MXPA06001022A - Binding constructs and methods for use thereof - Google Patents

Abstract

The invention relates to novel binding domain-immunoglobulin fusion proteins that feature a binding domain for a cognate structure such as an antigen, a counterreceptor or the like, a wild-type IgG, IGA or IgE hinge-acting region, i.e., IgE CH2, region polypeptide or a mutant IgGI hinge region polypeptide having either zero, one or two cysteine residues, and immunoglobulin CH2 and CH3 domains, and that are capable of ADCC and/or CDC while occurring predominantly as polypeptides that are compromised in their ability to form disulfide-linked multimers. The fusion proteins can be recombinantly produced at high expression levels. Also provided are related compositions and methods, including cell surface forms of the fusion proteins and immunotherapeutic applications of the fusion proteins and of polynucleotides encoding such fusion proteins.

Description

UNION CONSTRUCTIONS AND METHODS FOR THE USE OF THEM All requests for which this request has priority are incorporated as a reference in their entirety.

Field of the nvention The present invention relates generally to compounds having various utilities including uses for research, diagnosis, and therapy, for example, immunotherapy. The compounds of the invention include immunologically active proteins and protein conjugates. Such proteins include recombinant or engineered binding proteins such as, for example, binding domain immunoglobulin fusion proteins, which may include single chain Fv immunoglobulin fusion proteins and compounds containing single chain Fv immunoglobulins. The present invention also relates to compositions and methods for treating conditions, diseases, and disorders that would be improved, terminated, or decreased with the administration of, for example, polypeptide and / or nucleic acid constructs of the invention, including, for example, malignant conditions and B cell disorders, including diseases characterized by the production of autoantibodies and / or inflammation.

Background of the Invention The immune system is one of the most complex of the many intricate systems of the body. A coarse and complicated arrangement made of many different types of cells that involve many different kinds of molecules, the human immune system allows the body to respond to foreign invaders such as bacteria, viruses, and other infectious agents, as well as foreign material. such as pollen. In general, the human immune system is divided into two main parts, antibody-mediated immunity (also called "humoral" or "circulating" immunity) and cell-mediated immunity, which are managed by lymphocytes. Lymphocytes are one of five classes of white blood cells (leukocytes) that circulate in the blood. There are several kinds of lymphocytes, each with different functions to develop. The most common types of lymphocytes are B lymphocytes (B cells), which are responsible for the preparation of antibodies and T lymphocytes (T cells). The cells of the immune system include not only T cells and B cells but also natural killer cells, granulocytes (or polymorphonuclear leukocytes (PMN)), acrophages, and dendritic cells. The humoral system is driven by B cells with the help of T cells and deals with infectious agents in the blood and tissues of the body. The cell-mediated system is managed by T cells and deals with the cells of the body that have been infected.

An antigen is a substance, usually macromolecular, that stimulates or induces an immune response. Because of its complex macromolecular structure, a simple macroorganism consists of multiple antigens (e.g., surface structures such as cell wall components, fimbriae, flagella, etc., or extracellular proteins, such as toxins or enzymes produced by the microorganism) . The coating proteins and some of the coat proteins of animal viruses are also usually antigenic. A host is generally able to respond specifically to antigens that come in contact with components of their system immune. Both antibody-mediated immunity and cell-mediated immunity systems involve complex inter-relationships that allow them to mount immune reactions and to almost any antigen. In other words, the immune system is able to recognize foreign substances (antigens) that stimulate the system to produce antibody-mediated immunity, cell-mediated immunity, or both.

The complexes of the immune system are constituted by a variety of different cell types and organs scattered throughout the body. These include the primary and secondary lymphoid organs. The primary lymphoid organs are the spinal cord and the thymus. All cells of the immune system are initially derived from the bone marrow in a process called hematopoiesis. During hematopoiesis stem cells derived from the bone marrow differentiate into mature cells of the immune system ("B" cells) or precursors of cells that migrate out of the bone marrow to mature in the thymus ("T" cells). In addition to red blood cells, platelets, and B cells, the bone marrow also produces natural killer cells granulocytes and thymocytes immature The function of the thymus is to produce mature T cells. Immature thymocytes, also known as protocytes, leave the spinal cord and migrate to the thymus where they mature and then release into the bloodstream. The complex of the immune system also includes secondary lymphoid organs, for example, the spleen, lymph nodes, etc., as well as a circulatory system that separates from the blood vessels.

The spleen, made of B cells, T cells, macrophages, dendritic cells, natural killer cells, and red blood cells, is an immune filter of the blood. Migratory macrophages and dendritic cells capture antigens from the blood that pass through the spleen. Migratory macrophages and dendritic cells also bring antigens from the spleen via the bloodstream. An immune response is initiated in the spleen when macrophages or dendritic cells present the antigen to the appropriate B or T cells, and B cells are activated and produce large amounts of antibody.

Lymph vessels and lymph nodes are parts of the special circulatory system that carries lymph. The lymph is a clear fluid that contains white blood cells, mainly lymphocytes. The lymph bathes the tissue of the body, and is then collected in the lymphatic vessels. The lymph nodes dot a network of lymphatic vessels and, when different lymph ducts carry lymph-containing antigen to the node, they function as an immunological filter for the lymph. Composed primarily of T cells, B cells, dendritic cells, and macrophages, the lymph nodes drain fluid from most tissues. The antigens are filtered out of the lymph in the lymph node before the lymph is returned to the circulation. Macrophages and dendritic cells that capture antigens also present these foreign materials to T and B cells in the lymph nodes, resulting in the stimulation of B cells to develop there in the plasma cells that secrete antibodies. The antibodies leave the lymphatic node by means of the efferent ducts that are used in the bloodstream. Lymphocytes can also leave the node through an efferent duct and travel to other sites in the lymphatic system or enter the bloodstream. A simple lymphocyte completes a Circuit through the bloodstream and lymphatic systems once every 24 hours.

The tonsils, adenoids, Peyer's particles, and the appendix are also lymphatic tissues. Peyer's patches (masses of lymphocytes) are similar to tonsils and are found throughout the body, especially in the inner lining of the mucosa of the digestive and respiratory tracts. It is the function of the phagocytic cells found in Peyer's patches and other lymphatic aggregate follicles to defend the body against, for example, inadequately digested food particles that cross the wall of the gut and enter the blood, to attack unwanted foreign invaders while they are still in the intestine.

The main function of B cells is the production of antibodies in response to foreign proteins from bacteria, viruses, and tumor cells. T cells are usually divided into two major groups, namely cytotoxic T lymphocytes ("Te" cells or CTLs) and helper T cells ("Th" cells or helper T cells). Th cells, also called CD4 + T cells They work to increase or enhance immune responses to the secretion of specialized factors that act other white blood cells to fight the infection. They improve the production of antibodies by B cells. Te cells, also called CD8 + T cells, can directly kill certain tumor cells, cells infected with viruses, and sometimes parasites. The Te cells are also important in the sub-regulation of immune responses. Both types of T cells often depend on secondary lymphoid organs (the lymphoid nodes and the spleen) as sites where activation occurs, but they are also found in other tissues of the body, including the liver, lung, blood, and intestinal tracts and reproductive.

Natural killer cells, often referred to as NK cells, represent another type of lymphocyte and are similar to the subset of Te cells. They function as effector cells that directly kill certain tumors such as melanomas and lymphomas and cells infected with viruses. They are called "natural" killers because, unlike T cells cytotoxic, they do not need to recognize a specific antigen before carrying out its function. While NK cells, unlike Te cells, kill their targets without previous activation in lymphoid organs, NK cells activated by secretions of Th cells will kill tumors or targets infected with viruses more effectively. NK cells target tumor cells and protect against a wide variety of microbial infections. In several immunodeficiency diseases, including AIDS, the function of the Natural Killer cell is abnormal. Natural killer cells can also contribute to immunoregulation by secreting high levels of influential lymphokines.

Some MK cells have surface receptors (Fc? RIII, also referred to as C16) for the Fe portion of the IgG antibody. They bind to the target cells through receptors for the Fe portion of an antibody that has reacted with antigen on a target cell. This type of cell-mediated immunity is called antibody-dependent cell-mediated cytotoxicity (ADCC). MK cells may also have receptors for complement component C3, another defense system immune, and in this way recognize cells that are coated with C3 as targets. ADCC is believed to be an important defense against a variety of parasitic infections caused, for example, by protozoa and helminths.

Although small lymphocytes appear identical, they can be distinguished by molecules carried on their cell surface. Not only do such markers distinguish between B cells and T cells, they distinguish between several subsets of cells that behave differently. Each mature T cell, for example, carries a marker known as T3 (or CD3). In addition, most helper T cells carry a T4 marker (CD4), a molecule that recognizes the antigens of the major histocompatibility class II ("MHC") complex. A molecule known as T8 (CD8), which recognizes MHC class I antigens, is found on many suppressor / cytotoxic T cells.

Another group of white blood cells collectively referred to as granulocyte, or polymorphonuclear leukocytes (PMN), are composed of three types of cells These cells, neutrophils, eosinophils, and basophils are important in the removal of bacteria and parasites from the body. Neutrophils migrate through the capillary walls to the infected tissues where they kill the invaders (eg bacteria) and then engulf the remnants by phagocytosis. Eosinophils are cytotoxic, releasing the contents of their granules on an invader. Basophils leave the blood and accumulate at the site of an infection or other inflammation and discharge the contents of their granules, releasing a variety of mediators such as histamine, serotonin, prostaglandins, and leukotrienes, which, for example, increase blood flow to the body. area. Mediators released by basophils also play an important part in some allergic responses such as hay fever and anaphylactic responses to insect bites.

Monocytes are phagocytic white blood cells released from the bone marrow into the bloodstream. When a monocyte enters the tissue, it becomes a macrophage. Macrophages are also large phagocytic cells that gobble up foreign material (antigen) that they enter the body, as well as dead cells that are dying in the body. Macrophages are important in the regulation of immune responses, and are often referred to as scavengers, or antigen presenting cells (APCs) because they collect and ingest foreign material and present these antigens to other cells of the immune system such as T cells and B cells. This is one of the first important stages in the initiation of an immune response. Stimulated macrophages exhibit increasing levels of phagocytosis and also secrete interleukin-1 (IL-1), a product that helps activate B cells and T cells.

Dendritic cells also originate in the. bone marrow and they function like APCs. They are usually found in the structural compartment of lymphoid organs such as the thymus, lymph nodes and spleen, but they are also found in the bloodstream and other tissues. It is believed that dendritic cells capture antigens or carry it to lymphoid organs where an immune response is initiated.

Important immunological system characteristics relevant to host defense and / or immunity of pathogenic microorganisms include specificity, memory, and tolerance. It is understood, for example, that an antibody or reactive T cell will react specifically with the antigen that induced its formation; it will not react with other antigens. In general, this specificity is of the same order as that of the specificity of the enzyme substrate or the specificity of the receptor ligand, although a cross-reactivity is possible. The specificity of the immune response is explained by clonal selection.

During the primary immune response, a specific antigen selects a pre-existing clone of specific leukocytes and stimulates their activation, proliferation and differentiation. It is also understood that once the immune system has responded to produce a specific type of antibody or reactive T cell, it is capable of producing more of the antibody or activated T cell more rapidly in larger amounts; This is called secondary response (or memory). It is also recognized that an animal does not usually suffer an immune response to its own components (potentially antigenic). It is said that the animal is tolerant, or unable to react to its own potentially antigenic components. This ensures that under normal conditions, an immune response to "auto" antigens (called an autoimmune response) does not occur. Tolerance is effected in numerous ways, but in essence the immune system is able to distinguish "auto" components from "non-auto" (foreign) antigens; This will respond to "not auto" but not to "auto". Sometimes in an animal, tolerance can be "broken", which can result in an autoimmune disease.

The biological activities of immune responses mediated by antibody and mediated by cell are different and vary from one type of infection to another. There are several classes of types of antibodies (and subclasses of various types) involved in antibody-mediated immunity. All classes of antibody are produced in response to a specific antigen that reacts stereochemically with that antigen and not with other (different) antigens. The host has the genetic ability to produce specific antibodies to thousands of different antigens, but it does not do so until there is an appropriate antigen stimulant (specific) . Due to the clonal selection, the host produces only the homologous antibodies that will react with that antigen which, as noted above, is found in the blood (plasma) lymph, and many extravascular tissues. Once the antibody-mediated immune response occurs after interaction with the B lymphocytes with antigen and their differentiation into plasma cells that secrete antibodies, the secreted antibody binds to the antigen which, in turn, results in neutralization or elimination of the body.

Cell-mediated immunity, on the other hand, is mediated by specific subpopulations of T lymphocytes called T-cell effector cells that exist in the precursor forms as "resting T cells" (pT cell). These cells carried receptors for specific antigens and recognize those antigens on the surface of other cells. Stimulation with this antigen results in the activation of T cells. The enlarged T cells enter the mitotic cycle, reproduce and develop into T-cell effectors whose activities are responsible for this type of immunity. They also develop in clones of identical reactive T cells called memory T cells. As noted above, most T cells in the body belong to one of two subsets and are distinguished by the presence on their surface of one or the other of god glycoproteins designated CD4 and CD8. Which of these molecules are present determines the types of cells to which T cells can bind. T cells carrying CD8 (CD8 + T cells) always recognize antigen in association with MHC class 1 proteins and typically function as cytotoxic T cells. Almost all cells in the body express MHC class I molecules. T cells carrying CD4 (CD4 + T cells) always recognize antigens in association with MHC class II proteins on the surface of other cells. Only cells displaying specialized antigen express MHC class II molecules, which include dendritic cells, phagocytic cells such as macrophages and B cells. CD4 + T lymphocytes generally function as helper T cells.

Helper T cells that include Thl cells and Th2 cells respond to the antigen with the production of lymphokines. Thl and th2 cells can be distinguished based on their profiles of lymphokine. Like all T cells, Th cells arise in the thymus. When they are presented with an antigen by dendritic cells that present antigen they initiate its proliferation and become activated. There are two classes of dendritic cells, the DCl cells (descendants of monocytes) and the DC2 cells (which seem to be derived from the lymphocytes).

Thl cells (inflammatory Thl cells involved in the elimination of pathogens that recry intracellularly in the vesicular compartments) are produced when DC1-like dendritic cells present antigen in the T cell receptor for the antigen (TCR) and secrete interleukin 12 (IL -12). This stimulation of paracrine activates Thl cells to secrete their own lymphocytes, in particular, the Tumor Necrosis Factor beta (TNF-ß) (also referred to as lymphotoxin) and the interferon-gamma (INF-?). These lymphokines stimulate macrophages to kill bacteria that they have engulfed by phagocytosis and they recruit other leukocytes to the site that causes inflammation. Thl cells are essential for cell-mediated immunity and for control intracellular pathogens such as, for example, Listeria and Mycobacterium tuberculosis.

Th2 cells ("real" helper Th2 cells, which are required for production of antibody by B cells) are produced when dendritic cells type DC2 present antigen to the T cell receptor for antigen and, presumably, one or more stimulants of paracrine The main lymphokines secreted by Th2 cells are interleukin (IL-4) that stimulate the change of class in B cells and promote their synthesis of IgE antibodies, acting as a positive feedback device that promotes more pre-Th cells to enter the Th2 pathway, and block the expression of the IL-12 receptor thereby inhibiting the pre-Th cells in the thymus entering the Thl pathway. IL-4 also causes B cells to proliferate and differentiate into plasma cells that secrete antibodies and into memory B cells. IL-4 activates only B cells in the vicinity when they themselves have found the antigen, and not others, in order to sustain the specificity of the immune response. Th2 cells also produce interleukin 5 (IL-5), which attracts and activates eosinophils), interleukin 10 (IL-10, which inhibits the production of IL-12 by DC and prevents maturation of pre-Th cells to Thl), and interleukin 13 (IL-13, which also promotes the synthesis of IgE antibodies).

Activation of the Th2 cell also causes the initiation of the production of interleukin 2 (IL-2), and expresses a membrane receptor for IL-2. Secreted IL-2 self-stimulates the proliferation of Th2 cells. For example, in IL-2 it binds to IL-2 receptors on other T cells (which have joined the antigen) and stimulate its proliferation. In addition IL-2, stimulated Th2 cells also produce IFN-? and interleukin 6 (IL-6), which mediate several aspects of the immune response. The iFN-? activates Natural Killer cells to their full cytolytic potential, and is an activator of macrophages and thus increase their anti-tumor activities. If the macrophages are infected by intracellular parasites, this activates the macrophages, which in turn destroy the parasites. The IFN-? it also reinforces the antitumor activity of the cytotoxic lymphocytes, increases the non-specific activities of the NK cells, and is one of the factors that controls the differentiation of B cells and increases the secretion of immunoglobulins. IL-6 stimulates several types of leukocytes, as well as the production of Acute Phase Proteins in the liver. It is particularly important to induce B cells to differentiate between antibody-forming cells (plasma). In this way, Th2 cells provide support to B cells and are essential for antibody-mediated immunity.

Cytotoxic T lymphocytes are capable of killing cells that display a new or foreign antigen on their surface (e.g., virus-infected cells, or tumor cells, or cells of transplanted tissue). CD8 + CTLs also come in two subsets: Tcl which, like Thl cells, secrete IFN-? and Tc2, which, like Th2 cells, secrete IL-4.

The response to cell-mediated immunity also plays a role in the destruction of tumor cells and in the rejection of tissue transplants from animals. A major problem in tissue transplants is rejection, which is often based on the response to cell-mediated immunity to "foreign" cells (because they are not a perfect antigenic match). Because the tumor cells contain specific antigens not seen on normal cells they can also be recognized as foreign and distributed by the forces of cell-mediated immunity. If the tumor cells develop on a regular basis in animals this can be cell-mediated immunity that eliminates them or keeps them under review. The increased incidence of many types of cancer (tumors) in humans with advancing age may be correlated with a decline in the peak efficiency of the immune system that occurs at approximately 25 years of age.

A summary of cell types involved in the expression of cell-mediated immunity follows. The lymphocytes kill cells that carry foreign antigens on the surface in association with MCH Class 1 and can kill cells that have intracellular parasites (or arteries or viruses) as long as the infected cell is displaying a microbial antigen on its surface. The cells kill the tumor cells and count for the rejection of transplanted cells. The Te cells are recognized MHC Class 1 antigen complexes target cells, contact them, and release the contents of the granules directly into the membrane of the target cell that breaks the cell. Th lymphocytes produce lymphokines that are "helping" factors for the development of B cells in plasma cells that secrete antibody. They also produce certain lymphosins that stimulate the differentiation of T-cell effectors and the activity of macrophages. Thl cells recognize antigens on macrophages in association with MHC Class II and are activated (by IL-1) to produce lymphosims including IFN-α. which activates macrophages and NK cells. These cells mediate various aspects of responses to cell-mediated immunity that include delayed-type hypersensitivity reactions. Th2 cells recognize antigen in association with MHC Class II on an APC and then produce interleukins and other substances that stimulate the proliferation and activity of B cells and specific T cells. Macrophages are important as antigen presenting cells that initiate T cell interactions, development, and proliferation. Macrophages are also involved in the expression of cell-mediated immunity. Activated macrophages have increased their phagocytic potential and release substances soluble ones that cause inflammation and destroy many bacteria and other cells. Natural killer cells are cytotoxic cells that break cells that carry new antigens regardless of their MHC type and still break some cells that do not carry MHC proteins. NK cells are defined by their ability to kill cells that display a foreign antigen (eg, tumor cells) regardless of the MHC type and regardless of prior sensitization (exposure) to the antigen. NK cells can be activated by IL-2 and IFN-? and they break the cells in the same way as the cytotoxic T lymphocytes. Some NK cells have receptors for the Fe domain and the IgG antibody and are thus able to bind to the Fe portion of the IgG on the surface of a target cell and release cytolytic components that kill the target cell via cell-mediated cytotoxicity. antibody.

Extracellular factors that affect cell proliferation and differentiation have been defined as cytokines. These include lymphokines, which are proteins produced by T lymphocytes that have an effect on differentiation, proliferation, and activity of several cells involved in the expression of cell-mediated immunity. In general, the role of lymphokines in (1) focusing circulating leukocytes and lymphocytes at the site of immunological interaction; (2) stimulate the development and proliferation of B cells and T cells; (3) stimulate and prepare macrophages for their phagocytic tasks; (4) stimulate Natural Killer cells; and (5) provide cover and antiviral activity. A summary of several important lymphokines follows. Initially referred to as a lymphocyte activation factor, IL-1 is primarily a product of macrophages, and has a variety of effects on several cell types. This acts as a growth regulator of T cells and B cells, and induces other cells such as hepatocytes to produce protein relevant to host defense. IL-1 forms a chemotherapeutic gradient for neutrophils and serves as an endogenous pyrogen that produces fever. Thus, IL-2 plays an important role in both immune responses and inflammatory responses. IL-2 stimulates the proliferation of T cells and activates NK-cells. IL-13 regulates the proliferation of stem cells and the differentiation of mast cells. IL-4 originates the penetration of B cells and improved antibody synthesis. IL-6 (also referred to as interferon beta 2, B cell differentiation factor and hepatocyte stimulating factor) has an effect on B cell differentiation and on antibody production and on T cell activation, growth, and differentiation , and probably has an important role in mediating the inflammatory and immune response initiated by infection or damage. IL-8 is a chemotactic attractant for neutrophils. IL-13 shares many of the properties of IL-4 and is a potent regulator of inflammatory and immune responses. The IFN-? It is produced by T cells and can be considered as a lymphokine. This is sometimes called "immune interferon" (alpha interferon which is termed "interferon leukocyte" and interferon-beta which is termed "interferon fibroblast"). The IFN-? It has several antiviral effects that include the inhibition of viral protein synthesis in infected cells. It also activates macrophages and NK cells, and stimulates IL-1, IL-2, and antibody production. Lymphotoxins include tumor necrosis factors. The T cells produce TNF-beta, whereas TNF-alpha are produced by T cells as well as other cell types.

TNFs work to kill cells, including tumor cells (at a distance). There are several Colony Stimulating Factors (CSF), which include granulocyte macrophage colony stimulating factor (GMCSS), which causes phagocytic white cells of all types to differentiate and divide.

The nature of the membrane receptors for the antigen on B cells and T cells is clearly well understood. Each B cell has approximately 105 membrane-bound antibody molecules (IgD or IgM) that correspond in specificity to the antibody the cell is programmed to produce (these receptors being referred to as BCR). CD32 (FC (RII) on B cells are receptors for the Fe region of IgG) CD21 and CD35 on B cells are receptors for complement components Each T cell has approximately 105 molecules of a T cell binding receptor of a specific antigen (a TCR) exposed on its surface. similar, but not identical, to an antibody. There are two types of T cells that differ in their TCRs, alpha / beta T cells (aß) and gamma / delta T cells ((d).) The TCR of alpha / beta T cells bind to a molecular complex displayed by a molecule MHC Class I on the surface of the antigen presenting cell As noted above, most Th cells express CD4, while majorities of Te cells express CD8.

Both the DCR and the TCR are similar in that they are integral membrane proteins, they are present in thousands of identical copies exposed on the cell surface, they are made before the cell finds an antigen, they are encoded by genes assembled by recombination of DNA segments, they have a unique binding site that binds through non-covalent forces to a portion of the antigen called an epitope (or determinant antigen) that depend on the complementarity of the surface of the receptor and the surface of the epitope, and the successful binding of the antigen receptor to the epitope, if accompanied by additional signals, results in stimulation of the cell to leave GQ and enter the cell cycle and repeat the mitosis leading to a development of a clone of cells carrying the same antigen receptor, ie, a cell clone of identical specificity. BCRs and TCRs differ in their structure, the genes that encode them, and the type of epitope to which they bind. The induction of the primary immune response starts when an antigen penetrates the epithelial surfaces. This will eventually come into contact with macrophages of certain other classes of antigen presenting cells, including B cells, monocytes, dendritic cells, Langerhans cells, and endothelial cells. Antigens, such as bacterial cells, are internationalized by endocytosis and "processed" by APC, then "presented" to immunocompetent lymphocytes to initiate the early stages of the immune response. Processing by a macrophage, (for example) results in the binding of antigenic materials to the surface of the membrane in association with MHC Class II molecules on the surface of the cell. The MHC Class II antigen complex is presented to a helper cell T (Th2), which is capable of recognizing processed antigen associated with an MHC Class II molecule on the macrophage membrane. The interaction, together with the stimulation by IL-1 secreted by the macrophage, it will activate the Th2 cell.

As indicated above, the B cells themselves behave as APC. The cross-linked antigens bound to the antibody receptors on the cell surface of a B cell originate the internationalization of some of the antigens and the expression on the B cell membrane together with MHC Class II molecules. The Th2 cell recognizes the antigen together with the MHC Class II molecules, and secretes the various lymphokines that activate B cells to become plasma cells that secrete antibodies and B cells from memory. Even if the antigen can not cross-link the receptor, it can be endocytosed by the B cell, processed and returned to the surface of the MHC Class II partner where it can be recognized by specific Th2 cells that will be activated to initiate differentiation and proliferation of the B cell. In any case, the response of the total B cell leads to antibody-mediated immunity.

The antigen receptors on the surface of the B cell are considered as the specific types of antibodies that they are genetically programmed to produce. In this way, there are thousands of B cell subpopulations distinguished by their ability to produce a single antibody molecule. B cells can also react with a homologous antigen on the surface of the macrophage, or with soluble antigens. When a B cell binds to the antigen and is simultaneously stimulated by IL-4 produced by a neighboring Th2 cell, the. B cell is stimulated to grow and divide to form a clone of identical B cells, each capable of producing identical antibody molecules. Activated B cells are further differentiated into plasma cells that synthesize and secrete large amounts of antibody, and into memory B cells. The antibodies produced and secreted by the plasma cells will react specifically with the homologous antigen that induced their formation. Many of these reactions lead to host defense and prevent reinfection by pathogens. Memory cells play a role in secondary immune responses. Plasma cells are relatively short-lived (about a week) but produce large amounts of antibody during this period. Memory cells, on the other hand, are relatively long Life and then subsequent exposure to the antigen are rapidly transformed into plasma cells that produce antibody.

The generation of cell-mediated immunity starts when, for example, a cytotoxic T cell recognizes a processed antigen associated with MHC Class I on the membrane of a cell (usually a self-altered cell, but possibly a transplanted tissue cell, or a eukaryotic parasite). ). Under the stimulation of IL-2 produced by Th2 cells, the Te cell is activated to become a cytotoxic T lymphocyte capable of lysing the cell that is showing the new foreign antigen on its surface, a primary manifestation of cell-mediated immunity. The interaction between a macrophage presenting antigen and a Th cell stimulates the macrophage to produce and secrete an interleukin-1 that acts locally on the Th cell, stimulating the Th cell to differentiate and produce its own cytokines (which can be called here lymphokines by that they arise from a lymphocyte). These lymphokines have several functions. IL-4 has an immediate effect on neighboring B cells.

