R3 is -CH3, and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, m is 1, the group R3 is -halo, and the group R3 is attached to the carbon in the 2- position of the phenylene ring. In other mode, m is 1, the group R3 is -halo, and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In the present case, m is 1, the group R 3 is -Cl, and the group R 3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the group R3 is -Cl, and the group R3 is attached to the carbon in the 3- position of the phenylene ring.

In another embodiment, m is 1, the group R3 is -Br, and the group R3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the group R3 is -Br, and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, m is 1, the group R 3 is -F, and the group R 3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the group R3 is -F, and the group R3 is attached to the carbon in the 3- position of the phenylene ring. In another embodiment, m is 1, the group R3 is -I, and the group R3 is attached to the carbon at the 2-position of the phenylene ring. In another embodiment, m is 1, the group R3 is -I, and the group R3 is attached to the carbon in the 3- position of the phenylene ring.

Phenylene Compounds of the Formula (11) The invention also relates to Phenylene Compounds of the formula (II) (fl) wherein Ri, R2, Ar2, X, and n are defined above for the Phenylene Compounds of the formula (II). In one modality, X is O. In another modality, X is S.

In another embodiment, Ar2 is a benzoimidazolyl group. In another embodiment, Ar2 is a benzothiazolyl group. In other mode, Ar2 is a benzooxazolyl group. In another mode, Ar2 is In othea modadad, Ar2 is In othea modadad, Ar2 is In another mode, Ar2 is In another modality, n is 0. In another modality, n is 1. In another modality, n is 2. In another modality, n is 3. In another modality, or is 0. In another modality, or is 1.

In another modality, or is 2.

In another modality, or is 3.

In another modality, or is 4.

In another modality, q is 0. In another modality, q is 1.

In another modality, q is 2.

In another modality, q is 3.

In othe modahdad, q is 4.

In another modality, q is 5. In another modality, q is 6.

In another modality, r is 0.

In other mode, r is 1.

In another mode, r is 2. In another mode, r is 3. In another mode, r is 4.

In another mode, r is 5. In another mode, s is 0. In another mode, s is 1. In another mode, s is 2. In another mode, s is 3.

In another modality, s is 4. In another modality, R i is -halo. In another modality, Ri is -Cl. In another mode, Ri is -Br. In other mode, Ri is -I.

In another mode, Ri is -F.

In another modality, Ri-is CH3. In another mode, Ri is -C (halo) 3. In other mode, Ri is -CH (halo) 2. In another mode, Ri is -CH2 (halo). In another mode, n is 1 and R2 is -halo, -OH, -NH2, -CN, or -NO2. In another embodiment, n is 1 and R2 is - (C? -C? O) alkyl, - (C2-C? 0) alkenyl, - (C2-do) alkynyl, - (C3-C! O) cycloalkyl, - (C8-C? 4) bicycloalkyl, - (C8-C? 4) tricycloalkyl, - (C5-C? O) cycloalkenyl, - (Cs-C? 4) bicycloalkenyl, - (C8-C?) Tricycloalkenyl, - ( 3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups. In another embodiment, n is 1 and R2 is -phenyl, -naphthyl, - (C? 4) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or not with one or more groups Re .

In another embodiment, Ar2 is a benzothiazole group and s is 1. In another embodiment, Ar2 is a benzoimidazolyl group and s is 1. In another embodiment, Ar2 is a benzooxazolyl group and s is 1. In other mode, Ar2 is 'I j-Í dJc and 0 is 1. In other mode, Ar2 is and o is 1. In another mode, Ar2 is and q is 1. In another mode, Ar2 is and r is 1. In another embodiment, Ar2 is a benzothiazolyl group, s is 1, and Rs is -halo or - (Ci-Cß) alkyl. In other mode, Ar2 is a benzoimidazolyl group, s is 1, and Rg is -halo or - (Ci-C6) alkyl. In another embodiment, Ar2 is a benzooxazolyl group, s is 1, and Rg is -halo or - (dC6) alkyl. In othea modadad, Ar2 is or is 1, and Rs is -halo or - (d-Cß) alkyl. In another mode, Ar2 is or is 1, and Rs is -halo or - (d-Cß) alkyl. In othea modadad, Ar2 is r is 1, and Rs is -halo or - (C? -C6) alkyl. In another mode, Ar2 is q is 1, and Rp is -halo or - (Ci-Cß) alkyl. In othea modadad, Ar2 is r is 1, and Rs is listed in the para-position of the phenyl ring. In another embodiment, X is O, and Ar2 is a benzothiazolyl group. In another embodiment, X is O, and Ar2 is a benzooxazolyl group.

In another embodiment, X is O, and Ar2 is a benzoimidazolyl group. In another mode, X is O, and Ar2 is In another modality, X is O, and Ar2 is.

In another mode, X is O, and Ar2 is In other mode, X is O, and Ar2 is Y In another modality, X is O, r is 1, Ar2 is and Rs is a - (d-Ce) alkyl. In another embodiment, the - (d-Ce) alkyl is substituted in the para-position of the phenyl group. In other mode, the - (d-C6) alkyl is a tert-butyl group. In another embodiment, the - (d-Ce) alkyl is a tert-butyl group and is substituted in the para-position of the phenyl group. In other modality, the - (C? -Ce) alkyl is a so-propyl group. In another embodiment, the - (d-Ce) alkyl is a so-propyl group and is substituted on the other-position of the phenyl group. In ofra modahdad, X is O, r is 1, Ar2 is and Rs is -CF3. In another embodiment, -CF3 is substituted in the para-position of the phenyl group. In another modality, X is O, r is 1, Ar2 is and Rg is -halo. In another mode, the -halo is substituted in the para-position of the phenyl group. In another mode, -halo is -Cl. In other mode, -halo is -Cl and it is substituted in the sara-position of the phenyl group. In another modality, -halo is -Br. In another modality, -halo is -Br and it is substituted in the para-position of the phenyl group. In another modality, -halo is -I. In another modality, -halo is -I and it is substituted in the sara_P0Sition of the phenyl group. In another mode, -halo is -F. In another modality, -halo is -F and it is substituted in the sara-position of the phenyl group. Optical isomers of Phenylene Compounds can be obtained by known techniques such as chiral chromatography or formation of distereomeric salts from an active acid or optional base. Additionally, one or more hydrogens, carbons or other atoms of a Phenylene compound can be replaced with an isotope of hydrogen, carbon or other atoms. Such compounds, which are encompassed by the present invention, are useful as research and diagnostic tools in pharmacokinetic metabolic studies and in binding studies.

Compounds Illustrative Phenylenes Compound Illustrative phenylenes are listed below in the Tables 1-10. For the chemical structure represented, for example, at the beginning of each of Tables 1-5, a is independently 0 or 1. When a = 0, the group in position "a" is -H. When a = 1, the group in position "a" (-Sa) is oteo different from -H, that is, is Rg.

For the chemical structure represented, for example, at the beginning of each of Tables 6-10, a is independently 0 or 1. When a = 0, the group in position "a" is -H. When a = 1, the group in position "a" ((R8) a) is oteo different from -H, that is, is Rg. For the chemical structure represented, for example, at the beginning of each of Tables 6-10, b is independently 0 or 1. When b = 0, the group in position "b" is -H. When b = 1, the group in position "b" ((Rg) b) is oteo different from -H, that is, is Rg. Table 1 (the) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) means that R3 is -H, that is, in formula (I) m = 0.

(Ib) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) means that R3 is -H, that is, in formula (I) m = 0.

Table 3 (le) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) means that R3 is -H, that is, in formula (I) m = 0.

Table 4 (Id) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) means that R3 is -H, that is, in formula (I) m = 0. Table 5 (He has) and pharmaceutically acceptable salts thereof, wherein: Table 6 and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; Y (f) means that R3 is -H, that is, in formula (I) m = 0. Table 7 (if) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) signifies that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) signifies that R3 is -H, that is, in formula (I) m = 0.

Table 8 and pharmaceutically acceptable salts thereof, wherein: a "Compound" column: (a) signifies that R3 is -CH3; (b) means that Rs is -Cl; (c) means that Rs is -Br; (d) means that R3 is -I; (e) means that R3 is -F; and (f) means that R3 is -H, that is, in formula (I) m = 0.

Table 9 (Ih) and pharmaceutically acceptable salts thereof, wherein: In the column "Compound": (a) it means that R3 is -CH3; (b) means that R3 is -Cl; (c) means that R3 is -Br; (d) means that R3 is -I; (e) signifies that R3 is -F; and (f) means that R3 is -H, i.e., in formula (I) m = 0.

Table 10 (pb) and pharmaceutically acceptable salts thereof, wherein: Definitions According to its use in connection with the Phenylene Compounds of this document, the terms used herein have the following meaning: "- (dC? O) alky" means a straight or branched chain of non-cyclic hydrocarbon having from 1 to 10 atoms linear carbon chain representative representative linear chain -. (! C -do) alkylS include -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, - n-octyl, -n-nonyl, and -n-decyl Representative branched - (C? -C?) alkyls includes -so-propyl, -sec-butyl, -so-butyl, -tert-butyl, -¿so-pentyl, -neopentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1 -dimetilpropilo, 1,2-dimethylpropyl, 1 -metilpentilo, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1 -etilbutilo, 2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl, 1-methylhexyl , 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 1,2-dimethylpentyl or, 1,3-dimethylpentyl, 1,2-dimethylhexyl, 1,3-dimethylhexyl, 3,3-dimethylhexyl, 1,2-dimethylheptyl, 1,3-dimethylheptyl, and 3,3-dimethylheptyl. "- (C? -Ce) alkyl" means a straight or branched chain of non-cyclic hydrocarbon having from 1 to 6 carbon atoms. Representative linear chain - (Ci-Ce) alkyls includes -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, and -n-hexyl. Representative branched - (C? -Ce) alkyl includes -so-propyl, -sec-butyl, -so-butyl, -tert-butyl, -so-pentyl, -neopentyl, 1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 1,1 -dimetilpropilo, 1,2-dimethylpropyl, 1 -metilpentilo, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 1-ethylbutyl, 2-ethylbutyl, 3-ethylbutyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,2-dimethylbutyl, 2,3-dimethylbutyl, and 3,3-dimethylbutyl. "- (C? -C4) alkyl" means a straight or branched chain of non-cyclic hydrocarbon having from 1 to 4 carbon atoms. Representative linear chain - (dC) alkyl includes -methyl, -ethyl, -n-propyl, and -n-butyl. Representative branched - (Ci-C4) alkyls includes -so-propyl, -sec-butyl, -so-butyl, and -tert-butyl. "- (C2-C? O) alkenyl" means a straight or branched chain of non-cyclic hydrocarbon having from 2 to 10 carbon atoms including at least one carbon-carbon double bond. Representative linear and branched chain (C2-C! O) alkenyl includes -vinyl, -ahyl, -1-butenyl, -2-butenyl, -so-butylenyl, -1-pentynyl, -2-pentenyl, - 3-methyl-1-butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2 -heptenyl, -3-heptenyl, -1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3 -Decent and similar.

"- (C2-C6) alkeni" means a straight or branched chain of non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at least one carbon-carbon double bond. representative straight chain and branched (C2-Ce) alquenils include -vinyl, -ahilo, -1-butenyl, -2-butenyl, -¿so-butylenyl, -1-pentenyl, -2-pentenyl, -3-methyl-l -butenyl, -2-methyl-2-butenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, 2-hexenyl, 3-hexenyl and the like. "- (C2-C1o) alkyne" means a straight or branched chain of non-cyclic hydrocarbon having from 2 to 10 carbon atoms and including at least one carbon-carbon triple bond. Representative linear or branched chain - (C2-C? O) alkynyl includes -acetylenyl, -propynyl, -l-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, -4-pentynyl, -1-hexynyl, -2-hexynyl, -5-hexynyl-1-heptynyl -2-heptynyl -6-heptynyl-1-octynyl , -2-octynyl, -7-octynyl, -1-noninyl -2-n-phenyl, -8-noninyl, -1-decinyl, -2-decinyl, -9-decinyl and the like. "- (C2-C6) alkynyl" means a straight or branched chain of non-cyclic hydrocarbon having from 2 to 6 carbon atoms and including at least one carbon-carbon triple bond. Linear and branched chain (C2-Ce) alkynyl includes -acetylenyl, -propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, -4-pentynyl , -1-Hexynyl, -2-Hexynyl, -5-Hexynyl and the like. "- (Cs-do) cicloalquir" means a saturated cyclic hydrocarbon having from 3 to 10 carbon atoms. (C3-do) representative cycloalkyls are -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, -cycloheptyl, -cyclooctyl, - cyclononyl, and -cyclodecyl. "- (Cs-Cg) cycloalkyl" means a saturated cyclic hydrocarbon having from 3 to 8 carbon atoms. (Cs-Cg) Representative cycloalkyls include -cyclopropyl, -cyclobutyl, -cyclopentyl, -cyclohexyl, - cycloheptyl, and -cyclooctyl. "- (C8-C? 4) bicycloalkyl" means a bi-cyclic hydrocarbon ring system having from 8 to 14 carbon atoms and at least one saturated cyclic alkyl ring.

