MXPA06002894A

MXPA06002894A - Method for linking sequences of interest

Info

Publication number: MXPA06002894A
Application number: MXPA/A/2006/002894A
Authority: MX
Inventors: B Oleksiewicz Martin; S Nielsen Lars; S Andersen Peter; H Hansen Margit
Original assignee: Symphogen A/S
Priority date: 2003-09-18
Filing date: 2006-03-14
Publication date: 2006-12-13

Abstract

Multiplex overlap-extension RT-PCR provides an efficient method of linking two or more nucleotide sequences encoding for domains or subunits of a heteromeric protein, in a single reaction. Especially, the linkage of variable region encoding sequences from e.g. immunoglobulins, T cell receptors or B cell receptors is eased with the method of the present invention. This allows for a more efficient way of generating libraries of variable region encoding sequences. The capability to perform the multiplex overlap-extension RT-PCR using template derived from an isolated single cell enables the generation of cognate pair libraries in a high-throughput format.

Description

METHOD TO LINK SEQUENCES OF INTEREST Field of the Invention The present invention relates to a method of multiple molecular amplification, capable of binding nucleotide sequences of interest in conjunction with the amplification, in particular the polymerase chain reaction (multiple CRP). The method is particularly advantageous for the generation of libraries of cognate pairs, as well as combinatorial libraries of sequences encoding the variable region, from immunoglobulins, T cell receptors or B cell receptors. Background of the Invention Linker proteins antigens involved in the immune response are present in mammals as large polyclonal receptors, representing a wide variety of binding specificities. This diversity is generated by the rearrangement of gene sequences that encode variable regions of these binding proteins. Such variable region binding proteins include soluble and membrane bound forms of the B cell receptor (also known as immunoglobulins or antibodies) and the T cell receptors attached to the membrane (TcR). With respect to immunoglobulins, their affinity is improved REF. : 170083 subsequent to the recognition of an antigen by a B cell antigen receptor, through a process called affinity maturation, which involves somatic hyperadduration cycles of these variable genes. Notably, immunoglobulins or fragments thereof, such as Fab fragments, Fv fragments, and single chain Fv molecules (scFv), have been subjected to cloning and recombinant expression. However, all other variable region binding proteins can, in principle, also be cloned and expressed using the same concepts as for antibodies. Known procedures for isolating antibodies with a desired binding specificity, most often involve the generation of hybridomas from immunized hosts, followed by selection for specific clones or involves the generation of combinatorial expression libraries in E. coli, composed of domains immunoglobulin variables, which are subsequently enriched using techniques, such as, for example, phage display. The main restriction in the use of hybridoma technology to make therapeutic antibodies, is the absence of a suitable human lymphoma as fusion patterns for human B lymphocytes. Heterohybridomas (ie, fusion of human B cells with mouse lymphomas) are notoriously unstable and thus, rarely lead to suitable cell lines for production purposes. Human B cells immortalized through infection with Epstein-Barr virus exhibit similar changes in instability. The lack of solid cellular methodology to make human antibodies for therapy can be compensated with more recent advantages in molecular biology. The use of combinatorial libraries and phage display allows the generation of large repertoires of antibody clones with a potential diversity in excess of 1010. It can be made from this repertoire selection to link to a specific objective, thereby generating a sub-library. This sub-library can be used to generate antibodies either polyclonal or monoclonal. Variable region coding sequences (e.g., immunoglobulin heavy chain variable region and light chain variable region coding sequences), which constitute the library, can be amplified from lymphocytes, plasma cells, hybridomas or any other population of cells that express immunoglobulins. Current technologies for generating combinatorial libraries involve separate isolation of the sequences encoding the variable region from a population of cells. In this way, the original pairing of for example, sequences encoding the heavy chain variable region and the immunoglobulin light chain variable region, will be lost. Preferably, in a combinatorial library, said sequences are randomly paired and the original combinations of these variable sequences will occur only by chance. Thus, to isolate sequences encoding the variable region responsible for a desired binding specificity, a considerable amount of selection is necessary. This is typically performed in combination with methods for enrichment of clones having a desired specificity, such as ribose display or phage display. Even then, the diversity achieved may not be large enough to isolate sequence pairs that encode the variable region, giving rise to similar high affinity binding proteins as those found in the cells originated. In addition, the enrichment methods normally used to select combinatorial libraries, introduce a strong distortion for example, for polypeptides of particular low toxicity in E. coli, efficient folding, slow speeds, or other system-dependent parameters, which reduce the diversity of the even more library. In addition, clones derived from such combinatorial libraries will be more likely to produce cross-reactive binding proteins against self-antigens because they are even, contrary to their original pairs (later called cognate pairs), none has been through of negative selection in vivo, against autoantigens, as is the case for B and T lymphocyte receptors during the particular stages of their development. Therefore, the cloning of original pairs of sequences encoding the variable region is a desirable procedure. However, the frequency of clones exhibiting a desired binding specificity is expected to be considerably higher within a library of cognate pairs than in a conventional combinatorial library, particularly if the cells of the starting material are derived from a high frequency donor. of cells encoding binding pairs for example, immune or immunized donors. After the size of the cognate pair library will not need to be as large as a combinatorial library: a cognate pair library size of 104 to 105 clones or even as small as 102 to 103 clones derived from a donor with a relevant immune response progressive, it could be very well suited to obtain binding proteins representing a wide variety of desired binding specificities. To generate cognate pair libraries, the binding of the sequences encoding the variable region derived from the same cell is required. Currently, two different procedures have been described which can achieve the cognate pairing of sequences encoding the variable region. PCR in cells is a procedure in which a cell population is fixed and waterproofed, followed by binding in the cell of the sequences encoding the heavy chain variable region and light chain variable region of immunoglobulins. This link can be performed either by overlap-extension TI-PCR (WO 93/03151) or by recombination (Chapal, N. et al., 1997 BioTechniques 23, 518-524). The amplification process as described in these publications is a three- or four-step process consisting of i) reverse transcription using constant region primers that generate immunoglobulin Anda, ii) PCR amplification of the sequences encoding the variable region of light and heavy chain, using series of primers that contain either overlap-extension or recombination sites, iii) recombination binding, if this procedure is chosen, iv) nested RCP of the products that generate restriction sites by cloning . Since the cells are permeabilized, there is a considerable risk that the amplification products can be released from the cells, with them, introducing randomization of the sequences encoding the variable region of light chain and heavy chain variable region, resulting in the loss of cognate pairing. Therefore, the procedure includes washing steps after each reaction, which makes the process laborious and reduces the efficiency of the reactions. More generally, CPR in cells is notoriously inefficient, resulting in low sensitivity. Therefore, in the technique of CPR binding in cells, no distributed employment has been found, and the original study has never in fact been reliably repeated in a form which can be used to verify that the link currently occurs within the cell. This, however, is absolutely crucial to avoid randomization of the sequences encoding the variable region of light chain and heavy chain variable region and thereby interrupting the cognate pairs. A different cell procedure is described in WO 01/92291. This procedure is based on the trans-splicing of RNA and achieves binding of VH and VL that encodes the mRNA inside the cell. This procedure requires the presence of a DNA construct that drives the trans-splice within the cells. RCP in single cells is a different procedure to achieve cognate pairing of sequences encoding the light chain variable region and heavy chain variable region (see for example, Coronelia, J.

A. et al. 2000 Nucleic Acids Res. 28, E85; Wang, X., et al. 2000 J. Immunol. Methods 20, 217-225). In these publications, a population of cells expressing immunoglobulins are distributed by diluting to a density of a cell by reaction, thereby eliminating randomization of the sequences encoding the variable region of light chain and heavy chain variable region during the process of cloning Basically, the described process is a three to four stage procedure consisting of i) reverse transcription using oligo-dT, random hexamer or primers of the constant region that generate cDNA, ii) fractionation of the cDNA product in several tubes and perform amplification by PCR in the sequences that encode the individual variable chain (in separate tubes), with sets of primers that contain restriction sites for cloning, iii) nested PCR of the products that generate restriction sites for cloning (optionally) and iv) linking the sequences encoding the variable region of light chain and heavy chain variable region, from the separated tubes by cloning them into an appropriate vector, which in it, is a multi-step process. In humans there are two types of light chains: lambda (?) And kappa (K). This means that with the cDNA generated from each single cell, at least three separate PCR reactions must be performed, followed by analysis and cloning of the appropriate fragments into a single vector to achieve cognate pairing. Thus, the single cell PCR method as described requires a large number of manipulations to generate a library of cognate pairs. Although, a library of cognate pairs does not need to be as large as a combinatorial library to obtain binding proteins representing a wide variety of binding specificities, as it might still be a laborious task to generate a library of for example, 104 to 105 clones per the RCP procedure in single cells described. In addition, the large number of manipulations greatly increases the risk of contamination and human error. To obtain high affinity binding proteins, which correspond to the affinities normally observed during an immune response, the cognate pairing of the variable region sequences in association with their amplification is highly advantageous. To generate a library of great diversity, it is necessary to have a cloning technique that can be adjusted to a high performance format and where the risk of contamination and randomization is minimal. A reduction in the number of cloning steps that allows the generation of combinatorial libraries to be adjusted to a high performance format is likewise desired. Summary of the Invention The present invention provides an efficient method for linking two or more nucleotide sequences of interest, eg, sequences encoding the variable region, using a multiple molecular amplification method, such as multiple overlap-extension TI-PCR. or multiple TI-PCR, followed by binding by ligation or recombination. The method is applicable in a single cell, thereby allowing the cloning of cognate pairs in a high performance format. Brief Description of the Figures Figure 1 is a diagram illustrating the different types of overlap-extension ends. The bold line corresponds to a specific part of the primer gene and the regular line corresponds to the overlapping end. The vertical bars illustrate complementary regions. The primers facilitate the binding of two oligonucleotide sequences of interest. Figure 1 (1) illustrates two varieties of type I overlap-extension ends, where only the extension end overlaps, either completely or partially; Figure 1 (II) illustrates the ends of overlap-extension type II, where some of the 5'-nucleotides of the extension end of the first primer are complementary to the specific part of the gene of the close primer; Figure 1 (III) illustrates the overlap-extension ends type III, where the complete overlap-extension ends are complementary to the specific region of the close primer gene. Figure 2 is a diagram showing a schematic review of a multiple overlap-extension primer mixture, applicable at the binding of the immunoglobulin variable region encoding sequences. The cDNA encoding the light chain (CL) and the heavy chain variable region (VH) to be linked is illustrated as tubes indicating their 5 'and 3' ends of the sense strand, as well as the expected size of the strand. amplified product. The multiple overlap-extension primer series used to amplify the coding sequences are illustrated by the arrows. The ends of the arrows bent with prolongations of the 5 'drawn that illustrate the ends of cloning. The overlap-extension ends are in bold. The restriction sites present at the ends are named in conjunction with the extremes. The total number of primers in the multiple overlap-extension primer mixture is sixteen, distributed in the external primers comprising a primer Ck and a CH? and the overlap extension primers comprising six VL and eight VH primers. The CH? tunes to the 5 'end of the heavy chain constant domain. The resulting product of the multiple overlap-extension CT-PCR is expected to be approximately 1070 bp, which constitutes the kappa light chain composed of the constant region, joining the variable gene and gene (Ck + JL + VL) and the region heavy chain variable, composed of the variable gene, diversity segment and binding gene (VH + D + JH). The 5 'and 3' indicate the direction of the open reading structure. Only a small portion of the sequence that codes for the CH region? is amplified by this mixture of multiple overlap-extension primer, because the quenched position of the CH? it is close to the J region of heavy chain. Figures 3A-3D are a series of diagrams illustrating the different binding direction of the products that can be obtained depending on which primers are equipped with the link end. Solid black illustrates the region of overlap. The 5 'and 3' indicate the direction of the open reading structure. Figure 3A is a diagram illustrating a principle-to-principle orientation of the products. Figure 3B is a diagrame illustrating end-to-end orientation. Figure 3C is a diagram illustrating an end-to-end orientation with the first sequence encoding the light chain. Figure 3D is a diagram illustrating an end-to-end orientation with the first sequence encoding the heavy chain.

Figure 4 is a schematic diagram of the immunoglobulin expression vector pLL113, wherein the coding sequences are in an end-to-end orientation. The vector comprises the following elements: bla = promoter that allows the expression of the ampicillin resistance gene. Amp = gene that codes for ampicillin resistance. pUCori = origin of replication of pUC. AdMLP = late major adenovirus promoter. Human IgGl = Sequence coding for the heavy chain Gl of immunoglobulin isotype. pA of hGH = poly A signal sequence of human growth hormone polyA hGH = poly A sequence of bovine growth hormone. Human kappa LC = sequence encoding the light chain of kappa immunoglobulin. FRT = A target Flp recognition site. Hygromycin = gene that codes for hygromycin resistance. Poly SV40 = Poly A signal sequence from Simian Virus 40. Figures 5A-5B illustrate an electrophoretic gel showing the results of a two-stage multiple overlap-extension CT-PCR, followed by a semi-nested PCR. The amplification products are derived from cDNA isolated from unique pLL113 Flp-IN CHO cells. Lines 1-12 are sample lines and arrows indicate nested multiple-overlap-extension TI-PCR products, 1076 bp; Ml is a 100 bp scale that has been represented with less contrast to solve the individual DNA fragments. Figure 5B is a sketch of the gel shown in Figure 5A, illustrating the relevant fragments of the gel. Figures 6A-6D are a series of photographs and a graphic representation of electrophoretic gels showing the results of a single stage multiple overlap-extension CT-PCR reaction, without amplification by additional CPR. In each panel, Ml is a scale of 100 bp and M2 is a scale of 500 bp. Figure 6A is an electrophoretic gel showing the amplification products derived from lysate corresponding to 100, 10, 1 or 0 cells. The arrows indicate the product of overlap-extension. Figure 6B is a sketch of the gel in Figure 6A. Figure 6C is an electrophoretic gel that verifies the presence of the overlap-extension product in cell lines 100 and 1 in Figure 6A. Figure 6D is an electrophoretic gel showing the cleavage of the restriction enzyme with Nhel and Ncol, respectively, of the overlap-extension product of cell line 1 in Figure 6C. Figure 7 is an electrophoretic gel that shows the results from single-step multiple overlap-extension CT-PCR, followed by a semi-nested PCR amplification. Ml is a scale of 100 bp and M2 is a scale of 500 bp. The results of the overlap-extension primer mixtures containing either CH ?, CH2, CH3 / CH or CH5 as the external primer in the multiple extension-overlap CT-PCR reaction. The reactions were performed in cell lysates corresponding to 100, 10, 1 or 0 cells. The size of the overlap-extension product is indicated by an arrow. Figure 8 is an electrophoretic gel that shows the results of a single-step multiple-fold overlapping-TI PCR, followed by a semi-nested PCR amplification using enriched human B lymphocytes as templates. Ml is a 100 bp scale. Lines 5 and 6 show bands of the expected size for the overlap-extension product. Figures 9A-9C are schematic diagrams of the expression vectors (Em465 / 01P582 / Em465 / 01P581), used for the generation of cell lines expressing IgGl-lambda, wherein the coding sequences are in an initial-to-principle orientation. The vectors comprise the following elements: Amp = gene that codes for the ampicillin resistance. pUCori = origin of replication of pUC. AdMLP = late major adenovirus promoter. EFP = promoter of the elongation factor. Leader AP = alkaline phosphatase leader sequence. VH = sequence encoding the heavy chain variable region. IgGl HC = sequence encoding the heavy chain constant region Gl of the immunoglobulin isotype. polyB of rBG = Rabbit beta-globin poly A signal sequence. polyA of bGH = poly A sequence of bovine growth hormone. Leader IgK = sequence that codes for the murine kappa leader. IgL (Ib or le) = sequence encoding the lambda light chain family of immunoglobulin Ib or le. FRT = A target Flp recognition site. Hygromycin = gene that codes for hygromycin resistance. Poly SV40 = Poly A signal sequence of Simian Virus 40. Figures 9B and 9C are agarose gels stained with ethidium bromide loaded with PCR products isolated from the CHO cell line Flp-In / Em464 / 01P581 and CHO Flp- In / Em464 / 01P582, respectively. Lines 1 to 4 correspond to concentrations of total RNA templates of 50 pg, 50 pg, 0.5 pg or 0 pg, used for the TI-PCR reaction of multiple overlap-extension. M is a 100 bp scale (New Englands Biolabs, New England, USA). The arrows indicate the overlap-extension CPR product. Figure 10 is a flow chart showing the steps applied to generate a cognate antibody expression library, from which monoclonal or polyclonal antibodies can be expressed. Figure 11 is a schematic diagram of JSK301, an E. coli vector used to generate a library of Fab vectors, inserting the overlap-extension fragments comprising the sequences encoding the cognate variable region in the vector at the restriction sites Notl / Xhol indicated. The vector comprises the following elements: Amp and Amp pro = ampicillin resistance gene and its promoter. pUC19 Ori = origin of replication. Human CH1 = sequence encoding human immunoglobulin gamma 1 heavy chain domain 1. Filling = an insert of irrelevant sequence, which is cut after the insertion of the overlap-extension fragments. tacP and lac Z = bacterial promoters, which can be excised at the Nhel and Ascl restriction sites. Figure 12 is a schematic diagram illustrating the generation of a library of cognate Fab expression vectors. Stage I illustrates the insertion of cognate pairs of the sequences encoding the variable region (VH? -VL? To VHx-VLx) in the JSK301 vector of E. coli by Xhol-Notl digestion. Stage II illustrates the insertion of a bacterial promoter and a leader cassete (promoter pelB leader-P tac, which drives the expression of VHx and promoter P lac-pelB leader that drives the expression of VLx) by Ascl-Nhel digestion. Figure 13 illustrates the link of subunits a, ß and? that constitute a G protein, using the TI-PCR of single-step multiple extension overlap, followed by amplification by additional CPR. The sizes of the individual coding regions are given, as well as the size of the bound product. The restriction sites introduced by the primer ends during the amplification are indicated by the final product.

Figures 14A-14C show dot plots of an analytical FACS dyeing of (fig.l4A) PBMC purified from donor blood; (fig.l4B) the fraction of magnetically classified non-labeled CD19 negative cells and (fig.l4C) fraction of magnetically classified CD19 + cells. A scatter diagram, a CD19 / CD38 diagram and a CD38 / CD45 diagram are shown for each fraction. Figure 15 shows the CDl9 + fraction of Figure 9C, which has been stored in liquid nitrogen, thawed and stained with anti-CD19, anti-CD38 and anti-CD45. Point diagrams corresponding to Figure 9C are shown. Figures 16A-16B show entries used for classification in the fraction of CD19 + cells. A dispersion input and a fluorescence input based on CD38 and CD45 were used to isolate the high CD38 (CD38hi), intermediate CD45 (CD45in) in cells. Figures 17A-17B illustrate an electrophoretic gel showing the successful multiple-overlap-extension TI-PCR reaction in donor TT03 (Fig. 17A, cavity 1-12 of eight 96-well plates). The samples were applied to the agarose gel in two rows (fig 17A and figl7B) with 48 samples in each. The expected size of the overlap-extension fragment was approximately 1070 bp. The putative overlap-extension fragments are marked with arrows.

Figure 18 shows ELISA analysis of periplasmic extracts of the G060 plate. The ELISA plate was coated with goat (gt) -anti-human Kappa, and the captured Fab fragments were detected with a gt-anti-human Fab-specific antibody conjugated to HRP. Figures 19 shows ELISA analysis of periplasmic extracts of the G060 plate. The ELISA plate was coated with 10 μg / ml Ovalbumin (Sigma A-5503), and the fragments Captured Fabs were detected with gt-anti-human Fab-specific antibody conjugated to HRP. Figure 20 shows ELISA analysis of periplasmic extracts of the G060 plate. The ELISA plate was coated with tetanus toxoid, and the captured Fab fragments were detected with a gt-anti-human Fab-specific antibody conjugated to HRP. Figure 21 shows a one-step competition ELISA analysis of periplasmic extracts of the G060 plate. The ELISA plate was coated with Tetanus Toxoid (TT), and the soluble TT was added to each cavity at 10"7M to compete for the binding of Fab fragments from bacterial supernatants to immobilized TT.The captured Fab fragments were detected with HRT-conjugated HRP-specific Fb antibody to HRP Figures 22A-22H show the alignment of the variable heavy chain protein sequences from clones binding to the G060 platelet TT antigen The degree of sequence homology it was represented by different nuances: 100%, 80% and 60% were represented with black, gray and slightly gray, respectively, CDR1 is located in alignment position 34 to 41. CDR2 is located in alignment position 55 to 73. CDR3 is located in the alignment position 107 to 127. The premature arrest codons were denoted by an asterisk.The alignment is divided into 8 separate figures (ah), distributed in two rows of left to right with figure 22a to d in the top row and Figure 22e to h in the bottom row. Figures 23A-23H show the alignment of the variable light chain protein sequences from clones binding to the TT antigen of G060 plates. The degree of sequence homology was represented by different shades; 100%, 80% and 60% were represented with black, gray and slightly gray, respectively, CDR1 is located in the alignment position 26 to 42. CDR2 is located in the alignment position 58 to 64. CDR3 is located in the position of alignment 97 to 106. The premature arrest codons were denoted by an asterisk. The alignment is divided into 8 separate figures (a-h), distributed in two rows from left to right with figure 23A to 23D in the top row and Figure 23E to 23H in the bottom row.

Figure 24 shows a competition ELISA assay for determination of the apparent affinities of selected clones of the G060 plate. Dilutions of soluble TT at concentrations from 10 nM to 25 pM (four-part dilutions) were added to the Fab fragments, thereby competing the binding of the Fab fragments to immobilized TT. The extensions of the reactions are given as the ratio of the observed link to a concentration of soluble TT given to the bond found when the non-soluble TT is added to the reactions. Figures 25A-25B show a matrix diagram of double phylogenetic points, showing the intra and intergenetic relationship between light chain variable domain and heavy antibody sequences. Three phylogenetic sequences of VH and VL are paired in a dot matrix to indicate the current pairing of particular B genes. Fig. 25A) TT binding clones obtained from a combinatorial library using phage display. Fig. 25B) TT link clones obtained from a library of cognate pairs using the present invention. Detailed Description of the Invention The present invention provides an amplification and binding process of two or more noncontiguous nucleotide sequences of interest, which allow the cloning of such sequences to be adjusted to a high performance format. This is basically achieved by reducing the number of steps necessary to amplify and link sequences to be cloned. One aspect of the invention is a method for linking a plurality of noncontiguous nucleotide sequences comprising, amplifying in a multiple molecular amplification method, nucleotide sequences of interest using a template derived from a single isolated cell, a population of isogenic cells or a population of genetically diverse cells and effecting a subsequent binding of the amplified sequences. If the template is a single isolated cell or a population of isogenic cells, the linkage results in a segment of nucleic acid comprising nucleotide sequences of interest, associated with each other in a cognate manner. If the template is a population of genetically diverse cells, the linkage results in a library of segments where each segment comprises nucleic acid sequences of interest, associated in a random manner, this is also called a combinatorial library. In one embodiment of the present invention, this method of multiple molecular amplification is a multiple PCR amplification, preferably preceded by a reverse transcription step. In a preferred embodiment, the reverse transcription amplification and binding, are performed in a single step, using multiple overlap-extension CT-PCR, or alternatively, in two steps using multiple RT-PCR, followed by ligation or recombination binding. A further embodiment of the present invention relates to the generation of libraries of cognate pairs comprising sequences encoding the bound variable region, in particular, sequences encoding the light chain and particular heavy chain variable region or sequences encoding the alpha chain of the T cell receptor (TcR) and sequences encoding the beta chain. The process involves obtaining a fraction of cells containing lymphocytes of at least one suitable donor and optionally, enriched by a population of particular lymphocytes from this fraction, for example, B lymphocytes or T lymphocytes, depending on whether the sequences encoding the variable region of immunoglobulins or TcRs are desired. The fraction of cells containing lymphocytes or the fraction of enriched cells is distributed in a container array, obtaining one cell in each container. The arrangement of single cells is subjected to a reverse transcription (IT) step or an alternative cDNA generation procedure, using the nucleic acids derived from the single cell population as templates. The TI step is followed by methods of multiple molecular amplification and binding of pairs of sequences encoding the variable region, generated from each cell according to one of the methods of the present invention. The cloning techniques described in the present invention omit laborious and inefficient cloning procedures, and further reduce the risk of contamination and loss of diversity during the multiple cloning steps. Another aspect of the invention relates to libraries of cognate pairs produced by the processes of amplification and multiple molecular bonding. The initial library of the cognate pairs (original library), generated by the method of the present invention, can be subjected to selection, thereby generating a sub-library of cognate pairs that encode variable domains of target-specific binding protein or full-length binding proteins. In a further embodiment of the invention, the libraries and sub-libraries of the present invention can be used in the expression of recombinant monoclonal or polyclonal proteins, wherein the original binding affinities and specificities present in the donor are preserved. Definitions The term "cognate pair" describes an original pair of noncontiguous nucleic acids of interest, which are contained within or derived from a single cell. In preferred embodiments, a cognate pair comprises two sequences encoding variable regions, which together code for a variable domain of the binding protein and in which the sequences of the gene are derived from the same cell. Thus, when they are expressed either as a complete binding protein or as a stable fragment thereof, they preserve the binding affinity and specificity of the binding protein originally expressed from this cell. A cognate pair may for example be comprised of a sequence encoding the variable heavy chain of antibody associated with a sequence encoding the variable light chain, from the same cell, or a sequence encoding the OI chain of the cell receptor. T, associated with a β chain that encodes the sequence from the same cell. A library of cognate pairs is a collection of such cognate pairs. The term "hot onset polymerase" describes polymerases that are inactive or have very low activity at temperatures used for reverse transcription. Such polymerases need to be activated by high temperatures (90 to 95 ° C) to become functional. This is, for example, an advantage in single stage PCR procedures, since this prohibits polymerase interference with the reverse transcriptase reaction. The term "isogenic population of cells" describes a population of genetically identical cells. In particular, an isogenic population of cells derived by clonal expansion of a single isolated cell is of interest in the present invention. The term "isolated single cell" describes a cell that has been physically separated from a population of cells corresponding to a "single cell in a single container". When a population of cells is distributed individually among a plurality of vessels, a population of single isolated cells is obtained. As specified in the section entitled "Template Sources," the proportion of vessels with a single cell is not necessarily 100% to call a population of single cells. Terms derived from "link", or "linkages" in relation to amplification, describe the association of the amplified nucleic acid sequences encoding the nucleic acid sequences of interest in a single segment. In relation to cognate pairs, a segment comprises nucleic acid sequences that encode a variable domain, for example, an antibody heavy chain variable region associated with a sequence encoding an antibody light chain variable region, are derived from the same cell. The link can be either activated simultaneously with the amplification, or as an immediate step after the amplification. There are no requirements to the form or functionality of the segment, they can be linear, circular, single-strand or double-strand. Neither is the link necessarily permanent, one of the nucleic acid sequences of interest can be isolated from the segment if desired, one of the sequences encoding the variable region can be, for example, isolated from a segment of cognate pair. However, as soon as the original variable regions that constitute the cognate pair are not randomized with other variable regions, they are still considered a cognate pair, although they are not linked together in a single segment. The linkage is preferably a nucleotide phosphodiester linkage. However, the link can also be obtained by different chemical cross-linking processes. The term "multiple molecular amplification" describes the simultaneous amplification of two or more target sequences in the same reaction. Suitable amplification methods include the polymerase chain reaction (RCP) (US 4,683,202), ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560-9), strand displacement amplification (ADE) technique (Walker et al., 1992, Nucí Acids Res. 20, 1691-6), self-sustained sequence replication (Guatelli et al., 1990, Proc. Nat. Acad. Sci. U.S.A., 87, 1874-8) and nucleic acid-based sequence amplification (NASBA) (Compton J., 1991, Nature 350, 91-2). The last two methods of amplification involve isothermal reactions based on isothermal transcription, which produces both single-stranded RNA (ssRNA) and double-stranded DNA (dsDNA). The term "Multiple CPR" describes a variant of PCR in which two or more target sequences are amplified simultaneously, including more than one series of primers in the same reaction, for example, a primer series adapted for heavy chain variable region amplification and a primer series adapted for amplification of the variable kappa chain region in the same PCR reaction. Additionally, a first series adapted for amplification of the lambda chain variable region, can be combined with these series of primers. The term "multiple TI-PCR" describes a multiple PCR reaction, which is preceded by a reverse transcription (TI) step. Multiple TI-PCR can either be performed as a two-step process with a separate TR stage prior to multiple CPR, or as a single stage process, where all components for both TI and multiple CPR, They are combined in a single tube. The terms "Multiple-overlap RCP" and "Multiple-overlap-RCP TI-PCR" imply that multiple PCR or multiple TI-PCR are performed using a multiple overlap-extension primer mix to amplify the target sequences , thereby allowing the simultaneous amplification and binding of the target sequences. The term "a plurality of containers" describes any object (or collection of objects), which allows the physical separation of a single cell from a population of cells. These may be tubes, multiple cavity plates (eg, 96 cavities, 384 cavities, microtiter plates or other multiple cavity plates), arrays, microarrays, microchips, gels or a gel matrix. Preferably, the object is applicable by PCR amplification. The term "polyclonal protein" or "polyclonality", as used herein, refers to a protein composition comprising different but homologous protein molecules, preferably selected from the immunoglobulin superfamily. Thus, each protein molecule is homologous to the other molecules of the composition, but also contains one or more extensions of variable polypeptide sequences, which are / are characterized by differences in the amino acid sequence between the individual elements of the polyclonal protein. Known examples of such polyclonal proteins include immunoglobulin molecules or antibodies, T cell receptors and B cell receptors. A polyclonal protein may consist of a defined subset of protein molecules, which have been defined by a common characteristic, such as linkage activity carried to a desired target, eg, a polyclonal antibody that exhibits binding specificity towards a desired target antigen. The term "a population of genetically diverse cells" as used herein, refers to a population of cells, wherein the individual cells in the population, differ from each other at the genomic level. Such a population of genetically diverse cells are for example, a population of cells derived from a donor, or a fraction of such cells, for example, a fraction of cells containing a B lymphocyte or a T lymphocyte. The term "primer series" , is used interchangeably with the term "primer pair", and describes two or more primers which together are capable of priming the amplification of a nucleotide sequence of interest (i.e., an element of a cognate pair). A first series of the present invention can be designed to prime a family of nucleotide sequences containing sequences encoding the variable region. Examples of different families are kappa light chains of antibodies, lambda light chains, heavy chain variable regions, and variable regions of α, β, β T cell receptors. or d. A primer series for the amplification of a family of nucleotide sequences containing sequences encoding the variable region, often constitutes a plurality of primers, wherein several primers can be degenerate primers. The term "sequence identity" is expressed as a percentage, which indicates the degree of identity between nucleic acid sequences over the length of the shortest of the two sequences. It can be calculated as (Nref-Naif) x 100 / Nref, where Nref is the number of residues in the shortest of the sequences, and where aif is the total number of non-identical residues in a long Nref, optimally aligned equal between the two sequences. Therefore, the AGTCAGTC DNA sequence will have a sequence identity of 75% with the sequence TAATCAATCGG (Ndif = 2 and Nref = 8) (the underlined shows the optimal alignment and the bold letters indicate the two non-identical residues of 8) . The terms "randomly" or "randomly", with respect to linkage, refer to the linking of nucleotide sequences which are not derived from the same cell, but are cross-linked between a population of genetically diverse cells. If the nucleotide sequences of interest are sequences encoding the variable region, this will result in a combinatorial library of ligated sequences. If, on the other hand, the nucleotide sequences of interest code for a non-diverse heteromeric protein, the randomly linked sequences will appear similar to the ligated sequences of a single cell. The term "template derived from a single isolated cell", with respect to reverse transcription, refers to nucleic acids within such isolated cells. The nucleic acids may for example be in the form of RNA, ARMm, DNA or genomic DNA. The nucleic acids can be either isolated from the cell or still be within the remaining contents of the cell, wherein the cells are in an intact form or a used form. Amplification and Linking Process A feature of the present invention reduces the number of tubes needed to amplify the nucleotide sequences of interest, using a PCR variant in which two or more target sequences are amplified simultaneously in the same tube, including more of a series of primers, for example, all the primers needed to amplify the sequences encoding the variable region in the same reaction. In general, this procedure is known as multiple polymerase chain reaction (multiple PCR). Amplification by multiple PCR and multiple PCR, preceded by reverse transcription (multiple TI-PCR), are well-known techniques within the diagnostic field, for example, in the analysis of mutations, deletions and DNA polymorphisms, for quantitative assays of levels of mRNA and for identification of viruses, bacteria and parasites (reviewed in Markoulatos, P. et al., 2002. J. Clin. Lab.

