MXPA06001820A - Use of polypeptides of the cupredoxin family in cancer therapy - Google Patents

Abstract

Cytotoxic factors having use in modulating cell death, and their use in methods of treating necrosis or apoptosis- -related conditions are disclosed. The invention also relates to methods for identifying active agents useful in treating conditions related to cell death or uncontrolled growth. The present inventors have found that different microorganisms produce different cylotoxic factor(s) having anticancer activity. The substantially pure cytotoxic factors can be used in a method of treating an infectious disease or a cancer.

Description

USE OF POLYPEPTIDES OF THE CUPREDOXIN FAMILY IN CANCER THERAPY RELATED REQUESTS This application claims the priority of the US Provisional Patent Application No. 60 / 414,550, filed on August 15, 2003, and is a continuation in part of the Patent Application North American Series No.10 / 047,710, filed on January 15, 2002, which claims the priority of the US Provisional Patent Application Series No. 60 / 269,133, filed February 15, 2001. The entire content of these prior applications is incorporated in its entirety by reference to the present invention. GOVERNMENT INTEREST STATUS The subject matter of the present application has been supported by the research grants of the National Institute of Health (NIH), Bethesda, Maryland, E.U.A. (Concession Numbers to 16790-21, ES 04050-16, Al 45541, CA09432 and N01 -CM97567). The government may have certain rights in the present invention. Field of the Invention The present invention relates to cytotoxic factors secreted by microorganisms and inhibitors of cytotoxic factors, and their use to cause the arrest of cell growth and to modulate cell death by necrosis and apoptosis. The present invention also relates to methods for producing, isolating and identifying said cytotoxic factors and to compositions that incorporate substantially pure cytotoxic factors useful in the modulation of cell death and to cause the arrest of cell growth. The present invention also relates to methods for treating conditions related to apoptosis. More particularly, the present invention relates to the use of a substantially pure cytotoxic factor in a method for inducing apoptosis or arrest of cell growth in a cancer cell, and to the use of inhibitors the cytotoxic factors to treat an < infection or another condition induced by pathogens. Background of the Invention Infectious diseases can be a product of a number of environmental factors. Underlying any infectious disease is an infectious agent that causes it. The infectious agent is usually a pathogenic microorganism, for example, a pathogenic bacterium. The degree or capacity of the pathogenic microorganism to overcome the defense mechanisms and cause a disease, is related to its virulence. Microorganisms both pathogenic and non-pathogenic pathogenic are known to express cytotoxic factors, which allow microorganisms to defend themselves from the host immune system and prevent (for example, macrophages and mast cells) that the phagocytes eliminate the microorganism from the body. When pathogenic microorganisms survive, microorganisms can invade host tissues and proliferate, causing various symptoms of disease. Pathogenic bacteria have been identified as a cause or root of a variety of debilitating or fatal diseases, including for example tuberculosis, cholera, strong cough, plague and the like. To treat such severe infections, drugs are administered, for example antibiotics, which either kill the infectious agent or disarm the cytotoxic factors so that the infectious agent no longer has the ability to self-defend against the host's immune system. However, pathogenic bacteria commonly develop resistance to antibiotics and improved agents are needed to prevent the spread of infections due to said microorganisms. A cancer is a malignant tumor with potentially limited growth. It is mainly the pathogenic replication (a loss of normal regulatory control) of several types of cells that are found in the body human. The initial treatment of the disease is often surgery, radiation treatment or the combination of these treatments, although frequently the disease is locally recurrent and metastatic. Chemotherapeutic treatments are available for certain cancers, although these rarely induce a long-term regression. Therefore, they are often not curative. Normally, tumors and their metastases become refractory to chemotherapy, in an event known as the development of resistance to multiple drugs. In many cases, the tumors are inherently resistant to certain classes of chemotherapeutic agents. In addition, such treatments threaten non-cancerous cells, are completely stressful for the human body, and produce many side effects. Therefore, improved agents are needed to prevent the spread of cancer cells. Many cancers are known to return when patients become infected with pathogenic bacteria. However, very little is known about how bacterial infections cause the regression of human cancers. Summary of the Invention The present invention relates to cytotoxic factors that stimulate cell death by necrosis or apoptosis, or that cause the arrest of cell growth. In one aspect, substantially pure cytotoxic factors have been characterized and isolated. Substantially pure cytotoxic factors are obtained by column chromatographic fractionation of a growth medium which has been exposed to a pathogenic microorganism. Preferably, the production and secretion of said cytotoxic factors are stimulated during the growth of the pathogenic organisms in the presence of mammalian proteins. In another aspect of the present invention, the identification of mammalian protein receptors as a means of delineating virulent and avirulent microorganisms can lead to improved specificity for the treatment of the disease. Yet another aspect of the present invention relates to a method for treating a condition related to cell death resistance or susceptibility, wherein the method comprises the step of administering a cytotoxic factor, an inhibitor of a cytotoxic factor or a variant or derivative of the same, optionally incorporated in a pharmaceutical vehicle. The cytotoxic factor, or a variant or derivative thereof can be incorporated into a composition Pharmaceutical for use in the present invention and for the treatment of conditions related to abnormal cell proliferation. For example, a cytotoxic factor can be used to treat a cancer. An inhibitor of a cytotoxic factor, or a variant or derivative thereof, can be used to treat a bacterial infection, preventing phagocytic cell death and thereby allowing the host immune system to fight an invading pathogen. In another embodiment of the present invention, the cytotoxic factors, as well as the components of their secretion machinery, can be used as candidates for vaccines against infectious agents. The present invention also relates to a method for modulating cell death, wherein the method comprises the step of controlling the secretion of cytotoxic factors. In one embodiment, the cytotoxic factors can be used as anticancer agents against a host of human cancer cells. Cytotoxic factors can also be used as targets for the development of drugs, through classification or rational design of inhibitors. The present invention also relates to a method for modulating cell death wherein the method comprises using a cytotoxic factor such as a azurine, a plastocyanin, a rusticianin, a pseudoazurin, or a cytochrome c551, or a mutant of said cytotoxic factor. These and other aspects, advantages and characteristics of the present invention can be appreciated from the figures and detailed description of the preferred embodiments that follow. Brief Description of the Figures Figure 1. Graph showing the effect of 1.0 mM ATP on macrophage killing in the absence or in the presence of the filtered growth medium supernatant (SUP) or the column chromatographic fractions of the complete hydroxyapatite flow (HAFT), complete ATP-agarose flow (AAFT) and complete Q-sepharose flow (QSFT) derived from the growth medium B. cepacia. The degree of macrophage cell death is measured by the release of intracellular enzyme lactate dehydrogenase (LDH). In this test, 2 μg of protein from each fraction was used. All the tests were carried out in triplicate and the error bars are indicated. Figure 2. Graph showing the effect of the supernatant of filtered growth medium (SUP) and the column chromatographic fractions (HAFT, AAFT and QSFT) of B. cepacia on macrophage cell death in the absence of ATP. The degree of macrophage cell death it is measured by the release of intracellular enzyme lactate dehydrogenase (LDH). All tests were carried out in triplicate and error bars are indicated. Figure 3. Charts showing caspase activities (figure 3A-caspasa-3; Figure 3B-caspase-9) in the cytosolic extracts of J774 macrophages treated with the QSFT fraction of B. cepacia. Cytosolic extracts were prepared from macrophages incubated overnight with QSFT fraction from B. espacia (10 μg protein) and untreated macrophages. The substrate for the determination of caspase-3 activity was Ac-DEVD-pNA (N-acetyl-Asp-Glu-Val-Asp-p-N02-aniline). The substrate for caspase-9 activity was Ac-LEHD-pNa (N-acetyl-Leu-Glu-His-Asp-p-N02-aniline). The extracts were incubated with the substrate at a temperature of 37 ° C for the times indicated. In each case, 10 μg of macrophage cytosolic protein was used. The release of pNA (p-nitroaniline) was determined spectrophotometrically at 405 nm. Figure 4. Graph showing cytotoxicity as measured by% lactate dehydrogenase (LDH) release, in macrophages in the presence of azurine (Az), cytochrome c551 (Cyt C55?) And combinations thereof. The numbers represent μg of protein. On the right is the control of regulation (regulator). Figure 5. Graph showing the effects of anti-azurine and anti-cytochrome c551 antibodies on cytotoxicity of B. cerpacia (A) and M. Bovis (B) QSFT and in the presence of pre-immune serum. A, azurine (50 μg); C, cytochrome c551 (25 μg); ab, combination of anti-azurine and anti-cytochrome c551; P, pre-immune serum. 2 μg of QSFT fraction was used in each assay. The numbers after ab and P represent μg of the antibody or pre-immune protein. The results shown are average ± standard deviations of experiments in triplicate. Figure 6. Graph showing the effect after the injection of azurine / cytochrome c551 in mice deprotected in the size of the tumor after the induction of melanoma tumor cells (UISO-Mel-2). Approximately 10 6 UISO-Mel-2 cells were injected subcutaneously in uncovered mice followed by intraperitoneal injections once a week either from citrate buffer (control), a known anti-melanoma drug from DTIC (7.5 μg) or three times a week of a high dose (150 μg of azurine / 75 μg of cytochrome c55) or low (10 μg of azurine / dμg of cytochrome c551) of a mixture of azurine / cytochrome c55? for 4 weeks. On several occasions, the sizes (tumor volume) of the tumors were determined and plotted in graphic form. control (treated with regulator), treated with DTIC and mice treated with high and low doses of azurine / cytochrome c551. Figure 7. Graph showing the gain or loss of weight of the mice during the experiment described in figure 6. During the course of the previous experiment, the mice were weighed on a scale and the weights were recorded in grams. Figure 8. Graph showing Mel-6 tumor regression in uncovered mice treated with QSFT M. Bovis fraction in the presence or absence of azurine (AZ). Approximately 10 6 UISO-Mel-6 cells were injected subcutaneously in the discovered mice. Small tumors developed after about a week. Subsequently the mice were injected intraperitoneally with phosphate-regulated saline (control), QSFT M. Bovis fraction or a mixture of QSFT M. Bovis fraction and azurine. Figure 9. Graph showing the cytotoxicity of azurine for MCF-7 (B) and MDA-MB-157 (D) treated with various concentrations of azurine for 72 hours. Figure 10. Graph showing regression of MCR-7 tumor in unprotected mice treated with azurine (M) and control animals (D). Figure 11 (a) and (b). Figure 11 (a) is a table that shows the alignment of the amino acid sequence of azurine P. aeruginosa with other bacterial azurines. The amino acid sequences are aligned using the Genetyx software. Figure 11 (b) is a table showing the wild-type azurine (wt azurine) and chimeric mutant azurines. Figure 12 (a) and 12 (b). Figure 12 (a) is a graph showing the cytotoxicity of wild-type azurines and redox mutants towards macrophage cells. Azurines natural type (•), apo-azurine (o), M44KM64E (A), C112 (?).

Figure 12 (b) is a graph showing the cytotoxicity of wild-type azurines and chimeric mutants to macrophage cells. Azurine natural type (•), S1 (O), S2 (A), S3 (B), S4 (?), S6 (D), wtS5 (T), wtS5S4S6 (), S3S5 (V). Figure 12 (b) also shows the relative electron transfer efficiency of the mutants expressed as a percentage of the wild type azurine. To calculate the cytotoxicity the number of viable untreated cells was taken as 100%, and the number of viable cells in the samples treated with azurine was determined. Figure 13 is a graph showing the apoptotic activity of azurine, apo-azurine and azurin mutants towards macrophage cells. Azurine natural type (•), apo-azurine (O), M44KM64E (A), C112D (?).

Figure 14 is a graph showing the cytotoxicity of wild type azurine (wtazuA), rusticianina (raw •), apo-rusticianina (apo-rus o), and pseudoazurina (Peace D). Figure 15 is a graph showing the cytotoxicity of wild type (•) and plastocyanin (B).