(Cg-C? 4) Representative bicycloalkyls include -indanyl, -1,2,3,4-teteahidronaphthyl, -5,6,7,8-teteahidronaphthyl, -perhydronaphthyl, and the like. "- (C8-C? 4) tricycloalkyl" means a tri-cyclic hydrocarbon ring system having from 8 to 14 carbon atoms and at least one saturated cyclic alkyl ring. - (Cs-C? 4) representative tricycloalkyls includes -pyrenyl, -1,2,3,4-tetrahydroanteacenyl, -perhydroanthracenyl -aceantreneyl, -1,2,3,4-tetrahydropentenyl, -5,6,7,8- tettahydrofenanfrenyl, -perhydrofenanfrenyl and the like. "- (C5-C! O) cycloalkyl" means a non-aromatic cyclic hydrocarbon with at least one carbon-carbon double bond in the cyclic system and from 5 to 10 carbon atoms. (C5-do) include -cyclopentenyl cicloalquenils representative, -cyclopentadienyl, -ciciohexenilo, -cycloheptadienyl, -cycloheptatrienyl, -cyclooctenyl, -cicloheptatrienilo, -ciclooctenilo, -cyclooctadienyl, -cyclooctatrienyl, ciclooctateteaemlo, -ciclononenilo, -cyclononadienyl, -cyclodecenyl, - cyclodecadienyl and the like. "- (C5-C8) cycloalkenyl" means a non-aromatic cyclic hydrocarbon having at least one carbon-carbon double bond in the cyclo system and from 5 to 8 carbon atoms. (C5-Cs) Representative cycloalkenyls include -cyclopentenyl, cyclopentadienyl, -cydohexenyl, -cyclohexadienyl, -cycloheptenyl, -cycloheptadienyl, -cycloheptatrienyl, -cyclooctenyl, -cyclooctadienyl, -cyclooctatrienyl, -cyclooctateteaenyl, and the like. "- (C8-C14) bicycloalkenyl" means a bicyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. Representative (Cg-C1) bicycloalkenyls include -indenyl, -pentalenyl, -naphthalenyl, -azolenyl, -heptalenyl, -1,2,7,8-teteahidronaphthalenyl and the like. "- (C8-C! 4) tricycloalkenyl" means a tricyclic hydrocarbon ring system having at least one carbon-carbon double bond in each ring and from 8 to 14 carbon atoms. - (C8-C14) representative rubcycloalkenyls include -anfracenyl, -phenanfrenyl, -phenolenyl, -acenaphthalenyl, as-indacenyl, s-indacenyl and the like. "- (3- to 7-bodies) heterocycle" or "- (3- to 7-bodies) heterocycle" means a monocyclic heterocyclic ring of 3- to 7-bodies which is either saturated, unsaturated, non- aromatic or aromatic. A 3- or 4-body heterocycle can contain up to 3 heteroatoms, a 5-body heterocycle can contain up to 4 heteroatoms, a 6-body heterocycle can contain up to 6 heteroatoms, and a 7-body heterocycle can contain up to 7 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The - (3- to 7-bodies) heterocycle can be attached by means of a nitrogen or carbon atom. - (3- to 7-bodies) representative heterocycles include pyridyl, furyl, thiophenyl, pyrroyl, oxazoyl, imidazolyl, thiazoyl, thiadiazolyl, isoxazoyl, pyrazole, isothiazolyl, pyridazinyl, pyrimidinyl, triazinyl, morpholinyl, pyrrohdinonyl, pyrrolidinyl, piperidinyl, piperazinyl, hydantoinyl, valerolactamyl, oxiranyl, oxetanyl, teteahidrofuranyl, tetrahydropyranyl, tetrahydropyrindinyl, teteachhydropyrimidinyl, tetrahydrothiophenyl, tetrahydrothiopyranyl and the like. "- (3- to 5-bodies) heterocycle" or "- (3- to 5-bodies) heterocycle" means a monocyclic heterocyclic ring of 3- to 5-bodies which is either saturated, unsaturated, non-aromatic, or aromatic . A 3- or 4-body heterocycle can contain up to heteroatoms, and a 5-body heterocycle can contain up to 4 heteroatoms. Each heteroatom is independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The - (3- to 5-bodies) heterocycle may be attached by means of a nitrogen or carbon atom. - (3- to 5-bodies) Representative heterocycles include furyl, thiophenyl, pyrrole, oxazolyl, imidazolyl, thiazolyl, isoxazolyl, pyrazolyl, isothiazolyl, triazinyl, pyrrohdinonyl, pyrrolidinyl, hydantoinyl, oxiranyl, oxetanyl, tetrahydrofuranyl, teteahydrothiophenyl and the like. "- (7- to 10-bodies) bicycloheterocycle" or "- (7- to 10-bodies) bicycloheterocycle" means a bicyclic heterocyclic ring of 7- to 10-bodies which is either saturated, unsaturated, non-aromatic, or aromatic . A - (7- to 10-bodies) bicycloheterocycle contains from 1 to 4 heteroatoms independently selected from nitrogen, which can be quaternized; oxygen; and sulfur, including sulfoxide and sulfone. The - (7- to 10-bodies) bicycloheterocycle can be attached by means of a nitrogen or carbon atom. - (7- to 10-bodies) Representative bicycloheterocyclics include -quinolinyl, -isoquinolinyl, -chromonyl, -coumarinyl, -indolyl, -indolizinyl, -benzo [b] furanyl, - benzo [b] thiophenyl, -indazolyl, -purinyl, -4H-quinolizinyl, -isoquinolyl, -quinohlo, -phtalazinyl, -naphthyridinyl, -carbazolyl, -β-carbolinyl and the like. "- (C14) aryl" means an aromatic carbocyclic portion of 14-bodies such as -antril or -phenanthryl. "- (5- to 10-bodies) heteroaryl" means an aromatic heterocyclic ring of 5 to bodies, including both mono- and bicyclic ring systems, wherein at least one carbon atom of one or both rings is substituted with a heteroatom independently selected from nitrogen, oxygen and sulfur. In one embodiment, one of the - (5- to 10-body) heteroaryl rings contains at least one carbon atom. In another embodiment, rings of the (5- to 10-bodies) heteroaryl contain at least one carbon atom. - (5- to 10-bodies) representative heteroaryls include pyridyl, furyl, benzofuranyl, thiophenyl, benzothiophenyl, quinolinyl, pyrrolyl, indolyl, oxazolium, benzoxazolyl, imidazolyl, benzimidazolyl, thiazolyl, benzothiazolyl, isoxazole, pyrazolyl, isothiazolyl, pyridazinyl, pyrimidyl, pyrimidinyl, thiadiazolyl, triazinyl, cinnolinyl, phthalazinyl and quinazolinyl. "-CH2 (halo)" means a methyl group in which one of the hydrogens of the methyl group has been replaced with a halogen. Representative -CH2 (halo) groups include -CH2F, -CH2C1, -CH2Br, and -CH2I. "-CH (halo) 2" means a methyl group in which two of the hydrogens of the methyl group have been replaced with a halogen. Representative -CH (halo) 2 groups include -CHF2, -CHC12, -CHBr2, -CHBrCl, -CHC1I, and -CHI2. "-C (halo) 3" means a methyl group in which each of the hydrogens has been replaced with a halogen. Representative -C (halo) groups 3 include -CF3, "-Halogen" or "-halo" means -F, -Cl, -Br, or -I. The phrase "pyridyl group" means where Ri, R2, and n are defined above for the Femlen Compounds of the formula (p). The phrase "pyrazinyl group" means, wherein Rj, R2, and p are defined above for Femlen Compounds of the formula 00- The phrase "pyrimidinyl group" means wherein Ri, R2, and p are defined above for Phenylene Compounds of the formula (I). The phrase "pyridazinyl group" means wherein Ri, R2, and p are defined above for Phenylene Compounds of the formula 0). The phrase "thiadiazolyl group" means wherein Ri is defined above for Phenylene Compounds of the formula (I). The phrase "benzoimidiazolyl group" means wherein Rs and s are defined above for Phenylene Compounds of the formula (I) or (H). The phrase "benzothiazolyl group" sigmfica wherein Rs and s are defined above for Femlen Compounds of the formula (T) or (p). The phrase "benzooxazolyl group" means wherein Rs and s are defined above for Femlene Compounds of the formula (I) or (ü). The phrase "phenylene ring" means wherein R3 and m are defined above for Femlene Compounds of the formula (I) and the ind re numbers for the position of each atom of the phenylene ring.

The term "animal," includes, but is not limited to, a cow, monkey, baboon, chimpanzee, horse, sheep, pig, chicken, turkey, quail, cat, dog, rat, mouse, guinea pig, and human. The phrase "pharmaceutically acceptable salt," according to the use herein granted, is any pharmaceutically acceptable salt that can be prepared from a Phenylene Compound, including a salt formed from an acid and a functional basic group, such as a group of nitrrogen , of one of the Femlenos Compounds. Exemplary salts include, but are not limited to, sulfate, cytheate, acetate, oxalate, chloride, bromide, iodine, nitrate, bisulfate, phosphate, phosphonic acid, isonicotinate, lactate, salicylate, acid citrate, tarteate, oleate, tannate, pantothenate, bitarteate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, S-toluenesulfonate, and pamoate (that is, salts 1, -methyl-ene-bis- (2-hydroxy-3-naphthoate)). The term "pharmaceutically acceptable salt" also includes a salt prepared from a Phenylene Compound having an acidic functional group, such as a functional carboxylic acid group, and a pharmaceutically acceptable inorganic or organic base. Suitable bases include, but are not limited to, alkali metal hydroxides such as sodium, potassium and lithium; alkali metal hydroxides such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc; ammonia and organic amines, such as mono-, di-, hydroxy-substituted or unsubstituted, or trialkylamines; dicyclohexyl amine; tributyl amine; pyridine; N-methyl, N-ethyl amine; diethyl amine; triethyloamine; lower mono-, bis-, or tris- (2-hydroxy-alkyl amines), such as mono-, bis-, or tris- (2-hydroxyethyl) amine, 2-hydroxy-tert-butyloamine, or teis- ( hydroxymethyl) methyloamine, N, N-di-lower alkyl-N- (hydroxy lower alkyl) -amines, such as N, N-dimethyl-N- (2-hydroxyethyl) amine, or tri- (2-hydroxyethyl) amine; N-methyl-D-glucamine; and amino acids such as arginine, lysine and the like. The phrase "effective amount," used in connection with a Femlen Compound means an effective amount to: (a) treat or prevent a Condition; or (b) inhibit the VR1, mGluRl, or mGluR5 function in a cell. The phrase "effective amount," used in connection with another therapeutic agent means an amount to provide the therapeutic effect of the therapeutic agent.

When a first group is "substituted with one or more" second groups, one or more hydrogen atoms of the first group is replaced with a corresponding number of second groups. When the number of second groups is two or more, each second group may be the same or different. In a fashion, the number of second groups is one or two. In other mode, the number of second groups is one.

The term "EtOAc" means ethyl acetate. The term "THF" means tetrahydrofuran. The term "DMF" means dimethylformamide. The term "HOBT" means 1-hydroxybenzotriazole hydrate. The term "EDCI" means l-ethyl-3- [3- (dimethylamino) propyl] carbodiimide. The term "EBD" means inflammatory bowel disease. The term "IBS" means irritable bowel syndrome. The term "ALS" means lateral amyotopic sclerosis. The phrases "treatment", "treat" and the like include the alleviation or amelioration of a Condition or symptom thereof. In one embodiment, treating includes inhibiting, for example, decreasing the overall frequency of episodes of a Condition or symptoms thereof. The phrases, "prevention of," "preventing" and the like include avoiding the onset of a Condition or symptom thereof.

Methods for Preparing Phenylene Compounds Phenylene Compounds can be prepared using conventional organic syntheses or by means of the following illustrative methods shown in the following schemes.

Methods for Preparing Phenylene Compounds wherein X is O The Phenylene Compounds wherein X is O can be obtained according to the method illustrated below in Scheme 1.

Scheme 1 where Ar2, Ri, R2, R3, m, n and p are found above and Y is a halogen.

To a solution of 4-halobenzoic acid in DMF (0.22 M) is added 1 equivalent of amine Ar2-NH2, and the resulting solution is allowed to stir for about 5 minutes at a temperature of about 25 ° C. To the resulting solution is added 1 equivalent of HOBT and 1 eq. of EDCI, and the resulting mixture is allowed to stir for about 6 hours at a temperature of about 25 ° C. Typically, a solid forms during stirring and the resulting mixture is filtered to remove the resulting solid. If a solid is not formed, the reaction mixture is diluted with aq. Sodium hydroxide and extracted 2 to 3 times with EtOAc, the organic layers are combined, dried (with Na 2 SO 4), and the solvent is removed under reduced pressure to provide a residue. Then the residue is washed with methanol and dried under reduced pressure. Then, the solid or residue is suspended in THF (0.04 mol / liter) under an argon atmosphere and about 3 equivalents of zinc bromide 3a-e and about 0.05 equivalent of Pd (PPh3) 4 are added to the suspension. The suspension is allowed to stir for a period of 2 hours at a temperature of about 70 °. The solvent is removed under reduced pressure to provide a solid which is purified using a silica gel column eluted with an ethyl acetate / hexane gradient to provide the Phenylene Compound wherein X is O. If the compound of the formula 2 is substituted with a hydroxyl group or amine, the hydroxyl group or amine is protected using a suitable protecting group before start the reaction with zinc bromide 3a-e. Likewise, if R 2 is a hydroxyl group or amine, the hydroxyl group or amine is protected before forming the zinc bromide reagent. Suitable protecting groups for hydroxyl group include, but are not limited to, methyl, ether, methoxymethyl ether, methoxythiomethyl ether, 2-methoxyethoxymethyl ether, bis (2-chloroethoxy) ethyl ether, tetrahydropyranyl ether, tetrahydrothiopyranyl ether, 4-methoxytetehydropyranyl ether, ether methoxytetrahydrothiopyranyl, tetrahydrofuranyl ether, tetrahydrothiothiranyl ether, 1-ethoxyethyl ether, 1-methyl-1-methoxyethyl, 2- (phenylenyl ether) ether, tert-butyl ether, alkyl ether, benzyl ether, ether o-niteobenzil, triphenylmethyl ether, o-naphthyldiphenylmethyl ether, s-methoxydiphenylmethyl ether, 9- (9-phenyl-10-oxo) antryl ether (tritylone), trimethylsilyl ether, so-propyldimethylsilyl ether, tert-butyldimethylsilyl ether, tert-butyldiphenylsilyl ether, tribenzyl ether, tri-isopropylsilyl ether, formate ester, acetate ester, trichloroacetate ester, phenoxyacetate ester, so-butyrate ester, pivaloate ester, adamanttoate ester, benzoate ester, ester 2,4,6- trimethyl (mesitoate), methyl carbonate, 2,2,2-trichlorocarbonate, allo carbonate, s-nitrophenyl carbonate, benzyl carbonate, s-nitrobenzyl carbonate, S-benzylthiocarbonate, N-phenylcarbamate, nitrate ester, and stef 2,4-dinitophenylsulfenate (See, for example, TW Greene, Protective Groups in Organic Synthesis, John Wiley-lhterscience Publication, New York, (1981)). Suitable protecting groups for an amine include, but are not limited to, 1, l-dimethyl-2,2,2-trichloroethyl carbamate, 1-methyl-1- (4-biphenyloyl) ethyl carbamate, 2-trimethylsilylethyl carbamate, and tert -butyl carbamate (TW Greene et al., Protective Groups in Organic Synthesis, 309-405 (2d ed.1991)). The 4-halobenzoic acids 1 and the amines of the formula Ar2NH2 are commercially available or can be prepared by methods known to those skilled in the art. Compounds of the formula 3a-e can be prepared by methods known to those skilled in the art. (See, M.B. Smith and J. March, March 's Advanced Organic Chemistry: Reaction Mechanisms and Structure, 805-807 (5th ed., 2001); H. Fillon et al., Tett. Lett. 42: 3843-46 (2001); M. Amadji et al., Tettrahedron 9: 1657-60 (1998); and S. Billotte, Synlett. 379-380 (1998)).

Methods for Preparing Phenylene Compounds where X is S The Phenylene Compounds wherein X is S can be obtained by reacting a Phenylene Compound wherein X is O, according to the preparation described above in section 4.5.1, with the Lawesson reagent at a temperature of about 100 ° C. (See, M.B. Smith and J. March, March's Advanced Organic Chemistry: Reaction Mechanisms and Structure, 1184-1185 (5th ed., 2001)).

Therapeutic Uses of the Phenylene Compounds According to the invention, the Phenylene Compounds are administered to animals in need of treatment or prevention of a Condition. In one embodiment, an effective amount of a Phenylene Compound can be used to treat or prevent a treatable or preventable condition by means of inhibiting VR1. Examples of teachable or preventable conditions by inhibiting VR1 include, but are not limited to, pain, Ul, ulcer, IBD, and IBS.

In another embodiment, an effective amount of a Phenylene Compound can be used to treat or prevent a treatable or preventable condition by inhibiting mGluR5. Examples of conditions teachable or preventable by the inhibition of mGluR5 include, but are not limited to, pain, addictive disorders, Parkinson's disease, parkinsonism, anxiety, pruritic condition, and psychosis. In another embodiment, an effective amount of a Femlen Compound can be used to treat or prevent any condition treatable or preventable by inhibiting mGluRl. Examples of conditions that are treatable or preventable by inhibiting mGluRl include, but are not limited to, pain, Ul, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, epilepsy, infarction, an attack, a pruritus condition , psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's disease, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting, dyskinesia, and depression. The Phenylene Compounds can be used to treat or prevent acute or chronic pain. Examples of treatable or preventable pain using the Phenylene Compound include, but are not limited to, pain caused by cancer, labor pain, pain from myocardial infarction, pancreatic pain, pain from cramping, post-operative pain, headache, pain muscle, arthritic pain, and pain associated with periodontal disease, including gingivitis and periodontitis. The Phenylene Compounds can also be used to treat or prevent pain associated with inflammation or with an inflammatory disease in a animal. This pain can occur where there is an inflammation of body tissue which can be a local inflammatory response and / or a systemic inflammation. For example, the Phenylene Compounds can be used to treat or prevent pain associated with inflammatory diseases, including, but not limited to: rejection of organ transplantation, reoxygenation injury resulting from an organ transplantation (see Grapp et al., J. Mol. Cell Car diol 31: 297-303 (1999)) including, but not limited to, transplantation of heart, lung, liver or kidneys; chronic inflammatory diseases of the joints, including arthritis, rheumatic arthritis, osteoarthritis and bone diseases associated with increased resorption of bone mass; inflammatory bowel diseases, such as ileitis, ulcerative colitis, Barret's syndrome and Crohn's disease; inflammatory diseases of the lungs, such as asthma, respiratory distress syndrome in adults, and chronic airway obstruction disease; inflammatory diseases of the eye, including corneal dystrophy, trachoma, onchocerciasis, uveitis, sympathetic ophthalmitis and endophthalmitis; chronic gum diseases, including gingivitis and periodontitis; tuberculosis; leprosy; inflammatory diseases of the kidney, including uraemic complications, glomerulonephritis and nephrosis; inflammatory diseases of the skin, including sclerodermatitis, psoriasis and eczema; inflammatory diseases of the central nervous system, including diseases of chronic demyelination of the centeal nervous system, multiple sclerosis, neurodegeneration related to AIDS and Alzheimer's disease, infectious meningitis, encephalomyelitis, Parkinson's disease, Huntington's disease, lateral amyotopic sclerosis and viral or auto encephalitis immune; autoimmune diseases, including diabetes mellitus type I and type II; diabetic complications, including but not limited to diabetic cataract, glaucoma, retinopathy, nephropathy (such as microaluminuria and progressive diabetic nephropathy), polyneuropathy, mononeuropathies, autonomic nauropathy, gangrene of the feet, atherosclerotic arterial coronary disease, peripheral arterial disease, hyperglycemic coma -non-ketosal hyperosmolar, foot ulcer, joint problems, and skin or mucosal involvement (such as an infection, an area with pimples, a pure diabetic infection or lipid necrosis); immunocomplex vasculitis and systemic lupus erythematosus (SLE); inflammatory diseases of the heart, such as cardiomyopathy, ischemic heart disease, hypercholesterolemia, and atherosclerosis; as well as other diseases that may have significant inflammatory components, including preclaimsia, chronic failure of the liver, brain and spinal cord trauma, and cancer. The Phenylene Compounds can also be used to inhibit, treat or prevent pain associated with inflammatory disease that can, for example, be a systemic inflammation of the body, exemplified by gram-positive shock or gram negative, hemorrhagic or anaphylactic shock, or shock product Chemotherapy for cancer in response to pro-inflammatory cytokines, for example, shock associated with pro-inflammatory cytokines. Such a shock can be induced, for example, a chemotherapeutic agent administered as a treatment for cancer. The Phenylene Compounds can be used to treat or prevent UI. Examples of teatables or preventable using Femlenos Ul compounds include, but are not limited to, urge incontinence, stress incontinence, overflow incontinence, neurogenic incontinence, and total incontinence. The Phenylene Compounds can be used to treat or prevent an ulcer. Examples of teachable or preventable ulcers using Phenylene Compounds include, but are not limited to, duodenal ulcer, gastric ulcer, marginal ulcer, ulcer to the esophagus or ulcer product of stress. The Phenylene Compounds can be used to treat or prevent IBD, including Crohn's disease and ulcerative colitis. The Femlen Compounds can be used to treat or prevent IBS. Examples of IBS ttatable or preventable using Femlene Compounds include, but are not limited to, spastic colon type IBS and predominant constipation IBS. The Phenylene Compounds can be used to treat or prevent an addictive disorder, including but not limited to, an eating disorder, a disorder of impulse control, a disorder related to alcohol, a disorder related to nicotine, a disorder related to amphetamines, cannabis-related disorder, a cocaine-related disorder, a hallucinogen-related disorder, inhalant-related disorders and an opioid-related disorder, all of which are sub-classified below. Eating disorders include, but are not limited to Bulimia Nervosa, Non-Purgative Type; Nervous Bulimia, Purgative Type; Anorexy; and Eating disorders not otherwise specified (NOS).