Anal. 16, 47-51). However, there are only very few examples where the sequences encoding the immunoglobulin light chain variable region have been amplified in the same vessel as immunoglobulin heavy chain variable region encoding sequences, using a mixed multiple primer mixture. of more than four primers constituting a VK and / or V? primer series together with a VH primer series (Chapal, N. et al., 1997. BioTechniques 23, 518-524; Liu, A.H. et al. 1992. Proc. Nati Acad. Sci. U.S. . 89, 7610-7614; Embleton, M. J. et al. 1992. Nucleic Acids Res. 20, 3831-3837). The reason for this could be that the series of primers adapted for the amplification of sequences coding for the variable domains of proteins that bind to the antigen, are constituted in a general way, of a plurality of degenerate primers to capture the diversity of these sequences that code the variable region. Thus, the complexity of the PCR reaction is highly increased when multiple PCR amplification is performed on sequences encoding the variable region. A further feature of the present invention is that two or more target sequences amplified by multiple PCRs are linked in close proximity in the amplification process. In particular, cognate pairs of sequences that encode the variable region are linked by this process. One embodiment of the present invention exploits that a multiple primer mixture can be designed to function in an overlap-extension PCR procedure, resulting in simultaneous amplification and binding of the nucleotide sequences of interest. This multiple overlap-extension PCR technique serves to reduce the number of reactions necessary to isolate and bind nucleotide sequences of interest in particular, cognate pairs of bound variable regions. Other embodiments of the present invention apply ligation or recombination links as an alternative for multiple overlap-extension CPR linkage. In these procedures, the link is not performed simultaneously with amplification by multiple PCR, but as an immediate step after amplification. However, the link can still be made in the same tube as multiple CPR is performed inside. To perform multiple overlap-extension PCR, the presence of two or more sets of primers (a multiple primer mix), wherein at least one primer from each set is required that is equipped with an overlap-extension end. The overlap-extension ends allow the linking of the products generated by each of the series of primers during the amplification. Such a primer mixture is called a multiple overlap-extension primer mixture. Multiple overlap-extension PCR differs from conventional overlap-extension PCR, in that the sequences to be ligated are generated simultaneously in the same tube, thereby providing immediate linkage of the target sequences during amplification, without any intermediate purification . In addition, conventional overlap-extension PCR requires a separate link PCR reaction either with or outside the primer series or a series of nested primer to generate the bound product (Horton, RM et al., 1989. Gene 77, 61-68). Such a further amplification step is optional in the multiple extension-overlap PCR of the present invention. A feature of the present invention is a reverse transcription (TI) step that precedes amplification of multiple overlap-extension or multiple PCR, using a template derived from a single isolated cell or a population of isogenic cells. A further feature of the present invention is the use of nucleoside sequences derived from a single isolated cell or a population of isogenic cells as templates for amplification by multiple PCR. Preferably, RNA from a single cell is reverse transcribed in the cDNA prior to multiple PCR. For the amplification of some nucleic acid sequences of interest, genomic DNA can be used as an alternative to mRNA. Using single isolated cells or a population of isogenic cells derived by clonal expansion of a single isolated cell as template source, it is possible to avoid randomization of nucleotide sequences encoding a heteromeric protein of interest, with nucleotide sequences derived from different cells within a population of cells. This is important if one wants to obtain the original composition of the sequences of interest. Especially for the generation of a cognate pair of sequences encoding the variable region, the use of a single isolated cell or a population of isogenic cells as a source of templates is an important feature. Multiple overlap-extension CPR is a rarely used technology. WO 99/16904 describes the binding of exons from a genomic sequence in a single reaction, thereby generating cDNA without using reverse transcription. The process as described, uses a series of primer (consisting of two primers) per exon to be ligated, thereby, composing a mixture of multiple overlap-extension primer. Each individual primer series was able to overlap with the adjacent primer series by complementary overlap-extension ends. The cDNA was generated from a genomic DNA template by performing an overlap-extension TI-PCR reaction, using the multiple overlap-extension primer mixture, followed by a nested PCR, which is described as a necessary step. Generation of the cDNA from the genomic DNA exons as described in WO 99/16904, is a different field than the cloning of sequences encoding heteromeric proteins. First of all, the heteromeric proteins are generally expressed from different genes, while the exon linkages as described in WO 99/16904, refer to the linkage of exons from a single gene. Additionally, the present invention facilitates the generation of libraries of ligated nucleic acid sequences of interest, in particular, combinatorial libraries and libraries of cognate pairs of variable regions.; a completely drent situation than linking a series of exons from a single gene, resulting in a single non-variable cDNA. In addition, the present invention uses nucleic acids derived from single cells, preferably in the form of RNA that does not need to be isolated from the contents of remaining cells before it can be used as a template.

There are some publications, where the multiple overlap-extension CT-PCR has been described in relation to the binding of sequences that encode the variable region. The simplest form of multiple overlap-extension CT-PCR was described for the isolation of a sequence encoding scFv from a hybridoma cell line (Thirion, S. et al., 1996, Eur. J. Cancer Prev. 5, 507-511 and Mullinax, R. L et al. 1992. BioTechniques 12, 864-869). The methods described by Thirion and Mullinax, use reverse transcription of ARMm with oligo-dT primers in total ARM extracted from the hybridoma cell line, followed by a separate binding step. The binding step is performed with a total of four primers, constituting two primer pairs for amplification of the sequences encoding the variable region of heavy chain and light chain variable region, respectively. The forward primer VL and the reverse primer VH or CH, contain complementary overlap-extension ends, thereby allowing the simultaneous amplification and binding of sequences encoding the variable region of heavy chain and light chain variable region. These methods do not use a nested RCP to increase the sensitivity of the binding method. The other example of multiple overlap-extension PCR-RCP in relation to the binding of the sequences encoding the variable region, was described in WO 93/03151, mentioned previously, provides a method of cloning sequences encoding the variable region of light chain and heavy chain variable region that originate from the same cell, without having to isolate single cells prior to cloning. The method described in WO 93/03151 requires washing between the IT stage and the multiple extension-overlap PCR stage. In addition, one of the specific objectives carried out by WO 93/03151, was to solve the problem of having to isolate unique cells to obtain cognate pairs of sequences coding for the variable region. None of these known multiple overlap-extension CT-PCR techniques were developed to function in templates derived from a single isolated cell. Nor were some of the methods capable of performing them as single-stage TI-PCR reactions. One embodiment of the present invention encompasses the binding of a plurality of noncontiguous nucleotide sequences of interest. The method comprises amplifying, in a multiple PCR or multiple TI-PCR procedure, nucleotide sequences of interest, using a template derived from a single isolated cell or a population of isogenic cells and effecting the binding of the amplified nucleotide sequences of interest. . In addition, the method comprises an optional step of performing a further amplification of the bound products. A further embodiment of the present invention encompasses a method for producing a library of cognate pairs comprising, sequences encoding the bound variable region. The method comprises providing a fraction of lymphocyte-containing cells from a donor, which is optionally enriched by a population of particular lymphocytes from said cell fraction. In addition, a population of isolated single cells is obtained by distributing the cells from the fraction of lymphocyte-containing cells, or the enriched cell fraction, individually among a plurality of containers. Multiple molecular amplification (amplification by multiple TI-PCR) of the variable region encoding sequences contained in the isolated single cell population is carried out and the pairs of sequences encoding the variable region are linked, where an individual pair is derived from a single cell, within the population of isolated single cells. In addition, the technique comprises two optional steps: in the first step, the single isolated single cell in the single cell population is expanded to a population of isogenic cells prior to amplification by multiple TI-PCR. With that, obtaining a plurality of containers with a diverse population of isogenic cells (a population of isogenic cells in a container). The optional second step involves performing a further amplification of the sequences encoding the linked variable region. In preferred embodiments of the present invention, an individual element of said library of cognate pairs comprised of a sequence encoding the immunoglobulin light chain variable region, is associated with a sequence encoding an immunoglobulin heavy chain variable region, which is originating from the same cell or from sequences encoding a T-cell receptor binding domain, consisting of a variable region of alpha chain associated with a variable region of beta chain, or a variable region of gamma chain, associated with a variable region delta chain, where the associated variable regions originate from the same cell. The multiple TI-PCR amplification of the present invention can be performed either as a two-step process, where the reverse transcription (TI) is performed separately from the multiple PCR amplification (or alternative multiple molecular amplification), or as a single-stage process, wherein the multiple PCR and TI amplification steps are performed with the same primers in a tube. Reverse transcription (TI) is performed with an enzyme-reverse transcriptase activity, which results in the generation of cDNA from the target total RNA, mRNA or RNA from a single isolated cell. The primers which can be used for reverse transcription are for example, oligo-dT primers, random hexamers, random decamers, other random primers, or primers that are specific for the nucleotide sequences of interest. The two-step multiple TI-PCR amplification procedure allows for the cDNA generated in the TI stage to be distributed to more than one container allowing the storage of a template fraction before proceeding with the amplification. Additionally, the distribution of cDNA to more than one tube allows the operation of more than one amplification by multiple PCR of nucleic acid derived from the same template. Although this results in an increased number of separate reactions, it should be desired to open the possibility to decrease the complexity of multiple primer mixing of these. This two-step procedure can for example be applied to amplify and bind sequences encoding the heavy chain variable region and the kappa light chain variable region in a tube, and sequences encoding the lambda light chain variable region and variable region Heavy chain in a different tube, using the same template. A single cell usually only expresses one of the light chains. However, it will often be easier to perform the reactions simultaneously instead of waiting for the result of one of the reactions before performing the other. In addition, the amplification of both kappa and lambda serves as an internal negative control, since it could be expected that only kappa or lambda will be amplified from a single cell. In the single-step multiple-PCR procedure, multiple PCR amplification and reverse transcription is carried out in the same vessel. All the necessary components to perform both reverse transcription and multiple PCR in a single stage are initially added to the vessels and the reaction is performed. Generally speaking, there is no need to add additional components once the reaction has been initiated. The advantage of multiple TI-PCR amplification is that it reduces the number of steps necessary to generate the ligated nucleotide sequences of the present invention still further. This is particularly useful when performing multiple TI-PCR in a single-cell array, wherein the same reaction needs to be carried out in a plurality of containers. Single-step multiple TI-PCR is performed using reverse primers present in a multiple primer mix, necessary for multiplex PCR amplification as primers for reverse transcription as well. Generally, the composition necessary for single-step multiple TI-PCR comprises a nucleic acid template, an enzyme with reverse transcriptase activity, an enzyme with DNA polymerase activity, deoxynucleotide triphosphate mixture (dNTP mixture) comprising dATP, dCTP, dGTP, and dTTP) and a multiple primer mix. The nucleic acid template is preferably total RNA or RNA derived from a single cell isolated either in a purified form, as a lysate from the cell or still within the intact cell. Generally, the exact composition of the reaction mixture requires some optimization for each multiple primer mixture to be used within the present invention. This applies to multi-stage, single-stage, and two-stage multiple-PCR procedures. In alternative embodiments of the present invention, it may be appropriate to use genomic DNA instead of ARM as a template. In such cases, the reverse transcription step is omitted, and the remaining steps of the invention are performed as described by the application. For some single-step multiple TI-PCR reactions, it may be advantageous to add additional components during the reaction. For example, the addition of polymerase after the IT stage. Other components may, for example, be a mixture of dNTP or a multiple primer mixture possibly with a different primer composition. This can then be considered as a multiple tube TI-PCR, which generally has the same advantages as the single-stage multiple TI-PCR, since it also limits the number of tubes needed to obtain the desired linked products. The nucleotide sequences of interest, amplified by multiple TI-PCR, can be linked to one another by several methods, such as multiple overlap-extension TI-PCR, ligation or recombination, using different multiple primer mixtures. Preferably, the amplification by multiple TI-PCR and linking process, is a single stage or two stage process. However, the binding process can also be performed as a multi-step process, using for example, a filler fragment to link the nucleic acid sequences of interest, either with PCR, ligation or recombination. Such a filler fragment may contain cis elements, promoter elements or a relevant coding sequence or recognition sequence. In a preferred embodiment, the linking process is performed in the same vessel as the multiple TI-PCR amplification. In one embodiment of the present invention, the binding of a plurality of noncontiguous nucleotide sequences of interest, is performed in association with multiple PCR amplification, using a multiple overlap-extension primer mixture. This results in the combined amplification and binding of the target sequences. Generally, the composition necessary for multiple overlap-extension PCR comprises, a nucleic acid template, an enzyme with DNA poly-emrase activity, deoxynucleoside triphosphate mixture (dNTP mixture that corrects dATP, dCTP, dGTP and dTTP ), and a multiple overlap-extension primer mixture. In a particular embodiment of the present invention, the binding of a plurality of noncontiguous nucleotide sequences of interest is performed by TI-PCR of multiple overlap-extension, using a template derived from a single isolated cell or a population of isogenic cells . In addition, the method comprises an optional step of performing an additional molecular amplification of bound products. Preferably, the TI-multiple overlap-extension PCR, is performed as a single-stage reaction / one tube. A multiple overlap-extension primer mixture of the present invention comprises at least two sets of primers capable of priming the amplification and binding of at least two sequences encoding the variable region, eg, amplification and binding of sequences from of immunoglobulin heavy chain variable region families with kappa or lambda light chain variable region families, or amplification and linkage of sequences from T, a, b, c, or d T cell receptor families. In another embodiment of the present invention, the plurality of nucleotide sequences of interest, amplified by multiple TI-PCR, are linked by ligation. To achieve this, the multiple primer mix used for the multiple TI-PCR is designed in such a way that the target amplified sequences can be split with appropriate restriction enzymes and the covalent linkage can be performed by DNA ligation (the primer is described in the section "Mixtures and Primer Designs"). After amplification by multiple TI-PCR with such a multiple primer mixture, the restriction enzymes necessary to form compatible ends of target sequences are added to the mixture together with the ligase. Purification of CPR products is not necessary prior to this stage, although purification can be performed. The reaction temperature for combined restriction cleavage and ligation is approximately 0 to 40 ° C. However, if the polymerase of the multiple PCR reaction is still present in the mixture, an incubation temperature below room temperature is preferred, more preferred are temperatures between 4 and 16 ° C. In yet another embodiment of the present invention, the plurality of nucleotide sequences of interest, amplified by multiple TI-PCR, is ligated by recombination. In this procedure, the amplified target sequences can be linked using identical recombination sites. The link is then carried out by adding the recombinases that facilitate recombination. Some suitable recombinase systems are Flp recombinase with a variety of FRT sites, Cre recombinase with a variety of lox sites, integrase FC31 which perform recombination between the attP site and the attB site, the systems of six ß-reco binases, as well as as well as the Gin-gix system. Linkage by recombination has been exemplified by two nucleotide sequences (VH linked to VL) (Chapal, N. et al., 1997 BioTechniques 23, 518-524), thereby incorporated herein by reference. In a preferred embodiment of the present invention, the nucleotide sequences of interest comprise sequences encoding the variable region and linkages that generate a cognate pair of sequences encoding the variable region. Such a cognate pair may comprise one or more sequences encoding the constant region in addition to the variable regions. In a more preferred embodiment of the present invention, the nucleotide sequences of interest comprise sequences encoding the immunoglobulin variable region and the linkage generates a cognate pair of sequences encoding the variable region of heavy chain and light chain variable region. Such a cognate pair may comprise one or more sequences encoding the constant region, in addition to the variable regions. In addition, such a cognate pair can be isolated from templates derived from cells of B lymphocyte lineage enriched from a fraction of lymphocyte-containing cells, such as whole blood, mononuclear cells or white blood cells. In just one preferred embodiment of the present invention, the nucleotide sequences of interest comprise sequences encoding the TcR variable region and the linkage generates a cognate pair of sequences encoding a variable chain region or: and a variable region of β chain or sequences that encode the variable region of chain d and variable region of chain?. Such cognate pair may comprise one or more sequences encoding the constant region, in addition to the variable regions. In addition, such a cognate pair can be isolated from a template derived from cells of the T lymphocyte lineage enriched from a cell fraction containing lymphocytes, such as whole blood, mononuclear cells, or white blood cells. Another aspect of the present invention is to use multiple TI-PCR with a population of genetically diverse cells as template sources. The majority of sequences encoding the heteromeric protein do not vary from cell to cell as is the case with sequences that encode the variable region from binding proteins. Thus, when the present invention is used for the cloning of such sequences encoding the non-variable heteromeric protein, there is no need to perform an initial isolation of single cells. In this embodiment of the present invention, a plurality of noncontiguous nucleotide sequences of interest, are randomly linked by a method comprising, performing multiple TI-PCR amplification of nucleotide sequences of interest using a template derived from a population of cells. genetically diverse and effecting the binding of the amplified nucleotide sequences of interest. In addition, the method comprises an optional step of performing a further amplification of the bound products. As with the single cell method, the linkage can be either performed using a multiple overlap-extension primer mixture for amplification, or alternatively by ligation or recombination. Preferably, the template derived from the cell population is not strictly contained within the cells. The population of cells can, for example, be lysed. The application of the random binding process in a population of cells expressing binding proteins allows a simplified generation of combinatorial libraries of sequences encoding the variable region. Preferably, the cell population constitutes cells expressing proteins that bind to the variable region, such as B lymphocytes, T lymphocytes, hybridoma cells, plasma cells, or a mixture of these cells. The population of cells in the aforementioned embodiment can be, for example, permeabilized or lysed, without further purification, or the template nucleic acids can be isolated from the cells by standard procedures. The one-step multiple-fold overlap-ti-PCR procedure is preferred. However, the two-stage procedure can also be used in the modality. The invention also provides a combinatorial library comprised of linked pairs of sequences encoding the light chain variable region and immunoglobulin heavy chain variable region. An efficient way to increase the specificity, sensitivity and performance of the multiple TI-PCR binding process is by performing an additional molecular amplification of the nucleotide sequences obtained from the multiple TI-PCR, followed by binding by ligation or recombination or link using multiple overlap-extension TI-RCP. This additional amplification is preferably performed with PCR amplification, using a primer mix adapted to amplify the ligated nucleic acid sequences of interest. The primer mixture used may be the external primers of the multiple primer mixture or the multiple extension-overlap primer mixture, meaning primers which anneal the outermost 5 'and 3' end of the sense strand of the coding sequences. the variable region bound, thereby, allowing the amplification of the complete bound product. The external primers may also be described as the primers of the multiple overlap-extension primer that does not contain overlap extension ends. Alternatively, a nested or semi-nested primer series can be used for further amplification of the ligated nucleotide sequences. Such nested RCP, especially serves to increase the specificity of the method, as well as to increase the amount of bound product. By the present invention, semi-nested PCR (as described in the section entitled Mixtures and Primer Design), is considered to function as well as nested PCR. Thus, it is desired, though not necessarily by the present invention, to perform an additional PCR amplification of the ligated products from the multiple overlap-extension CT-PCR or the ligated products by ligation or recombination, preferably using nested PCR. o Semi-nested CPR.

The additional amplification may be either performed directly using a fraction or the complete multiple overlap-extension PCR reaction product or ligation product or recombination product, or any fraction of any of these products or using partially bound products. purified from any of these reactions, for example, by performing agarose gel electrophoresis of the ligated products, and by cleaving the fragment corresponding to the expected size of sequences encoding the linked chain variable region. For products linked by ti-PCR of multiple overlap-extension, the additional amplification is preferably performed directly in a fraction of the multiple overlap-extension TI-PCR reaction, since this could assist in the binding of the individual target sequences that do not they were linked in the first reaction. Sequences of interest The nucleotide sequences of interest of the present invention can be selected from sequences encoding different subunits or domains, which when expressed, form a protein or part of a protein. Such proteins that are composed of at least two non-identical subunits are known as heteromeric proteins. Heteromeric proteins are common in all classes of species. Some of the classes to which such proteins belong are, for example, enzymes, inhibitors, structural proteins, toxins, channel proteins, G proteins, receptor proteins, proteins of the immunoglobulin subfamily, transport proteins, etc. The nucleotide sequences encoding such heteromeric proteins are not contiguous, meaning for example, that they originate from different genes, or from different mRNA molecules. However, not contiguous as used in the present invention, it can also mean domains encoding nucleotide sequences of the same protein, wherein the domains are separated by nucleotide sequences which are not of interest. In one embodiment of the present invention, the nucleotide sequences of interest contain sequences encoding variable regions of the immunoglobulin superfamily, such as immunoglobulins (antibodies), B cell receptors and T cell receptors (TcR). Especially, sequences that encode variable regions from immunoglobulins are of interest. Such sequences encoding a variable region comprise full length antibodies, as well as Fab, Fv, scFV and combinations of fragments of the variable region encoding sequences, eg, regions determining complementarity (CDR), binding genes or V genes or combinations of these. In general, the present invention can be applied with any of the combinations of sequences encoding the variable region and fragments thereof. The present application exemplifies the link of the complete light chain with the variable domain of the heavy chain. However, the present invention also allows the binding of only the variable domains of sequences encoding Fv or scFVv that generate light and heavy chains, or the binding of the complete light chain to the heavy chain variable region + the domain of the region constant CH? + parts of the articulation region, generating Fab, Fab 'or F (ab) 2. In addition, it is possible to add any region of the domains of the heavy chain constant region to the variable heavy chain, thereby generating sequences encoding truncated antibodies or sequences encoding full-length antibodies. In a further embodiment of the present invention, sequences encoding a variable region of the present invention comprise a type of sequence encoding an immunoglobulin light chain (kappa or lambda) and a sequence encoding an immunoglobulin heavy chain variable region. . The sequences encoding the variable region derived from T cell receptors (TcR), are also of interest. Such sequences encoding TcR, comprise coding sequences for the full-length beta or alpha chains or gamma and delta chains, as well as also soluble TcR or only the variable domains of these chains or single chain fusion proteins thereof (eg. example, single chain ß or single chain? d). Template Sources A feature of the present invention is the ability to bind nucleotide sequences derived from a single isolated cell, a population of isogenic cells, or a genetically diverse population of cells, which have not been separated into single containers. The cells used in the present invention may for example be bacteria, yeast, fungi, insect cells, plant cells or mammalian cells or fractions of such cells. Blood cells derived from mammals are an example of a fraction of cells that can be used in the present invention. A preferred feature of the present invention is the use of isolated single cells or a population of isogenic cells as a source of templates, since randomization of the nucleic acid sequences of interest, in particular sequences encoding the particular variable region, is avoided. This is important if one wants to obtain an original pair of for example, sequences that encode the variable region.