IL-2 has an immediate effect on T cells as described above.

The leukocytes also express the sectors that promote adhesion that mediate cell-cell and cell-matrix interactions. These adhesive interactions are crucial for the regulation of hemopoiesis and maturation of thymocyte, the direction and control of leukocyte trafficking and migration through tissues, and the development of immune and non-immune inflammatory responses. Several families of adhesion recipients have been identified. The leukocyte integrin family comprises three heterodimeric alpha-beta membrane glycoproteins that share a common beta sub unit, designated CD18. The alpha subunits of each of the three members, antigen-1 associated with lymphocyte function (LFA-1), macrophage antigen-1 (Mac-1) and pl50, are designated CDlla, b and c respectively. These adhesion molecules play a critical part in the immune and inflammatory responses of leukocytes. The integrin family of leukocytes is, in turn, part of the integrin superfamily, whose members are evolutionarily, structurally and functionally related. Another integrin subfamily found in leukocytes is the VLA group, so called because the "very late activation antigens" VLA-1 and VLA-2 were originally found to appear late in T cell activation. The members of this family function primarily as extracellular matrix adhesion receptors and are found in both hematopoietic and non-hematopoietic cells. They play a part in various cellular functions that include the organization of tissue, lymphocyte recirculation and immune responses of T cells. Another integrin subfamily, cytoadesins, are receptors on platelets and endothelial cells that bind to extracellular matrix proteins. A second family of adhesion receptors is the immunoglobulin superfamily, whose members include CD2, LFA-3, and ICAM-1, which participate in the adhesive interactions of the T cell, and the antigen-specific receptors of T and B cells. , CD4, CD8, and MHC Class I and Class II molecules. Another recognized family of adhesion receptors is selectin, characterized by a common lectin domain. The leukocyte adhesion molecule-1 (LAM-1), which is the human homologue of the murine guide receptor, MEL-14, is expressed on leukocytes, although the molecule-1 of Endothelial leukocyte adhesion (ELAM-1) and granule membrane protein (GMP-140) are expressed on stimulated endothelial cells and activated platelets.

The activation of an immune response requires cell-cell physical contact in addition to the cytokines. Thus, for example, the development of B cell and T cell precursors require intimate contact with stromal cells. At least three critical cell-cell contact events are required for the generation of immune responses. The first is the initial contact of a specific antigen with a simple T cell. Because of the requirement for the MHC presentation, this is a bound cell contact event. In normal situations the cell that presents critical antigen is the dendritic cell. In addition to the MHC / peptide-TCR interaction there are other non-antigen-specific membrane-bound receptor ligand pairs that are important for the interaction of dendritic-T cells. The main one is the association of the CD28 molecule on the T cell with any of two ligands, B7.1 (CD80) and B7.2 (CD86), on the dendritic cell. These molecules are called accessory molecules and it will be understood that the CD28 molecule supplies a second signal essential to the T cell without which the T cell is not activated.

A second essential cell-cell contact is between the activated T cell and the antigen-specific B cell. Most antigens are T-cell dependent, that is, an antibody response to the antigen absolutely requires the help of the T cell. This aid is supplied by both the cytokine and the cell-cell contact. Cells bind specific antigen via surface Ig, then internalize, process, and present it on MHC Class II molecules. This makes it possible for them to be recognized by the T cells specific for the antigen-specific epitopes. This cell-cell interaction also requires the CD28 that binds B7 on the B cell. In addition, the molecule called CD40 or CD154 ligand, whose expression is induced after activation of the T cell, binds to the CD40 on the cells B. Crosslinking of CD40 promotes B cell proliferation, prevents apoptosis of cell B germinal center, and promotes switching and change of immunoglobulin isotope. The receptor ligand interactions CD28-B7 and CD40-CD40L are both essential for the dialogue between cells B and T that cause their mutual activation.

A third cell-cell interaction that is essential in immune responses is the binding of activated B cells (which have migrated to a specialized structure in lymphoid organs called germinal centers) to follicular dendritic cells (FDC). The FDCs are specialized stromal cells that keep intact, that is, without processing the antigen on its surface in the form of long-lived immune complexes. Among other molecules, FDCs express CD23, which bind to germ-center B cells via a CR2 receptor and stimulate differentiation to plasma cells.

It takes time before the primary immune response is effective as a host defense. The antigens have to be recognized, taken, digested, processed and presented by the APCs. A few selected Th cells must react with antigen and respond; pre-existing B and T lymphocytes must find the antigen and proliferate and differentiate into effector cells (plasma cells or Te cells). If of antibody-mediated immunity, the level of the antibody has to build at an effective physiological concentration to make its host resistant. This can take several days or weeks to reach a level of effective immunity, although this immunity can persist for many for many months or years, or even the lifetime, due to the presence of antibodies. In natural infections, the inoculum is small, and although the antigenic stimulus is increased during microbial replication, only small amounts of antibody are formed in the first few days, and the circulating antibody is not detectable until about one week after infection.

With regard to the induction of a secondary immune response, it is understood that upon re-exposure to the microbial antigens (secondary exposure to the antigen), there is an accelerated immune response, that is, the secondary or memory response. Larger amounts of antibodies are formed in only 1-2 days. This is due to the activities of specific memory B cells or memory T cells that were formed during the primary immune response. These cells When they are stimulated by the antigen, they "remember" to have previously seen the antigen, and are able to divide rapidly and differentiate into effector cells. Stimulating memory cells to rapidly produce very high (effective) levels of persistent circulating antibodies is the basis for giving "boosted" vaccines to humans and pets. Thus, after the first exposure to the antigen the immune response (as evidenced by the concentration of the specific antibody in the serum) develops globally over a period of days, and reaches a low plateau between 2 to 3 weeks and usually starts its decline in a relatively short period of time. When the antigen is found a second time, a secondary response (memory) causes a rapid rise in the concentration of the antibody, reaching a much higher level in the serum, which may persist for a relatively long period of time. A level of protection of the antibody can be achieved by a primary exposure alone, but usually to ensure a high level of the protective antibody that persists for a long period of time, it is necessary to have repeated antigenic stimulation of the immune system.

An immunoglobulin molecule (abbreviated as Ig), is a multimeric protein composed of two identical light chain polypeptides and two identical heavy chain polypeptides (H2L2) that are linked in a macromolecular complex by interchain disulfide bonds, ie covalent bonds between groups sulfhydryl and adhesive cysteine residues. There are several classes of human antibody proteins, each of which is produced by a specific clone of plasma cells. Five classes of human immunoglobulin are defined on the basis of their heavy chain composition, and are referred to as IgG, IgM, IgA, IgE, and IgD. The IgG class and IgA class antibodies are further divided into subclasses namely, IgGl, IfG2, IgG3, and IgG4 and IgA1 and IgA2. The intrachain disulfide bonds link different areas of the same polypeptide chain, which results in the formation of rings that, together with the adjacent amino acids, constitute the immunoglobulin domains. In the amino terminal portion (also termed the "NH2-terminal" or the "N-terminal"), each light chain and each heavy chain have a single variable region that shows considerable variation in the amino acid composition of one antibody to another. The light chain variable region, VL, is associated with the variable region of the heavy chain, VH, to form the antigen binding site of immunoglobulin, called Fv.

In addition to the variable regions, each of the antibody chains has one or more constant regions. Light chains have a simple constant region domain. Thus, light chains have a variable region and a constant region. Heavy chains have several constant region domains. The heavy chains of the IgG, IgA, and IgD antibodies have three constant region domains, which are designated CH1, CH2, and CH3, and the heavy chains in the IgM and IgE antibodies have four constant region domains, CH1, CH2, CH3, and CH4. Thus, heavy chains have a variable region and three or four constant regions. The structure of immunoglobulin and function are reviewed, for example, in Harlow et al. , Eds., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Habor Laboratory, Cold Spring Harbor (1988).

The heavy chains of immunoglobulins can also be divided into three functional regions: the Fd region (a fragment comprising V H and CH 1, ie, the two N-terminal domains of the heavy chain), the pivot region, and the region Fe (the region of the "crystallizable fragment", derived from the constant and formed regions after the digestion of pepsin). The Fd region in combination with the light chain forms a Fab (in "antigen binding fragment"). Since the antigen will react sterochemically with the antigen binding region in each amino terminus of each Fab, the IgG molecule is divalent, that is, it can bind to two molecules of antigen. Fe contains the domains that interact with the immunoglobulin receptors on the cells and with the initial elements of the complement cascade. Thus, the Fe fragment is generally considered responsible for each effector function of an immunoglobulin, such as the complement fixation of binding to Fe receptors. Pepsin is sometimes also clivaled before the third constant domain (CH3) of the heavy chain for give a long fragment F (abc) and a small fragment pFcb. These terms are also used for analogous regions of other immunoglobulins. The pivot region, which is found in IgG class IgA and IgD antibodies, acts as a flexible spacer, which allows the Fab portion to move freely in space. In contrast to the constant regions, the pivot domains are structurally diverse, varying both in sequence and in length between immunoglobulin classes and subclasses.

For example, the length and flexibility in the pivot region varies between the IgG subclasses. The pivot region of IgGl comprises as reported amino acids 216-231 and because it is freely flexible, Fab fragments can rotate around their axes of symmetry and move within a sphere centered on the first of two chain disulfide bridges interpesada. IgG2 has a shorter pivot than igG1, as reported by 12 amino acid residues and four disulfide bridges. The IgG2 pivot region is missing a glycine residue, it is relatively short and contains a double helix of rigid poly-proline, stabilized with extra interpesada chain disulfide bridges. These properties restrict the flexibility of the IgG2 molecule. IgG3 differs from the four subclasses of its single extended pivot region (about four times as long as the IgGl pivot), and is reported to contain 62 amino acids (including 21 prolines and 11 cysteines), which form a double inflexible poly-proline helix. In IgG3 the Fab fragments are relatively far from the Fe fragment, giving the molecule greater flexibility. The elongated pivot in IgG3 is also responsible for its higher molecular weight compared to the other subclasses. The pivot region of IgG4 is shorter than that of IgG1 and its flexibility is intermediate between IgG1 and IgG2. The flexibility of the pivot region as reported decreases the order IgG3 > IgGl > IgG4 > IgG2. The four igG subclasses also differ from each other with respect to their effector functions. This difference is related to the differences in structure, which include with respect to the interaction between the variable region, the Fab fragments, and the constant Fe fragment. However, in addition to glycolization within the CH2 region, for example, and despite the knowledge there are no established rules or conventions regarding the means or methods to change the characteristics, including sequences, of these subclasses of molecule to change, control, add, or remove different functions, for example, ADCC, CDC, and other functions.

According to the crystallographic studies, the pivot region of the immunoglobulin can be additionally subdivided functionally into three regions: the upper pivot region, the core region, and the lower pivot region. Shin et al., 1992 Innunological Reviews 130: 87. The upper pivot region includes the amino acids from the carboxyl terminus of the CH1 to the first residue in the pivot that restricts movement, generally the first cysteine residue forming an interchain disulfide bond between the two heavy chains. The length of the upper pivot region correlates with the flexibility of the antibody segment. The core pivot region contains the interchain chain disulfide bridges, and the lower pivot region joins the amino terminal ends of the CH2 domain and includes the residues in the CH2. The core pivot region of human IgGl contains a Cys-Pro-Pro-Cys sequence which, when dimerized by the formation of disulfide ions, results in a cyclic peptide which is considered to act as a pivot, thus conferring flexibility. The pivot region can also contain one or more glycolization sites, which includes a number of structurally distinct types of carbohydrate link sites. For example, IgAl contains five glycolization sites within a 17 amino acid segment of the pivot region, which reconfigures resistance of the pivot region polypeptide to the intestinal proteases, considered an advantageous property for a secretory immunoglobulin.

The conformational changes allowed by the flexibility structure of the polypeptide sequence of the immunoglobulin pivot region. it can also accept the effector functions of the Fe portion of the antibody. Three general categories of the effector function associated with the Fe region include (1) the activation of the classical complement cascade, (2) the interaction with the effector cells, and (3) the compartmentalization of immunoglobulins. The different human IgG subclasses vary in relation to the efficacy with which they fix the complement, or activate and amplify the stage of the complement cascade. See, for example, Kirschfink. 2001 Immunol. Rev. 180: 177; Chakraborti et al. , 2000 cell Signal 12: 607; Kohl et al. , 1999 Mol. Immunol. 36: 893; Marsh et al. , 1999 Curr. Opin. Nephrol. Hypertens. 8: 557; Speth et al. , 1999 Wien Klin, Wochenschr. 111: 378.

Complement-dependent cytotoxicity (CDC) is thought to be a significant mechanism for clearing specific target cells such as tumor cells. The CDC is a stream of events that consists of a series of enzymes that are activated one by the other in the form of a cascade. The complement plays an important role in antigen cleansing, achieved by its four main functions: (1) local vasodilation; (2) attraction of immune cells, specifically phagocytes (chemotaxis); (3) labeling of foreign organisms for phagocytosis (opsonization); and (4) destruction of the invading organisms by means of the membrane attack complex (MAC attack). The central molecule in the C3 protein. This is an enzyme that is divided into two fragments by the components of any of the classic paths or the alternative path. Antibodies, specifically IgG and IgM, induce the classical path, although the alternative pathway is not specifically stimulated by bacterial products such as lipopilisaccharide (LPS). In summary, the products of C3 are divided including a peptide small C3a that is chemotactic for phagocytic immune cells and results in local vasodilation by originating the release of the C5a fragment from C5. The other part of C3, C3b covers the antigens on the surface of the foreign organism and acts to opsonize the organism for destruction. C3b also reacts with other components of the complement system to form a MAC consisting of C5b, C6, C7, C8 and C9.

In general, IgG1 and IgG3 bind complement more effectively, IgG2 is less effective, and IgG4 does not activate complement. Complement activation is initiated by the Clq junction, a subunit of the first Cl component in the cascade, to the antigen-antibody complexes. Although the binding site for Clq is charged to the CH2 domain of the antibody, the pivot region influences the ability of the antibody to activate the cascade. For example, recombinant immunoglobulins that lack the pivot region are in agreement with what is reported and capable of activating complement. Shin et al., 1992. Without the flexibility conferred the pivot region the Fab portion of the antibody bound to the antigen may not be able to adopt the conformation required to allow the Clq join CH2. see id. Pivot length and segmental flexibility have been reported to correlate with complement activation; however, the correlation is not absolute. Human IGg3 molecules with altered pivot regions that are as rigid as IgG4, for example, can still effectively activate the cascade.

The absence of a pivot region, or the lack of a functional pivot region, can also affect the ability of certain human IgG immunoglobulins to bind to the Fe receptors on the effector cells. The binding of an immunoglobulin to a Fe receptor facilitates antibody-mediated cell-mediated cytotoxicity, which as noted above is presumed to be an important mechanism for the removal of tumor cells. The IgG receptor family (FcR) is divided into three groups, Fcγ (RI (CD64), which is capable of binding to IgG with high affinity, and Fcγ (RH (CD32) and Fcγ (RIII ( CD16), both of which have lower affinity receptors.The molecular interaction between each of the three receptors and an immunoglobulin has not been precisely defined, but the experimental evidence indicates that the residues in the proximal pivot region of the CH2 domain may be important to the specificity of the interaction between the antibody and the Fe receptor. IgG1 myeloma proteins and recombinant IgG3 chimeric antibodies that lack a pivot region they are incapable of sacuelo with the reported to join the FcRI perhaps because the accessibility to the CH2 is diminished. Shin et al., 1993 inter, Rev. Immuno2.10: 17, 178-79.

Exceptions unusual and apparently evolutionarily unrelated to the H2L2 structure of conventional antibodies occur some types of immunoglobulins found in camelids (camels, camels and llamas, Hamers-Casterman et al., 1993 Nature 3363: 446, Nguyen et al., 1998 J. Mol. Biol. 275: 413), nurse sharks (Roux et al., 1998 Proc. Nat. Acad. Sci. USA 95: 11804), and rats, spotted fish (Nguyen et al., "Heavy-Chain antibodies in Camelidae, a case of evolutionary innovation ", 2002 Iimmunogenetics) 54 (1): 39-47). These antibodies can apparently form antigen-binding regions that utilize only the heavy chain variable region, ie, these functional antibodies are heavy chain homodimers only (termed anti-cancer antibodies). heavy chain "or" HCAbs "). In both species, these variable regions often contain a third region of extended determinant complementarity (CD3) that can help compensate for the lack of light chain variable regions, and there are frequent disulfide linkages between CDR regions that presumably help stabilize the binding site Muyldermans et al., 1994 Prot. Engineer, 7: 1129; Roux et al., However, the precise function of the single heavy chain "antibodies" is unknown, and the pressure would evolve that leads to their formation has not been identified, see, for example, Nguyen, et al., 2002. Camelids, including camels, llamas, and alpacas, also express conventional H2L2 antibodies, and heavy chain alone antibodies do not. they thus appear to be present in these animals simply as an alternative antibody structure.

The variable regions (VHH) of camelid heavy chain immunoglobulins alone and the conventional heavy chain variable regions (H2L2) contain amino acid differences, which include differences in several positions that can be involved in the interference between the VH and VL domains conventional Nguyen et al. , 1998 J.

Mol. Biol.275: 413; Muyldermans et al., 1994 Prot. Engineer. 7: 1129. The camelid VHH according to the reports is recombined with the constant regions IgG2 and IgG3 that contain the pivot, CH2 and CH3 domains, and lack the CH1 domain. Hamers-Casterman et al., 1993 Nature 363: 446. Interestingly, VHH are encoded by a chromosomal locus distinct from the VH locus. (Nguyen et al., 1998, supra) that indicates that camelid B cells have evolved complex mechanisms of antigen recognition and differentiation. Thus, for example, flame IgGl is a conventional antibody isotope (H2L2) in which the VH recombines with a constant region containing the pivot domains CH1, CH2 and CH3 while the IgG2 and the flame IgG3 are isotopes of only heavy chain that lack the CH1 domains and that do not contain light chains.

The immunoglobulin classes have different physical and chemical characteristics and they exhibit unique biological properties. Its synthesis occurs in different stages and proportions during an immune response and / or during the course of an infection. his importance and functions in host resistance (immunity) are different.

Immunoglobulin G (IgG), a protein with a molecular weight of approximately 150,000 daltons (150kD), is the predominant Ig in serum. This corresponds to approximately 80% of the total antibody found in an animal at any given time, which is 75% of the total serum antibody. This can diffuse out of the bloodstream into extravascular spaces and is the most common Ig found there. Its concentration of tissue fluids increases during inflammation, and is particularly effective in neutralizing bacterial extracellular toxins and viruses. It also has the opsonizing capacity and the ability to fix complement. The polypeptide composition of the Fe region and all the IgGl antibody molecules are relatively constant regardless of the specificity of the antibody, however, as noted above, the Fab region always differs in its exact amino acid sequence depending on its antigenic specificity. The specific amino acid regions of the Fe portion of the molecule are recognized by receptors on phagocytes and certain other cells, and the Fe domain contains a peptide region that will bind and active complement that is often required for the expression of antibody-mediated immunity. Because the IgG molecule is divalent, it can cross-link antigen molecules that can lead to the precipitation or agglutination of the antigens, if the IgG is bound to the antigen on a microbial or surface cell, its Fe region can supply a ligand extrinsic that will be recognized by specific receptors on phagocytes. Microbial cells or viruses coated with IgG molecules are opsonized for phagocytosis, and opsonized pathogens are much more easily picked up and instructed by phagocytes than their non-opsonized counterparts. IgG, as well as IgM and IgA, will neutralize the activity of toxins, including bacterial exotocins. Additionally, the cross-linked IgG molecules on the surface of a cell can bind to an active complement of the serum and establish a cascade of reactions that can lead to the destruction of the cell.

IgM is the first immunoglobulin that appears in the bloodstream during the course of an injection. This It is mainly confined to the bloodstream and provides protection against pathogens of blood origin. IgM elaborates up to about 10% of the serum immunoglobulins, and is arranged to resemble a pentamer of 5 immunoglobulin molecules (having a molecular weight of about 900kD) bound together in the Fe domains. In addition to the covalent bonds between the monomeric subunits, the pentamer is stabilized by a 15kD polypeptide called J chain. IgM, therefore, has a theoretical "valence" of 10 (ie it has 10 exposed Fab domains). Probably, the most important role of IgM is the ability to function early in immune responses against pathogens of blood origin, making it effective in agglutinating antigens into particles. IgM also binds the complement strongly and IgM antibodies bound to a microbial surface act as opsonins, making the microbe more susceptible to phagocytosis. In the presence of complement and complete microbial IgM cells can be killed and used. As noted above, IgM also appears on the surfaces of mature B cells as a transmembrane monomer where it functions as an antigen receptor, capable of activating B cells when it binds to the antigen.

The rearrangement of the gene in the immunoglobulin sites during lymphoid development generates a repertoire of B lymphocytes that express a variety of antigen receptors. The rearrangement of the gene, which is catalyzed by the recombinase of the gene that activates the rearrangement ("RAG"), integrates immunoglobulin V, D and J gene segments to productively produce productively rearranged immunoglobulin genes encoding the heavy chain and light of IgM antibodies. The diversity of IgM antibodies in this primary repertoire is achieved through combinatorial mechanisms (the choice of segments of the V, D and J gene used in a particular antibody), as well as the binding diversity. The union of the segments of V, D and J is somewhat imprecise, and the nucleotides can be inserted into the junction in a non-template manner. There is therefore a high degree of diversity resulting in the V-D-J boundaries. This contributes in a major way to the structural diversity of the third region of determinant complementarity of the antibody, a region which often plays a critical role in the recognition of antigen. This primary repertoire of IgM antibodies comprises a few million different structures. The size of this repertoire means that any incoming antigen is probably found in an antibody that recognizes it with acceptable affinity. A high affinity binding site is unlikely to be available for most of the incoming antigens (the repertoire is not large enough), but the affinity of the available IgM antibodies in the primary repertoire will vary from antigen to antigen. If the epitope is reiterated in high affinity on the surface of the antigen (for example, a structure repeated on the surface of a virus or bacteria), then the IgM antibody may nevertheless be effective in mediating the cleansing of the organism, despite the low affinity of the individual interaction between the antigenic epitope and the immunoglobulin combination site. The density of the epitopes can also allow multivalent interactions with IgM, leading to a high avidity interaction, as long as adequate spacing of the antigenic epitopes can occur. However, to ensure an effective and specific response, especially when the Antigen concentration is low (as can occur when the body is confronted with a very small number of infecting viral particles), it would be preferable if high affinity antibodies were available to neutralize, for example, an infecting mechanism. The size of the primary repertoire militates against the probability of such high affinity antibodies that are present in this repertoire. The immune system therefore operates using a two-stage strategy. The primary repertoire and IgM antibodies are generated by a process of gene rearrangement and take place before the antigen is found during early lymphocyte development. However, once the foreign antigen has been found, these B cells in the primary repertoire encoding suitable antibodies (although of low affinity) are selectively expanded and subjected to iterative alternation of directed hypermutation and antigen-mediated selection. This allows a significant maturation of the affinity of the antigen-specific antibodies that are produced. The antigen that is triggered also handles isotype switched recombination. Thus, in the absence of a stimulation of external antigen and any maternally derived immunoglobulin, the serum it will only contain a diversity of non-mutated IgM molecules that have been generated by gene rearrangement. This repertoire changes with age as a result of continuous antigen exposure, such that the majority of serum immunoglobulin in older animals is composed of mutated IgG (and IgA) molecules whose specificities have been developed as a consequence of the selection of antigen.

The igA exists as a H2L2 monomer of approximately 160 kD in serum and, in secretions, as a monomer dimer of H2L2 of approximately 400 kD. As with IgM, polymerization (dimerization) is a J-chain pathway. IgA has two subclasses based on different heavy chains, IgAl and IgA2. IgAl is produced in bone marrow and produces most IgA serum. Both IgAl and IgA2 are synthesized in GALT (lymphoid tissues associated with gut) to be secreted on mucosal surfaces. Because IgA can be synthesized locally and secreted into seromucose secretions from the body, it is sometimes referred to as a secretory antibody or slgA. Quantitatively, igA is synthesized in larger amounts than IgG, but it has a short life in the serum (6 days), and it is lost in the secretory products. The concentration of IgA in the serum is approximately 15% of the total antibody. The secretion of dimeric IgA is mediated by a glycoprotein of 100 kD called secretory component. This is the addition of the secretory piece to the IgA molecules that counts for its ability to leave the body to the surfaces of the mucosa via the exocrine glands. IgM can be transported in a similar way and make a small proportion of the secretory antibodies. Secretory IgA is the predominant immunoglobulin present in the gastrointestinal fluids, nasal secretions, saliva, tears and other mucous secretions of the body. IgA antibodies are important in the resistance to infection of mucosal surfaces of the body, particularly the respiratory, intestinal and urogenital tracts.IgA acts as a protective coating for mucosal surfaces against microbial adherence or initial colonization It can also neutralize the activity of toxins on mucosal surfaces.Fe receptors for IgA-coated microorganisms found on monocytes and neutrophils derived from the respiratory mucosa suggest that IgA may have a role in the lung, at least in the opsonization of pathogens. Secretory IgA is also transferred via milk, that is, colostrum, from the nursing mother to the newborn, which provides passive immunity to many pathogens, especially those entering via the Gl tract.

IgE is an immunoglobulin of approximately 190 kD that contains approximately 0.002% of total serum immunoglobulins. This is produced via the plasma cells below the respiratory and intestinal epithelium. The majority of IgE is bound to tissue cells, especially mast cells. If an infectious agent succeeds in penetrating the IgA barrier, it comes against the next line of defense, the MALT system (lymphoid tissues associated with mucous membranes) that is managed by IgE. IgE is very tightly bound to specific IgE Fe receptors on mast cells. Contact with the antigens leads to the release of inflammatory mediators from mast cells, which effectively recruit several agents of the immune response that includes complement, chemotactic factors for phagocytes, T cells, etc. Although a good demonstration Known from this reaction is a type of immediate hypersensitivity reaction called atopic allergy (for example urticaria, asthma, hay fever etc.). MALT responses act as a defense mechanism because they amplify the inflammatory response and may facilitate rejection of the pathogen.