Detailed Description of the Invention Definitions For the purposes of the present invention, the term "cytotoxic factor" refers to a factor secreted by a pathogenic or non-pathogenic microorganism and that stimulates cell death by necrosis or apoptosis or that causes the arrest of cell death . Examples of cytotoxic factors include azurine, a plastocyanin, a rusticianin, a pseudoazurin, or a cytochrome c551. The term "dependent-ATP", when used to modify the term "cytotoxic factor" refers to a cytotoxic factor which acts to cause cell death or arrest of cell growth in the presence of 5 'adenosine triphosphate (ATP) . The term "Independent of ATP" when used to modify the term "factor" "Cytotoxic" refers to a cytotoxic factor that acts to cause cell death or arrest cell growth in the absence of ATP For the purposes of the present disclosure, the term "treatment" includes the prevention, reduction, arrest, or reversal of the progression or severity of the condition or symptoms being treated Therefore, the term "treatment" includes as appropriate, medical, therapeutic and / or prophylactic administration As used in the present invention, the term " a condition related to resistance to cell death "refers to a disease, condition or ailment characterized by at least one prolonged cell life tendency, when compared to a healthy cell of a type determined by a person skilled in the art or a treating physician The term "a condition related to susceptibility to cell death", as used in the present invention, refers to a disease, condition or condition characterized by at least one tendency of premature cell death when compared to a healthy cell of this type as determined by one skilled in the art or attending physician. As used in the present invention, the term "having a p53 functional tumor suppressor gene" refers to a cell that has a p53 tumor suppressor gene that is not deactivated, mutated, lost or byproduced. As used in the present invention, the term "p53 tumor suppressor gene deficiency" refers to a cell having a p53 tumor suppressor gene that is deactivated, mutated, lost or byproduced. For example, such deficiency may occur as a result of genetic aberrations within the p53 gene or interaction with viral and cellular oncogenes. The term "substantially pure", when used to modify the term "cytotoxic factor", as used in the present invention, refers to a cytotoxic factor, for example a cytotoxic factor isolated from the growth medium secreted in a substantially free of, or not adulterated by, the active inhibitor compounds. The term "substantially pure" refers to a factor in an amount of at least about 75%, by weight, of fraction isolated or at least about "75% substantially pure". More preferably, the term "substantially pure" refers to a compound of at least about 85% by weight of the active compound or at least "85% substantially pure". The substantially pure cytotoxic factor can be used in combination with one or more substantially pure compounds or isolated cytotoxic factors. As used in the present invention, the term "a variant or derivative" of a cytotoxic factor refers to a compound or substance obtained by chemical modification or manipulation of the cytotoxic factor or the gene encoding the cytotoxic factor or the gene encoding the cytotoxic factor. The variant or derivative of a cytotoxic factor can be obtained by chemical modification of the cytotoxic factor, or by manipulation of genes that code for the cytotoxic factor, for example, altering the basic composition or characteristics of the cytotoxic factor, although it is not toxicity. Similarly, "a variant or derivative" of an inhibitor of a cytotoxic factor may include chemical modifications to the chemical structure of the inhibitor or manipulation of genes encoding the inhibitor. The term "percentage (%) of amino acid sequence identity" is defined as the percentage of amino acid residue in a cytotoxic factor that are identical with the amino acid residues in a candidate sequence when the two sequences are aligned. To determine the% amino acid identity, the sequence is aligned and, if necessary, gaps are introduced to achieve a maximum% identity and sequence; they are not considered conservative substitutions as part of the identity of sequences. Sequence alignment procedures are amino acids to determine percent identity, are well known to those skilled in the art. Frequently publicly available computer software, such as BLAST, BLAST2, ALIGN2, or Megalign (DNASTAR) is used to align peptide sequences. When the amino acid sequences are aligned the percentage of amino acid sequence identity of an amino acid sequence determined to, for, with, or against a given amino acid sequence B (which may alternatively be phrased as a given amino acid sequence A it has or comprises a certain percentage of amino acid sequence identities for, with or against a given amino acid sequence B), it can be calculated as:% amino acid sequence identity = X / Y 100 where X is the number of residues of amino acids qualified as identical matches by aligning the algorithm or sequence alignment program of A and B and Y is the total number of amino acid residues in B. If the length of the amino acid sequence A is not equal to the length of the amino acid sequence B,% amino acid sequence identity of A to B is not equal to the% amino acid sequence identity of B for A. A "therapeutically effective amount" is an effective amount to prevent development, alleviate the existing symptoms of the subject being treaty. The determination of a therapeutically effective amount is within the ability of those skilled in the art. General. The present invention provides cytotoxic factors that are secreted by pathogenic or non-pathogenic microorganisms and that stimulate cell death by necrosis or apoptosis or that cause arrest of cell growth. When pathogenic microorganisms invade human or animal tissues, phagocytic cells are a first line of defense in the host's immune system. Normally, phagocytes seek out and destroy external pathogens that invade the body. However, cytotoxic factors secreted by microbial pathogens can stimulate cell death in phagocytic cells. Therefore, phagocytes are prevented from performing their immunoprotective function. The inventors of the present invention have previously reported that many pathogenic bacteria secrete ATP-dependent cytotoxic factors, for example, enzymes that use ATP, which cause phagocytic cell death by necrosis. [Zaborina O. and associates., Infecí. Immun. 67: 5231-5242 (1999); Melnikov A. and associates., Mol. Mycrobiol. 36: 1481-1493 (2000); and Punj V. and associates., Infecí. Immun. 68: 4930-4937 (2000), whose confidencies are incorporated for all purposes to the present invention as a reference]. Enzymes that ulilize ATP act on various energy-related nucleotide derivatives, ATP, adenosine 5'-diphosphate (ADP), 5'-adenosine monophosphate (AMP) or adenosine, converting them into several products that in turn can modulate the morphology of phagocytic cells, as macrophages and cells, through the acyvation of purinergic receptors. One aspect of the present invention relates to the discovery that independent cytotoxic factors of ATP, for example redox proteins, lambin are secreted by cyerogenic species of paleogenic microorganisms and that said facies originate from phagocytic cell mediating apophobiasis [Zaborina O. and associated ., Microbiology 146: 2521-2530 (2000), whose contents are incorporated for all purposes to the present invention as a reference]. Another aspect of the present invention relates to the surprising discovery that cytoxic factors independent of ATP induce apoptosis or cell growth rescímí in cancer cells. Said cyclo-toxic facfores can be used to treat a condition related to resistance to cell death. These conditions may includefor example, human melanoma, leukemia, breast cancer, ovarian cancer, lung cancer, mesenchymal cancer, colon cancer, and airway degenerative cancers (e.g., stomach, esophagus, larynx, and oral cancers). Normally the cancer cells are not suscepíibles to apopíóíica dying. Said resistance to apoptotic cell death may originate through the deactivation of mutations in the gene encoding the p53 suppressor tumor protein. It is known that mammalian cellular apopiosis requires the presence of the p53 profine. However, in 50% of human cancers, deactivation mutation is found in the gene that encodes the p53 suppressor of p53. Although it is also known that p53 regulates the expression of redox proteins in mammalian cells, mammalian redox proteins have not been implicated in apoptosis or arrested growth of cancer cells. Nor is the role of independent cyprofoxic favors of microbial ATPs to induce apoptosis in cancer cells or in reducing tumor size.

Another aspect of the present invention relates to methods for identifying and characterizing cytotoxic factors secreted by microorganisms. Such methods can provide a means to discover suitable inhibitors or stimulators of cell death. Inhibitors and sphimulators can be developed as pharmaceutical drugs, and are used to irritate conditions characterized by resistance or susceptibility to cell death. Another aspect of the present invention relates to cytotoxic facfores that have been characterized and isolated and to inhibitors of said cytoxic factors. The cyclo-toxic factors may be activated or deactivated according to a method of the invention to prevent or inflict a condition related to cell death. An inhibitor of a cytotoxic agent can be used to treat a condition related to the susceptibility to cell death. Secretion of Ciíoíóxicos Faciosres. In an aspect of the present invention, cyclooxy facifers are secreted through a number of different pathogenic microorganisms, including bacterias and proiozoa. Examples of suitable paleogenic bacferia to provide the ciopoxic facies include, but were not limited to, Pseudomonas aeruginosam.

(P. aeruginosa), Burkholderia cepacia (B. cepacia), Vibrio cholerae (V. cholerae), and Mycobacterium bovis (M. Bovis). In addition, the cycloxic facies are segregated by paphogens, fales such as Leishmania anazonensis and Brugia malayi. P. aeruginosa, a pathogenic oporisun, B. cepacia, which causes pharyngeal infections in patients suffering from cystic fibrosis and chronic granulomatous disease, V. cholerae, the infectious pathogen that causes cholera, and the slow growth of a virulent microbial group , Fales such as M. Tuberculosis or M. bovis, which cause Iuberculosis, have been discovered by secreting enzymes that use ATP. In addition to secreting enzymes that use ATP, the inventors have discovered that P. aeruginosa secretes independent cytophobic favors of ATP. These have been identified as two redox proteins, azurine and cyclochrome c551. B. cepacia has also shown to secrete redox proteins. M. bovis has also shown to secrete cytoxic factors that have alpha cytotoxicity independent of ATP towards phagocytic cells. Esimulation of the Facfores Segregation of Cifoioxicity in the Presence of Mammalian Profeins. In another aspect of the present invention, the production and secretion of cyclophoxic facsimiles are stimulated during the growth of paleogenic organisms in the presence of mammalian proteins. For example, the secretion of cyto-phobic factors mediating pathogenic microorganisms, such as P. aeruginosa, M. bovis and S. cepacia, is stimulated by the presence of mammalian prophelia such as kappa-casein, bovine serum albumin, ovalbumin or a2- macroglobulin. It is suggested, although not in a dependent manner, that the paleogenic microorganisms delegate the presence of certain mammalian proteins as an indication of the host environment of the mammal, thereby opening the secretion machinery for the cytoxic agents to ananogize and reveal themselves to the host's defenses. Guest. The inventors have concluded that several clinical isolates (virulenfos) from B. cepacia secrete large amounts of enzymes that use ATPal as adenylase or 5'-nucleoidase kinase, in which several environmental isolates (avirulenios) secreted only small amounts of enzymes. . In clinical isolates, such as strain B. cepacia 38, the level of secretion of the cycotoxic facfor is greatly improved in the presence of a2-macroglobulin in the growth medium. The segregated productions of the clinical isolates have a higher level of cyto-oxidase towards macrophages and cells than that of the environmental isolates. The clinical isolates which demonstrate improved secretion of cyclobiochemical facies in the presence of a2-macroglobulin also demonstrate the presence of receptors for a2-macroglobulin on its surface. In an embodiment of the present invention, the production and secretion of independent cytotoxic favors of ATP are stimulated during the growth of microorganism in the presence of mammalian proieins. The increased secretion of cytoxic factors can be obtained by growing microorganisms of organisms in the growth medium that contain mammalian proteins. Suitable growth media are, for example, broth L, broth, soy broth, syrup broth, and yeast-yeast extract broth (Difco Laboratories, Maryland, USA).

Normally, approximately 500ml to 1,000ml of sterile growth medium is inoculated with approximately 104 to 10 6 cells / ml. Possibly the inoculated medium is incubated under suitable conditions to allow the growth of the microorganism, normally in a rotary agitator at a femperafura of 30 ° C to 37 ° C. The selection of the growth medium, incubation conditions and other favors that allow the successful cultivation of bacteria and other microorganisms may be appreciated by the experts in the field. the technique The invenfores have observed that the maximum concentrations of cytotoxic factors in growth medium occur late in the exponential growth phase and early in the stationary growth phase. In another embodiment of the present invention, the identification of mammalian protein receptors provides a means for delineating virulent and avirulent strains of microorganisms. For example, the presence of receptors for primary a2-macroglobulin in clinical isolates, but not in environmental isolates, not only correlates with the ability of the former to secrete cyprofoxic agents as weapons against host defense, but also allows delineation between the clinical strains, virulent with the environmental strains, avirulent. Therefore, the virulenia strains of organisms can be idenified and subsequently tested with respect to their sensitivity to animals or for other clinical purposes. Purification of Independent Cylofoxic Facials ATP. In other aspect of the present invention, independent CTP-independent factors are substantially substantially chromatographic chromatography of the growing medium of the segregating microorganism.