Another preferred feature of the present invention is to obtain a single cell or population of single cells from a cell fraction comprising lymphocytes, such as B lymphocytes, T lymphocytes, plasma cells and / or various developmental stages of these cell lineages. . Other populations of cells expressing binding proteins from the immunoglobulin superfamily could also be used to obtain single cells. Cell lines such as hybridoma cells, cell lines of B lymphocytes or T lymphocytes or immortalized cell lines of viruses or donor derived cells, which participate in the immune response, are also applicable in the present invention. Fractions of cells containing lymphocytes derived from donors can be obtained from tissue or natural fluid which is rich in such cells, for example, blood, bone marrow, lymph nodes, spleen tissue, amygdala tissue or infiltrations in and around tumors or infiltrations of inflammatory tissue. Cell donors suitable for the present invention can be selected from vertebrates containing all, an acquired immune system. The donors may be either non-experienced, or hyperimmune, with respect to a desired objective. For the isolation of proteins that bind to antigens with binding specificity towards a desired target, hyperimmune donors are preferred. Such hyperimmune donors can either be donors immunized with the target, or fragments of the target, or they can be convalescent patients, or unhealthy individuals, which are running a natural immune response towards the target, for example, autoimmune patients, patients with cancer, patients with infectious diseases, for example, patients with HIV, patients with Hepatitis A, B or C, patients with SARS, etc., or patients with chronic diseases. When recombinant proteins are used for treatment, it is preferable that they are derived from sequences that have species identity with the individual to be treated (for example, human sequences for the treatment of humans). First, because recombinant proteins derived from a foreign sequence (ie, non-human), will be recognized by the immune system leading to an immune response, involving anti-polyclonal proteins. These anti-protein antibodies can block the action of the drug by occupying the active site, will accelerate drug removal and may potentially induce adverse reactions such as hypersensitivity reactions after repeated exposure. Immunogenicity can, however, also be seen in cases where the recombinant protein is derived from a sequence having species identity. Such immunogenicity can, for example, be induced by post-translational modifications that could differ from those seen in vivo. Combinatorial libraries of sequences encoding the variable region could also give rise to immunogenicity, since they consist of random pairs of sequences encoding the variable region created in vitro. The rules governing the formation of the sequence pairs encoding the antibody light and heavy chain (or T cell receptors) in vivo are not completely understood. Therefore, it follows that some of the pairs formed in vi tro may be recognized by strangers by the immune system, even though both sequences that make up the pair are perfectly human. The binding proteins obtained from cognate libraries, on the other hand, do not create such abnormal combinations and are consequently of less potential immunogenicity than the binding proteins from combinatorial libraries. This does not mean that the products of combinatorial libraries are inadequate for treatment, they only require a greater degree of monitoring with respect to the side effects mentioned above. For use in the present invention, the cell donors should preferably be from the same species, as the species to be treated with the products obtainable from the ligated nucleotide sequences of the present invention. Preferably, a cell donor is a pet, a pet, a human, or a transgenic animal. Transgenic animals that carry human immunoglobulin sites are described in U.S. Patent No. 6,111,166 and Kuroiwa, Y. et al. Nature Biotechnology; 2002; 20: 889-893. Such transgenic animals are capable of producing human immunoglobulins. In this way, completely human antibodies against a specific target, can be originated by usual immunization techniques of such transgenic animals. This allows the generation of libraries coding for binding proteins with specificities towards more difficult targets, such as human antigens to which a natural human antibody response does not exist or is limited. Such transgenic animals can likewise be developed to produce human T cell receptors. In a further embodiment of the present invention, the fraction of lymphocyte-containing cells is composed of whole blood, bone marrow, mononuclear cells, or white blood cells obtained from a donor. Mononuclear cells can be isolated from blood, bone marrow, lymph nodes, spleens, infiltrations around cancer cells and inflammatory infiltrations. Mononuclear cells can be isolated by density centrifugation techniques, for example Ficoll gradients. If the mononuclear cells are isolated from composite samples of tissue, the tissue is disintegrated before the centrifugation of the gradient is performed. The disintegration can be carried out, for example, by mechanical methods such as grinding, electroporation and / or by chemical methods such as enzymatic treatments. The isolation of white blood cells can be done directly from donors using leukophoresis. Crude preparations of eg bone marrow or tissue, which contain lymphocytes, can also be used in the present invention. Such preparations will not need to be disintegrated, for example, as described above, to facilitate the distribution of single cells. A further feature of the present invention is the enrichment of the fraction of lymphocyte-containing cells, for example, whole blood, mononuclear cells, white blood cells or bone marrow, with respect to a population of particular lymphocytes, such as cells from the lineage of B lymphocytes or T lymphocytes. The enrichment of B lymphocytes can for example be done using cell sorting by magnetic strips or fluorescence activated cell sorting (FACS), taking advantage of cell surface marker proteins lineage specific such as CD19 or other markers specific to the cell lineage. T lymphocyte enrichment may for example be performed using a cell surface marker, such as CD3 or other markers specific to the T cell lineage. A preferred feature of the present invention is to classify enriched B lymphocytes, in addition to acquiring cells. of the plasma, before distributing the cells individually among a plurality of containers. The isolation of the plasma cells is carried out generally, by FACS classification, using surface markers such as CD38 possibly in combination with CD45. Other specific surface markers of plasma cells or combinations thereof, can also be used, for example, CD138, CD20, CD21, CD40, CD9, HLA-DR or CD62L, the exact choice of marker dep on the source of plasma cells, for example, tonsils, blood or bone marrow. Plasma cells can also be obtained from a population of cells containing unenriched lymphocytes, obtained from any of these sources. Plasma cells isolated from the blood are sometimes called early plasma cells or plasmablast cells. In the present invention, these cells are also called plasma cells although they are CD19 positive, contrary to plasma cells residing in the bone marrow. Plasma cells are desired for the isolation of cognate pairs of sequences that encode immunoglobulins, because the higher frequency of these cells produces antigen-specific antibodies, which reflect the acquired immunity to the desired antigen and most of the cells have undergone somatic hypermutation and therefore, code for high affinity antibodies. In addition, the levels of ARMm in plasma cells are high, compared to the remaining B-cell population, thus, the reverse transcription procedure is more efficient when single plasma cells are used. As an alternative to the isolation of plasma cells, memory B cells can be isolated from a cell fraction containing lymphocytes, using a surface marker such as CD22. An alternative feature of the present invention is to select enriched B lymphocytes to determine the specificity of the antigen before distributing the cells among a plurality of containers. The isolation of antigen-specific B lymphocytes is carried out by contacting enriched B lymphocytes with the desired antigen or antigens that allow the binding of antigens to the surface exposed to immunoglobulin, followed by isolation of binders. This can be done, for example, by coating magnetic strips with the desired antigen or antigens, followed by sorting cells by magnetic strips, by FACS, by coating a column with the antigens, followed by affinity chromatography, by assays. of filter selection or other methods known in the art. Plasma cells, as well as B lymphocytes, enriched mononuclear cells, white blood cells, whole blood, bone marrow or tissue preparations, can be isolated with respect to the specificity of the antigen if this is desired. Another feature of the present invention is to classify enriched T lymphocytes (e.g., CD3 positive cells), using CD45R and / or CD27 surface markers, to obtain a fraction of memory T cells. T lymphocytes can also be selected to determine the specificity of the MHC antigen using MHC peptide complexes (eg, Callan, M. F. et al., 1998. J. Exp. Med. 187, 1395-1402; Novak, E. J. et al. 1999. J. Clin. Invest 104, R63-R67). A further feature of the present invention is the immortalization of any of the isolated cell fractions described above (e.g., B lymphocytes, plasma cells, memory cells or T lymphocytes). Immortalization can, for example, be performed with Epstein-Barr virus (Traggiai, E., et al., 2004. Nat Med 10, 871-875), prior to cell distribution. Alternatively, isolated single cells can be immortalized and expanded, prior to reverse transcription. Traggiai et al. , Nat Med. 2004 Aug; 10 (8): 871-5. A further feature of the present invention is the distribution of a population of desired cells (e.g., hybridoma cells, lineage of B-cell or T-cell lines, whole blood cells, bone marrow cells, mononuclear cells, white blood cells, B lymphocytes, plasma cells, antigen-specific B lymphocytes, memory B cells, T lymphocytes, MHC-specific T lymphocytes / antigens, or memory T cells), individually, in a plurality of containers, to obtain a population of isolated single cells. This unique cell isolation refers to the physical separation of cells from a population of cells in such a form, that a single container contains a single cell, or a micro array, chip or gel matrix, is loaded in a way that produces cells unique The cells can be distributed directly in multitudes of containers, such as arrays of single containers limiting dilution. The unique containers used in the present invention are preferably those applicable in the PCR (for example, PCR tubes and 96-well PCR plates or 384 cavities or larger arrays of containers). However, other containers may also be used. When the single cells are distributed in a large number of unique vessels (e.g., 384-well plates), a single cell population is obtained. Such a distribution can be carried out, for example, by dispersing a volume in a single container that, on average, covers a cell concentration of one, 0.5 or 0.3 cells, thereby obtaining containers that, on average, contain a single cell or less. Since the distribution of cells limiting dilution is a statistical event, a fraction of the containers will be emptied, a main fraction will contain a single cell, and a smaller fraction will contain two or more cells. If two or more cells are present in a container some randomization of the sequences encoding the variable region between the cells present in the containers may occur. However, since it is a minor event, it will not affect the total use of the present invention. Additionally, combinations of sequences encoding a variable region which do not possess the desired binding affinity and specificity, more likely will not be selected and therefore, eliminated during the selection process. Therefore, minor randomization events will not significantly affect the final library of the present invention. Alternatives to cell distribution exist by limiting dilution using, for example, cellular classifiers such as FACS machines or robots, which can be programmed to exactly distribute unique cells in single containers. These alternatives are preferable, since they are less laborious and more efficient in uniformity, obtaining a distribution of unique cells in the single containers. The enrichment, classification and isolation procedures described above are performed so that most cells remain intact. The rupture of the cells during enrichment and classification could result in randomization of the sequences encoding the variable region. Nevertheless, this is not expected to be a problem, since the frequency of the break is expected to be low. The possible washing and RNAse treatment of the cells prior to distribution in single containers, will remove any RNA that has been spilled during the process. Further, when considering the above descriptions of how to distribute the cells to obtain a population of single cells in a population of single vessels, it is not interpreted as an absolutely required feature, that each vessel must contain a single cell. Preferably, it indicates that a majority of the containers contain single cells, for example, the number of containers with two or more cells is below 25% of the total number of cells distributed, or even better, it is below 10%. .

A further feature of the present invention is the operation of a reverse transcription using templates derived from cells distributed individually among a plurality of containers. For purposes of reverse transcription (TI), in accordance with the present invention, nucleic acids within a single cell that serves as a template source for IT, are considered to be derived from a single cell even though they have not necessarily been separated from the cells. remaining contents of such a single cell. When the final distribution of single cells to their unique vessels has been performed, single cells can be expanded to obtain a population of isogenic cells, prior to reverse transcription. This process provides more mRNA to be used as a template, which should be important if a rare target is amplified and linked. However, the cells must remain genetically identical with respect to the target gene during expansion. The isolated cells or the population of isogenic cells can be kept intact or used as soon as the template for reverse transcription is not degraded. Preferentially, the cells are used to facilitate the following reverse transcription and amplification by PCR. In a different embodiment of the present invention, the described multiple-fold overlap-ti-PCR method, or multiple RI-PCR, followed by ligation or recombination binding, can also be used in a template derived from a genetically diverse population of cells which have not been separated into single containers, but will remain together as a combination of cells. This method can be used for the generation of combinatorial libraries. Such a procedure will not require the distribution of single cells. However, the cells which can be used in this procedure are the same as those described for the single-cell method, for example, a population (combination) of B lymphocytes or classified T lymphocytes. When performing single-step multiple-lap multiple-overlap CT or TI-multiple step PCR, followed by ligation or recombination in such a population of cells, it is preferable to lyse the cells prior to the reaction and if the RNA or Total desired mRNA can be isolated from the lysate. The sensitivity of the TI-single-stage multiple overlap-extension PCR of the present invention allows the use of a very low number of templates. As shown in Example 2 and 3, the TI-overlap PCR-single-stage multiple extension, may be carried out in a template amount corresponding to the lysis of a single cell.

Mixes and Design of Primers The primer mixtures of the present invention comprise at least four primers that form a series of two-by-two primers, which are capable of amplifying at least two different target sequences of interest. Mixtures of two or more of such series of primers constitute a mixture of multiple primers. Preferably a multiple mixture comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, 30, 40, 50, 60 , 70, 80, 90, 100, 110, 120, 130, 140 or 150 sets of primers (primer pairs). In particular for the amplification of the sequences encoding the variable region, a single primer series within the multiple primer mixture can be formed, constituting several more than two primers. Preferably, a series of individual primers comprises at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60 , 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280 or 300 primers. Preferably, the total number of primers in the multiple primer mixture is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 45, 50, 60, 70, 80, 90, 100, 125, 150 or 200 and at the most 225, 250, 275, 300, 325, 350, 375 or 400 primers. All primers of the present invention comprise a specific region of the gene, and preferably all primers are additionally equipped with a primer end to the 5 'end of the primer, i.e., 5' non-coding sequences, which are fused to the extreme 3 'of the part of the specific primer of the gene. Such a primer end is approximately 6 to 50 nucleosides in length, but may also be longer if desired. After amplification, the primer ends are added to the target sequences. The primer ends of the present invention are for example, cloning ends and binding ends such as, ends adapted for ligation binding, ends adapted for recombination binding or overlap-extension ends. The cloning ends may be from 6 to 20 nucleotides in length or longer and comprise restriction sites and / or recombination sites, which are useful for the insertion of the bound product into an appropriate vector. To allow linkage by ligation, the first sets of multiple primer mixtures are designed such that one part (forward or reverse primer (s) of the first series, is equipped with a binding end containing a restriction site). that after splitting will be compatible with a restriction site located at the binding end of a part of the second primer series. For linking more than two target sequences, the second part of the second primer series is equipped with a restriction site which after cleavage will be compatible with a restriction site located in a part of the third primer series. This second restriction site located in the second primer series should not be compatible with that of the first primer series. A considerable number of target sequences can be ligated by designing sets of primers in this way. Restriction sites should be chosen with a low frequency or no incidence, in the target sequences. In addition, it is preferable that the compatible restriction sites are not identical, such that the ligation site becomes resistant to cleavage by the particular restriction enzymes used. This will lead the reaction towards the binding of the target sequence with two target sequences, since the link between the identical target sequences will be cleavable by the restriction enzymes. Suitable pairs of restriction sites are for example, Sepl with Xbal (alternatively Nhel or Avrll, can substitute one or both of these), Ncol with BspHI, EcoRI with Mfel or PstI with Nsil. For binding, Spel can, for example, be located in a target sequence, Xbal can be located in two target sequences, Ncol can be located at the other end of two target sequences and BspHI in three target sequences and so on. To simplify the process further, it is an advantage if the restriction enzymes function in the same buffer. To allow recombination binding, the primer arrays of the multiple primer mixture can, for example, be designed as exemplified in the article by Chapal (1997 BioTechniques 23, 518-524), which is thereby incorporated by reference. To allow the linking of the nucleotide sequences of interest in the same stage as the multiplex PCR amplification, ends adapted for overlap-extension PCR are added in at least one primer of each first primer series of the multiple primer mixture. , thereby, generating a mix of multiple overlap-extension primer. The overlap-extension ends are typically longer, varying from 8 to 75 nucleosides in length, and may contain restriction sites or recombination sites, which allow the subsequent insertion of regulatory elements such as promoters., ribosomal binding sites, termination sequences, or linker sequences such as in a scFv. The overlap-extension end may also contain a stop codon if desired. Generally, there are three types of overlap-extension ends, as illustrated in Figure 1. In type I, the overlap-extension ends of two sets of primer only overlap each other. Not necessarily all the nucleotides of two ends of overlap-extension are complementary to each other. In one aspect of the present invention, complementary nucleotides represent between 60 to 85% of the overlap-extension end. At the ends of overlap-extension type II, 4 to 6 of the nucleotides at 5 ', are complementary to the specific region of the gene of the adjacent target sequence. At the type III overlap-extension ends, the entire overlap is complementary to the adjacent target sequence. The overlap-extension ends type I and II are preferred when regulatory and similar elements are then inserted between the linked target sequences. Type II overlap-extension ends are preferred, if the target sequences are linked by a linker defined as observed with scFv. Type III overlap-extension ends are preferred if the target sequences are being linked in structure with each other. The design of the overlap-extension ends are dependent on the characteristics of the sequence, such as length, relative GC content (% GC), presence of restriction sites, palindromes, melting temperature, the specific part of the gene a which are coupled, etc.

The length of the overlap-extension ends should be between 8 and 75 nucleotides in length, preferably they are from 15 to 40 nucleotides in length. Even more preferred are from 22 to 28 nucleotides in length. The use of very long overlap-extension ends (50 to 75 nucleotides), could favor the linking of the products produced by each primer series. However, the ratio between the length of the overlap-extension end and the specific region of the gene will probably need to be adjusted when using very long overlap-extension ends. The% GC preference is dependent on the length of the overlap-extension end. Since the shorter ends have a shorter area where they are complementary, they need a higher GC% to temper the interaction than the longer ends. Other principles of primer design should likewise be observed, for example, primer dimerization and hairpin formation should be minimized. They should not be attached to false primers. In addition, it is known that Taq DNA polymerase often adds an adenosine (A) to the 3 'end of the newly synthesized DNA strand, and this can be accommodated by an overlap-extension end design allowing the ends of overlap-extension, accommodate addition A without template to 3 '. The choice of primers carrying the binding end, for example, the overlap-extension end, end adapted for ligation binding or end adapted for recombination binding, defines the order and binding direction of the target sequences. It is not essential to the invention whether the forward primer (s) or reverse primer (s) of a first series or possibly both forward and reverse primers are equipped with the link end. However, some consideration should be given to this anyway, since the order and direction of the target sequences in the final product should be relevant, for example, for the insertion of regulatory elements such as promoters and termination sequences or for the link in structure of the individual target sequences. For binding of two nucleotide sequences of interest, the binding end can be added to either the forward primer (s) or forward primer (s) of each first series used for PCR amplification of each target sequence. The present invention exemplifies the addition of overlap-extension ends and ends adapted for ligation binding, to the forward primers VH and VL of each series (eg, Figure 2 and Example 9, respectively). This results in a linking direction of the products that is, 5 'to 5' (principle to principle and bi-directional). However, the binding ends may be added to the reverse primer (s) of each series (e.g., C? And / or C? In the first series and CH or JH in the second series). This results in a product link direction that is 3 'to 3' (end-to-end and bidirectional). A third option is to add the binding ends to the reverse primer (s) of the first set (eg, primers Ck and / or C \) and the forward primer (s) of the second set of primers (eg, VH primer (s) or vice versa) This results in a 3 'to 5' orientation (beginning to end and uni-directional) Figure 3 illustrates the possible directions that can be generated depending on which primer of each first series is equipped with the binding end When more than two nucleotide sequences of interest are linked, some of the primer sets need to have linked ends in both the forward and reverse primers, such that one end is complementary to one end of the preceding primer set and the other end is complementary to one of the primers of the subsequent primer set.This principle holds for all sets of primers that amplify target sequences that are linked between two sets of primers. other objective sequences. The design of the specific part of the gene, should generally observe rules of known primer designs, such as minimizing primer dimerization, hairpin formation, and non-specific tempering. In addition, multiple nucleotides G or C, such as the 3 'bases, are avoided when possible. The melting temperature (Tm) of the specific regions of the gene in a first set of primer should preferably be equal to each other plus / minus 5 ° C. In the present invention, Tm values between 45 ° C and 75 ° C are desirable, and Tm values of about 60 ° C, are optimal for most applications. Advantageously, the initial primer design can be aided by computer programs developed by this task. However, primer designs generally require laboratory tests and routine optimization. This can be done, for example, by size analysis, restriction fragment length polymorphism (RFLP) and sequencing of the amplification products obtained using the primer sets. The use of degenerate options within primers is a useful procedure when amplifying sequences with variable regions or when searching for new family elements belonging to a specified class of proteins. The numbers of degenerate positions may also require optimization. The present invention encompasses series of improved primers that can be used together in a highly multiplexed format. The primer series described by de Haard (de Haard, HJ et al., 1999. J. Biol. Chem. 274, 18218-18230), was used as a starting point, and was modified by trimming the 3 'ends of the primers , to reduce non-specific interactions and add ends of overlap-extension or ends adapted to link by ligation. A feature of the present invention are mixtures of primers composed of at least two sets of primers that are capable of priming the amplification and promoting the binding of at least two nucleotide sequences of interest. The primer mixtures of the present invention are capable of priming the amplification of at least two subunits or domains of heteromeric proteins, for example, belonging to the class of enzymes, inhibitors, structural proteins, toxins, protein channels, proteins. G, receptor proteins, proteins of the immunoglobulin superfamily, transport proteins, etc. A feature of the present invention is a multiple overlap-extension primer mix, comprising primer arrays wherein at least one first primer element of each set of primers comprises an overlap-extension end capable of hybridizing to the overlap end. -extension of an element of the primer series of a second series of primers. The overlap-extension ends allow for the immediate linkage of the nucleotides of interest during amplification by multiple overlap-extension PCR, equipping each individual product that originates from the primer series with one end that is complementary to an attached product. This, however, does not mean that the link necessarily occurs during this first PCR amplification. Depending on the establishment of the reaction, the majority of the current link can be made during a further amplification with the external primers of the first amplification by PCR (amplification by multiple PCR). A further feature of the present invention is a primer series designed to amplify a family of nucleotide sequences containing sequences encoding a variable region. Examples of such families are kappa light chains (e.g., VKI-VI in humans), lambda light chains (e.g., VL1-10 in humans) and variable heavy chains (e.g., VH1-7 in humans and VH1-15 in mice) of immunoglobulins, and variable regions TcR a, ß,? or d. A primer series for the amplification of a family of nucleotide sequences containing sequences encoding a variable region, often comprising a plurality of primers, wherein several primers can be degenerate primers. The amplification of families of sequences encoding an immunoglobulin light chain variable region is for example, performed using a primer series comprised of a plurality of primers complementary to the 5 'end of the variable region of the kappa chain (primer (s) VL?) Or the leader sequence kappa (primer (s) VLKL) and / or the lambda chain (primer (s) VL?) Or the lambda leader sequence (primer (s) L) (forward primers), together with the region kappa constant (primer (s) C?) and / or lambda primers (primer (s) C?) (reverse primers) or a plurality of such primers. Alternatively, primers from the light chain binding region (primer JL? And / or Ju) can be used as reverse primers in place of the primers of the constant region, Alternatively, forward primers temper the UTR region preceding the sequence leader of the variable light chain Likewise, families of sequences encoding the immunoglobulin heavy chain variable region, can be amplified with a primer series using various combinations of primers, eg, a plurality of primers complementary to the 5 'end of the heavy chain variable region (primer (is VH) or the leader sequence of this region (primer (is VHL (forward primers), together with a plurality of primers of the heavy chain binding region (primer (is JH) or primer (s) of a heavy chain constant region (reverse primers) The CH primer can be isotype specific and in principle, any CH primer can be used or (for example, CH ?, CH2, CH3 or CH), also one that could result in a full-length heavy chain. Alternatively, the forward primers temper the UTR region that precedes the leader sequence of the variable heavy chain. The use of forward primers that temper the leader sequence instead of the 5 'end of the variable region is particularly useful if cross-hybridization is observed for the variable region primers. Since the mutations due to cross-hybridization will be eliminated from the final protein because the leader sequences are split during the processing of the protein within the cell. Example 9 describes the design of leading kappa light chain and antibody variable heavy chain primers. The appearance that the priming site is located at the 3 'end of the leader coding sequence (C-terminal), is an advantage over the leader primers of previous antibodies, since this allows shuttles of the amplified sequences between the eukaryotic and bacterial expression vectors in a way that allows the leader functional sequences in both systems. The design system described in Example 9 can be easily applied to lambda light chains of antibody, as well as to TcR chains OÍ, β ,? or d.

A feature of the present invention are primers, which are tuned at the 3 'end of the sequence encoding the leader, preceding a sequence encoding the variable region, and their use for amplification of sequences encoding the variable region. A preferred feature of the present invention is the application of primers with at least 90% sequence identity (preferably at least 95% identity), with the specific region of the gene of SEQ ID NOs 86 to 92, which corresponds to primers that are tuned at the C-terminus of the sequences encoding the leader of the heavy chain (VHL primers) • The specific sequence of the gene of these SEQ ID NO, corresponds to the base number 18 to the extreme 30 of the sequences (see also table 11). Another preferred feature of the present invention is the application of primers with at least 90% sequence identity (preferably at least 95% identity) with the specific region of the gene of SEQ ID NOs 93 to 98, which corresponds to the primers that are tuned at the C-terminus of the sequences encoding the leader of the kappa light chain (VLK primers) • The specific sequence of the gene of these SEQ ID NO, corresponds to the base number 25 to the 3 'end of the sequences (see also table 11). In one embodiment of the present invention, the multiple overlap-extension primer mix for the multiple overlap-extension PCR and possibly the reverse transcription step, also comprises a) at least one CL or JL primer complementary to the sense strand. of a sequence encoding the immunoglobulin light chain region; b) at least one 5 'VL primer or VL leader primer complementary to the antisense strand of a sequence encoding an immunoglobulin light chain variable region and capable of forming a primer series with the primer (s) in a); c) at least one CH or JH primer complementary to the sense strand of a sequence encoding the constant heavy chain domain of immunoglobulin or the heavy chain binding region and at least one 5 'primer of VH or VH leader primer complementary to the antisense strand of a sequence encoding the immunoglobulin heavy chain variable region, and capable of forming a primer series with the primer (s) in c). The series of primers of the present invention can be, for example, VL? + C ?, L? + C ?, VL? + JLK / L + Ji ?, VLK + C ?, VL? L + C ?, VL? + JL ?, L + Jtí VH + JH, VH + CH, VHL + JH or VHL + CH or combinations thereof, capable of amplifying an objective sequence coding for a variable region. In a further embodiment are the primer (s) C (JL) and primer (s) VL (VLL) adapted to amplify sequences comprising kappa light chain variable regions or lambda light chain variable regions.

In a preferred embodiment of the present invention, are the CL (JL) primer and VL primer (VLL), adapted to amplify both lambda and kappa light chain variable region. In yet a more preferred embodiment of the present invention, it is the V primers for light chain amplification with at least 90% sequence identity (preferably at least 95% identity), with the specific region of the SEC gene ID 93 to 98, and the forward primers for heavy chain amplification are VHL primers with at least 90% identity (preferably at least 95%) with the specific region of the gene of SEQ IDs 86 to 92. In a further embodiment of the present invention, the primer binding ends carry the immunoglobulin VL / VLL and VH / VHL, preferably in the form of complementary overlap-extension ends. This generates sequences that encode the variable region, which are linked in a principle-to-principle way. For the binding of sequences encoding the variable region in a start-to-end manner, either the primers CL / JL and VH / VHL contain binding ends or the primers VL / VLL and CH / JH contain binding ends, preferably in the form of complementary overlap-extension ends. For the binding of the sequences encoding the variable region in an end-to-end manner, the primers CL / JL and CH / JH / contain binding ends, preferably in the form of complementary overlap-extension ends (Figure 3). Preferably, the multiple primer mixtures, including multiple overlap-extension primer mixtures, comprise two primer sets. In this way, a mixture comprises at least four different primers. In a further aspect of the present invention, a multiple primer mixture comprises more than four different primers. A multiple primer mixture of the present invention is used for the amplification of target sequences in a single container. For example, they are variable regions of heavy chain kappa and lambda, all amplified in the same vessel. A multiple primer mixture of the present invention is comprised of 16 different degenerate primers distributed as follows: eight VH primers, one n primer, six Vi? Primers, and one C primer? (Figure 2). Another series is comprised of 19 degenerate primers, distributed as follows: eight VH primers, four JH primers, six i? Primers, and one C? Primer. A third series is comprised of 22 degenerate primers distributed as follows: eight VH primers, one CH primer, eleven VL? / Primers and two C primers? . A fourth series is comprised of 27 degenerate primers distributed as follows: eight VH primers, one CH primer, six VL primers ?, one C primer ?, eleven L primers? and two primers C ?.