Impulse control disorders include, but are not limited to, Intermittent Explosive Disorder, Kleptomania, Pyromania, Impulsive Gambler, Trichotillomania, and Non-Specified Control Impulse Disorders (NOS). Disorders related to alcohol include, but are not limited to, Induced Psychotic Disorder Alcohol with delusions, Alcohol Abuse, Alcohol Intoxication, Alcohol Withdrawal Delirium, Alcohol Intoxication Delirium, Alcohol Withdrawal, Induced Persisting Dementia Alcohol induced persisting amnestic disorder by alcohol, Alcohol Dependence, mood disorders induced by alcohol, Psychotic disorders with hallucinations induced alcohol, Anxiety disorders induced by alcohol, Sexual Disftmción Alcohol-induced, sleep disorders Triggered by Alcohol and Alcohol-Induced Disorders Not Otherwise Specified (NOS). Disorders related to Nicotine include, but are not limited to, Nicotine Dependence, Nicotine Withdrawal, and Nicotine-related disorders of other than unspecified form (NOS). Amphetamine-Related Disorders include, but are not limited to, Amphetamine Dependence, Amphetamine Abuse, Amphetamine Intoxication, Amphetamine Withdrawal, Intoxication Delirium, Amphetamine Psychotic disorder induced delirium Amphetamine Psychotic Disorder with hallucinations, Amphetamine Induced, mood disorder Induced by Amphetamines, Anfetamine-Induced Anxiety Disorder, Amphetamine-Induced Sexual Dysfunction, Amphetamine-Induced Sleeping Disorder, and other disorders related to amphetamines other than unspecified (NOS). Cannabis-related disorders include, but are not limited to, Cannabis Dependency, Cannabis Abuse, Cannabis Intoxication, Cannabis Delirium Intoxication, Cannabis Delirium Psychotic Disorder, Psychotic Disorders with Cannabis-Induced Hallucinations, Anxiety Disorder Induced Cannabis, and Cannabis Related Disorders Not Otherwise Specified (NOS). Disorders related to cocaine include, but are not limited to, cocaine Dependency, Cocaine abuse, Cocaine poisoning, Cocaine abstinence, Cocaine poisoning rant, Psychotic disorder with cocaine-induced delusions, Psychotic disorders with hallucinations Cocaine-induced, mood disorders induced by cocaine, Anxiety disorder induced by cocaine, Cocaine-Induced Sexual Dysfunction, Cocaine Induced Sleeping Disorder, and Other Unspecified Cocaine Related Disorders (NOS). Disorders related to hallucinogens include, but are not limited to, Hallucinogenic Dependence, Hallucinogenic Abuse, Hallucinogenic Intoxication, Hallucinogenic Withdrawal, Hallucinogenic Intoxication Delirium, Persistent Hallucinogenic Perception Disorders (Flashbacks), Psychotic Disorder with Hallucinogen-Induced Delusions , Psychotic disorder with Hallucinogen-induced hallucinations, Hallucinogen-induced mood disorder, Hallucinogen-induced Anxiety disorder, Hallucinogen-induced Sexual dysfunction, Hallucinogen-induced Sleep Disorder, and other hallucinogen-related disorders of other than unspecified form (NOS). Disorders related to Inhalants include, but are not limited to, Inhalant Dependence, Inhalant Abuse, Inhalant Poisoning, Inhalant Poisoning Delirium, Psychotic Disorder with Inhalant-Induced Delirium, Psychotic Disorder with Inhalant-Induced Hallucinations, Induced Anxiety Disorder by Inhalants, and disorders related to Inhalants other than unspecified (NOS). Opioid-related disorders include, but are not limited to, Opium Dependence, Opium Abuse, Opium Abstinence, Opium Poisoning, Opium Poisoning Delirium, Psychotic Disorder with Opium Induced Delirium, Disorder Psychotic with hallucinations Opium Induced, Opium Induced Anxiety Disorder, and other disorders not otherwise specified (NOS). The Phenylene Compounds can be used to treat or prevent generalized or severe anxiety and symptoms associated with anxiety, including, but not limited to, agitation, tension, tachycardia, dyspnea; depression, including depression "neurotic" chronic; panic disorder; agoraphobia and other specific phobias; eating disorders; and disorders of the person. The Phenylene Compounds can be used to treat or prevent epilepsy, including but not limited to partial epilepsy, generalized epilepsy, and symptoms associated with epilepsy, including, but not limited to, simple partial seizures, Jacksonian seizures, complex partial seizures (psychomotor), convulsive attacks (grand mal or tonic-clonic attack), petit mal attacks (absence), and status epilepticus. The Phenylene Compounds can be used to treat or prevent infarcts, including, but not limited to, ischemic infarcts and hemorrhagic infarcts.

The Phenylene Compounds can be used to treat or prevent an attack, including, but not limited to, infantile spasms, febrile seizures and epileptic seizures. The Phenylene Compounds can be used to treat or prevent a pruritic condition, including, but not limited to, dry skin pruritus, scabies, dermatitis, herpetiformis, atopic dermatitis, pruritus vulvae et ani, milaria, insect bite, pediculosis, dermatitis contact, drug reactions, urticaria, urticarial eruptions of pregnancy, psoriasis, lichen planus, lichen simplex chronicus, exfoliating dermatitis, folliculitis, pemphigoid hullosa, or dermatitis caused by contact with fiberglass. The Phenylene Compounds can be used to treat or prevent psychosis, including but not limited to, schizophrenia, including paranoid schizophrenia, hebefrémca or disorganized schizophrenia, catatonic schizophrenia, undifferentiated schizophrenia, schizophrenia of the negative subtype or deficit, and non-deficit schizophrenia; a delirium disorder, including illusory erotomatic subtype disorder, delusional illusory subtype disorder, illusory jealous subtype disorder, persecution delusional subtype disorder, and somatic delirium subtype disorder; and brief psychosis. The Phenylene Compounds can be used to treat or prevent a cognitive disorder, including but not limited to delirium and dementia such as multi-infarct dementia, pugilistic dementia, dementia caused by AIDS, and dementia caused by Alzheimer's. The Phenylene Compounds can be used to treat or prevent a memory deficit, including but not limited to dissociated amnesia and fleeting dissociation. The Phenylene Compounds can be used to treat or prevent restricted cerebral functions, including, but not limited to, that caused by surgery or organ transplant, restricted supply of blood to the brain, injury to the spinal cord, head injury, hypoxia, arrest cardiac or hypoglycemia. The Phenylene Compounds can be used to treat or prevent Huntington's disease. The Phenylene Compounds can be used to treat or prevent ALS. The Phenylene Compounds can be used to treat or prevent retinopathy, including but not limited to, arteriosclerotic retinopathy, diabetic retinopathy arteriosclerotic, hypertensive retinopathy, non-proliferating retinopathy and proliferating retinopathy. The Phenylene Compounds can be used to teach or prevent muscle spasm. The Phenylene Compounds can be used to teach or prevent a migraine including, but not limited to, migraine without aura ("common migraine"), migraine with aura ("classic migraine"), migraine without headache, basilar migraine, hemiplegic familial migraine , migraine infarction, and migraine with prolonged aura. The Phenylene Compounds can be used to teach or prevent vomiting, including but not limited to, vomiting from nausea, dry vomiting (retching) and regurgitation. The Phenylene Compounds can be used to teach or prevent dyskinesia, including but not limited to tardive dyskinesia and bihar dyskinesia. The Phenylene Compounds can be used to teach or prevent depression, including but not limited to major depression and bi-polar disorder. Applicants believe that the Phenylene Compounds are antagonists for VR1.

The invention also relates to methods for inhibiting VR1 function in a cell which comprises contacting a cell capable of expressing VR1 with an effective amount of a Phenylene Compound to inhibit VR1 function in the cell. This method can be used in vitro, for example, as an assay to select cells capable of expressing VR1 and, consequently, useful as part of an assay for selecting compounds useful for teaching or preventing pain, Ul, ulcer, IBD, or IBS . The method is also useful for inhibiting VR1 function in a cell in vivo, in an animal (eg, a human), by contacting a cell in an animal with an effective amount of a Phenylene Compound. In one modality, the method is useful for teaching or preventing pain in an animal that needs it. In another modality, the method is useful to teach or prevent Ul in an animal that needs it. In modern fashion, the method is useful to treat or prevent an ulcer in an animal that needs it. In another modality, the method is useful for teaching or preventing IBD in an animal that needs it. In another modality, the method is useful to teach or prevent IBS in an animal that needs it.

Examples of tissues containing cells capable of expressing VR1 include, but are not limited to, neuronal, cerebral, kidney, urothelial, and bladder tissue. Methods for studying VR1 expressing cells are known in the art. Applicants believe that the Phenylenes Compounds are antagonists for mGluR5. The invention also relates to methods for inhibiting mGluR5 function in a cell which comprises contacting a cell capable of expressing mGluR5 with an effective amount of a Phenylene Compound to inhibit mGluR5 function in the cell. This method can be used in vitro, for example, as an assay to select cells capable of expressing mGluR5 and, therefore, are useful as part of an assay for selecting compounds useful for theatrix or prevention of pain, an addictive disorder, Parkinson's disease, parkinsonism, anxiety, a pruritus condition, or psychosis. The method is also useful for inhibiting mGluR5 function in a cell in vivo, in an animal (eg, a human), by contacting a cell in an animal with an effective amount of a Phenylene Compound to inhibit mGluR5 function in the cell. In a fashion, the method is useful to teach or prevent pain in an animal that needs it. In another modality, the method is useful to teach an addictive disorder in an animal that needs it. In another embodiment, the method is useful for treating or preventing Parkinson's disease in an animal in need thereof. In another modality, the method is useful to teach or prevent parkinsonism in an animal that needs it. In another modality, the method is useful to teach or prevent anxiety in an animal that needs it. In ofra modality, the method is useful to teach or prevent a pruritus condition in an animal that needs it. In other mode, the method is useful to teach or prevent psychosis in an animal that needs it. Examples of cells capable of expressing mGluR5 are the neuronal and glial cells of the centeal nervous system, particularly the brain, especially in the nucleus accumbens. Methods for studying cells expressing mGluR5 are known in the art. Applicants believe that the Femlene Compounds are antagonists for mGluRl.

The invention also relates to methods for inhibiting mGluRl function in a cell, which comprises contacting a cell capable of expressing mGluRl with an effective amount of a Phenylene Compound in order to inhibit mGluR1 function in the cell. This method can be used in vitro, for example, as an assay to select cells capable of expressing mGluRl and, therefore, they are useful as part of an assay for selecting compounds for theatrix or pain prevention, Ul, an addictive disorder, Parkinson's disease , Parkinsonism, anxiety, epilepsy, heart attack, an attack, a pruritus condition, psychosis, a cognitive disorder, a memory deficit, restricted brain function, Huntington's disease, ALS, dementia, retinopathy, a muscle spasm, a migraine, vomiting , dyskinesia, or depression. The method is also useful for inhibiting mGluRl function in a cell in vivo, in an animal (eg, a human), by contacting a cell in an animal with an effective amount of a Femlen Compound. Dwarfed modality, the method is useful to teach or prevent pain in an animal that needs it. In another modality, the method is useful to teach or prevent Ul in an animal that needs it. In another modality, the method is useful to teach or prevent an addictive disorder in an animal that needs it. In another embodiment, the method is useful for teaching or preventing Parkinson's disease in an animal that needs it. In other modality, the method is useful to teach or prevent parkinsonism in an animal that needs it. In other mode, the method is useful to teach or prevent anxiety in an animal that needs it. In another modality, the method is useful to teach or prevent epilepsy in an animal that needs it. In another modality, the method is useful to treat or prevent a heart attack in an animal that needs it. In ofra modadad, the method is useful to treat or prevent an attack on an animal that needs it. In other mode, the method is useful to teach or prevent a pruritus condition in an animal that needs it. In another modality, the method is useful to treat or prevent psychosis in an animal that needs it. In other mode, the method is useful to teach or prevent a cognitive disorder in an animal that needs it. In other mode, the method is useful to teach or prevent a memory deficit in an animal that needs it. In another modality, the method is useful to treat or prevent restricted cerebral function in an animal that needs it. In another modality, the method is useful to teach or prevent Huntington's disease in an animal that needs it. In other mode, the method is useful for teaching or preventing ALS in an animal that needs it. In Other modality, the method is useful to teach or prevent dementia in an animal that needs it. In another modality, the method is useful to teach or prevent retinopathy in an animal that needs it. In another modality, the method is useful to teach or prevent muscle spasm in an animal that needs it. In another modality, the method is useful for teaching or preventing a migraine in an animal that needs it. In another modality, the method is useful for teaching or preventing vomiting in an animal that needs it. In another modality, the method is useful to teach or prevent dyskinesia in an animal that needs it. In another modality, the method is useful to teach or prevent depression in an animal that needs it. Examples of cells capable of expressing mGluR1 include, but are not limited to, neuronal cells of the Purkinje cerebellum, Purkinje cell bodies (dotted), cells of the spinal cord (s) of the cerebellum; neurons and neurophil cells of the olfactory bulb glomerulus; cells of the superficial layer of the cerebral cortex; hippocampal cells; thalamic cells; superior coliculus cells; and cells of the nucleus of the triglycerial spinal cord. Methods for studying cells expressing mGluRl are known in the art.