Preferentially, the bacterial cells are eliminated from the growth medium and fractionated. This can be achieved by initial centrifugation and subsequent filtration of the growth medium. Suitable filters are usually less than or equal to a pore size of 0.5μm and preferably approximately 0.2μm. However other methods of pathogen removal will be known to those skilled in the art. The non-fractionated growth medium does not have any cyclooxic activity independent of ATP, and therefore fractional column chromatography is necessary to improve cell growth arrest activity or to induce apoptosis. Fractional eliminates cytotoxic factors dependent on ATP. It is also suggested, although not in a dependent manner, that fractionation also eliminates inhibitors of ATP-independent cytotoxic factors that can be found in unfractionated growth media. Chromatographic techniques useful for purifying cytoxic factors will be known to those skilled in the art. These include, for example, ion exchange chromatography, hydroxyapatite chromatography, affinity chromatography and gel filtration chromatography. Chromatographic columns useful in the fractionation of the bacterial growth medium include, for example: Hydroxyapatite; Superdex 75 or 200; Super 6 or 12; Sefacryl S; Sefadex G or Sephadex LH; Mono Q or Mono S; Q-Sepharose; DEAE Sepharose or CM Sepharose; Sepharose XL; ATP-Sepharose; Hi Trap Blue; Sepharose Blue; Cellulose or DNA Sepharose 2B, 2B or 6B, available from Amersham Pharmacia Biotech AB, Uppsala, Sweden or Bio-Rad Laboratories, Hercules, California, USA. Enzymes using ATP can also be isolated by column chromatographic fractionation as eluted fractions or through hydroxyapatite flow and ATP-agarose columns. During such fractionation, enzymes using ATP, such as ATPase or adenylate kinase, are absorbed in the column and can be eliminated or further purified. (See for example, the publication of Markaryan and associates, Bacteriol., 183, p 3345-3352, 2001). In one embodiment of the present invention, ATP-independent cytotoxic factors are isolated as fractions through flow of Q-sepharose columns (QSFT). Sepharose-Q is a strong quaternary ammonium anion exchanger. These columns can be obtained fromAmersham Pharmacia Biotech AB, Uppsala, Sweden. The supernatant (SUP) and other fractions of the column such as the complete flow fraction of hydroxypatype column (HAFT) or complete flow fraction of agarose-ATP column (AAFT) normally do not show high cyto-toxicity independent of ATP. Characterization of independent cytoxic factors of ATP. In a further aspect of the present invention, the fractionated grown media is tested for the presence of independent cytotoxic factors of ATP. The degree of cell death can be measured by means of the release of dehydrogenase from the inverse-cell enzyme (LDH) fal as described in the publication of Zaborina et al., Infection and Immunity, 67, 5231-5242 (1999) and Zaborina et al. Microbiology, 146, 2521-2530 (2000), whose contents are incorporated for all purposes to the present invention as a reference. The ability of cytotoxic factors independent of ATP to induce apoptosis can be observed through confocal microscopy of ApoAlerf mifosensor using a MITOSENSOR ™ APOLERT ™ Miiochondrial Membrane Sensor System (Clontech Laboraíories, Inc., Palo Alio, California, USA). In the trial, the healthy non-apoptotic cells fluoresced in red, in which cells with apoptotic cells fluoresced in green. A combination of red and green produce yellow fluorescence cells that represented cells of apopiophic bite. See the publication of Zaborina et al., Microbiology, 146, 2521-2530 (2000), whose contents are incorporated for all purposes of the present invention as a reference. Apoptosis is transmitted by the activation of a cascade of enzymes known as caspazas, which are proteases of cisieína, which dissociate in aspartic residues. Therefore, apoptosis can also be detected by measuring two important caspase acfivities, that is, caspase 9 and caspase 3, which are known to be activated during apoprosis by the oligomerization of chromochrome c released from myocondria with propiosin. -1, using the method described in the publication of Zou et al., J. Biol. Chem., 274: 11549-11556 (1999), whose contents are incorporated for all purposes to the present invention as a reference. Apoptosis can also be observed by detecting fragmentation of nuclear DNA induced by apoptosis using, for example, the APOLERT DNA fragmentation kit (Clontech Laboratories, Inc., Palo Alio, California, USA). This essay is based on the effigylation of the bite extrusion of dUTP lransmiiido by desermininucloidilfransferase (Tdf) (TUNNEL), in where Tdí calalises the incorporation of dUTP fluorescence into the free 3'-hydroxyl ends of the fragmented DNA in cells undergoing apoptosis. The incorporation of fluorescence-dUTP in the fragmented nuclear DNA generates a green fluorescence, which is detected by confocal microscopy. In one embodiment of the present invention, the fractionated growth media is tested to determine the ability of said fractions to induce apoptosis or cell growth arrest. These methods are useful in the identification and characterization of cytoxic factors of ATP independents. Ideniificación of Independent Cytotoxic Facfores of ATP. In another aspect, the present invention provides characterized cytotoxic factors exhibiting cyclo-toxicity that alleviate apoplosis independent of ATP or that cause arrest of cell growth. The inventors have discovered that the QSFT fraction of P. aeruginosa and B. cepacia is enriched with two azurine and cytochrome c551 proteins. The identification of these two proteins is based on their separation in SDS-PAGE and identification of their N-terminal amino acid sequences. In contrast, the SDS-PAGE analysis of the QSFT M. bovis fractions showed a thick band of 65 kDa of bovine serum albumin (BSA), which is a consíifuyenfe of the 7H9 medium used to grow M. bovis, as well as several bands with a molecular mass greater than 45 kDa, although not the characteristic bands of cyclochrome c55 or azurine. (See example 9.) Azurine and / or cyclochromium c55? and QSFT fractions exhibit cyclobioxicity of apophoresis acyivation towards phagocytic cells. In isolation, ci-chromo c551, causes the arrest of cell growth. A mixture of purified azurine / cyclocholine c551, or the fraction QSFT B. cepacia, irradiated with a mixture of anti-azurine and anti-cytochrome c551 antibodies, showed diminished cytotoxicity of macrophages aliamenie. In contrast, the QSFT M. bovis fraction, when previously brought with amphibo-azurine / cyclic ani-cytochrome c551, shows very little reduction in cyto-toxicity confirming that the QSFT M. bovis fraction contains cytoxic factors in addition to azurine or C551 cytochrome. At the same time, paphogenic differences secrete cytological differences that induce apopho- sis or that arrest cellular growth, which can be excellent targets for the development of drugs. Independent cytotoxic factors of ATP I. Cupredoxin compounds These small blue copper proteins (cupredoxins) are electrolyte transfer proteins (10-20 kDa) that pair in Baciferian redox chains, in phoinosinitis or are of unknown function. The copper ion binds only through the protein matrix. A special disproportionate, circular arrangement for two hisphidine ligands and one cis-amino group around copper gives rise to very peculiar electrophoretic properties of the metal site and an intense blue color. A number of cupredoxins have been crystallographically characterized in the medium for high resolution. Azurine Azurines are proteins that contain copper of 128 amino acid residues that belong to the family of cupredoxins involved in the transfer of electrons in plants and certain bac teria. The azurines include those of P. aeruginosa (PA) (SEQ ID NO: 1), A. xylosoxidans and A. dsntrificans. Murphy, L., M. and Associates, J. Mol. Biol., Volume 315, pages 859-71 (2002), whose contents are incorporated for all purposes for the present invention as a reference. Although the sequence homology between the azurines varies between 60 and 90%, the structural homology between these molecules is high. All azurines have a bela-walled character with the key Greek Greek and the only copper atom is always placed in the same region of the prophecy. In addition, Azurines have a hydrophobic essential-neuleral patch that surrounds the copper site (Murphy and Associates). Plasiocyanins Plasfocyanins are soluble proteins of eukaryotic plants that confine one molecule of copper per molecule and are blue in their oxidized form. They occur in the chloroplast, where they function as electric vehicles. Since the delermination of the poplar plasnocyanin sculpture in 1978, the esoteric of the algal plasiocyanines (Scenedesmus, Enimeromorpha, Chlamydomonas) and plañías (French bean) has been deineminated either by means of chriological or NMR methods, and the poplar esíruclura has been refined at a resolution of 1.33 A. SEQ ID NO: 2 shows the plasminocyanin amino acid sequence of Phormidium laminosum.

In spite of the sequence divergence between the plasiocyanins of algae and vascular plañías (for example, 62% of denudad between the Chlamydomonas and proleínas poplares), the iridimensional constructions are preserved (for example deviation 0.75 nm Á in the positions alpha C Enlarge clamidomonas and proleínas poplares). The characteristic features include a diffusion-copper linkage dissymressioned in an exíremo of an 8-strand ampiparale bean-barrel, a pronounced negaíivo patch and a flat hydrophobic surface. The site of copper is opimimized by its electron transfer function, and negative and hydrophobic patches are proposed to be involved in the recognition of physiological reaction patterns. Experiments of chemical modification, reiciculation, and mucosal targeting have confirmed the impor- tance of negative and hydrophobic patches in linkage interactions with cytochrome F, and validated the model of two functionally significant electrophysiology transference patches in plastocyanin. A pufativa electrostatic transfer path is relativly corfa (about 4 Á) in involves the copper liganie exposed to solvenfe His-87 in the hydrophobic patch, although the other one is longer (approximately 12 to 15 Á) and involves the almost conserved residue Tyr-83 in the negative patch, Redinbo and Associates, J. Bioenerg. Biomembr., Volume 26 (1), pages 49-66 (1994) whose contents are incorporated for all purposes for the present invention as a reference. Rusticianins Russians are single-chain polypipeids that contain copper-blue obhenides of iobacilus. The development of crissal and X-rays of the oxidized form of rheophyllin of cupredoxin aliameny oxidized and excretedly sphable came from Thiobacillus ferrooxidans (SEQ ID N0: 3), has been determined by anomalous diffraction of multiple wavelengths and refined at a resolution of 1.9 A. These rusficianins are composed of a beta-walled cenfro fold composed of a b-sheet of six and seven strands Like other cupredoxins, the copper ion is coordinated by a group of four conserved residues (His85, Cys138, His143, Me148) adjusted in a disintegrated fetrahedron. Walíer, R. L. and Associates, J. Mol. Biol. Volume 263, pages 730-51 (1996), whose contents are incorporated for all purposes herein by reference. Pseudoazurins The pseudoazurins are a copper-blue family containing single chain polypeptide: The amino acid sequence of pseudoazurin obtained from Achromobacter cycloclastes is shown in SEQ ID NO: 4. The X-ray structure analysis of pseudoazurin shows that it has a similar structure with the azurines although there is a low sequence homology between the proiephins. There are two main differences between the general pseudoazurines and the azurines. There is an ex- tension of the term carboxy in the pseudoazurines, in relation to the azurines, which consists of two alpha-helices. In the middle region of the peptide, the azurines contain an extended loop, which is accreted in the pseudoazurines, which forms a tab containing an alpha-helix ran. The only different importaníes in the copper vault are the conformation of the Meí lalleral chain and the Meí-S copper bond length, which is significantly more corfa in pseudoazurin than in azurine. II. C551 cytochrome The C551 cytochrome of P. aeruginosa (Pa-C551) is a monomeric redox protein of 82 amino acid residues (SEQ ID NO: 5), involved in dissimulative denirotization as the donor of physiological reactions of nitrate reductase. The functional properties of Pa-C551 have been investigated extensively. Reactions with non-small physiological inorganic redox redoxes and with more macromolecules, copper-blue proteins, cytochrome-c-cytochrome, and physiological particle-reducing reductases have provided a test for the transfer of protein-protein electrons. The three-dimensional structure of Pa-C551, which is an element of the cytochromes of class I bacteria, shows a single heme of slow yarn with His-Mei ligature and the fold of the íypic polypeptide which nevertheless leaves the edges of the rings of p. II and III of the ex-heme (Cuíruzzola and Associates, J. Inorgan, Chem., volume 88, pages 353-61 (2002), whose contents are incorporated for all purposes hereof). invention as reference). The lack of a 20-residue omega loop, which is found in the mammalian class I cytochromes, causes additional exposure of the heme rim at propionate level 13. The distribution of the charged residues on the surface of Pa-C551 is very anisotropic: one side is rich in acid residues, while the other shows a ring of posiive laferal chains, mainly mills, located in the lip of a hydrophobic patch that surrounds the heme crack. This patch comprises residues Gly11, Val13, Ala14, Met22, Val23, Pro58, Ile59, ProdO, Pro62, Pro63, and Ala65. The dissociation of anisoiropic charge leads to a large dipole moment which is important for the formation of the electron transfer complex. The load distribution described above for Pa-C551 has been replicated for other electron transfer proteins and their electron acceptors. Furthermore, the modification by site-directed mutagenesis of the denfro residues of the charged hydrophobic patch has shown for different proteins the importance of surface complementarity for the binding and transfer of electrons. As an example, the evidence for the relevance of the hydrophobic patch for the transfer properties of azurine electrostatic P. aeruginosa, comes from studies carried out in mutants of the residues Mel44 and Met64 changed to amino acids loaded in positive and negative form. (Cutruzzola and Associates). Induction of apoptosis or arrest of growth in cancer cells by cytotoxic factors independent of ATP. The present invention provides methods for using ATP-independent cytotoxic factors to induce apoptotic cell death or arrest of cell growth in cancer cells. The cytophoxic factors independent of ATP, such as the compounds of cupredoxin and C551 cyclochrome, can be used to treat conditions related to abnormal cell-mediated failure. It is well known that cancer cells are not prone to go through apoplosis. According to an aspect of the present invention, the administration of a cyclobiocic agent or active agent that stimulates the secretion of the cytoxic facer into a sufficient quantity to induce cancer cell apoplosis or arrest of cell growth, will be beneficial in reducing tumor size. in vivo and slow the growth of tumors. For example, tests that compare azurine and cytochrome C55? with a known anti-melanoma cancer drug [5- (3,3'-N, N'-dimethyl-triacen-1-yl) -imidazole-4-carboxyamide] (DTIC) shows that a sample of azurine and cytochrome C551 provides a powerful, non-toxic composition that promotes in vivo tumor regression in uncovered mice. In one embodiment of the present invention; a method is provided wherein treatment with a cupredoxin compound, such as azurine, induces apoptotic cell death in cancer cells. Although it is not intended to be limited by theory, it is considered that the cytophoxic activity of the cupredoxin compound results from its ability to form a complex with, and isolate, the p53 suppressor protein. p53 acíúa as a gene "tumor suppressor" and its low production or deactivation to íravés of the mutation, can lead to the development of the tumor. The average life of p53 in a cell is usually a few minutes. The destabilization of p53 allows the significant generation of reactive oxygen species (ROS), which is an apophoresis-inducing pofeny. Azurine forms a complex with p53, stabilizes it and improves its intracellular level, inducing apopiosis in this way from idiopathic myelochondrial arteries dependent on caspase-3 and caspase-9, see the publication by Yamada, T. and Associates, Infec. Immun., Volume 70, pages 7054-62 (2002), whose contents are incorporated for all purposes to the present invention as a reference.