IgE is a molecule of approximately 175 kD that resembles IgG in its monomeric form. IgD antibodies are found on most of the surface of B lymphocytes. The same cells can also carry IgM antibody. As noted above, it is believed that IgD and IgM function as mutually interacting antigen receptors to control the activation and suppression of B cell. In this way, Ig may have an immunoregulatory function.

In addition to opsonization, complement activation, and ADCC antibodies have other functions in host defense including steric hindrance, toxin neutralization, agglutination, and precipitation. With regard to the steric hindrance, it is understood that the antibodies combine with the surfaces of the microorganisms and can block or prevent their binding to susceptible cells or mucosal surfaces. The antibody against a viral component can block the binding of the virus to the susceptible host cells and thereby reduce the ineffectiveness. Secretory IgA can block the binding of pathogens to the mucosal surface. The toxin-neutralizing antibodies (antitoxins) can also react with the soluble bacterial toxin and block the interaction with the toxin with its specific target cell or substrate. The antibodies can also be combined with the surfaces of the microorganisms or the soluble antigens and cause them to bind or precipitate. This reduces the number of separate infectious units and makes them more easily phagocytosed because the grouping of particles is larger in size. Phagocytes can remove flocs or aggregates of neutralized toxins.

The antibodies have been proposed for use in therapy. Animals, which include humans and mice have the ability to make antibodies capable of recognizing (by binding to) virtually any antigenic determinant and discriminating between similar epitopes. Do not They only provide the basis for protection against sick organisms, but also make the candidates attractive to target other types of molecules found in the body, such as receptors or other proteins present on the normal cell surface and molecules present only in the body. surface of cancer cells. Thus the notorious specificity of the antibodies makes them promising agents for human therapy.

Of the initial antibody preparations available for use, such as intravenous gamma globulins, include animal and human antiserum which were used in vivo to destroy bacteria (tetanus, pneumococci) and neutralize viruses (hepatitis A and B, rabies, cytomegalovirus, and varicella zoster) in the blood of infected individuals. Possibly the most important early application is the use of endotoxins. However, there are problems associated with the use of antibodies in human therapy because the response of the immune system to any antigen, even the simplest one, is "polyclonal", that is, the system elaborates antibodies from a wide range of structures in both regions. of union as well as in their regions effectors The polyclonal antibody treatment was also associated with undesired side effects. In addition to the polyclonal nature of these antibody preparations, there is a risk of infection from contaminating viruses. Serum disease and anaphylaxis are also considered limiting factors. Additionally, even if one were to isolate a secretory cell from simple antibodies, and place it in culture, it would die after a few generations because of the potential limited growth of all normal somatic cells.

Until the end of the 1970s, polyclonal antibodies obtained from the blood serum of immunized animals provided the only source of antibodies for research or treatment of disease. The isolation of specific antibodies was essentially impossible until Kohler and Milstein discovered how to make "monoclonal antibodies" that would have a simple specificity, which would all be similar due to the elaboration of a simple clone of plasma cells and that could grow indefinitely. The technique was described in a publication of 1975 (Nature 256: 495-97), and Kohler and Milstein received the 1984 Nobel Prize in Medicine for this work.

The first stage in the Kohler and Milstein technique for production of monoclonal antibodies involves immunizing an experimental animal with the antigen of interest. In most of their experiments, Kohler and Milstein injected a mouse with red sheep blood cells. The body of the mouse initiates an immune response and initiates the production of antibodies specific for the antigen. The spleen of the mouse is then removed and the B cells that produce the antibody of interest are isolated. The cells that produce the tumor that have grown in culture are then fused with the B lymphocytes using polyethylene glycol in order to produce a "hybridoma". Only the hybridomas that result from the fusion will survive. The spleen lymphocyte has a limited life span, and so any of the B cells that did not fuse with a myeloma will die in the culture. Additionally, those cells that lack the appearance of producing B-cell antibodies will not secrete the HGPRT enzyme, which is required to grow in the hypoxatin-aminopterintimidine (HAT) medium. The HAT medium on which cells grow, and measures the path for nucleotide synthesis. The paths that produce HGPRT can deviate from this path and continue to grow. By locating the fused cells in a HAT medium, true hybridomas can be isolated. The isolated hybridoma cells are then selected for specificity to the desired antigen. Because each hybridoma descends from a B cell, it makes copies of only one antibody. The hybridoma that produces the antibody of interest grows in culture to produce large amounts of monoclonal antibodies, which are then isolated for further use. The technique is called somatic cell hybridization, and the resulting hybridoma (selected both by immortality and by production of the specific antibody of interest) can be cultured indefinitely, i.e., it is a potentially immortal cell line.

Monoclonal antibodies are not widely used as diagnostic and research reagents. However, its introduction to human therapy has been much slower. A major difficulty in mouse antibodies is "seen" by the human immune system as a stranger. He Human patient mounts an immune response against these, producing HAMA ("human anti-mouse antibodies"). This not only causes the therapeutic antibodies to be rapidly eliminated from the host, but also the immune complexes that cause damage to the kidneys.

Two approaches have been used in an attempt to reduce the HAMA problem. The first is the production of chimeric antibodies in which the antigen binding portion (variable region) of a mouse monoclonal antibody that fuses with the effector part, • constant region) of the human antibody using genetic engineering. In a second approach, rodent antibodies have been altered through techniques known as complementarity determining region (CDR) grafting or "humanization". In this process, the antigen binding sites, which are formed by three CDRs of the heavy chain and three CDRs of the light chain, are extracted from the cells that secrete the rodents mAb and grafted into the DNA that codes for the structure of the human antibody. Because only the CDR antigen binding site, the place of the full variable domain of the rodent antibody is transplanted, the resulting humanized antibody (a second generation or "hyperchimeric" antibody) is as reported less immunogenic than a first generation of chimeric antibody. This process has been further improved to include changes termed "reshaping" (Verhoeyen, et al., "Reshaping human antibodies: grafting an anti-lysozyme activity", 1988 Science 239: 1534-1536; Riechman, et al., "Reshaping antibodies for therapy ", 1988 Nature 332: 232-337; Tempest, al. , "Reshaping human monoclonal antibody to inhibit respiratory ayncitial virus infection in vivo", Bio / Technol 1991 9: 266-271), "hyperchimerization" (Queen, et al., "A humanized antibody that binds to the human interleukin 2 receptor, 1989 Proc Nati Acad Sci USA 10029-10033; Co, et al., "Hmanized antibodies for antiviral Therapy," 1991 Proc Nati Acad Sci USA 88: 2869-2873; Co, et al., "Chimeric and humanized antibodies with specificity for the CD33 antigen, "1992 JI munol 148: 1149-1154), and" coating "(Mark, et al.," Derivation of therapeutically active humanized and veneered anti-CD8 antibodies. "In: Metcalf BW, Dalton BJ, eds. Cellular adhesion: molecular definition to therapeutic potential.? Ew York: Plenum Press, 1994: 291-312.).

In the process of reconformation on the basis of homology, the variable region of the rodent is compared with the consensus sequence of the subgroup of the protein sequence to which it belongs. Similarly, the selected human constant region that accepts the structure is compared to its family consensus sequence. Gussowal, et al. , "Humanization of monoclonal antibodies." 1991 Meth Enzymol 201: 99-121. The sequence analysis identifies the residues, which may have undergone mutation during the affinity maturation procedure and may therefore be idiosyncratic. The inclusion of the most common human waste is said to diminish immunogenicity problems by replacing idiosyncratic human acceptor residues. Additionally, the reconformation process is said to allow the comparison of human and rodent consensus sequences to identify the systematic differences of the "species". The RSV19 antibodies are humanized by using this procedure. Taylor et al. "Humanized monoclonal antibody to respiratory syncitial virus," 1991 Lancet 337: 1411-1412; Tempest, et al. , "Reshaping a human monoclonal antibody to inhibit human respiratory cyclic virus infection in vivo," 1991 Bio / Technol 9: 266-271.

Hyperquimerization is an alternative method to identify the outer CDR regions of the residues that are probably involved in the construction of binding activity. In this method, the human sequences are compared with the variable region sequences of murine and that with higher homology is selected as the accepting structure. As in the reconformation process, "idiosyncratic" waste is replaced by human waste of more common occurrence. The non-CDR residues that can be interacting with the CDR sequence are identified. Finally, it is determined which of these residues will be included in the variable region structure. Humanized antibodies against the CD33 antigen are developed according to what is reported by this method. Co, et al. , "Chimeric and humanized antibodies with specificity for CD33 antigen," • 1992 J Ipmunol 148: 1149-154. See also Crter, et al., "Humanization of an anti-pl85 HER2 antibody for human cancer therapy," 1992 Proc Nati Acad Sci USA 89: 4285-4289.

The unfolded surface of the protein is primarily determinant in its immunogenicity. A humanized murine antibody can thus be made less immunogenic to the replace the exposed residues that they infer from those commonly found in human antibodies. This method of humanization is termed as "coating". The appropriate replacement of the external waste may have little or no impact on the internal domains or the inter-domain structure. The coating is a two-stage process. In the first stage, the most homologous human variable regions are selected and compared for each of the single residues with the corresponding mouse variable regions. In the second stage, the residues present in the human homologue replace the residues of mouse structure, which differs from the human homologue. This replacement involves only those residues that are on the surface and at least partially exposed.

However, it took more than a quarter of a century of research to monoclonal antibody technology and genetic engineering methods to yield results in the development of immunoglobulin molecules for the treatment of human diseases. In fact, it was not until after 5 years that monoclonal antibodies became an expansive class of therapies. See Glennie MJ and van de Winkel JG, Drug Discov Today 2003 Jun 1; 8 (11: 503-10; Souriau C and Hudson PJ, "Recombinant antibodies for cancer diagnosis and therapy," 2003 Expert Opin Biol Ther. 3 (2): 305-18 See also Pendley C, eyt al., "Immunogenicity of therapeutic monoclonal antibodies," 2003 Curr Opin Mol Ther. 5 (2): 172-9.

Therefore, an average of less than one therapeutic antibody per year has been introduced into the market, starting in 1986, 11 years after the publication of monoclonal antibodies. Five murine monoclonal antibodies were introduced into human medicine for a period of 20 years from 1986-1995, including "muromonab CD3" (OrthoClone OKT3®), which binds to a molecule on the surfaces of T cells and was launched in 1986 to avoid acute rejection of organ transplants; "edrecolamb" (Panorex®), launched in 1995 for the treatment of colorectal cancer "odulimomab" (Antilfa®), launched in 1997 for use in transplant rejection, and, "ibritumomab" (Zevalin®yiuxetan), launched in 2002 for use in non-Hodgkin's lymphoma. Additionally, a monoclonal Fab "abciximab" (ReoPro®), was launched in 1995. This inhibits the caking of platelets by joining the receptors on their surface that are normally linked by fibrinogen and may be helpful in preventing reattachment of the coronary arteries in patients who have suffered from angioplasia. Three chimeric monoclonal antibodies were also released: "rituximab" (Rituxan®), in 1197, which binds to the CD20 molecule found in most B cells and is used to treat B cell lymphomas, "basiliximab" (Simulect® ), in 1998 for rejection of transplant; "infliximab" (Remicade®) that binds to tumor necrosis factor-alpha (TNF-a), in 1998 for the treatment of rheumatoid arthritis and Crohn's disease. Additionally, "abciximab" (ReoPro®), a 47.6 kD Fab fragment of the chimeric human-mouse 7E3 monoclonal antibody that binds to the human platelet hydroprotein (GP) receptor Ilb / IIIa, was released in 1995 as an adjunct to Percutaneous coronary intervention for the prevention of cardiac ischemic complications in patients suffering from percutaneous coronary intervention. Finally, seven monoclonal "humanized" were launched from 1997-2003: "daclizumab" (Zenapax®) in 1997, which bind a part of the IL-2 receptor produced on the surface of activated T cells that are used to prevent acute rejection of transplanted kidneys; "palivizumab" (Synagis®) in 1998 for RSV; "trastuzumab" (Herceptin®) in 1998, which binds to HER-2, a growth factor receptor found in breast cancer cells; "gemtuzumab" (Mylotarg®) in 2000, which is a conjugate of a monoclonal antibody that binds to CD33, a cell surface molecule expressed by cancer cells in acute myelogenous leukemia (AML) but not found in normal stem cells need to repopulate the bone marrow; and "alemtuzumab" (MabCampath®) in 2001, which binds to CD52, a molecule found in white blood cells that has produced temporary remission of chronic lymphocytic leukemia; "adalimumab" (Humira® (D2E7)), a human anti-TNF monoclonal containing heavy and light chain variable regions of human derivatives containing human anti-TNF monoclonal and human IgG: k constant regions was launched in 2002 for the treatment of rheumatoid arthritis; and, "omalizumab" (Xolair®), which binds to IgE and avoids joining mast cells was approved in 2003 for the treatment of adults and adolescents over twelve years of age with persistent moderate to severe asthma who have a trial to a positive test or in vitro reactivity to a perennial allergen whose Symptoms are inadequately controlled with inhaled corticosteroids.

Thus, protein engineering has been set in an effort to decrease problems related to the immunogenicity of recombinant immunoglobulin polypeptides administered and to try to alter the antibody-carrying functions. However, the problems remain. For example, most cancer patients treated with rituximab relapse, usually at 6-12, and fatal infusion reactions have been reported 24 hours after the rituximab infusion. This fatal reactions followed by infusion reaction complex that included hypoxia, pulmonary infiltrates, acute respiratory distress syndrome, myocardial infarction, ventricular fibrillation or cardiogenic shock. The acute real failure that requires dialysis with cases of fatal results has been reported in the establishment of the tumor lysis syndrome. After treatment with rituximab, due to having severe mucocutaneous reactions, some with fetal results. Additionally, high doses of rituximab are required for intravenous injection because the molecule is large, approximately 150 kDa, and the infusion is limited with the lymphoid tissues where many tumor cells reside.

The administration of trastuzumab may result in the development of ventricular dysfunction and congestive heart failure, and the incidence and severity of cardiac dysfunction has been reported to be particularly high in patients receiving trastuzumab in combination with anthracyclines and cyclophosphamide. The administration of trastuzumab can also result in severe hypertensive reactions (including anaphylaxis), infusion reactions, and lung events.

Patients receiving daclizumab immunosuppressive therapy are at increased risk of developing lymphoproliferative disorders and opportunistic infections, and it is not known whether the use of daclizumab will have long-term effects on the ability of the immune system to respond to antigens first encountered during induced immunosuppression. by daclizumab.

Hepatotoxicity, including severe hepatic veno-occlusive disease (VOD), has also been reported in association with the use of gemtuzumab as a single agent, as part of a combination chemotherapy regimen, and in patients without a history of liver disease or transplantation. of hematopoietic stem cell (HSCT). Patients receiving gemtuzumab either before or after HSCT, patients suffering from liver disease or abnormal liver disease or function, and patients receiving gemtuzumab in combinations with other chemotherapy may be at increased risk of developing severe VOD. The disease from liver failure and VOD has been reported in patients who received gemtuzumab, and it has been noted that careful monitoring may not identify all patients at risk or avoid the complications of hepatotoxicity.

Hepatotoxicity is also reported in patients who received alemtuzumab. Serious and in some rare cases fatal cases have occurred of pancytopenia / hypoplasia of the marrow, autoimmune idiopathic thrombocytopenia, and autoimmune hemolytic anemia in patients receiving alemtuzumab therapy. Alemtuzumab may result serious infusion reactions as well as opportunistic infections.

In patients treated with adalimumab, serious infections and sepsis have been reported, including fatalities, such as exacerbation of clinical symptoms and / or radiographic evidence of demyelinating disease, and in patients treated with adalimumab in clinical trials they had a higher incidence of lymphoma than the expected proportion in the general population.

Severe severe adverse reactions in clinical studies with omalizumab have influenced malignancies and anaphylaxis, in which the observed incidence of malignancies among patients treated with omalizumab (0.5%) is medically superior than among patients in control groups (0.2%).

The smallest immunoglobulin molecules have been constructed in an effort to solve various problems associated with immunoglobulin therapy. complete Polypeptides with single-chain immunoglobulin variable region ferment (scFvs) are made from a variable immunoglobulin heavy chain variable domain via a short linker peptide to an immunoglobulin light chain variable domain. Huston et al., 1988 Proc. Nati Acad. Sci. USA, 85: 5879-83. It has been suggested that the smaller size of scFv molecules can lead to faster plasma clearance and more effective penetration into tissues than whole immunoglobulins. See, for example, Jain, 1990 Cancer Res. 50: 814s-819s. An anti-tumor scFv was reported to show a faster penetration and a more homogeneous distribution through the tumor mass than the corresponding chimeric antibody. Yolota et al., Cancer Res. 52: 3402-08 (1192).

Despite the advantages of scFv molecules can have in relation to serotherapy, there are also disadvantages for this therapeutic approach. For example, rapid scFv cleaning can prevent the delivery of a minimal effective dose to the target tissue. Additionally, the preparation of adequate amounts of scFv for administration to patients has been a challenge due to the difficulties of scFv expression and isolation that adversely affect performance. During expression, the scFv molecules lack stability and they are often added during the pairing of variable regions from different molecules. Additionally, levels of production of scFv molecules in the mammalian expression system have been reported to be low, which may limit the potential for the efficient production of scFv molecules for therapy. Davis et al., 1990 j. Biol. Chem. 265: 10410-18; Traunecker et al., 1991 EMBO J. 10: 3655-59. Strategies to improve production have been explored, and have contributed to the inclusion of the addition of glycosylation to variable regions. See, for example, U.S. Patent No. 5,888,773; Jost et al., 1994 J. Biol. Chem. 269: 26267-73. Another disadvantage for the use of scFvs for therapy is the lack of an effector function. A scFv that lacks cytolytic function, ADCC, and complement-dependent cytotoxicity may be less effective or ineffective in treating diseases. Although the development of scFv technology began 12 years ago, there is no approved scFv product for therapy at present.

Alternatively, it has been proposed that the fusion of a scFv to another molecule, such as toxin, which could have the advantage of specific antigen binding activity and the small size of a scFv to deliver the toxin to a target tissue. Chaudary et al., 1989 Nature 339: 394; batra et al. , 1991 Mol. Cell. Biol 11: 2200. The conjugation or fusion of scFv toxins has thus been offered as an alternative strategy to deliver specific molecules of potent antigen, but dosing with such conjugates or chimeras can be limited by excessive and / or non-specific toxicity due to the toxin portion of all the preparations. Toxic effects may include supraphysiological elevation of liver enzymes and vascular weakness syndrome, and other undesirable effects. In addition, immunotoxins are themselves highly immunogenic after administration to a host, and host antibodies raised against the immunotoxin limit the potential utility for repeated therapeutic treatments of an individual.

Fusion proteins in which the polypeptide sequences of the immunoglobulin constant region are present and the non-immunoglobulin sequences are substituted by the variable regions of the antibody have also been investigated. For example, CD4, and the T cell surface protein recognized by HIV, were recombinantly fused to an effector domain Immunoglobulin Fe, and an IL-2-IgGl fusion protein that reported complement-mediated lysis of cells carrying the IL-2 receptor. See Sensel et al., Chem. Immunol. 65: 129-158 (1997). An extensive introduction as well as detailed information about all aspects of recombinant antibody technology can be found in the text "Recombinant Antibodies" (John Wiley & Sons, NY, 1999). A comprehensive collection of detailed antibody engineering laboratory protocols can be found in R. Kontermann and S.

Dübel (eds.). "The Antibody Engineering Lab Manual" (Springer Verlag, Heidelberg / New York, 2000).

Diseases and disorders are believed to be responsible for some type of therapy with immunoglobulin include cancer and immune system disorders. Cancer includes a wide range of diseases, affecting approximately one in four individuals in the world. The rapid and unregulated proliferation of malignant cells is a hallmark of many types of cancers, including hematologic malignancies. Although patients with malignant haematological condition have benefited from the Advances in cancer therapy in the past two decades, Multani et al., 1998 j. Clin. Oncology 16: 3691-3710, and remission times have increased, most patients still relapse and succumb to their disease. The barriers to cure with cytotoxic drugs include, for example, the cellular resistance to the tumor and the high toxicity of chemotherapy, which avoids the optimal dosage of many patients.

However, patients have been treated with immunotherapeutics that target malignant cells, that is, antigens expressed on tumor cells. With regard to the selection of tumor cell surface antigens suitable for use as immunotherapy targets, it is preferable that such a target antigen is not expressed by normal tissues, particularly where the preservation of such tissue is important to the survival of the host. In the case of hematologic malignancy, the malignant cells express many antigens that are not expressed on the surfaces of the stem cells or other essential cells. The treatment of a malignant haematological condition that uses a therapeutic regimen that empties both the cells normal as malignant haematological origin has been acceptable when the generation of normal cells from progenitors can occur after the therapy has ended. Additionally, the target antigen is desirably expressed in all or virtually all clonogenic populations of tumor cells, and it is better that the expression persist despite the selective pressure of immunoglobulin therapy. Strategies that employ selection of a cell surface ideotype (for example a particular ideotype) as an objective for B cell malignancy therapy have been limited by the growth of tumor cell variants with altered surface ideotype expression, even when the antigen exhibits a high degree of tumor selectivity. Meeker et al., 1985 N. Engl. J. Med. 312: 1658-65. The selected antigen must also traffic properly after an immunoglobulin binding to it. The shedding or internalization of a cell surface target antigen after an immunoglobulin binds to the antigen can allow the tumor cells to escape suction, thus limiting the effectiveness of serotherapy. Finally, the binding of an immunoglobulin to antigens with cell surface targets that transmit or Transduce signals of cellular activation may result in improved functional responses to tumor cell immunotherapy and may lead to increased detection and / or apoptosis. While all these properties are important, the triggering of apoptosis after an immunoglobulin binds to the target antigen can also be a critical factor for successful serotherapy.

Antigens that have been tested as targets for seropherapy of B-cell and T-cell malignancies include the Ig ideotype (Brown et al., 1989 Blood 73: 651-61), CD19 (Hekman et al., 1991 Cancer Immunol, I munother. 32: 364-72), Vlasveld et al., 1995 Cancer Immunol Immunother 40: 37-47), CD20 (Press et al., 1987 Blood 69: 584-91), Maloney et al., 1997 J. Clin. Oncol. 15: 3266-74), CD21 (Scheinberg et al., 1990 J. Clin. Oncol. 8: 792-803), CD5 (Dillman et al., 1986 J. Biol. Resp. Mod. 5: 394-410) , and CD52 (CAMPATH) (Pawson et al., 1997 J. Clin. Oncol. 15: 2667-72). Of these, the greatest benefit for therapy of T cell lymphores has been had using molecules that point to CD20. Other targets have been limited by the biological properties of the antigen. For example, the surface idiotype is it can alter through the somatic mutation that allows the escape of the tumor cell. CD5, CD21 and CD19 are rapidly internalized after monoclonal antibody binding, which allows the tumor cell to escape destruction unless the monoclonal antibodies are conjugated with the toxin molecules. CD22 is expressed on only a subset of T-cell lymphores, thus limiting its utility, although CD52 is expressed in both T cells and B cells and can therefore generate counterproductive immunosuppression by depletion.

Treatment of patients with low grade or follicular B-cell lymphoma using a chimeric CD20 monoclonal antibody has been reported to introduce partial or complete responses in patients. McLaughlin et al., 1996 Blood 88: 90a (abstract, suppl.1); Maloney et al., 1997 Blood 90: 2188-95. However, as noted above, tumor lapses commonly occur from six months to one year. Additional improvements in serotherapy are necessary to induce more durable responses, for example, in low-grade B-cell lymphoma, and for allow effective treatment of high-grade lymphoma and other B-cell diseases Another approach has been the target of radiostopes to B cell lymphomas using monoclonal antibodies specific for CD20. Although the effectiveness of the therapy is reported as increased, the associated toxicity from the long in vivo half-life of the radioactive antibody also sometimes increases the requirement that the patient need stem cell rescue. Press et al., 1993 N. Eng. J. Med. 329: 1219-1224; Kaminski et al., 1993 N. Eng. J. Med. 329: 459-65. The monoclonal antibodies to CD20 have been hardened with proteases to produce F (ab ') 2 or Fab fragments before the binding of the radioisotope. Improvement in penetration of the radioisotope conjugate into the tumor and shortening in the half-life in vivo has been reported, thus reducing toxicity in normal tissues. However, these molecules lack the effector function, which includes complement fixation and / or ADCC.

CD20 was the first molecule molecule-specific surface of B-cell lineage identified by a monoclonal antibody. This is a 35 kDa non-glycosylated hydrophobic B-cell transmembrane phosphoprotein that has both amino and carboxy ends in the cytoplasm. Einfeld et al. , 1988 EMBO J. 7: 711-17. CD20 is expressed by all normal mature B cells, but is not expressed by means of precursor B cells. The natural ligands for CD20 have not been identified, and the function of CD20 in the biology of the B cell is still incompletely understood.

Anti-CD20 monoclonal antibodies effect the viability and growth of B. Clark et al., 1986 Proc. Nati Acad. Sci. USA 83: 4494-98. Extensive cross-linking of CD20 can induce apoptosis in cell lines of B-lymphoma, Shan et al., 1998 Blood 91: 1644-52, and cross-linking of CD20 on the cell surface has been reported by increasing the magnitude and improving the kinetics of signal transduction, for example, as detected by measuring thyroxine phosphorylation of cellular substrates. Deans et al., 1993 J. Immunol. 146: 846-53. Therefore, in addition to cellular depletion by complement and ADCC mechanisms, binding of the Fe receptor by means of CD20 monoclonal antibodies in vivo can promote apoptosis of malignant B cells by crosslinking CD20, consistent with the theory that the effectiveness of CD20 therapy of human lymphoma in a SCID mouse model may be dependent on the binding of the Fe receptor by means of the monoclonal antibody CD20. Funakoshi et al., 1996 J. Immunotherapy 19: 93-101. The presence of multiple membrane spaced domains in the CD20 polypeptide (Einfeld et al., 1988 EMBO J. 7: 711-17; Stamenkovic et al., 1988 J. Exp. Med. 167: 1975-80; Tender et al. , 1988 J. I munol 141: 4388-4394), avoids the internalization of CD20 after antibody binding, and this was recognized as an important feature for the therapy of B-cell malignancy when a murine monoclonal antibody, .1F5 , was injected in patients with B-cell lymphoma, resulting in significant depletion of malignant cells and partial clinical responses. Press et al., 1987 Blood 69: 584-91.

