MXPA06001398A - Bridged element for detection of a target substance - Google Patents

Abstract

Physical changes resulting from an association between a template molecule and a target molecule are detected by monitoring changes in the template molecule. Exemplary changes include a change in a physical dimension or stiffness of the template molecule, a change in electrical conductivity of the template molecule and a change in the energy required to dissociate the target molecule and the template molecule. The magnitude of the change is indicative of the specific identity of the target molecule.

Description

BRIDGE ELEMENT FOR DETECTION OF AN OBJECTIVE SUBSTANCE CROSS REFERENCE TO RELATED REQUESTS This document claims the priority benefit, under U.S.C. Section 119 (e), for U.S. Provisional Patent Application Serial Number 60 / 493,142, entitled "METHOD AND BIO-ELECTRONIC DEVICE FOR RAPID DETECTION OF ANALYTES SUCH AS BIOLOGICAL AGENTS," by Fred G. Albert et al., Filed August 6, 2003, which is incorporated herein.

TECHNICAL FIELD This document generally belongs to sensor devices, and more particularly, but not by way of limitation, to the detection and analysis of a target substance.

BACKGROUND Previous efforts to detect analytes, such as biological agents, pathogens, bacteria, viruses, fungi, molecules and toxins are relatively problematic, time consuming and require significant technical expertise to operate. For example, one technique generally requires incubation of samples in Petri dishes for an extended period of several days. Another technique includes the use of inked antibodies selected to identify the presence of specific pathogenic bacteria.

In addition, some systems require target biological molecules to undergo an amplification procedure that is prone to errors and requires a high level of technical expertise. In addition, amplification sometimes can not determine the concentration of an objective biological agent and is not practical for use in the field. Some systems fail to detect natural or contrived changes in biological agents, are known to generate false positive errors and are sensitive to test conditions. Some devices for the detection of biological molecules (such as proteins or DNA sequences) require a large number of target molecules to operate effectively. According to the above, the target molecules must be amplified, and in some cases marked, which prevents the additional use of model molecules.

BRIEF DESCRIPTION OF THE DRAWINGS In the drawings, which are not necessarily drawn to scale, similar numbers describe substantially similar components throughout the various views. Similar numbers having different letter suffixes represent different cases of substantially similar components. The drawings generally illustrate, by way of example, but not limitation, various modalities discussed herein. Fig. 1 illustrates a flow chart for a method of detecting a target molecule. Fig. 2 illustrates a cantilever detector. Fig. 3 illustrates a portion of a cantilevered structure. Fig. 4 illustrates a displacement graph as a function of time. Figs. 5A and 5B illustrate a cantilever detector system. Fig. 6 illustrates a current graph as a voltage function. Figs. 7A and 7B illustrate parameters measured as a function of time. Fig. 8 illustrates a change in resonance. Fig. 9 illustrates a flow chart for a method of preparing a model molecule. Figs. 10 and 11 illustrate flow diagrams for detection methods of a target molecule. Fig. 12 schematically illustrates a set of cantilevers in a system. Fig. 13 illustrates an example of a portable detector.

DETAILED DESCRIPTION The following detailed description includes references to the accompanying drawings which form a part of the detailed description. The drawings show, by way of illustration, specific embodiments in which the invention can be practiced. These embodiments, which are also referred to herein as "examples," are described in sufficient detail to enable those skilled in the art to practice the invention. The modalities can be combined, other modalities can be used, or structural, logical and electrical changes can be made without departing from the scope. of the present invention. The following detailed description, therefore, should not be taken in a limiting sense, and the scope of the present invention is defined by the appended claims and their equivalents. In this document, the terms "a" or "an" are used, as is common in patent documents, to include one or more than one. In this document, the term "or" is used to refer to a non-exclusive or at least another indicated way. In addition, all publications, patents, and patent documents referred to in this document are incorporated herein by reference in their entirety, as incorporated by reference herein. In the case of inconsistent uses between this document and those documents so incorporated for reference, the use in the incorporated reference (s) should be considered complementary to those of this document.; for unrecognizable inconsistencies, the use in this document is controlled. The accompanying drawings that form a part thereof, show by way of illustration, and not limitation, specific modalities in which subject matter can be practiced. The illustrated modalities are described in sufficient detail to enable those skilled in the art to practice the teachings described herein. Other modalities can be used and derived from it, so that structural and logical substitutions and changes can be made without departing from the scope of this description. The detailed description, therefore, should not be taken in a limiting sense, and the scope of various embodiments is defined only by the appended claims, together with the wide range of equivalents to which such claims are directed. Such embodiments of the inventive subject matter should be referred to herein, individually or collectively, by the term "invention" merely for convenience and without attempting to voluntarily limit the scope of this application to any single invention or. Inventive concept if more than one, in fact, is described. Thus, although the specific modalities have been illustrated and described herein, it should be appreciated that any facility calculated to achieve the same purpose should be substituted for the specific embodiments shown. This document is intended to cover any and all adaptations, or variations, or combinations of various modalities. The combinations of the above modalities, and other modalities not specifically described herein, will be apparent to those of experience in the matter when reviewing the above description. Introduction Molecules are affected by changes in their environment. For example, a single filament deoxyribonucleic acid (ssDNA) will respond to the introduction of its complementary ssDNA. Hybridization of a DNA strand with its complementary strand results in a reduction in total length, as well as a change in the conductive properties of DNA. The changes are directly provided to the fidelity of similarity between the two strands of DNA with still a difference of a single nucleotide having a measurable effect. The analysis of the changes allows the identification of several pathogens and allows the differentiation between specific chains. In one example, a microelectromechanical structure (MEMS) is used to measure the molecular changes associated with hybridization. For example, a mobile element in a MEMS chip is connected by a selected single filament DNA fragment. A complementary fragment is detected and identified based on a measurement of the deflection of the element and a conductivity measurement resulting from the hybridization. In one example, signal processing is used to interpret hybridization events as detection and identification. The correlation of length and change of conductivity to DNA filament homology is used to discriminate between known pathogens and variants, and between benign and virulent varieties. In addition, a voltage applied after hybridization causes the DNA strand of the pathogen, or target molecule, to be released from the model molecule. The current to which the target molecule is released can also provide information to identify the target molecule. In addition, by releasing the target molecule, the sensor can be prepared for an additional detection event. In addition, sensor integrity is tested by conducting a low-level current through the model molecule before a detection event to verify continuity. In one example, a set of DNA bridge MEMS sensors allows the simultaneous multiplexed detection of numerous viral or bacterial pathogens, or allows the concentration measurement of a single pathogen. In addition, changes in the resonance of the model molecule are used to identify a sample that binds to the model molecule. In one example, a mobile end of a cantilever is connected to a structure by a model molecule. The resonance frequency of the cantilever system (with the model molecule bridge) will change in the hybridization of the sample with the model molecule. The degree of homology can be determined by the magnitude and direction of the change in amplitude or frequency. 'Exemplary Method Fig. 1 illustrates the exemplary method 100 for detecting and identifying a target substance. The target substance, in one example, includes a single strand DNA fragment. As used herein, the target molecule and the model molecule are coined terms and the molecules are related in the manner of their binding. According to the above, a particular sensor uses a first strand ssDNA as a model molecule and a second strand ssDNA is a target molecule, another sensor can use the first strand ssDNA as the target molecule and the second strand ssDNA as the model molecule. Other combinations of bond patterns are also contemplated. For example, either the model molecule or the target molecule can include nucleic acid molecules (eg, oligonucleotides, including ss-DNA or RNA referred to as ss-RNA), proteins and carbohydrates. A model molecule comprising a single strand of DNA can be hybridized with a complementary strand of DNA to form a double strand DNA (ds-DNA). In addition, a model molecule including a protein can be attached to a target molecule that also includes a protein (through a protein-protein recognition), a nucleic acid (through protein-nucleic acid recognition) or a carbohydrate (a through protein-carbohydrate recognition). In addition, a model molecule including nucleic acid can be attached to a target molecule including a nucleic acid using DNA (through nucleic acid-nucleic acid recognition) or a carbohydrate (through nucleic acid-carbohydrate recognition). In addition, a model molecule including a carbohydrate can be attached to a target molecule including a carbohydrate (through carbohydrate-carbohydrate recognition). In general, model molecule-target molecule combinations can be described as a safe and key mechanism that allows certain molecules to bind only with other molecules. In 105, the sample to be analyzed is collected. The sample, which potentially includes the target molecule, can be in a gas, liquid or solid form. In 1 10, the sample is prepared for analysis, which, in one example, includes filtering the sample. At 115, the sample is supplied to the sensor for analysis. The sample supply, in one example, includes routing the sample using a microfluidic pump, valve, channel, vessel or other structure. At 120, the sample is introduced into one or more sensors for possible detection and identification. In several examples, detection and identification include monitoring a change in length or position, a change in a force, a change in resistivity or electrical conductivity, determining a signal level to disjoin a sample of the model molecule and determining a change in resonance . At 125, the collected data is processed to detect and identify the sample. Processing the data, in several examples, includes comparing an output signal with stored data where the stored data includes a look-up table that correlates an objective molecule with a model molecule. Other procedures are also contemplated. For example, a sensor integrity test can be performed before exposing the sensor to the sample by monitoring several parameters. Cantilever Sensor Exemplary Fig. 2 illustrates the sensor 200 according to an example.