Azurine redox aclivity is not important for its cyclobioxic activity. Rather, the generation of reactive oxygen species during the formation of complexes is the factor that induces apoptosis. Gofo, M. and Associates, Mol. Microbiol. 47, pages 549-59 (2003) whose contents are incorporated for all purposes to the present invention as a reference. For example, apo-azurine, which has an amino acid sequence SEQ ID NO: 1 but does not contain a copper atom, has a lower redox activity compared to azurine, although it demonstrates a significant kyphopoxic acfivity. The importance of complex formation with p53 is illustrated by differences in the cytoxic activity of two mutant azurines, C112D (SEQ ID NO: 6) and the double mutant M44KM64E (SEQ ID NO: 7). The copper bond to the Cys-112 residue is important for the redox activity. The C112D model, which is deficient in the coordination with copper, has a redox activity of approximately 0.01% azurine but shows significant cifoloxicity. In comparison, the mutein M44KM64E has a redox acfivity of approximately 2% azurine, although it shows little cytotoxicity. The azurine molecule confers a hydrophobic patch that is the site of interaction of the physiological parts of cytochrome C55? and the nitrate reductase. (Cufruzzola and Associates). The C112D mutein, with the hydrophobic patch without change, has the ability to complex forms with p53 and to raise its intracellular level. However, the double mutant M44KM64E, where an electric dipole is used in the hydrophobic patch, does not have the ability to form stable complexes. Therefore, the infection site with the C55 cytochrome? In the short term, it is also important for the formation of complexes with p53. Glycerol gradient centrifugation and Glutathione S-transferase (GST) centrifugation methods have been used to demonstrate the insertion of cupredoxin compounds with p53. Yamada and Associates (2002), whose conlinings are incorporated for all purposes of the present invention as a reference. p53 is known to form oligomeric complexes and a GST-p53 fusion protein sediments in various glycerol fractions, such as glycerol at 5, 10, 15, 20, or 25%, so that azurine sediments in 5% glycerol. The previous incubation of azurine with the GST-p53 fusion protein followed by centrifugation in the glycerol gradient, demonstrates the presence of azurine in all glycerol fractions, indicating its association with p53. The mutant C112D, but not the mutant M44KM64E, showed a similar association. Yamada y Asociados (2002). Previous incubation of the GST-p53 fusion protein with the mulanie azurine M44KM64E alferred the oligomerization of p53, giving as resulfate that the largest part of GST-p53 found in glycerol of 5 to 10%, where the muffin azurine protein was also found. Esio indicates that the hydrophobic azurine patch is also involved in the p53 ini- raction. A non-unique loss of hydrophobicity of azurine results in a loss in cyclooxicity but also results in oligomerization. Although the mutein M44KM64E shows little induction of apoprosis, it shows a significant inhibition of cell cycle progression. Therefore, a change in the nature of the p53-cupredoxin complex may change the specificity of p53 from apoptosis to arrest of cell growth. The action of azurine depends on the tumor cell having a functional p53 tumor suppressor gene. However, cytotoxic factors can also cause the retardation in the growth of cells that have a deficient p53 tumor suppressor gene. For example, cytochrome C55? it does not act on p53 but significantly improves the level of the p16 tumor suppressor protein. C551 inhibits cell cycle progression in macrophages and also increases the effect of azurine. In addition, combinations of cytotoxic factors such as azurine and C551 (or M44KM64E) can achieve more effective inhibition of progress of the tumor inducing tanio apopiosis as cellular arrest. Because the mode of action of C55 cycromo is independent of the level of p53 in the cell, it provides a regression rate of cancer in 50% of human cancers that have a deficiency in the p53 tumor suppressor gene. In addition to C551, other cytochromes, for example, cyanobacteria cyanobacteria, also demonstrate cyto-toxicity. Cyclobioxic factors in the eradication of infectious diseases. In another aspect of the present invention, the characterization of cytoxic factors may be useful to identify new subsidences that inhibit cell death, for example, in an infectious disease. For example, inhibition of the secretion or activity of a cytotoxic factor using ATP, or the production of ATP, can reduce or eliminate cytoxic activity from a pathogen that causes the disease. Therefore, the adequate administration of a compound that inhibits the secretion or acfivity of a cyclophoxic factor provides a useful tool for the development of anli-infection. Examples of useful antimicrobial agents to inhibit the activity of the cyto-toxic factor that induces cell death may include antibodies to ciolóxicos faciores, as well as analogs of ATP that avoided the acfivación of enzymes that ufilízan ATP. Examples of cytoxic factors and antimicrobial agents to inhibit or hinder the secretion or expression of the cyclooxic factor include, but are not limited to, enzymes that use ATP, redox proteins, ATP production activators, ATP production inhibitors, redox protein activators. and inhibitors of redox proteins. Pharmaceutical compositions comprising cytotoxic factors. Pharmaceutical compositions comprising cytotoxic factors may be manufactured in any conventional manner, for example, by conventional mixing, dissolving, granulating, dragee-making, emulsifying, encapsulating, coating or lyophilizing. The sub-purely cyto-toxic factor or other agent can easily combine with a pharmaceutically acceptable carrier well known in the art. Said vehicles allow the preparation to be formulated in the form of a sandwich, pill, lozenge, capsule, liquid, gel, syrup, pastry, suspension and the like. Suitable excipients may also include, for example, fillers and cellulose preparations. Other excipients may include, for example, flavoring agents, coloring agents, destaquifiers, thickeners, and other additives, adjuvants or linkers that can be accepted. The compositions of the present invention can be used in the irradiation of a condition related to cell death or in the prevention thereof. The substantially pure cytotoxic factor can be administered in an amount sufficient to prevent or treat a condition related to cell death. Normally, the host organism is a mammal, such as a human or animal. Administration of compositions comprising cytotoxic factors. The compositions of the present invention can be administered through any suitable route, for example, by oral, buccal, inhalation, sublingual, rectal, vaginal, transurethral, nasal, topical, percutaneous administration, i.e., transdermal or parenteral administration ( including intravenous, intramuscular, subcutaneous, and incoraminal administration). The pharmaceutical compositions and formulations thereof can be administered in any effective amount to achieve their intended purpose. More specifically, the composition is administered in a therapeutically effective amount. In various embodiments, the cytotoxic factor composition includes carriers and excipients (including but not limited to regulators, carbohydrates, mannitol, proleins, polypeptides or amino acids such as glycine, antioxidants, bacilli, chelation agents, suspension agents, thickening agents and / or preservatives), water, acels, saline solutions, aqueous dexfrosa and glycerol solutions, other pharmaceutically acceptable auxiliary substances as required for to approximate physiological conditions, as a regulating agent, agents for the adjustment of the ionicity, moisturizing agents and the like. It will be recognized that, although any suitable vehicle known to those skilled in the art can be employed to administer the compositions of the present invention, the type of vehicle will vary depending on the mode of administration. The compounds can also be encapsulated within liposomes using well-known technology. The biodegradable microspheres can also be used as carriers for the pharmaceutical compositions of the present invention. Biodegradable microspheres are described, for example, in the North American Patenies Nos. 4,897,268; 5,075,109; 5,928,647; 5,811,128; 5,820,883; 5,853,763; 5,814,344; and 5,942,252. The compositions of the present invention may be sterilized by conventional, well-known sterilization techniques, or they may be sterile filtering. Aqueous resulfanic solutions can be Packed to be used as such, or lyophilized, the lyophilized preparation being combined with a sterile solution before administration. The cytoioxic factor compositions of the present invention can be administered in a variety of ways, including by injection (eg, intradermal, subcutaneous, inframuscular and inirapraeoneal and the like), by inhalation, by topical administration, by suppositories, by use of a transdermal patch or by oral means. When the administration is by injection, the cyto-toxic factor can be formulated in aqueous solutions, or preferably in physiologically compatible regulators such as Hanks' solution, Ringer's solution, or physiological saline regulator. The solution may contain formulating agents such as suspending, destabilizing and / or dispersing agents. As an alfalfa, the cyto-toxic factor composition may be in the form of a powder for consideration with a suitable vehicle, for example, pyrogen-free sterile water, used for use.