Because normal mature B cells also express CD20, normal B cells are depleted by anti-CD20 antibody therapy. Reff., M. E. et al., 1994 Blood 83: 435-445. After the treatment is completed, however, normal B cells can be regenerate of CD20 negative B cell precursors; therefore, patients treated with antiCD20 therapy do not experience significant immunosuppression. Depletion of normal B cells can also be beneficial in diseases that involve the inappropriate production of antibodies or other diseases where B cells play a role. A chimeric monoclonal antibody specific for CD20 consisting of heavy and light chain variable regions of mouse origin fused to human IgGl heavy chain and constant regions of light chain human layer, according to the reports they retained the union to CD20 and the ability to mediate ADCC and fix complement. Liu et al., 1987 J. I munol. 139: 3521-26. The mechanism of antitumor activity of rituximab, discussed above, is believed to be a combination of several activities, including ADCC, complement fixation, and triggering of signals that promote apoptosis in malignant B cells, although the large size of rituximab prevents diffusion optimal of the molecule in lymphoid tissues containing malignant cells, thus limiting these antitumor activities. Autoimmune diseases include anutoimmune thyroid diseases, which include Graves' disease and thyroiditis.

Hashimoto '. In the United States alone, there are approximately 20 million people who have some form of thyroid autoimmune disease. Autoimmune thyroid disease results in the production of antibodies that stimulate the thyroid that cause hyperthyroidism (Graves' disease) or destroy the thyroid to cause hypothyroidism (Hashimoto's thyroiditis). Thyroid stimulation is caused by antibodies that bind and activate the thyroid stimulating hormone (TSH) receptor. The destruction of the thyroid is caused by autoantibodies that react with other thyroid antigens. The usual therapy for Graves' disease includes surgery, radioactive iodine, or an antithyroid drug therapy. Reactive iodine is widely used, because antithyroid drugs have significant side effects and the recurrence of the disease is high. Reserve surgery for patients with large dewlap or when there is a need for a very rapid normalization of thyroid function. There are no therapies that point to the production of antibodies responsible for the stimulation of the TSH receptor. The usual therapy for Hashimoto's thyroiditis is levothyroxine sodium, and therapy is usually long duration due to the low probability of remission. Suppressive therapy has been shown to shrink the gills in Hashimoto's thyroiditis but there are no known therapies that reduce the production of antibodies that point to the mechanism of the disease.

Rheumatoid arthritis (RA) is a chronic disease characterized by inflammation of the joints that leads to swelling, pain, and loss of function. The RA affects an estimated 2.5 million people in the United States. RA is caused by a 'combination of events that include an initial infection or damage, an abnormal immune response, and genetic factors. Although T cells and autoreactive B cells are present in RA, the detection of high levels of antibodies that are reconnected in the joints, called rheumatoid factor, is used for the diagnosis of RA. The usual therapy for RA includes many medications to manage pain and slow the progression of the disease. No therapy has been found that can cure the disease. Medications include nonsteroidal anti-inflammatory drugs (NSAIDS), antirheumatic drugs that modify the disease (DMARDS). The NSAIDs are useful in benign disease, but fail to prevent the progression of joint destruction and weakness in severe RA. Both NSAIDs and DMARDs are associated with significant side effects. Only one new DMARD, leflunomide, has been approved in almost ten years. Leflunomide blocks the production of antibodies, reduces inflammation, and decreases the production of RA. However, this drug also causes severe side effects that include nausea, diarrhea, hair loss, rash, and liver sessions.

Systemic Lupus Erythematosus (SLE) is an autoimmune disease caused by recurrent damage to blood vessels in multiple organs, including the kidneys, skin, and joints. The SLE is estimated to affect more than 500 thousand people in the United States. In patients with SLE, a failed interaction between T cells and B cells results in the production of antibodies that attack the nucleus of cells. These include anti-smolder DNA and anti-Sm antibodies. Antibodies that bind to phospholipids are also found in about half of the complexes SLE, and are responsible for damage to blood vessels and low blood counts. Immune complexes accumulate in the kidneys, blood vessels, and joints of SLE patients, where they cause inflammation and tissue damage. No treatment for SLE has been found to cure the disease. NSAIDs and DMARDs are used for therapy depending on the severity of the disease. Plasma exchange with plasma exchange to remove antibodies may cause temporary improvement in SLE patients. There is general agreement that antibodies are responsible for SLE, so new therapies that deplete the B cell lineage, and that allow the immune system to re-establish itself as new B cells are generated from the precursors, would offer hope for long-term benefit in SLE patients.

Sjogren's syndrome is an autoimmune disease characterized by the destruction of the glands that produce body moisture. Sjogren's syndrome is one of the most prevalent autoimmune disorders, which strike an estimated 4 million people in the United States. Approximately half of the person struck with Sjogren's syndrome also has a disease of collective tissue, such as RA, while the other half has primary Sjogren's syndrome without another concurrent autoimmune disease. Antibodies, which include antinuclear antibodies, rheumatoid factor, antifodrin, and anti-mascanin receptor are often present in patients with Sjogren's syndrome. Conventional therapy includes corticosteroids, and more effective additional therapies would be of benefit.

Immune thrombocytopenic purpura (ITP) is caused by antibodies that bind to blood platelets and cause their destruction. The drugs cause some cases of ITP, and others are associated with infection, pregnancy, or autoimmune disease such as SLE. Approximately half of all cases are classified as "idiopathic", meaning that the cause is unknown. The treatment of ITP is determined by the severity of the symptoms. In some cases, no therapy is required although most cases immunosuppressive drugs, which include corticosteroids or intravenous infusions of immune globulin to deplete T cells, are given. Another treatment that usually results in an increasing number of platelets is the removal of the spleen, the organ that destroys platelets coated by antibody. The most potent immunosuppressive drugs that include cyclosporine, cyclophosphamide, or azatropiopine are used by patients with severe cases. The removal of antibodies by passage of plasma from patients over a protein A column is used as a second line of treatment in patients with severe disease. More effective additional therapies are desired.

Multiple sclerosis (MS) is also an autoimmune disease. This is characterized by inflammation of the central nervous system and destruction of myelin, which isolates the nerve cell fibers in the brain, spine, and body. Although the cause of MS is unknown, it is widely believed that autoimmune T are the primary contributors to the pathogenesis of the disease. However, high levels of antibodies are present in the cerebral spinal fluid of patients with MS, and the theories predict that the B cell response that leads to the production of antibodies is important to mediate the disease. No B cell depletion therapy has been studied in patients with MS and there is no cure for MS. Life therapy are corticosteroids, which can reduce the duration and severity of attacks but do not affect the course of the MS during the time. New therapies of biotechnological interferon (IFN) for MS have recently been approved but more effective additional therapies are desired.

Myasthenia Gavis (MG) is a chronic autoimmune neuromuscular disorder characterized by weakness of voluntary muscle groups. The MG affects approximately 40 thousand people in the United States. MG is generated by antibodies that bind to acetylcholine receptors expressed in the neuromuscular joints. Autoantibodies reduce or block acetylcholine receptors, preventing the transmission of signals from the nerves to the muscles. There is no known cure for MG. Common treatments include immunosuppression with corticosteroids, cyclosporine, cyclophosphamide, or azathioprine. The surgical removal of the thymus is often used to calm the autoimmune response. The plasmapheresis, used to reduce the levels of antibodies in the blood, is effective in MG, but is short in life because the production of antibodies continues. Plasmapheresis is usually reserved for severe muscle weakness before surgery. It would be of benefit new and effective therapies.

Psoriasis affects approximately 5 million people, and is characterized by autoimmune inflammation of the skin. Psoriasis is also associated with arthritis in 30% (soriatic arthritis). Many treatments, including steroids, UV light retenoids, vitamin D derivatives, cyclosporine, methotrexate have been used but it is clear that psoriasis would benefit from new and effective therapies. Scleroderma is a chronic autoimmune disease of the connective tissue that is also known as systemic sclerosis. Scleroserma is characterized by an overproduction of collagen that results in thickening of the skin, and approximately 300 people in the United States have scleroderma which would also benefit from new and effective therapies.

There is a clear need for improved compositions and methods for treating malignancies, including B-cell malignancies and disorders that include autoimmune diseases, disorders, and conditions, as well as other diseases, disorders, and collisions. The compositions and methods of the present invention described and claimed herein provide such improved compositions and methods as well as other advantages.

SUMMARY OF THE INVENTION It is an aspect of the present invention to provide an immunoglobulin fusion protein with binding domain, comprising a polypeptide with binding domain. which is fused or otherwise connected to an immunoglobulin polypeptide or to a polypeptide with pivot region, which in turn is fused or otherwise connected to a region comprising one or more constant regions native or treated with engineering from immunoglobulin heavy chain, other than CH1, for example, the CH2 and CH3 regions of IgG and igA, or the CH3 and CH4 regions of igE. The immunoglobulin fusion protein with binding domain comprises, consists essentially of, or consists of, an immunoglobulin heavy chain CH2 constant region polypeptide native or worked with engineering (or CH3 in the case of a construct derived wholly or in part from IgE) that is fused or otherwise connected to the pivotal region polypeptide and a native or engineered immunoglobulin heavy chain CH3 polypeptide or constant region. or CH4 in the case of a construction derived in whole or in part from IgE) that is fused or otherwise connected to a polypeptide or constant region CH2 (or CH3 in the case of a construction derived in whole or in part from IgE) . Such immunoglobulin fusion proteins with binding domain are capable of at least one immunological activity selected from the group consisting of antibody-dependent cell-mediated cytotoxicity and complement fixation. Such polypeptides with binding domain are also capable of binding or binding specifically to a target, eg, a white antigen.

In certain embodiments, for example, the polypeptide with binding domain comprises at least one variable region immunoglobulin pblipeptide that is selected from a native or engineered immunoglobulin light chain variable region polypeptide and / or a variable region polypeptide heavy chain immunoglobulin native or engineered. In certain additional embodiments, the immunoglobulin fusion proteins with binding domain comprise a native or engineered immunoglobulin heavy chain variable region or polypeptide wherein the polypeptide or heavy chain variable region is a polypeptide or heavy chain variable region of engineered human immunoglobulin (or a polypeptide or immunoglobulin heavy chain variable region engineered from a non-human species) comprises a mutation, substitution, or deletion of one or a few amino acids at a site corresponding to any one or more of amino acid positions 9, 10, 11, 12, 108, 110 and / or 112. Mutations, substitutions, or deletions of a or amino acids at the site corresponding to one or more or more of the amino acid positions 9, 10, 11, 12, 108, 110, and / or 112 the heavy chain variable region can be included within a construct such as a construction corresponding to, for example, SEQ ID. DO NOT. : In certain other additional embodiments, the fusion protein comprises a polypeptide having a sequence selected from SEQ ID NOS. NO .: or SEC ID. DO NOT.: . In certain modalities the immunoglobulin variable region polypeptide is derived from, for example, a human immunoglobulin, and in certain other embodiments the immunoglobulin variable region polypeptide comprises a humanized immunoglobulin polypeptide sequence. In certain embodiments, the immunoglobulin variable region polypeptide, whether humanized or not, is derived from a murine immunoglobulin, or is derived from an immunoglobulin from other species, including, for example, rat, pig, monkey or camel.

In accordance with certain embodiments of the present invention, the polypeptide with binding domain comprises, consists essentially of, or consists of, (a) at least one polypeptide with native immunoglobulin light chain variable region or engineered, (b) at least one native or engineered immunoglobulin heavy chain variable region polypeptide; (c) at least one linker polypeptide that is fused or otherwise connected to the polypeptide of (a) and the polypeptide of (b). In certain additional embodiments the immunoglobulin light chain variable region and the heavy chain variable region polypeptides native or worked with engineering are derived or constructed of human immunoglobulins, and in certain other additional embodiments the linker polypeptide comprises at least one polypeptide that includes or has an amino acid sequence Gly-Gly-Gly-Gly-Ser [SEQ ID NO. DO NOT.: ]. In other embodiments, the linker polypeptide comprises at least two or three repeats of a polypeptide having an amino acid sequence Gly-Gly-Gly-Gly-Ser [SEQ ID NO. DO NOT.: ]. In other embodiments, the linker comprises a glycolization site, which in certain additional embodiments is a glycolisation site linked to asparagine, an O-linked glycolization site, a C-mannosylation site, a glypiation site, or a phosphoglycation site. In another embodiment, at least one native or engineered immunoglobulin heavy chain CH2 constant region polypeptide and a native or engineered immunoglobulin heavy chain CH3 constant region polypeptide is derived from an IgG or IgA human immunoglobulin heavy chain. . In another embodiment at least one native or engineered immunoglobulin heavy chain CH3 constant region polypeptide and a heavy chain CH4 constant region polypeptide of native or engineered immunoglobulin is derived from a human IgE immunoglobulin heavy chain.

An immunoglobulin pivot region polypeptide can comprise, essentially consists of, or, for example, any of (1) a naturally occurring pivot or polypeptide-acting pivot or peptide for example, an immunoglobulin pivotal region polypeptide that includes, for example, wild-type human IgE pivot or a portion thereof, a wild type human IgA pivot or a portion thereof, wild-type human IgE pivot or a portion thereof, wild-type human IgE pivot region, that is, IgE CH2, or a portion thereof, a wild type camel pivot region or a portion thereof (which includes a flame pivot region IgG1 or a portion thereof, a flame pivot region IgG2 or a portion thereof). of this, and a flame pivot region IgG3 or a portion thereof), a nurse shark pivot region or a portion thereof, and / or a spotted rat pitch region or a portion thereof; (2) an engineered altered or engineered pivot region polypeptide that does not contain cysteine residues that are derived or constructed from wild type immunoglobulin having one or more cysteine residues; (3) an altered or engineered pivot region polypeptide containing a cysteine residue and derived from a wild-type immunoglobulin pivot region polypeptide having one or more cysteine residues; (4) a pivot region polypeptide that has been mutated or otherwise altered or engineered to contain or aggregate one or more glycolization sites, eg, a glycolization site bound to aspargin, a glycolization site bound to aspargine, a C mannolization site, a glyphiation site or a phosphoglycation site, (5) an engineered or altered pivot region polypeptide in which the number of cysteine residues is reduced by amino acid substitution or deletion , for example, an IgG1 or IgG4 pivot region mutated or otherwise altered or engineered containing for example zero, one, or two cysteine residues, or an Ig2 pivot region mutated or otherwise altered or worked by engineering containing for example zero, one, two or three cysteine residues, a mutated or otherwise altered or engineered Ig3 pivot region containing for example zero, one, two, three, or four ten cysteine residues or an IgAl or human IgA2 pivot region polypeptide mutated or otherwise altered or engineered containing zero or only one or two cysteine residues (eg a "SCC" pivot), a pivot region igD mutated or otherwise altered or engineered that does not contain cysteine residues, or a human IgE pivot region that is mutated or otherwise altered or engineered ie, an IgE CH2 region polypeptide that contains zero or only one, two, three or four cysteine residues; or (6) any other connecting molecule or region described or referenced herein or otherwise known or subsequently discovered to be useful for connecting attached immunoglobulin domains such as, for example, a CH1 domain and a CH2 domain. for example, a pivotal region polypeptide can be selected from the group consisting of (i) a wild-type human IgGl immunoglobulin pivot regio polypeptide, for example, (ii) a human IgG mutated or otherwise altered or worked by engineering or another immunoglobulin pivot region polypeptide that is derived from or constructed of a wild-type immunoglobulin pivot region polypeptide having three or more cysteine residues, wherein said mutated human IgGl or other immunoglobulin pivot region polypeptide contains two cysteine residues and wherein a first cysteine of the wild-type pivot region is not mutated, (iii) a human IgGl mutated or otherwise altered or worked up by engineering or another immunoglobulin pivot region polypeptide that is derived from a wild-type immunoglobulin pivot region pivot region polypeptide having three or more cysteine residues, wherein said human IgGl mutated or pivotal region polypeptide of immunoglobulin contains no more than one cysteine residue, and (iv) a human IgGl mutated or otherwise altered or engineered or other immunoglobulin pivot region polypeptide that is derived from an immunoglobulin pivot region type polypeptide. wild animal having 3 or more cysteine residues wherein said human IgGl mutated or otherwise altered or engineered or another immunoglobulin pivot region polypeptide does not contain cysteine residues. In certain embodiments, for example, the immunoglobulin pivot region polypeptide is mutated otherwise altered or the pivotal region polypeptide engineered and exhibits a reduced capacity for dimerizarce, relative to human wild-type immunoglobulin G or to another wild type pivot region or to a pivotal polypeptide.

Immunoglobulin heavy chain constant region polypeptides can be, for example, native or engineered CH2 and CH3 domains of an isotype that is human IgG or human IgA. The immunoglobulin heavy chain constant region CH3 and CH4 polypeptides are native or engineered from an isotype that is human IgE.

In certain other embodiments, the target antigen may be, for example, CD19 (CD19 lymphocyte antigen also referred to as B4, or Leu-12 surface antigen), CD320 (B lymphocyte antigen 20, also referred to as surface antigen). lymphocyte B Bl, Leu-16 or Bp35), CD22 (CD22 B cell receptor also referred to as Leu-14, B cell adhesion molecule, or BL-CAM), CD37 (leukocyte antigen CD37), CD40 (CD40 B cell surface antigen, also referred to as a member of the Tumor Necrosis Factor 5 receptor superfamily, the receptor CD40L, or BP50), CD80 (T-lymphocyte activation antigen CD80, also referred to as B7-1 activation antigen, B7, B7-1, or BB1, CD86 (T-lymphocyte activation antigen, CD86, also referred to as antigen Activation B7-2, B70, FUN-1, or BU63), CD137 (also referred to as the Tumor Necrosis Factor receptor superfamily number 9), CD152 (also referred to as cytotoxic T lymphocyte protein 4 or CTLA-4), CD45 (common leukocyte antigen, also referred to as L-CA, T 200, and EC3.1.3.48), CD45RA (an isoform of CD45, and an antigen expressed on immature native lymphocytes) CD45RB (an isoform of CD45), CD45RO (an isoform of CD45, and a common leukocyte antigen expressed on B cells and T memory), L6 (antigen associated with L6 tumor, also referred to as member of transmembrane superfamily 4, marker 1 of the membrane component surface, or M3S1), CD2 (CD2 T cell surface antigen, also referred to as T22 / Leu-5 cell surface antigen, LFA-2 , LFA-3 receptor, Erythrocyte receptor or Rócete receptor), CD28 (CD28 T cell-specific homodimer surface protein, also referred to as Tp44), CD30 (CD30 lymphocyte activation antigen, also referred to as member 8 of the receptor superfamily Tumor Necrosis Factor, CD30L receptor, or Ki-1), CD50 (also referred to as intracellular adhesion 3 molecules (ICAM3), 0 ICA-R), CD54 (also referred to as intracellular adhesion molecule 1 (ICAMl) , or rhinovirus receptor of the major group), B7-H1 (ligand for an immunoinhibitory receptor expressed by T cells, B cells and activated myeloid cells, also referred to as PD-Ll; see Dong, et al., "B7-H1 , a third member of the B7 family, co-stimulates T-cell proliferation and interleukin-10 secretion "1999 Nat. Med. 5: 1365-1369), CD134 (also referred to as member 4 of the Necrosis Factor receptor superfamily) Tumor, 4.0X40, '0X40L receptor, ACT35 antigen, or transcriptionally activated protein 1 receptor TAX), 41BB (4-lBB ligand receptor, 4-lBB T cell antigen, or ILA T cell antigen), CD153 (also referred to as as member 8 of the Factor's ligand superfamily of Tumor Necrosis, ligand CD30, or CD30-L), CD154 (also referred to as member 5 of the ligand superfamily of Tumor necrosis factor, ligand CD40, CD40-L, TNF-related activation protein, TRAP or cell antigen T Gp39). ICOS (Inducible Coestimulator), CD3, one or more of the chains delta, epsilon, gamma, eta, and zeta, alone or in combination), CD4 (CD4 T cell surface glycoprotein, also referred to as T4 cell surface antigen / Leu-3), CD25 (also referred to as alpha chain of interleukin-2 receptor, sub-unit alpha of IL-2 receptor, p55, or Tac antigen), CD8 alpha (CD8 alpha chain of T-cell surface glycoprotein, also referred to as T-lymphocyte differentiation antigen, T8 / Leu -2, and Lyt-2, CDllb (also referred to as alpha-M Integrina sub-alpha unit MAC-1 of cell surface glycoprotein, alpha chain CR-3, receptor Mol of leukocyte adhesion, or Neutrophil adhesion receptor), CD14 (CD14 monocyte differentiation antigen, also referred to as myeloid-cell-specific leucine glycoprotein or LPS receptor), CD56 (also referred to as Neural cell adhesion molecule 1), or CD69 (also referred to as T cell activation antigen) anus, P60, Gp32 / 28, Leu-23, MLR-3, Activation-inducing molecule, or AIM), or TNF-factor (for example TNF-a). The above list of construction targets and / or white antigens are only examples and is not exhaustive.

In another aspect, the invention includes a binding construct (or a polynucleotide that encodes such a construct) comprising an extracellular domain CD154, or a desired functional portion thereof. In one embodiment of this aspect of the invention, for example, the binding construct comprises a CD54 extracellular domain fused or otherwise connected to a second binding domain. The second binding domain, for example, may comprise, and consists essentially of, or consists of at least one immunoglobulin variable region polypeptide. In at least one immunoglobulin variable region polypeptide can be a native or engineered scFv. The native or engineered scFv can be a native or engineered scFv discovered or described herein. The second binding domain, which includes a native or engineered scFv, can be one that binds, for example, to any of the targets, including, white antigen discovered or described herein, including but not limited to, for example, any of B7-H1, ICOS, L6, CD2, CD3, CD8, CD4, CD14, CD14, CD1, CD20, CD22, CD25, CD30, CD37, CD40, CD45, CD50, CD54, CD56, CD69. , CD80, CD86, CD134, CD137, CD152, CD153.0 CD154.

In another embodiment, the binding domain polypeptide comprises an extracellular CTLA-4 domain, or a desired functional portion thereof, and in additional embodiments at least one of the immunoglobulin heavy chain constant region polypeptides selected from a constant region polypeptide. CH2 and a CH3 constant region polypeptide that is a human IgGl constant region polypeptide, either native or engineered.

In yet another embodiment, at least one of the immunoglobulin heavy chain constant region polypeptides selected from the CH2 constant region polypeptide and a CH3 constant region polypeptide is a human IgA constant region polypeptide, either native or engineered.

In yet another embodiment at least one of the immunoglobulin heavy chain constant region polypeptides selected from the CH3 constant region polypeptide and a CH4 constant region polypeptide is a constant region polypeptide is a polypeptide of constant region. human IgE constant region, whether native or engineered.

Returning to another embodiment, the present invention provides an immunoglobulin fusion protein with binding domain, comprising or consisting essentially of, or consisting of, (a) a polypeptide with binding domain that is fused or otherwise connected to a immunoglobulin pivot region polypeptide, (b) a CH2 (or IgE Ch3) constant region polypeptide. a native or engineered immunoglobulin heavy chain that is fused or otherwise connected to a pivotal region polypeptide; and (c) a native or engineered immunoglobulin heavy chain CH3 (or IgE Ch4) constant region polypeptide. which is fused or otherwise connected to the CH2 (or IgCh3) constant region polypeptide wherein (1) the polypeptide with binding domain comprises an extracellular domain CTL-4, a portion thereof, which is capable of binding or specifically binding at least one CTL-4 ligand selected from the group consisting of CD80 and CD86, (2) the immunoglobulin pivot region polypeptide may be as described above or herein, and may comprise, consists essentially of, or consists of, for example, a polypeptide that is selected from the group consisting of a native or engineered human IgA pivot region polypeptide, a native or engineered human IgGl pivot region polypeptide and a Native or engineered human CH2 IgE region polypeptide (3) an immunoglobulin heavy chain constant region polypeptide comprising, consists essentially of, or consists of, a polypeptide that is selected from the group consisting of a constant region polypeptide Native or engineered human IgA heavy chain CH2, a native chain Ig2 heavy chain CH2 constant polypeptide engineered, and a native IgE heavy chain CH3 constant region polypeptide or engineered (4) a polypeptide of heavy chain constant region immunoglobulin comprising, consisting essentially of, or consisting of of, a polypeptide that is selected from the group consisting of a native or engineered human IgA heavy chain constant region CH3 polypeptide, a native or engineered human IgGl heavy chain CH3 constant region polypeptide, and a CH3 heavy chain constant region IgE native or engineered human, and (5) an immunoglobulin fusion protein with binding domain that is capable of inducing at least one immunological activity selected from the group consisting of antibody-dependent cell-mediated cytotoxicity, CDC, and CE binding. complement. In a further embodiment, the immunoglobulin fusion protein with binding domain is capable of inducing two immunological activities selected from the group consisting of antibody-dependent cell-mediated cytotoxicity, CDC, and complement fixation.

In another embodiment, the present invention provides an immunoglobulin fusion protein with binding domain that comprises, consists essentially of, or consists of (a) a polypeptide with a binding domain that is fused or otherwise connected to a region polypeptide. from. immunoglobulin pivot, wherein said pivotal region polypeptide could be described above or herein, and may comprise, consists essentially of, or consists of, for example a native or engineered human IgE pivot region of action, i.e., a polypeptide of CH2 IgE region; (b) a first region polypeptide heavy chain constant of native or engineered immunoglobulin that is fused or otherwise connected to the pivot region polypeptide, wherein said native and engineered constant region polypeptide consists essentially of, or consists of, a native CH3 IgE constant region polypeptide or engineered; (e) a native or engineered immunoglobulin heavy chain constant region polypeptide that is fused or otherwise connected to the first native or engineered constant region polypeptide, wherein said second native region constant polypeptide or engineered comprises, consists essentially of, or consists of, a native or engineered human CH4 IgE constant region polypeptide and wherein - (1) the immunoglobulin fusion protein with binding domain is capable of inducing at least one immunological activity selected from cytotoxicity and antibody-mediated cell-mediated induction of an allergic response mechanism, and (2) the polypeptide with binding domain that is capable of binding or specifically binding to an antigen. In a further embodiment the antigen is a tumor antigen.