The substrate 215 provides a reference structure or stage in which the cantilever is fabricated. The base 210 is fixed to one end of the cantilever 205A and raises the cantilever 205A above the substrate 215. In one example, the cantilever 205A has dimensions of approximately 200 μm in length by 20 μm in width and 1 μm in thickness. A portion of the model molecule 220 is fixed to a cantilevered free end 205A. The figure illustrates the model molecule 220 as a linear element having one end attached to the free end of the cantilever 205A and another end attached to a portion of the substrate 215. The space between the cantilever 205A and substrate 215 is connected by the model molecule 220. In In the figure, the model molecule 220 is shown at a time when no complementary binding pattern has been joined and the cantilever 205A is shown in a relaxed or uncharged state. Alternative positions for cantilever 205A are illustrated in dotted lines. The cantilever 205B, for example, is illustrated at a time when a joint pattern has been associated with the model 220. The cantilever 205B has been displaced by the distance D1 below the position shown by the cantilever 205A. The model molecule 220 is associated with a low affinity binding pattern. The cantileau 205C illustrates a moment when a different joint pattern has been associated with the model 220. The cantilever 205C has moved by the distance D2 below the position shown by the cantilever 205A. The cantilever 205C represents the case when the model molecule 220 is associated with a binding pattern with higher affinity than the bonding pattern represented with the cantilever 220B. The displacement of the cantilever 205A is detected, in one example by an optical detection system. In the figure, the optical source 230 projects a light beam 250 on a cantilevered surface 205A that is reflected, as shown by the beam 245A, and is detected by the cell 240A of the optical sensor 235. The cantilever 205B reflects light, as shown by beam 245B which is detected by cell 240B and cantilever 205C reflects light, as shown by beam 245C which is detected by cell 240C. Sensor 235 is illustrated as having three cells, however, more or less is also contemplated. In one example, the optical source 230 includes a laser or other collimated light source. Others, means for detecting displacement or cantilever resonance 205A are also contemplated. In one example, a piezoelectric element provides an electrical signal as a deflection function of the cantilever 205A. The piezoelectric element includes a piezoelectric material that is attached to, or integrates with, a cantilever surface 205A, base 210, or other structure. In one example, a capacitance measurement is used to determine the displacement or resonance. For example, a conductive layer of a cantilever structure serves as a capacitor plate. The capacitance between the conductive layer of the cantilever and another conductor varies with the distance between the conductors. In this way, a capacitance measurement can provide resonance and displacement data. In several examples, the conductive layer of the cantilever is electrically isolated from other conductive layers of the cantilever. In one example, an electric or magnetic field is used to determine the displacement or resonance of a cantilever structure. The relative motion between a magnet and a conductor provides a signal used to determine displacement or resonance. In addition, a variety gauge attached to a cantilever provides resonance and displacement information. Exemplary cantilever structure Fig. 3 illustrates an example of a sensor structure fabricated using Directed Model Circuitry (DiTC) construction. The directed model circuitry uses microelectromechanical systems, self-assembled monolayers (SAMs), and DNA hybridization. Using lithography, thin films of various materials, including metals such as silver (Ag), chromium (Cr), gold (Au) and carbon, are modeled in micron size dimensions. The self-assembled monolayers selectively immobilize model molecules on a MEMS surface. In addition, proteins and other biomolecules can be immobilized on surfaces such as gold using SAMs. In addition, target analytes can be detected using amperometric methods and SAMs on electrodes. In a modality of the directed model circuit, the SAMs technology is used to apply a monolayer of the protein streptavidin in gold that is layered in chromium. Streptavidin is immobilized on the surface of the gold electrode based on the binding of the protein to a biotinylated dissolved monolayer on the gold surface. The same biotin-based chemistry is then used to bind between about 20 and 100 base oligonucleotide primers specifically designated and synthesized to hybridize the single strand DNA model bridge as shown in Fig. 8. The model circuitry primers directed, they direct the orientation and placement of the ssDNA model bridge, that is, the left hand primer. In one example, a single strand DNA model (ssDNA) is ligated using oligonucleotide primers in a way that bypasses an electronic MEMS-based circuit. Hybridization to target DNA derived from the microorganism identified, causes a reduction in distance between cantilever arms. . The manufacture of MEMS microchip devices using model circuitry assumptions directed, briefly, a gel photopolymerization technique to produce microarrays of polyacrylamide gel bearings separated by a hydrophobic glass surface. In one example, the DNA oligonucleotides are applied to the gel bearings and tested for proper orientation and placement by fluorescence microscopy and exonuclease digestion.

Other methods can be used to join the model molecule to the contact points in a manner that aligns the tempered molecule for detection and identification of a target molecule. For example, established unions using Streptavidin gold and sulfur / biotin group are also contemplated. In one example, the primers are designed and synthesized to hybridize to a model molecule comprising a single-stranded DNA molecule. In addition, the primers are installed and oriented so that the model molecule will have a desired position and orientation. More particularly, the primers ensure that a selected portion (at or towards a first end) of the model molecule is attached to a cantilever surface and that a selected portion (at or to a second end) of the quenched molecule is attached to another cantilever surface. In several examples, the ends of the model molecule is directed to a specific portion of the cantilever structure (one way alignment) or non-directed (two way alignment). Performance - Displacement In one example, the resistance of a DNA strand, and length, is dependent on the base composition, sequence and environment. A measurable biophysical phenomenon occurs when a single strand of DNA interacts with its complementary strand. In particular, the average free length reduction of DNA in the hybridization with its complement is approximately 40%. The composition and sequence of DNA nucleotides can be correlated with structural and other biophysical parameters. Fig. 4 illustrates a relationship between force amplitude and displacement of a cantilevered surface 205A. For a particular cantilever, the measured performance can be used to identify a complementary joint pattern. If a cantilever is exposed to a molecule shows that it is not a completely complementary, then the results will be different. Fig. 4 graphically illustrates the resistance of a biological molecule for an example. For the presented data, a molecule is tied between the cantilever tip and a substrate. Tying is done by adding a functional group to the ends of the model ssDNA for cantilever at one end of the sequence and to the substrate at the other end. Exemplary combinations include gold-Tiol linkages and biotin-streptavidin linkages. The data analysis to establish the molecular tensile strength is presented in the figure. In one example, the sensor structure is manufactured so that the model molecule is maintained at a light voltage, however, a voltage close to zero or neutral is also contemplated. With the tempered molecule maintained in such a way, a binding pattern is introduced. For a model molecule of ssDNA, a suitable binding pattern is the complementary ssDNA strand. The subsequent binding (or hybridization) of the model molecule with the target molecule provides a measurable change in a physical or characteristic parameter. The cantilever is able to detect (and measure) displacement and change in length of the molecule due to hybridization. The figure illustrates a cantilever shift relative to hybridization of a model ssDNA with a target ssDNA. As observed, the cantilever deformed by approximately 10.2 nm after exposure of the ssDNA model with a ssDNA target genetically coupling (or complementary). This experimental approach is repeated in more than 100 different biological molecules. In the figure, the standard objective represents a filament of complementary ssDNA with 100% homology with the model molecule (filament). Other objectives are illustrated at 2%, 19% and 38% variant of 100% strand of complementary ssDNA homologue. As used herein, the term variant denotes an objective ssDNA containing random base base substitutions relative to 100% complementary homologous ssDNA filament. The gradations observed in the figure illustrate that variant ssDNA molecules are also detectable and identifiable using the present system. Dual Exemplary Cantilever Detector Figs. 5A and 5B illustrate views of cantilever-based sensor 500. FIG. 5A illustrates model 545 molecule connecting, or linking, free ends of double projections 505A. The cantilevers 505A are electrically coupled to the detector circuit 530 through conductors 550 and connecting plates 535 placed at stabilized ends of cantilevers 505A. The connecting plates 535 are joined to a layer 510 which is placed in upper layers 515 and layer 520. Layers 510, 515 and 520, in one example, are comprised of S3N4, Si, S3N4 each having a thickness of about 50 nm, 150 nm and 250 nm, respectively. The cantilevers 505A are suspended above the sample channel 540 formed in the layer 515. The cantilevers 505A, in one example, are formed in layer 555 (gold) and layer 560 (chromium) having thickness of approximately 40 nm and 5 nm, respectively . In Fig. 5A, cantilevers 505A are connected by a model molecule of ssDNA 545 under few or no tensile forces. The detector circuit 530, in one example, provides an electrical current to detect the level of conductivity. It will be appreciated that the conductivity is the reciprocal of resistance and in one example, a resistance is determined. In one example, an impedance value is determined. In Fig. 5B, bridge 565 represents a hybridized dsDNA formed by the combination of the model molecule (ssDNA) and the "target molecule (ssDNA)." As illustrated in Fig. 5B, the cantilevers 505A deviate convergently. detector circuit 530 generates a conductivity measurement and in the hybridization of the dsDNA filament, it reflects a measured increase in conductivity In several examples, a test circuit and a reset circuit are provided in detector circuit 530. The test circuit is configured to provide a current to model molecule 545 to establish that the model molecule is properly fixed to the cantilever arms For example, a combination of a series of a current source, sensor and a resistor will indicate an expected current flow if the sensor and model molecule are properly configured Deviations from an expected current level can indicate that the model molecule or the sensor is not configured Appropriate way for sample test. A reset circuit of the detector circuit includes an actuator circuit to disengage the target molecule from the model molecule in preparation for another identification and detection event. In one example, this involves providing a ramp voltage to the model molecule and monitoring a maximum current. In one example, this involves providing a camping current to the model molecule and monitoring a maximum voltage. The maximum voltage, or current, will coincide with an event of disassociation or denaturation of the model molecule and the target molecule. Fig. 6 illustrates an example of a current required to induce the denaturing of bound DNA of a complementary filament. The reset circuit, or other means to provide a denaturing current can remove the complementary filament from a sensor site, thus preparing it for a new detection event. In one example, a sensor placed in a flow stream can be used for successive and separate detection events, in this way, allowing continuous operation of the sensor.

In figure 1, the denatration current is indicated in the ordinate and the applied voltage appears in the abscissa. The difference in current magnitude, as illustrated, provides a means to discern variations of a complementary target molecule. A high degree of proportionality is observed between the amount of current required to force denaturation and the degree of decoupling of the target and model ssDNA filaments regardless of whether the variation occurred in a region of the genetic sequence or diffuses over a number of different locations along the target sequence. Figs. 7A and 7B illustrate a manual process for increasing the voltage to force the denaturation followed by a reduction in the voltage back to the detection levels to allow another hybridization to occur. As illustrated in Fig. 7A, a number of detection events are observed. The restart signals are illustrated in Flg. 7B, as corresponding to those detection events. A denaturing current provides a means to reset the sensor. The denaturation current appears consistent, both during the ssDNA and after the hybridization states (dsDNA). In the figure, a complementary filament is introduced approximately 15 seconds from the start of data acquisition followed by an immediate detection event. After several seconds, the voltage is manually increased to approximately 4 volts, resulting in the denaturing of the double-stranded DNA. The voltage is manually reduced to 3 volts, and the system is reset in this way for another detection event. Resonance Example Fig. 8 includes graphical data 800 illustrating how resonance can be used to identify and detect a target molecule using a bridged model molecule. In the figure, the frequency is plotted on the abscissa and amplitude on the ordinate. The cantilevered structure, or other suspended structure is actuated to oscillate using an excitation signal. In several examples, the excitation signal is provided by a magnetic, piezoelectric or acoustic member placed close to the movable structure. In the figure, curve 805 illustrates an example where the model molecule resonates at an initial frequency of F2 and with an initial amplitude of A2. After exposing the model molecule to the target molecule, the structure resonates with a frequency of F-i and with an amplitude of A-i. The difference in frequency? F and the difference in amplitude? A are indicative of the degree of homology and therefore allow detection and identification of the target molecule. For example, it is believed that a target molecule with a higher percentage of coupling with the model molecule will show a greater change in either or both of the amplitude and frequency. The figure illustrates a reduction in both amplitude and frequency. However, in other examples, either or both of the amplitude and frequency may show an increase or a reduction. . In one example, the resonance of the mobile portion of the MEMS device allows detection and identification. In one example, one end of the cantilever includes a magnetic material and an alternating current passed through a coil disposed under the cantilever causes the cantilver to vibrate at the frequency of the alternating current. In one example, the dimensions of the cantllver and the alternating current are selected to maximize the output. For example, if the alternating current is close to the natural frequency of the cantilever, the response of the structural system will be maximized. The stiffness of the structural system is changed when ssDNA, or another model molecule, is tied between the end of the cantilver and the base of the substrate. Either or both of the amplitude of the displacement of the oscillating system and the frequency of oscillation will differ from that of the system with the free cantilever end. In the introduction of a target molecule (such as an analyte or the complement of ssDNA to the ssDNA model), the amplitude of the displacement and frequency of the oscillating system will change. The amount of the change will be proportional to the degree of homology between the molecules, model and objective, since the stiffness of a strand of dsDNA is greater than the sum of the stiffness of two independent ssDNAs. In this way, in addition to the detection of the presence of the analyte, the change in amplitude and frequency can be used to measure the degree of homology of the ssDNA molecules when compared to that of a complementary coupling.