The present invention also encompasses primers for an additional PCR amplification of ligated products obtained by multiple TI-PCR, followed by ligation or recombination binding or by multiple-extension overlap CT-PCR. This additional PCR amplification can be performed using a primer mix adapted to amplify the ligated target sequences. Such a primer mixture may comprise the outer primers of the multiple primer mixture or multiple extension-overlap primer mixture, meaning the primers that anneal to the outermost 5 'end and 3' end of the sense strand of the linked nucleotide sequences. , thereby, allowing the amplification of the complete bound product. An example of primers that can be used as external in the present invention are the primers CK / JL and / or C? / J ?, forming a primer series with the primers JH or CH. This process is generally used to increase the amount of bound product obtained from multiple TI-PCR, followed by ligation or recombination or multiple-extension overlap-RTCP. Alternatively, a primer series which is nested compared to the external primers used in the multiple primary TI-PCR or multiple overlap-extension TI-PCR reaction can be used for further amplification of the ligated nucleotide sequences. In the present invention, such a primer series is called a series of nested primers. The design of nested primers generally observes the same design rules as for the gene-specific primers previously described, except that they prime the 3 'in the warm position of the external primers used in the TI-multiple PCR or TI-overlap PCR -extension multiple. The resultant product of a nested PCR is therefore shorter than the ligated product obtained by multiple TI-PCR, followed by ligation or recombination binding or by multiple TI-PCR of overlap-extension. In addition, to increase the amount of bound product, the nested RCP also serves to increase the overall specificity, especially of multiple overlap-extension IT-PCR technology. However, it should be noted that not all multiple overlap primer / multiple primer mixes that have been described above are suitable for combination with a series of nested primer, when additional amplification is performed. In such cases, the external primers of the multiple overlap-extension primer / multiple primer mix can be used for further amplification or a semi-nested PCR, can be applied as described below. In one embodiment of the present invention, a mixture of primers JL and JH is used as nested primers for further amplification of the sequences encoding the variable region of ligated immunoglobulin.

Series of nested primers of the present invention, may also be comprised of an external (or forward) forward primer (s), of the first multiple overlap-extension primer / multiple primer mixture and a second nested primer which primes at 3 'in the warm position of the forward (or inverse) external primer (s) of the first multiple overlap-extension primer / multiple primer mixture. The use of such a primer series for an additional PCR amplification is generally known as a semi-nested PCR. Semi-nested PCR may, for example, be amplified if it is difficult to design a nested primer in a specific region, for example, for the variable region sequences (primers V and J), because such a primer could have been annealed in the regions that determine complementarity (CDR). In addition, semi-nested PCR may be used, when it is desirable to keep one end of the ligated sequences intact, for example, for cloning purposes. A feature of the present invention maintains the sequence encoding the intact constant light chain during the additional amplification reaction. The primer (s) CL (inverse) used for the additional amplification, they are only slightly modified compared to the external primer (s) used for the primary reaction (the TI-PCR reaction of multiple overlap-extension or multiple TI-PCR). The modification comprises the addition of a few bases to the 3 'end of the CL primer (s) used for the primary amplification. In addition, a different cloning end can be added to the nested CL primer (s). The forward primer (s) used in the additional amplification, are completely nested compared to the external specific primer (s) of the constant heavy chain used in the primary reaction. The combined use of the external primer (s) in the primary reaction and the slightly modified nested CL primer (s), together with the forward primer (s) completely nested in the additional amplification, result in an increase in specificity that is comparable to that achieved with a nested PCR using a fully nested primer set. In a preferred embodiment of the present invention, nested PCR with primer (s) JH and modified primer (s) is performed, wherein between 2 and 10 specific base pairs of the gene have been added to the 3 'end compared to the first primer ( es) CL of the multiple overlap-extension primer mix / multiple primer mix. Multiplex-Extension Multiplex RCP Optimization The parameters of the multiple-overlap-RCP stage of both the one-stage and two-stage procedures can be optimized in several parameters (see for example, Henegariu, 0. et al. , 1997.

BioTechniques 23, 504-511; Markoulatos, P. et al. 2002. J. Clin. Lab.

Anal 16, 47-51). In general, the same optimization parameters apply to TI-multiple PCR, although the relationship between the external and internal primers is less important for such a reaction. to . Primer Concentration The concentration of the primers that carry the overlap-extension end (eg, the VH and VL primers), is preferably lower than the concentration of the external primers with no overlap-extension end (eg, primers). JH and kappa). If one of the target sequences is amplified with a lower efficiency than the others, for example, as a result of a higher GC%, it may be possible to equalize the efficiency of retrofitting. This can be done using a higher concentration of the primer series, which mediates the amplification with low efficiency, or decreasing the concentration of another set of primers.

For ex- ample, sequences that code for heavy chain variable regions tend to have a higher GC% and therefore decrease the efficiency of retrieval than the light chain variable regions. This indicates towards the use of VL primers at a lower concentration than the VH primers. In addition, when a large number of primers is used, the total primer concentration could be an emission. The upper limit is determined experimentally by titration experiments. For the "AmpliTaq Gold" PCR system from Applied Biosystems, the upper limit was found to be 1.1 μM of the total oligonucleotide concentration, for other systems, it can however be as high as 2.4 μM. Such upper limit of concentration of total oligonucleotide, influences the maximum concentration of individual primers. If the individual primer concentration is also low, it is likely to cause poor sensitivity to CPR. The quality of the oligonucleotide primers has also been found to be important for multiple overlap-extension PCR. The oligonucleotides purified by HPLC have produced the best results. b. RCP cyclization conditions: Preferably, the cyclization conditions are as follows: Denaturation: 10-30 s 94 ° Temperate: 30-60 s 50-70 ° C approximately 5 ° C below the Tm of the primers. Extension; 1 min x EPL 65-72 ° C EPL is expected Product length in kb.

Cycle number; 30-80 Final extension; 10 minutes 65-72 ° C.

For the single-stage multiple overlap-extension CT-PCR, the following stages were constructed in the cyclization program prior to the cyclization amplification summarized above: Reverse transcription: 30 min 42-60 ° C These conditions are also used where the reverse transcription is performed separately.

Activation of polymerase: 10-15 min 95 ° C hot start polymerases are favorable in TI-PCR single stage. Activation in accordance with the manufacturer. It is possible to optimize in all these parameters.

Especially, the tempering temperature is important. Thus, all series of individual primers that make up the final primer mixture should be tested separately to identify the optimal tempering temperature and time, as well as denaturing and elongation time. This would give a good idea about the window within which these parameters can be optimized for the multiple overlap-extension primer mix. Problems with poor sensitivity to PCR, for example, due to low primer concentration or template concentration, can be overcome by using a high number of thermal cycles. A high number of thermal circles constitutes between 35 and 80 cycles, preferably around 40 cycles. In addition, extended extension times can improve the multiple extension-overlap CPR process. The long extension times constitute 1.5-4 min x ELP, compared to the normal extension of 1 minute. c. Use of adjuvants Multiple PCR reactions can be slightly improved using a CPR additive, such as DMSO, glycerol formamide or betaine, which relaxes the DNA, thereby making denaturing the template easier. d. dNTP and MgCl2 The quality and concentration of deoxynucleoside triphosphate (dNTP) is important for multiple overlap-extension CPR. The best concentration of dNTP is between 200 and 400 μM of each dNTP (dATP, dCTP, dGTP and dTTP), above which the amplification is rapidly inhibited.

Lower dNTP concentrations (100 μM of each dNTP) are sufficient to achieve PCR amplification. dNTP base are sensitive to defrost / freeze cycles. After three to five such cycles, multiple CPR often does not work well. To avoid such problems, small dNTP aliquots can be made and kept frozen at -20 ° C. The optimization of Mg2 + concentration is critical, since most DNA polymerases are magnesium-dependent enzymes. In addition to the DNA polymerase, the template DNA and dNTP primers bind to Mg2 +. Therefore, the optimal Mg2 + concentration will depend on the concentration of dNTP, template DNA, and sample buffer composition. If primers and / or template DNA buffers contain chelators such as EDTA or EGTA, the apparent optimal Mg2 + can be altered. The excessive Mg2 + concentration stabilizes double-stranded DNA and prevents complete DNA denaturation, which reduces performance. Excessive Mg2 + can also stabilize the spurious tempering of primers to incorrect template sites, thereby decreasing specificity. On the other hand, an inadequate Mg2 + concentration reduces the amount of product. A good balance between dNTP and MgCl2 is approximately 200 to 400 μM dNTP (of each) at 1.5 to 3 mM MgCl2. and. CPR Absorber Concentration Generally, KCl based buffers are sufficient for multiple overlap-extension CPR; however, buffers based on other components such as (NH4) S04, MgSO4, Tris-HCl, or combinations thereof, can also be optimized to function with the Multiple overlap-extension CPR. The primer pairs involved in the amplification of longer products, work well at lower salt concentrations (eg, 20 to 50 mM KCl), while pairs of primers involved in the amplification of short products, work well at higher salt concentrations ( for example, 80 to 100 mM KCl). Raising the buffer concentration to 2X instead of IX can improve the efficiency of the multiple reaction. d. DNA polymerase The present invention is exemplified with Taq polymerase. Alternatively, other types of heat resistant DNA polymerases including, for example, Pfu, Phusion, Pwo, Tgo, Tth, Vent, Deep-vent, may be used. The polymerases are either with 3 'or 50' exonuclease activity, they can be used either alone or in combination with each other. Vectors and Libraries The binding of the nucleotide sequences of interest according to the present invention produces a nucleotide segment comprising the linked nucleotide sequences of interest. In addition, libraries of such linked nucleic acid sequences of interest are produced by the methods of the present invention, in particular, libraries of sequences encoding a variable region. A feature of the present invention is the insertion of a segment containing linked nucleotide sequences of interest, or a library of linked nucleotide sequences of interest, generated by a method of the present invention, into suitable vectors. The libraries can be combinatorial libraries or libraries of cognate pairs of sequences encoding a variable region. The restriction sites generated by the external primers, nested primers or primers are i-nested, are preferably designed to equalize appropriate restriction sites of the vector of choice. The ligated nucleic acid sequences of interest can also be inserted into vectors by recombination, if one of the nested, semi-nested primers or external primers is equipped with a suitable recombination site and the vector of choice contains one as well. Basically, there are no limitations to the vectors that can be used as carriers for the products generated by one of the multiple TI-PCR methods of the present invention. Vectors of choice may be suitable for amplification and expression in cells that include, for example, bacteria cells, yeasts, other fungi, insect cells, plant cells or mammalian cells. Such vectors can be used to facilitate additional cloning steps, shuttle between vector systems, display of the product inserted in the vector, expression of the product inserted and / or integrated into the genome of a host cell. The cloning and shuttle vectors are preferably bacterial vectors. However, the other types of vectors can also be applied in cloning and shuttle procedures. The display vectors can, for example, be phage vectors or phagemid vectors that originate from the class of filamentous bacteriophages fd, M13, or f1. Such vectors are capable of facilitating the display of a protein including, for example, a binding protein or fragment thereof, on the surface of a filamentous bacteriophage. Suitable display vectors for display in ribosomes, DNA, yeast cells or mammalian cells are also known in the art. These comprise, for example, viral vectors or vectors that code for chimeric proteins. The expression vectors exist for all the mentioned species and one to be chosen completely depends on the protein to be expressed. Some expression vectors are additionally capable of integrating into the genome of a host cell, either by random integration, or by site-specific integration, using appropriate recombination sites. Expression vectors can be designed to provide additional coding sequences, which when the bound product is inserted into the structure to these sequences, allows the expression of a larger protein, eg, a full-length monoclonal antibody, when introduced into an appropriate host cell. This insertion in structure can also facilitate the expression of chimeric proteins that facilitate the display on the surface of a filamentous bacteriophage or cell. In a bacteriophage display system, the ligated nucleotide sequences of interest can be inserted in structure into a sequence encoding a coated protein such as pIII or pVIII (Barbas, CF et al., 1991. Proc. Nati. Acad. Sci. USA 88, 7978-7982; Kang, A. S. et al. 1991, Proc. Nati Acad. Sci. USA 88, 4363-4366). In one embodiment of the present invention, the individual segments of linked nucleotide sequences of interest are comprised of a sequence encoding the immunoglobulin heavy chain variable region, associated with a sequence encoding a light chain variable region. Preferably, these ligated sequences are inserted into a vector containing sequences that encode one or more constant immunoglobulin domains. The insert is designed by engineering, such that the sequences encoding the light chain variable region and / or heavy chain variable region linked, are inserted in structure to the sequences encoding the constant region. Such an insertion can, for example, generate a Fab expression vector, a full-length antibody expression vector, or an expression vector encoding a fragment of a full-length antibody. Preferentially, such a vector is an expression vector suitable for selection (e.g., E. coli, phagemid or mammalian vectors), and the sequences encoding the heavy chain of the constant region, are chosen from the human immunoglobulin classes IgG1, IgG2. , IgG3, IgG4, IgM, IgAl, IgA2, IgD, or IgE, thereby, allowing the expression of a full-length recombinant antibody. In addition to the sequences encoding the constant heavy chain, the vector may also contain a sequence encoding a constant light chain chosen from human lambda or kappa chains. This is appropriate when the ligated nucleotide sequences only encode the sequences encoding the immunoglobulin variable region (Fvs).

In another embodiment of the present invention, the individual segments of the ligated nucleotide sequences are comprised of a sequence encoding the TcR a chain variable region, associated with a sequence encoding a β-chain variable region or a sequence encoding a variable chain region?, associated with a sequence encoding a variable region of chain d. Preferably, these ligated sequences are inserted into a vector containing sequences encoding one or more constant TcR domains. The insert is engineered such that the sequences encoding the inserted ligated variable region are in structure to the sequences encoding the corresponding TcR constant region. In a further embodiment, such a vector is a chimeric expression vector comprising sequences encoding a leucine lock in structure at constant regions Tcr. It has been shown that such constructs increase the stability of soluble TcR (Willcox, B. E. et al., 1999. Protein Sci 8, 2418-2433). Libraries of cognated pairs of the present invention can be introduced into vectors by two different methods. In the first procedure, unique cognate pairs are inserted individually into a suitable vector. This vector library can then either be kept separate or be combined. In the second procedure, all cognate pairs are combined prior to insertion of the vector, followed by mass insertion into suitable vectors that generate a combined library of vectors (illustrated in Figure 12). Such a vector library comprises a wide variety of pairs of sequences encoding the variable region. One aspect of the present invention is a library of cognate pairs of sequences encoding a linked variable region. Preferably, the individual cognate pairs in the library comprise a sequence encoding an immunoglobulin light chain variable region, associated with a sequence encoding a heavy chain variable region. Another preferred library of cognate pairs comprises sequences encoding a ligated TcR region, wherein each of the sequences encoding an individual TcR region comprises a sequence encoding a variable region, associated with a sequence encoding a beta chain variable region. and / or a sequence encoding a variable region of gamma chain TcR, associated with a sequence encoding a delta chain variable region. Another embodiment of the present invention is a sub-library of cognate pairs of sequences encoding a linked variable region, which code for desired binding specificities directed against a particular target. Preferably, these cognate pairs comprise sequences encoding the light chain variable region and immunoglobulin-linked heavy chain variable region, sequences encoding a beta chain variable region and a TcR alpha chain variable region and / or sequences encoding a region variable delta chain and variable region of gamma chain TcR. A further embodiment is a sub-library selected from an original library of cognate pairs of sequences encoding a variable region, as described by the invention. A preferred embodiment of the present invention is a library or sub-library that codes for full-length immunoglobulin co-paired pairs, selected from the human immunoglobulin classes IgA, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM. Another feature of the present invention is a library or sub-library that codes for stable and soluble TcR cognate pairs. A feature of the present invention is the diversity of said libraries, which are comprised of at least 5, 10, 20, 50, 100, 1000, 104, 105 or 106 different cognate pairs. In a further embodiment of the present invention, said libraries of cognate pairs of sequences encoding a bound variable region, are obtainable by a method comprising the steps described herein. This library is also called the original library. Classification and Selection The original library of pairs of sequences encoding a ligated variable region isolated from a donor, using one of the methods of the present invention, is expected to represent a variety of binding proteins, some of which will be irrelevant, ie , will not be linked to a desired goal, in particular for combinatorial libraries. Therefore, the present invention encompasses enrichment and selection, for a sub-library that encodes a subset of diversities of binding specificities against a particular target. For libraries of cognate pairs, the diversity of the library is expected, representing the diversity present in the donor material, with only a smaller number of randomly linked variable regions. Thus, an enrichment step may not be necessary prior to selection for target-specific binding affinities in a library composed of cognate pairs. In a further embodiment of the present invention, the method for generating a library of pairs of sequences encoding a linked variable region, further comprises creating a sub-library by selecting a subset of pairs of linked variable region sequences, which encode binding proteins with a desired objective specificity. Such a selection of sequences encoding a ligated variable region is also called a library of specific cognate pairs of the target. In a preferred embodiment of the present invention, it is the library of specific cognate pairs of the target of sequences encoding a variable region, transferred to a mammalian expression vector. Immunological assays are generally suitable for the selection of sequences encoding a target-specific immunoglobulin variable region. Such assays are well known in the art and constitute for example, ELISPOTS, ELISA, membrane assays (eg, Western blot), filter arrays, or FACS. The assays can be either performed in a direct manner, using the polypeptides produced from the sequences encoding the immunoglobulin variable region. Alternatively, immunoassays may be performed in combination with or following enrichment methods such as phage display, ribosome display, bacterial surface display, yeast display, eukaryotic virus display, RNA display or covalent display (reviewed in FitzGerald, K., 2000.

Drug Discov. Today 5, 253-258). As illustrated in Figure 10, both cognate Fab expression libraries and cognate full-length antibody expression libraries can be screened, thereby generating a sub-library of positive clones. Such screening assays and enrichment methods are also suitable for Fv or scFv fragments or combinatorial libraries of bound variable regions. In a preferred embodiment of the present invention, the selection of a sub-library of target-specific cognate pairs or combinatorial pairs of sequences encoding a variable region is performed using a high throughput screening assay. High-throughput screening assays may be, but are not restricted to, ELISA assays performed with semi-automated or fully automated equipment. It may also be a membrane assay in which the bacteria are robotically drilled and ground into an appropriate membrane on the surface of agar plates that generate arrays of colonies expressing antigen-binding molecules. The molecules are secreted through the membrane onto a second membrane coated with a fundamental antigen, which can be developed separately and used to identify clones that secrete antigen binding molecules towards the desired target (de Wildt, RM, et al, 2000 Nat. Biotechnol 18, 989-994).

When a sub-library of cognate pairs or combinatorial pairs of clones that bind to the antigen has been selected by an appropriate technology, it is possible to perform additional analysis by DNA sequencing of the variable region heavy chain and variable region coding sequences. of light chain of bound immunoglobulin. First of all, such DNA sequencing will provide information about the diversity of libraries, such as germline origin, family distribution and maturation within the CDR regions. Such analysis will allow the selection of clones, which represent a wide diversity, and lead to repeated clones. Second, DNA sequencing will reveal mutations introduced during the isolation process. When analyzing sequences that encode a variable region, there are three types of mutations to consider when assessing whether a mutation is acceptable: i) The most frequent type of mutations result from intra-family cross-priming, where primers of the V gene prime to the wrong subseries within a particular V gene family. The changes introduced are mainly codon substitutions that originate naturally in a particular position. Due to the high degree of sequence homology within a V gene family, these changes can usually be considered as conservative and acceptable changes; ii) Fewer frequent mutations are introduced by inter-family cross-priming (eg, a VH3 family primer primes a sequence encoding the VH1 family) and induces more significant structural changes, sometimes without a natural counterpart. Such changes could potentially affect the immunogenicity of the variable region by creating new epitopes. Such changes can be easily identified and subsequently repaired using standard molecular biological techniques, or the clones can be excluded from the library; iii) Errors created by the AMD Taq polymerase are more easily identified in the sequences encoding the constant region and can be easily eliminated. However, Taq-induced mutations, of course, will also be present in the sequences encoding the variable region, where they are indistinguishable from the somatic mutations that originate naturally, which are also the result of random mutations in the sequences that code the variable region. Whereas mutations are non-systematic and only affect particular pairs in different waysIt seems reasonable to disagree with such changes. In addition, sequence analysis can be used to identify the degree of randomization in a cognate pair library, as illustrated in table 20 for group H4 of VH. As described in Example 9, the presence of the mutations described in i) and ii), can be avoided in the expression library, when primers are used that anneal in the leader sequence of the sequences encoding a variable region in place of the primers that tune in the 5 'region of the variable regions. In a further embodiment of the present invention, the specific sub-library of the target and possibly of the sequence, which analyzes pairs of sequences encoding the variable region of heavy chain and light chain variable region, are transferred to an expression vector of mammal. Such transfer can be performed in any of the vectors described in the previous section, allowing the expression of a full-length recombinant antibody. If the selection is made with a mammalian cognate full-length antibody expression library, such transfer may not be necessary. In another embodiment of the present invention, the original library is generated from a fraction of lymphocyte-containing cells, which is enriched for T-lymphocytes. The pairs of sequences encoding a bound variable region, constitute the original library, can be selected by encoding a subset of pairs of ligated variable region sequences, composed of alpha and beta chains and / or delta and gamma, which encode binding proteins with a desired target specificity, generating a sub-library of cognate pairs or combinatorial pairs . Antigen-specific T cell receptors can subsequently be identified from a combination of transfected cells using standard methodology such as staining with tetrameric MHC peptide complexes (eg, Callan, MF et al, 1998. J. Exp. Med. 187, 1395-1402; Novak, E. J. et al. , 1999. J. Clin. Invest 104, R63-R67), by measuring cellular responses in the form of released IL-2 or by more sophisticated means such as retroviral or yeast display techniques. Host Cells and Expression The libraries of the present invention can be transferred to vectors suitable for expression and production of encoded proteins from the ligated nucleic acid sequences of interest, in particular, binding proteins containing variable regions or fragments thereof. . Such vectors are described in the Vectors and Libraries section, and provided for the expression of for example, full-length antibodies, Fab fragments, Fv fragments, scFv, membrane-bound fragments or soluble TcRs or TcRs, of a species of choice.

A feature of the present invention is the introduction into a host cell of a library or sub-library of cognate pair vectors of sequences encoding a linked variable region, or a single clone encoding a cognate pair of sequences encoding a bound variable region, for amplification and / or expression. The host cells can be chosen from bacteria cells, yeasts, other fungi, insect cells, plant cells or mammalian cells. For expression purposes, mammalian cells, such as Chinese hamster ovary (CHO) cells, COS cells, BHK cells, myeloma cells (e.g., Sp2 / 0 cells, NSO), NIH 3T3, human cells immortalized or fibroblasts, such as HeLa cells, HEK 293, or PER.C6 cells, are preferred. The introduction of vectors into host cells can be performed by a number of transformation or transfection methods known to those skilled in the art, including calcium phosphate precipitation, electroporation, microinjection, liposome fusion, fusion of RBC spectra, fusion of protoplasts, viral infection and the like. The production of monoclonal full length antibodies, Fab fragments, Fv fragments and scFv fragments is well known. The production of recombinant polyclonal antibodies to be used for treatment is an almost new area. A recombinant polyclonal manufacturing technology has been described in the PCT application WO 2004/061104. In short, this technology involves the generation of a collection of cells, suitable as a cell line manufacturing. The following description of the technique is made for a library of cognate pairs, however, only as applicable for a combinatorial library. Individual cells in the collection of cells are capable of expressing a different element of the recombinant polyclonal binding protein, for example, from a library of cognate pairs. To ensure that individual cells express a single cognate pair, not several cognate pairs of polyclonal binding protein, the nucleic acid sequences encoding the cognate pairs are introduced at a site-specific site unique in the genome of each individual cell. This is an important feature of the cell collection, since it prevents the randomization of light and heavy chains expressed among themselves, but also because it generates cells that are virtually identical to each other, except for the small differences in the variable regions of the cells. the individual cognates. This test will allow a non-deviated growth of the cell collection over the period of time necessary for production. To ensure specific integration of the single site, a line of host cells without only one integration site should be used, these are commercially available, for example, Invitrogen's Flp-In CHO cells, which contain a unique FRT site. Appropriate vectors for this cell line contain a corresponding FRT site and are introduced into the genome using the Flp recombinase. There are several other known recombinases, for example, Cre, beta-recombinase, Gin, Pin, PinB, PinD, R / RS, lambda integrase, or phage FC31 integrase, which can be used in combination with their corresponding recombination sites. In addition, appropriate vectors contain a selection marker that allows the selection of site-specific members. The generation of a polyclonal manufacturing cell line and the production of a recombinant polyclonal protein from such a cell line can be obtained by several different manufacturing and transfection strategies. One way is to use a library of vectors mixed together in a single composition, for the transfection of a line of host cells with a single integration site per cell. This method is called transfection by volume or transfection by volume. Generally, the vector and host cell design described previously, will ensure that a polyclonal cell line capable of non-deviated growth will be obtained after the appropriate section. A frozen base of the polyclonal cell line will be generated before the initiation of the manufacture of recombinant polyclonal protein. Another way is the use of a library of divided vectors in fractions, containing approximately 5 to 50 individual vectors of the library in a composition for transfection. Preferably, a fraction of the library constitutes 10 to 20 individual vectors. Each composition is then transferred in an aliquot of host cells. This method is called semi-volume transfection. The number of transfected aliquots will depend on the size of the library and the number of individual vectors in each fraction. If the library, for example, constitutes 100 different cognate pairs, which are divided into fractions containing 20 different elements in a composition, 5 aliquots of host cells may need to be transfected with a library composition that constitutes a fraction other than the original library. . The aliquots of the host cells are selected for site-specific integration. Preferably, the different aliquots are selected separately. However, they can also be combined before the selection. The aliquots can be analyzed for their clonal diversity and only those with sufficient diversity will be used to generate a polyclonal cognate pair library base. To obtain the desired polyclonal cell line for manufacturing, the aliquots can be mixed before generating the freezing base, immediately after they have been recovered from the base or after a time of proliferation and short adaptation. Optionally, the aliquots of cells are kept separate through production, and the polyclonal protein composition is similar combining the products of each aliquot, preferably the aliquots of the cell before production. A third form is a high throughput method in which the host cells are transfected separately using the individual vectors that constitute the library of cognate pairs. This method is called individual transfection. The individually transfected host cells are preferably selected by site-specific integration separately. Individual cell clones generated after selection can be analyzed for proliferation time and preferably, those with similar growth rates are used to generate a polyclonal cognate pair library base. Individual cell clones can be mixed to obtain the desired polyclonal cell line, before generating the base, immediately after they have been recovered from the base, or after a short adaptation and proliferation time. This procedure can eliminate any possible residual sequence deviation during transfection, integration and selection. Alternatively, the individually transfected host cells are mixed before the selection is made, this will allow control of sequence deviation due to transfection. A characteristic of the manufacturing strategies outlined above is that all the individual cognate pairs that constitute the recombinant polyclonal protein can be produced in one or a limited number of bioreactors. The only difference is the stage at which they are chosen to generate a collection of cells that constitute the polyclonal manufacturing cell line. One embodiment of the present invention is a population of host cells comprising a cognate library or sub-library of linked pairs of sequences encoding a variable region. In an additional mode, a population of host cells comprises a library obtained from a population of isolated single cells constituting lymphocytes, using amplification by multiple TI-PCR, followed by ligation or recombination or multiple overlap-extension CT-PCR technology. the present invention, to link the cognated pairs. Another embodiment of the present invention is a population of host cells comprising a combinatorial library or sub-library of linked pairs of sequences encoding a variable region. A population of host cells according to the present invention will encompass a diverse population of cells corresponding to the diversity of libraries that the cells have transformed / transfected with them. Preferably, each cell of the cell population constitutes only one cognate pair of the entire library of cognate pairs, and not individual elements of the cognate pair library that exceeds more than 50%, more preferred 25%, or most preferred 10%, of the total number of individual elements expressed from the host cell population. In a preferred embodiment of the present invention, the host cell population is mammalian cells. A population of host cells as described above, can be used for the expression of a recombinant polyclonal binding protein, since individual cells of the population constitute sequences encoding the variable region of different diversity.