In certain other embodiments, the present invention provides an immunoglobulin fusion protein with binding domain, which comprises, consists essentially of, or consists of, (a) a polypeptide with binding domain that is fused or otherwise connected to a immunoglobulin pivot region polypeptide, wherein the binding domain polypeptide is capable of binding or specifically binding at least one antigen that is present in an immune effector cell and wherein the polypeptide with pivot region can be as described formerly or herein, and may comprise, consists essentially of, or consists of, an example, a polypeptide selected from the group consisting of a polypeptide with native or engineered human IgA pivot region, a polypeptide with native human IgG pivot region or engineered, ie, the polypeptide of the IgE CH2 region; (b) a first native or engineered immunoglobulin heavy chain constant region polypeptide that is fused or otherwise connected to the pivotal region polypeptide, wherein said first native or engineered constant region polypeptide, comprises, consists essentially of, or consists of, a polypeptide selected from the group consisting of a native or engineered human IgA CH2 constant region polypeptide, a native or engineered human IgG CH2 constant region polypeptide, and a polypeptide of human CH3 IgE constant region native or engineered; (c) a second native or engineered immunoglobulin heavy constant region polypeptide that is fused or otherwise connected to the first constant region polypeptide, wherein said second constant region polypeptide comprises, consists essentially of, or consists of a polypeptide selected from the group consisting of a native or engineered human IgA CH3 constant region polypeptide, a native or engineered human IgG CH3 constant region polypeptide, and a native or worked human IgE CH4 constant region polypeptide by engineering; and (d) a membrane polypeptide domain polypeptide in native or engineered plasma. In one example of this embodiment, the plasma membrane anchor domain polypeptide is linked to a native or engineered glycosyl-phosphatidylinositol linkage. In an additional embodiment the polypeptide The plasma membrane anchor domain consists essentially of, or consists of, a native or engineered transmembrane domain polypeptide. In a further embodiment, the polypeptide consists essentially of, or consists of, a native or engineered transmembrane domain polypeptide and a native or engineered cytoplasmic tail polypeptide. In yet a further embodiment the polypeptide with cytoplasmic tail comprises, consists essentially of, or consists of, a polypeptide sequence that signals native or engineered apoptosis, which in a further embodiment is derived or constructed from a domain-dominant polypeptide. of death of the receiver worked native or worked by engineering, a domain of death, or a functional portion or any. In a further embodiment the native or engineered death domain polypeptide comprises, consists essentially of, or consists of, for example, a native or engineered polypeptide selected from an ITIM domain (motif of inhibition based on Tyr immunoreceptor), an ITAM domain (activation motif based on Tyr immunoreceptor), TRAF, RIP, CRADD, FADD (Fas-associated death domain), TRADD (domain protein associated with Type 1 Tumor Necrosis Factor receptor), RAIDD (also referred to as RAID, CD95 (mimic 6 of the Tumor Necrosis Factor receptor superfamily, also referred to as the FASL receptor, A surface antigen mediated by FAS apoptosis, FAS antigen and Apo-1), TNFRl, and / or DR5 (death receptor-5.) In another embodiment the polypeptide sequence that signals native or engineered apoptosis comprises, consists essentially of, or consists of, for example, a sequence derived from a native or engineered caspase polypeptide that is caspase 3 or caspase 8 or caspase 10, which includes caspase 8 / FLICE / MACH-Mch5 and caspase 10 / Flice 2 / Mch4. The plasma membrane anchor domain polypeptide comprises, consists essentially of, or consists of, for example, a polypeptide sequence with a native or engineered glycosyl-phosphatidylinositol linkage. present in an immune effector cell is, for example, CD2, CD216, CD28, CD30, CD32, CD40, CD50, CD50, CD54, CD64, CD80, CD86, CD75, CD152, CD154, CD154, ICOS, CD19. , CD20, CD22, CD37, L6, CD3, CD4, CD25, CD8, CDII, CD14, CD56, CD69. In another modality the human IgG is an IgGl native human or worked with engineering. These immunoglobulin fusion proteins with binding domain may be capable of inducing, for example, at least one immunological activity selected from antibody-dependent cell-mediated cytotoxicity and / or complement and / or CDC binding, and are capable of bind or bind specifically to a target, including, for example, a white antigen. In other embodiments, the immunoglobulin fusion proteins with binding domain may be able to induce, for example, two immunological activities selected from antibody-dependent cell mediated cytotoxicity and / or complement fixation and / or CDC, which are capable of binding or specifically join a target. Immune effector cells include, for example, granulocytes, mast cells, monocytes, macrophages, dendritic cells, neutrophils, eosinophils, vasophils, NK cells, T cells. (which include Thl cells, Th2 cells, Te cells, cells T memory, null cells, and large granular lymphocytes, etc.) and B cells. This embodiment of the invention further includes the use of such proteins for therapy and, for example, the use of such vectors for in vivo and ex vivo gene therapy. . The above list of components of construction and targets is not exhaustive, and may include any desired target or component that may function as, or be useful for the purposes, described herein.

In another embodiment, the invention provides a protein having a first protein motif comprising, consisting essentially of, or consisting of, (1) a native or engineered immunoglobulin pivot region or a pivot region (eg, example IgE CH2) polypeptide that is fused or otherwise connected (2) or a native or engineered CH2 constant region polypeptide (or constant region polypeptide) IgE CH3 native or worked with engineering). Said first protein motif may be fused or otherwise connected to one or more of such other first protein motifs to form a second protein motif, the second protein motif is fused otherwise connected to (3) a region. CH3 constant native or engineered (or an IgE CH4 constant region native or engineered) to form a third protein motif. Said first, second or third protein motifs can be fused or otherwise connected to one or more polypeptides with membrane anchor domain of native or engineered plasma described herein including, for example, a native or engineered transmembrane domain polypeptide, and a native or engineered transmembrane domain domain polypeptide and a cytoplasmic tail polypeptide native or worked with engineering, such as, for example, a polypeptide sequence 'signaling native or engineered apoptosis, which can be derived or constructed a polypeptide with native or engineered death receptor domain, a death domain, or a functional or anyone. Thus, a protein or a polynucleotide within this aspect of the invention can be, for example, a "Finge CH2-CH3-TransmembraneDomain-DeathDomain" construct. It can also be, for example, a construct (Finge-CH2) x-CH3 -TransmembraneDomain-DeathDomain, where X goes from 2 to 5, or such other number as may be needed to achieve a desired length or union of Fe receptor and / or function or complement fixation fusions.

This embodiment of the invention also includes polynucleotides that encode such proteins, vectors including such polynucleotides, and host cells that they contain such polynucleotides and vectors. This embodiment of the invention further includes the use of such proteins for therapy, and, for example, the use of such polynucleotides and / or vectors for gene therapy in vivo and ex vivo. The invention provides, in another embodiment, an immunoglobulin fusion protein with binding domain, comprising, consisting essentially of, or consisting of, (a) a polypeptide with binding domain that is fused or otherwise connected to a polypeptide of immunoglobulin pivot region, wherein the polypeptide with binding domain is capable of binding or specifically binding to at least one antigen that is present on a cancer cell surface and wherein the polypeptide with pivot region can be as described above or herein, and may comprise, consists essentially of, consists of, for example, a polypeptide selected from the group consisting of a polypeptide with native or engineered human IgA pivot region, a polypeptide with native human IgG pivot region or worked with engineering, and a human igE pivot region native or engineered, ie IgE CH2, polypeptide of region; (b) a first heavy chain constant region polypeptide of engineered native immunoglobulin that is fused or otherwise connected to the pivot region polypeptide, wherein the first constant region polypeptide comprises, consists essentially of, or consists of, a polypeptide which is native or a region polypeptide. human IgA CH2 constant native or engineered, a native or engineered human IgG CH2 constant region polypeptide, or a native or engineered human IgE CH3 constant region polypeptide; and (c) a second polypeptide with native or engineered immunoglobulin heavy chain constant region that is fused or otherwise connected to the first constant region polypeptide, wherein the second constant region polypeptide comprises, consists essentially of, or consists of, a polypeptide which is a polypeptide with human IgA CH3 constant region, native or engineered, a polypeptide with a human-engineered native IgG CH3 constant region, or a polypeptide with human IgE CH4 constant region, native or engineered . In a further embodiment the human IgG polypeptides are native or engineered human IgGl polypeptides.

In another embodiment, the present invention provides an immunoglobulin fusion protein with binding domain, which comprises, consists essentially of, or consists of, (a) a polypeptide with binding domain that is fused or otherwise connected to a polypeptide with immunoglobulin pivot region, wherein said polypeptide with pivot region can be as described above or "aguy", and can comprise, consists essentially of, consists of, for example, a polypeptide with human IgA pivot region wild type or worked with engineering; (b) a native or engineered immunoglobulin heavy chain CH2 constant region polypeptide that is fused or otherwise connected to the pivotal region polypeptide, wherein said native or engineered CH2 constant region polypeptide consists essentially of of, consists of, a polypeptide with human IgA CH2 constant region native or engineered; and (c) a native or engineered immunoglobulin heavy chain CH3 constant region polypeptide that is fused or otherwise connected to a native or engineered CH2 constant region polypeptide, wherein the native CH3 constant region polypeptide or worked with engineering comprises, consists essentially of, or consists of, a polypeptide which is (i) a polypeptide with human wild-type IgA CH3 constant region or another IgA region, preferably human or humanized, which is capable of associating with Chain J, (ii) a polypeptide with human IgA CH3 constant region mutated, altered or otherwise engineered that is, unable to associate with a J chain, wherein (1) the immunoglobulin fusion protein with binding domain is capable of at least immunological activity selected from the group consisting of antibody-dependent cell-mediated cytotoxicity, CDC, and complement fixation, and (2) the polypeptide with binding domain is capable of specifically binding or binding to a target such as, for example, an antigen. In certain additional embodiments, the mutated human IgA CH3 constant region polypeptide that is capable of associating with a J chain is (i) a polypeptide comprising, consisting essentially of, or consisting of, an amino acid sequence as set forth in DE ID. SEC NO: _ or (ii) a polypeptide comprising, consists essentially of, or consists of, an amino acid sequence as set forth in SEQ ID NO: _. In other embodiments, the polypeptide with IgA pivot region is a native or engineered IgAl pivot region polypeptide or a native or engineered IgA2 pivot region polypeptide. In yet other embodiments, the IgA pivot region polypeptide is different from the wild-type IgA1 or IgA2 pivot region polypeptide by, for example, altering, substituting, or deleting one or more cysteine residues within said pivot region type. wild.

In certain other embodiments, the present invention provides an immunoglobulin fusion protein with binding domain, comprising, consisting essentially of, or consisting of (a) a polypeptide with binding domain that is fused or otherwise connected to a polypeptide with immunoglobulin pivot region; (b) a native or engineered immunoglobulin heavy chain CH2 constant region polypeptide that is fused or otherwise connected to the pivotal region polypeptide, wherein the native or engineered CH2 constant region polypeptide comprises, consists of essentially of, or consisting of, a polypeptide with a native or engineered flame CH2 constant region that is a polypeptide with IgGl constant region Native or engineered flame CH2, a polypeptide with a native or engineered flame IgG2 CH2 constant region, or a native or engineered IgG3 CH2 polypeptide constant region. and (c) a native or engineered immunoglobulin heavy chain CH3 constant region polypeptide is fused or otherwise connected to the native or engineered CH2 constant region polypeptide, wherein said polypeptide with native or worked CH3 constant region. with engineering, consists essentially of, or consists of, a polypeptide with native or engineered flame CH3 constant region that is selected from the group consisting of a native or engineered flame IgGl CH3 constant region polypeptide, a polypeptide with IgG2 CH3 constant region of native or engineered flame and a polypeptide with IgG3 CH3 native or engineered flame constant region wherein (1) the immunoglobulin fusion protein with binding domain of at least one immunological activity selected from the group which consists of antibody-dependent cell-mediated cytotoxicity, fixed complement ion CDC, and (2) the polypeptide with binding domain is able to bind or specifically bind to a target, for example a target antigen. In a further embodiment the polypeptide with immunoglobulin pivot region, the polypeptide with constant region Natively or engineered flame CH2 and the native or engineered flame CH3 constant region polypeptide comprise sequences derived from a native or engineered flame IgGl polypeptide and the fusion protein does not include a native flame IgGl CH1 domain or worked with engineering. In certain embodiments, the invention provides any of the immunoglobulin fusion proteins with binding domain described above wherein the polypeptide with pivot region is mutated, is engineered, or otherwise altered to contain a glycosylation site, which in certain additional embodiments is a glycosylation site linked to asparagine, a glycosylation site linked to 0, a C-styrylase site, or an phosphorylation site.

In certain embodiments, the invention provides any of the binding constructs described above or herein, including immunoglobulin fusion proteins. with binding domain wherein the polypeptide with binding region or binding domain comprises two or more polypeptide sequences with binding domain wherein each of the polypeptide sequences with binding domain is capable of binding or binding specifically to the targets such as one or more antigens whose antigen or antigen targets may be the same or different. A native, more preferably an igD pivot worked with engineering is a desired connection region between the binding domains of a bispecific molecule of the invention, ie, with two or more binding domains, preferably two. The wild-type human IgD pivot has a cysteine that forms a disulfide bond with the light chain in the native IgD structure. It is desirable to mutate or suppress this cysteine in the human IgD pivot for use as a region of connection between the binding domains of, for example, a bispecific molecule. Other amino acid changes or 'deletions or alterations in an IgD pivot which do not result in undesired pivotal inflexibility are within the scope of the invention. The IgD pivot region native or engineered from other species is also within the scope of the invention, such as native IgD or engineered IgD joints. non-human species. The present invention also provides, in certain embodiments, an immunoglobulin fusion protein with binding domain, comprising, consisting essentially of, or consisting of (a) a polypeptide with binding domain that is fused or otherwise connected to a polypeptide with immunoglobulin pivot region, wherein the polypeptide with pivot region can be as described above or herein, and can comprise, consists essentially of, or consists of, for example, a polypeptide sequence with an alternate pivot region; (b) a native or engineered immunoglobulin heavy chain constant region, such as a IgG or IgA CH2 constant region polypeptide (or a IgE CH3 constant region polypeptide) that is fused or otherwise connected to a polypeptide with pivot region, and (c) a second native or engineered immunoglobulin heavy chain constant region, such as a polypeptide with IgG or IgA CH3 constant region (or a IgE CH4 constant region polypeptide) that is fused or connected another way to the first polypeptide with constant region, where (1) the immunoglobulin fusion protein with binding domain is capable of at least one immunological activity selected from a group consisting of antibody-dependent cell-mediated cytotoxicity, CDC, and complement fixation, and (2) the polypeptide with binding domain is capable of binding or specifically binding to a target, such as an antigen.

Returning now to another embodiment, an immunoglobulin fusion protein with binding domain is provided, which comprises, consists essentially of, or consists of (a) a polypeptide with a binding domain that is fused or otherwise connected to a polypeptide with a specific region. of immunoglobulin pivot, wherein the polypeptide with binding domain is capable of binding or specifically binding to at least one target, such as an antigen, which is present on a cancer cell surface and wherein the polypeptide with pivot region it may be as described above or to u, and may comprise, consists essentially of, or consists of, for example, a polypeptide sequence with alternative pivot region; (b) a first native or engineered immunoglobulin heavy chain constant region polypeptide that is fused or otherwise connected to a polypeptide with pivot region, wherein said polypeptide with native or engineered constant region comprises, consists essentially of, or consists of, a polypeptide selected from the group consisting of a native or engineered human IgA CH2 constant region polypeptide, a native human IgG CH2 constant region polypeptide or worked with engineering and a polypeptide with human IgE CH3 constant region native or engineered; and (c) a second polypeptide with immunoglobulin heavy chain constant region that is fused or otherwise connected to the first constant region polypeptide, wherein the second polypeptide with constant region comprises, consists essentially of, or consists of, a polypeptide Which is a native or engineered human IgA CH3 constant region polypeptide, a native or engineered human IgG CH3 constant region polypeptide, or a native or engineered human IgE CH4 constant region polypeptide. In certain additional embodiments the polypeptide sequence with alternative pivot region comprises, consists essentially of, or consists of, a polypeptide sequence of at least ten continuous amino acids that are present in a sequence selected from SEQ ID NO:.

In certain embodiments, the present invention provides polynotides or vectors (including cloning vectors and expression vectors) or transformed or transfected cells, including isolated or purified or pure polynotides, vectors, and isolated transformed or transfected cells, which encode or contain any one of the polypeptides described above or aguy, or protein constructs of the invention, for example, which include immunoglobulin fusion proteins with binding domain. Thus, in various embodiments the invention provides a recombinant cloning or an expression construct comprising any such polynotide that is operably linked to a promoter.

In another embodiment, a host cell transformed or transfected with, or otherwise containing, any such recombinant cloning or expression constructs is provided. The host cells include the cells of a subject who undergoes ex vivo cell therapy which includes, for example, ex vivo gene therapy.

In a related embodiment, a method for producing a polypeptide or protein or other construct of the invention is provided, for example, which includes an immunoglobulin fusion protein with binding domain, comprising the steps of (a) culturing a host cell as the present was described or delivered under conditions that allow expression of the construct, for example, an immunoglobulin fusion protein with binding domain; and (b) isolating the construct, for example, the immunoglobulin fusion protein with host cell binding domain or host cell culture.

In another embodiment, a pharmaceutical composition comprising any one of the polypeptides or proteins described above or described herein, or other constructions of the invention, for example, is provided. (including, for example, immunoglobulin fusion proteins with binding domain), in combination with a physiologically acceptable carrier.

In another embodiment of the invention, a pharmaceutical composition is provided, comprising, for example, a isolated, purified or pure polynotide encoding any one of the polypeptides or protein constructs of the invention, for example (including, for example, immunoglobulin fusion proteins with binding domain), in combination with a physiologically acceptable carrier, or example, in combination with, or in, a vehicle or gene therapy delivery vector.

In another embodiment the invention provides a method for treating a subject having or suspected of having a malignant condition or a B cell disorder, comprising administering to a patient a therapeutically effective amount of any of the pharmaceutical compositions described or claimed herein.

In certain additional embodiments the malignant condition or B-cell disorder is a B-cell lymphoma or a B-cell leukemia, or a disease characterized by the production of antibody, and in certain other modalities the B-cell disorder is, for example , rheumatoid arthritis, myasthenia gravis, Grave's disease, diabetes mellitus type I, multiple sclerosis or an autoimmune disease. In certain other modalities the malignant condition is, for example, melanoma, myeloma, glioma, astrocytoma, lymphoma, leukemia, carcinoma, or sarcoma, and so on.

It is an aspect of the present invention to provide an immunoglobulin fusion protein with binding domain, comprising, consisting essentially of, or consisting of, (a) a polypeptide with binding domain that is fused or otherwise connected to a polypeptide with immunoglobulin pivot region, wherein said polypeptide with pivot region is as described herein, and may be selected from the group consisting of (i) a polypeptide with a mutated pivot region, engineered or otherwise altered contains no cysteine residues and is derived from the polypeptide having a wild-type immunoglobulin pivot region having one or more cysteine rediches, (ii) a polypeptide with a mutated, engineered or otherwise altered pivot region containing a cysteine residue that is derived from the wild-type immunoglobulin pivot region polypeptide having two or more cysteine residues, (iii) a polypeptide with wild-type human IgA pivot region, (iv) a polypeptide with human IgA pivot region mutated, engineered or altered from another form that does not contain cysteine residues, (v) a polypeptide with human IgA pivot region mutated, engineered or altered in another way that contains a cysteine residue and (vi) a polypeptide with human igA pivot region mutated, worked engineered or altered in another way that contains two cysteine residues; (b) a native or engineered immunoglobulin heavy chain CH2 constant region polypeptide that is fused or otherwise connected to the polypeptide with pivot region; and (c) a native or engineered immunoglobulin heavy chain CH3 constant region polypeptide that is fused or otherwise connected to a CH2 constant region polypeptide, wherein (1) the immunoglobulin domain fusion protein is The binding is capable of at least one immunological activity selected from the group consisting of antibody-dependent cell-mediated cytotoxicity and complement fixation and (2) the polypeptide with binding domain is capable of binding or specifically binding to an antigen. In one embodiment the polypeptide with immunoglobulin pivot region is a polypeptide with a mutated pivot region, for example, and the resulting constructs exhibit a reduced capacity of dimerizing, in relation to a construct containing a polypeptide with wild-type human immunoglobulin G pivot region. In another embodiment, the polypeptide with binding domain comprises, consists essentially of, or consists of, at least one native or engineered immunoglobulin variable region polypeptide that is a native or engineered immunoglobulin light chain variable region polypeptide. and / or a native or engineered immunoglobulin heavy chain variable region polypeptide. In a further embodiment the native or engineered immunoglobulin variable region polypeptide is derived from human immunoglobulin and, for example, can be humanized.

In another embodiment, the invention provides an immunoglobulin fusion protein with binding domain that includes a polypeptide with binding domain comprising, consisting essentially of, or consisting of, (a) at least one polypeptide with light chain variable region of native or engineered immunoglobulin; (b) at least one native or engineered immunoglobulin heavy chain variable region polypeptide; and (c) at least one linker peptide that is fused or otherwise connected to the polypeptide of (a) and the polypeptide of (b). In a further embodiment, the light chain variable region of native or engineered immunoglobulin and the native or engineered heavy chain variable region polypeptides are derived from human immunoglobulins and can, for example, be humanized.

In another embodiment at least one polypeptide with engineered or engineered immunoglobulin heavy chain CH2 (or IgE CH3) constant region and the native or engineered immunoglobulin heavy chain CH3 (or Ig? CH4) constant region polypeptide is it is derived or constructed from a heavy chain of human immunoglobulin. In another embodiment, the CH2 and CH3 polypeptides with native or engineered immunoglobulin heavy chain constant region are from, or are derived from, or otherwise prepared from or constructed of, a selected isotype of human IgG and human IgA. In another embodiment the target, for example, the target antigen is selected from the group consisting of CD16, CD19, CD20, CD37, CD40, CD45RO, CD80, CD86, CD137, CD152 and L6. In certain additional embodiments of the fusion protein constructs described above, the binding domain comprises, consists essentially of, or consists of, a scFv and the scFv contains a linker polypeptide comprising, consisting essentially of, or consisting of, at least a polypeptide comprising or having an amino acid sequence Gly-Gly-Gly-Gly-Ser [SEQ ID NO: _], and in certain other embodiments the linking polypeptide comprises, consists essentially of, or consists of, at least three repeats of a polypeptide having an amino acid sequence Gly-Gly-Gly-Gly-Ser [SEQ ID NO: _]. In certain embodiments, the polypeptide with immunoglobulin pivot region comprises, consists essentially of, or consists of, a native or engineered native IgG, IgA, IgG pivot region polypeptide, or a polypeptide with native or worked IgE CH2 region. with engineering. In certain embodiments, the polypeptide with binding domain comprises, consists essentially of, or consists of, a native or engineered CD154 extracellular domain. In certain embodiments the polypeptide with binding domain comprises, consists essentially of, or consists of, an extracellular domain CD154 native or engineered and at least one polypeptide with variable region of native or engineered immunoglobulin.

In other embodiments, the invention provides an isolated polynucleotide that encodes any of the constructions of the invention, for example, the protein or polypeptide constructs of the invention that include immunoglobulin fusion proteins with binding domain, and in embodiments related to the invention. provides a recombinant expression construct comprising such a polynucleotide, and in certain additional embodiments the invention provides a host cell transformed or transfected with, or otherwise containing such a recombinant expression construct. In another embodiment the invention provides a method for producing a construct of the invention, for example, a protein or a polypeptide construct of the invention such as the immunoglobulin fusion protein with binding domain, comprising the steps of (a) culturing a host cell that has been transformed or transfected with, or otherwise made to contain, a polynucleotide construct of the invention under conditions that allow the expression of the construct, for example, a construct encoding an immunoglobulin fusion protein with binding domain; and (b) isolating the construct, e.g., the immunoglobulin fusion protein with binding domain, from the host cell culture.

The invention described and claimed herein includes novel molecules useful, for example, as therapy and for other purposes that include diagnostic and research purposes. Such molecules have, for example, antigen binding or other binding functions and one or more effector functions. The DNA constructs of the invention are useful in, for example, gene therapies, including gene therapies in vivo and ex vivo.In one aspect, the various molecule constructions of the invention include molecules that comprise a "binding region," a "tail" region, and a "connecting" region that binds to a binding region and a tail region. .

The binding regions within the molecules of the invention may comprise, for example, binding domains for the desired objectives, which include the antigen binding targets. The binding domains for targets that bind to the antigen may comprise, for example, a single chain Fvs and a scFv domain. In certain embodiments, the molecules of the invention may comprise a binding region having at least one immunoglobulin variable region polypeptide, which may be a variable polypeptide of light chain or heavy chain. In certain embodiments, the molecules of the invention may comprise at least one of such light chain V regions and one such heavy chain V region and at least one linker peptide connecting the V regions. The ScFvs useful in the invention also include those with chimeric binding or other domains or sequences. Other ScFvs useful in the invention also include those with humanized binding or other domains or sequences. In such embodiments, all or a portion of an immunoglobulin binding or other sequence that is derived from the non-human source can be "humanized" according to methods recognized to generate humanized antibodies, ie, immunoglobulin sequences in which the sequences Human Ig are introduced to reduce the degree to which the human immune system would perceive such proteins as foreign.

Examples of scFvs useful in the invention, whether included as murine or other scFvs (including human scFvs), chimeric scFvs, or humanized scFvs, in whole or in part include anti-human CD20 scFvs (eg, scFvs "2H7"), scFvs CD37 anti-human (e.g., scFvs "G28-1"), anti-human CD40 scFvs (e.g., scFvs "G28-5" and scFvs "40.2.220"), antigen scFvs associated with carcinoma (e.g., scFvs) "L6"), anti-CTLA-4 (CD152) scFvs (for example, "10A8" scFvs), anti-human CD28 scFvs (eg, "2E12" scFvs), anti-murine CD3 scFvs (e.g., scFvs " 500A2"), anti-human CD3 scFvs (eg, scFvs G19-4), anti-murine 4-lBB scFvs (eg, scFvs" 1D8"), anti-human scFvs 4-1BB (eg, scFvs" 5B9"), Anti-human CD45RO (e.g., scFvs" UCHL-1"), and anti-human CD16 (e.g., scFvs" Fc2").

The scFvs useful in the invention also include scFvs that include chimeric and humanized scFvs, which have one or more amino acid substitutions. A preferred amino acid substitution is the position of amino acid 11 in the variable heavy chain (the VH). Such substitution can be preferred here as "XxxVHllZxx". Thus, for example, when the amino acid of normal occurrence at the VH11 position is a Leucine, and an amino acid residue Serine is substituted therefore, the substitution is identified as "L VH11S" or "Leu VHHSer". Other preferred embodiments of the invention include molecules containing scFvs in which the amino acid residue normally found in the VH11 position is deleted. Still other additional embodiments of the invention include molecules containing scFvs in which the amino acid residues normally found at the VH10 and / or VH11 and / or VH12 positions are substituted or deleted.