Exemplary Preparation Fig. 9 illustrates a flow chart of method 900 according to an example. In the figure, a cantilever is formed at a base at 905. Structures other than a cantilever are also contemplated, including, for example, a helical or circular structure having a supported end and a free end. In addition, a rectangular or disc-shaped structure is also contemplated with a movable central region and a perimeter fixed to a base structure in the manner of a drumhead. In one example, semiconductor fabrication techniques are used for the formation of the cantilver in the base. In 910, a bonding material, or primer, is applied to the cantilever and to the base structure or substrate. The primer is selected to ensure that the model molecule is fixed with proper alignment and orientation. In several examples, the primer includes gold and streptavidin. In 915, the model molecule bridges between the substrate and the cantilever. In one example, method 900 is performed by a manufacturer when preparing a sensor for a particular application. Identification and Exemplary Detection Figs. 10 and 11 illustrate 1000 test methods and method 1100, respectively. The illustrated methods, as well as other methods, can be implemented using a computer, or other control circuitry, coupled to a sensor. In one example, the method is executed using manual sensor control. In Fig. 10, the sample is prepared at 1005. The sample preparation, in several examples, filtration, purification, amplification and other methods to prepare the sample for analysis. In 1010, the model molecule is analyzed to establish one or more parameters to serve as a baseline. In one example, this involves verifying that the model molecule is properly aligned and placed when verifying a current level through the model molecule. In addition, the resonance conductivity or resistivity, amplitude and resonance for the model molecule alone is measured. In one example, the physical position of the model molecule is measured. In 1015, the sample is exposed to the model. In one example, this involves injecting a sample, possibly including the target molecule, into a channel or container of this test apparatus. The channel or vessel is in communication with the model molecule. At 1020, the model molecule is analyzed to generate a physical parameter corresponding to the model molecule exposed. The parameter set forth, in several examples, includes measuring a change in a position, or displacement, measuring a change in alignment, measuring conductivity or resistance, measuring a denaturing current and measuring changes in resonance. Other physical parameters are also contemplated, including those based on a color or optical property of the combination of the model and objective molecules.

At 1025, a request is made to determine if a difference is observed between the baseline and the parameter after exposure of the sensor to the target molecule. If a change in the physical parameter, or a difference, is observed, then processing continues at 1030 where the sample is identified. The existence of a difference is indicative of detection of the model molecule. As observed elsewhere in this document, the degree of homology is indicative of the coupling between the model molecule and the target molecule. Other binding pairs are also contemplated and the proximity to a complete coupling can be correlated with the difference observed in the physical parameters. In one example, a memory coupled to a processor of the subject subject includes data stored in the form of a look-up table. The stored data provide a correlation between the differences or changes observed in a physical parameter and the degree of homology. If the request in 1 025 produces a negative response, then the processing continues to 1035 where an emission signal is generated. The output signal, in several modalities, includes a measurement of the observed difference or change, the degree of homology or the identification of the target molecule. At 1040, the model molecule is cleared of any remaining target molecule or sample material, or restarted, by applying an electronic excitation to the model molecule and inducing denaturation or disunity. In an example, following 1040, the method returns to 1005 for detection and identification of an additional sample. Fig. 1 1 illustrates method 1100 which includes a serial test of a sample. It will be appreciated that other test orders are also contemplated as well as parallel testing. For example, the measurement of a change in resonant frequency, resonant amplitude and conductivity can be performed concurrently. In method 1100, the initial conditions, or baseline, are set at 1105. In 11-10, the displacement of the sensor, due to the model molecule hybridizing to the target molecule, is determined. In 1115, a change in resonance is determined. The change may correspond to a change in resonant frequency or resonant amplitude. At 1120, the conductivity of the model molecule with the target molecule is determined. At 1125, a disjoint current, or heat level, is determined by monitoring a maximum signal. Fig. 12 illustrates a set of cantilever sensors fabricated on substrate 1205 having common base 1210. The cantilevers, some of which are marked 1240A, 1240B, 1240C and 1240D are fixed to the base 1210 at one end and tied by the model molecules to contact points 1245A, 1245B, 1245C and 1245D, respectively, on a substrate surface 1205. The model molecules, in one example, are of identical composition and provide a level of redundancy for testing. In one example, at least two model molecules are different and are adapted to detect and identify different target molecules. Each cantilever, such as 1240A, is coupled to controller 1215 by electrical conductors 1235A and 1235B using a muitiplexer 1220. Controller 1215 selectively applies test current, voltage, drive signals or other signals to allow each cantilever to detect and identify a molecule objective. The power source 1225 of the controller 1215 provides a ramp voltage or constant or current for excitation. In one example, the power source 1225 provides a denaturing current or voltage. In one example, the power source 1225 provides a drive signal to excite the resonance in each cantilever. Interface 1230 is coupled to controller 1215 and provides data input and data output. In several examples, the interface 1230 includes a screen, a touch-sensitive screen, a keyboard, a numeric keypad, a mouse or other indicator control, an audio transducer, a storage device, a printer, a network connection ( for example, a wide area network such as the Internet, or a local area network such as an intranet), an electrical connector or a wireless transceiver. Fig. 13 illustrates exemplary portable device 1300 according to one embodiment. In the figure, the screen 1305 provides visual indications and data corresponding to the analysis of a target molecule and condition of the device. User-accessible controls and data entry points include power button 1310, reagent cut 1315, sample input 1320 and controls 1325. Other controls and data entry devices are also contemplated. In one example, a permeable surface on the device 1300 allows a user to supply a sample using a syringe or other injection device. In one example, a port on a surface of 1300 includes a container to receive a sample. The device 1300 is illustrated as a battery-operated, portable device, however, other modalities are also contemplated, including for example, a desk unit with accommodations to receive a sample and provide an outlet. Example In addition to measurable changes in length or force, the ability of DNA structures to conduct an electrical current is related to the content, sequence, length, and chemical environment of the bridged circuit. In one example, conductivity is related to guanine / cytosine levels. In one example, a genomic DNA sequence of Bacillus of 121 base pairs (bp) is isolated from genomic, plasmid and viral lambda DNA. The data indicate consistent results using numerous variables with respect to DNA properties (length, sequence composition) and analysis conditions (redox, pH, salt, denaturant, and accelerating hybridization controls) and other DNA (single or double-stranded) ), molecules and genetic variants isolated from Bacillus as well as DNA from E. coli. The subject fragment is isolated from Bacillus genomic DNA by restriction endonuclease digestion and ligated into a cloning vector of plasmid pUC 13 which is transformed into an E. coli host as the variety of origin. A library of random genetic point mutations is created along the length of the plasmid insertion and is isolated with insertions that varied from the origin by 2%, 19%, and 35% were sequenced and used for further analysis. Both parenteral and variant insertions are cut from the host plasmid and the 5 'and 3' ends were chemically modified with a thiol and biotin group. The single strand DNA is isolated using affinity chromatography (based on the biotin modifications) and is joined between stages and atomic force microscopy (AFM) coated with gold and streptavidin. The AFM tip initially does not deviate. In one example, the change in effective length of a single strand of DNA as it hybridizes to its complementary strand is a 40% reduction. The AFM tip displacement is observed within seconds by introducing the DNA complement (in hybridization solution) or genetic variants to the bound DNA model. The experimental results indicated a consistent tip displacement (< 0.5% VOC) as a function of the degree of decoupling between model and complement. It is postulated that base pair decoupling or contribute to the helical formation of the total structure, thus reducing the reduction in molecule length. The electrical conductivity is determined using conductive AFM tips. The same 121 bp fragment is tied between AFM tip and stage and the DNA complement is introduced. The electric current (in nanoampers) is measured as a function of time at a fixed voltage. Prior to the introduction of complementary DNA, the applied voltage resulted in a current, consistent or baseline (of approximately 0.3 nA) passing through the bound ssDNA. The treatment of ssDNA bound with DNA nuclease results in a loss of this baseline current. The nuclease treated with heat does not result in a loss of current. The measurable current through a sensor provides a sensor function check (sensor self test) since the electric current will flow if the ssDNA remains attached to the MEMS mobile elements. After hybridization between the bound ssDNA and its complementary filament, an increase in current appears as shown in the figures. In addition, the figures illustrate a relationship between measured current and the degree of coupling between the filaments. After hybridization, the conducted current remains relatively constant as long as the voltage is applied to the sensing site. After the hybridization, the applied voltage is increased and the conducted current increased correspondingly to a maximum level. The denaturation of the bound ssDNA and the complementary filament occurred at a potential of approximately 4.1 volts for this particular fragment of 121 bp. The amount of current associated with the denaturation varied with the degree of coupling between the bound ssDNA and the complementary strand. The current with the current drop, the AFM tip returned to an undifferentiated position. It is postulated that the highest level of current infuses enough energy in the hybridized filaments so that they can not remain more hybridized although other mechanisms or factors may be responsible for this phenomenon. The base pairs decoupling present in the variants seem to introduce insulating locations along filaments, thus reducing the conductance. In one example, the selection of a model molecule, such as particular DNA, to connect a circuit or cantilever structure affects the specificity of DNA, length, sequence, composition and conductivity. In one example, the identification and detection specificity is improved by selecting ssDNA from multiple genetic regions of a pathogen to bind. In one example, a longer DNA segment provides increased specificity (DNA sequence that is unique to the target of the specific biological agent). In one example, a shorter DNA segment allows the selection of high content regions of guanine (G) or cytosine (C). The total composition of GC and the sequence provides insulating characteristics of adenine (A) and thymine (T). The rich content of AT in DNA leads to inflexibility and total molecular curvature depending on the relative positioning of regions rich in AT (that is, in phase with helical rotation). In several modalities, the selected DNA segments were greater than 40% GC, or greater than 60% GC. The length of the DNA segment was therefore less than 500 base pairs (bp), or less than 150-200 base pairs (bp). The determination of the GC composition of DNA, sequence, and specificity is determined using commercially available and publicly available software such as PubMed BLAST (www.ncbi.nlm.nih.gov/). Other software is available to correlate first order molecular parameters with higher order features (ie, flexibility, curvature). In one example, the model molecule is selected using a software algorithm. Additional Examples In one example, the sensor includes a suspended member that includes a cantilever. The model molecule is fixed to a point of contact, at least one of which is located in the suspended member. The cantilever, in several examples, is curved, circular or in the form of a network. In one example, the suspended member is a rotating member that rotates about an axis. As a rotating member, the point of contact travels along an arc when the model molecule binds to the target molecule. In one example, one end of the rotating member rotates while another remains fixed or rotates in an opposite direction or through a smaller range and the phase difference between the two ends of the rotating member provides a difference signal that is used to discern the target molecule. In one example, the model molecule has more than one specific binding site to a target molecule. In one example, the target molecule has multiple binding sites, each of which is specific to a different target molecule. In one example, the target molecule has multiple binding sites, each of which is specific for a single target molecule. In one example, the multiple contact points are provided in one sensor and the model molecule joins two or more of the multiple contact points. For example, a double-ended model molecule can be attached to a sensor having two, three or more contact points. As another example, a model molecule with three ends can be attached to a sensor having two, three, four or more points of contact. In an example, an output signal is generated as a function of a change in a measurement of a physical parameter. The physical parameters include structural parameters such as electrical. Exemplary structural parameters include positional changes such as physical displacement, resonant frequency, resonant amplitude, physical alignment or orientation of a point of contact and a reference point, force exerted on an axis, optical and heat-generated changes including color. Other physical parameters are also contemplated. In one example, an output signal is generated as a function of a change in a measurement of an electrical parameter. The exemplary electrical parameters include impendance, conductivity, resistivity, inductance, capacitance. In addition, an electrical parameter can be described as an output signal in the presence of an input signal. For example, a change in current conducted in a model molecule can result in a change in voltage. In addition, a change in voltage applied to the model molecule can result in a change in a current. Other drive signals may also be applied and the measured responses may be used to generate an output signal. Other electrical parameters are also contemplated. In one example, a physical parameter includes a measurement of electrical conductivity. . Electrical conductivity is a measurement of the flow of electrons in a material. Electrical conductivity is the reciprocal of resistivity, or resistance, and in one example, the monitored physical parameter includes resistivity. In one example, a model molecule ssDNA, linked through oligonucleotide primers, bridges an electronic MEMS-based circuit. Hybridization to a target molecule (such as DNA) is derived from the microorganism that is identified and causes a reduction in the distance between the cantilevered elements. In various modalities, a buyer or Wheatstone bridge is used to detect, identify and compare voltage levels, current levels, conductivity or other parameters. In one example, denaturation of the model molecule is done by applying heat to the model and target molecules. A heat level is quantified by measuring a current, voltage or current. In one example, a difference in the heat level correlates with the identity of the target molecule. In one example, a single sensor site includes a single strand DNA (ssDNA), tied by bridging a mobile element in a microelectromechanical chip (MEMS). In one example, hundreds or thousands of such sites are placed in a single chlp. bound ssDNA is selected to hybridize with a complementary strand extracted from a bioagent of interest. The resulting hybridization changes both the physical length of the bound molecule, and changes the conductivity of the bound molecule. Changes are measured in a SEMS system at a high signal-to-noise ratio. The degree of change is related to the degree of coupling between strands of bioagent and bound DNA. In this way the degree of variance (specificity) of the bioagent can be measured. After detection, identification and discrimination are confirmed, the strand of bioagent DNA is expelled from the strand attached by increasing the current flow through the molecule, thus restarting the sensor for subsequent detection events. The viability of the sensor is verified through a self-test since a bound ssDNA (absent its complement) is capable of conducting a measurable amount of current.