When administration is mediated by inhalation, cytotoxic factors may be supplied in the form of an aerosol spray from pressurized packaging or a nebulizer with the use of a suitable propellant, for example, dichlorodifluoromethane, friclorofluoromelan, carbon dioxide or other suitable gas. In the case of a pressurized aerosol, the dose unit can be determined by providing a valve to supply a measured quantity. Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator can be formulated by conferring a powder mixture of the proteins and a suitable powder base, such as lactose or starch. When administration is by topical administration, the cytotoxic factor composition can be formulated in the form of solutions, gels, ointments, creams, suspensions and the like, as is known in the art. In some modalities, the administration is by means of a transdermal patch. When the administration is by suppository (eg rectal or vaginal) the cyto-toxic factor compositions can be formulated in compositions conforming to conventional suppository foundations. When the administration is oral, a cylioxy compound composition can be easily formulated by combining the cyto-toxic factor with pharmaceutically acceptable vehicles known in the art. A solid vehicle, such as a manifold, laclosa, magnesium coating and the like, may be employed; these vehicles allow the chemoxine to be formulated in the form of fablets, pills, dragees, capsules, liquids, gels, syrups, pastries, suspensions, and the like, for oral ingestion by a subject that will be brought. For solid oral formulations, such as, for example, powders, capsules and tablets, suitable excipients include fillers such as sugars, cellulose preparations, granulating agents and binding agents. Nucleic acid molecules that encode cytotoxic factors can be inserted into vectors and used as gene therapy vectors. Genetic therapy vectors can be delivered to a subject, for example, by means of in-venous injection, local administration (Nabel et al., Patenfe Norieamericana No. 5,328,470 1994, USA), or by means of sphereophytic injection (Chen et al., Proc. Nati. Acad. Sci. USA, volume 91, pages 3054-7 (1994) The pharmaceutical preparation of a gene therapy vector can include an acceptable diluent or can comprise a slow release matrix where the genetic delivery vehicle is embedded. When the full genetic delivery vector can be produced intact from recombinant cells, for example, viral neighbors, the pharmaceutical preparation can include one or more cells that produce the gene delivery system. the technician, also include multivaleni vehicles, such as bacterial capsular polysaccharide or dextran or a neighbor consíruido in genetic form. In addition, sustained release formulations that include cytotoxic factor molecules allow the release of cytotoxic factors for extended periods of time, so that without the sustained release formulation, the cytotoxic factor can be cleared from the subject's system, and / or degraded by, for example, proteases and simple hydrolysis, in order to provoke or improve a therapeutic effect. The formulation, administration rufa and exact dose are determined by the doctor, according to the patient's condition. The amount of dose and the range can be adjusted individually to provide plasma levels of the active cytotoxic factor, which are sufficient to maintain the therapeutic effect. Generally, the desired cytotoxic factor is administered in a mixture in additions with a selected pharmaceutical carrier with respect to the intended route of administration and standard pharmaceutical practice. The pharmaceutical compositions used in accordance with the present invention can be formulated in a conventional manner using one or more physiologically acceptable vehicles comprising excipients and auxiliaries that facilitate factor processing. cytoioxic agents, to inhibit or stimulate the secretion of cytoxic facies or a mixture of them in preparations that can be used in therapeutic form. In one aspect, the cifotoxic facfor is supplied in the form of DNA, so that the polypeptide is generated in situ. In one embodiment, the DNA is "deprecated," as described, for example, in the publication by Ulmer and Associates, Science, volume 259, pages 1745-49 (1993) and reviewed by Cohen, Science, volume 259, pages 1691- 92 (1993). The uptake of unprotected DNA can be increased by covering the DNA in a vehicle, for example, biodegradable beads, which is transported efficiently in the cells. In such methods, the DNA can be found within any of a variety of delivery systems known to those skilled in the art, including nucleic acid expression systems, bacterial and viral expression systems. The techniques for incorporating DNA into such expression systems are well known to those skilled in the art. See, for example, Publications WO90 / 11092, WO93 / 24640, W093 / 17706, and US Pat. No. 5,736,524. The vectors, which are used to connect the generic material from organism to organism, can be divided into two general classes: cloning vectors that replicate the plasmid or phage with regions that are not essential for propagation in a suitable host cell and into which the external DNA can be inserted; the external DNA replicates and propagates as if it were a component of the vector. An expression vector (such as a plasmid, yeast or animal virus genome) is used to introduce foreign genetic material into a host cell or tissue for the purpose of transcribing and translating external DNA, such as the DNA of a cytotoxic factor. . In expression vectors, the introduced DNA is operably linked to elements such as promoters that signal the host cell to cross-rewrite the unsaturated DNA. Promoter frames are exceptionally useful, such as inducible promoters that control genetic transcription in response to specific factors. The operable linkage of a polynucleotide of cytotoxic factor to an inducible promoter can control the expression of the polypeptide or fragments of cytoxic factor. Examples of classical inducible promoters include those that respond to α-interferon, heat shock, heavy metal ions and steroids such as glucocorticoids (Kaufman, Methods Enzymol, volume 185, pages 487-511 (1990)). Other desirable inducible promoters include those that are not endogenous to the cells in which the construct is being introduced, although, however, they respond in those cells when the induction schedule is supplied exogenously. In general, useful expression vectors are often plasmids. However, other forms of expression vectors, such as viral vectors (e.g., retroviruses, adenoviruses and adenoviruses associated with defective replication) are contemplated. The choice of vector is dictated by the organism or cells that are used and the destination of the desired vector. In general, the vectors comprise signal sequences, replication origins, marker genes, enhancer elements, promoters and transcription sequences. Equipment that includes cytotoxic factors. In one aspect, the present invention provides kits containing one or more of the following in a package or container: (1) a biologically active composition comprising a cytotoxic factor; (2) an acceptable pharmaceutically acceptable adjuvant or excipient; (3) a vehicle for administration, such as a syringe; (4) instructions for administration. The modalities in which two or more of the components (1) - (4) are found in the same container are also contemplated. When equipment is supplied, the different components of the composition can be packaged in separate containers and mixed together immediately after they are used. Said packaging of the components separately, can allow a long-term storage without the loss of the functions of the active components. The reagents included in the equipment can be supplied in containers of any kind, so that the life of the different components is conserved and is not absorbed or altered by the materials of the container. For example, sealed glass ampoulels may contain freeze-dried kyphototoxic polypeptides or polynucleotides, or regulators that have been packaged under a neutral gas, without reaction such as nitrogen. The vials can consist of any suitable material, such as glass, organic polymers, such as polycarbonate, polyesirene, efe, any ceramic, metal, or any other material that is normally employed to hold similar reagents. Other examples of suitable containers include simple bottles that can be manufactured from similar substances in the form of ampoules, and wrappers, which may comprise sheet-lined interiors, such as aluminum or an alloy. Other containers include test tubes, flasks, containers, bottles, syringes or the like. The containers can have a door sterile access, like a bofella that has a stopper that can be pierced through a hypodermic injection needle. Other containers may have two compartments that are separated by an easily removable membrane, which at the time of disposal allows the components to mix. The removable membranes can be glass, plastic, rubber, etc. The equipment can also be supplied with instructional materials. The instructions may be printed on the paper or other subsystem and / or may be supplied as a readable medium in electronic media, such as a floppy disk, CD-ROM, DVD-ROM, Zip disk, videotape, audio tape, etc. The detailed instructions may not be physically associated with the equipment; Rather, a user can be directed to interact on a specific website through the manufacturer or distributor of the equipment, or provided in the form of an email. The identification and characterization of cytotoxic factors can also lead to the development of methods to stimulate the secretion of cytotoxic factor. Pathogenic organisms have been shown to secrete large numbers of cytoxic factors in the presence of mammalian proleins. That principle can be modified in the human body to provide new methods to stimulate the production of desired cytotoxic factor or inhibit the production of unwanted cytotoxic factor. Said methods are useful to inhibit or stimulate cellular apoptosis or cause the arrest of cell growth. A compression of the cytotoxic factors, and the characterization and development thereof, also allows the development of the drug and the classification of suitable active agents or compounds to modulate the activity or secretion of the cytotoxic factor. The understanding of the secretion machine related to the secretion of the cytotoxic factor in cells, additionally provides new forms of development and identification of the design of useful inhibitors or stimulators of cytoxic factors. The delineation and identification of the presence of receptors for mammalian proteins can also be used as a means to differentiate between virulent and avirulent microorganisms, which provides specificity for trapping the disease. Modification of cyclo-toxic facsimiles. Cytoioxic factors can also be chemically modified or genetically altered to produce variani that lack an enzyme that uses ATP or redox activity, but retains toxicity. Mutations and / or truncations of cyclophobic facfores can produce cyclooxic agents of diverse compositions that they also demonstrate functional activity. In particular, truncated derivatives with high efficiency and low antigenicity can be produced from the original cyto-toxic factor. Said modified or altered cytotoxic factors are also included in the scope of the present invention. Several derivatives of cytoxic factors can be synthesized by standard techniques. The derivatives are amino acid sequences formed from native compounds either directly or through partial modification or substi tution. Analogs are sequences of amino acids that have a similar structure, but are not identical to the native compound but differ with respect to compose closes or laferal chains. Analogs can be synthesized or come from a different origin of evolution. Analogous derivatives may have tofal length or a non-linear length, if the derivative or analog contains a modified amino acid. Derivatives or analogs of cytotoxic factors include, but are not limited to, molecules that comprise regions that are subsitically homologous to the cyclo-toxic facies in at least about 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity through an amino acid sequence of identical size or when compared to an aligned sequence in which the alignment is carried out through a homology algorithm. In addition to allelic variants that occur naturally from cytotoxic factors, changes can be introduced by mutation in cytotoxic factors that incur alterations in the amino acid sequences of the encoded cytotoxic factors that do not significantly alter cytoxic activity. A "non-essential" amino acid residue is a residue that can be altered from the wild-type sequences of the cytoxic factors without altering the biological activity, wherein an "essential" amino acid residue is required for said biological activity. For example, the amino acid residues that are conserved among the cytotoxic factors of the present invention are anticipated to be particularly non-inducible for alliation. The amino acids for which conservative subsfitutions can be made are known in the art. The useful conservative subscripts are shown in Table 1, "preferred substi tutions". The conservative substi tutions by which an amino acid of one class is replaced with another amino acid of the same type are within the scope of the present invention, provided that the substitution does not materially alter the biological activity of the compound.

Table 1. Preferred substitions Non-conservative substi tutions that affect (1) the structure of the skeleton of the polypeptide, lal as a conformation of ß-lamina or α-heliocoidal, (2) the charge, (3) hydrophobicity or (4) the volume of the target chain of the target site can modify the function of the cytotoxic factor. The residues are divided into groups based on common lamellar chain properties as denoised in Lab.2. Non-conservative substitutions include the exchange of a member of one of these classes to another class. Substitutions may be introduced at conservative substitution sites or more preferably at non-conserved sites. Table 2. Classes of amino acids Variant polypeptides can be made using methods known in the art, such as oligonucleotide-transmitted mutagenesis (site-directed), alanine scanning and PCR mutagenesis. Site-directed mutagenesis (Cárter, Biochem. J., volume 237, pages 1-7 (1986); Zoller and Smith, Methods Enzymol., Volume 154, pages 329-50 (1987)), cartridge mutagenesis, restriction selection mutagenesis (Wells and Associates, Gene, volume 34, pages 315-23 (1985)) or other techniques known, can be carried out in the cloned DNA to produce the cytotoxic factor variant DNA. The cytotoxic activity of the mutants of cytotoxic factor C112D and M44KM64E was described above. In addition, Example 19 shows the cytoxic activity of a number of chimeric azurine mutants prepared by site-directed mulagenesis as described in Example 18. The present invention can also utilize cyto-toxic factors, such as apo-azurine, where There is a copper spindle. Both apo-azurine and mutant C112D show significant cytotoxic activity, whereas mutant M44KM64E does not. However, the muhanfe M44KM64E does not cause significant inhibition of cell cycle progression. One embodiment of the present invention utilizes mutated cytotoxic facilli which relies on the ability to complex with and stabilize p53 and thereby induce apoptosis. In another modality, the present invention utilizes mutated cyto-toxic factors, such as the M44KM64E mutant, which has the ability to interact with p53 and cause the arrest of cell growth.

A more complete understanding of the present invention can be obiened by reference to the following specific examples. The examples are described solely for purposes of illustration and are not intended to limit the scope of the present invention. Changes in the form and subsíiution of equivalents are considered as circumstances that may suggest or become necessary. Although specific terms have been employed in the present invention, such terms are projected in a descriptive sense and not for purposes of limitation. The modifications and variations of the present invention, as will be set forth below, may be carried out without departing from the spirit and scope thereof, and consequently, only such limitations will be imposed as indicated by the appended claims. EXAMPLES Example 1. Stimulation of secretion of cytotoxic factors through mammalian proteins. The clinical and environmental isolates (five of each) of B. cepacia were grown in broth of prophylase-yeast pepita-peptide (PPY) with and without added a2-macroglobulin (1 mg / ml). After growth for 10 hours at a temperature of 34 ° C in an agifator, a portion of the growth medium was centrifuged from each culinary and the supernatant through a 0.22 μM millipore filter to remove whole cells and debris. The filtered supernatant was subsequently tested with respect to the activity of adenylate kinase as described in the publication by Meinikov A. and Associates, Mol. Microbiol. 36: 1481-1493 (2000). The adenylate kinase transfers the terminal phosphate of [? 32P] ATP to AMP giving rise to ADP. The products of this reaction were subsequently detected by thin layer chromatography. The secretion of adenylate kinase was minimal when the B. cepacia cells were grown in PPY broth. However, the secretion of the clinical isolates, but not of the environmental isolates, was stimulated in the presence of a2-macroglobulin. Immunofluorescence microscopy with an anti-a2-macroglobulin antibody showed that the clinical isolates have receptors that bind to a2-macroglobulin, whereas ambient isolates lack such receptors. The clinical and environmental isolates of B. cepacia were grown in the absence or in the presence of 1 mg / ml a2-macroglobulin in PPY broth during 1 hour. The ex2-a2-macroglobulin was eliminated by washing with phosphate-regulated saline. The cells were incubated for 2 hours with a2-macroglobulin antibodies conjugated by isothiocyanate fluorescence (FITC), obtained by injecting rabbits with a2-macroglobulin. After washing with phosphate-buffered solution, the cells treated with FITC-conjugated antibody were fixed in 16% paraformaldehyde, covered in slides covered with poly-L-lysine, and examined by confocal microscopy. Only clinical isolates that showed enhanced cytotoxic factor secretion in the presence of a2-macroglobulin fluoresced (cells with green fluorescence) demonstrating the presence of a2-macroglobulin receptors. Example 2. Extermination of dependent macrophage ATP by means of filtered supernatant or column chromatographic fractions derived from growth medium B. cepacia. A clinical strain of B. cepacia (strain 38 -collection number 95828, DG Allison, University of Manches- ler Institute of Science and Technology, Manchester, UK) was grown in TB broth 810 g of friterous Baccon, 3 g of Bacfo beef extract. per liter of water) at an emperature of 34 ° C in an agifer in an OD550n of 1.3. Subsequently, the growth medium was centrifuged and the supernatant was filtered through a 0.22 μM millipore filter to remove the complex cells and residues. Macrophage cells were isolated from J774 cell lines and were grown in RPMI 1640 medium (GIBRO-BRL, Grand Island, N.Y.) as described by Zaborina O. and Associates, Infecí, immun. 67: 5231-5242 (1999). The filmed medium was added in sequences to hydroxyapaite, ATP-agarose and Q-sepharose columns. The fraction from the flow of the hydroxyapair column (HAFT) was fractionated in the ATP-agarose column (AAFT). Subsequently, the AAFT fraction was fractionated in the Q-sepharose column (GSFT). 106 macrophages were added to deposits in a plate of 96 deposits and incubated for 2 hours in a C02 incubator for adhesion. 2 μg of protein from the supernatant or fraction was added through the flow of each of the previous columns to the deposits, and the plates were incubated for 4 hours in the presence or absence of 1.0 mm ATP. The degree of cell death of macrophages was subsequently measured by the release of lactate dehydrogenase from cellular enzyme (LDH) as described by Zaborina O. and Associates, Infecí. Immun. 67: 5231-5242 (1999). The degree of macrophage killing in the presence and absence of 1.0 mM ATP, by filinated supernatant (SUP) and HAFT, AAFT, and QSFT column fractions, are shown in Figure 1. All the assays are carried out in duplicate and the error bars are indicated.