Other binding regions within the molecules of the invention may include domains comprising sites for glycosylation, for example, covalent attachment of carbohydrate moieties such as monosaccharides or oligosaccharides.

Still other regions of attachment within molecules of the invention include polypeptides that may comprise proteins or portions thereof that retain the capacity to specifically bind to another molecule, including an antigen. Thus, the binding regions can comprise or be derived from hormones, cytokines, chemokines, and the like; the surface of the cell or the soluble receptors for such polypeptide ligands; lectins; intercellular adhesion receptors such as specific leukocyte integrins, selectins, members of the immunoglobulin gene superfamily, intercellular adhesion molecules (ICAM-1, -2, -3) and the like .. Histocompatibility antigens; and so on. The binding regions derived from such portions will generally include thoss portions of molecules required or desired for attachment to a target.

Certain constructs include binding regions comprising receptors or receptor binding domains. Receptor domains useful for binding to a target include, for example, an extracellular domain CD154, or an extracellular domain CTLA-4. In another example, the binding domain can include a first portion comprising, consisting essentially of, or consisting of, an extracellular domain CD154 and a second portion comprising, consisting essentially of, or consisting of, at least one variable immunoglobulin region polypeptide, said second portion includes, for example, a scFv or a VH. Examples of other cell surface receptors that may comprise, consist essentially of, or consist of, or a portion of which may provide, a binding region or a polypeptide with binding domain, include, for example, HERI, HER2, HER3, HER4, epidermal growth factor receptor (EGFR), vascular endothelial cell growth factor, vascular endothelial cell growth factor receptor, insulin-like growth factor I, insulin-like growth factor II, transferrin receptor, receptor estrogen, progesterone receptor, follicle stimulating hormone receptor (FSH-R), retinoic acid receptor, MUC-1, NY-ESO-1, Melan-A / MART-1, tyrosinase, Gp-100, MAGE, BAGE , GAGE, any of the CTA classes of receptors that include in particular the HOM-MEL-40 antigen encoded by the SSX2 gene, carcinoembionic antigen (CEA), and PyLT. Additional cell surface receptors that can be sources of binding regions or polypeptides with binding domains include, for example, CD2, 4-lBB, ligand 4-1BB, CD5, CD10, CD27, CD28, CD152 / CTLA-4, CD40, interferon? (IFN-?), interleukin-4 (IL-4), interleukin-17 (IL-17) and interleukin-17 receptor (IL-17R). Still other cell surface receptors which can be sources of binding regions and / or polypeptides with binding domain include, for example, CD59, CD48, CD58 / LFA-3, CD72, CD70, CD80 / B7.1, CD86 / B7.2, B7-H1 / B7-DC, IL-17, CD3, ICOS, CD3 (e.g., gamma subunit, epsilon subunit, delta subunit), CD4, CD25, CD8, CDllb, CD14, CD56, CD69 and VLA-4 (ß7). The following cell surface receptors are typically associated with B cells: CD19, CD20, CD22, CD30, CD153 (ligand CD30), CD37, CD50 (ICAM-3), CD106 (VCAM-1), CD54 (ICAM-1), interleukin-12, CD134 (OX40), CD137 (41BB), CD83, and DEC-205. These lists are not exhaustive. The binding regions such as those set forth above may be connected, for example, by a native or engineered IgD 'pivot region polypeptide, preferably a polypeptide with IgD pivot region native or engineered with human or humanized engineering. The invention thus further provides constructs comprising, consisting essentially of, or consisting of, two binding regions, for example a scFv and a cell surface receptor (or portion thereof), connected by a third molecule, by example, a polypeptide with IgD pivot region as described herein.

Several molecules of the invention described and claimed herein include a connection region that joins one end of the molecule to another end. Such connection regions may comprise, for example, polypeptides with immunoglobulin pivot region, which include any naturally occurring pivot peptide or polypeptide. A connection region may also include, for example, any artificial peptide or other molecule (including, for example, non-peptide molecules, partial peptide molecules, and peptidomimetics, etc.) useful for joining the tail region and the region of Union. These may include, for example, alterations of molecules located in an immunoglobulin heavy chain polypeptide between the amino acid residues responsible for forming intrachain chain immunoglobulin domain disulfide bonds in CH1 and CH2 regions. Naturally occurring pivot regions that include those located between constant region domains, CH1 and CH2, of an immunoglobulin. Useful polypeptides of immunoglobulin pivot region include, for example, polypeptides of human immunoglobulin pivot region and flame immunoglobulin pivot region polypeptides or other camelid. Other useful polypeptides of immunoglobulin pivot region include, for example, nurse shark and spotted rat fish immunoglobulin pivot region polypeptides. Human immunoglobulin pivot region polypeptides include, for example, wild-type IgG linkages that include wild-type human IgG1 joints, immunoglobulin pivot region polypeptides derived from human IgG, a portion of a human igG pivot or a pivot region of IgG-derived immunoglobulin, wild-type human IgA pivot region polypeptides, human IgA-derived immunoglobulin pivot region polypeptides, a portion of a human IgA pivot region polypeptide or an immunoglobulin pivot region polypeptide derived from IgA, wild-type IgD pivot region polypeptides, immunoglobulin pivot region polypeptides derived from human IgD, a portion of a human IgD pivot region polypeptide or an immunoglobulin pivot region polypeptide derived from IgD, region of action of wild-type human IgE pivot, ie IgE region polypeptides CH2 (which generally have 5 cysteine residues), immunoglobulin pivot region polypeptides derived from human IgE, a portion of a human igE pivot action region, i.e., an IgE CH2 region polypeptide or a derived immunoglobulin pivot region polypeptide of IgE, and so on. A polypeptide "derived from" or that is "a portion or fragment of" an immunoglobulin polypeptide chain region considered to have a pivot function has one or more peptide bond amino acids, for example 15-115 amino acids, preferably 95 -110, 80-94, 60-80, or 5-65 amino acids, preferably 10-50, more preferably 15-35, still more preferably 18-32, still more preferably 20-30, even more preferably 21, 22, 23 , 24, 25, 26, 27, 28, or 29 amino acids. The flame immunoglobulin pivot region polypeptides include, for example, a flame pivot IgGl. The connection region may comprise a strip of consecutive amino acids of an immunoglobulin pivot region. For example, the connection region may comprise at least five consecutive pivotal region amino acids, at least ten consecutive pivotal region amino acids, at least fifteen consecutive pivotal region amino acids, at least 20 consecutive pivotal region amino acids, and to the minus twenty-five or more consecutive pivotal region amino acids of human IgG pivot, human igA pivot, human IgE pivot, camelid pivot region, IgGl flame pivot region, nurse shark pivot region, and rat fish pivot region stained, which includes for example a pivot region IgGi, a pivot region IgG2, a pivot region IgG3, a pivot region IgG3, and an pivot region IgG.

Such connection regions also include, for example, immunoglobulin pivot region polypeptides mutated or otherwise altered or engineered. A polypeptide with immunoglobulin pivot region mutated or otherwise altered or engineered can comprise, consists essentially of, or consists of, a pivot region that has its origin in an immunoglobulin of a species, an isotype or a class of immunoglobulin, or a subclass of immunoglobulin that is the same as or different from that of either including the CH2 and CH3 domain native or engineered. Immunoglobulin pivot region polypeptides mutated or otherwise altered or engineered include those derived or constructed from, for example, wild-type immunoglobulin pivot region containing one or more cysteine residues, for example, an IgG pivot region or wild type human IgA naturally comprising three cysteines. In such polypeptides the number of cysteine residues can be reduced by amino acid substitution or deletion or truncation, for example. These polypeptides include, for example, human IgGl or IgG4 pivot region polypeptides mutated or other containing zero, one, or two cysteine residues, and human IgAl or IgA2 pivot region polypeptides mutated or other containing zero, one, or two cysteine residues. Immunoglobulin pivot region polypeptides mutated or otherwise altered or engineered include those derived or constructed from, for example, wild-type immunoglobulin pivot region containing three or more cysteine residues, eg, a region of pivot human wild type IgG2 (which has 4 cysteines) or pivot region IgG4 (which has 11 cysteines). Immunoglobulin pivot region polypeptides mutated or otherwise altered or engineered include those derived or constructed of, for example, an immunoglobulin region wild type IgE CH2 which generally contains five cysteine residues. In such polypeptides the number of cysteine residues can be reduced by one or more cysteine residues by substitution or deletion or truncation of amino acid, for example. Also included are altered pivot region polypeptides in which the cysteine residues of the pivot region are substituted with serine or one or more amino acids which are less polar, less hydrophobic, more hydrophilic, and / or neutral. Such mutated immunoglobulin pivot region polypeptides include, for example, mutated pivot region polypeptides that contain a cysteine residue that are polypeptide derivatives with a wild-type immunoglobulin pivot region having two or more cysteine residues, such as a mutated human IgG or igA pivot region polypeptide containing a cysteine residue that is derived from the wild-type human IgG or IgA region polypeptide. The link region polypeptides include immunoglobulin pivot region polypeptides which are compromised in their ability to form interchain homodimeric disulfide bonds.

The mutated immunoglobulin pivot region polypeptides also include mutated pivot region polypeptides that exhibit a reduced ability to dimerize, relative to wild-type human immunoglobulin pivot region G polypeptide, and mutated pivot region polypeptides that allow the expression of a mixture of monomeric and dimeric molecules. The mutated immunoglobulin pivot region polypeptides also include pivot region polypeptides engineered to contain a glycosylation site. Glycosylation sites include, for example, an asparagine-linked glycosylation site, an O-linked glycosylation site, a C-mannosylation site, a glypiation site, and a phosphoglycation site.

Specific connection regions useful in molecules of the invention described and claimed herein include, for example, the following 18 amino acid sequences, DQEPKSCDKTHTCPPCPA, DQEPKSSDKTHTSPPSPA, Y DLEPKSCDKTHTCPPCPA. Other specific connection regions include, for example, mutant joints within the sequences referred to as "2H7 scFv (SSS-S)" WCH2 WCH3"and" 2H7 scFv (CSS) H WCH2 WCH3", and the human IgA-derived pivot referred to herein as" 2H7 scFv IgAH WCH2 WCH3".

The tail regions within the molecules of the invention may include heavy chain constant region immunoglobulin sequences. The tail regions may include, for example, a polypeptide having at least one immunoglobulin heavy chain CH2 constant region polypeptide and an immunoglobulin heavy chain CH3 constant region polypeptide. At least one of the immunoglobulin heavy chain constant region CH2 polypeptides and the immunoglobulin heavy chain CH3 constant region polypeptide derived from a human immunoglobulin heavy chain. Thus, for example, the CH2 and / or CH3 polypeptides can be derived from molecules of human igG, human IgA, human IgD. The tail regions may also include, for example, a polypeptide having at least one immunoglobulin heavy chain CH3 constant region polypeptide and an immunoglobulin heavy chain CH4 constant region polypeptide. At least one of the immunoglobulin heavy chain CH3 constant region polypeptides and the Immunoglobulin heavy chain CH4 constant region polypeptide can be derived from a human immunoglobulin heavy chain. Thus, for example, the CH3 and / or CH4 polypeptides can be derived from human IgE. An immunoglobulin heavy chain CH2 region polypeptide included within the molecule of the invention can, for example, be subclasses of IgG1, IgG2, IgG3 and / or IgG4. An immunoglobulin heavy chain CH3 region polypeptide included within the molecule of the invention can, for example, be of the subclasses IgGl, IgG2, IgG3 and / or IgG4. Additionally, both the immunoglobulin heavy chain CH2 polypeptide and the immunoglobulin heavy chain CH2 region polypeptide included within a molecule of the invention can, for example, be subclasses of IgG1, IgG2, IgG3 and / or IgG4. . In other molecules of the invention at least one of the immunoglobulin heavy chain constant region polypeptides selected from a CH2 constant region polypeptide and a CH3 constant region polypeptide is a human IgA constant region polypeptide. An immunoglobulin heavy chain CH2 region polypeptide included within a molecule of the invention can, for example, be of the igAl subclasses and / or IgA2. An immunoglobulin heavy chain CH3 region polypeptide included within a molecule of the invention can also, for example, be of the IgA1 and / or IgA2 subclasses. Additionally, both the immunoglobulin heavy chain CH2 polypeptide and the immunoglobulin heavy chain CH2 region polypeptide included within a molecule of the invention can, for example, be of the IgA1 and / or IgA2 subclasses. In yet other molecules of the invention, the tail region may comprise or consist essentially of a CH2 and / or CH3 constant region polypeptide comprising a human IgA and / or human IgE polypeptide. In other embodiments, for example, the tail region within the molecule of the invention may include an immunoglobulin heavy chain CH2 and / or CH3 constant region polypeptide that is mutated (e.g., a mutated CH3 igA constant region polypeptide which is capable of associating with a J chain in which, for example, the IgA CH3 constant region polypeptide is of human origin). The tail region may also comprise, consists essentially of, or consists of an extracellular portion of a protein derived from the TNF superfamily, eg, CD154.

For molecules of the invention intended for use in humans, these regions will typically be substantially or completely human to minimize potential human immune responses against the molecules and provide appropriate effector functions. In certain embodiments of the invention, for example, the tail region includes a human IgGl CH3 region sequence, a wild type IgA heavy chain constant region polypeptide sequence which is capable or incapable of associating with the J chain.

In preferred embodiments of the invention, a CH1 domain is not included in the tail region of the molecule, and the carboxyl terminus of the binding region is linked to an amino terminus of the CH2 portion of the direct or tail region. indirectly. A binding region may be indirectly linked to a tail region, for example via a link region polypeptide or other linker molecule.

The invention also includes molecules having mutated CH2 and / or CH3 sequences within a region of tail. For example, a molecule of the invention can include a mutated Fe domain having one or more mutations introduced into the CH2, CH3 and / or CH domains. In certain embodiments of the invention, the molecules can include a IgA CH3 constant region polypeptide such as a human IgA CH3 constant region polypeptide in which two or more residues from the C-terminus have been deleted to produce a CH3 constant region polypeptide. truncated. In other embodiments of the invention, the molecules include a mutant human IgA CH3 constant region polypeptide that is capable of associating with a J chain comprising a C terminal deletion of either four or 18 amino acids. However, the invention needs to be limited so that the molecules containing the mutated constant region IgA CH3 polypeptide can comprise a deletion of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-25, 26-30 or more amino acids, whereas the fusion protein is capable of specifically binding to an antigen and capable of at least such immunological activity. as ADCC, CDC or complement fixation. The invention also includes molecules that contain a tail region comprising a mutated IgA CH3 constant region polypeptide that is unable to associate with a J chain by virtue of the replacement of the penultimate cysteine, or by chemical modification of that amino acid residue, in a manner that prevents the formation of interchain disulfide bonding.

Several molecules of the invention include, for example, a scFv fusion protein with binding domain having a polypeptide with binding domain comprising, consisting essentially of, or consisting of (a) at least one polypeptide with light chain variable region. of immunoglobulin, (b) at least one immunoglobulin heavy chain variable region polypeptide, and at least one linker peptide that binds to the polypeptide of (a) and the polypeptide of (b).

Such polypeptides can, for example, be derived from human immunoglobulins or non-human immunoglobulins.

Thus, in one aspect, the invention includes a non-naturally occurring single chain protein and / or a VH protein and / or a VL protein, or a desired portion of any of the foregoing, which includes a first polypeptide comprising a polypeptide with binding domain capable of binding to a target molecule, a second polypeptide comprises a flexible or other desired linker linked to said first polypeptide, a third polypeptide comprising a tail region, for example, an N-terminal truncated immunoglobulin heavy chain constant region polypeptide (or desired portion thereof) attached to a second polypeptide. The flexible linker may comprise, consists essentially of. or consists of an immunoglobulin pivot region or portion thereof that has been mutated or otherwise altered or engineered, for example, one containing a number of cysteine residues that is less than the number of cysteine residues present in the wild-type immunoglobulin pivot region or portion (eg, zero, one, or two cysteines in the case of IgG1 or IgG4), and wherein said non-naturally occurring single chain protein is capable of at least one activity immunological, for example, ADCC, CDC, and / or complement fixation. The single chain protein may be capable of two immunological activities _ including, for example, ADCC, CDC, and / or complement fixation. This protein can include a peptide with binding domain that is a single chain Fv. Additionally, this protein can include a peptide with binding domain that is a single chain Fv wherein the heavy chain variable region of the single chain Fv has a deletion or amino acid substitution at one or more of the amino acid positions 9, 10, 11, 12, 108, 110, and 112. The protein may also include a polypeptide with binding domain which is a single chain Fv wherein the variable region Single chain Fv light chain has a deletion or substitution of amino acids at one or more of amino acid positions 12, 80, 81, 83, 105, 106, and 107.

In another aspect, the invention includes a non-naturally occurring VH protein, or a desired portion thereof, which comprises, consists essentially of, or consists of, alone or in combination with any other molecule or construct, a VH region or portion thereof. it having an amino acid deletion or substitution at one or more of amino acid positions 9, 10, 11, 12, 108, 110, and 112 of said VH region. The amino acids can be substituted with naturally occurring or unnatural occurrences of amino acids, or any other desired useful molecules.

Also described or claimed are uses of VH proteins, or desired portions thereof, which comprise, consist essentially of, or consist of, alone or in combination with any other molecule or construct, a VH or portion thereof having an amino acid deletion or substitution at one or more of amino acid positions 9, 10, 11, 12, 108, 110, and 112 of said VH region. Such uses include uses in systems and methods of phage display, yeast deployment, and deribosome deployment.

In yet another aspect, the invention includes a non-naturally occurring VL protein, or a desired portion thereof, which comprises, consists essentially of, or consists of, alone or in combination with any other molecule, a VL region or portion thereof. having an amino acid deletion or substitution at one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107 of said VL region. The amino acids can be substituted with any naturally occurring or unnatural amino acid, or any other desired useful molecule.

Also described and claimed are uses of VL proteins, or desired portions thereof, which comprise, consist essentially of, or consist of, alone or in combination with another molecule, a V region or portion thereof having an amino acid deletion or substitution. in one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107 of said VL region. Such uses include uses in systems and methods of phage display, yeast deployment, and ribosome deployment.

In yet another aspect, the invention includes a molecule comprising, consisting essentially of, or consisting of, (1) a VH protein, or a desired portion thereof, wherein the VH protein or portion thereof has a deletion or substitution. of amino acid at one or more of amino acid positions 9, 10, 11, 12, 108, 110, and 112, and (2) a non-naturally occurring VH protein, or desired portion thereof, alone or in combination with any another molecule, wherein the V protein or portion thereof has an amino acid deletion or substitution at one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107. The amino acids may be substituted with any of the amino acids of natural or non-natural occurrence, or any other desired useful molecule.

Also described and claimed are uses of a molecule comprising, consisting essentially of, or consisting of, (1) a VH protein, or a desired portion thereof, wherein the VH protein or portion thereof has a deletion or amino acid substitution at one or more of amino acid positions 9, 10, 11, 12, 108, 110, and 112, and (2) an unnaturally occurring VL protein, or desired portion thereof, alone or in combination with any other molecule, wherein the VL protein or portion thereof has an amino acid deletion or substitution at one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107. Such uses include uses in systems and methods of phage display, yeast deployment, and ribosome display.

The invention also includes molecular constructs wherein the binding domain is a single chain Fv and the heavy chain variable region of said single chain Fv has an amino acid substitution at the position of amino acid 11. The amino acid substituted for the amino acid of the position of 11 of the heavy chain variable region of the single chain Fv can be selected from the group consisting of serine, threonine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine, and histidine. The invention thus includes for example, a construction wherein the binding domain is a single chain Fv and the heavy chain variable region of said single chain Fv it has an amino acid substitution serine at amino acid position 11. Other amino acid position changes, substitutions, and deletions are noted here.

The invention also includes, for example, a construct wherein the binding domain is a single chain Fv and the amino acid at position 10 and / or 11 of the heavy chain variable region of said single chain Fv has been deleted.

In another aspect, the invention includes constructs wherein the binding region binds to a tumor or an antigen associated with tumor. The binding region of a construct of the invention can be linked, for example, to a cancer cell antigen. Cancer cell antigens to which the constructs of the invention bind include cancer cell surface antigens and intracellular cancer cell antigens.

In yet another aspect, the invention includes a construct wherein the binding region binds to an antigen in immune effector cell.

In another aspect, the invention includes a construct wherein the binding region binds to a B cell antigen that includes, for example, a B cell antigen selected from the group consisting of CD19, CD20, CD22, CD37, CD40, CD80, and CD86. Constructs of the invention that bind to such B cell antigens include, for example, junction regions comprising a single chain Fv. Examples of such single chain Fv binding regions include molecules that comprise or consist essentially of single chain Fvs selected from the group consisting of single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, and Single chain Fv 4.4.220. Other examples include a binding region comprising, consisting essentially of, or consisting of, an extracellular domain of CTLA-4.

In another aspect, the invention includes a construct wherein the binding region binds to a B cell differentiation antigen. B cell differentiation antigens include, for example, CD19, CD20, CD21, CD22, CD23, CD37, CD40, CD45RO, CD80, CD86 and HLA class II.

In another aspect, the invention includes a construct wherein the binding regions are linked to a target selected from the group consisting of CD2, CD3, CD4, CD5, CD6, CD8, CD10, CD14, CD14, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD28, CD30, CD37, CD40, CD43, CD50 (ICAM3), CD54 (ICAM1), CD56, CD69, CD80, CD86, CD134 (OX40), CD137 (41BB), CD152 (CTLA- 4), CD153 (ligand CD30), CD154 (ligand CD40), ICOS, L6, B7-H1, and HLA class II.

The invention also includes protein constructs having a binding region, a tail region, and a connection region, wherein the protein construct is capable of existing in solution as a monomer or in substantially monomeric form.

The invention also includes protein constructs which have a binding region, a tail region, a connection region, wherein the protein construct is capable of forming a complex comprising two or more of said protein constructs including, for example, example, wherein said complex is a dimer.

In another aspect, the constructs of the invention are capable of participating in or inducing or eliciting or helping to induce or elicit, directly or indirectly, at least one immunological activity selected from the group consisting of antibody-mediated cell-dependent cytotoxicity, dependent cytotoxicity. of complement (or complement-mediated lysis), complement fixation, induction of apoptosis, induction of one or more biologically active signals, induction of one or more immune effector cells, activation of cell differentiation, cellular activation, release of one or more molecules biologically active, and neutralization of an infectious agent or toxin.

In another aspect, the binding constructs of the invention are capable of induction of biologically active signals by the activation or inhibition of one or more molecules selected from the group consisting of protein kinases, protein phosphatases, G-proteins, cyclic nucleotides or other seconds. messengers, ion channels, and components of secretory paths. Such biologically active molecules are, for example, proteases. Other biologically active molecules are, for example, cytokines, which include by way of example monoguins, lymphoguins, guimioguins, growth factors, factors of colony stimulants, interferons, and interleukins.

In another aspect, the constructs of the invention are capable of induction, or participation in the induction, of one or more immune effector cells selected from the group consisting of NK cells, monocytes, macrophages, B cells, T cells, mast cells, neutrophils, eosinophils, and basophils.

In another aspect, the constructs of the invention are capable of induction, or participation in the induction, of one or more immune effector cells that result in antibody-dependent cell-mediated cytotoxicity or the release of one or more biologically active molecules.

In another aspect, the constructs of the invention are capable of participating in and / or initiating apoptosis with target cells, for example, by activating one or more signaling molecules or mechanisms.

In another aspect, the constructions of the invention are capable of induction, or participation in the induction, of cellular activation, wherein said activation leads to changes in cellular transcriptional activity. In one embodiment, the cellular transcriptional activity increases. In another embodiment, the cellular transcriptional activity is decreased.

In another aspect, the constructs of the invention having tail regions comprising, consisting essentially of, or consisting of, constant regions of IgA or IgE molecules, are capable of induction or participation in the induction of degranulation of neutrophils and / or mast cells. .

In another aspect, the constructions of the invention are capable of promotion, or participation in the promotion of neutralization of an infectious agent, wherein said infectious agent is, for example, a bacterium, a virus, a parasite, or a fungus.

In another aspect, the constructs of the invention are capable of promoting, or participating in the promotion of, toxin neutralization, wherein said toxin is selected from the group consisting of endotoxins and exotoxins. Such toxins include, for example, exotoxins selected from the group consisting of anthrax toxin, cholera toxin, diphtheria toxin, pertussis toxin, heat-labile toxin of E. coli LT, heat-stable toxin of E. coli ST, toxin. shiga Pseudomonas exotoxin A, botilinum toxin, tetanus toxin, Bordetella pertussis AC toxin, and Bacillus anthracis EF toxin. Other toxins include, for example, saxitoxins, tetrodotoxins, mushroom toxins (amatoxins, gyromitrin, orelanin, etc.), aflatoxins, pyrrolizidine alkaloids, phytohemagglutinins, and grayanotoxins.

In another aspect, the constructs of the invention are capable of binding an intracellular target to, for example, effecting (or participating in effecting) a cellular function. Such constructions include, for example, constructs that include a tail region comprising, consisting essentially of, or consisting of, a native or engineered CH2 IgA domregion and a region of IgA CH3 domnative or engineered, said tail region is capable of binding to the J ch Such a tail region is found, for example, in the 2H7 scFv IgAH WlgACH2 WCH3 + Cadena J. construction. Thus, the invention includes constructions which have, for example, a binding dom"Anti-Intracellular Target" (for example, and "Anti-Intracellular Objective" scFv), a connection region, and a native or engineered IgA constant region capable of binding to the string J (for example, WlgACH2 WCH3).

In yet another aspect, the constructs of the invention include a molecule wherein a N-terminal immunoglobulin heavy chconstant region polypeptide comprises a CH2 IgG constant region polypeptide bound to a immunoglobulin heavy chIgG CH3 constant region polypeptide. .

In yet another aspect, the invention includes a method for reducing a target cell population in a subject comprising administering to said subject a therapeutically effective amount of a protein molecule that is less than about 120 kK. or less than about 150 kD, measured, for example, by HPLC and non-reducing gels and consisting essentially of (a) a first protein or peptide molecule that is capable of binding to cells within said target cell population, and (b) a second peptide or protein molecule that is capable of (i) binding to a Fe receptor and / or (ii) inducing target cell apoptosis and / or (iii) attaching complement, wherein said first protein molecule or peptide is directly connected to said second protein or peptide molecule, or , optionally said first protein or peptide molecule and said second protein or peptide molecule are linked by a third protein or peptide molecule, wherein said protein molecule is not an antibody, a member of the TNF family or the TNF receptor family , and is not conjugated with a bacterial toxin, a cytotoxic drug, or a radioisotope.