Physical parameter changes are proportional to the fidelity of coupling between the model molecule and the target molecule (or DNA strands). A decoupling of nucleotide produces a measurable change, thus allowing the identification of several pathogens and differentiation of subsequent variations between specific strains. In one example, the model molecule includes ssDNA. In one example, the specific DNA regions of B. anthracis are propagated and functionalized. The sensor can be bridged by DNA from any biological agent (bacteria, virus or fungi). In one example, four (4) 150-200 base pair (bp) segments of Bacillus anthracis (Ames) are selected to be used as DNA bridge models. In one example, for the purpose of testing the ability of systems to discriminate between strains, alternative sequences to one of the models are designed. The variants differ from the source molecule by random nucleotide substitutions to generate 2%, 10% and 20% variants. The selection of the model molecule is based on the parameters of conductivity, calculated specificity, and flexibility. Species and strain-specific segments are chosen from virulence and fingerprint genes of 16S rRNA. In one example, the four selected 150-200 bp models and variants are synthesized through commercially available DNA synthesis kits. The 150-200 bp DNA models and variants are synthesized in 50 bp ssDNA fragments.

The hybridization and ligation stages are used to create 150-200 bp full-length models. The models are ligated into an appropriate plasmid cloning vector and a library of the DNA bridge models are generated in large-scale plasmid production preparation. Optionally, the selected 150-200 bp model candidates are cut by restriction endonucleotide or amplified PCR digestions and subcloned from Bacillus anhtracis (Ames) DNA. In one example, DNA bridge models are covalently bound to MEMS and AFM surfaces through biotin-estrepativin and thiol-gold linkages. Plasmid-derived models were cut from restriction endonuclease, and labeled at the biotin / thiol 5-primer / 3-primer end with commercially available kits. In one example, the models are amplified by PCR using primers labeled with thiol and biotin. In one example, DNA variants and models are verified for sequence integrity through outsourced DNA sequencing services. The specificity of each of the molecules is verified through standard Southern selection against genomic DNA from strains of Bacillus anthracis (ie., Ames, Sterne, A2012, 1055, Vollum, Kruger) and anthrax stimulants (ie., B. globigii, B. cereus, B. subtilis, B. thuringiensis) purchased commercially from the American Type Culture Collection or purchased through a material transfer agreement or other collaborators.

In one example, atomic force microscopy (AFM) is used to measure specific physical properties (ie, displacement and conductivity) of variant ssDNA fragments and B. anthracis. The AFM stages and tips are coated with gold and streptavidin and the DNA bridge models labeled at the end with thiol / biotin bind. The electrical properties of the material and displacement of the AFM tip are measured before, during and after hybridization with variant and complementary ssDNA molecules and are used as an input into the design of the MEMS device. In one example, the reagents for controlling the hybridization (pH regulators, salts), denaturation, hydrolysis and nucleotide oxidation are selected. In one example, MEMS manufacturing techniques are used for the construction of sensor chips. In one example, fabrication involves the deposition of thin films of material on a substrate, application of a mask modeled on the material using photolithographic methods and selective etching of the film using the resulting developed mask. The deposition of the material on the substrate (silicon ostia) is carried out by means of chemical reaction (chemical vapor deposition)., epitaxy, electrodeposition, or thermal oxidation) or by approaches based on physical reaction (evaporation, firecracker or smelting). The removal of materials is done through engraving techniques. In this way, the circuitry for the device, using the application of patterned photolithographic masks, is constructed using appropriate application of layers of conductive and insulating material. The manufacturing equipment incorporates the chip in the package which, in one example, includes a plastic or ceramic housing for the chip that includes the interface with pins for attachment to a printed circuit board (PCB). In one example, in the manufacture of MEMS chips, DNA bridge models are generated and tested. In one example, the MEMS mobile elements (cantilevered end) includes covalent biotin / esptrepativinine and thiol / gold linkages. The unique molecule binding is performed by electrostatic attraction. In one example, the device applies an electric potential of 5 volts through the space between the mobile MEMS elements where the tied ssDNA is desired, in series with a resistor of 10 MO. The ssDNA molecule is attracted to the resulting electric field. When in proximity, the biotin-streptavidin bonds in the substrate base are formed, and the gold-thiol bonds are formed in the free end of the overhang. When a molecule binds in this way, the potential through space is reduced due to the series resistance in the circuit. In this way, a single ssDNA molecule binds at each site. Excess DNA that is not bridged through MEMS circuits is removed by DNA exonucleases digestions. The circuit is stored in DNA stabilizing regulators (ie, 300 mM NaCl, 10 mM Na citrate and 5 mM EDTA). In one example, current measurement in the nano-amp range is performed using integrated circuit amplifiers.