Example 3. Extermination of ATP independent macrophages by filtered supernatant or column chromatographic fractions derived from growth medium B. cepacia. The supernatant (SUP) and the column chromatographic fractions (HAFT, AAFT, and QSFT) of the medium with B. cepacia growth were as in example 2. The isolation of macrophages was as in example 2. The degree of cell death of Macrophages have been determined by the release of LDH as in Example 2 and shown in Figure 2. Only the WSFT fraction shows high ATP-independent cytotoxicity towards macrophages. Example 4. Induction of apoptosis in macrophages by cytoioxic factor P. aeruginosa. P. aeruginosa was grown in L broth at a temperature of 37 ° C for 13 hours at an OD551nm of 1.2. The growth medium was subsequently centrifuged and the supernatant was filtered through a 0.22 μm filter. The supernatant (SUP) and the column chromatographic fractions (HAFT, AAFT, and QSFT) were collected as in example 2. The isolation of macrophages was as in example 2. 2 μg of supernatant protein or one of the fractions a Through the flow, 1 x 105 macrophages were added in 200 μl of RPMI medium and the mixture was incubated overnight. The Induction of apoptosis in macrophages, whether delivered or not, by incubation overnight with SUP or HAFT fractions, AAFT, or QSFT, was measured by confocal microscopy using the mitochondrial membrane tensioner ApoAlerí (Cloníech Laboraíories, Inc., Palo Alto, California, USA), as described in the publication of Zaborina O. y Asociados, Microbiology 146: 2521-2530 (2000). In this trial, the healthy non-apoptotic cells were red-colored in tannin so that the cells with apopioic dying fluoresced in green. A combination of red and green fluorescence produces yellow cells that fluoresce in yellow, indicating cells with apoptotic death. The untreated macrophages or macrophages treated overnight with SUP, HAFT, or AAFT fractions mainly fluoresced in red, indicating a lack of apoptotic cell death. Macrophages fused at night with a QSFT fraction mostly fluoresced in green, indicating the apoptotic death of most macrophages. The time of the study, showed that the apoptosis was adjusted in approximately 6 hours (indicated by a combination of red and green fluorescence that makes the cell yellow) and was completed in 12 to 16 hours.

Example 5. Induction of apoptosis in mast cells by cytotoxic factors B. cepacia. Mast cells were isolated through the method described by Meinikov A. and Associates, Mol. Microbiol. 36: 1481-1493 (2000). The growth medium fractionated by B. cepacia was prepared as in example 2. The induction of apoptosis in mast cells mediated by the cytoioxic factor B. cepacia was determined using confocal microscopy, as described in example 4. The mast cells were not Treated or mast cells treated overnight with SUP, HAFT, or AAFT fractions of growth medium B. cepacia, fluoresced primarily in red, indicating a lack of apoptotic cell death. The mast cells harvested during the night with the QSFT fraction of the growth medium B. cepacia, fluoresced mainly in green, indicating the apoptotic death of most of the mast cells. Example 6. Induction of apoptosis in macrophages by QSFT tractions of B. cepacia, and M. bovis. The isolation of macrophages was as in example 2. The induction of apoptosis in macrophages by cytotoxic factors B. cepacia, and M bovis, was determined using the methods of example 4. Induction of apoptosis was observed in macrophages when trampled with the QSFT fractions of B. cepacia, and M. bovis. Example 7. Measurement of caspase activities (caspase-3 and caspase-9) in the cytosolic extracts of irradicated macrophages with the QSFT fraction of B. cepacia). Isolation of macrophages was as in the example 2. The macrophages were brought overnight with the QSFT fraction of B. cepacia using the method described in example 2. The preparation of the cytosolic extract of macrophages and the caspase assays was as described in the publication of Zaborina O. and Associates , Microbiology 146: 2521-2530 (2000). In synthesis, the determination of the activity of caspase-3 was carried out using Ac-DEVDpNA (N-acetyl-Asp-Glu-Val-Asp-p-N02-aniline) as a sub-stratum. The release of pNA (p-nifroaniline) is determined spectrophotomically at 405 nm from the caspase-3 substrate (200 μm) after an incubation of 15, 30, 45, 60, 75, and 90 minutes at a temperature of 37 ° C (Figure 3A), with an uninduced macroscopic cyanosolic expression. The cytosolic macrophage exfracto was incubated overnight with a QSFT fraction of B. cepacia (10 μg protein); and cytosolic extract of macrophages incubated overnight with the QSFT fraction of B. cepacia (10 μg of protein) and aggregated inhibitor (DEVD-CHO). In each case, 10 μg of cytosolic protein was used. macrophage In the caspase-9 assay, it was determined in the release of pNA from 200 μM of the caspase-9 Ac-LEHD-pNA substrate (N-acetyl-Leu-Glu-His-Asp-p-N02-aniline) , after an incubation of 15, 30, 45, 60, 75 and 90 minutes (Figure 3B), with cytosolic excretion of non-induced macrophage, cilosolic extract of macrophages induced overnight with QSFT fraction of ß. cepacia (10 μg of protein) and cytosolic extract of macrophages incubated overnight with QSFT fraction of β. cepacia (10 μg of protein) in addition to inhibitor (LEHD-CHO). In each case, 10 μg of macrophage cytosolic protein was used. DEVD-CHO and LEHD-CHO specifically blocked the activity of caspase-3 and caspase-9 and are available from Biomol Research Laboratories, Plymouth Meeting, PA, E.U.A. The tannin activities of caspase-9 and caspase-3 increased when macrophages were brought in overnight with the QSFT fraction of B. cepacia (Figure 3A and B). These activities remained very low for non-delivered macrophages or with presenter inhibitor, suggesting that the induction of apoptosis by QSFT fractions comprises the activation of caspase. Example 8. TUNNEL test to measure fragmentation Nuclear DNA in macrophages treated with QSFT fractions of M. bovis or B. cepacia.

The growth medium of ß was obtained. fractionated cepacia using the method described in example 2. B. bovis BCG in Middlebrook 7H9 broth (Difco Laboratories, Maryland, USA) supplemented with 2% glycerol, 0.02% TWEEN® 80 and ADC (albumin / dexrose) was grown. / citraío) (available at Difco Laborafories, Maryland, E.U.A.). Bacteria were grown for several days at a femperafura of 32 ° C in a shaker before being harvested. The fractionated M. bovis growth medium was obtained using the method described in example 2. The isolation of macrophages was as in example 2. The induction of apoptosis in macrophages either untreated or treated overnight by incubation of the SUP or HAFT, AAFT, or QSFT fractions were measured using confocal microscopy detecting nuclear DNA fragmentation induced by apoptosis with the ApoAlert DNA fragmentation equipment (Clontech Laboratories, Inc., Palo Alto, California, USA). This assay is based on the labeling of exíremo-nick dUTP lransminido by deserucleinidylideransferase (TdI) (TUNNEL), where Tdí catalyzes the incorporation of fluorescence-dUTP into free 3'-hydroxyl ends of fragmented DNA in cells undergoing apoptosis. . The incorporation of fluorescence-dUTP in the fragmented nuclear DNA generates green fluorescence, which is detected by confocal microscopy. Macrophages treated with either QSFT M. bovis or ß fractions. cepacia, showed a yellow-green nucleus in the red cytoplasmic background, indicating fragmentation of nuclear DNA. No fragmentation was observed or very little fragmentation was observed with untreated macrophages or with macrophages treated with other column fractions. Example 9. SDS-PAGE analysis of proteins in the supernatant and the AAFT, HAFT, and QSFT fractions of growth media of P. aeruginosa, B. cepacia, and M. b or vis. The SDS-PAGE separation showed the proteins present in the supernatant and the AAFT, HAFT, and QSFT fractions of P. aeruginosa, B. cepacia, and M. bovis. The fraction of the QSFT medium from the mucoid strain of P. aeruginosa 8821 showed the presence of two bands, an 18 kDa band corresponding to azurine through the N-terminal analysis, and a 9 kDa band corresponding to the cifocromo c551. The QSFT fraction of ß. cepacia showed the presence of three predominant bands of 75 kDa, 20 kDa, and 8 kDa. The N-terminal amino acid sequence of 10 amino acids of the 20 kDa band (AHHSVDIQGN) determined by Edman degradation showed 80% sequence homology with that of the 10 amino acid N-terminal sequence of P. azurin. aeruginosa in Japan, that the N-terminal amino acid sequence of 10 amino acids of the 8 kDa band (EDPEVLFKNK) showed 100% coincidence with that of cytochrome c551 from P. aeruginosa. Therefore, the QSFT fractions that have high cytophoxic activity of P. aeruginosa tanio as B. cepacia show enrichment with the type of redox proteins of azurine and cytochrome c551. In contrast, the QSFT fraction of M. bovis showed a thick band of 65 kDa of bovine serum albumin (BSA), which is a constituent of the 7H9 medium used to grow M. bovis, as well as several bands with a higher molecular mass. at 45 kDa, but not with the type of cytochrome c55- protein? or azurine of 8 kDa or 22 kDa. Example 10. Cell death in macrophages treated with azurine / cytochrome C551- Purified macrophages, azurine and cytochrome c551 (Sigma CHemicals, St. Louis USA), prepared as in example 2, were added and the mixture was incubated for 2 hours . The concentrations of azurine and cytochrome C551 were as in Figure 4. The numbers represent the μg of protein. The cellular bite of the macrophages was measured after the release of the dehydrogenase of the in-cell enzyme (LDH) using the method of Example 2. Tannin the azurine as the cyclochromium c55? they originated cell bite of macrophages. A combination of azurine and ciiochrome c55? caused a more extensive cellular macrophage death. The control of the regulator (regulator) is shown on the right (figure 4). Example 11. Induction of apoptosis in macrophages treated with azurine / cytochrome c55 ?. Isolation of macrophages was as in Example 2. The macrophages were brought with azurine / cycromo c55 (50/25 μg) for 4 and 6 hours and afterwards examined by confocal microscopy., using the ApoAleri mitochondrial membrane sensor equipment, as in example 4, to determine the degree of apoptosis. The macrophages went through increased levels of apoptosis with increases in incubation levels in the presence of a mixture of azurine / cytochrome c551. The control macrophages without treatment (trafficated with phosphate-regulated solution for 6 hours) did not show apoptosis. Example 12. Cytoxicity of a mixture of azurine / cytochrome c55 or QSFT fractions derived from β. cepacia or M. bovis in macrophages after previous tracing with anti-azurine and anti-cyclochrome c55 antibodies? - The macrophage isolation was as in example 2. The macrophages were irradiated with a purified mixture of azurine / cyclochrome c551 (50 / 25 μg) or the QSFT fractions of H.H. cepacia or M. bovis in the presence and absence of a mixture of anti-azurine and amphi-cytochrome c551 antibodies prepared in rabbits. The antibodies were mixed in a ratio of 1: 1 and the mixed antibody (1, 2, 3, or 4 mg) was used for the trailing of macrophages. The degree of cell death of macrophages was determined by the release of LDH as in example 2. Figure 5 shows a reduction in cytotoxicity towards macrophages trafficated with a mixture of azurine / cytochrome c551 (A + C) or the fraction QSFT derived from B. cepacia (Bc- QSFT), when anti-azurine and anti-cytochrome C551 antibodies are found. This reduction was not observed with the QSFT fraction of M. bovis (Mb-QSFT). : Therefore, when a mixture of azurine / cytochrome c55 was treated? or the QSFT fraction of B. cepacia with a mixture of anti-azurine and anti-C551 anti-cytochrome antibodies, and subsequently tested for macrophage cytotoxicity, the cytotoxicity was significantly reduced. In contrast, when the QSFT fraction of M. bovis was previously obtained, which was previously shown by means of SDS-PAGE with a lack of azurine and cytochrome c551 bands (example 9), with anti-azurine / anti-cytochrome C551 antibodies and Subsequently, it was tested for cytotoxicity, very little reduction in cytotoxicity was observed. Example 13. Induction of apoptosis in cell lines of lumor through the QSFT fraction of B. cepacia and by azurine / cytochrome c551 as measured by confocal microscopy. Cell lines of lung carcinoma H460, ovarian cancer PA-1, breast cancer NCF, colon cancer HT-29 and leukemia HT-1080, from the American Type Culture Collection (Manassas, VA, E.U.A.) were obtained. MDD7 and MN1 breast cancer cell lines were obtained from Andrei Gudkov, Ph.D., Cleveland Clinic Foundation (Cleveland, OH, E.U.A.). UISO-BCA-9 and UISO-MEL-1, MEL-2, MEL-6, and MEL-29 melanoma cell lines were developed and maintained as described in the publication by Rauth, S. et al. Associates, in vitro Cellular and Developmental Biology, 30a (2): 79-84 (1994), and Rauíh, S. and Associates, Aníicancer Research, 14 (6): 2457-2463 (1994). Approximately 1 x 105 of each cell type was grown overnight in a dTC3 dish of 0.15 mm thickness (Bioptech, Butler, PA, USA) in the presence of the QSFT fraction of B. cepacia (5 μg protein) or a azurine / cytochrome c551 mixture (50/75 μg). Cells were subsequently examined by confocal microscopy, with example 4, to determine the degree of apoptosis. Both the QSFT fraction of ß. cepacia as the mixture of azurine / cytochrome c551 induced extensive apoptosis in lung carcinoma H460, colon cancer HT-29, leukemia HT-1080, ovarian cancer PA-1, breast cancer MDD7, NCF, and MN1, and melanoma cells USIO-MEL-1, MEL-2, MEL-6, and MEL- 29, after an incubation during the night. In each case, cells not irradiated with cytotoxic factor (phosphate-regulated saline was added) not shown in extensive apoptosis. Example 14. Induction of apoptosis in melanoma cell line USIO-Mel-6 by the fraction QSFT M. bovis and measured by TUNNEL assay. USIO-Mel-6 melanoma cells were prepared as described in the publication by Rauth, S. and Associates, Anticancer Research, 14 (6): 2457-2463 (1994). The QSFT fraction from M. bovis was prepared as in example 8. The melanoma cells brought with QSFT M. bovis fraction (5 μg protein) and the untraceed control cells were incubated for 2 hours. The induction of apoptosis was measured, using the TUNNEL assay to detect the fragmentation of nuclear DNA induced by apoptosis as in example 8. The melanoma cells tyrannized with QSFT fraction of M. bovis showed a green-yellow nucleus in the cytoplasmic color background. red, indicating a fragmentation of nuclear DNA. No fragmentation was observed or little fragmentation was observed with untreated melanoma cells.