In another aspect, the invention also includes single chproteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding dompolypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C terminus of said first polypeptide; and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chconstant region polypeptide attached to the C-terminus of said second polypeptide, wherein said single chain protein is capable of at least one immunological activity, and so long as that (a) when the connecting region polypeptide comprises an IgG pivot region polypeptide having no cysteine residues, the goal of Binding domain polypeptide is not CD20 or L6, or (b) when the polypeptide of the connecting region comprises an IgG connection region polypeptide that has no cysteine residues, the single chain protein is not a 1F5 scFv capable of join the CD20. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said first polypeptide; and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide attached to the C-terminus of said second polypeptide, wherein said second chain protein is capable of binding to a target molecule on or in a target cell and decreasing the number of target cells in vivo and / or depleting a target cell population in vivo. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, (ii) a second polypeptide comprising a connecting region attached to the C-terminus of the first polypeptide; and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide attached to the C-terminus of said second polypeptide, wherein said single chain protein is capable of inducing cell-mediated cytotoxicity dependent on antibody and complement fixation. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said first polypeptide; and (iii) a third polypeptide comprising a chain constant region polypeptide of N-terminal truncated immunoglobulin bound to the C-terminus of said second polypeptide, wherein said single-chain protein is capable of (1) inducing antibody-mediated cell-mediated cytotoxicity and complement fixation, and (2) binding to a molecule target on or in a target cell and decrease the number of target cells in vivo and / or by depleting the target cell population in vivo. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said first polypeptide; and (iii) a third polypeptide comprising a N-terminal truncated immunoglobulin heavy chain constant region polypeptide linked to the C-terminus of said second polypeptide, wherein said connecting region comprises an IgG pivot region polypeptide having at least first, second, and third cysteine residues, said first cysteines are N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted and wherein said single chain protein is capable of at least one immunological activity. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a binding region attached to a C-terminus of said first polypeptide, and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide linked to the C- terminal of said second polypeptide, wherein when said connecting region comprises an IgG pivot region polypeptide having at least first, second, and third cysteine residues, said first cysteines are N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted, and wherein said single chain protein is capable of inducing at least one immunological activity selected from (a) cytotoxicity mediated by antibody dependent cell and (b) complement fixation. The invention also includes single chain proteins that comprise, consist essentially of, or consist of, (i) a first polypeptide which has a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said polypeptide; and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide attached to the C-terminus of said second polypeptide, wherein said connecting region comprises an IgG pivot region polypeptide having the less first, second and third cysteine residues, said first cysteines are N-terminal to said second cysteines and said second cysteines are N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted, and wherein said single chain protein is capable of antibody-dependent cell-mediated cytotoxicity and complement fixation. The invention also includes single chain protein comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a binding region attached to the C-terminus of said first polypeptide, and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide attached to the C-terminus of said second polypeptide, wherein when said connecting region comprises an IgG pivot region polypeptide at least first, second, and third cysteine residues, said first cysteine is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted, and wherein said single chain protein is capable of binding to a target molecule on or in a target cell and decreasing the number of target cells in vivo and / or depleting a target cell population in vivo. The invention also includes single chain protein comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said first polypeptide; and (iii) a third polypeptide comprising a chain constant region polypeptide of N-terminal truncated immunoglobulin bound to the C-terminus of the second polypeptide, wherein when said connection region comprises an IgG pivot region polypeptide having at least first, second and third cysteine residues, said first cysteine is N- terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted, and wherein a single chain protein is capable of inducing at least one activity immunological selected from antibody-dependent cell-mediated cytotoxicity and complement fixation, and wherein said single chain protein is capable of binding to a target molecule on or in a target cell and decreasing the number of target cells in vivo and / or depleting a population of target cells in vivo. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule; (ii) a second polypeptide comprising a binding region attached to the C-terminus of said first polypeptide, and (iii) a third polypeptide comprising a region polypeptide.

N-terminal truncated immunoglobulin heavy chain constant bound to the C-terminus of said second polypeptide, wherein when said connection region comprises an IgG pivot region polypeptide having at least first, second and third cysteine residues, said first cysteine is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or both of said second and third cysteine residues are substituted or deleted, and wherein said single chain protein is capable of inducing antibody-mediated cell-mediated cytotoxicity and complement fixation, and wherein said single chain protein is capable of binding to a target molecule on or in a target cell and decreasing the number of target cells in vivo and / or depleting a population of target cells in vivo. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprising a region heavy chain variable where the leucine in position 11 in the region's first framework region heavy chain variable is deleted or replaced with another amino acid; (ii) a second polypeptide comprising a connection region attached to the C-terminus of said first polypeptide; and (iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide attached to the C-terminus of said second polypeptide, wherein said single chain protein is capable of at least one immunological activity, and as long as the binding domain polypeptide is capable of binding to CD20 said connection region comprises three cysteine residues wherein one or two of said three cysteine residues are replaced or replaced with another amino acid. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprising a region heavy chain variable wherein the leucine at position 11 in the first framework region of the heavy chain variable region is deleted or substituted with another amino acid, (ii) a second polypeptide comprising a binding region attached to the C-terminus of said first polypeptide; and (iii) a thirdpol peptide comprising an N-terminal truncated immunoglobulin heavy chain constant region peptide linked to the C-terminus of the second peptide, wherein said single chain protein is capable of including at least one immunological activity, as long as the binding of the domain peptide is 2H7 scFv capable of binding to CD20 and said connection region comprises an IgG pivot region peptide having at least first, second, and third cysteine residues, said first cysteine being N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, one or two of said cysteine residues are replaced or deleted. The invention also includes single chain proteins comprising, consisting essentially of, or consisting of, (i) a first peptide having a peptide with binding domain capable of binding to a target molecule on or in a target cell, said peptide having binding domain comprises a heavy chain variable region wherein the leucine at position 11 in the first framework region of the heavy chain variable region is deleted or substituted with another amino acid; (ii) a second peptide comprising a connection region linked to said peptide; and (iii) a third peptide comprising an N-terminal truncated immunoglobulin heavy chain constant region peptide linked to the second peptide, wherein said second single chain protein is capable of at least one immunological activity, as long as said single chain protein does not comprise , consists essentially of a peptide with binding domain capable of binding to CD20 and a connection region comprising (a) an IgG pivot having three cysteine residues or (b) an IgG pivot comprising three serine residues (or similar amino acids) that have been replaced by cysteine residues. There are many possible variations and variants of these single chain proteins. For example, the binding domain peptide can be a single chain antibody or a scFv including VL and VH peptides of natural occurrence and / or unnatural occurrence, and the binding domain peptide can bind any of a number of targets . VH peptides of non-natural occurrence include, by way of example and not limitation, human heavy chain variable region peptides comprising a mutation, substitution, or deletion of one or a few amino acids at the corresponding location with any one or more of amino acid positions 9, , 11, 12, 108, 110, and / or 112. VL peptides of non-natural occurrence include, by way of example and not limitation, human light chain variable region peptides comprising a mutation, substitution, or deletion of one or more amino acids at a corresponding location with any one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107. The objectives include, by way of example and not limitation, CD19, CD20, CD28, CD30, CD37, CD40, L6, HER2, epidermal growth factor receptors (EGFR), endothelial cell growth factors (VEGF), tumor necrosis factors (eg, TNF-alpha), as well as other targets described or referred to herein or otherwise useful, whether known or discovered later. Additionally, the link region peptide can be any number of molecules, both of natural occurrence and unnatural occurrence. The connection region peptides include, by way of example and not limitation, immunoglobulin pivot region peptides of natural occurrence and unnatural occurrence. Immunoglobulin pivotal region peptides of natural occurrence include immunoglobulin pivot region type peptides wild-type such as, by way of example and not limitation, human IgGl pivot region peptides, human igA pivot region peptides, human IgD pivot region polypeptides, human igE pivot region regions (e.g., IgE CH2), camelid immunoglobulin pivot regions, or any other naturally occurring pivot region peptides described or referenced herein or referred to herein another useful way, either known or discovered later. Immunoglobulin pivotal region polypeptides of non-natural occurrence include, by way of example and not limitation, mutated naturally occurring immunoglobulin joints, including immunoglobulin pivot region polypeptides that contain less than the number of wild type cysteines , for example, mutated naturally occurring immunoglobulin pivot region polypeptides containing zero, one, or two cysteines, and any other link region molecule described or referred to herein or otherwise useful or known or later discovered as useful for the connection junction, for example, the immunoglobulin domains such as a CH1 domain and a CH2 domain. N-truncated immunoglobulin heavy chain constant region polypeptides terminal include N-terminal truncated immunoglobulin heavy chain constant region polypeptides of natural occurrence and unnatural occurrence which, with or without other portions of the single chain protein, provide one or more effector functions such as those described herein. N-terminal truncated immunoglobulin heavy chain constant region polypeptides of natural occurrence include, by way of example and not limitation, CH2CH3 constant region polypeptides, including CH2CH3 constant region polypeptides taken, together or separately, from IgG human, human IgA, and human IgE, and any other immunoglobulin heavy chain constant region polypeptide described or referenced herein or otherwise known or later discovered to be useful. The N-terminal truncated immunoglobulin heavy chain constant region polypeptides of non-natural occurrence include, by way of example and not limitation, any mutated wild-type heavy chain constant region polypeptide described or referenced herein or otherwise. known or discovered later to be useful.

Several specific constructions of the invention include, by way of example only, the following: I. 2H7 scFv VH LllS (CSC-S) H WCH2 WCH3 2. 2H7 scFv VH LllS IgE CH2 CH3 CH4 3. 2H7 scFv VH LllS mlgE CH2 CH3 CH4 4. 2H7 scFv VH LllS mlgAH WIgACH2 T4CH3 5. 2H7 scFv VH LllS ( SSS-S) H K322S CH2 WCH3 6. 2H7 scFv VH LllS (CSS-S) H K322S CH2 WCH3 7. 2H7 scFv VH LllS (SSS-S) H P331S CH2 WCH3 8. 2HU scFv VH LllS (CSS-S) H P331S CH2 WCH3 9. 2H7 scFv VH LllS (SSS-S) H T256N CH2 WCH3 10. 2H7 scFv VH LllS (SSS-S) H RTPE / QNAK (255-258) CH2 WCH3 II. 2H7 scFv VH LllS (SSS-S) H K290Q CH2 WCH3 12. 2H7 scFv VH LllS (SSS-S) H A339P CH2 WCH3 13. G28-1 scFv (SSS-S) H WCH2 WCH3 14. G28-1 scFv IgAH WCH2 WCH3 15. G28-1 scFv VH LllS (SSS-S) H WCH2 WCH3 16. G28-1 scFv VH LllS (CSS-S) H WCH2 WCH3 17. G28-1 scFv VH LllS (CSC-S) H WCH2 WCH3 18 G28-1 scFv VH LllS (SSC-P) H WCH2 WCH3 19. CTLA4 (SSS-S) H P238SCH2 WCH32 20. CTLA4 (CCC-P) WH WCH2 WCH3 21. FC2-2 scFv (SSS-S) H WCH2 WCH3 22. FC2-2 scFv VHLllS (SSS-S) H WCH2 WCH3 23. UCHL-1 scFv (SSS-S) H WCH2 WCH3 24. UCHL-1 scFv VHLllS (SSS -S) H WCH2 WCH3 25. 5B9 scFv (SSS-S) H WCH2 WCH3 26. 5B9 SCFv VHLllS (SSS-S) H WCH2 WCH3 27. 2H7 scFv (SSS-S) H WCH2 WCH3 28. 2H7 scFv (SSS- S) H P238SCH2 WCH3 29. 2H7 scFv IgAH WCH2 WCH3 30. 2H7 scFv IgG WIgACH2 T4CH3 31. 2H7 scFv IgAH WIgACH2 WCH3 + ChainJ 32. 2H7 scFv CCC-P) WH WCH2 WCH3 33. 2H7 SCFv SSS-S) H WCH2 F405YCH3 34. 2H7 SCFv SSS-S) H WCH2 F405ACH3 35. 2H7 SCFv SSS-S) H WCH2 Y407ACH3 36. 2H4 scFv SSS-S) HWCH2 F405A, Y407ACH3 37. 2H7 scFv CSS-S) H WCH2 WCH3 38. 2H7 scFv SCS -S) H WCH2 WCH3 39. 2H7 SCFv SSC-P) H WCH2 WCH3 40. 2H7 scFv CSC-S) H WCH2 WCH3 41. 2H7 scFv CCS-P) H WCH2 WCH3 42. 2H7 scFv SCC-P) H WCH2 WCH3 43. 2H7 SCFv VH LllS (SSS-S) H WCH2 WCH3 44. 2H7 SCFv VH LllS (CSS-S) H WCH2 WCH3 45. G28-1 scFv VH LllS (SCS-S) H WCH2 WCH3 46. G28-1 scFv VH LllS (CCS-P) H WCH2 WCH3 47. G28-1 SCFv VH LllS (SCC-P) H WCH2 WCH3 48. G28-1 scFv VH LllS mlgE CH2 CH3 CH4 49. G28-1 scFv VH LllS mlgAH WIgACH2 T4CH3 50. G28-1 scFv VH LllS hlgE CH2 CH3 CH4 51. G28-1 scFv VH LllS hlgAH WIgACH2 T4CH3 52. HD37 scFv IgAH WCH2 WCH3 53. HD37 scFv (SSS-S) H WCH2 WCH3 54. HD37 SCFv VH LllS (SSS-S) H WCH2 WCH3 55. L6 SCFv IGAH WCH2 WCH3 56. L6 SCFv VHLllS (SSS-S) H WCH2 WCH3 57. 2H7 scFv-flame IgGl 58. 2H7 scFv-flame IgG2 59. 2H7 scFv-flame IgG3 60. Low CD16-6 (ED) (SSS-S) H P238SCH2 WCH3 61. CD16 -9 high (ED) (SSS-S) H P238SCH2 WCH3 62. 2el2 scFv (SSS-S) H P238SCH2 WCH3-hCD80TM / CT 63. 10A8 SCFv (SSS-S) H P238SCH2 WCH3-hCD80TM / CT 64. 40.2.36 scFv (SSS-S) H P238SCH2 WCH3-hCD80TM / CT 65. 2H7 scFv (SSS-S) H P238SCH2 WCH3-hCD80TM / CT 66. G19-4 scFv (SSS-S) H P238SCH2 WCH3-hCD80TM / CT 67. 2el2 scFv (SSS-S) H WCH2 WCH3-hCD80TM / CT 68. 2el2 scFv IgAH TgACH2 T4CH3-hCD80TM / CT 69. 2el2 scFv IgE CH2CH3CH4-hCD80TM / CT 70. 2el2 scFv SSS-S H P238SCH2 WCH3-mFADD-TM / CT 71. 2el2 scFv SSS-S H WCH2 WCH3-mFADD-TM / CT 72, 2el2 scFv SSS-S H WCH2 WCH3-mcasp3-TM / CT 73. 2el2 scFv SSS-S H P238SCH2 WCH3-mcasp3-TM / CT 74. 2el2 scFv SSS-S H WCH2 WCH3-mcasp8-TM / CT 75. 2el2 scFv SSS-S H P238SCH2 WCH3-mcasp8-TM / CT 76. 2el2 scFv SSS-S H WCH2 WCH3-hcasp3-TM / CT 77. 2el2 scFv SSS-S H P238SCH2 WCH3-hcasp3-TM / CT 78, 2el2 scFv SSS -S H WCH2 WCH3-hcasp8-TM / CT 79, 2el2 scFv (SSS-S H P238SCH2 WCH3-hcasp8-rTM / CT 80, 1D8 scFv-hlgGl SSS-S) H P238SCH2 WCH3-hCD80TM / CT 81. 1D8 scFv- -hIgGl SSS-S) H WCH2 WCH3-hCD80TM / CT 82, 1D8 scFv-mIgAT4-hCD80TM / CT 83, 1D8 scFv-hIgE-hCD80TM / CT 84, 1D8 scFv-hlgGl (SSS-S) H P238SCH2 WCH3-mFADD- TM / CT 85, 1D8 scFv-hlgGl (SSS-S) H WCH2 WCH3-mFADD-TM / CT 86, 1D8 scFv-hlgGl (SSS-S) H WCH2 WCH3-mcasp3-TM / CT 87, 1D8 scFv-hlgGl ( SSS-S) H P238SCH2 WCH3-mcasp3-TM / CT 1D8 scFv-hlgGl (SSS-S) H WCH2 WCH3-mcasp8 - TM / CT 89 1D8 scFv-hlgGl (SSS-S) H P238SCH2 WCH3-mcasp8-TM / CT 90. 1D8 scFv-hlgGl (SSS-S) H WCH2 WCH3-hcasp3-TM / CT 91. 1D8 scFv-hlgGl (SSS-S) H P238SCH2 WCH3-hcasp3-TM / CT 92. 1D8 scFv-hlgGl (SSS-S) H WCH2 WCH3-hcasp8-TM / CT 93. 1D8 scFv-hlgGl (SSS-S) H P238SCH2 WCH3-jhcasp8-TM / CT L6 SCFv (SSS-S) H WCH2 WCH3 94 .2H7 scFv CD154 (L2) 95. 2H7 scFv CD154 (S4) 96. CTLA4 IgAH IgACH2CH3 97. CTLA4 IgAH IgACH2 T4CH3 98. 2H7 scFv IgAH IgACH2CH3 99. 2H7 scFv IgAH IgAHCH2 T18CH3 100. 2H &-40.2.220 scFv (SSS -S) H WCH2 WCH3 (anti-ccd20-anti-CD40 bispecific) 101. 2H7 scFv IgAH IgACH2 T4CH3-hCD89 TM / CT 102. G19-4 scFv (CCC-P) WH WCH2 WCH3-hCD89 TM / CT 103. 2el2 scFv (CCC-P) WH WCH2 WCH3-hCD89 TM / CT These and other aspects of the invention will be further evident after reference to the following detailed description and the accompanying drawings. As noted here, all referenced patents, articles, documents, and other materials described or identified here they are incorporated as a reference here in their entirety as if each one were incorporated individually.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows deduced amino acid sequences and DNA [SEQ ID NO: 1] of 2H7scFv-Ig, an immunoglobulin fusion protein with binding domain capable of binding specifically to CD20.

Figure 2 shows production levels of 2H7 scFv-Ig by transfected stable CHO lines and generation of a standard curve by binding of purified 2H7 scFv Ig to CHO cells expressing CD20.

Figure 3 shows SDS-PAGE analysis of multiple preparations of isolated 2H7scFv-Ig protein.

Figure 4 shows complement fixation (Fig. 4A) and mediation of antibody-dependent cellular cytotoxicity (Fig. 4B) by 2H7scFv-Ig.

Figure 5 shows the effect of simultaneous ligation of CD20 and CD40 on the growth of normal B cells.

Figure 6 shows the effect of the simultaneous ligation of CD20 and CD40 on the expression of CD95 and the induction of apoptosis in a lymphoblastoid cell line e B.

Figure 7 shows DNA and deduced amino acid sequences [SEQ ID NOS: _J of 2H7scFv-CDl54 L2 (Fig. 7A, SEQ ID NOS: _) and 2H7scFv-CDl54 S4 (Fig. 7B, SEQ ID NO: 1) ) immunoglobulin fusion proteins with binding domain capable of binding specifically to CD20 and CD40.

Figure 8 shows the binding of immunoglobulin fusion proteins with the 2H7scFv-CDl54 binding domain to CD20 CHO cells by flow immunocitofluorimetry.

Figure 9 shows the binding of Annexin V to Ramos, BJAB, and T51 B cell lines after binding to immunoglobulin fusion protein with 2H7scFv-CD154 binding domain to cells Figure 10 shows the effects on the proliferation of B-cell line T51 after the binding of the immunoglobulin fusion protein with binding domain 2H7scFv-CD154.

Figure 11 depicts schematic representations of the structures of the 2H7ScFv-Ig fusion proteins [SEQ ID NOS: _] referred to as CytoxB or CytoxB derivatives: CytoxB-MHWTGlC (2H7 ScFv, mutant pivot, wild-type human IgGl Fe domain) ), CytoxB-MHMGlC (2H7 ScFv, mutant pivot, mutated human IgGl Fe domain) and CytoxB-IgAHWTHGlC (2H7 ScFv, pivot derived from human IgA [SEQ ID NO: _], domain igGl human Fe wild type). The arrows indicate position numbers of the amino acid residues considered to contribute to the FcR binding and ADCC activity (heavy arrows), and to complement fixation (light arrows). Note the absence of the interchain disulfide bonds.

Figure 12 shows SDS-PAGE analysis of isolated CytoxB and immunoglobulin fusion proteins with binding domain 2H7scFv-CDl54.

Figure 13 shows cytotoxic activity mediated by antibody dependent cell of CytoxB derivatives.

Figure 14 shows complement-dependent cytotoxicity of CytoxB derivatives.

Figure 15 shows serum half-life determinations of CytoxB-MHWTG1C in macaque blood samples.

Figure 16 shows the effects of CytoxB-MHWTGlC on the levels of circulating CD40 + B cells in rhesus macaque blood samples.

Figure 17 shows the production levels of HD37 (CDl9-specific) ScFv-Ig by transfected mammalian cell lines and the generation of a standard curve by binding purified HD37 ScFv-Ig to cells expressing CD19.

Figure 18 shows the production levels of L6 (carcinoma antigen) ScFv-Ig by transfected stable CHO lines and generation of a standard curve by attaching purified L6 ScFv-Ig to cells expressing the L6 antigen.

Figure 19 shows antibody-mediated cell-mediated cytotoxicity activity of immunoglobulin fusion proteins with binding domain 2H7 ScFv-Ig, HD37 ScFv-Ig and G28-1 (CD37-specific) ScFv-Ig.

Figure 20 shows antibody-mediated cell-mediated cytotoxicity activity of the L6 ScFv-Ig fusion proteins.

Figure 21 shows SDS-PAGE analysis of L6 ScFv-Ig and 2H7 ScFv-Ig fusion proteins.

Figure 22 shows SDS-PAGE analysis of the fusion proteins G28-1 ScFv-Ig and HD37 ScFv-Ig.

Figure 23 shows an alignment of immunoglobulin pivot sequence and CH2 domain of IgGl (ID DE SEC NO: _) with the pivot and the CH2 domains of flame IgGl (SEC ID NO: _), IgG2 (SEC ID NO: _) and IgG3 (SEC ID DO NOT:_) .

Figure 24 illustrates the migration of purified IgG flame protein 2H7 scFv in a 10% SDS polyacrylamide gel. The purified fusion proteins (5 μg per sample) were prepared in a non-reducing sample buffer (lanes 2-5) and in a reducing sample buffer (lanes 6-9). Lane 1: molecular weight markers (not reduced); Lanes 2 and 6: flame IgGl 2H7 scFv- (SEQ ID NO: _); Lanes 3 and 7: flame IgG2 2H7 scFv (SEQ ID NO: _); Lanes 4 and 8: flame IgG3 2H7 scFv (SEQ ID NO: _); and Lanes 5 and 9: Rituximab (chimeric anti-CD20 antibody (human IgGl constant region).

Figure 25 shows binding of flame IgGl 2H7 scFv (SEQ ID NO: _), flame IgG2 2H7 scFv (SEQ ID NO: _), and flame IgG3 2H7 scFv- (SEQ ID NO: _) to CD20 + CHO cells detected by flow immunocitofluorimetry.

Figure 26 describes CDC activity of flame IgG fusion proteins 2H7 scFv, flame IgGl 2H7 scFv (SEQ ID NO: _), flame IgG2 2H7 SCFv (SEQ ID NO: _), and IgG3 from call 2H7 scFv (SEQ ID NO: _), and IgGl from human 2H7 scFv (2H7 scFv IgG WTH WTCH2CH3) (SEQ ID NO: _) against BJAB cells in the presence of rabbit complement. Rituximab was included as a control.

Figure 27 shows antibody-dependent cell-mediated cytotoxicity activity of the flame IgG 2H7 scFv fusion proteins, flame IgGl 2H7 scFv (SEQ ID NO: _), flame IgG2 2H7 scFv (SEQ ID NO: 1) ), and flame IgG3 2H7 scFv (SEQ ID NO: _). Effector cells (human PBMC) were combined with target cells (BJAB cells) in three different ratios, 1:25, 1:50, and 1: 100. Rituximab was included as a control. Each of the data points represents three separate measurements.

Figure 28 shows antibody-dependent cell-mediated cytotoxicity activity of the flame IgG fusion proteins 2H7 scFv, flame IgGl 2H7 scFv (SEQ ID NO: _), flame IgG2 2H7 scFv (SEQ ID NO: 1) ), and flame IgG3 2H7 scFv (SEQ ID NO: _). Effector cells (flame PBMC) were combined with target cells (BJAB cells) in three different ratios, 1:25, 1:50, and 1: 100. Rituximab was included as a control. Each data point represents three separate measurements.

Figure 29 describes complement dependent cytotoxicity activity of Reh cells (acute lymphocytic leukemia) expressing scFv-Ig fusion proteins on the cell surface. Reh cells were transfected with constructs that encode specific scFv antibodies for human co-stimulatory molecules, CD152, CD28, CD40, and CD20, fused to CH2-CH3-wild-type human IgGl pivot, which was fused to the human CD80 transmembrane and cytoplasmic tail domains. Complement-dependent cytotoxic activity was measured in the presence and absence of rabbit complement (plus C and not C, respectively). The data represents the average of the duplicate samples. Reh anti-hCDl52 scFvIg: Reh cells transfected with polynucleotide 10A8 scFv IgG MTH (SSS) MT CH2CH3 (SEQ ID NO: _); Reh anti-hCD28scFvIg: 2E12 scFv IgG MTH (SSS) MT CH2CH3 (SEQ ID NO: _); Reh anti-hCD40scFvIg: 4.2.220 scFv IgG MTH (SSS) MT CH2CH3 (SEQ ID NO: _); and Reh anti-hCD20scF Ig: 2H7 scFv IgG MTH (SSS) MT CH2CH3 (SEQ ID NO: _).

Figure 30 shows antibody-mediated cell-mediated cytotoxicity activity of Reh cells that were transfected with constructs encoding scFv antibodies specific for human co-stimulatory molecules, CD152, CD28, CD40, and CD20, as described for Figure 29, and CD3 of murine, fused to a pivot IgGl of human mutant and a CH2 mutant and CH3 wild type (Reh anti-mCD3scFv gue designates Reh cells transfected with polynucleotide 500A2 scFv IgG MTH (SSS) MTCH2WTCH3 ID SEC SEC: _)), which is fused a human CD80 transmembrane and cytoplasmic tail domains. The data represents the average of the quadrupled samples.