An amplifier integrated circuit (IC) multiplexing and other electronic and processing are used to display the results of detection events. The analog signals taken from the MEMS chip are amplified and converted into digital signals. In one example, a printed circuit board includes accommodations for joining the MEMS chip and the IC chip. The board also includes a dedicated main processing chip used to perform calculations and electrical control operations on PCBs. PCB contains electrical interfaces for deployment and battery, as well as menu buttons. In one example, a program executed by the main processor uses the digital signals emitted from IC to provide deployment. The user interface includes controls to display and set parameters that determine the deployment characteristics, threshold detection values, battery level, on / off and purge control of pathogen molecule. In one example, a plastic housing contains the printed circuit board (and attached IC bio-chips), sample flow paths, LCD screen and control buttons. In one example, the interior walls of the housing contain shelves and slots for containing electronic components and produce change within the housing. In one example, the housing includes one or more flow paths for introduction and removal of reagents and sample. In one example, the electrical conduction through the sensor sites is greater than 0.2 nA using AFM electronics. In one example, the integrated circuit provides analog signal amplification > 10 mV maximum to maximum. In one example, the sensor is configured to detect and identify preferred genomic DNA from strains of Bacillus anthracis and anthrax simulators (ie B. globigii, B. cereus, B. subtills, B. thuringiensis), mechanically interrupted whole inactivated cell ( sonicated) and chemistry and spores of previously mentioned anthrax stimulators and strains, DNA and whole cells / spores in the presence of common and interfering contaminants such as postal powder, soil components, other chemical mixtures, and mixed consortiums of microorganisms. In one example, the system includes sufficient signal amplification, processing and deployment to detect and identify a target molecule. In one example, electronic controls include on / off, mode, display control, battery life, reset functions and self-test. In one example, the system includes one or more flow passages for delivering a prepared sample to the surface of a sensor configured to identify a single predetermined pathogen, simulators or target variants of DNA in an interruption solution. In one example, the sample is collected outside the system using air collector in groups or surface drying. The present system includes a method and apparatus for determining the presence, identity or amount of an objective substance comprising chemical or biological analytes. In one example, an electronic circuit including at least one deflectable arm of a bio-electronic cantilever is surface treated to facilitate attachment to a model polymer molecule that undergoes a measurable change in a physical parameter in response to environmental changes, such as the presence of an objective molecule associated with a target substance to be detected. For example, a change in the physical configuration or dimensions of the model molecule results in a deflection of a cantilever arm. In one example, a change in electrical characteristics through the model molecule is detected by hybridizing a single strand DNA bridge model to its complementary strand. Such changes in physical properties or parameters are measured to provide information related to the presence and identity of a substance of interest. In an example, a number of such circuits bridged by similar model molecules is provided and information related to the concentration or amount of the target substance can be obtained. In one example, a microcircuit with geometry adapted to be used within a biological agent detection device is provided to detect the presence of target and related biological substances or agents. As used herein, a model molecule can be any molecule that will bind, or is likely to respond, to the presence or binding to a biological agent or a component of a biological agent. According to the above, a model molecule can comprise a synthetically formed or naturally occurring biological molecule that will respond, or will be able to respond to, or bind to, an objective molecule associated with the target substance to be detected. In one example, the model molecule includes an antibody, protein, nucleic acid, carbohydrate, glycoprotein, or a polymer. In one example, the specific model molecule selected to detect the presence of a particular target molecule (or species or genera of target molecule) is selected so that the model molecule responds to, or binds only to the exact target molecule or molecule related objective. In one example, a differential electric current or physical displacement results from a biomolecule-biomolecule recognition between the target and model. According to the above, the relationship between a model molecule and a target molecule can be that of complementary strands of nucleic acids, including ribonucleic acids (RNA) and deoxyribonucleic acids (DNA) and derived molecules. Additional examples of the relationship between the model molecule and the target molecule include nucleic acid-nucleic acid recognition, protein-protein recognition, protein-nucleic acid recognition, protein-carbohydrate recognition, nucleic acid-carbohydrate recognition, and carbohydrate-carbohydrate recognition. In one example, a biosensing device containing the described circuit including a model molecule by expanding a space between two surfaces is provided. In one example, the two surfaces are mobile relative to each other. When the model molecule is exposed to, binds to, a target molecule, the model molecule undergoes a dimensional change, altering the distance between the two surfaces. According to the above, a biosensing device according to such embodiment of the present invention can signal the presence of a related or objective biological substance or agent when a change in the distance between the two surfaces is detected. In one example, the amount by which the distance between the surfaces is altered is indicative of the molecule exposed to, or bound to, the model molecule. For example, a target molecule that is an exact coupling to the model molecule (ie, an "exact target molecule") can result in shortening the distance between the points of the model molecule interconnected to the two surfaces by an amount that is greater than the shortening that occurs when the model molecule joins a molecule that is related to but not an exact link for the model molecule. According to the above, when measuring the amount by which the distance between the two surfaces has changed, the information related to the identity of the molecule bound to the model molecule is obtained. In one example, a biosensing device containing the described circuit capable of measuring the conductivity through a model molecule is provided. In particular, a model molecule is interconnected with the first and second electrodes, so that it expands the space between the two electrodes. When the model molecule binds to a target molecule, the conductivity between the electrodes is altered. According to the above, when detecting a change in the conductivity between the electrodes, the presence of a target molecule or related molecule can be detected. In addition, the amount by which the conductivity between the electrodes changes is indicative of the molecule bound to the model molecule. For example, an exact target molecule will cause a greater change in the conductivity observed between the electrodes than a target molecule will bind to the model molecule that is related but not identical to the exact target molecule. According to one embodiment of the present invention, a detection device that can be reused, without requiring the replacement of components, is provided. In particular, by heating the model molecule, the related molecule or target can be dissociated from the model molecule. According to one embodiment of the present invention, the heating of the model molecule is carried out by passing a current through the model molecule (and the bound molecule). In addition, the process of disbonding the target molecule from the model molecule can be used to obtain information related to the identity of the target molecule. In particular, the current applied through the model molecule (and target molecule) can be increased in a fixed manner or increased in stages, until a sudden change in conductivity is observed, indicating that the target molecule has been: disassociated from the model molecule. Because the current, and therefore heat, necessary to disengage the target molecule is related to the fact that both the target molecule is coupled to the model molecule, the amount of current required to disengage the target molecule is an indication of the proximity of the target molecule. coupling between the bound molecule and the target molecule. For example, an exact target molecule would be expected to require more energy to dissociate it from the model molecule that would be a molecule that is not identical to the target molecule. In one example, a biological agent detection device containing the described circuit combining a number of detection mechanisms or techniques is provided. For example, a detection device can determine the presence of an objective biological agent by detecting a dimensional change experienced by a model molecule, by detecting a change in conductivity through a model molecule, or by determining the amount of current required to disengage an objective molecule from the model molecule. In addition, the information for identifying the target molecule can be provided using such mechanisms or techniques. In accordance with one embodiment of the present invention, a method for detecting target substances or analytes upon detecting a change in a physical dimension associated with a model molecule is provided. According to such a method, a model molecule that undergoes a change in physical dimension when bound to a target molecule is exposed to a suspected biological agent or target substance (i.e., a substance suspected of containing a target molecule). The suspected biological agent can be derived from a gaseous, liquid or solid medium. If the exact target molecule or a related molecule is attached to the model molecule, the resulting dimensional change in the model molecule is detected, and the change is reported. According to a further embodiment, the method includes measuring the amount by which the physical dimension of the model molecule has changed. In one example, a method for detecting a target substance by detecting a change in conductivity associated with the model molecule in the presence of the analyte is provided. A model molecule capable of selectively binding to an exact target molecule or related target molecule is exposed to a suspected biological agent. According to the method, the conductivity through the model molecule is monitored. By binding to a target molecule, the resulting change in conductivity through the model molecule is detected, and that change is reported. In one example, the change in conductivity is measured. In one example, a method for detecting the presence of a suspected biological agent by determining the amount of energy required to disengage a target molecule from a model molecule is provided. An electric current is passed through the model molecule-target molecule pair. In addition, the amplitude of the current can be increased, until a sudden change in conductivity through the model molecule is observed, indicating that the target molecule has been dissociated from the model molecule. In addition, the current to which the target molecule is dyed of the model molecule is used to characterize or identify the target molecule that will bind to the model molecule. The present system refers to the detection and identification of biological analytes. According to the present invention, target biological molecules are detected upon detecting a change in a model biological molecule. The change in the model biological molecule can include a change in a physical dimension of the model molecule, a change in the electrical conductivity observed through the model molecule, and / or the energy required to disassociate an objective molecule from the model molecule . The magnitude of the change in a physical dimension, change in conductivity, or amount of energy required to disassociate a molecule. The objective of a model molecule can be measured to determine the degree of homology between the target molecule and the model molecule. In a further aspect, the present invention provides a detection method and apparatus that do not require the replacement of components for multiple readings. In one example, an electronic circuit is bridged by a model molecule, including a biological component or a representation of the biological component. In one example, the circuit includes a MEMS-based structure bridged by a nucleic acid molecule, such as a DNA molecule, or a molecule that physically and chemically represents a single-stranded DNA molecule. In one example, the MEMS circuit detects and responds to the movement and conductivity of a bridged DNA molecule as it hybridizes with its complementary or almost complementary DNA strand. The following describes the selection and design of biological components of the bio-electronic circuit. As used herein, the specificity of the biological detection and identification device refers to the ability of the system to specifically and accurately identify a particular genus, species and strain of target biological agent. In the case of DNA-based biological detectors / identifiers, the term specificity sometimes refers to the ability of the DNA components of the system to specifically specifically and hybridize to a DNA isolated from the biological agent. In the present, multiple segments of biological agent DNA are selected (in one example, more than three). The selection of the DNA segment is based on the calculated parameters of length, specificity, conductivity and flexibility of the molecule to bridge the MEMS circuit. Longer DNA segments tend to retain greater specificity (DNA sequence that is unique to the target of the specific biological agent) and even shorter DNA segments allow the selection of high content regions of guanine (G) and cytosine (C ): The GC sequence and total composition is related to the insulating characteristics of adenine (A) and thymine (T). In addition, the high content of AT in DNA leads to inflexibility and total molecular curvature, depending on the relative positioning of regions rich in AT (that is, in phase with helical rotation). In this way, the selected DNA segments can be greater than 40%. GC, or greater than 60% »GC. In one example, the length of the DNA segment is less than 500 base pairs (bp) or less than 150-200 base pairs (bp). The determination of the GC composition of DNA, sequence, flexibility, curvature, and specificity is determined through a number of privately, commercially and publicly available software such as PubMed BLAST (www.ncbi.nlm.nih.gov/). In one example, four DNA model segments are 100% homologous to Bacillus anthracis (Ames) and samples less homology to other strains and Bacillus species. The specific segments of strain and species have been chosen from virulence and fingerprint genes of 16S rRNA. In this mode, microorganisms outside the genus Bacillus fall below the exact detection and identification thresholds. In one example, a matrix includes MEMS bridged with DNA having DNA components that have specificity for other biological agents, and, in one example, is capable of continuously monitoring the presence of agents simultaneously. The following describes the production of the biological components of the bio-electronic circuit.