One embodiment of the present invention is a recombinant polyclonal protein expressed from a population of host cells comprising a library of vectors encoding various cognate pairs of sequences encoding a linked variable region, wherein said library is obtained by the method of of the present invention. Typically, a recombinant polyclonal protein of the present invention is comprised of at least 3, 5, 10, 20, 50, 100, 1000, 104, 105 or 106 proteins composed of different cognate pairs. A preferred embodiment of the present invention is a recombinant polyclonal immunoglobulin expressed from a host cell population comprising a library of vectors encoding diverse heavy chain variable region pairs and sequences encoding a light chain variable region. Another preferred embodiment of the present invention is a recombinant polyclonal TcR expressed from a population of host cells comprising a library of vectors encoding diverse cognate pairs of a TcR alpha chain variable region linked to sequences encoding a beta chain variable region. and / or sequences encoding a variable region of delta chain linked to a variable region of gamma chain TcR.

Another embodiment of the present invention is a host cell suitable for production of a monoclonal protein. In particular, a monoclonal antibody comprised of a cognate pair of a light chain variable region with a heavy chain variable region or a monoclonal TcR comprised of a cognate pair of an alpha variable region with a beta variable region or a delta variable region with a gamma variable region. Preferably, such a monoclonal production cell line is a hybridoma cell line. Such a monoclonal antibody or TcR can be generated by adding the following steps to the method by linking a plurality of noncontiguous nucleotide sequences of interest a) by inserting said nucleotide sequences ligated into a vector; b) introducing said vector into a host cell; c) cultivating said host cells under conditions suitable for expression; and d) obtaining the expressed protein product of the vector inserted into said host cell. Preferably, the vector introduced into the host cell encodes an individual cognate pair of sequences encoding a variable region. Applications of the Invention One of the main applications of the present invention is the binding of cognate pairs of sequences encoding a variable region, especially sequences encoding an immunoglobulin light and heavy chain variable region or sequences encoding a variable chain region alpha and beta or gamma and delta TcR, by a high performance method, for the generation of libraries of cognate pairs. In addition to the generation of libraries of cognate pairs, the multiple TI-PCR, followed by ligation or recombination link or the multiple overlap-extension CT-PCR techniques of the present invention, can be used in the generation of combinatorial libraries performing the technique in a population of genetically diverse cells, cell lysates from such a population of cells, or an RNA purified from such a population of cells. Libraries, sub-libraries, or unique clones from one of these libraries, facilitate the expression of polyclonal or monoclonal proteins. Especially, monoclonal or polyclonal antibodies can be obtained from the libraries of the present invention. The use of recombinant monoclonal antibodies in diagnosis, treatment and prophylaxis is well known. The recombinant monoclonal and polyclonal antibodies generated by the present invention will have the same applications as antibody products generated by existing technologies. In particular, a pharmaceutical composition comprising a polyclonal recombinant immunoglobulin as an active ingredient, combined with at least one pharmaceutically acceptable excipient, can be produced by means of the present invention. More preferred are pharmaceutical compositions wherein the polyclonal recombinant immunoglobulin is comprised of cognate pairs of sequences encoding a variable region. Such pharmaceutical compositions of polyclonal recombinant immunoglobulins can be used as medicaments. The polyclonal recombinant immunoglobulin of the composition can be specific for or reactive against a predetermined disease target and the composition can thus be used for the treatment, alleviation or prevention of diseases such as cancer, infectious diseases, inflammatory diseases, allergy, asthma and other respiratory diseases, autoimmune diseases, immune dysfunction, cardiovascular diseases, diseases in the central nervous system, metabolic and endocrine diseases, rejection of transplant or unwanted pregnancy, in a mammal such as a human, a pet or a pet . The present invention has a further application which can not be obtained with conventional monoclonal combinatorial antibody techniques. In situations where the protective antigens are either poorly characterized or completely unknown, such as in the emergence of infectious diseases, it is impossible to select a polyclonal antibody that will provide protection against the disease. However, with the present invention, it will be possible to obtain cells expressing antibody directly from donors with established protective antibody response, for example, convalescent patients, and use the starting material of individual states, to generate a library of cognate pairs of sequences that encode a variable region of light and heavy immunoglobulin chain. In situations where, for example, the virus is known but the protective antigens are unknown, it will be possible to generate a sub-library of cognate antibody gene pairs, with broad reactivity towards antigenic structures in the virus. If a recombinant polyclonal antibody is produced from such a sub-library, it will likely contain protective antibodies. In situations where the antigens are completely unknown, a recombinant polyclonal antibody generated from a cognate pair library of, for example, convalescent patients, can be used in the same way as hyperimmune immunoglobulins are used today. The reason for this is that cognate pairing which ensures that the recombinant polyclonal antibody produced closely resembles the antibody immune response of the convalescent patient.

Another application of the techniques for linking cognate pairs of variable regions, described in the present invention, is for diagnostic and analytical purposes. When a medication is administered to a patient, there is always the possibility of an immune response directed toward the medication. Immunogenicity can be assessed by conventional techniques, such as drug-specific binding assays with serum or plasma derived from drug treated individuals. Alternatively, the methods of the present invention can be used to reflect immune responses of patients soon after administration of the drug, isolating cognate pairs from sequences encoding a light chain and variable heavy chain. Antibodies expressed from such a library can then be selected for reactivity to the drug or drug components. This method is particularly useful if the presence of the drug in the plasma or serum could interfere with the conventional method. Such drugs are for example, antibodies. With conventional methods, the identification of an anti-drug immune response (e.g., an anti-idiotopic, anti-structure or anti-Fc immune response), relative to treatment with an antibody, can not be performed until the antibody used for the treatment has been completely separated from the blood. With the present invention, sequences encoding such anti-drug antibodies can be isolated and analyzed from individuals treated with the drug within a couple of weeks. In this way, it may be an alternative method for assessing whether the drugs in general and, in particular, drugs based on antibodies, are immunogenic. An additional application of the present invention is the validation and comparison of vaccines and immunization programs. This is particularly useful during the development of the vaccine, since it will be possible to assess and compare the diversity of antibody response sequences generated in response to new candidate vaccines, in addition to current comparisons of antibody binding affinities and serum titrators. In addition, the present invention can be used to analyze, monitor and compare antibody responses in monitoring the efficacy of vaccines in populations. The present invention also finds applications outside the field of binding proteins that contain a variable region. It is merely an optimization matter for one skilled in the art, to adapt the technique described in the present invention, to link two or more transcribed nucleotide sequences encoding a heteromeric protein other than a binding protein. Such binding of sequences that code for domains or subunits of a heteromeric protein, may be an advantage in the isolation of these protein-coding sequences, since it could reduce the number of steps considerably. In addition, it is possible to isolate for example, splice variants, mutations or new family elements of such proteins, using only a multiple overlap-extension primer / multiple primer mixture. The binding of sequences which encode distant domains of a single protein is also a possibility. Such a technique may facilitate the search in relation to the importance of certain domains in a multiple domain protein, since it could facilitate the suppression of intermediate domains. The generation of coupled or dimeric proteins is also an area where the present invention can be applied. Even if the proteins to be ligated are of different origin, for example, a chimera between a human and a mouse protein, the present invention can be used by mixing cells prior to reverse transcription. Such a cellular mixture can constitute either a population of cells from each of the species of a single cell of each of the species.

EXAMPLES Example 1: TI-PCR of Two-Stage Multiple-Extension-Translaps In this example, reverse transcription (TI) was performed using a template derived from a single isolated cell and the produced cDNA was used as a template for more than one overlapping PCR. -extension multiple. to. Cells A Chinese hamster ovary (CHO) cell line expressing IgGl-kappa was generated using the Flp-In technology (Invitrogen, Carlsbad, CA, USA). A pLL113 plasmid vector expressing mammalian IgG-kappa (Figure 4) was constructed based on the Flp-In expression vector, pcDNA / FRT. CHO-Flp-In cells were co-transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), in accordance with the manufacturer's instructions, with pLL113 containing the genes encoding the antibody and pOG44 conferring temporal expression of the Flp recombinase. Transformants were selected and verified for IgG-kappa production by immunoassays. The selected cell line was named pLL113 of CHO Flp-In, and was maintained in F12 Ham medium, supplemented with 2 mM L-glutamine, 10% FCS and Hygromycin B 900 (maintenance medium). PLL113 cells were harvested from CHO Flp-In using trypsin and washed 3x in maintenance medium. After the final wash, the cells were resuspended in the original volume of the maintenance medium. The cell concentration was determined using a Casy-1 system (Schárfe System GmbH, Reutlingen, Germany) and diluted in maintenance medium at a concentration of 1 cell / 5 μl. b. Reverse transcription CHO pLL113 cell suspension Flp-In, on average containing one cell, was delivered in single cells from a 96-well PCR plate (Thermo-Fast 96, skirted AB-0800, ABgene, Epsom, Surrey, UK) . The cDNA was synthesized from the cells distributed using the reverse transcriptase (TI) step in the one-step TI-PCR protocol Qiagen (Qiagen one-step TI-PCR Kit, Cat # 210210, Hilden, Germany). Each of the cavities contains the following reagents in a total volume of 20 μl: 1 x one-step TI-PCR buffer, dNTP at a final concentration of 1 mM each, 5 pmol of Oligo poly-dT (18) , 26 U of RNase inhibitor (RNasin, Promega, Madison USA, cat No. N2111), 2 μl of one-step TI-PCR enzyme mixture, and 5 μl of CHO pLL13 cell suspension Flp-In.

The TI reaction was performed by incubating the reaction mixtures at 55 ° C for 30 minutes. Subsequently, the reverse transcriptase was inactivated by incubating the reaction mixture at 94 ° C for 10 minutes. c. Multiplex-Overlapping RCP A fraction of the cDNA products generated in step b) was used as a template for multiple overlap-extension CPR. The reactions were carried out in 96-well plates. Each well contains, in a total volume of 40 μl, the following reagents: 1 x One-step TI-PCR buffer, dNTP at a final concentration of 500 μM each, Mixing of multiple overlap-extension primer at concentrations as indicated in Table I, 26 U of RNase inhibitor (RNasin, Promega, Madison USA, cat No. N2111), 2 μl of one-step TI-PCR enzyme mixture, and 1 μl of cDNA template (derived from a single cell (stage b)). The multiple overlap-extension primer mixture used, comprises the primers shown in Table 1.

Table 1 W = AT, S = G / C, R = A G. Capitalized sequences that correspond to the specific region of the gene.

The reactions were carried out with a HT Primus MWG 96-well thermocycler (MWG Biotech AG, Ebersberg, Germany), with the following cyclization conditions: Denaturation 30 seconds 95 ° C Tempered 30 seconds 50 ° C 50 cycles Prolonged 5 minutes 72 ° C Final extension 10 minutes 72 ° C d. Nested CPR Nested CPR was performed using multiple extension-overlap products as a template. The reactions were carried out in 96-well plates. Each cavity contains, in a total volume of 50 μl, the following reagents: 1 x of BioTaq Buffer, dNTP in a final concentration of 400 μl each, 2 mM MgCl2, nested PCR primer mixture, 1.25 U of BIOTAQ DNA Polymerase (Cat. No. BIO-21040, Bioline, ÜK) and 1 μl of multiple overlap-extension PCR product (step c). The primers used are shown in table 2.

Table 2 Capitalized sequences that correspond to the specific region.

The reactions were carried out with 96-cavity Primus HT MWG thermal cycler (MWG Biotech AG, Ebersberg, Germany) with the following cyclization conditions: Denatured 30 s 95 ° C Tempered 30 s 50 ° C 25 cycles Prolonged 90 s 72 ° C Final extension 10 min 72 ° C Nested products were analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 5). The expected size of the overlap-extension product was 1076 bp. Such product can be observed on lines 1, 5, 6,7, 8 and 12 indicated by arrows (Figure 5A). In the experiment shown, the negative control is contaminated and similar contamination is also present in the samples. Figure 5B illustrates the fragments of Figure 5A, which are relevant in the present experiment. The present experiment illustrates a way to perform the two-stage multiple overlap-extension PCR, using templates derived from a single cell. In addition, it is shown that it is possible to perform approximately twenty multiple splice-extension PCR using cDNA generated from a single isolated cell.

Example 2: Single Stage Multiple Overlapping-TI-PCR In this example, reverse transcription and multiple overlap-extension PCR was performed in a single step using lysed cell templates, in concentrations corresponding to 100, 10 or 1 cell. to. Cells The human hybridoma cell line HB-8501 which produces an anti-tetanus IgGl-kappa antibody was purchased from the American Type Culture Collection and cultured in Iscove Modified Dulbecco's medium (Vitacell, Viev, Ukraine, Cat. No. 30-2005 ) containing 10% fetal bovine serum. Before performing multiple overlap-extension CT-PCR, the cells were collected, counted and frozen at -80 ° C in a culture medium at a concentration of 200 cells / μl. b. TI-RCP Single-Stage Multiplex-Extension The Qiagen one-step TI-PCR kit (Qiagen cat. No. 210212, Hilden, Germany) was used for the TI-multiple extension-extension PCR essentially in accordance with manufacturer's recommendations. Prior to addition to the PCR tubes, the cell lysates were thawed and diluted in H20 to produce a lysate concentration corresponding to 100, 10 and 1 cell per 5 μl. Each PCR tube contains the following reagents in a total volume of 50 μl: 1 x TI-PCR single-step buffer, dNTP at a final concentration of 400 μl each, multiple overlap-extension primer mix at the indicated concentrations in Table 3, 2 μl of the one-step TI-PCR enzyme mixture, 50 U of RNase inhibitor (RNasin, Promega, Madison USA, cat No. N2515), and 5 μl of diluted cell lysate The primer mixture of multiple overlap-extension used comprises the primers shown in Table 3.

Table 3 W = A / T, S = G / C, R = A / G. Capitalized sequences that correspond to the specific region of the gene.

The reactions were carried out using the following cyclization conditions: Reverse transcription: 30 minutes 55 ° C Polymerase activation: 15 minutes 95 ° C inactivated reverse transcriptase and Taq polymerase activated.

PCR reaction: Denatured 30 s 94 ° C Tempered 30 s 44 ° C Prolonged 3 min 72 ° C Final extension 10 min 72 ° C Ten microliters of the reaction products were analyzed by 15% agarose gel electrophoresis using bromide of ethidium for detection (Figure 6A). The expected size of the fragments (the exact size depends on the length of the variable regions): VH: 410 bp Lc: 680 bp overlap-extension fragment: 1070 bp. The discrete DNA fragments with mobilities that correspond to the lengths of the heavy chain variable region (VH) and the light chain variable and constant region (LC), are observed for all dilutions of cell lysate. A less intense fragment with mobility corresponding to the putative overlap-extension fragment is observed in lysates of 100 and 10 cells. The overlapping-extension fragment of a cell lysate sample is difficult to recognize, although it can be observed in the original gel (see arrow in the photograph shown in the Figure 6A and a sketch shown in Figure 6B). c. Identification of the Overlap-extension Fragment The presence of the overlap-extension band was verified from an experiment produced as described above. Regions were cleaved on the agarose gel of approximately 1070 bp of a line corresponding to 1 cell and of a line corresponding to 100 cells and the DNA was purified using Qiaex II (Qiagen cat. 20051, Hilden, Germany) and eluted in 20 μl of water. One microliter of the eluate was subjected to CPR (Biotaq Kit, Bioline, UK cat. No. BIO-21040) in accordance with the manufacturer's instructions with primers flanking the putative overlap-extension fragment (primers JH corresponding to SEQ ID NO: 32 to 35 and primer CLk corresponding to SEQ ID NO: 17, each primer at a concentration of 0.5 μM). The parameters of cyclization are: Denatured 30 s 95 ° C Tempered 30 s 55 ° C 30 cycles Prolonged 1 min 72 ° C Ten microliters of each reaction product was analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection. Several fragments can be observed including both 1 and 100 cells, a fragment with mobility of the expected overlap-extension fragment (the arrow in Figure 6C). The 1 kb fragment of the gel line corresponding to a cell was cut out of the gel and purified using Qiaex II as described above. The purified fragment was digested with the restriction enzymes Nhel and Ncol (separately) and the reaction products were analyzed by 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 6D). These restriction sites are present in the overlap between VH and LC, and the expected sizes after digestion are approximately 410 and 680 bp in length, respectively (Figure 2). The Nhel digestion is partial since a long fraction is still present in the original size.

Example 3. Nested RCP and Combined Single-Stage Multiple Overlap-RCP TI-PCR In this example, the multiple-overlap and reverse transcription PCR reactions were performed in a single step by a semi-nested PCR amplification, using used cell templates, in concentrations corresponding to 100, 10 or 1 cell. to. Single-stage multiple-overlap-overlapping TI-PCR Multiple-overlapping-TI-PCR was performed using HB-8501 cell lysate as described in Example 2, using a multiple overlap-extension primer mixture comprising the primers shown in table 4.

Table 4 W = A / T, S = G / C, R = A / G. Capitalized sequences that correspond to the specific region of the gene.

However, it should be noted that for each multiple overlap-extension primer mix only one of the CH? -5 primers was used, resulting in five different multiple overlap-extension primer mixtures. The remaining parameters are as described for the multiple overlap-extension TI-PCR reaction in Example 2, only with a change in the tempering temperature to 50 ° C. A reaction was performed for each heavy chain constant region reverse primer (CH ?, CH, CH3, CH4, CH5 corresponding to SEQ ID NO: 49 to 53, respectively) using lysates corresponding to 100, 10, 1 and 0 cells b. Semi-nested PCR One microliter of the multiple extension-overlap TI-PCR reaction product underwent semi-nested PCR (Biotaq kit, Bioline, UK cat No. BIO-21040), essentially as proposed by the manufacturer. The total volume of the reactions was 50 μl. The primers used are shown in Table 5.

Table 5 Capitalized sequences that correspond to the specific region of the gene.

The conditions of cyclization are as follows: Denaturated 30 s 95 ° C Temperate 30 s 50 ° C and 25 cycles Prolonged 1. 5 min 72 ° C Final extension 5 min 72 ° C Ten microliters of each reaction was analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (Figure 7). The putative overlap-extension fragment of the PCR corresponding to the lysate of a cell and wherein the CH primer was used in the first reaction (see arrow in Figure 7), was excised from the agarose gel, purified using a Qiaex kit II (Qiagen cat. No. 20051, Hilden, Germany) and inserted into pCR2.1-TOPO using an Invitrogen TOPO TA cloning kit (Invitrogen cat. No. 45-0641, Carlsbad, CA, USA). Inserts of eight clones were sequenced and seven of these appeared to consist of a variable region of heavy chain linked to a constant and variable region of light chain, by the region of expected overlap. In summary, the combined multiple-fold overlap-RT-PCR reaction sensitivity and the semi-nested PCR reaction was very satisfactory, with 4 of 5 primers of the constant region capable of amplifying significant amounts of lysate-overlap-extension products. which corresponds to a single cell.

Example 4. Nested CPR and Combined Single Step Multiplex-Overlap CT-RCP Using Enriched Human B-lymphocytes as Template Source In this example, the multiple-overlap and reverse transcription PCR reactions were performed in a single step followed by a PCR of semi-nested amplification, using unique human B lymphocytes, isolated as templates sources. to. B cell isolation A human male donor was immunized with tetanus toxoid. A blood sample of 120 ml of the donor was collected 6 days after the immunization and peripheral blood mononuclear cells (PBMC) were isolated using Lymphoprep (Axis-Shield, Oslo Norway, product No. 1001976) according to the instructions of the maker. The population of positive CD-19 cells was enriched using cell sorting by magnetic strips. The PBMC were stained with anti-CD19 antibody conjugated to FITC (Becton Dickinson, NJ, USA, cat No. 345776). Magnetic perlillas cells were sorted using magnetic micropellets conjugated to anti-FITC and the column purification was carried out in accordance with the manufacturer's instructions (Miltenyi Biotec, Gladbach, Germany, cat No. 130-042-401). The cells were diluted to a concentration of 200 cells per ml in PBS containing 2 nM EDTA and 0.5% BSA. Five microliters of diluted cells were distributed to PCR tubes obtaining approximately one single cell per tube. The tubes were stored at -80 ° C until use. b. Semi-nested RCP and TI-RCP of multiple overlap-extension The conditions for semi-nested PCR and TI-RCP of multiple overlap-extension are as described in Example 3. However, the reactions are only carried out with the mixture of multiple overlap-extension primer constituted by the CH3 primer corresponding to SEQ ID NO: 51. Sixteen samples of the semi-nested RCP and combined multiple extension-extension PCR-TI reactions were analyzed by subjecting 10 μl of each PCR reaction to semi -anidated by 1% agarose gel electrophoresis using ethidium bromide for detection (Figure 8). As can be seen in Figure 8, 2 of 16 lines (lines 5 and 6) combine fragments of the expected mobility (around 1 kb). In addition, line 2 contains a less intense fragment to the expected mobility. The 1 kb fragments of line 5 and 6 were excised from the agarose gel, purified using a Qiaex II kit (Qiagen cat. No. 20051) and inserted into pCR2.1-TOPO using the Invitrogen TOPO TA cloning kit ( Invitrogen cat. No. 45-0641, Carlsbad, CA, USA). Two clones of each isolated fragment have inserts of the correct size. The digestion of the restriction enzyme (Ncol and Nhel, separately) showed fragments of the expected sizes (410 and 680 bp) that indicate a correct link between the heavy chain variable region and the light chain variable and constant region encoding the sequences . The two clones originated from the fragment in the line were sequenced and did not show to be identical, which indicates that the bound VH and Lc were cognate pairs.

Example 5: Nested CPR and Single-step Combined Multiplex Overlap-Repeat TI-PCR Using Specific Vx Primers In this example, the multiple extension-overlap and reverse transcription PCR reactions were performed in a single step using V primers? specific, followed by a semi-nested PCR reaction. Total purified RNA was used from two different cell lines expressing lambda Ib and le gene families in combination with the same heavy chain variable region as a template. to. Cells Two Chinese hamster ovary (CHO) cell lines expressing IgGl-lambda were generated, using the Flp-In technology (Invitrogen, Carlsbad, CA, USA). Vectors pEm465 / 01P581 and pEm465 / 01P582 expressing mammalian IgGl-lambda were constructed (Figure 9A), which represents two families of the lambda gene, based on the Flp-In expression vector, pcDNA5 / FRT. CHO-Flp-In cells were co-transfected, using Fugen 6 (Roche, Mannheim, Germany) in accordance with the manufacturer's instructions, with the aforementioned plasmids containing the genes encoding antibodies and pOG44 which confers temporal expression of the Flp recombinase. The transformants were selected by inserts. The selected cell lines were named CHO Flp-In / Em464 / 01P581 and CHO Flp-In / Em464 / 01P582, and were maintained in Ham F-12 medium, supplemented with 2 mM L-glutamine, 10% FCS and 900 μg / ml Hygromycin B (maintenance medium). Cell lines were collected using trypsin and washed 3x in maintenance medium. Approximately 107 cells were used for total RNA purification using Core Spin kit (Macherey-Nagel, Duren, Germany) in accordance with the manufacturer's description. The final RNA concentrations were determined by OD2S0 measurements. b. Ti-Rcp Single-Step Multiplex-Extension Multiple-overlap-extension CT-PCR was essentially performed using 50 pg, or 0.5 pg of total RNA as a template, as described in Example 3, using a primer-PCR mixture. multiple overlap-extension comprising the primers shown in Table 6 and the cyclization conditions specified below. Reverse transcription: 30 min 55 ° C Polymerase activation: 15 min 95 ° C inactivation reverse transcriptase and activation Taq polymerase.

PCR reaction: Denatured 30 s 95 ° C Tempered 30 s 50 ° C > 35 cycles Prolonged 5 min 72 ° C Final extension 10 min 72 ° C Table 6 Y = C / T, W = A / T, S = G / C, R = A / G. Capitalized sequences that correspond to the specific region of the gene e. Semi-nested PCR ün microliter of the multiple extension overlap TI-PCR reaction product was subjected to semi-nested PCR (BioTaq kit, Bioline, UK, cat No. BIO21040), essentially as proposed by the manufacturer. The total volumes of the reactions are 20 μl. The primers used are shown in table 7.

Table 7 Capitalized sequences that correspond to the specific region of the gene.