Example 15. Growth reduction of melanoma tumor cells (USIO-Mel-2) in deprotected raphons after azurine / cyclochrome c551 bleaching. Approximately 106 USIO-Mel-2 cells were subcutaneously injected into disproved rails (available in Frederick Cancer Research and Developmení Cenler, Frederick, Maryland USA). The small tumors developed after approximately 3 weeks. Subsequently, the mice received intraperitoneal injections once a week of a known ani-melanoma drug, DTIC [5- (3,3 ', N, N-dimethyl-triacen-1-yl) -imidazole-4-carboxamide] ( 7.5 μg) (see the publication of Ahlmais and Associates, Cancer 63: 224-7 (1989)) or iniraperial injections of fres times a week of an alpha dose (150 μg azurine / 75 μg cichlo chrome c551), low (10 μg) azurine / 5 μg cytochrome c55?) of azurine / cytochrome c551 mixture or control (citrafo regulator) lasted for four weeks. The volume of tumor was determined in intervals in control mice, brought with DTIC, and frayed with high and low doses of azurine / cytochrome c55- ?. The increments in tumor size in control mice, brought with DTIC and fracked with C551 disproved are shown in Figure 6 and in Figure 7 the gain / loss data of said mice are shown.

After the injection of an alia dose of 150 μg of azurine / 75 μg of C551 cytochrome, a delayed growth and a contraction of the comparable tumor size of DTIC occurred. Figure 7 shows that injection of either DTIC or azurine / cytochrome c551 mixture did not affect the weight gain of the mice. All mice gained weight during the experimental period. Example 16. Effect of post-injection of azurine and the QSFT fraction of M. bovis in mice deprotected in tumor size after injection of melanoma tumor cells (Mel-6). Approximately 106 USIO-Mel-6 cells were subcutaneously injected into 3 unprotected mice (available from Frederick Cancer Research and Developmenf Cener, Frederick, Maryland E.U.A.). After approximately three weeks, small tumors developed. Subsequently, a rod was injected intraperitoneally with phosphate-regulated saline solution (confrol), a mouse was injected with M. bovis QSFT fraction (5 μg protein) and a mouse was injected with a mixture of QSFT fraction of M. bovis (5 μg of protein) and azurine (50 μg). The QSFT fraction M. bovis was prepared as in example 8. The sizes (tumor volume) of the tumors in control mice, brought with QSFT fraction of M. bovis and were determined during a period of 30 days.

Framed with fraction QSFT of M. ibo s / azurine. These data are shown in Figure 8. Both of the treated mice showed decreased tumor growth compared to the control mouse. Example 17. Azurine induces apoptosis and regression of human breast cancer cells. The human breast cell lines MCF-7 (p53 + / +) MDA-MB-157 (p53 - / -), were obtained from the existence of the culture collection of the Depariomenlo of Surgical Oncology of the University of Illinois at Chicago (UlC ), Chicago. Normal (MCF-10F) and skin cells were obtained from the same source. The HBL100 cells were a gift from Dr. Nita J. Mahile, Department of Biochemistry and Molecular Biology, Mayo Clinics, Rochester, MN. The cells were grown either in MEM medium supplemented with Earle's salt, 10% FBS, Penicillin / Streptomycin or 5A medium of Macoy. The cells were grown at a temperature of 37 ° C in 6% C02. The gene encoding the Pseudomonas aeruginosa azurine was amplified and cloned into pUC19. Azurine was purified from JM109 of E. coli as described in the publication of Yamada, T. y Asociados, Infecí. Immun., Volume 70, pages 7054-62 (2002), whose contents are incorporated for all purposes to the present invention as reference.

The cilotoxicity of azurine towards cell lines, was determined using the MTT assay, as described in the publication by Yamada y Asociados, (2002). Figure 9 shows the cytotoxicity of azurine of MCF-7 and MDA-MB-157 cells framed with various azurine concentrations lasting 72 hours. After 72 hours of irradiation, azurine at a concentration of 28.5 μM (400 μg / ml) induced 50% cell death in MCF-7 cells in 72 hours. Under the same experimental conditions, MDA-MB-157 cells required 57 μM (800 μg / ml) for 50% cell death. To determine if azurine induces similar cell death in normal cells, two mammalian epithelial cell lines (HBL 100 and MCF-10F) were tested. After 72 hours of incubation with 57 μM (800 μg / ml) of azurine, only 20% of the MCF-10F cells and 18% of the HBL100 cells were non-viable. Feasibility was determined through an aqueous proteolytic assay of 96 cellular isolations (Eilon, GF and Associates, Chemoher Cancer, Pharmacol, volume 45, pages 183-91 (2001) using a Promega (Madison, Wl) kit. Treatment with azurine reduces tumor size in unprotected mice injected with breast cancer tumor cells, approximately 500,000 MCF-cells were injected 7 obtained as in example 17 in the lower right mammary fat pad of female deprotected mice previously brought with estradiol (available from Frederick Cancer Research and Development Center, Frederick, Maryland, USA). The rafones were alloyed in two groups of 10 rafones each. The framed group received 1 mg of azurine in 1 ml of normal saline intraperitoneally daily for 28 days, and the control group received 1 ml of saline daily for 28 days. The traffic began several days after the MCF-7 inoculation. During the course of the experiment, the mice are examined daily, the tumor volume of axis-3 and the body weights were measured twice a week. On day 29, the animals were sacrificed and a detailed necropsy was carried out. All tumors and viscera were preserved for histological and immunocytochemical examination. Tumor volume in mice brought daily with 1 mg of azurine for 28 days had a substantially slower range of increase than in animals in the control group. The univariate analysis of the data showed that the difference in tumor growth rates in these two groups (treated with azurine versus control) is significant. For example, 28 days after the start of the In the treatment, the average tumor volume in the treated mice was only 22% of the average tumor volume of the control mice (for example 0.0267 cm3 and 0.1240 cm3, respectively, P = 0.0179, Kruskal-Wallis test), which demonstrates an inhibition of tumor growth of 78%. At the conclusion of the experiment on day 29, the average tumor volume in the group swallowed with azurine was only 15% of the average tumor volume of the conírol group. This is further illustrated in Figure 10, the graph of the variation over time of the average tumor volumes for the two groups, expressed in cm 3, is shown. The multivariate method, the models of non-linear mixed effect were adjusted to the dafos. A model that was adjusted for the growth of the tumor was exponential in time, with coefficients that were mixed effects specific to the subject. For the control group, the fitted model was: tumor volume = exp. { -4.23 + 0.06 * time} , so that for the treated group was: tumor volume = exp. { -4.23 + 0.03 * time} . The difference was statistically significant (P = 0.0456). During the treatment period (28 days, the animals brought did not show any sign of toxicity, as can be evidenced by weight loss and / or other signs of toxicity commonly observed. The degree of apopiosis in tumors was estimated by TUNNEL staining as in example 8. The group treated with azurine showed a marked increase in apoptotic figures compared to controls, where apoptotic cells were rarely found. Example 19. Preparation of azurine mutants. Microorganisms and plasmids The azurine gene (wild-type azurine) was amplified by polymerase chain reaction (PCR) according to the method described by Kukimoto and Asociados, FEBS Leíí, volume 394, pages 87-90 (1996), whose confidencies they are incorporated for all purposes to the present invention as a reference. PCR was carried out using genomic DNA from P. aeruginosa PAOI strain as template DNA. The direct and reverse primers used were 5'- GCCCAAGCTTACCTAGGAGGCTGCTCCATGCTA-3 '(SEQ ID NO: 8) and 5'-TGAGCCCCTGCAGGCGCCCATGAAAAAGCCCGGC-3' (SEQ ID NO: 9), where the restriction sites introduced additionally from the sites Hindlll and Pstl are underlined. The amplified DNA fragment of 545 bp, digested with HindIII and PstI, was inserted into the corresponding sites from pUC19, so that the azurine gene was placed in the downstream of the lac promoter to produce a pUC19-azuA expression plasmid. E. coli JM109 was used as a host strain for the expression of the azurine gene. The recombinant E. coli strain was cultured in the 2YT medium containing 50 μg mi "1 of ampicillin, 0.1 mM IPTG, and 0.5 mM CuS04 for 16 hours at a temperature of 37 ° C to produce azurine. Site-directed mutagenesis of the azurine gene Site-directed mutagenesis of the azurine gene was carried out using a QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). A single group of oligonucleotides was designated for each mutation as indicated below. For C112D: 5'-CAGTACATGTTCTTCGACACCTTCCCGGGCCAC-3 '(SEQ ID NO: 10) and 5'- TGGCCCGGGAAGGTGTCGAAGAACATGTACTGC-3' (SEQ ID NO: 11); for M44K: 5'- CCTGCCGAAGAACGTCAAGGGCCACAACTGGG-3 '(SEQ ID NO: 12), and 5'-CCCAGTTGTGGCCCTTGACGTTCTTCGGCAGG-3' (SEQ ID NO: 13); for M64E: 5'- GGTCACCGACGGCGAGGCTTCCGGCCTGG-3 '(SEQ ID NO: 14) and 5'-CCAGGCCGGAAGCCTCGCCGTCGGTGACC-3 '(SEQ ID NO: 15). The mutations were confirmed by DNA sequencing.