In one example, the specific DNA regions of the target biological agent are selected, generated, mass produced and chemically modified for ease of adherence to a MEMS circuit. In addition, variants of the DNA regions are also generated and produced for the purpose of testing the proposed circuit for discrimination capabilities. In one example, a variant is a DNA molecule that differs from the DNA model selected in nucleotide sequence and composition by 2% to 30%. In one example, four 150-200 bp segments selected either are synthesized, amplified by PCR, or sub-cloned from a current target biological agent. High-fidelity DNA synthesis is generally limited to 50 bp ssDNA fragments which then require hybridization and ligation steps to create the 150-200 bp DNA models of desired length. Completed DNA models bind directly to MEMS guide surfaces if the synthesized fragments of -50 bp 5-arbor and 3-primer are specifically labeled with binding ligands. Alternatively, the completed 150-200 bp models are ligated into a plasmid cloning vector and a library of the DNA bridge model is generated in preparation for mass production. In one example, the selected DNA regions chosen to bridge the MEMS circuit guides can be counted by restriction endonuclease digestions or amplified by PCR, and sub-cloned from the target biological agent. The following describes the integrity check of the biological component. In one example, the DNA circuit bridge models and variants are verified for sequence integrity. Sequence integrity refers to the current nucleotide sequence compared to the desired sequence. The DNA sequencing methods will reveal the exact nucleotide sequence of the proposed molecules to be labeled and attached to the MEMS guide surfaces. Subject matter present is sensitive to single base pair decoupling, thus, any sequence variation should be considered. The following describes test and analysis of biochemical and physical characteristics of the biological component. In one example, the specific ssDNA molecules are selected, mass produced, used to bridge the mobile elements of a MEMS circuit. The selection of specific ssDNA molecules is based on a number of biophysical characteristics such as length, sequence and composition of nucleotides, flexibility and mechanical movement and conductivity parameters. The calculated conductivity and movement parameters are verified by atomic force microscopy (AFM) that can measure specific physical properties (ie, molecular motion as determined by tip displacement and conductivity) of the ssDNA bridge model and ssDNA fragments variants . Stages and tips of AFM coated with gold and streptavidin and gold according to published procedures are bridged, n by DNA bridge models labeled at the thiol / biotin end. The electrical material properties and AFM tip displacement are measured before, during and subsequent to hybridization with variant and complementary ssDNA molecules as input into MEMS device design. Temperature, chemical and operational environments can be considered for specific ssDNA bridge models. For example, reagents for controlling the effects of the user defined operational environment, operational temperature and specific DNA hybridization (pH regulators, salts), denaturation, hydrolysis and nucleotide oxidation may have an effect. In one example, the operational reagents include: a. Salts, pH, temperature b. Hydrolysis control: Conductivity through aqueous environments can induce hydrolysis that would affect the conductivity through the medium. The control of this effect through the addition of appropriate reagents. c. Oxidation control: Conductivity through DNA can induce oxidative damage particularly with guanine residues. Control of this oxidative damage through the addition of antioxidants (ie, ascorbic acid, citric acid). d. Thermal stability factors of DNA (ie, 0.5-3 molar betaines (N, N, N-trimethylglycine; (Rees et al., Biochem., (1993) 32: 137-144). and. Denaturing reagents (ie, 2-4 molar tetraethyl acetate, urea, chaotropic salts (ie, trichloroacetate, perchlorate, thiocyanates and fluoroacetates), or glycerol, formamide, formaldehyde, and dimethylsulfoxide (DMSO). to increase DNA to DNA hybridization through the molecular exclusion phenomenon.Example accelerators include mixtures of acetate salts and alcohols, certain amines (sperm, spermidine, polylysine) 0.1 -0.5 molar detergents (dodecyl trimethylammonium bromide, and bromide of cetyltrimethylammonium) and specific small proteins such as single filament bridge protein.The following describes the verification of DNA specificity.In one example, variants and DNA circuit bridge models are verified for sequence specificity. software of the selected DNA fragment can demonstrate the specificity of the fragment for a region n of a strain of a target biological agent which can be confirmed through the selection of the specificity of bioagent. An example of these methods includes Southern selection in which the various restriction-digested fragments of the bioagent target genome (and any other related suspicious species) are resolved electrophoretically and transferred to a solid substrate (i.e., nylon or nitrocellulose). The fixed genomic DNA fragments can then be incubated with model bridge DNA of labeled (i.e., fluorescent or radioactive) DNA. Under appropriate conditions (i.e., temperature, pH, and salt concentration) the model DNA will hybridize to a single fragment (assuming restriction digestions of genomic DNA did not cut the fragment). Multiple hybridization sites from DNA model to genomic DNA may involve modification of conditions in the biosensing device or selection of a new model DNA. The following describes marking of the DNA bridge model end. In one example, the DNA fragments synthesized, amplified by PCR, or cloned (selected to bridge the MEMS circuit guides) are bound to SEMS surfaces by any of the various methods concerning DNA binding to inorganic or organic surfaces. In one example, specific orientation immobilization is achieved when the unique chemical portions in the DNA bridge model term and MEMS guide surface are degraded. The commercially available specific chemical-type degraders are generally based on nucleophilic substitution chemistry. This chemistry generally includes a direct displacement of a leaving group by an attack nucleophile. In one example, MEMS circuit guides include coated guides with another and streptavidin respectively. In one embodiment, the ssDNA bridge models are covalently linked to AFM and MEMS surfaces through biotin-streptavidin and thiol-gold linkages. The DNA fragments are labeled at the end with biotin / thiol primer 5 / primer 3 with commercially available equipment or by other means by labeling or functionalizing the 5 'and 3' ends of DNA. Binding chemistries may include, but are not limited to amino groups (such as N-hydroxy-succinimidyl esters), polyethylene glycols, carbodiimide, thiol groups (such as maleimide or α-haloacetyl), organosilane groups, or biotin-streptavidin. In one example, DNA fragments are synthesized with biotin or 5 'and 3' streptavidin modified nucleotides, or amplified by PCR with biotin / streptavidin labeled primers of DNA targets originated by plasmid or genomic. The following describes an example of MEMS fabrication. In one example, microelectromechanical systems (MEMS) refers to technology using small mobile structures built on the one million meter scale (micron). These structures are made through the use of a number of tools and methodologies, similar to those used in the manufacture of integrated circuits (IC). MEMS devices, in one example, include combinations of mechanical elements and electrical elements, and in manufacturing, they are placed in a packing with pins that allows the union through a socket on a printed circuit board (PCB). The following describes construction in MEMS layers. In general, the manufacture of a MEMS device includes the deposition of thin films of material on a substrate, the application of a mask formed on the material using photolithographic methods and the selective etching of the film using the resulting developed mask. The deposition of the material on the substrate (usually silicone ostia) can be done by approaches based on chemical reaction (chemical vapor deposition, epitaxy, electrodeposition, or thermal oxidation) or by approaches based on physical reaction (evaporation, firecracker or smelting ). Each of which varies in speed, accuracy and cost of the process; The applied material can be from a few nanometers to approximately 100 microns. The application of the pattern includes placing a photosensitive material on the surface, locating the mask formed on the surface (typically with the help of alignment marks on the surface and mask), and exposing the photosensitive material through the mask. Depending on the process used, either the positive or the negative of the exposed material can be removed, leading to the pattern in the substrate material. Other methods include preparing the surface, developing the photosensitive film and cleaning the result. The manufacture of the MEMS element can be done using micro manufacturing techniques. In one example, lithographic techniques are used in manufacturing using semi-conductive manufacturing methods, such as photolithographic etching, plasma etching or wet chemical etching, in glass, silicone or quartz substrates. The removal of materials is typically done through wet etching, in which the material dissolves when immersed in a chemical solution or dry etching, in which the material is removed in a process essentially opposite to the deposition based on reaction physical. As with the various approaches to deposition, speed, accuracy and cost vary with the approach. In one example, engraving of "deep" cavities of a substrate is done with aspect ratio of side wall at 50 to 1. The MEMS device can be manufactured with one or more mobile elements, through which the model molecule will be attached. ssDNA The movable element, for example a cantilever beam, can be constructed so that both the beam and the substrate below the free end of the beam contain at least one conductive layer. In this way, the circuitry of the device, using patterned photolithographic masks, can be constructed using appropriate application of layers of conductive and insulating material. In one example, the geometry allows sample flow from a DNA bridge MEMS to the next and re-circulation to. improve the likelihood of contact and preserve reagents. One embodiment includes an electronic circuit constructed in a support composed of such materials as, but not limited to, glass, quartz, silicone and various polymeric substrates, for example, plastics. In one example, the various insulating layers are provided in the substrate. In one example, the solid material to support and respond to the molecular properties described (ie, conductivity and movement) are used to construct the device. Although the figures in this description may represent a flat positioning of the circuit, other embodiments include another orientation (i.e., vertical, etc.). An example includes additional flat element (s) covering the channels and containers for closing and sealing to form ducts. This additional flat surface is bonded by adhesives, thermal bonding, or natural adhesion in the presence of certain hydrophilic or charged substances. In one example, sample preparation and collection is completed outside the device. Samples are collected from surfaces using sponges or bearings or collected in air or liquid by aspiration through filters, liquid traps or chromatography resins. Those samples are prepared by adding the reagents to interrupt the biological agent, release the target molecules and prepare those molecules to be detected by the device. The prepared sample is then introduced into the device through a flow channel, vessel or duct by syringe, tube, dropper or other such automatic or manual means.