The conditions of cyclization are as follows: Denaturalized 30 s 95 ° C Tempered 30 s 50 ° C 25 cycles Prolonged 1. 5 min 72 ° C Final extension 5 min 72 ° C Ten microliters of the nested products were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for detection (Figures 9B and 9C). The arrows indicate overlap-extension products with the expected migration properties of approximately 1 kb. The present experiment illustrates that the mixture of the lambda multiple extension-overlap primer shown in Table 6 is applicable in independent single-stage multiple overlap-extension CT-PCR in the template used. In addition, specific overlap-extension PCR products were produced at 0.5 pg of total RNA. This sensitivity suggests that the heavy chain variable region of cognate linkage and the light chain variable region encoding sequences can be amplified from a single cell. Example 6. Generation of a Sub-library of Cognate-Specific Pairs of Tetanus Sequences Encoding Antibodies In the present example the steps summarized in the flow scheme illustrated in Figure 10, are exemplified using Tetanus Toxoid (TT) as a target antigen. to. Donors Donors, who have previously been immunized with the Tetanus vaccine, were reinforced with the Tetanus vaccine (Statens Serum Institut, Denmark). Six days after booster of the Tetanus vaccine, a blood sample of approximately 200 ml of the donor was drawn into a tube containing anticoagulant. Donors are usually required to be healthy from chronic or non-silent infections. They should not suffer from autoimmune diseases or receive any immunosuppressive medication and should not have any vaccination within at least 3 months. Also, at the time of reinforcement of the TT vaccine, donors should not have any serious infection within at least one month. b. Preparation of Peripheral Blood Mononuclear Cells (PBMC) PBMCs were isolated from blood samples using Lymphoprep (Axis-Shield PoC AS, Norway, prod. No. 1001967) in accordance with the manufacturer's recommendations. Briefly, blood was diluted 1: 1 in PBS and this suspension was layered on Lymphoprep in a 2: 1 ratio. Vials were centrifuged for 20 minutes, 25 ° C at 800 g and the white internal phase band was collected. The cells were washed in PBS containing 2 mM EDTA. c. Enrichment of B Cells The B cell lineage (CD19 + cells) of PBMC is enriched by selection of cells by magnetic strips using the following procedure. The isolated PBMC were stained with anti-CD19-FITC (Becton Dickenson, NJ, USA, cat No. 345776). All stages were performed at 4 ° C in the dark. Dyeing was performed with 10 μl of lxlO6 anti-CD19-FITC cells in a volume of 100 μl per lxlO6 cells using M buffer (PBS, pH 7.2, 0.5% BSA, 2 mM EDTA). This will stain the B cell lineage of PBMCs. The cells were incubated for 20 minutes followed by two washing steps with M. buffer. Cells stained with anti-CD19-FITC were magnetically labeled with micro-wings conjugated with anti-FICT, using 10 μl of anti-FITC magnetic beads (Miltenyi Biotec, Gladbach, Germany, cat. No. 130-042-401) by lxlO6 cells in a volume of 100 μl of M buffer per lxl0e cells. Incubation was performed for 15 minutes followed by a washing step with M. buffer. The cells were again suspended in degassed M buffer. A MACS LS column (Miltenyi Biotec, Gladbach, Germany, cat.No. 130-042-401) was pre-treated with degassed M buffer in accordance with the manufacturer's instructions. The suspension of cells stained with anti-CD19-FITC and labeled with magnetic anti-FITC beads was applied to the column and allowed to run through it. Labeled and stained cells (CD19 +) will be retained in the magnetic fields surrounding the column while unstained cells (CD19-) will pass through the column. The column was washed with degassed M buffer. The magnetic field was removed and the CD19 + cells were collected. d. Selection of Plasma Cells The eluate of the MACS column was centrifuged and resuspended in FACS buffer (PBS, pH 7.2, 2% BSA) in a concentration of lxlO6 cells / 60 μl of FACS buffer. Anti-CD19-FITC (Becton Dickenson, NJ, USA, cat No. 345776) (10 μl / 106 cells), anti-CD38-PE (Becton Dickenson, NJ, USA, cat No. 555460) (10 μl / 106 cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA, cat No. 345809) (20 μl / 106 cells). Incubation was carried out at 4 ° C for 20 minutes in the dark, followed by washing twice and again suspended in FACS buffer. The cells were classified by fluorescent activated cell sorting (FACS) using the following selected parameters: 1. Front dispersion and lateral dispersion to retain lymphocytes and monocytes including plasma cells and plasma blasters to avoid cell death and cells with very high side scatter , in which they can be added or granulocytes. 2. Cells that are CD19 are positive and express increased levels of CD38 (CD38h:? "). This is basically only one entry in CD38 since PBCMs have been enriched in a MACS column by expression of CD19, but this will describe some of contaminants 3. CD45 positive cells All lymphocytes express CD45 However, plasma cells down-regulate their CD45 expression compared to early lymphocyte differentiation stages Therefore, a discrete population of cells that corresponds to plasma cells can be obtained when it enters CD45. The FACS-associated cl cells were colleccted as single cells directly into single cavities of 96-well plates containing 5 μl of PBS buffer, supplemented with 5 U of the inhibitor. RNase (RNasin, Promega, Madi are USA, cat. No. N2515) per cavity At this point the cells can be frozen by TI-PCR after or cells can proceed immediately to TI -RCP. e. Linkage of Paired Cognitive Sequences that Encode the Variable Region of Immunoglobulin The TI-PCR technique of multiple overlap-extension is applied to single cells, thereby achieving the cognate binding of sequences encoding the variable region of light chain and region heavy chain variable of the anti-Texan Toxoid transcript. e-1. TI-RCP Single-Stage Multiplex-Extension The Qiagen single-stage PCR-kit (Qiagen cat. No. 210212, Hilden, Germany) was used for multiple-extension overlap-RTCP essentially in accordance with the manufacturer's recommendation. Plates of 96 frozen cavities containing a cavity per single cell were removed from the freezer and when the cavities are free of glass crystals, 15 μl of the TI-PCR reaction mixture is immediately added to each sample (single cell). The TI-PCR reaction mixture contains, in a total volume of 20 μl, the following reagents: 1 x TI-PCR single-step buffer, dNTP at a final concentration of 400 μl each, Multiple overlap-extension mixture in concentrations as indicated in Table 8, 0.8 μl of the one-step TI-PCR mixture, and 20 U of RNase inhibitor (RNasin, Promega, Madison USA, cat No. N2515). The composition of the overlap-extension primer mixture is shown in Table 8.

Table 8 W = A / T, S = G / C, R = A / G. Capitalized sequences that correspond to the specific region of the gene.

The cyclization conditions are as follows: Reverse transcription: 30 min 55 ° C Polymerase activation: 15 min 95 ° C inactivated reverse transcriptase and Taq polymerase activated, PCR reaction Denatured 30 s 94 Temperate 30 s 52 35 cycles Prolonged 5 min 72 Extension final 10 min 72 ° C e-2. Additional Amplification A microtitrator of the multiple extension-overlap TI-PCR reaction product from each sample was subjected to semi-nested PCR (BioTaq kit, Bioline, UK, cat. No. BIO-21040), essentially as proposed by the manufacturer using 96-well plates. The total volume of each reaction is 50 μl, which contains a final concentration of Ix of BioTaq buffer, 200 μM of dNTP (of each), 2 mM of MgCl2, 1.25 U of Taq polymerase and the primers shown in Table 9. The cyclization conditions are as follows: Denaturated 30 s 95 ° C Tempered 30 s 55 ° C 30 cycles Prolonged 1.5 min 72 ° C Final extension 5 min 72 ° C Table 9 Capitalized sequences that correspond to the specific region of the gene.

Ten microliters of a limited series of samples were analyzed by 1.5% agarose gel electrophoresis using ethidium bromide for visualization, to verify that the multiple-overlap-extension CT-PCR has been successful. The expected size of the fragments (the exact size depends on the lengths of the variable regions): VH: ~ 410 bp LC: -680 bp Overlap-extension fragment: ~ 1070 bp Two microliters of all samples, run on plates of 96 cavities, originating from the same donor, were combined in a single tube. The pooled samples were digested with Xhol and Notl. The digested overlap-extension fragments were purified by preparative 1% agarose gel electrophoresis; the overlap-extension fragments were excised from the agarose gel and purified using a Qiaex II kit (Qiagen cat. No. 20051, Hilden, Germany). It is not necessary to group the cognates of this stage if this is not desired. In such case, each individual reaction will be subjected to restriction cleavage and the products are cloned individually in the vector described below. F. Fab Cognada Expression Library A Fab vector library generated by inserting the combination of Xhol / Notl digested overlap-extension fragments into the JSK301 vector of E. coli (Figure 11) by ligation of E. coli (TOPO10), is transformed by electroporation with the Fab vector library and the transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Colony plasmid DNA was prepared directly from agar plates. The plasmid preparation was derived from a minimum number of colonies per donor, corresponding to 3x of the total number of uniquely selected plasma cells, to maintain diversity. A Fab expression library was generated by inserting a prokaryotic promoter and leader cassette derived from phh3 (Den, W. et al., 1999 J. Immunol Methods 22, 45-57) in the preparation of the resulting plasmid by digesting the preparation of the plasmid with AscI and Nhel and subsequent ligation. The library generation process is delineated in Figure 12. E. coli (TG1) was transformed by electroporation with the resulting Fab expression library and the transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. The individual donors were kept separate during the procedure described in Den et al., J Immunol Methods, 1999, January 1; 222 (1-2): 45-57. They can, however, be combined at any stage where this can be desired. g. Clone Selection Clones expressing Fab were selected for antigen binding to TT by antigen-specific ELIS assays. g-1 Fab Expression and Master Plate Generation Individually selected colonies of TG1 cells, each harboring a cognate Fab expression vector from the library generated in step (f) were collected in unique cavities of 96-well plates containing 2x YT / 100 μg / mL Amp / 1% glucose. The colonies were grown overnight at 37 ° C with gentle agitation. These plates are referred to as master plates, which are stored at -80 ° C after the addition of glycerol to a final concentration of 15%. Before the master plates were stored, they were used for inoculation of one or more plates of 384 cavities containing 2 x YT / 100 μg / mL Amp 0.1% glucose using a 96-tooth replicator. The plates were sealed and shaken for 2-3 hours at 37 ° C. Fab expression was induced by adding an equal volume of 2 x YT / 100 μg / mL Amp / 0.2 mM IPTG, obtaining a final IPTG concentration of 0.1 mM. The plates were sealed and shaken overnight at 30 ° C. The next day, the supernatants containing Fab were analyzed for specificity of binding to the TT antigen by ELISA. g-2 ELISA Analysis ELISA plates of three hundred and eighty four (384) cavities (Nunc, Roskilde, Denmark, cat. No. 265196) were coated overnight at 4 ° C with tetanus toxoid (TT) antigen, diluted to a final concentration of 1 μg / mL in PBS in a volume of 25 μL per well. The excess binding sites of the cavities are blocked for 1 hour at room temperature by adding 2% M-PBS-T (2% skimmed milk powder in PBS, 0.05% Tween 20). The cavities were washed 2 times with PBS-T (PBS, 0.05% Tween 20). The bacterial supernatants containing Fab of g-1, are diluted 1: 2 in 2% M-PBS-T, and transferred to the ELISA cavities in duplicate. Incubation was performed for 1 hour at room temperature. The wells were washed 4 times with PBS-T. The 1: 10,000 dilution in 2% M-PBS-T was added to the goat anti-human Fab / HRM cavities (Sigma, St. Louis, MO, USA, Cat. No. A0293). Incubation was performed for 1 hour at room temperature. The wells were washed 4 times with PBS-T. The TMB Plus substrate (KemEnTec, Copenhagen, Denmark, cat No. 4390L) was added and the incubation was performed for 5 - 15 minutes. The reaction was stopped by adding an equal volume of IM of H2SO4. The magnitudes of the reactions were read at 450 nm in an ELISA reader (Multiscan Ascent, Labsystems, Franklin, USA). The original bacterial clones corresponding to TT antigen binding clones are subsequently recovered from the original master plates. The plasmid DNA of the Fab positive clones of the isolated antigen was prepared, generating a cognate Fab expression sub-library of clones that bind to the TT antigen. The clones can also be analyzed by an anti-light chain ELISA assay, to achieve correlation between the number of clones that bind to the antigen and the number of clones expressing Fab. In addition, such analysis provides kappa and lambda light chain representation information in the clones. b. Expression Library of the Cognant Antibody To facilitate the expression of full-length human antibodies, the cognate variable regions of the bacterial Fab expression vector must be transferred to a mammalian expression vector containing the constant domains of one of the human immunoglobulin isotypes . Such a transfer can be carried out either clone by clone or mass. Below is how to perform mass transfer. The mass transfer is carried out in two stages. First, the plasmid preparations of the Fab clones that bind to the individually isolated antigen are combined. The prokaryotic promoter and the cassette containing the leader is exchanged with a mammalian promoter and the leader cassette consisting of the leader sequence of human alkaline phosphatase (leader AP), promoter 1-alpha human extension factor (EFP), late promoter Adenovirus master (AdMLP), IgK leader sequence digesting the Fab expression sub-library pooled with AscI and Nhel followed by insertion of a mammalian promoter and leader cassette by a subsequent ligation. E. coli (TOP10) was transformed by electroporation with the Fab expression library exchanged for the resulting promoter and the transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Colony plasmid DNA was prepared directly from the agar plates. The plasmid preparation is derived from a minimum number of colonies per donor, corresponding to approximately 3x the total number of clones in the original library, to maintain diversity. Second, the cognate variable regions of the exchanged Fab expression vector of the promoter were isolated by digesting the plasmid preparation with Xhol and Notl. The isolated fragment was inserted by ligation into a mammalian expression vector that results in a cognate antibody expression library. The vector used is essentially the same as in Figure 9A, except that IgL in this case corresponds to the sequence encoding the kappa light chain. The mammalian expression vector used above is based on the site-specific Flp-In system (Invitrogen Corporation, Carlsbad, CA, USA, cat. No. K6010-01). E. coli (TOPO10) was transformed by electroporation with the resulting cognate antibody expression library and the transformants were selected on 2xYT agar containing 100 μg / ml carbenicillin. Colony plasmid DNA was prepared directly from the agar plates. The preparation of the plasmid is again derived from a minimum number of colonies per donor, which corresponds to approximately 3x the total number of clones in the original library, to maintain diversity. The plasmid preparation resulting from the cognate antibody expression library can be used to transfect a mammalian host cell, for example the CHO cells of the Flit-In system from Invitrogen (Invitrogen Corporation, Carlsbad, CA, USA, cat. K6010-01) to generate stable mammalian expression cell lines by Flp recombinase-mediated integration. Such a cell line can be used in the production of recombinant polyclonal antibodies. Example 7: Selection by High Density Membrane Test The clones expressing Fab from Example 6f are selected by a high density membrane assay. to. Master Plate Generation Master plates were generated as described in step (g-1) of Example 6. b. PVDF membrane preparation The PVDF membranes (Amersham, Uppsala, Sweden, cat No. NoRPN2020F) were coated according to the manufacturer's instructions overnight at 4 ° C with TT antigen diluted to a final concentration of 1 μg / ml in PBS. The excess binding sites in the membranes were blocked for 1 hour in 2% M-PBS (2% skimmed milk powder in PBS). The membranes were rinsed 3 times in PBS. The membranes were soaked in 2x YT for a few minutes. c. Clone Consolidation Clone consolidation was performed in 384-well plates by transferring clones from the master plates into one or more 384-well plates containing 20 μl 2 x YT / well, using a 96-tooth replicator. Using a 384-tooth replicator, the bacterium was transferred to one or more nylon membranes in duplicate (Amersham, Uppasala, Sweden, cat No. RPN2020B) placed on 2 × YT / Carb / 1% glucose agar plates. Plates were incubated 4-6 hours at 37 ° C. d. Fab Induction The PVDF membranes prepared in stage B were placed on 2 x YT / Carb / 0.1 mM IPTG agar plates. Nylon membranes with the growth of bacterial colonies were placed on the top of the PVDF membranes (a nylon membrane by PVDF membrane) on the agar plate containing IPTG. The agar plate containing IPTG was incubated at 30 ° C overnight to facilitate IPTG-induced Fab expression of the colonies. The Fab molecules are diffused through the nylon membrane in the PVDF membrane, where the Fab binding to the TT antigen will be retained in the membrane. and. Detection The nylon membranes were removed and the PVDF membranes were washed 2 x 5 minutes with PBS-T (PBS, 5% Tween 20). The membranes were incubated for 30 minutes with 2% M-PBS. The PVDF membranes were washed 2 x 5 minutes with PBS-T, followed by incubation for 1 hour with goat anti-human IgG / HRP (Sigma, St. Louis, MO, USA, cat. No. A0293), 1: 100,000 diluted in 2% M-PBS. The membranes were washed 3 x 5 minutes with PBS-T. Finally, the PVDF membranes were incubated for 5 minutes with SuperSignal West Femto chemiluminescent substrate (Pierce, Rockford, TI, USA, cat No. 34095) in accordance with the manufacturer's instructions. Excess substrate was removed and the PVDF membranes were placed under a CCD camera for detection of the chemiluminescent signal generated at positions on the PVDF membrane where a Fab fragment binds to the TT antigen. Clones that bind to the positive TT antigen will appear as dots in the image. The original bacterial clone is subsequently recovered from the original master plates. The plasmid DNA of the positive Fab clones of the isolated antigen was prepared, generating a sub-library of Fab expression cognate of clones that bind to the TT antigen. F. Correlation between Clones Binding to the Antigen and Clones Expressing Fab The nylon membranes removed in step e are placed in a second series of PVDF membranes coated with anti-light chain antibody or anti-Fab antibody in accordance with the procedure in stage b. Stage D and e are then repeated. Fab positive clones will then appear as dots in the image and a correlation can be made between the number of clones that bind to the TT antigen and the number of clones expressing Fab.

Example 8. Illustrative Example Describing the Isolation of Sequences that Codify a Heteromeric Protein. The present example illustrates how a protein (G protein) binds to the trimeric guanine nucleotide can be isolated in a single step using the TI-PCR technique of multiple overlap-extension of the present invention. The family of G protein subunits is long, only in humans that are approximately 16 different alpha subunits, 5 beta subunits and 12 gamma subunits. For the present example, the sub-unit GaS (GenBank Accession No. X04408), sub-unit Gßl (GenBank Accession No. AF501822) and sub-unit Gl (GenBank Accession No. BC029367) are chosen. The linking procedure is illustrated in Figure 13, wherein step 1 is the TI-PCR step of multiple overlap-extension and step 2 is the further amplification of the linked product. to . Cells A population of human liver cells is obtained from surgical waste samples. The liver cells disintegrated and lysed, the total RNA was isolated from the lysate using an L-RNA kit (Macherey-Nagel, Duren, Germany, cat No. 740 962.20), in accordance with the manufacturer's instructions. b. TI-PCR of multiple overlap-extension The Qiagen one-step TI-PCR kit (Qiagen cat. No. 210212, Hilden, Germany) was used for multiple overlap-extension RT-PCR essentially in accordance with the manufacturer's recommendation. Each PCR tube contains, in a total volume of 50 μl, the following reagents: 1 x TI-PCR single-step buffer, dNTP at a final concentration of 400 μM each, Mixture of the multiple overlap-extension primer in the concentrations as indicated in Table 10, 2 μl of the one-step TI-RCP enzyme mix, 1 U / μl of the RNase inhibitor (RNasin, Promega, Madison USA, cat # N2515), and 50 ng of RNA total. The mixture of the multiple overlap-extension primer used, comprises the primers shown in Table 10. Table 10 Capitalized sequences that correspond to the specific region of the gene.

The cyclization conditions used are: Reverse transcription: 30 min 42 ° C Polymerase activation: 15 min 95 ° C inactivation reverse transcriptase and activation Taq polymerase. Reaction CPR Denatured 30 s 94 ° C Temperate 30 s 49 ° C r 45 cycles Prolonged 3 min 72 ° C Final extension 10 min 72 ° C c. PCR Amplification One microliter of the multiple extension-overlap TI-PCR reaction product is subjected to an additional PCR amplification step (Biotaq kit, Bioline, UK, cat No. BIO-21040) essentially as proposed by the manufacturer . The primers used are α and β2 as shown in table 10 corresponding to SEQ ID NO: 80 and 85. The total volume of the reaction is 50 μl. The cyclization conditions are as follows: Denaturated 30 s 95 ° C Tempered 30 s 53 ° C - 25 cycles Prolonged 3 min 72 ° C Final extension 10 min 72 ° C Five microliters of the reaction product were analyzed by agarose gel electrophoresis at 1% using ethidium bromide for detection. The product size is expected to be 2215 bp. However, additional unbound fragments of the subunits may be present. The expected sizes of these fragments are Ga: 1228 bp, Gß: 1064 bp and G ?: 262 bp. d. Cloning The remaining reaction product was subjected to 1% agarose gel electrophoresis using ethidium bromide for detection and the 2215 bp overlap-extension fragment was excised from the agarose gel, purified using a Qiaex II kit (Qiagen , Hilden, Germany, cat. No. 20051) and inserted into pCR2.1-TOP0 using the TOPO TA cloning kit from Invitrogen (Invitrogen cat. No. 45-0641, Carlsbad, CA, USA). In addition, promoter sequences or sites that bind to the ribosome can be inserted upstream of each sequence encoding the subunit to facilitate its expression of the vector. The restriction sites present in the overlap-extension sequences are applicable for such an insertion. and. General Considerations The binding of subunits that encode the sequences that make up a heteromeric protein, as described above, can be performed for most heteromeric proteins where the sequence of individual subunits is known. However, when you use a multiple overlap-extension primer mix capable of amplifying several elements of a particular family, for example, all sub-units a-, β-, and? of G protein, it is possible to identify and link any combination of subunits of a cell type without the first having to analyze which family elements are expressed by that cell type. For example, the above example can be performed using a template derived from single isolated liver cells employing a multiple overlap-extension primer mix capable of amplifying and linking all 16 Ga subunits with the 5 Gß subunits and 12G subunits ?, thereby identifying which combination of subunits are expressed in each cell and simultaneously isolating the coding sequences responsible for such a combination of subunits. In addition, the use of degenerate primers may still serve to identify new elements of a particular family. When subunits of a heteromeric protein are linked using the multiple overlap-extension CT-PCR technique of the present invention, the total size of the bound product must be considered, since there are limits to the number of base pairs of a DNA polymerase. . Deep Vent polymerase from New England Biolabs, MA, USA is a DNA polymerase capable of generating very long primer extensions, up to 14,000 bp in length. Theoretically, 14,000 bp can encode a protein with an average weight of 510 kDa. In this way, it is possible to isolate coding sequences by very long heteromeric proteins using the method of the present invention. The extension capacity can possibly even be increased further by using mixtures of DNA polymerase. Example 9: Leader Primer Design: In this example, a multiple series of primers was designed in which the priming site is maintained in the sequence encoding the leader region of the human antibody heavy chain kappa and light chain families. When primers are used to anneal the sequences encoding the N-terminal families of the variable region, some degree of cross-hybridization can be observed. Primers of a family sequence of the particular gene can hybridize to the cDNA of another gene family, which in many cases, causes the creation of new sequences. Proteins produced from such sequences are potentially immunogenic when used in the treatment. Generally, these new sequences can be corrected by RCP, or eliminated from the library. An alternative solution is to place the booster site in the sequence encoding the leader peptide region of the variable region of the antibody. Hybrid sequences, generated as a result of cross-priming, will be eliminated during the intra-cellular process of the antibody, in which the leader peptide containing the potential immunogenic sequences will be unfolded, and therefore, will not be present in the product of the secreted antibody. Previous sets of leader primers for antibody cloning have been located at the 5 'end of the leader coding sequence, allowing direct eukaryotic expression (Campbell M. J. et al., 1992 Mol Immunol, 29, 193-203). Unfortunately, eukaryotic leader peptides are poorly suited for the prokaryotic process. The ease by which the nucleic acid sequences are manipulated in the bacterium is possible, making it attractive to develop cloning systems in which the shuttle sequences between the bacterial vectors and vectors of other host organisms. Therefore, a series of multiple primer, in which the priming site is maintained at a position in the sequence encoding the leader region, which allows the functional expression of antibodies or antibody fragments in both eukaryotic and prokaryotic expression systems, was designed in the present example. The sequence requirement for signal peptide cleavage in the C-terminal region of any leader peptide appears very similar for prokaryotic and ecurariote systems (Nielsen H. et al., 1997 Protein Eng. 10, 1-6). Furthermore, it follows that mutations in the C-terminal region of the leader peptide are likely to have an effect on the conformation of the N-terminal region and vice versa. Thus, it is expected that C-terminal sequences may be transferable between species without loss of function. The basic concept of the primer design in the present example was to place the priming site in the last six codons of the C-terminal region of the leader peptide. The remaining part of the sequence encoding the leader, upstream of the priming site (approximately 50 nucleosides), must be provided by the appropriate expression vector by matching the host species. For example, vectors suitable for expression in the gram negative bacterium can be designated with a full length or partial length PelB leader sequence. For expression of antibodies in eukaryotes, a vector with a sequence encoding the heavy chain leader of the partial native antibody and a sequence encoding the partial variable kappa chain leader will be suitable. With respect to the expression system, the last six amino acids of the leader will originate from the sequence encoding the endogenous antibody leader contained in the nucleic acid segment inserted in the vector. The following primer sequences were designated for use in multiple overlap-extension CT-PCR (Table 11). However, overlapped ends (letters written in lowercase) can easily be re-designated for function in the link by ligation or recombination procedures. Table 11 M = A / T, R = A / G; Y = C / T, S = G / C. Capitalized sequences that correspond to the specific region of the gene.

It should be noted that the restriction sites in this slightly modified primer design are compared to the primers described in the previous examples. Thus, the sequence of overlap between the sequences encoding the light chain and heavy chain variable region comprising a restriction site Notl and Nhel, and in the constant kappa primer (CLk), the previous Notl site has been exchanged with a site Ascl. The last modification must, of course, be observed when the primers are designed for the amplification of additional CPR. In addition, the Notl site in the cloning vector, shown in Figure 11, must be changed to an AscI site, and the AscI site in the promoter unit must be changed to a Notl site. The functionality with respect to the leading splitting has been tested in-house using SignalP provided by CBS of Danish Technical University. The chimeric leader peptides tested for the variable heavy chain were encoded by the nucleic acid sequences composed of a truncated PelB sequence, a C-terminal Notl site (SEQ ID NO 100: ATG AAA TAT CTT CTA CCA ACA GCG GCA GCT GGA TTA TTG GCG GCC GCC), and in association with the Notl site of the specific part of the gene of one of SEQ ID NOs 86-92, which encodes the six C-terminal amino acids of the elements of the native VHL family.

All seven sequences showed signal peptide cleavage in the gram negative bacteria, using the SigmalP program. The chimeric leader peptides tested for the variable light chain were encoded by nucleic acid sequences composed of a truncated PelB sequence, a C-terminal Nhel site (SEQ ID NO 101: ATG AAA TAT TTG CTA CCA ACA GCG GCA GCT TGA TTG TTA CTA GCG), and in association with the Nhel site of the specific part of the gene of one of SEQ ID NOs 93 to 98, which encodes the six C-terminal amino acids of the elements of the native L L family. All six sequences show signal peptide cleavage in a gram negative bacterium, using the SigmalP program. The sequences of SEQ ID NOs 100 and 101 are suitable for the construction of a bacterial expression vector similar to one illustrated in Figure 11, in which the AscI site illustrated in Figure 11 is replaced by SEQ ID NO 100 and Nhel site is substituted with SEQ ID NO 101. In addition, the Notl site illustrated in figure 11 needs to be replaced by an Ascl site. The mammalian expression vector (Figure 9) can also be re-designated to allow expression in mammalian cells after transfer of the segments encoding the variable region, from the bacterial vector simply described. Example 10. A TI-PCR Multiple and Ligation Linkage This example illustrates how a linked heavy chain variable region comprising a cognate pair and sequences encoding the light chain variable region can be generated in a reaction tube. only using ligation instead of overlap-extension RCP, to obtain a link. to. Multiple TI-PCR A cell line produced in the host that expresses the Fab molecules with specificity towards the Tetanus Toxoid, is distributed limiting the dilution to obtain a single cell in a single PCR tube. In addition to the single cell, each PCR tube contains the following reagents in a total volume of 20 μl: 1 x of Phusion HF dNTP buffer in a final concentration of 200 μM each. Mixture of multiple primer in concentrations as indicated in table 12 0.8 U of Phusion polymerase (FinnZymes Cat. No. F-530-L) 1 μl of Sensiscript reverse transcriptase (Qiagen Cat. No. 205213) 20 U of Rnase inhibitor Table 12 W = A / T, R = A / G, S = G / C. Capitalized sequences that correspond to the region. The conditions of cyclization are: Reverse transcription 30 min 37 ° C Denatured 30 s 98 ° C Denatured 10 s 98 ° C Tempered 30 s 55 ° C - 40 cycles Prolonged 30 s 72 ° C Final extension 5 min 72 ° C b. Linkage by ligation To perform the ligation linkage, ligase and restriction enzymes were added directly to the multiple TI-PCR reaction products. Alternatively, multiple TI-PCR can be purified prior to this addition to release the polymerase mixture. The following reagents are added to each tube in a total volume of 40 μl: lx NEBlI buffer 1 mM ATP 50 U of Xbal (New England Biolabs Cat. No. R0145L) 25 U of Spel (New England Biolabs Cat. No. R0133S) 100 μg / ml of BSA 400U of T4 DNA ligase (New England Biolabs Cat. No. M0202S) The reaction was incubated at 16 ° C overnight. The sequences encoding light chain variable regions and linked heavy chain were purified from the reaction by gel electrophoresis and excised from the band of approximately 1000 bp. In an alternative version of this method, the multiple TI-PCR reaction was performed with a CH primer in place of the JH primers in the multiple primer series.