Therapeutic / Prophylactic Administration and Compositions of the Invention Due to their activity, the Phenylene Compounds are advantageously useful in veterinary and human medicine. As described above, the Femlene Compounds are useful for treating or preventing a Condition in an animal in need thereof. When administered to an animal, Femlene Compounds can be administered as a component of a composition comprising a pharmaceutically acceptable carrier or excipient. The present compositions, which comprise a Phenylene Compound, can be administered orally. The Phenylenes Compounds of the invention may also be administered by any other convenient route, for example, by infusion or bolus injection, by absorption through epithelial or mucocutaneous coatings (e.g., oral, rectal, and intestinal mucosal mucosa, etc.) and can be admired in conjunction with another active therapeutic agent. The administration can be systemic or local. Several delivery systems are known, example, encapsulation in liposomes, microparticles, microcapsules, capsules, etc., and can be used to administer the Phenylene Compound. Methods of administration include, but are not limited to, inteadermal, intramuscular, inteaperitoneal, intravenous, subcutaneous, inteasal, epidural, oral, sublingual, inteacerebral, inteavaginal, transdermal, rectal, inhalation, or topical, particularly to the ears, nose, eyes or skin. The mode of administration is left to the discretion of the physician. In most instances, administration will result in the release of the Phenylene Compounds into the blood system. In specific embodiments, it may be desirable to administer the Phenylene Compounds locally. This can be achieved, for example, and in no case limiting, by local infusion during surgery, topical application, for example, together with a bandage disposed in the wound after surgery, by injection, by means of a catheter, by means of of a suppository or enema, or by means of an implant, said implant being of a porous, non-porous or gelatinous material, including membranes, such as silastic membranes, or fibers. In certain embodiments, it may be desirable to introduce the Phenylene Compounds to the centeal nervous system or gastrointestinal tract through any suitable route, including inteaventricular, inteatenal, and epidural injection, and enema. Intraventricular injection can be facilitated through an inteaventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, for example, by the use of an inhaler or nebulizer, and formulation with an air-removing agent, or via perfusion in a fluorocarbon or synthetic pulmonary surfactant. In certain embodiments, the Phenylene Compounds can be formulated as suppositories, with traditional coatings and excipients such as triglycerides. In another mode, the Femlene Compounds can be delivered in a vesicle, particularly a hposome (see Langer, Science 249: 1527-1533 (1990) and Treat et al, Liposomes in the Therapy of Infectious Disease and Cancer 317-327 and 353- 365 (1989)). In yet another mode, the Phenylene Compounds can be delivered under a controlled delivery system or sustained delivery system (see, for example, Goodson, in Medical Applications of Contexted Relay, supra, vol.2, pp. 115-138 (1984)). ). Other controlled and sustained delivery systems discussed in the Langer publication, Science 249: 1527-1533 (1990) can be used. In one embodiment, a bowler can be used (Langer, Science 249: 1527-1533 (1990), Sefton, CRC Crit Ref Biomed, Eng. 14: 201 (1987), Buchwaid et al, Surgery 88: 507 (1980 ); and Saudek et al, N. Engl. J. Med. 321: 574 (1989)). In another form, polymeric materials can be used (see Medical Applications of Controlled Relay (Langer and Wise eds., 1974).; Controlled Drug Bioavailability, Drug Product Design and Performance (Smolen and Ball eds., 1984); Ranger and Peppas, J. Macromol Sci. Rev. Macromol Chem. 23:61 (1983); Levy et al, Science 228: 190 (1985); During et al, Ann. Neurol. 25: 351 (1989); and Howard et al, J. Neurosurg. 71: 105 (1989)). In yet another embodiment, a controlled or sustained system may be placed near a target of the Phenylened Compounds, for example, the spine, brain or gastrointestinal tract, such that only a fraction of the systemic dose is required. The present compositions may optionally comprise a suitable amount of a pharmaceutically acceptable excipient in order to provide the form for a correct administration to the animal. Such a pharmaceutical excipient may be a liquid, such as water or an oil, including those of petroleum, animal, vegetable or synthetic origin, such as peanut or peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical excipient may be saline, acacia gum, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. Also, auxiliary agents, stabilizers, thickeners, lubricants and dyes can be used. In one embodiment, the pharmaceutically acceptable excipient is sterile when administered to an animal. Water is a particularly useful excipient when the Phenylene Compound is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid excipients, particularly for injectable solutions. Suitable pharmaceutically acceptable excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycer monostearate, talc, sodium chloride, skimmed milk powder, propylene, glycol, water, ethanol and the like. The present compositions, if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffers. The present compositions may take the form of solutions, suspensions, emulsions, tablets, pills, pellets, capsules, capsules containing liquids, powders, sustained delivery formulations, suppositories, emulsions, aerosols, sprays, suspensions, or any other form of suitable use. In one embodiment, the composition is in the form of a capsule (see for example, U.S. Patent No. 5,698,155). Other examples of pharmaceutically suitable excipients are described in Remington's Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., 19th ed., 1995), incorporated by reference herein. In one embodiment, the Phenylene Compounds are formulated according to routine procedures as a composition adapted for oral administration in humans. Compositions for oral delivery can be presented, for example, in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups or elixirs. Orally administered compositions may contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; savoring agents such as peppermint, oil of wintergreen or cherry; coloring agents; and preservative agents, to provide a pharmaceutically palatable preparation. Moreover, when in the form of a tablet or a pill, the composition can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over a prolonged period of time. Selective permeable membranes enveloping the active osmotic preparation compound are also suitable for compositions administered orally. In these latter platforms, fluid from the environment enveloping the capsule is embedded by the release compound, which swells to displace the agent or agents through an opening. These platforms can provide an essentially zero-order breeding profile as opposed to instant profiles of immediate-release formulations. A delayed release material such as glycerol monostearate or glycerol stearate may also be used. Oral compositions may also include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. In one embodiment, the excipients are pharmaceutical grade. In another embodiment, the Phenylene Compounds can be formulated for intravenous administration. Typically, compositions for oral administration comprise an aqueous isotonic buffer. If necessary, the compositions may also include a solubilizing agent. Compositions for intravenous administration may optionally include a local anesthetic such as lignocaine to reduce pain at the site of injection. Generally, the ingredients are already provided either separately or mixed in unit doses, for example, as a lyophilized dry powder or water-free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the amount of active agent. Where the Phenylene Compounds should be administered by infusion, these can be dispensed, for example, with an infusion bottle containing water or a pharmaceutically sterile pharmaceutical grade saline solution. Where the Phenylene Compounds should be administered by injection, an ampoule of sterilized water for injection or saline can be provided so that the ingredients can be mixed before being administered. Femlene Compounds can be administered by means of counting delivery or delivery by means of delivery mechanisms known to those skilled in the art. Examples include, but are not limited to, those described in U.S. Patent Nos .: 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; and 5,733,566, each of which is incorporated herein by reference. Such dosage forms can be used to provide co-or contemporaneous release of one or more active agents using, for example, hydropropylmethyl cellulose, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, hposomes, microspheres, or a combination thereof to provide the desired release in varying proportions. Suitable co-sustained or sustained release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients of the invention. Accordingly, the invention comprises suitable unit doses for oral administration, such as, but not limited to, tablets, capsules and soft capsules, ada for counting or sustained preparation. Pharmaceutical compositions of controlled or sustained release may have a common objective of improving drug therapy over that achieved by non-controlled or non-sustained counterparts. In one mode, a co-or controlled release composition comprises a minimum amount of a Phenylene Compound to treat or prevent the Condition or symptom thereof in the minimum amount of time. The advantages of coagulated or sustained release compositions include prolonged drug activity, decreased frequency of dosing, and increased patient compliance. Also, controlled release compositions or These factors may favorably affect the starting time of the action or other features, such as blood levels of the Phenylene Compound, and thereby reduce the occurrence of adverse side effects. Controlled or sustained release compositions can, in principle, release an amount of Femlene Compound that will immediately produce the desired therapeutic or prophylactic effect, and gradually and continuously release other amounts of the Phenylene Compound in order to maintain this level of therapeutic or prophylactic effectiveness for a period of time. prolonged period of time. To maintain a constant level of Phenylene Compound in the body, the Phenylene Compound can be released from its dosage form at a rate that replaces the amount of Phenylene Compound being metabolized and excreted from the body. Sustained or sustained release of an active ingredient can be stimulated by various conditions, including, but not limited to, changes in pH, changes in temperature, concentration or availability of enzymes, concentration or availability of water, or other physiological or compound conditions. . The amount of Phenylene Compound effective for the treatment or prevention of a condition can be determined by standard clinical techniques. Likewise, in vitro or in vivo assays can be optionally employed in order to help identify the optimal dose ranges. The precise dose to be used will also depend on the route of administration, and the seriousness of the condition and can be decided according to the criteria of a doctor and / or the circumstance of each animal. However, effective amounts of effective doses vary from about 0.01 mg / kg of body weight to about 2500 mg / kg of body weight, although typically they are 100 mg kg of body weight or less. In one embodiment, the effective dose amount varies from about 0.01 mg kg of body weight to about 100 mg / kg of body weight of a Phenylene Compound, in another embodiment, about 0.02 mg / kg of weight body weight around 50 mg / kg body weight, and in another embodiment, from 0.025 mg / kg body weight to about 20 mg / kg body weight. In one embodiment, an effective dose amount is administered every 24 hours until the Condition is counted. In other mode, an effective dose amount is administered every 12 hours until the Condition is counted. In other mode, an effective dose amount is administered every 8 hours until the Condition is counted. In another modality, an effective dose amount is administered every 6 hours until the Condition is counted. In another modality, an effective dose amount is administered every 4 hours until the Condition is counted. The amount of effective dose described in this document refers to the total amount administered; this, if more than one Phenylene Compound is administered, the effective dose amounts correspond to the total amount administered. Where a cell capable of expressing VR1, mGluR5 or mGluR1 is contacted with a Phenylene Compound in vitro, the amount effective to inhibit the receptor function VR1, mGluR5 or mGluR1 in a cell will typically vary from about 0.01 μg / L to about of 5 mg / L, in one embodiment, from 0.01 μg / L to 2.5 mg / L, in another form, from 0.01 μg / L to 0.5 mg / L L, and in other mode, from about 0.01 μg / L to about 0.25 mg / L of a solution or suspension of a pharmaceutically acceptable carrier or excipient. In one embodiment, the volume of solution or suspension comprising the Femlen Compound is from about 0.01 μL to about 1 mL. In another modality, the volume of solution or suspension is about 200 μL. Where a cell capable of expressing VR1, mGluR5, or mGluR1 is contacted with a Phenylene Compound in vivo, the amount effective to inhibit the receptor function in a cell will typically vary between about 0, 01 mg / kg of body weight to about 2500 mg / kg of body weight, although typically ranging from 100 mg kg of body weight or less. In one mode, the amount of effective dose ranges from about 0.01 mg / kg of body weight to about 100 mg / kg of body weight of xm Phenylene compound, in another embodiment, about 0.02 mg / kg of body weight at about 50 mg / kg of body weight, and in other mode, about 0.025 mg / kg of body weight to about 20 mg / kg of body weight. In one embodiment, an effective dose amount is administered every 24 hours. In other mode, an effective dose amount is administered every 12 hours. In another modality, xma amount of effective dose is administered every 8 hours. In another modality, an effective dose amount is administered every 6 hours. In another mode, an effective dose amount is administered every 4 hours. The Femlene Compounds can be analyzed in vitro or in vivo for the desired therapeutic or prophylactic activity before being used in humans. Animal model systems can be used to demonstrate safety and efficacy. The present methods to teach or prevent a Condition in an animal that needs it can also include the administration to the animal being treated x Phenylene compound, oteo therapeutic agent. In one embodiment, the other therapeutic agent is administered in an effective amount. The methods present for inhibiting VR1 function in a cell capable of expressing VR1 may further comprise contacting the cell with an effective amount of other therapeutic agent that may or may not inhibit VR1. The methods present for inhibiting mGluR5 function in a cell capable of expressing mGluR5 may further comprise contacting the cell with an effective amount of another therapeutic agent that may or may not inhibit mGluR5. The methods present for inhibiting mGluRl function in a cell capable of expressing mGluRl may further comprise contacting the cell with an effective amount of other therapeutic agent that may or may not inhibit mGluRl. Effective amounts of other therapeutic agents are known to those skilled in the art. However, it is within the scope of the skilled person to determine the variation of the optimal effective amount of the other therapeutic agent. In one embodiment of the invention, when another therapeutic agent is administered to an animal, the minimum effective amount of the Phenylene Compound is less than what would be the minimum effective amount of not having administered the other therapeutic agent. In this mode, without being limited to theory, it is believed that the Femlene Compounds and the other therapeutic agent act synergistically to teach or prevent a Condition. The other therapeutic agent may be, but is not limited to, an opioid agonist, non-opioid analgesic x, a non-steroidal anti-inflammatory agent, an anti-migraine agent, a Cox-II inhibitor, x antiemetic, xm β-blocker. -adrenergic, xm anticonvulsant, an antidepressant, a Ca2 + channel blocker, an anticancer agent, an agent to teach or prevent Ul, xm agent to teach or prevent an ulcer, an agent to treat or prevent IBD, an agent to treat or prevent IBS, xm agent for teatar addictive disorders, xm agent to teach Parkinson's disease and parkinsonism, an agent to treat anxiety, an agent to teach epilepsy, an agent to stage a heart attack, xm agent to stage an attack, an agent for teatar a pruritic condition xm agent to teatar psychosis, an agent to teatar Korea of Huntington, an agent to treat ALS, an agent to treat a cognitive disorder, an agent to teatar a migraña, xm agent to treat Vomiting, an agent to teach dyskinesia or xm agent to teach depression and mixtures thereof.