One example includes the preparation and acquisition of air sample in the device by itself for automatic operation through the presence of a fan aspiration system. An example includes preparation and collection of automatic liquid sample in the device. The interruption of the samples can be provided by mechanical means, such as sonication techniques. In one example, the sample is delivered through a flow path embodied in the device to the surface of the biochip. The device includes reagent containers for sample preparation, as well as for leveling the system, calibrating the device and collecting the waste material. In one example, the device includes means for pumping materials to and from these containers. In one example, the device recirculates reagents through the system if no positive detection event has occurred and the reagent remains of adequate purity. In one example, the oligonucleotide sequences are layered in the guides to aid in the positioning and orientation of DNA bridge models. In general, oligonucleotide-directed hybridization of DNA through a circuit is used to orient and position the single strand DNA bridge model (ssDNA). In one example, the ssDNA bridge model binds to the MEMS guides through any binding method, including biotin-mediated or thiol-mediated linkages. MEMS multi-DNA bridge circuits can be placed on a single chip in a set or array geometry to allow simultaneous identification and detection of multiple pathogens from the same sample. In one example, the array includes multiple identical DNA bridge MEMS repeats to allow measurement of concentration of target DNA molecules as a function of the number of 'stimulated' circuits per sample volume. The following describes biological bridging of MEMS mobile elements. After the physical MEMS device containing the mobile elements and the circuitry is manufactured, the single ssDNA molecule of interest (the model molecule) is attached to the device. In one example there is a cantilever arm, the ssDNA joins the free end of the cantilever to the base of the substrate below the cantilever. In one example, the surfaces are prepared so that the functionalized ends of the model ssDNA will be attached to the surface. The ssDNA is functionalized with a thiol group at one end (which has a high affinity for a gold surface) and biotin on the other side (which has a high affinity for a surface coated with streptividin). In this way, if the gold is used in the duct on the lower surface of the cantilever, the thiol functionalized end of the ssDNA will join it. A gold surface on the substrate below the free end of the cantilever will also be exposed. Prior to the introduction of the ssDNA model to be joined, biotin is deposited electrostatically on the gold surface on the substrate. Streptavidin is introduced over the ostia, which binds to the biotinylated surface in the substrate. In accordance with the above, the surfaces of the MEMS device are prepared to join the ssDNA model. The following describes the electrostatic entrapment of a bridged molecule model which, in one example, includes the joining of a single ssDNA molecule through the space between the free end of the cantilever and the base of the substrate prepared below it. In one example, an electrical potential is applied through space, in series with a large resistor. The ssDNA molecule is attracted to the resulting electric field. When in close proximity, the biotin-streptavidin bonds at the base of the substrate are formed, and the gold-thiol bonds are formed at the free end of the cantilever. As soon as a molecule is joined in this way, the potential through space is vastly reduced due to the series resistance in the circuit. In this way, only one molecule of ssDNA will bind at each site. The field aided the attraction of ssDNA to guide arms MEMS - device to aid in the binding of single molecule. The electrostatic trapping of nanoparticles of unique conduction between nanoelectrodes. Appñ. Phys. Lett. 71 (9). The following describes the removal of model molecules in excess. In some cases, even when only one filament has been bound through space, a number of ssDNAs can be tied to either the gold surface or the biotinylated surface. These "stray" have the potential to undesirably bind the target pathogen ssDNA sequences. In one example, the device is treated with an exonuclease, to remove all unbound ssDNA at both ends, thus eliminating the potential for binding events at other sensing sites. In one example, the system incorporates additional mobile elements, bridged with either synthetic or biological molecules, which act as reference or baseline controls for the elimination of mechanical, electrical or chemical background effects such as temperature, pressure, movement, spray voltage , induced electric fields, and / or chemical sample contaminants. In one example, a device includes thousands of reference sites and sensors on a MEMS chip. The sensing sites may include biological elements to detect the presence of a single bioactive, or may include a variety of biological elements to allow the simultaneous detection of numerous bioactives in a single biochip. The following describes the integration of the MEMS circuit in signal amplification, processing and deployment systems. Measuring the current in the nano-amps range involves integrated circuit amplifiers. In one example, multiplexing and integrated circuit (IC) amplifiers and other electronics and processing are used to display the results of the detection events. An integrated circuit is used to amplify analog signals from the MEMS chip and convert them into digital signals. In one example, IC manufacturing incorporates IC in packaging that allows the connection with IC pins to a printed circuit board (PCB). In addition to providing MEMS and IC chips, PCB includes a main processor for calculations and electrical control operations in PCBs. The PCB includes an electrical interface for the display and the battery, as well as input / output to the menu buttons. In one example, the processor is programmed to use the digital signals emitted from IC to provide deployment. The user interface includes direct controls of the deployment, and controls to set the parameters that determine the deployment characteristics, threshold detection values, battery level, on / off and purge control of bioagent molecule. In one example, PCB, screen, user interface, battery and input / output are integrated into a metal or plastic housing. The following describes test and analysis of an exemplary system. An example involves sample collection, processing and supply to electronic circuitry. to. Sample collection: The procedure for sample collection of air, liquid or solid is based on the source of target molecule and instrument operating environment. For example, particles of appropriate size, mass or charge can be isolated and collected by filtration methods and / or mass spectrometry. Biological or chemical agents trapped in the filters can be eluted by sample preparation reagents and delivered to the instrument. In one example, the instrument aspiration technology is used to entrain or force air samples through the sample preparation reagents that are subsequently supplied to the detection chip. b. Sample Preparation: In one example, air, liquid or solid samples are prepared externally to the detection device or internally through the automatic sample preparation technologies. The specific reagents and steps for sample preparation depend on the target and source molecules to be detected and identified. Chemical means, thermal and / or mechanical are used to break down the contents of the biological cell and release the target molecules. Similar media are used to prepare previously prepared organic or inorganic sources of target molecules. In general, disruption of biological cells requires detergents that solubilize the lipid membranes, enzymatic digestion of proteins associated with cell membranes or target molecules, and various denaturants that modify or otherwise prepare the target molecules for detection and identification. The mechanical means include sonication or agitation, alone or in the presence of interruptive beads. In one example, the filtration or chromatography methods are used to purify the target molecules based on the size, hydrophilicity, charge or affinity of the ligand. In one example, the system is sensitive to indicator quantities of target molecule associated with the sample. In one example, the system detects and identifies specific DNA fragments found on, the surface of, or otherwise associated with the DNA source (i.e., microbe, animal cell, virus). In one example, the double-stranded DNA is fragmented and denatured. c. Supply of sample to microchip. d. Detection, identification and discrimination occurs, e. Result displayed on the device. Exemplary applications for the present system include real-time detection, identification, discrimination, and concentration measurement of components derived from sources including, but not limited to animals, bacteria, viruses, fungi, plants, archaea, found in soil, water or air. Exemplary components include, but are not limited to, organic (i.e., nucleic acid, amino acid, or carbohydrate compounds, etc.) or inorganic (i.e. metals, inorganic phosphates, etc.) related to humans, plants, or animal pathogens. , components and sources of interest for food safety, components and sources of interest to medical diseases, genetic sequences associated with predisposition to diseases, pre-symptomatic diagnosis of diseases in plants and animals, laboratory diagnostic tool of sources or listed components, a laboratory tool to monitor gene expression of specific RNA and identification of specific animals or people through polymorphism ID. In addition, from the DNA-DNA interaction, other alternatives are contemplated, including: Protein-Protein 1) The interaction of prion protein with other prions. Bovine espingiform encephalopathy (BSE, also known as mad cow disease), is a neurodegenerative disease in cattle and ingestion of infected meat products causes Creutzfeldt-Kjob disease (CJD and vCJD) in humans. Variations of BSE have been identified in animal species and have been classified as spongiform encephalopathies (TSE). BSE in cattle or CJD in humans, results when a neural protein called a prion changes from its normal form to an infectious form without bending. Infectious prions without bending then induce other prion proteins to also unfold. The present system can detect physical conformation from a normal prion to the infectious form. In one example, a normal prion protein is bound through cistern or histidine residues exposed to MEMS surfaces coated with gold, nickel or platinum. AFM allows the investigation and verification of the phenomenon underlined in the previous section. Detection events include selected attributes of a dedicated biosensing device. For example, the AFM cantilever tips are constructed using the same approach and techniques as used to fabricate the device, the sensor device including AFM used an ssDNA as a detection site. Search plan to synthesize a DNA bridge model: Stage 1. Synthesis of the molecule fragments (A +, A-, B + and B-) with linkers (small case) (A +) = 5'- CTGGGCTACACACGTGCTACAATGGACAGAACAAAGGGCAGCGAAAC CGCGAGGTTAAGCCAATCC (B +) = 5'- CACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGT GAAGCTGGgcatg (A-) = 3'-tgcaGACCCGATGTGTGCACGATGTTACCTGTCTTGTTTCCCGTCGCTT TGGGGCT (B-) = 3'- CCAATTCGGTTAGGGTGTTTAGACAAGAGTCAAGCCTAGCGTCAGAC GTTGAGCTGACGACTTCGACC Stage 2 Hybridization of the molecule fragments (A + to A-, and B + to B-) (A + / A-) - Heat at 95 Celsius, slow cooling at room temperature CTGGGCTACACACGTGCTACAATGGACAGAACAAAGGGCAGCGAAAC CGCGAGGTTAAGCCAATCC tgcaGACCCGATGTGTGCACGATGTTACCTGTCTTGTTTCCCGTCGCTT TGCGCT (B + / B-) Heat at 95 Celsius, slow cooling at room temperature CACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGT Step 3. GAAGCTGGgcatgCCAATTCGGTTAGGGTGTTTAGACAAGAGTCAAGC CTAGCGTCAGACGTTGAGCTGACGCACTTCGACC ligated fragments A + / A- to B + / B- (A + / A-) in more ligase ligation regulator 1x T4 DNA at room temperature CTGGCTACA-ÁCCGCGAGGTTAAGCCAATCCCACAAATCTGTT- GTGAAGCTGGgcatg tgcaGACCCGATGT- TGGCGCTCCAATTCGGTTAGGGTGTTTAGACAA-CACTTCGACC 121 bp molecules resulting they can then be ligated into Aat ll / Sph I cloning sites of pGem-T. Solutions: Solution I: 50 mM Glucose (0.9% w / w); 25 mM Tris pH 8, 10 mM EDTA pH 7.5 Solution II: 0.2 N NaOH, 1% SDS Solution III: 2.7 M potassium acetate at pH 4.8 with glacial acetic acid SOC = medium (per 100 ml, 2 grams BactoT-trlptone ( BD), 0.5 gram yeast extract (BD), 1 ml 1 molar NaCl, 0.25 ml 1 molar KCl, Mg + 2 2 molar reserve, 1 ml 2 molar glucose). Mg + 2 reserve = MgCl? 1 molar, 1 molar MgSO4. Plates of LB / ampicillin / IPTG / X-Gal = per liter add 15 grams of agar (BD), 10 grams BactoT-tryptone (BD), 5 grams yeast extract (BD), and 5 grams NaCl; adjust the pH with NaOH; autoclave, cool to 50 ° C; add ampicillin at 100 micrograms per ml, I PTG at 0.5 millimolar, and 80 micrograms per milliliter X-Gal. Pour 30-35 ml of medium per 85 mm of plate, add hardened agar at 22 ° C, and store 4 ° C. Abbreviations: ml: milliliter, μl: microliter, g: gram, mg: milligram, ng: nanogram, M: molar (moles / liter), mM: millimomar, (BD = Becton, Dickinson and Company, Franklin Lakes, NJ) ( EM = EMD Chemical Inc., Glbbstown, NJ) (VWR = VWR International, West Chester, PA) (Calbiochem / Novabiochm Corp., San Diego, CA) ((Promega = Promega Corporation Madison, Wl) (Pierce = Pierce Biotechnology Inc ., Rockford, IL) All biological and chemical detection / identification systems must incorporate (A) sample collection, (B) sample and supply processing, (C) sample analysis technology, and (D) signal and output processing (Fig. 1). In one example, the microchip, or series of microchips, consists of thousands of DNA-sensitive overhangs called electromechanical systems (MEMS) installed in a manner to allow the detection, identification, and concentration flow of multiple pathogens (multiplexes). Each cavity in a microchip can contain one or hundreds of cantilever-based circuits. Each circuit is composed of some form of mobile element bridged by preferably a biological molecule so that when the molecule interacts with other molecules, the associated movement causes the cantilvers to move. Numerous geometries are possible such as single cantilever suspended over a stage as represented in the AFM drawings, a single rotating disc or other shape, or two cantilever arms that move relative to each other as shown in Figure 10. A matrix of these bridged overhangs, or cavities of these overhangs, could be constructed so that on an axis the identical redundant circuits measure the concentration of a single biological agent dependent on the number of circuits that respond to the presence of the bioagent. Each row of these overhangs, or cavities of these overhangs, could be dedicated to a different biological agent. Each chip would also contain a significant number of reference cantilevers to respond to previous levels of chemical, mechanical and other environmental 'noise'. A biosensing / identification device could include chips that are dedicated to a particular set of biological agents. For example, a device may contain a chip with cantilevers bridged by molecules that would react only with agents associated with local security. Other devices may contain bypassed cantilevers that only respond to food safety, or important agents for the medical or agricultural industries. As the biological molecule responds to changes in its environment, the mobile elements will deviate, and this subsequent deflection is measured. The measurement of movement in MEMS devices is well documented. One way to measure the deformation is to reflect a laser beam off the surface in the deformable element. As the molecule responds, the element moves, and the laser beam is subsequently diverted to different locations of the receiver. The change in the reflected beam is measured by the different locations of the receiver and correlates with the amount of physical response displayed by the molecule. The present sensitivities are approximately 10 angstroms for displacement and 5 peak-Newtons for force, but improvements as the size of the device shrinks are expected. The smallest transistor-probe structure reported has dimensions of 3x2 microns x 140 nm. Thomas Kenny of Stanford reported the use of sparse cantilevers in atomic force microscopes to measure forces at the atonewton level (10-18 newtons). Several alternative methods to measure the deformation of the mobile MEMS elements also exist. One method is to include a layer of piezoelectric material of the deformable elements themselves. Another includes adding a mass of magnetic material to the end of a mobile MEMS element and measuring the change in magnetic field as the mobile element moves through the responses of the biological element. Still another includes measuring the changes in capacitance through the space bridged by the biological element as it moves through the biological element. The mobile elements of the MEMS device must also comprise a circuit, including the model molecule. In this way, a voltage can be applied through the moving elements, and a resulting current will pass through the ssDNA. The increase in conductivity through the circuit subsequent to hybridization will be measured when detecting the increase in current flow, amplifying that signal and converting the result to digital emission for processing. During normal operation, when a sensor site is in a fixed state (a detection event has not occurred), the voltage across the mobile elements will be set to a 'detection' level. This level is high enough to allow the measurable current, but low enough to be close to the denaturation limit. This current appears to have the additional benefit of dragging target ssDNA into the detection site, most likely through electrophoresis. Passing a stream through ssDNA has an additional benefit. Since the ssDNA is capable of passing a small amount of current on its own (before hybridization), the device has an inherent self-test. If the ssDNA model is damaged, broken, or released from the mobile MEMS elements, the circuit is not completed anymore. In this way, the ability of each sensor site is in a fixed state so that a detection event is able to be validated. If a specific site is found to be inoperable, those signals from that site can be removed in software for inclusion in future calculations for pathogen presence and concentration calculations. Having completed the circuit by the model ssDNA will also allow the ability to measure the third phenomenon observed previously: perform denaturation using electric current. The applied voltage can be increased to a level that results in sufficient current to denature dsDNA. This gives the sensor the ability to reset it, after a detection event occurs, the pathogen attached to the model portion of the device can be rejected. The rejected ssDNA target moves away in the material flowing through the sensor, the voltage is lowered back to its detection level, and the detector site is then ready for another detection event. . The size of these elements is extremely small, so potentially thousands of detector sites could be located on a MEMS chip the size of a penny. In this way, a number of genetic virulence regions could be included in a given chip for a specific pathogen, and additionally, a number of pathogens could be included in a given chip as well. In several examples, the sensor of the subject subject is coupled to a detector. In one example, the detector includes an electrical circuit and is referred to as a detector circuit. In one example, the detector uses non-electrical means to discern a physical displacement or resonance condition. In the absence of a modifier, the term detector includes both electrical and non-electrical detectors. It should be understood that the foregoing description is intended to be illustrative, and not limiting. For example, the modalities described above, or aspects thereof, may be used in combination with each other. Many other modalities will be apparent to those experts in the field when reviewing the above description. The scope of the invention should, therefore, be determined with reference to the appended claims, together with the full scope of equivalents for which such claims are assumed. In the appended claims, the term "including" and "in which" are used as full English equivalents of the respective terms "comprising" and "where". Also, in the following claims, the terms "including" and "comprising" are broad, i.e., a system, device, article, or process that includes elements in addition to those listed after such term in a claim still appear to fall within the scope of the invention. scope of this claim. In addition, in the following claims, the term "first", "second", and "third" etc. , are used merely as labels, and do not intend to impose numerical requirements on their objects.