This primer can be either equipped with a cloning end that allows the insertion into the heavy chain variable region structure in the expression vector, or a semi-nested TI-PCR can be performed with the primers of Table 5. Example 11. Generation of a recombinant polyclonal immunoglobulin with specificity towards the Tetanus Toxoid In the present example, the results of a single donor (TT03) immunized with Tetanus Toxoid are used to illustrate the steps summarized in the flow schemes in Figure 10. . to. Donors Eight donors who had previously been immunized with the Tetanus vaccine were boosted with Tetanus vaccine (Statens Serum Institut, Denmark). The donors were assigned with numbers TT01 to TT08. Six days after booster of the Tetanus vaccine a blood sample of approximately 200 ml of the donors was taken in a tube containing anticoagulant. The donors are healthy without chronic infections, autoimmune disease, or immunosuppressive medication and have not had any vaccination within at least 3 months. a-1. Quality monitoring of the donor The pre-bleeds of the donors were taken at the time of immunization. Fourteen days later, additional bleeds were taken to determine the serum titrant. All donors respond with an increase in the TT titrator. An ELISPOT assay was also established to measure the frequency of TT-specific plasma cells. Different cell fractions can be used for the ELISPOT, for example, the main bleeding of day 6, the PBMC fraction, the selected magnetic fraction, or the fraction selected by FACS. The ELISPOT can be used to evaluate the donor material and to identify the best responders, which can then proceed through the multi-extension overlap and TI-RCP classification stage. For the TT03 donor, an ELISPOT was performed using the CD19 + cell fraction (see section c). The ELISPOT assay was performed as described by Lakew (Lakew, M. et al., 1997. J. Immunol. Methods 203, 193-198) with minor modifications. The frequency of TT-specific plasma cells was calculated in PBMC fractions at 0.021%. b. Preparation of Peripheral Blood Mononuclear Cells (PBMC) PBMCs were isolated from the blood sample using Lymphoprep (Axis-Shield PoC AS, Norway, product No. 1001967) in accordance with the manufacturer's recommendations. Briefly, the blood was diluted 1: 1 in PBS and this suspension was stratified on Lymphoprep in a 2: 1 ratio. The vials were centrifuged for 20 minutes, 25 ° C to 800 g and the white internal phase band was collected. The cells were washed in PBS containing 2 mM EDTA. From 200 ml of the whole blood sample from donor TT03, approximately 2 x 108 PBMC were obtained. c. Enrichment of B cells The B cell lineage (CD19 + cells) of the PBMC was enriched by cell selection by magnetic strips using the following procedure. Isolated PBMC were stained with anti-CD19-FITC (Becton Dickenson, NJ, USA, cat No. 345776). All stages were performed at 4 ° C in the dark. The dyeing was performed with 19 μl of anti-CD19-FITC pr. 1 x 106 cells in a volume of 100 μl per lxlO6 cells using M buffer (PBS, pH 7.2, 0.5% BSA, 2 mM EDTA). This will stain the B cell lineage of PBMCs. The cells were incubated by minutes followed by two stages of washing with shock absorber M. The anti-CD19-FITC stained cells were magnetically labeled with anti-FITC conjugated microperils, using 10 μl of anti-FITC magnetic beads (Miltenyi Biotec, Gladbach, Germany, cat. No. 130-401) by IxlO6 cells in a 100 μl volume of M buffer per 1 x 106 cells. Incubation was performed for 15 minutes followed by a washing step with M. buffer. The cells were again suspended in degassed M buffer. A MACS LS column (Miltenyi Biotec, Gladbach, Germany, cat No. 130-042-401) was pre-treated with degassed M buffer in accordance with the manufacturer's description. The suspension of cells stained with anti-CD19-FITC and labeled with magnetic anti-FITC beads was applied to the column and allowed to run through it. Stained and labeled cells (CD19 +) were retained in magnetic field around the column while unstained cells (CD19- passed through the column.The column was washed with degassed M buffer.The magnetic field was removed and CD19 + cells The analytical dyeing of the starting material (PBMC), the unlabeled fraction and the fraction labeled CD19 were made from TT03, using anti-CD19-FITC, anti-CD38-PE and anti-CD45-PerCP (Figure 4) This shows that the magnetic cell classification results in two different fractions compared to the PBMC fraction, the CD19 negative cells are shown in panel B and the CD19 positive cells are shown in panel C. Of the PBMC fraction 11% the cells are CD19 +, the extent of the purification of the CD19 positive cell was 99.5% Rl (the guide distributed in Figure 14C) for TT03 As seen in Figure 14C, the anti / CD38 / anti-CD45 lot showed a different population of CD38hi, CD45in (R2) cells corresponding to 1.1% of Rl. This population contains the plasma cells and were collected during the last stage selection. This indicates that in the PBMC fraction, 0.12% of cells correspond to the plasma cells. The CD19 positive cell fraction was frozen in FCS (Invitrogen, Cat. No. 16000-044) + 10% DMSO (Sigma, cat. No. D2650) for last selection. An analysis similar to one observed in Figure 14 was done on the purified MACS cells that have been frozen to ensure that the cells are intact (Figure 15). The dyeing patterns observed in Figure 15 are the same as those observed in Figure 14C through a lightly observed dyeing intensity. The cells that were collected by classification are the sub-series of Rl and R2. This corresponds to approximately 1.1% of the MACS purified cells. D. Selection of Plasma Cells The frozen eluate of the MACS column was thawed, centrifuged and resuspended in FACS buffer (PBS, pH 7.2, 2% BSA) at a concentration of lxlO6 cells / 60 μl of FACS buffer. Anti-CD19-FITC (Becton Dickenson, NJ, USA, cat No. 3457769 (10 μl / 106 cells), anti-CD38-PE (Becton Dickenson, NJ, USA, cat No. 555460) (10 μl) was added. / 106 cells) and anti-CD45-PerCP (Becton Dickenson, NJ, USA), cat No. 345809) (20 μl / 10 6 cells), and the mixture was incubated at 4 ° C for 20 minutes in the dark, followed by by washing twice and suspension again in FACS buffer. Cells were selected by fluorescent activated cell selection (FACS) using the following activation parameters: 1. Front dispersion and lateral dispersion to retain lymphocytes and monocytes including plasma cells and plasma blasters to avoid cell death and cells with very high dispersion lateral, which can be added or granulocytes. 2. Cells that are CD19 positive and express increased levels of CD38 (CD38hi).

This is basically only one entry in CD38 since the PBCMs have been enriched in a MACS column by expression CD19, but this will describe any of the contaminants. 3. Intermediate CD45 positive cells. All lymphocytes express CD45. However, plasma cells down-regulate their CD45 expression, compared to the early lymphocyte differentiation stages. Therefore, a discrete population of cells corresponding to plasma cells can be obtained when they enter CD45. The selected FACS cells of donor TT03 were collected as the sub-series of the two inputs P2 and Pl (Figure 16A and 16B, respectively). The cells are CD38hi (FL2-A), CD45in (FL3-A) and CD19 +, the latter due to MACS purification. Briefly, the cells were collected in volume, counted and diluted in RPM1 (Invitrogen, cat No. 21875-034) containing 10% FCS (Invitrogen, cat No. 16000-044), 100 units / ml penicillin- streptomycin (Invitrogen, cat No. 15140-122), 2 mM L-glutamine (cat No. 25030-024). The cells were then dispersed in fifty 96-well PCR plates (ABgene, cat No. AB-0800) with one cell per cavity in 5 μl of medium. The plates were sealed and frozen immediately, and stored for last TI-PCR analysis. and. Linkage of Paired Cognitive Sequences that Codify the Variable Region of Immunoglobulin The TI-RCP technology of multiple overlap-extension was applied to the unique cells obtained from the donor TT03, thereby achieving cognate links of the sequences encoding the variable region of light chain and heavy chain variable region of the anti-tetanus toxoid. e-1. Single-Stage Multiple Overlap-Extension CT-PCR The one-step Qiagen RT-PCR kit (Qiagen cat. No. 210212, Hilden, Germany) was used for the multiple overlap-extension CT-PCR essentially in accordance with the manufacturer recommendation. Fifty frozen 96-well PCR plates containing approximately one single cell per well were removed from the freezer and when the cells were free of ice crystals, 15 μl of the TI-PCR reaction mixture was immediately added to each well. The TI-RCP reaction mixture contains, in a total volume of 20 μl, the following reagents: 1 x 1-step dNTP TI-PCR buffer at a final concentration of 400 μM each. Mixture of multiple overlap-extension primer in the concentrations as indicated in Table 13 0.8 μl of the TI-PCR mix of a 20 U step of RNase inhibitor (RNasin, Promega, Madison USA, cat No. N2515) The composition of the multiplex overlap primer It is shown in table 13.

Table 13 W * = A / T, S = G / C, R = A / G, Capitalized sequence that corresponds to the specific region of the gene. The cyclization conditions are as follows: Reverse transcription: 30 minutes 55 ° C Polymerase activation: 15 minutes 95 ° C inactivated reverse transcriptase and Taq polymerase activated.

PCR reaction: Denatured 30 s 94 ° C Tempered 30 s 52 ° C 35 cycles Prolonged 5 min 72 ° C Final extension 10 min 72 ° C e-2. Additional Amplification One microliter of the multiple overlap-extension TI-PCR reaction product from each sample was subjected to semi-nested PCR (Biotaq kit, Bioline, UK, cat. No. BIO-21040), essentially as proposed by the manufacturer using 96-well RCP plates (ABgene, cat No. AB-0800). The total volume of each reaction was 50 μl, containing a final concentration of 1 x Biotaq buffer, 200 μM of dNTP (each) 2 mM of MgCl2, 1.25 U of Bio Taq polymerase and the primers are shown in table 14. Table 14 Capitalized sequences that correspond to the specific region of the gene.

The cyclization conditions are as follows: Denaturated 30 s 95 ° C Tempered 30 s 55 ° C Prolonged 1.5 min 72 ° C Final extension 5 min 72 ° C Ten microliters of the samples of line A, cavity 1-12 of each plate were analyzed by electrophoresis of the 1.5% agarose gel using ethidium bromide for visualization, to verify that multiple-transliterate RT-PCR is successful. The expected size of the overlap-extension fragment is approximately 1070 bp (the exact size depends on the lengths of the variable regions). Figure 17 shows samples of eight 96-well plates. The average number of successful overlap-extension TI-PCR fragments of fifty 96-well plates was estimated at eight per plate. Thus, the total number of successful overlap-extension TI-PCR fragments was estimated at approximately 400. Ten microliters of all reactions performed, run on 96-well plates, originating from the same donor, were consolidated into a single tube. An aliquot consisting of 200 μl of the combined PCR products was subsequently purified using the QIAquick PCR RCP purification kit according to the manufacturer's procedure (Qiagen cat. No. 28106, Hilden, Germany) using 60 microliters of EB buffer for elution. The purified combination of the overlapping PCR products was digested with Xhol and Notl and subsequently purified by preparative 1% agarose gel electrophoresis.; the overlap-extension fragments were excised from the agarose gel and purified using a Qiaex II kit (Qiagen, cat No. Hilden, Germany). F. Fab Cognada Expression Library An Fab expression library was generated by a two-step ligation procedure. Initially the digested overlap-extension fragment combination described above was ligated into the JSK301 vector of E. coli digested with Xhol / Notl (Figure 11). The ligation reaction is subsequently transformed into electrocompetent E. coli cells (electroporation component XL1-Blue, Stratagen, cat. No. 200228, La Jolla, USA), in accordance with the manufacturer's instructions. The transformed E. coli cells were placed in 2x YT agar containing 100 μg / ml carbenicillin. The biomass corresponding to approximately 1010-101: L cells that originate from a number of independent colonies that exceeds at least 5 times the total number of overlapping PCR products, was used as starting material for plasmid preparation using the kit Max preparation of Qiagen Plasmid (Qiagen, cat No. 12163, Hilden, Germany). To allow for the expression of cloned cognate linked VH and VL coding sequences, a prokaryotic promoter and a leader cassette was inserted into a second ligation step. The bi-directional promoter fragment used (SC ID NO 321) was extracted from the original JSK301 by Ascl / Nhel digestion. The purified combination of plasmids was also digested with Ascl / Nhel restriction endonucleases and gel purified as previously described. The purified fragments were subsequently ligated and transformed into electrocompetent E. coli cells (TGl, Stratagene, cat. No. 200123, La Jolla, USA) and plated on 2xYT agar containing 100 μg / ml carbenicillin and glycosa at 1%. The process of generating the Fab expression library is summarized in Figure 12. g. Clone Selection Clones expressing Fab for binding to the TT antigen were selected by antigen-specific ELISA assays. g-1 Generation of Master Plate and Fab Expression Selected individual colonies of the cells TGl, each harboring a cognate Fab expression vector from the library generated as described in section (f) were chosen in unique cavities of 96-well plates containing 2 x YT / 100 μl / ml Carb / 1% glucose . Plates were incubated overnight at 37 ° C with gentle shaking. Four 96-well plates were consolidated in the cavities of a 384-well plate, containing 2 x YT / 100 μg / ml Carb / 1% glucose, using 96-tooth replicator. The 384-well plates were incubated during the day at 37 ° C. Plates were referred to as master plates, and stored at -80 ° C after the addition of glycerol to a final concentration of 15%. The master plates were used for inoculation of 384 Deep Cavities plates containing 2 x YT / 100 μg / ml Carb / 0.1% glucose using a 96-tooth replicator. Plates were sealed and incubated for 2-3 hours at 37 ° C with shaking. Expression was induced by shaking an equal volume of 2 x YT / 100 μg / ml Carb / 0.2 mM of IPTG, obtaining a final IPTG concentration of 0.1 mM. Plates were sealed and incubated overnight at 30 ° C with shaking. The next day, the supernatants containing Fab were analyzed for specificity of binding to the TT antigen by ELISA. g-2 ELISA ELISA plates of three hundred eighty-four (384) cavities (Corning Inc. Corning, NY, USA, cat. No. 3700) and coated overnight at 4 ° C with Tetanus Toxoid Antigen (TT), were diluted to a final concentration of 1 μg / ml in PBS in a volume of 25 μl per well. The excess binding site of the cavities was blocked for 1 hour at room temperature (RT), adding 2% M-PBS (2% skimmed milk powder in PBS, 0.05% Tween 20). The cavities were washed 2 times with PBS-T (PBS, 0.05% Tween 20). The bacterial supernatants containing Fab from section (g-1) were diluted 1: 2 in 2% M-PBS-T and transferred to the ELISA cavities in duplicate. The inoculation was performed for 1 hour at room temperature. The wells were washed 4 times with PBS-T. Goat anti-human Fab / HRP (Sigma, St. Louis, MO, USA, cat No. A0293) dilution 1: 10,000 in 2% M-PBS-T was added to the cavities. Incubation was performed for 1 hour at room temperature. The wells were washed 4 times with PBS-T. The TMB Plus substrate (KemEnTec, Copenhagen, Denmark, cat No. 4390L) was added and the incubation was performed for 5 - 15 minutes. The reactions were stopped by adding an equal volume of IM of H2SO4, and analyzed using a spectrometer at 450 nm (Multiscan Ascent, Labsystems, Franklin, USA). The original bacterial clones corresponding to clones that bind the TT antigen can subsequently be recovered from the original master plates. The plasmid DNA can be prepared from the fab positive clones of the isolated antigen, generating a fab-cognate sub-library of clones that bind to the TT antigen. A sub-series of the clones was further analyzed by an anti-kappa ELISA assay, to achieve a correlation between the number of clones that bind the antigen and the number of clones expressing fab. The anti-kappa assay was generally performed as the TT assay, except that the cavities were coated with a 1: 1000 dilution of anti-human kappa antibody (Caltag, California, USA, Cat. No. H16000), using a carbonate buffer , pH 9.6. g-3 Selection Results The clones from four 384-well plates were selected by reactivity with anti-kappa Ab and ELISA assays using TT according to the procedure described in g-2. The results obtained are summarized in table 15 to 19. The anti-kappa ELISA results inform about the expression of Fab fragments in a given clone, the results of ELISA TT inform about the functionality of the Fab fragments. Table 15. ELISA selection, goat anti-kappa (1440 clones in total) Of 1440 unique clones analyzed, 482 clones or 34% exhibited anti-Kappa reactivity at a level that exceeds the 2x antecedent reactivation. 395 clones or 27% of the clones showed reactivity on 3 x antecedents, etc. The same clones were analyzed by reactivity of the TT antigen by ELISA, and the results are given in table 16 below: Table 16. Selection ELISA, goat TT (1440 clones in total) From this table, it is observed that 9. 0% of clones show reactivity with TT at 2 x antecedent (defined as the signal obtained by the reactivity of a Fab fragment with an irrelevant specificity). 104 clones reacted to 3 x antecedent (7. 2%) etc. Of these positive Fab clones (482 clones in total), approximately 27% of the clones (130/482) exhibited reactivity with TT at level 2 x background. This level does not change significantly with the other levels of antecedent.

Six plates of 384 cavities were selected for clones with TT reactivity. The number of clones that gives rise to the reactivity with the antigen is shown in Table 17. No anti-kappa ELISA was carried out with these plates. Table 17. ELISA selection, goat TT (2160 clones in total) The percentage of positive TT clones in G054 - G059 plates was comparable with that found in G050 - G053 plates (table 16). The results of all the clones selected against TT (table 16 and 17) are summarized in table 18. Table 18. Selection of all clones, TT reactive clones In summary, a total of 339 clones show reactivity with TT at least at 2x antecedent levels (Table 18). This corresponds to 9.4% of the total of selected clones. All positive clones exhibiting reactivity with TT at 2 x antecedent were incubated in 96-well plates as previously described, from the master plate. The next day, the bacteria was collected by centrifugation at 4000 rpm for 15 minutes, and the pellet was suspended again in 0.8 mM EDTA, 0.4 x PBS, 0.8 M NaCl, and incubated on ice for 15 minutes. The periplasmic extract was collected by centrifugation, and the reactivity of the clones was further analyzed. Results of a plate are displayed (G060) for reactivity with anti-Kappa (Figure 18), Ovalbumin (unrelated antigen) (Figure 19), TT (Figure 20), and a competitive one-step assay using 10 ~ 7 M concentration of TT antigen in solution (Figure 21). These ELISA assays were performed in the same periplasmic extract, in the same dilution. Most clones express fragments (90/96) (Figure 13), and unreacted clones with Ovalbumin (Figure 19). The reactivity with immobilized TT was reduced or completely inhibited by TT in solution (Figure 21), indicating that the clones react specifically with TT. The reactivity of the clones in the G060 plate is summarized in table 19.

Table 19. Summary of the G060 plate (96 clones in total) h. Diversity of analysis and approval of the clone The plasmid isolated from 47 clones (of the G060 plate) of the cognate TT antigen binding Fab expression sub-library was subjected to sequence analysis. The sequences encoding the variable heavy chain were sequenced using the LSN-HCP primer: AGGAAACAGGAGATATACAT (SEQ ID NO 131), annealing to the ta c P promoter, and the sequences encoding the light chain were sequenced using LSN-LCP primer: TCGCCAAGGAGACAGTCATA (SEQ ID NO: 132), annealing to the lac P promoter. Sequence data were analyzed using Vector NTI software (Informax, Frederick, MD, USA). The sequence data resulting from the heavy chain were rescissed to a base pair 5 'from the AscI restriction site upstream and immediately 3' from the downstream Xhol restriction site. The light chain sequence data were rescaled to the second base pair 5 'of the restriction site Nhel upstream and 3' of the last codon "AAA" encoding the variable chain C-terminal lysine. The trimming was performed to facilitate additional analysis such as translation of each DNA sequence. The sequences encoding the variable light and heavy chain were analyzed by the use of the germline gene, comparing the sequences for the variable region database of the germline base V (MRC Center for Protein Engineering, Cambridge , UK). The allele of the germline most closely related, was thus determined for each sequence that shows a V gene repertoire that originates from 12 different variable heavy chain germline alleles belonging to the VH family, VH1 to VH5 and 8 different variable kappa heavy chain germ line alleles. which belong to VLI, VKIII and VLIV (Table 20). In addition, the variable gene sequences were translated into protein sequences which were aligned using the AlignX software (Informax, Frederick, MD, USA) as described in Figure 22 and Figure 23. Based on protein sequence alignments , the variable chain sequences must be categorized in groups according to V (D) J rearrangement events, designated with H for the variable heavy chain sequence and L for the variable kappa chain sequence followed by a unique number. In each rearrangement group, the sequences were categorized according to the maturation genotype (type M in Table 20) within regions CDR1, 2 and 3, represented by a capital letter in alphabetical order. Seven of the clones have premature stop codons, of which 6 clones were an amber mutation (TAG) (clone IDs g060: bl2, d08, f06, cl2, f03, c04) and 1 clone was an opal mutation (TGA) ( clone ID g060: hl2). These codons are more likely suppressed by E. coli, resulting in functional fab fragments. Four of these codons are elements of groups that contain similar clones that make them redundant. Additionally, the clones will be analyzed to replace the remaining 3 clones with premature arrest codons, as they are unique elements of their groups. Alternatively, the sequences should be corrected by standard molecular biological techniques such as PCR, replacing the stop codon with an appropriate codon.

The 47 V region sequences analyzed should be divided into 20 unique V (D) J rearrangement groups ("groups" designated in Table 20) both for variable and variable heavy kappa gel. Four of the rearrangement groups should also be divided into 1 to 4 types of maturation (up to d), resulting in 27 sequences encoding the single antibody (Table 2). Generally, specific heavy chain rearrangement groups are combined with specific light chain rearrangement groups (e.g., Hl with Ll, H12 with L24 and so on). In addition, the type of maturation matched between pairs of sequences encodes the variable light chain and the variable weigh (for example, H4c matched with L13c). Such a restriction in mating between groups of rearrangement and types of maturation, indicates pairing of the sequences coding for the variable region. However, the H4 group of heavy chain rearrangement is an exception. H4 pairs with two different light chains L28 and L13. L13 is unique for H4, comprising maturation types a, b and c that are matched with maturation types L13. L28, on the other hand, was also found to be paired with the unique element in the heavy chain H2 group. Two of seven pairs of heavy chain sequences H4a with heavy chain L13a and five of seven pairs of heavy chain sequences H4a with L28a. In summary, these observations suggest a CT-PCR of multiple overlap-extension even where two plasma cells are present produce specific TT antibody, with the combinations H2-L28 and H4a-L13a genotype, in a single cavity. Rare randomization events of the heavy chain and light chain gene, such as for H2 and H4a with L28, were expected as the experiment was based on limiting dilutions of plasma cells. The sequence identity between individual cognate pairs of the sequences encoding the variable light chain and variable heavy chain of the same group and the type of maturation, is at least 90% and preferably at least 95%. Taking for example g060g03 and g060a01 of the maturation group Hl type a. Clone g060g03 corresponds to SEQ ID nucl., Pair 168: 215, wherein the sequence encoding the variable heavy chain corresponds to SEQ ID NO: 168 and the sequences encoding the variable light chain correspond to SEQ ID NO 215. Clone g060a01 corresponds to mating SEQ ID NO nuclear 133: 180. When SEQ ID NO 168 is aligned with SEQ ID NO 133 (variable heavy chains) 4/369 bases are not identical and for variable light chains (SEQ ID NOs 215 and 180) 8/327 bases are not identical, this corresponds to a sequence identity of 98.3% between these two cognated pairs (g060g03 and g060a01). However, when observed in sequence identity between different groups, the sequence identity is not expected to be high, since a sub-library and polyclonal diversity is desired. In this particular example, the lower identity between the cognated pairs is approximately 40% (for example, g060bll and g060hll have a sequence identity of 39.5%). One embodiment of the present invention is a raised library of cognate pairs of sequences encoding a light chain variable region and immunoglobulin heavy chain variable region, wherein the immunoglobulins obtained from said library are capable of reacting with or binding to the toxin. Tetanic An additional embodiment of the present invention is such a sub-library of cognate pairs of sequences encoding the light chain variable region and immunoglobulin heavy chain variable region, comprising individual cognate pairs with at least 90% sequence identity with an individual SEQ ID pairing, selected from the group consisting of SEQ ID 135: 182, 168: 215, 146: 193, 151: 198, 173: 220, 152: 199, 164: 211, 148: 195, 137: 184; 169: 216, 138: 185, 143: 190, 161: 208, 166: 213, 157: 204, 139: 186, 134: 181, 150: 197, 156: 203, 25 158: 205, 170: 217, 178 : 225, 141: 188 or 144: 191. 15881YY00 O ID OO or o 0 IV) or n Asterisks indicate sequences that encode V in mixed. Sec. Sec, indicate numbers SEQ ID of the sequence listing corresponding to the protein and Seq. Sequences, indicate SEQ ID numbers corresponding to the nucleic acid sequence in the sequence list i. Apparent affinities A competition assay was prepared to determine the apparent affinity or IC50 of selected cabbages of the G060 plate. Briefly, the Fab fragments were expressed in 50 ml of cultures as follows: 50 ml 2x YT / 100 μg / ml carb / 0.1% glucose, 0.5 ml of culture was added overnight, and stirred approximately 2 hours at 37 ° C C. IPTG was added to a final concentration of 0.1 mM, and stirring continued overnight at 30 ° C. The next day, the bacteria was collected by centrifugation at 4000 rpm for 15 minutes, and the pellet was suspended again in 1 ml of 0.8 mM EDTA, 0.4 x PBS, 0.8 M NaCl, and incubated on ice for 15 minutes. The periplasmic extracts were collected by centrifugation, and stored at -20 ° C. The competition assay was performed as follows: the periplasmic extracts in appropriate dilutions estimated by titration, were added to a series of tubes. The mp584 fragment of fab derived from the phage display, derived from the human hybridoma cell line HB8501 expressing an anti-TT antibody, was used as a positive control. Soluble TT was added to the first tube at a concentration of 100 nM, and subsequently it was diluted in four-fold steps in the following tubes, making a total of seven dilutions of TT (from 100 nM to 25 pM). The reactions were incubated for approximately 45 minutes at room temperature. The samples were transferred to ELISA plates coated with TT at 1 μg / ml and blocked as previously described. The plates were incubated for 1 hour at room temperature, followed by 4 x washing with PBS-T, goat anti-human Fab / HRP was added at a 1: 10,000 dilution and incubated for 1 hour. The TMB Plus substrate (KemEnTech, Denmark, cat No. 4390A) was added, the incubation was performed for approximately 10 minutes, and the reaction was stopped with 1M of H2SO4. The plates were read at 450 nm. The data were plotted in Figure 24. The apparent affinities of the clones analyzed are given in Table 21: Table 21 As seen in Table 21, the fragments have apparent affinities in the upper molar-peak and lower nano-molar range. In addition, all cognate paired Fab fragments exhibit a higher apparent affinity than that of the Fab fragment derived from phage display. j. Summary In the TT03 donor, the frequency of the TT specific plasma cells in the peripheral blood monocyte cell fraction was calculated at 0.022%. Approximately 400 cognate pairs were generated from TT03. 3600 clones of the cells transformed with the cognate pair library were selected using ELISA, of these, 339 clones showed TT reactivity of the ELISA selection. 47 of these clones have been analyzed with respect to their clonal diversity. Of these 47 clones, 27 proved to look like sequences encoding the single nonrandomized variable region. Three of these clones contain a premature stop codon that will need correction before transfer to a mammalian expression vector. The transfer to mammalian expression vectors is described in Example 1 section h. Apparent affinities were measured in selected clones, varying from the peak-to-molar interval higher than the lower nano-molar. k. Prospects Tetanus toxin is one of the most toxic substances known with a lethal dose of few nanograms. The toxin is produced by Clostridium tetani, a soil bacterium also present in the digestive tract of up to 25% of humans. The tetanic immunization program has effectively abolished the disease in the Western world, although 100-200 cases are still observed in most Western countries annually, with a case-fatality ratio of 50%. In the developed world, the number of cases is significantly higher. Bacterial growth in contaminated penetrating wounds can lead to toxin release, eventually leading to stiffness, spasms, respiratory failure and death. Hyperimmune immunoglobulin products isolated from human blood donors with a high titrant of antibody response against the Tetanus Toxoid, can be used to prevent tetanus or if instituted early, to treat established tetanus, also in conjunction with active immunization. However, due to the scarcity of the human product, the equine hyperimmune anti-tetanus Toxoid is used in the developed world. Monoclonal or polyclonal recombinant antibodies against tetanus toxoid have the potential to substitute hyperimmune globulin products for therapeutic and / or prophylactic use. Recombinant monoclonal antibodies originating from conventional hybridoma technology have been described as being effective against TT (Chin, J. et al., 2003. Biologicals 31, 45-53). Interestingly, a synergistic effect was observed when two monoclonal antibodies were mixed. Thus, a recombinant polyclonal anti-tetanus Toxoid antibody capable of reacting with or binding to the Tetanus Toxin, may potentially be very effective in the treatment or prophylactic protection of patients at risk of developing tetanus. One embodiment of the present invention is a recombinant polyclonal immunoglobulin or fragments thereof capable of reacting with or binding to the Tetanus Toxin. A preferred embodiment of the present invention is a recombinant polyclonal immunoglobulin or fragments thereof, capable of reacting with or binding to the Tetanus Toxin comprised of cognate pairs of light chain variable region and immunoglobulin heavy chain variable region. A further embodiment of the present invention is a recombinant polyclonal immunoglobulin capable of reacting with or binding to the Tetanus Toxin obtained by the method according to the present invention. A further embodiment of the present invention is a recombinant polyclonal immunoglobulin capable of reacting with or binding to the tetanus toxin comprising individual cognate pairs of light chain variable region and immunoglobulin heavy chain variable region with at least 90% sequence identity with a pair of individual SEQ IDs, selected from pairs SEQ ID 229: 276, 262: 309, 240: 287, 245: 292, 267: 314, 246: 293, 258: 305, 242: 289, 231: 278, 263 : 310, 232: 279, 237: 284, 255: 302, 260: 307, 251: 298, 233: 280, 228: 275, 244: 291, 250: 297, 252: 299, 264: 311, 272: 319 , 235: 282 or 238: 285. Another embodiment of the invention is a pharmaceutical composition comprising a recombinant polyclonal antibody capable of reacting with or binding to the Tetanus Toxin as an active ingredient, intended for the treatment or prevention of tetanus. Preferably, the recombinant polyclonal antibody is combined with a pharmaceutically acceptable excipient. A further embodiment of the present invention is the use of a recombinant polyclonal immunoglobulin capable of reacting with or binding to the Tetanus Toxin as a medicament for the prophylactic treatment or protection of a patient at risk of developing tetanus. An additional embodiment is a method of preventing or treating a patient at risk of developing tetanus by administering to a patient in need thereof, a composition comprising a recombinant polyclonal antibody capable of reacting with or binding to the tetanus toxin. Example 12. Comparison of results obtained from two donors The results of the following examples obtained from the donor TT08 are compared with the results obtained from the donor TT03 in Example 11. The results are summarized in table 22.Table 22 NA = not analyzed This clearly illustrates that libraries of similar quality should be isolated from two different donors immunized with TT. The reasons for the higher number of unique cognates in the library obtained from the TT08 donor are more likely due to the larger number of sequences analyzed.