Examples of useful opioid agonists include, but are not limited to, alfentanil, aliloprodine, alphaprodine, anileridine, benzylmorphine, bezitramide, buprenorphine, butorphanol, clonitazene, codeine, desomorphine, dextromoramide, dezocin, diampromide, diamorphone, dihydrocodeine, dihydromorphine, dimenoxadol, dimetheptanol. , dimethyl thiambutane, dioxafethyl butyrate, dipipanone, eptazocine, ethoheptazine, ethylmethylthiambutene, ethylmorphine, etonitazene, fentanyl, heroin, hydrocodone, hydromorphone, hydroxypetidine, isomethadone, ketobemidone, levorphanol, levofenacillorphan, lofentanil, meperidine, meptazinol, metazocine, methadone, metopona, morphine, mirofin , nalbuphine, narcein, nicomorphine, norlevorphanol, normethadone, nalorphine, normorphine, norpipanone, opium, oxycodone, oxymorphone, papaveretum, pentazocine, fenadoxone, fenomorphan, phenazocine, phenoperidine, piminodine, piriframide, proheptazine, promedol, properidin, propiram, propóxidofen sufentanila, tihdina, teamadol, salts fa rmeaceutically acceptable thereof and mixtures thereof. In certain embodiments, the opioid agonist is selected from codeine, hydromorphone, hydrocodone, oxycodone, dihydrocodeine, dihydromorphine, morphine, teamadol, oxymorphone, pharmaceutically acceptable salts thereof, and mixtures thereof. Examples of useful non-opioid analgesics include non-steroidal anti-inflammatory agents, such as aspirin, ibuprofen, diclofenac, naproxen, benoxaprofen, flurbiprofen, fenprofen, flubufen, ketoprofen, indoprofen, piroprofen, carprofen, oxaprozin, pramoprofen, muroprofen, trioxaprofen, suprofen, aminoprofen, tiaprofenic acid, fluprofen, bucilloxic acid, indomethacin, sulindac, tolmetin, zomepirac , tiopinac, zidometacin, acemetacin, fentiazaco, clidanaco, oxpinac, mefenamic acid, meclofenamic acid, flufenamic acid, niflumic acid, tolfenamic acid, diflurisal, flufenisal, piroxicam, sudoxicam, isoxicam, and pharmaceutically acceptable salts thereof and mixtures thereof . Other suitable non-opioid analgesics include the following analgesics, antipyretics, and non-steroidal anti-inflammatory drugs: derivatives of salicylic acids, including aspirin, sodium salicylate, magnesium choline trisalicylate, salsalate, diflunisal, salicylsalicylic acid, sulfasalazine, and olsalazine; para-aminophenol derivatives including acetaminophen and phenacetin; type and indene acetic acids, including indomethacin, sulindac, and etodolac; heteroaryl acetic acids, including tolmetin, diclofenac, and ketorolac; Anteanilic acids (fenamates), including mefenamic acid and acid meclofenamico; enóhcos acids, including oxicams (piroxicam, tenoxicam), and pirazolidindiones (phenylbutazone, oxifentartazone); and alkanones, including nabumetone. For a more detailed description of the NSAIDs, see Paul A. Insel, Analgesic-Antipyretic and Anti-inflammatory Agents and Drugs Employed in the Treatment of Gout, in Goodman & Gilman's The Pharmacological Basis of Therapeutics 617-57 (Perry B. Molinhoff and Raymond W. Ruddon eds., 9th ed.1996) and Glen R. Hanson, Analgesic, Antipyretic and Anti-Inflammatory Drugs in Remington: The Science and Practice of Pharmacy Vol II 1196-1221 (AR Gennaro ed., 19th ed., 1995) which are incorporated herein by reference in their entirety. Examples of useful Cox-II inhibitors and 5-lipoxygenase inhibitors, as well as combinations thereof, are described in U.S. Patent No. 6,136,839, which is incorporated herein by reference in its entirety. Examples of Cox-II inhibitors include, but are not limited to, rofecoxib and celecoxib. Examples of useful anti-migraine agents include, but are not limited to, alpiropride, bromocriptine, dihydroergotamine, dolasetron, ergocornin, ergocorninin, ergocryptine, ergonovine, ergot, ergotamine, flumedroxone acetate, fonazine, ketanserin, lisuride, lomerizine, methylergonovine, methysergide , metoprolol, naratriptan, oxetorone, pizotiline, propranolol, risperidone, rizatriptan, sumatriptan, timolol, teazodone, zolmitriptan, and mixtures thereof. The other therapeutic agent may be an antiemetic agent. Examples of useful antiemetic agents include, but are not limited to, metoclopromide, domperidone, prochlorperazine, promethazine, chlorpromazine, trimethobenzamide, ondanseteone, graniseteone, hydroxyzine, acetylleucine monoethanolamine, alizapride, azasetron, benzquinamide, bietanautin, bromopride, buclizine, clebopride, cyclizine, dimenhydrinate, diphenidol, dolaseteone, meclizine, metallatal, metopimazine, nabilone, oxyperendil, pipamizine, scopolamine, sulpiride, tetrahydrocannabinol, thiethylperazine, thioproperazine, fropisetron, and mixtures thereof. Examples of useful β-adrenergic blockers include, but are not limited to, acebutolol, alprenolol, amosulabol, arotinolol, atenolol, befunolol, betaxolol, bevantolol, bisoprolol, bopindolol, bucumolol, bufetolol, bufuralolol, buniteolol, bupranolol, butidrine hydrochloride, butofilolol. , carazolol, carteolol, carvedilol, celiprolol, cetamolol, cloranolol, dilevalol, epanolol, esmolol, indenolol, labetalol, levobunolol, mepindolol, metipranolol, metoprolol, moprolol, nadolol, nadoxolol, nebivalol, nifenalol, nipradilol, oxprenolol, penbutolol, pindolol, practolol, pronetalol, propranolol, sotalol, sulfinalol, talinolol, tertatolol, tilisolol, timolol, toliprolol, and xibenolol. Examples of useful anticonvulsants include, but are not limited to acetylpheneturide, albutoin, alloxidone, aminoglutethimide, acid 4-amine-3-hydroxybutyrate, atelactamide, beclamide, buramate, calcium bromide, carbamazepine, cinchromide, clomethiazole, clonazepam, decimemide, dietdione, dimethadione, doxeniteoin, eterobarb, etadione, ethosuximide, ethotoin, felbamate, fluoresone, gabapentin, 5- hydroxytryptophan, lamotrigine, magnesium bromide, magnesium sulfate, mephenytoin, mephobarbital, metarbital, metetoin, methsuximide, 5-methyl-5- (3-phenanthryl) -hydantoin, 3-methyl-5-phenylhydantoin, narcobarbital, nimetazepam, nifrazepam, oxcarbazepine, parametadione, phenacemide, phenetarbital, pheneturide, phenobarbital, phensuximide, phenylmethylbarbituric acid, phenytoin, sodium fetenilate, potassium bromide, pregabalin, primidone, progabide, sodium bromide, solanum, strontium bromide, suclofenide, sultiamo, tetrantoin, tiagabine , topiramate, trimethadione, valproic acid, valpromide, vigabatrin, and zonisamide. Examples of useful antidepressants include, but are not limited to binedaline, caroxazone, citalopram, (S) -citalopram, dimethazan, fencamine, indalpin, indeloxazine hydrochloride, nefopam, nomifensin, oxytriptan, oxypertine, paroxetine, sertraline, thiazothine, teazodone, benmoxin, iproclozide, iproniazide, isocarboxazide, nialamide, octamoxin, phenelzine, cotinine , roliciprin, rolipram, maprotiline, metalindinol, mianserin, mirtazepine, adinazolam, amitriptyline, amitriptylinide, amoxapine, butriptiline, clomipramine, demexiptiline, desipramine, dibenzepine, dimethacrine, dotiepin, doxepin, fluacizine, imipramine, imipramine N-oxide, iprindol, lofepramin, meliteacene, metapramina, nortriptilina, noxiptilina, opipramol, pizotilina, propizepina, protriptilina, quinupramina, tianeptina, trhnipramina, adrafinil, benactyzina, bupropiona, butacetina, dioxadrol, duloxetina, etoperidona, febarbamate, femoxetina, fenpentadiol, fluoxetina, fluvoxamina, hematoporfirina, hipericina, levofacetoperano, medifoxamina, milnacipran, minaprine, moclobemide, nefazodone, oxaflozane, pib eraline, prolintane, pirisuccideanol, ritanserin, roxindole, chlorinated rubidium, sulpiride, tandospirone, tozalinone, tofenacin, toloxatone, tranylcypromine, L-tr ptofano, venlafaxine, viloxazine, and zimeldine. Examples of Ca2 + channel blockers include, but are not limited to, bepridil, clentiazem, diltiazem, fendiline, gallopamil, mibefradil, prenylamine, semothiadil, terodiline, verapamil, amlodipine, aranidipine, bapiidipine, benidipine, cilidipine, efonidipine, eldipipine, felodipine, isradipine, lacidipine, lercanidipine, manidipine, nicardipine, nifedipine, nilvadipine, nimodipine, nisoldipine, nitrendipine, cinnarizine, flxmarizine, lidoflazine, lomerizine, benciclane, etafenone, phanopharone, and perhexiline. Examples of useful anticancer agents include, but are not limited to, acivicin, aclar bicin, acodazole hydrochloride, acronine, adozelesin, aldesleukin, altretamine, ambomycin, ametanphronate acetate, aminoglutethimide, amsacrine, anasteozole, ampramycin, asparaginase, asperlin, azacitidine, azetepa , azotomycin, batystatate, benzodepa, bicalutamide, bisantene hydrochloride, bisnafide dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, biririmine, busulfan, cactinomycin, calusterone, caracemide, carbetimer, carboplatin, carmustine, carubicin hydrochloride, carzelesin, cedefingol, chlorambucil, Cholemycin, Cisplatin, Cladribine, Chromatin Mesylate, Cyclophosphamide, Cytarabine, Dacarbazine, Dactinomycin, Daunorubicin Hydrochloride, Decitabine, Dexormaplatin, Dezaguanine, Dezaguanine Mesylate, Diazicuone, Docetaxel, Doxorubicin, Doxorubicin Hydrochloride, Droloxifene, Droloxifene Citeate, Dromostanolone Propionate, Duazomycin, edateexate, hydrochloride eflornithine, elsamitrucin, enloplatin, empromatin, epipropidine, epirubicin hydrochloride, erbulozole, esorubicin hydrochloride, steamustine, steamustine sodium phosphate, etanidazole, etoposide, etoposide phosphate, etoprine, fadrozole hydrochloride, fazarabine, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, flurocitabine, fosquidone, fostriecin sodium, gemcitabine, gemcitabine hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide, ilmofosin, interlexikin II (including recombinant interleukin po rIL2), interferon alfa-2a, interferon alfa-2b, interferon alfa-nl, interferon alfa-n3, interferon beta-I a, interferon gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide acetate, leteozol, leuprolide acetate, liarozole hydrochloride, lometeexol sodium, lomustine, losoxanthone hydrochloride, masoprocol, maytansine, hydrochloride mechlorethamine, megestrol acetate, melengesteol acetate, melphalan, menogaril, mercaptopurine, methotrex to, sodium methothexate, metoprine, meturedepa, mitindomide, mitocarcin, mitochromin, mitogilin, mitomalin, mitomycin, mitosper, mitotane, mitoxantrone hydrochloride, myiophenolic acid, nocodazole, nogalamycin, ormaplatin, oxisurane, paclitaxel, pegaspargase, pehomycin, pentamustine, peplomycin sulfate , perfosfamide, pipobroman, piposulphan, piroxantrone hydrochloride, plicamycin, plomestan, porfimero sodium, porfiromycin, prednimustine, procarbazine hydrochloride, puromycin, puromycin hydrochloride, pyrazofurine, riboprine, rogletimide, safingol, safingol hydrochloride, semustine, simteazena, sodium esparfosate, sparsomycin, spirogermanium hydrochloride, spiromustine, espiroplatin, streptonigrin, esteeptozocin, sulofenur, tahsomycin, tecogalan sodium, tegafur, teloxanthone hydrochloride, temoporfin, teniposide, teroxirone, testoiactone, tiamiprin, thioguanine, thiotepa, thiazofurine, tirapazamine, toremifene cytheate, teestolone acetate, trichiribine phosphate, trimetrexate, trimetrexate glucuronate, triptorelin, tubulozole hydrochloride, uracil mustard, uredepa, vapreotide, verteporfin, vinblastine sulfate, vincristine sulfate, vindesine, vindesine sulfate, vinepidine sulfate, vinghcinate sulfate, vinleurosine sulfate, vinorelbine tarteate, vinrosidine sulfate, vinzolidine sulfate, vorozole, zeniplatine, zinostatin, zorubicin hydrochloride. Examples of other anti-carcinogenic agents include, but are not limited to, 20-epi-l, dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acrylic fulvene; adecipenol; adozelesina; aldesleukin; ALL-TK antagonists; alteetamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anasteozole; andrografol; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; morphogenetic protein-1 anti-splitting; antiandrogen, prostatic carcinoma; antiesteogen; antineoplaston; ohgonucleotides antisense; aphidicolin ghcinate; modulators of the apoptosis gene; regulators apoptosis; Apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azaseteone; azatoxin; azathirosine; Bacatin IH derivatives; balanol Batimastat; BCR / ABL antagonists; benzoclorins; benzoylstaurosporin; beta lactam derivatives; beta-aletine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantene; bisaziridinyl espermine; bisnafide; bistraten A; bizelesin; breflate; biririmine; budotitan; butionine sulfoximine; calcipotriol; calfostin C; camptothecin derivatives; canaripox TL-2; capecitabine; carboxamide-amine-triazole; carboxyamidotriazole; CaRest M3; CARN 700; inhidor derived from cartilage; carzelesin; inhibitors casein kinase (ICOS); castanospermine; cecropin B; ceteorelix; clorlns; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomiphene analogues; clotrimazole; colismicin A; colismicin B; combretastatin A4; analogous combretastatin; conagenina; crambescidin 816; crisnatol; cryptophycin 8; Cryptophycin A derivatives; Cure A; cyclopentantraquinones; Cycloplatam; cipemycin; cytarabine ocphosphate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexiphosphamide; dexrazoxane; dexverapamil; diazicuone; didemnin B; didox; diethylonorspermine; dihydro-5-azacytidine; 9-dihydrotaxol; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolaseteone; doxifluridine; droloxifene; dronabinol; duocarmicin SA; ebselen; ecomustine; edelfosin; Edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristerida; esteamustine analogous; stenogen antagonists; stenogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastima; Finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadqlinium texaphylline; gauze nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulina; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosin; ilomastat; imidazoacridones; imiquimod; immunostimulatory peptides; Insulin-like factor-1 growth receptor inhibitor; interferon agonists; interferonase; interleukins; iobenguane; iododoxorubicin; 4-ipomeanol; iroplact; irsogladine; isobengazole; isohomohahcondrin B; itaseteon; jasplakinolide; kahalalide F; lamelarine-N triacetate; lanreotide; leinamycin; lenograstima; lentinan sulfate; leptolstatin; lefrozole; leukemia inhibitory factors; alpha leukocyte interferon; leuprohda + spherogen + progesterone; leuprorelin; levamisole; liarozola; analogous linear pohamine; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricin; lometrexol; lonidamine; losoxantone; lovastatin; loxoribine; lurtotecan; luteciu texaphyrin; lyophilin; UTIC peptides; Maytansine; Handstatin A; marimastat; masoprocol; maspina; matrilysin inhibitors; inhibitors of metalloproteinase matrix; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; Uneven RNA of double slob; mitoguazone; mitolactol; mitomycin analogues; mitonafide; growth factor fibroblast mycotoxin; mitoxantone; mofarotene; molgramostim; monoclonal antibody, chorionic human gonadotrophin; hpido monophosphoryl cell wall A + myobacterium sk; mopidamol; gene inhibitor for multiple drug resistance; 1-based suppressor therapy of multiple tumors; anticancer agent of mustard; micaperoxida B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone + pentazocinea; napavina; naphthefin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; Nitric oxide modulators; nitroxide antioxidants; nitrulin; 06-benzylguanine; octeeotide; okicenone; oligonucleotides; onapristone; ondanseteona; ondansetrone; oracine; oral cytokine inducer; ormaplatin; osaterone; Oxaliplatin; oxaunomycin; paclitaxel; analogous paclitaxel; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxitriol; panomiphene; parabactin; pazeliptina; pegaspargasa; peldesina; sodium pentosan polysulfate; pentostatin; penteozole; perflubron; perfosfamide; perilyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocaphine hydrochloride; pirarubicin; piriteexim; placetina A; placetina B; plasminogen activator inhibitor; platinum complexes; platinum compounds; platinum-triamine complexes; sodium porfimer; porphyromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; A-based immune protein modulator; inhibitor of protein kinase C, microalgal; inhibitors of tyrosine phosphate protein; inhibitors of nucleoside purine phosphorylase; purpurinsa; pyrazoloacridine; conjugate of pyridoxylated hemoglobin plioxyethylene; raf antagonists; raltiteexed; ramosetron; ras protein inhibitors farnesil teansferasa; ras inhibitors; ras-GAP inhibitor; demethylated reteliptina; rhenium Re 186 etidronate; rhizoxin; ribozymes; RH retinamide; rogletimide; rohitukina; romurtida; roquinimex; Rubiginone Bl; ruboxil; safingol; saintopine; SarCNU; sarcofitol A; sargramostima; Sdi 1 mimetics; semustine; inhibitor 1 derived from senescence; oligonucleotides sense; signal teansduction inhibitors of the transmission signal; modulators of the driving signal; simple peptide protein of the antigenic chain; sizofirana; Sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; Esparfosic acid; Spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; cell root inhibitor; inhibitors of root-cell division; stihadid; Esteomehsin inhibitors; Sulfinosine; vasoactive superactive antagonist of the intestinal peptide; suradista suramin; Swainsonin; synthetic glycosaminoglycans; talimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; Telurapyrilium; telomerase inhibitors; temoporfin; temozolomide; teniposide; teteaclorodecaoxide; teteazomina; Taliblastine; thiocoraline; theombopoietin; mimetic thrombopoietin; timalfasin; timopoietin antagonist receptor; thymotrinan; Hormone thyroid stimulant; ethyl tin ethiopurcine; tirapazamine; bicyclic titanocene; topsentin; toremifene; totipotent factor of cellular root; Translation inhibitors; teetinoin; triacetyluridine; teiribibin; trimeteexate; triptorelin; theopiseteone; turosteride; tyrosine kinase inhibitors; Tyrphostins; UBC inhibitors; ubenimex; sine-derived urogenital growth inhibitory factor; urokinase antagonist receptor; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramina; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zipiplatine; zilascorb; and zimatatin stimalamer. Examples of therapeutic agents useful for teaching or preventing Ul include, but are not limited to, propantheline, imipramine, hyoscyamine, oxybutynin, and dicyclomine.

Examples of therapeutics useful for teaching or preventing ulcer include antacids such as aluminum hydroxide, magnesium hydroxide, sodium bicarbonate, and calcium bicarbonate; sucralfate; bismuth compounds such as bismuth subsalicylate and bismuth subcytheate; H2 antagonists such as cimetidine, ranitidine, famotidine, and nizatidine; inhibitors H ", K + - ATPase such as omeprazole iansoprazole, and lansoprazole, carbenoxolone, misprostol, and antibiotics such as teteacicline, metromdazole, thymidazole, clariteomycin, and amoxicillin Examples of therapeutic agents useful for teaching or preventing IBD include, but are not limited to a, anticholinergic drugs, diphenoxylate, loperamide, deodorized opium dye, codeine, a wide range of antibiotics such as meteomdazole, sulfasalazine, olsalazine, mesalamine, prednisone, azathioprine, mercaptopurine, and metoteexate Examples of therapeutic agents useful for teaching or preventing IBS include , but are not limited to, propantheline, muscarin antagonist receptors such as pirenzapine, methocteamine, iprateopium, tiotropium, scopolamine, metscopolamine, homateopine, homateopine methyl bromide, and metadin, and antidiarrheal drugs such as diphenoxylate and loperamide.Examples of useful therapeutic agents for Fratar or prevent an addictive disorder or include, but are not limited to, methadone, desipramine, amantadine, fluoxetine, buprenorphine, an opiate agonist, 3-phenoxypyridine, levomethadyl acetate hydrochloride, and serotonin antagonists. Examples of useful therapeutic agents for treating or preventing Parkinson's disease and parkinsonism include, but are not limited to, carbidopa / levodopa, pergolide, bromocriptine, ropinirola, pramipexole, entacapone, tolcapone, selegiline, amantadine, and trihexyphenidyl hydrochloride. Examples of therapeutic agents useful for teaching or preventing anxiety, include, but are not limited to, benzodiazepines, such as alprazolam, brotizolam, clordiazepoxide, clobazam, clonazepam, clorazepate, demoxepam, diazepam, estazolam, flumazenil, flurazepam, halazepam, lorazepam, midazolam , mtrazepam, nordazepam, oxazepam, prazepam, quazepam, temazepam, and triazolam; non-benzodiazepine agents, such as buspirone, gepirone, .ipsaprione, thiospirone, zolpicone, zolpidem, and zaleplone; tranquilizers, such as barbiturates, for example, amobarbital, aprobarbital, butabarbital, butalbital, mephobarbital, methohexital, pentobarbital, phenobarbital, secobarbital, and thiopental; and propanediol carbomatos, such as meprobamate and tibamate.