Claims (50)

1. CLAIMS 1. A device comprising: a model molecule linked between at least two contact points including a first contact point placed on a first, surface and a second contact point placed on a second surface, wherein the first surface is independent of the second surface, further wherein the model molecule includes at least one binding site for a target molecule; and a detector coupled to the first contact point, the first contact point having a first physical parameter, the detector configured to generate an output signal based on a change in the first physical parameter, wherein the change in the first physical parameter corresponds to an association of the target molecule and the model molecule.
2. 2. The device according to claim 1, characterized in that the model molecule is a nucleic acid.
3. 3. The device according to claim 2, characterized in that the model molecule is ssDNA or ssRNA.
4. 4. The device according to claim 2, characterized in that the target molecule is a nucleic acid comprising a sequence sufficiently complementary to a sequence in the model molecule so that the target molecule will be synthesized to said model molecule.
5. The device according to claim 2, characterized in that the model molecule is a nucleic acid that is attached to the first contact point at its 3 'end and the second contact point at its 5' end.
6. The device according to claim 1, characterized in that the model molecule comprises a polypeptide.
7. The device according to claim 6, characterized in that the polypeptide is bound to its carboxy terminus at the first contact point and at its amino terminus at the second contact point.
8. The device according to claim 6, characterized in that the polypeptide comprises a binding region for a target molecule wherein the target molecule is an antibody.
9. The device according to claim 6, characterized in that the polypeptide comprises a binding site derived from an antibody that binds to a target molecule comprising an antigenic site for said antibody.
10. The device according to claim 6, characterized in that the polypeptide comprises a receptor site for a target molecule. eleven .
11. The device according to claim 10, characterized in that the target molecule is an antagonist or agonist for a polypeptide comprising the receptor site.
12. The device according to claim 1, characterized in that the target molecule is a polypeptide comprising a receptor site for at least a portion of the model molecule.
13. The device according to claim 1, characterized in that the target molecule is or comprises metal ions.
14. The device according to claim 1, characterized in that the model molecule is a polysaccharide.
15. 15. The device according to claim 1, characterized in that the model molecule is a synthetic analogue of a nucleic acid sequence.
16. 16. The device according to claim 1, characterized in that the model molecule is a synthetic analogue of a polypeptide.
17. 17. The device according to claim 1, characterized in that the model molecule is a synthetic analogue of a polysaccharide.
18. The device according to claim 1, characterized in that the first physical parameter includes at least one of: a resonant frequency of the first contact point relative to a reference point; a resonant amplitude of the first contact point relative to the reference point; a distance between the first point of contact and the reference point; and an alignment between the first point of contact and the reference point.
19. 19. The device according to claim 18, characterized in that the reference point includes the second contact point.
20. The device according to claim 1, characterized in that the first surface includes a suspended structure and the emission signal is a function of a displacement of the suspended structure. twenty-one .
21. The device according to claim 19, characterized in that the suspended structure includes a cantilever.
22. 22. The device according to claim 1, characterized in that the first surface includes a piezoelectric element and the output signal is a function of a force of the piezoelectric element.
23. 23. The device according to claim 1, characterized in that the first surface includes a movable surface.
24. The device according to claim 1, characterized in that the detector includes at least one of an optical sensor, a magnetic field sensor, an electric field sensor, a capacitance sensor, a resistance sensor and a voltage sensor.
25. 25. The device according to claim 1, characterized in that the detector includes at least one of a comparator and a bridge circuit.
26. 26. The device according to claim 1, characterized in that the detector includes a resonance actuator in communication with the first surface.
27. 27. The device according to claim 1, characterized in that the first contact point has a second physical parameter, and wherein the detector is configured to generate the output signal based on a change in the second physical parameter, wherein the change in the second physical parameter corresponds to the association of the target molecule and the model molecule.
28. The device according to claim 1, characterized in that the detector is coupled to the second contact point and wherein the first, contact point having a first physical parameter includes the first contact point and the second contact point having a first parameter electric.
29. 29. The device according to claim 28, characterized in that the detector includes a voltage source coupled to the first contact point and the second contact point and wherein the first electrical parameter includes a measurement of a current.
30. 30. The device according to claim 29, characterized in that the voltage source is configured to supply an increasing potential.
31. 31 The device according to claim 28, characterized in that the detector includes a current source coupled to the first contact point and the second contact point and wherein the first electrical parameter includes a measurement of a voltage.
32. 32. The device according to claim 31, characterized in that the current source is configured to supply an increasing current.
33. The device according to claim 28, characterized in that the detector includes an actuator circuit configured to supply an electrical signal and wherein the change in the first physical parameter corresponds to a disunion of the target molecule and the model molecule.
34. 34. The device according to claim 1, characterized in that at least one of the first surface and the second surface includes at least one of glass, quartz, silicone and a polymer.
35. 35. The device according to claim 1, characterized in that the model molecule includes at least one of thiol, gold, biotin and streptavidin.
36. 36. A method comprising: exposing a target molecule to a model molecule, the bound model molecule between at least two contact points including a first contact point placed on a first surface and a second contact point placed on a second surface, wherein the model molecule includes at least one binding site for a target molecule; and generating an output signal as a function of a change in a first physical parameter measured using the first point of contact relative to a reference point, wherein the change in the first physical parameter corresponds to an association of the target molecule and the model molecule.
37. 37. The method according to claim 36 further comprising: Monitoring a resonant frequency of the first contact point relative to a reference point; Monitor a resonant amplitude of the first contact point relative to the reference point; Monitor a distance between the first point of contact and the reference point; and Monitor an alignment between the first point of contact and the reference point.
38. 38. The method according to claim 37, characterized in that the reference point includes the second contact point.
39. 39. The method according to claim 36, characterized in that it also includes actuating the first surface at resonance.
40. 40. The method according to claim 36, characterized in that it also includes conducting a current using the model molecule before exposure.
41. 41 The method according to claim 36, characterized in that it further includes: Driving a rising current using the model molecule; Monitor a corresponding maximum voltage to disengage the target molecule and the model molecule; and Generate the output as a function of the current at the maximum voltage.
42. 42. The method according to claim 36, characterized in that it further includes: Applying an increasing voltage to the model molecule; Monitor a maximum current corresponding to the disunion of the target molecule and model molecule; and Generate the output as a function of the voltage at the maximum current.
43. 43. The method according to claim 36, characterized in that it further includes applying an electrical signal to the model molecule to disengage the target molecule.
44. 44. A system comprising: A port of introduction of the target molecule to receive a sample; A sensor having a model molecule in communication with the target molecule insertion port, the model molecule placed between a first point on a first surface and a second point on a second surface, the first independent surface of the second surface and wherein the model molecule has at least one specific binding site for a target molecule; A detector coupled to the first point and configured to generate an output signal based on a change in a measurement parameter of the first point and corresponding to an association of the model molecule with the target molecule; and An output circuit to provide a result based on the output signal.
45. 45. The system according to claim 44, characterized in that it includes a plurality of sensors, each sensor coupled to the detector by a multiplexer.
46. 46. The system according to claim 44, characterized in that a processor coupled to the detector and having access to a memory, wherein the memory provides data storage to identify a target molecule based on the change in the measured parameter.
47. 47. The system according to claim 44, characterized in that the output circuit includes at least one of an interface, a screen and a wireless transceiver.
48. 48. The system according to claim 44, characterized in that it also includes a test circuit coupled to the model molecule to determine the conductivity of the model molecule.
49. 49. The system according to claim 44, characterized in that it also includes a reset circuit coupled to the model molecule to disengage a target molecule from the model molecule.
50. 50. The system according to claim 44, characterized in that it also includes a housing for containing at least one of the target molecule introduction port, the sensor, the detector and the output circuit.