Example 13: Comparison of the library of cognate pairs of Example 11 with a combinatorial phage display library, generated from the same donor. In the present example, a combinatorial phage display library of the same donor, previously used to prepare the library of cognate pairs, was prepared to compare library diversity, affinity and specificity between libraries of cognate pairs and combinatorial libraries. to. Construction of combinatorial phage library A library was generated that exhibits a phage of CD19 + fraction of donor cells TT03 (identical to the cell fraction obtained in Example 11c). Total RNA was prepared from approximately 5 x 105 CD19 + cells using the NucleoSpin kit of RNA L (Machery-Nagel, cat No. 740 962.20). The cDNA was subsequently synthesized in an oligo (dT) -primer reaction using ThermoScript reverse transcriptase (Invitrogen, cat No. 11146-016). The VH and kappa chains were amplified by PCR using the HotMasterTaq DNA polymerase (Eppendorf, cat. No. 0032 002,692) and primers essentially as described by de Haard et al., (J. Biol. Chem. 274, 18218-18230; 1999), only modified with respect to restriction enzyme recognition sequences at the 5 'end.

The combinatorial phage display library was generated by successive insertion of Kappa and VH PCR products into the vector exhibiting the phage Em351 (phh3 modified described in den, W. et al., 1999 J. Immunol. Methods 222, 45 -57). The final library was electroporated in strain of E. coli TGl (Stratagen). The size of the combinatorial library contains 3 x 106 independent clones with a high insert frequency. b. Overview of the combinatorial library Phage particles were prepared that exhibit Fab in accordance with standard procedures (eg, Antibody Engineering, A Practical Approach 1996, ed. McCafferty, Hoogenboom and Chiswell). An overview was made of tetanus toxoid (TT; SSI lot no. 89-2), diluted to 1 μg / mL in PBS, and immobilized in MaxiSorp immunotubes (Nuc cat. No. 444202). Following an incubation period of one hour and several washing steps, the bound phage particles were diluted using 100 mM TEA (Triethylamine). The eluate phage particle was neutralized and used to exponentially infect the growth of TG1 cells, from which phage particles exhibiting Fab-enriched for TT specificity were obtained. A second round of panoramas using eluted phage was performed following the general procedure outlined above. In parallel, three panoramic rounds were performed on fragment C of the tetanus toxin molecule (Sigma cat No. T3694), following the procedure outlined above. Single colonies were selected for binding to the tetanus toxin and fragment C of the unselected library, and after each panoramic round, of both series of panoramas described above. c. Comparison of specificity and affinity of combinatorial phage particle clones and clones of cognate pairs Single colonies were chosen from the unselected library and after each round of panoramas (in intact tetanus toxoid (TT) and the C fragment of tetanus toxoid) , respectively). The phage particles exhibiting Fab were analyzed for reactivity by ELISA assays. The number of positive Fab clones exhibiting TT and / or reactivity of fragment C of at least 2x antecedent reactivity and at least 4x antecedent reactivity are given in Table 23 to 35 below. All results are shown as numbers of specific clones / numbers of positive Fab clones.

Table 23: Clones selected in TT and analyzed by TT-specific ELISA Table 24: Clones selected in TT and analyzed by specific ELISA of fragment C Table 25: Clones selected in fragment C and analyzed by specific ELISA of fragment C The panoramic of the phage display library against TT, revealed an increased number of specific clones of TT when the number of panoramic rounds was increased, and only some clones were identified in the unselected library. No clones were found to be reactive with the C fragment of tetanus toxoid from the unselected library or after two rounds of library panning against TT. To obtain Fab fragments with specificity of fragment C from the combinatorial phage display library, this library has been paneled against fragment C specifically. By comparison, thirteen TT-specific clones of Example 11 were subjected to specific ELISA of fragment C, of these, seven showed reactivity above the 2x antecedent. In this way, Fab fragments with specificity to the fragment C of the tetanus toxin can be expressed from a library of cognate pairs obtained from individuals immunized with TT. This clearly illustrates the disadvantage of using panoramas to identify clones with specificity towards a particular antigen. If fragments of important antigens or epitopes are unknown, they can be discharged during panning, thereby resulting in a less efficient product at the end.

In addition, apparent affinities of the combinatorial clones were measured as described in the test of Example lli. Ten of the combinatorial clones obtained after two rounds of TT panoramas were analyzed, revealing apparent link affinities between 1 and 15 nM. For comparison, four of the nine clones analyzed from the library of cognate pairs (table 21) showed affinities in the pico-molar range. This indicates that the pairing of the variable regions as originally selected or by the immune system donors, in combination with the somatic hypermutations of the pairs that have been subjected as a pair, potentially results in apparent binding affinities higher than the random combinations of such variable regions. d. Comparison of clone sequences of TT-specific combinatorial phage particles and clones of cognate pairs The large amount of sequence data generated from the two libraries avoids direct comparisons of pure sequences. To visualize the difference between the VH and VL sequence pairs in the phage display library and in the library of cognate pairs, three were phylogenetically generated for the VH and VL sequences, and the pairs were illustrated in a point matrix. The pairing of phylogenetic information in a point matrix (Figure 25), revealed very different distribution profiles of VH and VL sequence pairs in the phage display library (Figure 25A), indicating little phylogenetic relationship between the VH and VH genes. VL according to the random pairing of V genes in this library. In contrast, pairs of VH and VL sequences from the library of cognate pairs (Figure 25B), show a grouped appearance indicating co-evolution of V genes, as expected for cognate pairs. Also, the genetic diversity is much higher for the V genes in the library of cognate pairs, compared with the V genes of the combinatorial library, indicating that the method of isolation of paired V genes is less deviated. Example 14: TI-CPR of Single-Combined Combined-Stage Multiple Stroke and Nested CPR Using T-Cells as Template Sources In this example, we describe how a single-stage multiple-splice-overlapping TI-PCR can be performed on lymphocytes T derived from a human donor. to. Obtaining a fraction of cells containing lymphocytes A blood sample was obtained from human donors, who have been subjected to the desired antigen, for example, by immunization, natural infection, malignancy, through an immune reaction or other diseases. Peripheral blood mononuclear cells (PBMC) are isolated using Lymphoprep (Axis-Shield, Oslo Norway, product No. 1001967), in accordance with the manufacturer's instructions. In the present example, T cells specific for the antigen were generated by further stimulation of the PBMC fraction. However, multiplex translipap TI-PCR can also be performed directly on single cells from the PBMC fraction or on a fraction of cells enriched for T cells (for example, by FACS classification for CD3 positive cells). b. Generation of antigen-specific T cells The PBMC cell fraction is re-suspended in an appropriate culture medium containing relevant cytosines such as IL2. In addition, the desired antigen is added to the culture, where it will be present in the T lymphocytes by antigen presenting cells (APC) present in the PBMC fraction. Alternatively, APC feeder cells treated in advance, so that they are presenting the desired antigen, can be added to the PBMC fraction. Such APC feeder cells can be APC exposed to the desired antigen in the form of for example, peptide, protein or other molecular form, or microbially infected ACP or transfected cells to express and present the antigen, or APC co-cultured with other antigenic cells , for example, such as cancer cells in the form of primary tissue or cell lines. Many different types of APC feeder cells are known from the literature, which includes transformed cell lines, B cell lines, dendritic cells, etc. The PBMC fraction is cultured for about 3 to 5 weeks, during which cells presenting fresh antigens are added together with cytosines, for example, on a weekly basis. This results in the proliferation, activation and maturation of T lymphocytes. At the end of the cultivation period, the cell culture will be dominated by antigen-specific T cells. If these cells are CD4 + or CD8 +, it depends on the disease, the antigen, the APC cells and the mixtures of cytosines used during the stimulation period. The specificity of the antigen can for example be tested with a CTL assay, proliferation assays and MHC tetramers loaded with the desired antigen (Altman, J. D., et al., 1996. Science 274, 94-96). Antigen-specific T cells are distributed to PCR tubes, either by limiting the dilution or by using a FACS to obtain a single cell against the container. The container can be stored at -80 ° C until use. b. TI-RCP Single-Phase Multiplex-Extension The Qiagen one-step TI-PCR kit (Qiagen cat. No. 210212, Hilden, Germany) was used for the multiple overlap-extension CT-PCR, essentially in accordance with the manufacturer's recommendations. Prior to the addition of the PCR reaction mixture to the PCR tubes, the cells were frozen. The reaction mixtures by PCR and cyclization conditions are initially exposed as described in Example 11 e-1. However, a certain amount of optimization can be expected for a new series of primers. The multiple overlap-extension primer mixture used, comprises the primers shown in Table 26.

Table 26 c. Semi-nested PCR Semi-nested PCR is likewise proposed to be performed as described in Example 11 e-2, and some optimization can be expected. The primers used are shown in Table 27.

Table 27 Catalyzed sequences correspond to the specific region of the gene. To verify that multiple overlap-extension PCR-PCR was successful, a proportion of the samples was analyzed from the semi-nested PCR reactions, subjecting 10 μl of each semi-nested PCR reaction to gel electrophoresis of 1% agarose using ethidium bromide for detection. The expected size of the overlap-extension fragment is approximately 850 bp (the exact size depends on the lengths of the variable regions). Approximately ten microliters of all the reactions performed that originate from the same donor are consolidated in a tube. An aliquot of combined PCR is subsequently purified using a QIAquick PCR purification kit, in accordance with the manufacturing process (Qiagen cat No. 28106, Hilden, Germany) The purified combination of overlapping PCR products can be deferred with enzymes of appropriate restriction and subsequently purified and inserted into a suitable vector In the present experiment, primers of the constant region (SEQ ID NOs 376 and 377) used in semi-nested PCR are designed for sub-cloning of the PCR product Semi-nested in a suitable vector The design of the Cß primers relies on the change of a SER to Met at position 21 in the constant region peptide of the β chain, by which, an Nsil site can be introduced into the nucleic acid sequence: Nsil tcc falls -> atg cat SER HIS MET HIS This translation must be relatively safe, since SER 21 is exposed in the constant region of the β chain in a loop structure at the proximal end of the domain membrane.

This relative conservative change is therefore not, probably interrupting the total domain structure. The Ca primer design relies on changing nucleotides corresponding to pos. 15-17 in the α-chain constant region peptide, by which, a Sacl site can be introduced into the nucleic acid sequence: Sacl aaa tcc agt - > aag age tet LYS BE SER LYS BE SER Suitable vectors will therefore contain the remaining portions of the constant regions of the TlR Oi and ß chains, and will contain appropriate modification in terms of restriction sites. These changes can be made using standard sub-cloning and RCP techniques. e. Additional Considerations The large number of variable region primers can potentially interact in an inhibitory manner during amplification of multiple overlap-extension PCR. To avoid this, variable region primers can be divided into sub-series and used separately in appropriate combinations. Other Modalities All publications and patent applications cited in this specification are incorporated herein by reference, as if each individual publication or patent publication was specifically and individually indicated as being incorporated by reference. Although the aforementioned invention has been described in some detail by way of illustration and exercise for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in view of the teachings of this invention, that certain changes and modifications may be done without departing from the spirit or scope of the appended claims. It is noted that in relation to this date, the best method known to the applicant to carry out the aforementioned invention, is that which is clear from the present description of the invention.

Claims

CLAIMS Having described the invention as above, the content of the following claims is claimed as property:

1. Method for linking a plurality of non-contiguous nucleotide sequences of interest, characterized in that said method comprises: a) amplifying, in a multiple molecular amplification method, nucleotide sequences of interest using a template derived from a single ated cell or a population of enic cells; and b) effecting the linking of the nucleotide sequences of interest amplified in step a).

Method according to claim 1, characterized in that the nucleotide sequences of interest comprise the sequences encoding the variable region and the link generates a cognate pair of sequences encoding the variable region.

3. Method according to claim 1 or 2, characterized in that the nucleotide sequences of interest comprise sequences encoding the immunoglobulin variable region and the linkage generates a cognate pair of a sequence encoding the light chain variable region, associated with a sequence encoding a heavy chain variable region .

Method according to claim 1 or 2, characterized in that the nucleotide sequences of interest comprise sequences encoding the variable region of the T-cell receptor and the linkage generate a cognate pair consisting of a sequence encoding the variable chain region alpha associated with a sequence encoding the beta chain variable region or a sequence encoding the gamma chain variable region associated with a sequence encoding the delta chain variable region.

5. Method for randomly linking a plurality of non-contiguous nucleotide sequences of interest, characterized in that said method comprises: a) amplifying, in a multiple molecular amplification method, nucleotide sequences of interest, using a template derived from a population of genetically diverse cells; and b) carrying out the binding of the nucleotide sequences of interest, amplified in step a).

6. Method according to claim 5, characterized in that said population of cells are subjected to lysis.

Method according to claim 5 or 6, characterized in that said nucleotide sequence of interest comprises sequences coding for a variable region and the link generates a combinatorial library of pairs of sequences encoding a variable region.

Method according to claim 7, characterized in that said nucleotide sequence of interest comprises sequences that encode the immunoglobulin variable region and the link generates a combinatorial library of pairs of sequences encoding a variable region of light chain and a variable region heavy chain.

Method according to claim 7, characterized in that the nucleotide sequence of interest comprises the sequences encoding the variable region of the T-cell receptor and the linkage generates a combinatorial library of pairs of sequences encoding a variable region of a chain a variable region of ß chain.

10. Method according to any of the preceding claims, characterized in that said method of multiple molecular amplification is a multiple TI-PCR amplification.

11. Method according to claim 10, characterized in that said multiple TI-PCR amplification is a two-step process comprising a separate reverse transcription (RT) stage before amplification by multiple PCR.

12. Method according to claim 10, characterized in that the multiple TI-PCR amplification is performed in a single stage that comprises initially adding all the necessary components to perform both the reverse transcription (RT) and the multiple PCR amplification in a single container .

13. Method of compliance with any of the preceding claims, characterized in that said binding of the nucleotide sequences of interest is carried out in the same vessel as the multiple molecular amplification. 1 .

Method according to any of claims 10 to 13, characterized in that the binding of the nucleotide sequences of interest is carried out in association with the amplification by multiple PCR, using a mixture of multiple overlap-extension primer.

15. Method according to any of the preceding claims, characterized in that said binding of the nucleotide sequences of interest is effected by ligation.

Method according to any of the preceding claims, characterized in that the additional molecular amplification is carried out, using a primer mixture adapted to amplify the linked nucleic acid sequences of interest.

17. Method according to claim 14, characterized in that the mixture of multiple overlap-extension primer comprises series of primers wherein at least one element of the series of primers of each series of primers comprises an overlap-extension end capable of hybridizing to the overlap-extension end of an element of the primer series of a second set of primers.

Method according to claim 14 or 17, characterized in that the multiplextranslamp primer combination comprises: a) at least one CL or JL primer complementary to the sense strand of a sequence encoding the immunoglobulin light chain region; b) at least one VL5 'primer or VL primer complementary to the antisense strand of a sequence encoding the immunoglobulin light chain variable region or light chain variable region leader sequence, and capable of forming a series of primers with the (the) primer (s) in step a); c) at least one CH or JH primer complementary to the sense strand of a sequence encoding the immunoglobulin constant heavy chain domain or a sequence encoding the heavy chain binding region; d) at least one VH5 'or VHL primer complementary to the antisense strand of a sequence encoding the immunoglobulin heavy chain variable region or heavy chain variable region leader sequence, and capable of forming a series of primers with the ) primer (s) in step c).

19. Method according to claim 18, characterized in that the primers of step b) are VLL primers with at least 90% sequence identity with the specific region of the gene of SEQ IDs 93 to 98, and the primers of the step d) are VHL primers with at least 90% sequence identity with the specific region of the gene of SEQ IDs 86 to 92.

Method according to any of the preceding claims, characterized in that the single cell, the population of isogenic cells or the population of genetically different cells, is obtained from a fraction of cells containing lymphocytes.

21. A method for producing a library of cognate pairs, comprising linked variable region encoding sequences, characterized in that said method comprises: a) providing a cell fraction containing lymphocytes from a donor; b) optionally enriching a particular lymphocyte population of said cellular fraction; c) obtaining a population of isolated single cells, comprising distributing cells of said cellular fraction individually in a plurality of containers; and d) amplifying and effecting the binding of the sequences encoding the variable region contained in said population of isolated single cells, according to a method of any of claims I to 4 or 10 to 20, insofar as these are dependent on

22. The method according to claim 21, characterized in that the single isolated single cell in the population of single cells is expanded to a population of isogenic cells, before carrying out the amplification and binding (step d).

23. Method according to any of claims 20 to 22, characterized in that the cell fraction containing lymphocytes constitutes whole blood, bone marrow, mononuclear cells or white blood cells.

24. Method according to any of claims 20 to 23, characterized in that the lymphocyte-containing cell fraction is enriched for cells of the B lymphocyte lineage.

Method according to any of claims 20 to 24, characterized in that the fraction cell that contains lymphocytes or lineage of B lymphocytes, is enriched by plasma cells.

Method according to any of claims 20 to 25, characterized in that the cells of the cell fraction containing lymphocytes, lineage of B lymphocytes or plasma cells, are enriched for antigen specificity.

27. Method according to any of claims 20 to 23, characterized in that the lymphocyte-containing cell fraction is enriched for cells of the T lymphocyte lineage.

Method according to any of claims 20 to 23, characterized in that the cells Antigen-specific T, are generated by stimulation of the cell fraction containing lymphocytes.

29. Method according to any of the preceding claims, characterized in that it further comprises inserting the linked nucleotide sequences or a library of cognate pairs into a vector.

30. Method according to claim 29, characterized in that said vector is selected from cloning vectors, shuttle vectors, display vectors or expression vectors.

31. Method according to claim 29 or 30, characterized in that the linked nucleotide sequences or the individual elements of the library of cognate pairs, comprise a sequence encoding the immunoglobulin heavy chain variable region associated with the sequence encoding the light chain variable region and said sequences are inserted into the structure in a vector that already contains sequences encoding one or more constant immunoglobulin domains or fragments thereof.

32. Method according to claim 29 or 30, characterized in that the linked nucleotide sequences or the individual elements of the library of cognate pairs, comprise a sequence encoding the variable region of a chain of the T cell receptor, associated with sequences encoding the β-chain variable region and said sequences are inserted into the structure in a vector that already contains sequences encoding one or more constant domains of the T cell receptor or fragments thereof.

33. Method according to any of claims 21 to 32, characterized in that it further comprises creating a sub-library by selecting a subset of cognate pairs of linked variable region sequences encoding binding proteins with a desired target specificity, generating a library of cognate pairs specific to the target sequences that encode the variable region.

34. Method according to any of claims 31 to 33, characterized in that it further comprises transferring said cognate pair or library of target-specific cognate pairs, from sequences encoding the variable region to a mammalian expression vector.

35. Method according to claim 34, characterized in that the mammalian expression vector encodes one or more constant region domains selected from human immunoglobulin classes IgAl, IgA2, IgD, IgE, IgGl, IgG2, IgG3, IgG4, IgM, chain light kappa or lambda light chain or alpha, beta, delta and / or gamma chains of the T cell receptor.

Method according to one of claims 29 to 35, characterized in that it also comprises the steps: a) introducing a vector which encodes a segment of linked nucleotide sequences in a host cell; b) culturing said host cells under conditions adapted for expression; and c) obtaining the protein product expressed from the vector inserted into said host cell.

37. Method according to claim 36, characterized in that said protein product is a monoclonal antibody comprising a cognate pair of a light chain variable region associated with a heavy chain variable region.

38. Method according to claim 36, characterized in that said polypeptide product is a T cell receptor comprising a cognate pair of a variable region of alpha chain associated with a variable region of beta chain.

39. Library of cognate pairs, characterized because it consists of sequences that encode the bound variable region.

40. Library according to claim 39, characterized in that said cognate pairs of sequences encoding the variable region, are obtained by the method according to claim 21 or any claim dependent on this.

41. Library according to claims 39 or 40, characterized in that an individual element of said cognate pairs comprises a sequence encoding the immunoglobulin light chain variable region associated with a sequence encoding the heavy chain variable region.

42. Library according to claim 41, characterized in that said single element encodes a full length antibody selected from human immunoglobulin classes IgA1, IgA2, IgD, IgE, IgG1, IgG2, IgG3, IgG4 or IgM.

43. Library according to claim 39 or 40, characterized in that an individual element of said cognate pairs comprises a sequence encoding a variable region of alpha chain TcR associated with a sequence encoding the beta chain variable region or a sequence encoding the gamma chain variable region associated with a sequence encoding the delta chain variable region.

44. Library in accordance with the claim 40, characterized in that said individual element encodes a full-length TcR.

45. Sub-Library of cognate pairs of sequences encoding the variable region characterized in that it encodes proteins that have desired binding specificities directed against a particular target.

46. Sub-Library characterized in that it encodes proteins that exhibit targeted binding specificities directed against a particular target, selected from a library according to one of claims 39 to 44.

47. Sub-Library of cognate pairs of sequences encoding a region light chain variable and a linked immunoglobulin heavy chain variable region, characterized in that the immunoglobulins that are expressed from said library, are capable of reacting with, or binding to, the Tetanus Toxin.

48. Population of host cells, characterized in that it comprises a library or sub-library according to any of claims 39 to 47.

49. Population of host cells according to claim 48, characterized in that the cells are mammalian cells.

50. Recombinant polyclonal protein, characterized in that it is expressed from the host cells according to claim 48 or 49.

51. Recombinant polyclonal immunoglobulin or fragments thereof, characterized in that they are capable of reacting with or binding to the tetanus toxin.

52. The recombinant polyclonal immunoglobulin according to claim 51, characterized in that the individual elements are cognate pairs.

53. The recombinant polyclonal immunoglobulin according to claim 51 or 52, characterized in that it comprises at least two individual cognate pairs comprising a sequence encoding an immunoglobulin heavy chain variable region, associated with a sequence encoding a variable region of light chain, with at least 90% identity to a pair of individual SEQ ID, selected from the group consisting of pairs SEQ ID 229: 276, 262: 309, 240: 287, 245: 292, 267: 314, 246: 293, 258: 305, 242: 289, 231: 278, 263: 310, 232: 279, 237: 284, 255: 302, 260: 307, 251: 298, 233: 280; 228: 275, 244: 291, 250: 297, 252: 299, 264: 311, 272: 319, 235: 282 or 238: 285.

54. Recombinant immunoglobulin or fragments thereof capable of reacting with or binding to the Tetanus Toxin, characterized in that the complementarity determining regions (CDR1, CDR2 and CDR3) are derived from one or more pairs of SEQ ID in accordance with the claim 53.

55. Pharmaceutical composition characterized in that it comprises a recombinant polyclonal immunoglobulin according to claim 50 as an active ingredient, combined with at least one pharmaceutically acceptable excipient.

56. Pharmaceutical composition characterized in that it comprises a recombinant polyclonal antibody capable of reacting with or binding to the Tetanus Toxin as an active ingredient, optionally combined with a pharmaceutically acceptable excipient.

57. Pharmaceutical composition according to claim 55 or 56, characterized in that it is for use as a medicament.

58. Method for preventing or treating a patient at risk of developing tetanus, characterized in that a composition comprising a recombinant polyclonal antibody capable of reacting with or binding to the Tetanus Toxin is administered to a patient in need thereof.