Examples of therapeutics useful for teaching or preventing epilepsy include, but are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrignin, phenobarbital, phenytoin, primidone, valproic acid, trimethadione, bemzodiaepines, gabapentin, lamotrigine,? -immune GABA, acetazolamide, and felbamate Examples of therapeutic agents useful for treating or preventing infarcts include, but are not limited to, anticoagulants such as heparin, clot dissolving agents such as steeptokinase or tissue plasminogen activator, swelling reducing agents such as mannitol or corticosteroids, and acetylsalicylic acid. Examples of therapeutic agents useful for treating or preventing an attack include, but are not limited to, carbamazepine, ethosuximide, gabapentin, lamotrignin, phenobarbital, phenytoin, primidone, valproic acid, trimethadione, bemzodiaepines, gabapentin, lamotrigine, β-vinyl GABA, acetazolamide. , and felbamate. Examples of therapeutic agents useful for teaching or preventing a pruritic condition include, but are not limited to, nalteexono; nalmefene; Danazol; tricyclics such as amitriptyline, imipramine, and doxepin; antidepressants such as those indicated below, menthol; camphor, phenol, pramoxin, capsaicin, tar; steroids; and antihistamines. Examples of therapeutic agents useful for teaching or preventing psychosis include, but are not limited to, phenothiazines such as chlorpromazine hydrochloride, mesylazine besylate, and toridazine hydrochloride; thioxanthenes such as chloroprothixene and thiothixene hydrochloride; clozapine; risperidone; olanzapine; quetiapine; quetiapine fumarate; haloperidol; haloperidol decanoate; loxapine succinate; molindone hydrochloride; pimozide; and ziprasidone. Examples of therapeutic agents useful for teaching or preventing Huntington's disease include, but are not limited to, haloperidol and pimozide. Examples of therapeutic agents useful for teaching or preventing ALS include, but are not limited to, baclofen, neuroteopic factors, riluzole, tizanidine, benzodiazepines such as clonazepam and danteolene.

Examples of therapeutic agents useful for teaching or preventing cognitive disorders include, but are not limited to, agents for teaching or preventing demensia such as tacrine; donepezil; ibuprofen; antipsychotic drugs such as thioridazine and haloperidol; and antidepressant drugs such as those indicated below. Examples of therapeutic agents useful for trapping or preventing migraine include, but are not limited to, sumatriptan; methysergide; ergotamine; caffeine; and beta-blockers such as propranolol, verapamil, and divalproex. Examples of therapeutic agents useful for teaching or preventing vomiting include, but are not limited to, 5-HT3 antagonist receptors such as ondanseteone, dolaseteone, graniseteone, and theopiseteone; dopamine antagonist receptors such as procloferazine, tiethylperazine, clofromazine, metoclopramide, and domperidone; glucocorticoids such as dexamethasone; and benzodiazepines such as lorazepam and alprazolam. Examples of therapeutic agents useful for teaching or preventing dyskinesia include, but are not limited to, resephine and teteabenazine. Examples of therapeutic agents useful for treating or preventing depression include, but are not limited to, tricyclic antidepressants such as amitriptyline, amoxapine, bupropion, clomipramine, desipramine, doxepin, imipramine, maprotiline, nefazadone, nortriptyline, protriptyline, teazodone, trimipramine, and venlaflaxin.; selective serotonin reukptake inhibitors, such as citalopram, (S) -citalopram, fluoxetine, fluvoxamine paroxetine, and setealine; monoamine oxidase inhibitors such as isocarboxazide, pargyline, phenelzine, and thesanylcypromine; and psychostimulants such as dextroamphetamine and methylphenidate. A Phenylene Compound and the other therapeutic agent can act together or, in one embodiment, synergistically. In a fashion, a Femlen Compound is administered concurrently with another therapeutic agent; for example a composition comprising an effective amount of a Phenylene Compound and an effective amount of other therapeutic agent can be administered. Alternatively, a composition comprising an effective amount of xm Phenylene Compound and a different composition comprising an effective amount of another therapeutic agent may be administered concurrently. In other mode, an effective amount of a Femlen Compound can be administered before or after the administration of an effective amount of another therapeutic agent. In this modality, the Phenylene Compound is administered while the other therapeutic agent it exerts its therapeutic effect, or the other therapeutic agent is administered while the Phenylene Compound exerts its therapeutic effect to teach or prevent a Condition.

A composition of the invention is prepared according to a method comprising mixing a Phenylene Compound or a pharmaceutically acceptable salt and a pharmaceutically acceptable carrier or excipient. The mixture can be achieved using known methods for mixing a compound (or salt) and a pharmaceutically acceptable carrier or excipient. In a. The Phenylene Compound is present in the composition in an effective amount.

Kits The invention comprises kits that can simplify the administration of a Femlen Compound to an animal. A typical kit of the invention comprises unit dose formulation of a Femlene Compound. In one embodiment, the unit dose is a container, which can be sterile, containing an effective amount of a Phenylene Compound and a pharmaceutically acceptable carrier or excipient. The kit may additionally comprise a label or printed instructions instructing on the use of the Femlene Compound to treat a Condition. The kit may further comprise a unit dose of another therapeutic agent, for example, a second container containing an effective amount of the other therapeutic agent and a pharmaceutically acceptable carrier or excipient. In another modality, the kit comprises a container containing an effective amount of xm Phenylene Compound, an effective amount of another therapeutic agent, a pharmaceutically acceptable carrier or excipient. Examples of other therapeutic agents include, but are not limited to, those indicated above. Kits of the invention may further comprise a device useful for administering the unit doses. Examples of such devices include, but are not limited to, a syringe, a drip bag, a patch, an inhaler and an enema bag. The following examples are set forth to assist in the understanding of the invention and should not be construed as limiting the invention described and claimed herein. Such variations of the invention, including the substitution of all equivalents currently known or developed in the future, Those who would be in the field of those who are well versed in the art, and changes in the formulations or changes in the experimental design, should be considered as an underestimate of the field of invention here.

Examples Example 1: Synthesis of Compound E35 D E35 To a solution of 4-iodobenzoic acid A (commercially available from Sigma-Aldrich, St. Louis, MO) in DMF (0.22 M) was added 1 equivalent of 4-tert-butylaniline B (commercially available from Sigma-Aldrich) , and the resulting mixture was stirred for about 5 minutes at a temperature of about 25 ° C. To the resulting reaction mixture was added about 1 equivalent of HOBT and about 1 equivalent of EDCI and the mixture was allowed to stir for about 6 hours at a temperature of about 25 ° C. The reaction mixture was diluted with 2N aqueous hydroxide partner and extracted 3 times with EtOAc. The EtOAc layers were combined, dried (with Na2SO), and the solvent removed under reduced pressure to provide a residue which was washed with methanol and dried under reduced pressure. The residue was then suspended in THF (0.04 mol / liter) under a nitrogen atmosphere and 3 equivalents of Compound E (commercially available from Sigma-Aldrich) and 0.05 equivalents of Pd (PPh3) 4 (commercially available from Sigma -Aldrich) were added to the resulting mixture. Then, the mixture was heated to about 70 ° C and stirred for about 2 hours. The solvent was removed under reduced pressure to provide a residue that was purified using a column of silica gel eluted with a gradient of 5:95 ethyl acetate: hexane at 50:50 ethyl acetate: hexane to provide Compound E35 as an off white solid. (28% in proportion). The identity of Compound E35 was confirmed using 'H NMR. Compound E35: * H NMR (MeOD) d 8.335 (s, ÍH), 7.939 (d, 2H), 7.681 (d, ÍH), 7,513 (t, 4H), 7,300 (d, 2H), 7,251 (dd, ÍH), 2,230 (s, 3H), 1,227 (s, 9H) ppm.

Example 2: Synthesis of Compound E42 Compound E42 was made by xm procedure analogous to the process used to make Compound E35 except that 4-trifluoromethylaniline (commercially available from Sigma-Aldrich) was used instead of 4-tert-butylaniline. Compound E42 was obtained as a white solid (80% in proportion).

The identity of Compound E42 was confirmed using 1 H NMR. Compound E42: H NMR (CDC13) d 8.560 (s, ÍH), 8.138 (s, ÍH), 7.954 (d, 2H), 7.813 (d, 2H), 7.684-7.604 (m, 5H), 7.267-7.223 ( m, ÍH + CDC13), 2.369 (s, 3H), 1.559 (s, H2O) ppm.

Example 3: Synthesis of Compound J35 Compound J35 was made by means of a procedure analogous to the process used to make Compound E35 except that 6-chlorobenzothiazol-2-ylamine (commercially available from Sigma-Aldrich) was used instead of 4- tert-butylaniline Compound J35 was obtained as a white solid. The identity of Compound J35 was confirmed using 1H NMR. Compound J35: 1 H NMR (DMSO 6), d 8.65-8.60 (M, lh), 8.22-8.17 (M, 2h), 7.93-7.89 (M, lh), 7 , 86-7.84 (M, IhO, 7.74-7.67 (M, 3H), 7.52-7.47 (m, IH), 7.45-7.41 (m, IH), 2.43 (s, 3H) ppm.

Example 4: Synthesis of Compound J37 Compound J37 was made by a process analogous to the procedure used to make Compound E35 except that 6-fluorobenzothiazol-2-ylamine (commercially available from Sigma-Aldrich) was used instead of 4- tert-butylaniline Compound J37 was obtained as a whitish substance. The identity of Compound J37 was confirmed using! H NMR. Compound J37: * H NMR (DMSO-de) d 8.29-8.24 (m, 1H), 8.15-8.09 (m, 2H), 7.65-7.61 (m, 1H) , 7.52-7.34 (m, 4H), 7.22-7.16 (m, HH), 6.98-6.91 (m, HH), 2.19 (s, 3H) ppm.

Example 5: Synthesis of Compound E50 Compound 50 was made by means of xm procedure analogous to the process used to make Compound E35 except that the following zinc bromide compound, prepared according to the procedure provided in M.B. Smith and J. March, March 's Advanced Organic Chemistry: Reaction Mechanisms and Structure, 805-807 (5th ed., 2001); H. Fillon et al., Tett. Lett. 42: 3843-46 (2001); M. Amadji et al, Tettrahedron 9: 1657-60 (1998); and S. Billotte, Synlett. 379-380 (1998), was used in place of Compound E: Compound E50 was obtained as a white solid xm. The identity of Compound E50 was confirmed using XH NMR. Compound E50: lH NMR (CDC13) d 8.87 (dd, ÍH), 8.12 (dd, ÍH), 7.96 (d, 2H), 7.83 (s, ÍH), 7.64 (d , 2H), 7.58 (d, 2H), 7.48 (dd, ÍH), 7.41 (d, 2H), 1.33 (s, 9H) ppm.

Example 6: Ligand or Union of Phenylene Compounds to mGluR5 The following assay can be used to demonstrate that Phenylene Compounds bind or bind to and modulate the activity of mGluR5. Cell Culture: Primary glial cell cultures are prepared from 18 day Sprague-Dawley embryo cortices. The cortices are dissected and then dissociated by means of grinding. The resulting homogeneous cell is disposed on the plate on TI 75 flasks pre-coated with poly-D-lysine ((BIOCOAT, commercially available from Becton Dickinson and Company Inc. in Franklin Lakes, NJ) in the Modified Eagle Dulbecco Medium ("DMEM," pH 7.4), buffered with 25 mM HEPES, and supported with 15% fetal calf serum ("FCS," commercially available from Hyclone Laboratories Inc. in Omaha, NE), and incubated at 37 ° C and 5% CO2 After 24 hours, the FCS supplement is reduced to 10% On the sixth day, oligodendrocytes and microglia are removed by strongly beating the contour of the flasks One day after this purification step, secondary astrocyte cultures are established by subplanting in 96 pre-coated TI-75 poly-D-lysine flasks (BIOCOAT) at a density of 65,000 cells / originals in DMEM and 10% FCS. 24 hours, the asphrocytes are washed with a serum-free medium and then cultured in DMEM, without glutamate, supplemented with 0.5% FCS, 20 mM HEPES, 10 ng / mL epidermal growth factor ("EGF"), 1 mM sodium pyruvate, and IX penicillin / sfreptomycin at pH 7.5 for 3 to 5 days at 37 ° C and 5% CO2. The method allows the expression of mGluR5 receptor by asterocytes, as demonstrated by S. Miller et al, J. Neuroscience JL5 (9): 6103-6109 (1995).

Test Protocol: After a 3 to 5 day incubation with EGF, the asteocytes are washed with 127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 700 mM NaH2PO4, 2 mM CaCl2, 5 mM NaHCO3, 8 mM HEPES, 10 mM Glucose at pH 7.4 ("Assay Buffer") and loaded with Fluo-4 dye (commercially available from Molecular Probes Inc. of Eugene, OR) using 0.1 mL of Assay Buffer containing Fluo-4 (3 mM final). After 90 minutes of dye loading, the cells are washed twice with 0.2 mL of Assay Buffer and resuspended in 0.1 mL of Assay Buffer. The plates containing the asteocytes are then transferred to a Fluorometric Image Plate Reader ("FLIPR," commercially available from Molecular Devices Coforation of Sunnyvale, CA) for calculation of calcium mobilization flux in the presence of glutamate and in the presence or absence of antagonist. After monitoring the fluorescence for 15 seconds in order to establish a baseline, DMSO solutions containing various concentrations of a Phenylene Compound diluted in Assay Buffer (0.05 mL of 4X solutions for competitive curves) are added to the cell plate and the fluorescence is monitored for 2 minutes. 0.05 mL of a 4X glutamate solution (agonist) is then added to each original to provide a final concentration of glutamate in each original of 10 mM. The fluorescence of the plate is then monitored for an additional 60 seconds after the addition of the agonist. The final concentration of DMSO in the assay is 1.0%. In each experiment, the fluorescence is momtored as a function of time and the data analyzed using Microsoft Excel and GraphPad Prism. The dose-response curves are adjusted using a non-linear regression to determine the IC50 value. In each experiment, each data point is determined twice.

Example 7: In Vivo Tests for the Prevention or Treatment of Pain Test animals: Each experiment uses rats weighing 200-260 g at the beginning of the experiment. Rats are grouped and have free access to food and water at any time, except before oral administration of a Phenylene Compound when the food is removed 16 hours before the dose. A control group acts as a comparison for rats armed with a Femlen Compound. The carrier of the Phenylene Compound is administered to the control group. The volume of carrier administered to the control group is equal to the volume of carrier and Phenylene compound administered to the test group.

Acute Pain: In order to evaluate the actions of the Phenylene Compounds for the treatment or prevention of acute pain, the rapid tail movement test of the rat can be used. The rats are carefully restrained with the hand and tail exposed to a focused beam of radiant heat light at a point 5 cm from the tip using a fast tail movement unit (Model 7360, commercially available from Ugo Basile of Italy). The latencies of the fast tail movements are defined as the interval between the beginning of the thermal stimulus and the rapid movement of the tail. The unresponsive animals of 20 seconds are removed from the fast tail movement unit and assigned a latency withdrawal of 20 seconds. The latencies of fast tail movements are measured immediately before (pre-treatment) and 1, 3, and 5 hours after the administration of a Femlene Compound. The data are expressed as fast tail movement latency (s) and the maximum possible effect percentage (% MPE), that is, 20 seconds, is calculated as follows: [(post-administration latency) - (pre-administration latency)]% MPE = x 100 (20 s pre-administer latency) The rapid tail movement test in rats is described in F.E. D'Amour et al, "A Method for Determining Loss of Pain Sensation," J. Pharmacol. Exp. Ther. 72: 74-79 (1941). Acute pain can also be assessed by measuring the response of the animal to noxious mechanical stimulus by determining the leg withdrawal threshold ("PWT"), as described below.