Chimeric azurine mutants The azurine amino acid residues that were considered as candidates for T-cell epitopes were searched through the GENETYX software (Software Development, Tokyo). Seven putative antigenic epitopes, EP1 to EP7: EP1, I20TVDKS25 (SEQ ID NO: 16) were found as follows: EP2, V49LSTAA54 (SEQ ID NO: 17); EP3, G58VVT61 (SEQ ID NO: 18); EP4, C63HASG66 (SEQ ID NO: 19); EP5, R79VIAH83 (SEQ ID NO.20); EP6, K85LIG88 (SEQ ID NO: 21); and EP7, M121KGTLT126 (SEQ ID NO: 22). The amino acid sequences of azurines from various microorganisms that were obtained from GenBank and aligned by the GENETYX software, to compare the amino acids around the putative (EP) T cell (EP) epitope sites (Figure 11 (a)) ). The EP sites, numbered 1 through 7, are shown with bars in the upper part of the sequences. PA, Pseudomonas aeruginosa PAOI (SEQ ID NO: 23); AF, Alcaligenßs faecalis (SEQ ID NO: 24); AX, Achromobacfßr xylosoxidans spp. denifrificans I (SEQ ID NO: 25); BB, Bordefella bronchisepfica (SEQ ID NO: 26); MJ, Meyhylomonas sp. J. (SEQ ID NO: 27); NM, Neisseria meningifidis Z249I (SEQ ID NO: 28); PF, Pseudomonas fiuorescen (SEQ ID NO: 29); PC, Pseudomonas chiororaphis (SEQ ID NO: 30); XE, Xylella fasididiosa 9a5c (SEQ ID N0: 31). Replacements of the amino acids in the putative amphibian epíioppes of P. aeruginosa with amino acids of microbial azurines were designed to obtain chimeric azurines in which the antigenic epitopes were altered. Chimeric mufanfes were collected cumulatively by site-directed mutagenesis and the replacement of a fragment of BslEll resfriction in the azurin gene using the following oligonucleotides: for mutation T21Q with EP1, 5'- CAACACCAATGCCATCcagGTCGACAAGAGCTGCAAGC-3 '(SEQ ID NO: 32 ) and 5'- AGCTCTTGTCGACcígGATGGCATTGGTGTTGAGAGC-3 '(SEQ ID NO: 33); for mutation T126K within EP7, 5'-GAAGGGCACCCTGAagCTGAAGTGATGCGCG-3 '(SEQ ID NO: 34), and 5'-GCGCATCACTTCAGctCAGGGTGCCCTTCATC-3' (SEQ ID NO: 35), for mufions T52K / A53S within EP2, 5'- AACTGGGTACTGAGCAagtCCGCCGACATGCAGGGC-3 '(SEQ ID NO: 36) and 5'- CTGCATGTCGGCGGacíTGCTCAGTACCCAGTTGTG-3' (SEQ ID NO: 37); for mutations G58P / V591 within EP3, 5'-CCGCCGACATGCAGccCaTGGTCACCGACGGCATGGC-3 '(SEQ ID NO: 38) and 5'-GCCATGCCGTCGGTGACCAtGggCTGCATGTCGGCGG-3' (SEQ ID NO: 39); for M591 / V60A mulations of EP3, 5'-CATGCAGCCCATcGcCACCGACGGCATGGC-3 '(SEQ ID NO: 40) and 5'- CATGCCGTCGGTGgCgATGGGCTGCATGTCG-3' (SEQ ID NO: 41); for muíaciones S66A / G67A / H83F / K85P / L861 deniro EP4, EP5, EP6 and, 5'- GTCACCGACGGCATGGCToCCGcCCTGGACAAGGATTACCT GAAGCCCGACGACAGCCGTGTCATCGCCítCACccGaTcATCG GCTCGGGCGAGAAGGACTCG-3 '(SEQ ID NO: 42) and 5'-GTCACCGAGTCCTTCTCGCCCGAGCCGATgAtCggGGTGaaG GCGATGACACGGCTGTCGTCGGGCTTCAGGTAATCCTTGTC CAGGgCGGcAGCCATGCCGTCG-3' (SEQ ID NO: 43), where a BsiEll site was underlined, they were used to replace BstEII fragments of the wt azurine gene. The small letters in the oligonucleófidos indicate the nucleóíidos muíagénicos. Figure 11 (b) shows the natural-type azurine and chimeric mutant azurines prepared by using the methods described above. S1 (SEQ ID NO: 45), S2 (SEQ ID NO: 46), S3 (SEQ ID NO: 47), S4 (SEQ ID NO: 50), and S6 (SEQ ID NO: 51), were built in this order by cumulative site-directed mutagenesis. WtS5 (SEQ ID NO: 52) and S3S5 (SEQ ID NO: 48) were constructed by replacing the wf of the BstEII fragments (SEQ ID NO: 44) of aztine wt (wtS5) of azurine S3 (S3S5) with mutagenic BstEII fragment, respectively. WIS5S4S6 (SEQ ID NO: 53) and S3S5S4S6 (SEQ ID NO: 49) were consumed by two rounds of site-directed mutagenesis using the wtS5 gene and the S3S5 gene as the template DNA, respeclivamenle. The induction of mutations was confirmed by DNA sequencing. The replaced amino acids are shown in bold letters. The genes were expressed in E. coli lal as described above for the wild type azurine. No expression of S3S5S4S6 was observed. Natural-type azurines and muirins were purified from periplasmic fractions of recombinant E. coli cells using a FF Q-Sepharose column and a Superdex 75 column (American Pharmacia Bioíech AB, Uppsala, Sweden) according to the method described by Kukimoto and Associates, (1996). For the preparation of apo-azurine, the natural-type azurine was sprayed with a 0.1M Month regulator, pH 6.0 containing 0.2M thiourea, 0.25M NaCl and 1mM EDTA for 16 hours. The copper released by dialysis was eliminated according to the method described by Van Pouderroyen and Associates, Biochemistry, volume 35, pages 1397-1407 (1996). Example 20. Cytoxic activity of azurine and mutant azurines. The natural type azurine, apo-azurine, C112D mutants and M44KM64E and the chimeric mutants prepared in Example 19 were used in macrophage cytotoxicity assays. Isolation of macrophages was as in Example 2. Approximately 1 x 10 5 cells were seeded per deposit in 96-well culture plates in 200 μl of RPMI-1640 medium containing 10% FBS at a temperature of 37 ° C with 5 % of C02. After growth overnight, the cells were washed with the same medium, which was then replaced with a new medium containing azurine and mutant azurine. After tracing for 24 hours, 10 μl of a solution of 5 mg mi4 MTT [3- (4,5-dimethylfiazol-2-yl-2,5-diphenyl-teryrazolium bromide)] was added to the culture and incubated for 2.5 hours at a temperature of 37 ° C. The MTT reaction was terminated by the addition of 40 mM HCl in isopropanol. The formazan MTT format was measured spectrophotometrically according to the method described by Mosmann, J. Immunol. Methods, volume 65, pages 55-63 (1983). The cytotoxicity of azurine and mutant azurines is shown in Figure 12 (a) and 12 (b). Figure 12 (b) also shows the relative electron transfer efficiency of the mutants expressed as a percentage of the natural-type azurine. Therefore, the efficiency of Electron transfer between oxidized azurine and the induced cytochrome C551 was measured by instantaneous laser photolysis as described in the publication by Cuíruzzola and Associates, Journal of Inorganic Biochemistry 88; 353-361, 2002. Example 21. Apopiophic azimine and mutant azurines. To determine the range of apoptosis induced by natural-type azurine or azurine mutants, the change in mitochondrial potential was measured by flow cytometry (Becton Dickinson, Inc., Franklin Lakes, NJ) using a mitochondrial membrane sensor system ApoAlert (Clonik Laboratories, Inc., Palo Alto, California, USA). Isolation of macrophages was as in example 2. Approximately 1x10 6 cells were seeded per deposit in six-reservoir plates in 12 ml of RPMI-1640 medium containing 10% FBS at a temperature of 37 ° C with 5% C02. . After growth overnight, the cells were washed with the same medium, which was subsequently replaced with a new medium containing azurine and mutant azurine. After 16 hours of fragrancing, the cells were stained with MitoSensor feint and analyzed by flow cytometry with an FL-1 filter according to the manufacturer's manuals.

Figure 13 shows the apoptotic activity of azurine, apo-azurine and the mutants C112D and M44KM64E towards macrophage cells. The apoptotic range (%) is expressed as the fraction of the cell population that is changed from the control population to an apoptotic population with green fluorescence. Example 22. Cytotoxic activity of rusticianin, apo-rusticianin and pseudoazurin. The wild-type azurine was prepared as in example 19. The rusticyanin from Thiobacillus ferrooxidans and pseudoazurin from Achromobacter cycloclasts were prepared by hyperexpression of their genes and column chromatographic fractionation, as described for azurine (Yamada and Asociados, 2002 Goto y Asociados, 2003). Apo-rusticianin was prepared using the method described in Example 18. UISO-Mel-2 cells obtained as in Example 3 were obtained. Approximately 5 x 10 3 cells were seeded per deposit in 96-well culture plates in 200 μl of medium MEM that contains 10% FBS at a lemperafura of 37 ° C with 5% C02. After overnight growth, the cells were washed with the same medium, which was subsequently replaced either with regulator (PBS pH 7.4 or Tris-HCl pH 5.0), crude sample containing rusticianin in Tris-HCl pH 5.0, or apo-rusticianina on PBS pH 7.4. After 24 hours, an MTT assay was carried out as described in example 19. The cytotoxicity of the wild type azurine, rusficianin, apo-rusticianin and pseudoazurin is shown in figure 14. Example 23. Plastocyanin cytoxic activity. The naíural azurine was prepared as in example 18. The plasnocyanin was prepared from Phorinidium laminosum by hyperexpression of its gene and column chromatographic fractionation as described for azurine. The macrophage isolate was made as in example 2. Approximately 1 x 10 5 cells were seeded per deposit in 96-well culture plates in 200 μl of RPMI-1640 medium containing 10% FBS at 37 ° C with C02 at 5 ° C. %. After growth overnight, the cells were washed with the same medium, which was subsequently replaced with a fresh medium containing azurine or mutant azurine. After 24 hours of treatment, 10 μl of a solution of 5 mg / ml MTT [3- (4,5-dimethyltiazol-2-yl-2,5-diphenyl-tetrazolium-bromide)] was added to the culinary and incubated last 2.5 hours at a temperature of 37 ° C. The MTT reaction was terminated by the addition of 40 mM HCl in isopropanol. The formazan MTT formed in accordance with the method described by Mosmann, J. Immunol, was measured spectrophotometrically. Methods, volume 65, pages 55-63 (1983). Figure 15 shows the cytotoxicity of natural type azurine and plastocyanin.

Claims (21)

1. A method for bringing a condition related to cell death resistance, wherein the method comprises administering an effective amount of cupredoxin, or a variant or derivative thereof, to promote cell death in a cell that demonstrates resistance to cell death.

2. The method according to claim 1, characterized in that the cupredoxin, or the variant or derivative thereof, binds to the tumor suppressor protein p53.

3. The method according to claim 1, characterized in that the cupredoxin is selected from a group consisting of an azurine, a pseudoazurin, a plastocyanin and a rusticianin.

4. The method according to claim 3, characterized in that the cupredoxin is an azurine.

The method according to claim 4, characterized in that the cupredoxin is an azurine comprising the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having at least 90% sequence identity with the SEQ ID NO: 1.

6. The method according to claim 5, characterized in that the cupredoxin is an azurine that it comprises the amino acid sequence of SEQ ID NO: 1, or an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1 and wherein cupredoxin binds a p53 tumor suppressor protein.

7. The method according to claim 4, characterized in that the azurine comprises the amino acid sequence of SEQ ID NO: 6.

8. The method according to claim 4, characterized in that the azurine comprises the amino acid sequence of SEQ ID NO: 7.

9. The method according to claim 3, characterized in that the cupredoxin is a plastocyanin.

The method according to claim 9, characterized in that the cupredoxin is a plastocyanin comprising the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 2 11.

The method according to claim 3, characterized in that the cupredoxin is pseudoazurin.

The method according to claim 11, characterized in that the cupredoxin is a pseudoazurin comprising the amino acid sequence of SEQ ID NO: 4, or an amino acid sequence having at least 90% sequence identity with SEQ ID NO :4.

13. The method according to claim 3, characterized in that the cupredoxin is a rusticianin.

The method according to claim 13, characterized in that the cupredoxin is a rusticianin comprising the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence having at least 90% sequence identity with the SEQ ID NO: 3

15. A method for preparing a condition related to cell death resistance, wherein the method comprises administering an effective amount of cytochrome C551, or a varianfe or derivative thereof to promote the arrest of growth in a cell demonstrating resistance to cell death .

16. The method according to claim 15, characterized in that cytochrome C551 comprises the amino acid sequence of SEQ ID NO: 5, or an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 5.

The method according to claim 15, characterized in that the condition related to cell death resistance is selected from the group consisting of human melanoma, leukemia, breast cancer, ovarian cancer, lung cancer, mesenchymal cancer, cancer of colon, and airway degenerative cancers.

18. The method of compliance with the claim 17, characterized in that the condition related to resistance to cell death is breast cancer.

The method according to claim 15, characterized in that it further comprises administering an effective amount of a cupredoxin selected from a group consisting of azurine, a pseudoazurin, a plastocyanin and a rusticianin.

The method according to claim 1, characterized in that the condition related to resistance to cell death is selected from the group consisting of human melanoma, leukemia, breast cancer, ovarian cancer, lung cancer, mesenchymal cancer, cancer colon, and cancers of the aerodigeslive nerve.

21. The method according to claim 20, characterized in that the condition related to resistance to cell death is breast cancer. R E S U M E N Cytotoxic factors are described that are used in the modulation of cell death, and their use in methods to bring conditions related to necrosis or apoptosis. The present invention also relates to methods for identifying useful active agents in the trafficking of conditions related to cellular muerfe or non-coniolated growth. The inventors of the present invention have discovered that different microorganisms produce cytotoxic differential differences that have anti-cancer activity. Substantially pure cytotoxic favors can be used in a method to eradicate an infectious disease or cancer.