Inflammatory Pain: In order to evaluate the actions of the Phenylene Compounds for the treatment or prevention of inflammatory pain, Freund's complete adjuvant inflammatory pain model ("FCA") is used. The FCA-induced inflammation of the hind paw of the rat is associated with the development of persistent inflammatory mechanical hyperalgesia and provides reliable predictions of the anti-hyperalgesic action of clinically useful analgesic drugs. (L. Bartho et al, "Involvement of Capsaicin-sensitive Neurons in Hyperalgesia and Enhanced Opioid Antinociception in Inflammation, "Naunyn-Schmiedeberg's Archives of Pharmacol 342: 666-670 (1990).) In the left hind paw of each animal, an interplantar injection of 50 μL of 50% FCA is administered 24 hours after injection, the animal is evaluated on its response to noxious mechanical stimulus, determining the PWT, as described below: The rats are then administered a single injection of 1, 3, 10 or 30 mg / Kg of either a Femlen Compound; 30 mg / Kg of xm control selected from Celebrex, indomethacin or naproxen, or carrier.The noxious mechanical stimulus responses are then determined 1, 3, 5 and 24 hours after their administration.The percent inversion of hyperalgesia for each animal is defined as : [(PWT post administration) - (PWT pre-administration)]% Investment = x 100 [(baseline PWT) - (PWT pre-administering)] Neuropathic Pain: To evaluate the actions of Femleno Compounds for the treatment of neuropathic pain, You can use either the Seltzer or Chung model. In the Seltzer model, the neuropathic pain model of partial hgation of the sciatic nerve is used to produce neuropathic hyperalgesia in rats. (Z. Seltzer et al, "A Novel Behavioral Model of Neuropathic Pain Disorders Produced in Rats by Partial Sciatic Nerve Injury," Pain 43: 205-218 (1990)). The partial ligation of the left sciatic nerve is carried out under the inhalation of isoflurane / O2 anesthesia. After the induction of anesthesia, the left thigh of the rat is shaved and the sciatic nerve exposed at the level of the thigh height through a small incision and is carefully isolated from the surrounding connective tissue, in a place near the teoncater just distal to the point where the semitendenous nerves of the posterior biceps branch out from the common sciatic nerve. A 7-0 silk suture is inserted into the nerve with a reversible cutting mini-needle with a 3/8 curve firmly attached so that the 1/3 to Vi thickness of the nerve is contained in the ligation of the ligature. The wound is closed with a single muscle suture (4-0 nylon (Vicryl)) and vetbond tissue glue. After surgery, the area of the wound is sprinkled with antibiotic powder. The surrogate-teared rats undergo an identical surgical procedure except that the sciatic nerve is not manipulated. After surgery, the animals are weighed and placed on a warm pad until they recover from anesthesia.

The animals are then returned to their cages until the behavioral tests begin. The animal is evaluated for its response to noxious mechanical stimulus, determining PWT, as described below, before surgery (baseline), then immediately before and 1, 3, and 5 hours after the administration of drugs to the hind leg of the animal. The hyperalgesia inversion percentage is defined as: [(PWT post administration) - (PWT pre-administration)] % Investment = X 100 [(baseline PWT) - (PWT pre-administering)] In the Chung model, the neuropathic pain model of the spinal nerve ligature is used to produce mechanical hyperalgesia, thermal hyperalgesia and tactile allodynia in rats. The surgery is carried out under inhalation of isoflurane / O2 anesthesia. After the induction of anesthesia, a 3 cm incision is made and the left paraspinal muscles are separated from their vertebral process at the L4 - S2 levels. The transverse process is carefully removed with a pair of small forceps to visually identify the vertebral nerves L4 - Le. The left nerve (s) L5 (or L5 and L6) is isolated and firmly linked with silk thread. A complete hemostasis is confirmed and the wound is sutured using non-absorbent sutures, such as nylon sutures or stainless steel staples. Substituted-teared rats are subjected to an identical surgical procedure, except that the vertebral nerve (s) is not manipulated. After surgery, the animals are weighed, administered a subcutaneous (s.c.) injection of saline or lactose, the wound area is sprinkled with antibiotic powder and kept on a warm pad until they recover from anesthesia. The animals are then returned to their cages until the behavior test begins. Animals are evaluated for their response to noxious mechanical stimulus, determining PWT, as described below, before surgery (baseline), then immediately prior to and 1, 3, and 5 hours after they are administered a Compound Femlenos for the left rear leg of the animal. The animal can also be evaluated for its response to noxious thermal stimulus or tactile allodynia, as described below. The Chung model for neuropathic pain is described in S.H. Kim, "An Experimental Model for Peripheral Neuropathy Produced by Segmental Spinal Nerve Ligation in the Rat," Pani 50 (3): 355-363 (1992). Response to Mechanical Stimulation as Evaluation of Mechanical Hyperalgesia: The leg pressure test can be used to evaluate mechanical hyperalgesia. For this test, the hind paw withdrawal thresholds (PWT) at xm noxious mechanical stimulus are determined using analgesymetry (Model 7200, commercially available at Ugo Basile in Italy) as described in C. Stein, "Unilateral Inflammation of The Hindpaw in Rats as a Model of Prolonged Noxious Stimulation: Alterations in Behavior and Nociceptive Thresholds, "Pharmacol. Biochem. and Behavior 31: 451-455 (1988). The maximum weight that can be applied to the rear leg is set at 250 g and the end point is taken as the complete withdrawal of the leg. PWT is determined once for each rat at each time point and only the affected paw (ipsilateral) is tested. Response to Thermal Stimulation as Evaluation of Thermal Hyperalgesia: The plantar test can be used to evaluate thermal hyperalgesia. For this test, latencies of withdrawal of the hind paw to a noxious thermal stimulus are determined using a plantar test apparatus (commercially available from Ugo Basile of Italy) following the technique described by K. Hargreaves et al, "A New and Sensitive Method for Measuring Thermal Nociception in Cutaneous Hyperalgesia, "Pain 32 (1): 77-88 (1988). The maximum exposure time is set at 32 seconds in order to avoid tissue damage and any direct withdrawal of the leg from the heat source is taken at this end point. Three latencies are determined in each period of time and averaged. Only the affected paw (ipsilateral) is tested. Tactile Allodynia Evaluation: To assess tactile allodynia, the rats are placed in transparent plexiglass compartments with a mesh floor where they are allowed to become habituated for a period of at least 15 minutes. After habituation, a series of von Frey monofilaments are placed on the plantar surface of the left leg (operated) of each rat. The von Frey monofilament series consist of six monofilaments of increasing diameter, with the smaller diameter fiber presented first. Five tests are conducted with each strand, each test with approximately 2 minutes of separation. Each presentation lasts a period of 4-8 seconds or until a nociceptive withdrawal behavior is observed. Retraction, withdrawal of the leg or licking of the leg are responses considered as nociceptive behavior.

Example 8: In Vivo Tests for the Prevention or Treatment of Anxiety The elevated plus maze test or the probe-shock concealment test can be used to evaluate the anxiolytic activity of Femlene Compounds in rats and mice. Plus Labyrinth Plus Test: The plus plus labyrinth test consists of a platform with four sleeves, two open and two closed (50x10x50 cm enclosed with an open roof). Rats (or mice) are placed in the center of the platform, at the intersection of the four sleeves, facing one of the closed sleeves. The time of stay in the open sleeves vs. Closed sleeves and number of open sleeves entries is registered. This test is conducted before drug administration and again, after drug administration. The results of the test are expressed as the average time spent in open sleeves and the average number of open sleeves. Known ansyolytics increase both the open sleeves time and the open sleeves entry number. The plus plus maze test is described in D. Treit, "Animal Models for the Study of Anti-anxiety Agents: A Review," Neuroscience & Biobehavioral Reviews 9 (2): 203-222 (1985). Probe-shock concealment test: For the probe-shock concealment test, the test apparatus consists of a plexiglass box measuring 40x30x40 cm, uniformly covered with approximately 5 cm of bedding material (cat litter absorbing odors) with a small hole at one end through which a shock probe is inserted (6.5 cm long and with a diameter of 0.5 cm). The Plexiglas discharge probe is spirally wrapped with two copper cables through which electrical current is administered. The current is set to 2 mA. The rats are habituated to the test apparatus for 30 minutes for 4 consecutive days without the shock probe in the box. On the day of the test, the rats are placed in a corner of the test chamber after drug administration. The probe is not electrified until the rat touches it with its nose or front legs, at which point the rat receives a short 2 mA discharge. The 15-minute test period begins once the rat receives its first shock and the probe remains electrified for the remainder of the test period. The discharge induces a burial or concealment behavior on the part of the rat. After the first discharge, the duration time that the rat spends spraying bedding material towards or above the probe with its nose or front legs (burial or concealment behavior) is measured as well as the number of discharges that the rat receives from the probe induced by contact. Known anxiolytic drugs reduce the amount of burial or concealment behavior. Also, the rate of rat reactivity to each discharge is recorded on a scale of 4 points. The total immobility time during the 15 minute test period is used as an index of general activity. The probe-shock concealment test is described in D. Treit, 1985, supra.

Example 9: In Vivo Assays for the Prevention or Treatment of an Addictive Disorder The conditioned place preference test or drug self-administration test can be used to evaluate the ability of Phenylene Compounds to attenuate the rewarding properties of known drug abuse. The conditioned place preference test: The apparatus for the conditioned place preference test consists of two large compartments (45 x 45 x 30 cm) made of wood with a Plexiglas front wall. These two large compartments are clearly different. Doors in the back of each compartment lead to a smaller box (36 x 18 x 20 cm) made of wood, painted gray, with a mesh roof. The two large compartments differ in terms of shade (white vs. black), level of illumination (the plexiglass door of the white compartment is covered with aluminum foil except for a 7 x 7 cm window), texture (the white compartment has a 3 cm thick board (40 x 40 cm) with nine holes of a diameter of 5 cm equally spaced and black has a mesh floor), and smell controls (saline in the white compartment and 1 mL of 10% acetic acid in the black compartment). On the days of habituation and testing, the doors to the small box remain open, giving the free rat access to both large compartments. The first session in which a rat is placed in the apparatus is a habituation session and the entrances to the smaller gray compartment remain open giving the rat free access to both large compartments. During habituation, rats generally show no preference for either compartment. After habituation, the rats are given 6 conditioning sessions. The rats are divided into 4 groups: carrier pre treatment + carrier (control group), Phenylene compound pretreatment + carrier, pretreatment carrier + morphine, Phenylene compound pre-treatment + morphine. During each session, the rat is injected with one of the drug combinations and confined to a compartment for 30 minutes. The next day, the rat receives a carrier + carrier treatment and is confined to the other large compartment. Each rat receives tees conditioning sessions consisting of 3 combinations of drugs and tees pairs of compartment-carrier. The order of the injections and the compartment / drug pairs are counterbalanced denteo of the groups. On the day of the test, the rats are injected, before the test (30 min to 1 hour), with either morphine or a carrier and the rat is placed in the apparatus, the doors to the gray compartment remain open and the rat You can scan the whole device for 20 min. The time that remains in each compartment is recorded. Abuse of known drugs increases the time spent in the drug-drug compartment during the test session. If the Femlen Compound blocks the scope of the place preference conditioned with morphine (prize), there will be no difference in the residence time on each side in rats pretreated with a Phenylene Compound and the group will not be different from the group of rats that are gave them carrier + carrier in both compartments. The information will be analyzed as the time of permanence in each compartment (pair-drug combination vs. pair-carrier). In general, the experiment is repeated with a minimum of 3 doses of a Phenylene Compound. Self-Administered Drug Testing: The self-administered drug testing device is a standard chamber commercially available as an operational conditioning chamber. Before the drug tests begin, the rats are trained to press a lever for a reward in food. Once a stable lever pressure behavior is acquired, the rats are tested to exert pressure on the lever for a drug reward. The rats are implanted with chronic residence jugular catheters for intea venous administration of compounds and allowed to recover for 7 days before the start of training. Experimental sessions are conducted daily for 5 days in 3-hour sessions. Rats are trained to self-administer a known drug of abuse, such as morphine. The rats are then presented with two levers, an "active" lever and an "inactive" lever. Pressing the active lever results in a drug infusion in a fixed ratio program of 1 (FR1) (that is, a lever pressure gives an infusion) followed by a recess period of 20 seconds (indicated by the illumination of a light above the levers). Pressing the inactive lever results in the infusion of excipients. Training continues until the total number of morphine infusions stabilizes within ± 10% per session. The rats are trained to evaluate the effect of pre-treatment with Phenylene Compounds in the self-administration of drugs. On the day of the test, rats are pre-treated with a Phenylene Compound or excipient and then allowed to self-administer drugs, as usual. If the Phenylene Compound blocks the reward effect of morphine, the rats pre-treated with the Phenylene Compound will demonstrate a lower response rate compared to the previous response rate and compared to rats pretreated with excipients. The information is analyzed according to the change in the number of drug infusions per test session (number of infusions during the test session - number of infusions during the training session).

Example 10: Functional Assay for Characterizing mGluRl Antagonist Properties Functional assays for the characterization of mGluR 1 antagonist properties are known in the art. For example, the following procedure can be used. A CHO-rat mGluRl cell line is generated using cDNA encoding the rat mGluRl receptor (M. Masu and S. Nakanishi, Nature 349: 760-765 (1991)). The cDNA encoding the mGluRl receptor can be obtained from, for example, Prof. S. Nakanishi (Kyoto, Japan). 40,000 cells / original CHO-rat mGluRl are plated on a tissue plate treated with culture tissue, 96 wells, clear bottom, black, COSTAR 3409 (commercially available from Fisher Scientific of Chicago, El) and incubated in a Medium Modified Eagle Dulbecco (DMEM, pH 7.4) supplemented with glutamine, 10% FBS, 1% Pen / Steep, and 500 μg / mL Geneticin for about 12 hours. Then, the mGluRl CHO-rat cells are washed and stained with an Optimem medium (commercially available from Invifrogen, Carlsbad, CA) and incubated for 1 to 4 hours before loading the cells with FLUO-4 dye. After incubation, the cell plates are washed with a loading buffer (127 mM NaCl, 5 mM KCl, 2 mM MgCl2, 700 μM, NaH2PO4, 2 mM CaCl2, 5 mMNaHCO3, 8 mM HEPES, and 10 mM glucose, pH 7.4) and incubated with 3 μM FLUO-4 in 0.1 mL of loading buffer for 90 minutes. After the cells are washed twice with 0.2 mL of buffer load, resuspended in 0.1 mL of loading buffer, and transferred to a FLIPR for flow measurement of calcium mobilization in the presence of glutamate and in the presence or absence of a Phenylene Compound. To measure the flow of calcium mobilization, the fluorescence is monitored for about 15 seconds to establish xma baseline and DMSO solutions containing a variety of concentrations of a Femlen Compound ranging from 50 μM to 0.8 nM diluted in an agent of charge (0.05 mL of a 4X dilution) are added to cell plates and the fluorescence monitored for about 2 minutes. Then, 0.05 mL of a 4X glutamate solution (agonist) is added to each original to provide a final concentration of glutamate in each original of 10 μM and the fluorescence is momtoreated for about 1 additional minute. The final concentration of DMSO in the assay is 1%. In each experiment, the fluorescence is momtored as a function of time and the data are analyzed using a non-linear regression to determine the ICso value. In each experiment, each data point is determined twice.

Example 11: Linking or Compounding of Phenylenes to VR1 Compounds Methods for analyzing compounds capable of inhibiting VR1 are known to those skilled in the art, for example, those methods described in U.S. Patent No. 6,239,267 to Duckworth et al. to the; Patent of the States U.S. Patent No. 6,406,908 to Mclntyre et al; or U.S. Patent No. 6,335,180 to Julius et al.

Ligament or Compound of Compound E35 to VR1: Test Protocol Human VR1 Cloning: Human spinal cord RNA (commercially available from Clontech, Palo Alto, CA) is used. Reverse transcription is reacted in 1.0 μg of total RNA, using Reverse Transcriptase Termoscript (commercially available in friviteogen) and primers (oligo dT) as detailed in the product description. Reverse transcription reactions are incubated at 55 ° C for 1 hour, inactivated by heat at 85 ° C for 5 min, and stained with RNase H- at 37 ° C for 20 minutes.

The human VR1 cDNA sequence is obtained by comparison of the human genomic sequence, prior to annotation, with the published sequence of the rat. The inteon sequences are removed and the flanking exonic sequences are linked to generate the hypothetical human cDNA. Primers that flank the human VR1 coding region have the following design: primer (primer) forward, GAAGATCTTCGCTGGTTGCACACTGGGCCACA; and primer (first) back, GAAGATCTTCGGGGACAGTGACGGTTGGATGT. VR1 PCR is carried out in a tenth of the reverse transcription reaction mixture, using Expand Long Tissue Polymerose and Expand Buffer 2 in a final volume of 50 μL according to the manufacturer's instructions (Roche Apphed Sciences, Indianapolis, IN ). After denaturation at 94 ° C for 2 minutes, the PCR amplification is carried out for 25 cycles at 94 ° C for 15 seconds, 58 ° C for 30 seconds, and 68 ° C for 3 minutes, followed by a final incubation at 72 ° C for 7 minutes to complete the amplification. A ~ 2.8 kb PCR product is gel isolated using 1.0% agarose, Tris-Acetao gel containing 1.6 μg / mL crystal violet and purified with an S.N.A.P. UV-free gel purification kit (commercially available from Inviteogen). The VR1 PCR product is cloned dentent of the pIND / V5-His-TOPO vector (commercially available from Inviteogen) according to the manufacturer's instructions. DNA preparations, restricted digestion of enzymes, and preliminary DNA sequencing are carried out according to standard protocols. Full-length sequencing confirms the identity of human VR1. Generation of Inducible Cell Lines: Unless otherwise indicated, cell culture reagents are purchased from Life Technologies of Rockville, MD. HEK293-EcR cells expressing the ecdysone receptor (commercially available in Inviteogen) are grown in a Growth Medium (Dulbecco's Eagle Medium Modified with 10% fetal bovine serum (commercially available in HYCLONE, Logan, UT), lx penicillin / streptomycin , be glutamine, 1 mM sodium pyruvate and 400 μg / mL Zeocin (commercially available from Inviteogen)). The VR1-pIND constructs are transfected with dentel of the HEK293-EcR cell line using Fuge? E teasing reagent (commercially available from Roche Applied Sciences, Basel, Switzerland). After 48 hours, the cells are transferred to a Selection Medium (Growth Medium containing 300 μg / mL G418 (commercially available from Invitrogen)). Approximately 3 weeks later, Zeocin / G418 resistant individual colonies are isolated and expanded. In order to identify functional clones, multiple colonies are plated in 96-well dentended plates and expression is induced for 48 hours using a Selection Medium supplemented with 5 μM ponasterone A ("PonA") (commercially available from Inviteogen). On the day of the assay, the cells are loaded with Fluo-4 (a calcium-sensitive dye commercially available in Molecular Probes) and the influx of CAP-mediated calcium is measured using a FLIPR, as described below. Functional clones are re-analyzed, expanded and cryopreserved. PH-Based Assay: Two days prior to carrying out this assay, the cells are seeded in 96 transparent bottom black plates coated with poly-D-lysine- (commercially available in Becton-Dickinson) at 75,000 cells / originals in a medium of growth containing 5 μM PonA to induce expression. On the day of the assay, plates are washed with 0.2 mL lx Hank's Balanced Salt Solution (commercially available from Life Technologies) containing 1.6 mM CaCl2 and 20 mM HEPES, pH 7.4 ("wash buffer") ), and loaded using 0.1 mL of wash buffer containing Fluo-4 (3 μM final concentration, commercially available in Molecular Probes). After 1 hour, the cells are washed twice with 0.2 mL of wash buffer and resuspended in 0.05 mL lx of Hank's Balanced Salt Solution containing 3.5 mM CaCl2 and 10 mM Citrate, pH 7.4 ("test buffer"). The plates are then transferred to a FLIPR for testing. Compound E35 is diluted in the assay buffer, and 50 mL of the resulting solution is added to the cell plates and the solution is momtoreated for 2 minutes. The final concentration of Compound E35 ranges from about 50 pM to about 3 pM. An agonist buffer (wash buffer treated with IN HCl to provide a solution with a pH of 5.5 when mixed 1: 1 with assay buffer) (0.1 mL) is then added to each original, and the plates incubated during 1 additional minute The data is collected on the total time course and using Excel and Graph Pad Prism. When tested according to this protocol, Compound E35 had an IC 50 of 11.2 ± 5.5 nM (n = 5). Capsaicin-based assay: Two days before carrying out this assay, the cells are seeded in 96 black transparent bottom plates coated with poly-D-lysine- (50,000 cells / originals) in a growth medium containing 5 μM PonA for induce expression. On the day of the test, the plates are washed with 0.2 mL lx of Hank's Balanced Salt Solution containing 1 mM CaCl2 and 20 mM HEPES, pH 7.4, and the cells are loaded using 0.1 mL of buffer. washing containing Fluo-4 (3 μM final). After one hour, the cells are washed twice with 0.2 mL of wash buffer and resuspended in 0.1 mL of wash buffer. The plates are transferred to a FLIPR for testing. 50 μL of Compound E35, diluted with wash buffer is added to the cell plates and incubated for 2 minutes. The final concentration of Compound E35 ranges from about 50 pM to about 3 μM. Human VR1 is activated by the addition of 50 μL capsaicin (400 nM), and the plates are incubated for an additional 3 minutes. The data is collected during the whole period and analyzed using Excel and GraphPad Prism. When tested according to this protocol, Compound E35 had an IC50 of 128.1 ± 26 nM (n = 4). The results in pH-based and capsaicin-based assay showed that the Compound E35, an illustrative Phenylene Compound, binds or binds to and modulates the activity of human VR1 and, consequently, is useful for teaching or preventing pain, Ul, ulcer ulcer, IBD or IBS in an animal. The present invention should not be limited in scope by the embodiments described in the examples which are intended to delineate some aspects of the invention and any modalities that are functionally equivalent are within the scope of this invention. In effect, various modifications of the invention, in addition to those indicated in this document, will be apparent to those persons skilled in the art and fall short of the scope of the claimed Claims. A number of references have been cited, the descriptions of which are completely unaffected to this document by reference.

Claims (32)

1. CLAIMS Compound of the formula: 0) or xma pharmaceutically acceptable salt thereof, CHARACTERIZED because: Ari is Ar2 is X is O or S; Ri is -halo, -CH3, -C (halo) 3, -CH (halo) 2, or -CH2 (halo); each R2 is independently: (a) -halo, -OH, -NH2, -CN, or -NO2; (b) - (C? -C? o) alkyl, - (C2-C10) alkenyl, - (C2-C10) alkynyl, - (C3-C10) cycloalkyl, - (C8-C14) bicycloalkyl, - (C8-) C? 4) tricycloalkyl, - (C5-C? O) cycloalkenyl, - (C8-C14) bicycloalkenu, - (C8-C1) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10) -bodies) bicycloheterocycle, each of which is substituted or not with one or more R5 groups; or (c) -phenyl, -naphthyl, - (C14) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or unsubstituted with one or more Re groups; each R3 is independently: (a) -halo, -CN, -OH, -NO2, or -NH2; (b) - (dC? o) alkyl, - (C2-C10) alkenyl, - (C2-C10) alkynyl, - (C3-C10) cycloalkyl, - (C8-C1) bicycloalkyl, - (C8-C?) tricycloalkyl, - (C5-C1o) cycloalkenyl, - (C8-C14) bicycloalkenyl, (C8-C1) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-cue? s) bicycloheterocycle, each xmo of which is replaced or not. with one or more Rs groups; or (c) -phenyl, -naphthyl, - (C1) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or unsubstituted with one or more Rg groups; each R5 is independently -CN, -OH, - (Q-C6 ^ alkyl, - (C2-C6) alkenyl, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each Rd is independently - (dC ^ alkyl, - (C2-C6) alkenyl, - (C-C6) alkynyl, - (C3C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, - (3- to 5-bodies) heterocycle, - C (halo) 3, -CH (halo) 2, -CH 2 (halo), -CN, -OH, -halo, -N 3, -NO 2, N (R 7) 2, -CH = NR 7, -NR 7 OH, -OR 7 , -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each R7 is independently -H, - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl , - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, or CH2 (halo); each Rs is independently - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7 , -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each Rn is independently - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, (C3-C8) cycloalkyl, - (Cs-C8) cycloalkenyl, -phenyl, -C ( halo) 3, -CH (halo) 2, -CH 2 (halo), -CN, -OH, -halo, -N 3, -NO 2, -N (R 7) 2, -CH = NR 7, -NR 7 OH, -OR 7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each halo is independently -F, -Cl, -Br, or -I; m is an integer that varies from 0 to 4; or is an integer that varies between 0 to 4; p is a whole number that varies from 0 to 2; q is an integer that varies between 0 to 6; r is an integer that varies between 0 to 5; and s is a whole number that varies between 0 to 4.
2. 2. Compound according to Claim 1, CHARACTERIZED because: Ar! is Ar2 is XesO; R! is -CH3; month; p is 0; and resO.
3. Compound according to Claim 1, CHARACTERIZED because: Ari is Ar2es XesO; R! is -CH3; month; pes 0; r is l; and Rs is selected from - (C1-C6) alkyl or CF34.
4. Compound according to Claim 3, CHARACTERIZED because the - (C? -C6) alkyl is xm tert-butyl group, the - (C? -C6) alkyl preferably being substituted in the 4- position of Ar2.
5. 5. Composed according to Reification 1, CHARACTERIZED because: Ai \ es Ar2 is X is O; R! is -CH3, -CF3, -Cl, -Br, -I, or -F; m is O; p is 0; (Rs) a is -H; Y (Rβ) b is -H, -CH 3, -CF 3, -OCH 2 CH 3, tert-butyl, -Cl, -Br, -I, or -F.
6. 6. Compound according to Claim 5, CHARACTERIZED in that Rx is -CH3, -CF3 or -Cl and (Rü) b is -Cl, -F, -CF3 or tert-butyl.
7. 7. Compound according to Claim 1, CHARACTERIZED because: Ari is Ar2 is X is O; Ri is -CH3; m is O; p is 0; and r is O.
8. Compound according to Claim 1, CHARACTERIZED because: Ar! is Ar2 is XesO; Ri is -CH3; month; weight; res 1; and R 8 is - (CrC 6) alkyl or CF 3.
9. 9. Compound according to Claim 8, CHARACTERIZED in that the - (Ci-Ce) alkyl is xm tert-butyl group, the - (Ci-Ce) alkyl preferably being substituted in the 4- position of Ar2.
10. 10. Compound according to Claim 1, CHARACTERIZED because: Ari is XesO; Ri is -CH3, -CF3, -Cl, -Br, -I, or -F; month; weight; (Rs) a is -H; and (R8) b is -H, -CH3, -CF3, -OCH2CH3, tert-butyl, -Cl, -Br, -I, or -F.
11. 11. Compound according to Claim 10, CHARACTERIZED in that H3, -CF3 or -Cl and (Rs) b is -Cl, -F, -CF3 or tert-butyl.
12. 12. Compound according to Claim 1, CHARACTERIZED because: Ar! is Ar2es XesO; Ri is -CH3; month; p is 0; and resO.
13. 13. Compound according to Claim 1, CHARACTERIZED because: AI is Ar2es X is O; Ri is -CH3; m is 0; p is 0; r is 1; and Rs is - (Ci-C6) alkyl or CF3.
14. 14. Compound according to Claim 13, CHARACTERIZED in that the - (d-C ^ alkyl is x tert-butyl group - (Ci-C6) alkyl preferably being substituted in the 4- position of Ar2.
15. 15. Compound according to Claim 1, CHARACTERIZED because: Ari is Ar2 is X is O; Ri is -CH3, -CF3, -Cl, -Br, -I, or -F; m is O; p is 0; (R8) a is -H; and (Rs) b is -H, -CH3, -CF3, -OCH2CH3, tert-butyl, -Cl, -Br, -I, or -F.
16. 16. Compound according to Claim 15, CHARACTERIZED in that H3, -CF3 or -Cl and (Rs) b is -Cl, -F, -CF3 or tert-butyl.
17. 17. Compound according to Claim 1, CHARACTERIZED because: Ar2 is XesO; Ri is -CH3; m is 0; and resO.
18. 18. Compound according to Claim 1, CHARACTERIZED because: Ari is Ar2es XesO; Ri is -CH3; month; r is 1; and Rs is - (C1-C6) alkyl or -CF3.
19. 19. Compound according to Claim 18, CHARACTERIZED in that the - (C? -C6) alkyl is a tert-butyl group, the - (CrC6) alkyl preferably being substituted in the 4- position of the Ar2.
20. 20. Compound according to Claim 1, CHARACTERIZED because: Ari is Ar2 is that; Ri is -CH3, -CF3, -Cl, -Br, -I, or -F; m is O; (Rs) a is -H; and (Rs) b is -H, -CH3, -CF3, -OCH2CH3, tert-butyl, -Cl, -Br, -I, or -F.
21. 21. Compound according to Claim 20, CHARACTERIZED because i is -CH 3, -CF 3 or -Cl and (Rs) b is -Cl, -F, -CF 3 or tert-butyl.
22. 22. Compound of the formula: (H) or pharmaceutically acceptable salt thereof, CHARACTERIZED because: Ar2 is X is O or S; Ri is -halo, -CH3, -C (halo) 3, -CH (halo), or -CH2 (halo); each R2 is independently: (a) -halo, -OH, -NH2, -CN, or -NO2; (b) - (C? -C10) alkyl, - (C2-Ci0) alkenyl, - (C2-C? o) alkynyl, - (C3-C? o) cycloalkyl, - (C8-C? 4) bicycloalkyl, - (C8-C1) tricycloalkyl, - (C5-C? 0) cycloalkenyl, - (C8-C14) bicycloalkenyl, - (C8-C1) tricycloalkenyl, - (3- to 7-bodies) heterocycle, or - (7- to 10-bodies) bicycloheterocycle, each of which is or is not substituted with one or more R5 groups; or (c) -phenyl, -naphthyl, - (C14) aryl or - (5- to 10-bodies) heteroaryl, each of which is substituted or unsubstituted with one or more Re groups; each R5 is independently -CN, -OH, - (Ci-C6) alkyl, - (C2-C6) alkenyl, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each Re is independently - (Ci-C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alky1, - (C3C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, - (3- a 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, N (R7) 2, -CH = NR7, -NR7OH, -OR7, -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each R is independently -H, - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-C8) cycloalkyl, - (C5-Cg) cycloalkenyl, -phenyl , - (3- to 5-bodies) heterocycle, -C (halo) 3, -CH (halo) 2, or CH2 (halo); each R8 is independently - (C? -Cd) alkyl, - (C2-C6) alkenyl, - (C2-Ce) alkynyl, - (C3.C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7 , -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each Rp is independently - (C? -C6) alkyl, - (C2-C6) alkenyl, - (C2-C6) alkynyl, - (C3-C8) cycloalkyl, - (C5-C8) cycloalkenyl, -phenyl, -C (halo) 3, -CH (halo) 2, -CH2 (halo), -CN, -OH, -halo, -N3, -NO2, -N (R7) 2, -CH = NR7, -NR7OH, -OR7 , -COR7, -C (O) OR7, -OC (O) R7, -OC (O) OR7, -SR7, -S (O) R7, or -S (O) 2R7; each halo is independently -F, -Cl, -Br, or -I; n is an integer in a range from 0 to 3; or is x integer in a range from 0 to 4; q is xm integer in a range from 0 to 6; r is an integer in a range from 0 to 5; and s is an integer in a range from 0 to 4.
23. 23. Compound according to Claim 22, CHARACTERIZED because: Ar2 is X is O; n is 0; and r is O.
24. 24. Compound according to Claim 22, CHARACTERIZED because: Ar2 is that; Ri is -CH3; n is O; r is l; and R8 is - (Ci-C6) alkyl or -CF3.
25. 25. Compound according to Claim 24, CHARACTERIZED in that the - (Ci-C6) alkyl is a tert-butyl group, the - (C? -C6) alkyl preferably being substituted at the 4- position of Ar2.
26. 26. Compound according to Claim 22, CHARACTERIZED because: Ar2 is X is O; Ri is -CH3, -CF3, -Cl, -Br, -I, or -F; n is O; (Rs) a is -H; and (R8) b is -H, -CH3, -CF3, -OCH2CH3, tert-butyl, -Cl, -Br, -I, or -F.
27. 27. Compound according to Claim 26, CHARACTERIZED because i is -CH 3, -CF 3 or -Cl and (Rβ) b is -Cl, -F, -CF 3 or tert-butyl.
28. 28. Composition CHARACTERIZED because it comprises an effective amount of the compound or pharmaceutically acceptable salt of the compound of claim 1 or 22 and a pharmaceutically acceptable carrier or excipient.
29. 29. Use of the effective amount of x compound of claim 1 or 22 or xma pharmaceutically acceptable salt thereof, CHARACTERIZED because it is used for the manufacture of a medicament for treating pain, urinary incontinence, an ulcer, irritable bowel syndrome or inflammatory bowel disease in an animal
30. 30. Method for inhibiting VR1 function in a cell, CHARACTERIZED because it comprises contacting a cell capable of expressing VR1 with an effective amount of the compound or pharmaceutically acceptable salt of the compound of claim 1 or 22.
31. 31. CHARACTERIZED kit because it comprises a container containing an effective amount of the compound of claim 1 or 22 or a pharmaceutically acceptable salt thereof.
32. 32. Method for preparing a composition, CHARACTERIZED because it comprises the step of mixing the compound of claim 1 or 22 or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier or excipient.