Figure 31 lists immunoglobulin constant region constructs that were used in the experiments illustrated in the subsequent Figures.

Figure 32 describes the complement-dependent cytotoxicity activity of the CTLA-4 Ig, CTLA-4 IgG WTH (CCC) fusion proteins WTCH2CH3 (SEQ ID NO: _) (2 μg / ml) and CTLA-4 IgG MTH MTCH2WTCH3 (SEC ID NO: _) (2 μg / ml), in the presence and absence of rabbit complement (plus C and not C, respectively). The target cells were Reh cells and Reh cells transfected with CD80 (Reh CD80.10).

Figure 33 shows antibody-mediated cell-mediated cytotoxicity activity of CTLA-4 Ig fusion proteins, CTLA-4 IgG WTH (CCC) WTCH2CH3 (SEQ ID NO: _) (2 μg / ml) and CTLA-4 IgG MTH MTCH2WTCH3 (SEQ ID NO: _) (2 μg / ml). The effector cells, the human PBMC, were added to the target cells, Reh or Reh CD80.1, in the indicated proportions. Figure 33A shows the level of natural death in Reh CD80.1 cells in the absence of any Ig fusion protein. Figure 33B presents antibody-mediated cell-mediated cytotoxicity mediated by CTLA-4 IgG MTH MTCH2WTCH3, and Figure 33C presents antibody-mediated cell-mediated cytotoxicity mediated by CTLA-4 IgG WTH (CCC) WTCH2CH3. Each data point represents the specific percent death percentage measured in four sample wells.

Figure 34 illustrates the binding of 2H7 fusion proteins (anti-CD20) scFv Ig to cells (CD20 +) CHO by flow immunocytofluorimetry.

Figure 35 shows an immunoabsorption of the 2H7 scFv IgG and IgA fusion proteins. COS cells were transiently transfected with various constructs of 2H7 scFv Ig fusion proteins. The expressed polypeptides were immunoprecipitated with protein A, separated on a non-reducing SDS polyacrylamide gel, and then transferred to a polyvinyl fluoride membrane. The proteins were detected using an anti-human IgG (specific Fe) horsetail peroxidase conjugate. Lane 1: vector only; Lane 2: 2H7 scFv IgG WTH (CCC) WTCH2CH3 (SEQ ID NO); Lane 3: 2H7 SCFv IgG MTH (CSS) WTCH2CH3 (SEQ ID NO: _); Lane 4: 2H7 scFv IgG MTH (SCS) WTCH2CH3 (SEQ ID NO: _); Lane 5: • 2H7 scFv IgAH IgG WTCH2CH3 (SEQ ID NO: _); and Lane 6: 2H7 scFv IgG MTH (SSS) WTCH2CH3 (SEQ ID NO: _).

Figure 36 illustrates the binding of the polypeptide 2H7 scFv IgAH IgACH2CH3 (SEQ ID NO: _) and 2H7 SCFv IgAH IgAT4 (SEQ ID NO: _) to cells (CD20 +) CHO by immunocytofluorimetry flow. The source of the polypeptides was to culture supernatants of transiently transfected COS cells. COS cells transfected with a plasmid comprising a sequence encoding 2H7 scFv IgAH IgACH2CH3 were co-transfected with a nucleotide sequence containing plasmid encoding human J chain.

Figure 37 illustrates antibody-mediated cell-mediated cytotoxicity activity of anti-CD20 (2H7) fusion proteins scFv Ig against target BJAB cells using whole blood as the source of effector cells. The purified 2H7 scFv Ig fusion proteins were titrated and combined with BJAB cells labeled with 51 Cr (5 x 104) and whole blood (1: 4 final dilution). Each data point represents a specific average percentage of death measurement in four sample wells.

Figure 38 demonstrates the antibody-dependent cell-mediated cytotoxicity activity of the 2H7 scFv Ig fusion proteins (5 μg / ml) BJAB cells labeled with 51 Cr at 0.25, 0.125, and 0.625 dilutions of the whole blood. Each data point represents the specific average percentage of death measured in four sample wells.

Figure 39 shows a comparison of antibody-mediated cell-mediated cytotoxicity activity of 2H7 scFv IgG MTH (SSS) WTCH2CH3 (5 μg / ml) and 2H7 scFv IgAH IgACH2CH3 (5 μg / ml) when the human PBMC is the source of effector cells (Figure 39A) and when whole human blood is the source of effector cells (Figure 39B).

Figure 40 shows an immunoabsorption of the 2H7 scFv IgG fusion proteins. COS cells were transiently transfected with several constructs of 2H7 scFv Ig fusion proteins. The culture supernatants containing the expressed polypeptides were separated on a non-reducing SDS polyacrylamide gel, and then transferred to a polyvinyl fluoride membrane. The proteins were detected using an anti-human IgG (specific Fe) horsetail peroxidase conjugate. Lanes 1-5: 2H7 scFv gG MTH (SSS) WTCH2CH3 purified at 40 ng, 20 ng, 10 ng / 5 ng, and 2.5 ng per lane, respectively. The culture supernatants were separated in lanes 6-9. Lane 6: 2H7 scFv IgG WTH (CCC) WTCH2CH3; Lane 7: 2H7 scFv IgG MTH (CSS) WTCH2CH3; Lane 8: 2H7 scFv IgG MTH (SCS) WTCH2CH3; and Lane 9: 2H7 scFv VHSERll IgG MTH (SSS) WTCH2CH3. The molecular weight (kDal) of the marker proteins is indicated to the left of the immunosorption.

Figure 41 illustrates the cell surface expression of 1D8 (anti-murine 4-lBB) scFv IgG WTH fusion protein WTCH2CH3-CD80 on K1735 melanoma cell flow immunofluorimetry (Fig. 41A). The scFv fusion protein was detected with goat anti-human Ig F (ab ') 2 phycoerythrin-conjugating. Fig. 41B describes the growth of tumors in natural C3H mice transplanted with subcutaneous injection with K1735 wild type melanoma cells (K1735-WT) or with K1735 cells transfected with 1D8 scFv IgG WTH WTCH2CH3-CD80 (K1735-1D8). The growth of the tumor was monitored by measuring the size of the tumor. Fig. 41C demonstrates the kinetics of tumor growth in natural C3H mice injected intraperitoneally with monoclonal antibodies to remove CD8 + T cells, CD4 +, or both CD4 + and CD8 + before transplanting the animals with K1735-1D8 cells.

Figure 42 demonstrates the therapy of established K1735-WT tumors using K1735-1D8 as an immunogen. Six days later the mice were transplanted with K1735-WT tumors, one group (five animals) was injected subcutaneously with K1735-1D8 cells (open circles) or irradiated with K1735-WT cells (solid squares) on the contralateral side. A control group of mice received PBS (open squares). The treatments were repeated on the days indicated by the arrows.

Figure 43 shows the growth of tumors in animals that were injected subcutaneously with 2 x 106 K1735-WT cells (solid squares) and the growth of tumors in animals that were injected subcutaneously with 2xl06 K1735-WT cells plus 2 x 105 cells K1735-1D8 (open triangles).

Figure 44 presents a flow cytometry analysis of murine sarcoma tumor cells antigens 04 transfected with 1D8 scFv IgG WTH WTCH2CH3-CD80 isolated after repeated rounds of panning against antihuman IgG. Transfected cells expressing 1D8 scFv IgG WTH WTCH2CH3-CD80 was detected with goat anti-human IgG fluoroisothiocyanate conjugated (FITC) (described in black). Untransfected cells are shown in gray.

Figure 45 illustrates the migration of several 2H7 scFv Ig fusion proteins in a 10% SDS-PAGE. The 2H7 was the anti-CD20 scFv and 40.2.220 was the anti-CD40 scFv. Lane 1: pre-stained molecular weight standards Bio-Rad; Lane 2: anti-CD20 scFv IgG MTH (SSS) MTCH2WTCH3; Lane 3: anti-CD20 scFv IgG MTH (SSS) WTCH2CH3; Lane 4: 2H7 scFv IgAH IgG WTCH2CH3; Lane 5: anti-CD20-anti-CD40 scFv IgG MTH (SSS) MTCH2WTCH3; Lane 6: Rituximab; Lane 7: Novex Multimarkt molecular weight standards.

Figure 46 illustrates the effector function measured in an antibody dependent cell-mediated cytotoxicity assay of the 2H7 Ig fusion proteins containing a mutant CH2 domain or a wild-type CH domain. The specific percentage of BJAB target cell death in the presence of human PBMC effector cells by 2H7 scFv MTH IgG (SSS) MTCH2WTCH3 (diamonds) was compared to 2H7 scFv IgG MTH (SSS) WTCH2CH3 (squares) and 2H7 scFv IgAH IgG WTCH2CH3 (triangles) and Rituximab (circles).

Figure 47 shows the cell surface expression of a CD3 scFv anti-human WTH WTCH2CH3-CD80 fusion protein (SEQ ID NO: _) on Reh cells (Fig. 47A) and T51 lymphoblastoid cells (Fig. 47B) when measuring the linear fluorescent equivalent (LFE) using flow immunocitofluorometry.

Figure 48 presents the percentage of specific death of untransfected Reh and T51 cells and the specific percentage of death of Reh cells (Reh anti-hCD3) (Fig. 48A) and T51 cells (T51 anti-hCD3) (Fig. 48B) They were transfected with a construct encoding human CD3-specific scFv antibodies, fused to CH2-CH3-wild-type human IgGl pivot, which were fused to CD80 transmembrane and to cytoplasmic tail domains (anti-human CD3 scFv IgG WTH WTCH2CH3-CD80 ( SEQ ID NO: _) The human PBMC (effector cells) was combined with BJAB target cells in the indicated proportions.

Figure 49 illustrates the binding of 5B9, an anti-murine CD137 monoclonal antibody (4-lBB) and a 5B9 scFv IgG fusion protein (5B9 scFv MTH IgG (SSS) WTCH2CH3 (SEQ ID NO: _) to stimulated human PBMC The binding of the fusion protein 5B9 scFv IgG was detected by flow immunocytofluorimetry using goat anti-human IgG conjugated with FITC The binding of the monoclonal antibody 5B9 was detected with goat anti-mouse IgG conjugated with FITC.

Figure 50 illustrates the effect of the LVH11S mutation on the expression of 2H7 LVH111S scFv WCH2 WCH3 ("CytoxB scFv ig"; SEQ ID NO: 1) on CHO cell lines.

Figure 51 shows a semi-quantitative SDS-PAGE analysis examining the expression of 2H7 LVH11S scFv WCH2 WCH3 (SEQ ID NO: _) when transiently transfected into CHO cells. Lanes 2-5 are various amounts of 2H7 LVH11S scFv WCH2 WCH3. Lanes 6-10 are 10 μl samples of five different clones expressing 2H7 LVH11S scFv WCH2 WCH3.

Figure 52 shows differences in the binding capacity between a G28-1 LVH11S scFv Ig construct (SEQ ID NO: _) and a wild type IgG scFv binding domain fusion protein G28-1 (SEQ ID NO. : _), both obtained from transiently transfected COS cells. The binding of Ramos cells was determined using flow cytometry. The data illustrates a significant increase in the binding of the VH11S protein to the CD37 + Ramos cells.

Figure 53 illustrates increasing levels of expression of G28-1 LVHllS scFv Ig constructs (SEQ ID NO: _) compared to wild type Ig scFv G28-1 constructs in COS. Protein levels were compared using immunoabsorption analysis. Both immunoabsorption gels have quantified amounts of a G28-1 scFv Ig (SSS-S) H WCH2 WCH3 construction of the invention in lanes 1-4. Lanes 5-9 of the first immunoabsorption represent five different clones each transfected with G28-1 scFv (SSS-S) H WCH2 WCH3, while lanes 5-9 of the second immunoabsorption represent five different clones transfected with G28-1 LVH11S SCFV (SSS-S) H WCH2 WCH3. Immunoabodies illustrate that the LVH11S form causes the G28-1 scFv Ig construct to be expressed at very high levels.

Figure 54 illustrates the binding of 2H7 scFv Ig derivatives with altered joints (SEQ ID NOS: _, _, _, _, _, _, _, _) to CHO cells expressing CD20 (CD20 + CHO) by flow cytometry , and indicates that these altered connection region pivot constructs (including pivot regions (SSS-S), (CSS-S), (SCS-S) and (CSC-S)) retain the function of binding to CD20.

Figure 55 shows the ability to mediate antibody-dependent cell-mediated cytotoxicity of several constructs against the Bjab targets: (A) 2H7 scFv Ig constructs of the invention containing onexion regions comprising joints (CSS-S), (SCS-S), (CSC-S), and (SSS-S) (SEC ID: _, _, _, _, _, _, _, _) and (B) constructions 2H7 scFv of the invention with several connection regions and queue regions (SEQ ID NOS: _, _, _, _, _, _). The specific percentage of death is compared to the total death induced by a detergent. The controls are natural death in the target cells with added effectors and a 2H7 construction with a IgA pivot connection region and an IgA derived tail region that does not bind to the PBMC effectors.

Figure 56 illustrates the capacity of various 2H7 scFv Ig constructs of the invention (SEQ ID NO: _, _, _, _, _, _) which include connection regions that have several pivot regions (eg, (CSC -S), (SSS-S), (SCS-S), and (CSS-S)) to mediate complement activity in Ramos cells. The specific percentage of death is measured against complement control alone, and 100% of deaths are determined by exposure of the cells to the detergent.

Figure 57 illustrates the binding samples of the 2H7 scFv Ig constructs of the invention containing different tail regions (SEQ ID NO: _, _, _) to CD20 + CHO using immunocytofluorimetry. The different proteins were detected using FITC conjugated to anti-gG, anti-IgA, and anti-IgE.

Figure 58A shows the binding of 2H7 VHL11S scFv IgECH2CH3CH4, was purified using hydrophobic charge induction chromatography (HCIC) and eluted with different pHs 4.0 and 3.5, (SEQ ID NO: _) in CD20 + CHO cells by flow cytometry, indicating that the proteins bound to CD20 are eluted at pH 4.0 or 3.5. Figure 58B is a graph of data indicating the ability of these 2H7 VH LllS scFv igE constructs of the invention to mediate, for example, ADCC in Bjab target cells.

Figure 59 shows the binding capacity of G28-1 VH LllS mIgECH2CH3CH4 (SEQ ID NO: _) (A) to Bjab and Ramos target cells and (B) to CD20 + CHO cells by flow cytometry.

Figure 60 shows the High Performance Liquid Chromatography (HPLC) profiles of various protein constructs of the invention (A) 2H7 scFv (SSS-S) H (P238S) CH2 WCH3 (ID FROM SEC NO: _) (B) 2H7 scFv (CSS-S) H WCH2 WCH3, (SEC ID NO: _) (C) 2H7 scFv (SCS-S) H WCH2 WCH3, (SEC ID NO: _) and (D) 2H7 scFv (SSS-S) H WCH2 (Y407A) CH3 (SEQ ID NO: _), which indicates that construction A has forms of apparent molecular weight of lOOkD and 75kD and that, upon introducing certain changes, a predominant molecular weight of 75 kD, as seen in constructions B, C and D. See Example 40.

Figure 61 shows the HPLC profiles of several protein constructs of the invention (A) 2H7 scFv (SSS-S) H WCH2 WCH3, (SEQ ID NO: _) (B) 2H7 SCFv (CSC-S) H WCH2 WCH3 , (SEC ID NO: _) (C) 2H7 SCFv (CCC-P) H WCH2 WCH3, (SEC ID NO: _) and (D) 2H7 scFv IgAH WCH2 WCH3 (SEC ID NO: _), indicating that construction A has forms of apparent molecular weight of lOOkD and 75kD and that, when introducing certain changes, a predominant molecular weight form of 75 kD is obtained, as seen in constructions B and C, although construction D (which has an IgA tail region) has an apparent molecular weight of 150 kD. See Example 40.

Figure 62 shows the HPLC profiles of various protein constructs of the invention (A) 2H7 scFv (SSS-S) H WCH2 WCH3, (SEC ID NO: _) (B) 2H7 scFv (SCS-S) H WCH2 WCH3, (SEC ID NO: _) (C) 2H7 scFv IgA 3TCH2 WCH3, (SEC ID NO: _) and (D) 2H7 scFv (SSS-S) 'H WCH2 (F405A Y407A) CH3 (SEQ ID NO: _, indicating that construct A has two apparent molecular weight forms of lOOkD and 75kD, construction B has a predominant form with an apparent molecular weight of 75 kD, although construction C with the T4 mutation leads to three forms with apparent molecular weights close to 600 kD and construction D with a double point mutation in the CH3 region leads to a predominant form having a molecular weight of less than 44 kD. A T4 mutation refers here to a truncation of four amino acids from a CH3 region. See Example 40.

Figure 63 compares the effect on the binding of CD20 + CHO cells by the 2H7 VH LllS scFv Ig constructs (SEQ ID NOS: _, _), with and without the alterations F405A and Y407A in the CH3 region, by cytometry. flow, indicating a loss of binding capacity with this double amino acid change. See Example 41.

Figure 64 shows the binding capacity of 2H7 VH LllS scFv Ig-conjugated FITC derivatives (SEQ ID NO: _, _, _, _, _,) to CH20 + CHO cells by flow cytometry, which indicates that these constructions do not lose binding capacity when conjugated to a fluorescent marker. See Example 41.

Figure 65 shows a non-reducing SDS-PAGE analysis examining 10 μg (per lane) of several purified 2H7 VH LllS scFv Ig constructs of the invention (SEQ ID NOS: _, _, _, _, _, _), which indicate an apparent molecular weight for each construct in reference to the standard molecular weight marker in lane 1. See Example 41.

Figure 66 compares CH2 domain sequences from four different human IgG regions, hlgGl, hIgG2, hIgG3, hIgG4, hIgG4, and a rat region, rlgG2b. The point mutations that affect ADCC and CDC are marked with arrows. See Example 52.

Figure 67 demonstrates the ability of several constructs 2H7 VH LllS scFv Ig (SEQ ID NO: _, __) to mediate ADCC in CHO and transiently transfected Lecl3 CHO cells, which indicate that the constructs expressed in Lecl3 CHO cells had a 20 % increase in specific death over the same construct expressed in regular CHO cells. See Example 42.

Figure 68 shows the SDS-PAGE analysis, both reduced and unreduced, of high and low affinity alleles of soluble CD16 (ED) (SSS-S) H P283S CH2 WCH3 (SEQ ID NOS: _, _). See Example 43.

Figure 69 demonstrates the different binding capacities of the high and low affinity CD16 fusion proteins (SEQ ID NOS: _, _,) at 2H7 VH LllS ScFv (CSC-S) WCH2 WCH3 (SEQ ID NO: 1) ) or 2H7 VH LllS ScFv (SSS-S) WCH2 WCH3 (SEQ ID NO: _), and indicate a loss of the high and low affinity allele that binds using P238S CH2 constructs. See Example 43.

Figure 70 shows a diagram of (A) an assay used to detect changes in the Fe receptor binding using FITC-conjugated extracellular domain Ig fusion protein with a mutated tail, elilmin self-association and (B) a system of mammalian deployment using cell surface expression of constructions. See Example 44.

Figure 71 shows the induction of apoptosis in Bjab and Ramos cells by several mAbs (SEC ID NOS: _, _, _, _, _, _, _) and the scFvIg constructions of the invention (SEQ ID NOS: _, _, _, _, _, _). See Example 45.

Figure 72 illustrates the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs to induce apoptosis in Ramos cells that are mediated by the activation of caspase 3. The results indicate that Under these conditions, both constructions bind to CD20 and induce apoptosis.

Figure 73 illustrates the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs to mediate CDC activity in Bjab positive CD20 target cells. The results indicate that both constructions have the capacity to mediate CDC.

Figure 74 compares the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs to mediate ADCC target cells in Bjab target cells. The results indicate that the construction 2H7 scFv (SSS-S) H WCH2 WCH3 was very effective in inducing high levels of specific death, although the construction 2H7 scFv (SSS-S) H P238CH2 WCH3 was not effective in mediating ADCC.

Figure 75 compares the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs to bind soluble CD16 (high affinity and low affinity forms) in CHO positive CD20 cells. The results indicate that 2H7 scFv (SSS-S) H WCH2 WCH3 was able to bind to CD16 (both forms), although 2H7 scFv (SSS-S) H P238CH2 WCH3 was not able to bind CD16 (any form).

Figure 76 compares the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs to bind to CD9 positive U937 cells. The results indicate that both constructs have high affinity for FcγRI, and that the P238S mutation selectively reduces binding to FcγRIII.

Figure 77 illustrates an in vivo experiment in macaques to measure the effect of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238CH2 WCH3 constructs on B cell depletion. The constructs were administered with One week separation and B cells were measured at days -7, 0, 1, 3, 7, 8, 10, 14, 28 and 43 using whole blood counts and two-color flow cytometry. The results indicate that the construction 2H7 scFv (SSS-S) H WCH2 WCH3 resulted in a rapid and complete exhaustion of B cells, which lasted up to 28 days after the second injection. In contrast the construction 2H7 scFv (SSS-S) H P238CH2 WCH3 resulted in a slow reduction in B cells to approximately 50% in the first two weeks; however, B cells quickly started returning to their regular level soon after this. This suggests that the ADCC mediated by the CDl6 interaction is probably necessary for a rapid and sustained exhaustion of the B cell.

Figure 78 illustrates the SEC profiles of the constructions G28-1 VL11S SCFv (SSS) H WCH2 WCH3 and G28-1 VLllS SCFv (SSC) H WCH2 WCH3. The construction with an SSS pivot generated a simple uniform peak at approximately 75-100 kD, while the construction with the SSC pivot generated a smaller form and other heterogeneous shapes, including one to more than 200 kD.

Figure 79 illustrates the binding capacity of the G28-1 VLllS scFv (SSS) H WCH2 WCH3 and G28-1 VLllS scFv (SSC) H WCH2 WCH3 constructs in B cell lymphoma cells: Bjab, Ramos, WIL-2, Namalwa and Raji. The results in (a) indicate that G28-1 VLllS scFv (SSS) H WCH2 WCH3 bound to Bjab and Ramos cells, and moderately to WIL-2 cells, and to levels lower than Namalwa and Raji cells. The results in (b) indicate the G28-1 VLllS scFv (SSC) H WCH2 WCH3 bound to the Bjab cells, and moderately the Ramos and WIL-2 cells, and at lower levels of the Namalwa and Raji cells.

Figure 80 illustrates the binding of annexin and v-iodide of propidium in Ramos cells incubated with constructs G28-1 VLllS scFv (SSS) H WCH2. WCH3 and G28-1 VLllS scFv (SSC) H WCH2 WCH3 overnight. The results indicate that both constructions induced apoptosis, however, the construction with the pivot (SSC) induced more apoptosis than the construction with the pivot (SSS).

Figure 81 illustrates the ability of the G28-1 VLllS scFv (SSS) H WCH2 WCH3 and G28-1 VLllS SCFv (SSC) H WCH2 WCH3 constructs to inhibit cell proliferation Ramos The results indicate that both constructions inhibited prolilferation.

Figure 82 illustrates the capacity of the G28-1 VLllS scFv (SSS) H WCH2 WCH3 and G28-1 VLllS scFv (SSC) H WCH2 WCH3 and 2H7 scFv (CSS) H WCH2 WCH3 constructs to induce apoptosis in B cells Ramos , alone and in different combinations. The results shown in this experiment indicate that both G28-1 constructs were more efficient than the 2H7 construct. The results also indicate that the construction G28-1 VLllS scFv (SSS) H WCH2 WCH3 was more efficient than the construction G28-1 VLllS scFv (SSC) H WCH2 WCH3. However, the amount of apoptosis was the greatest when the constructs 2H7 and G28-1 were used in combination.

Figure 83 compares the capacity of the G28-1 VLllS SCFv (SSS) H WCH2 WCH3, G28-1 VLllS scFv (SSC) H WCH2 WCH3 and 2H7 scFv (CSS) H WCH2 WCH3 constructs to mediate CDC in Ramos B cells. The results indicate that all constructions mediated CDC. Construction 2H7 was more effective, followed by G28-1 VLllscFv (SSC) H WCH2 WCH3, then G28-1 VLllS scFv (SSS) H WCH2 WCH3.

Figure 84 compares the capacity of the G28-1 VLllS scFv (SSS) H WCH2 WCH3, G28-1 VLllS scFv (SSC) H WCH2 WCH3 and 2H7 scFv (CSS) H WCH2 WCH3 constructs to mediate ADCC in Ramos B cells. The results indicate that the constructs G28-1 VLllS scFv (SSS) H WCH2 WCH3 and G28-1 VLllS scFv (SSC) H WCH2 WCH3 were able to mediate ADCC, while the construction capacity 2H7 scFv (CSS) H WCH2 WCH3 to mediate ADCC was lower, but still higher than the level of natural death.

DETAILED DESCRIPTION OF THE INVENTION The present invention is directed to novel molecules useful, for example, therapeutic coolants, as well as for other purposes including diagnostic and research purposes. Such molecules have, for example, antigen binding or other binding functions and, for example, one or more effector functions. The invention includes molecular constructs, which include proteins of immunoglobulin fusion with binding domain, and related compositions and methods, which will be useful in immunotherapeutic and immunodiagnostic applications, and in research methods, and which offer certain advantages over antigen-specific compounds and prior art polypeptides . Constructs, including fusion proteins, of the present invention are preferably single polypeptide chains comprising, in the relevant part, the following domains or regions fused or otherwise connected: a binding region construction, such as a domain of binding or a polypeptide, a construction or connection region that includes, for example, a native or engineered immunoglobulin pivot region polypeptide, and a tail region construct, including, for example, a construct that can comprise, consists essentially of, or consists of, a native or engineered immunoglobulin heavy chain CH2 constant region polypeptide and a native or engineered immunoglobulin heavy chain CH3 constant region polypeptide. According to certain modalities that are particularly useful for gene therapy, constructions, including the fusion proteins of the present invention may additionally comprise a native or engineered plasma membrane anchoring domain. According to certain other preferred embodiments constructs, including fusion proteins, of the present invention may additionally include a tail region having a native or engineered immunoglobulin heavy chain CH4 constant region polypeptide. In particularly preferred embodiments, the binding regions, such as the polypeptide domains, of which the constructs, which include the immunoglobulin fusion proteins with binding domain; are comprised, or are derived from, polypeptides that are the products of human gene sequences, but the invention need not be so limited and may in fact relate the constructs, including the immunoglobulin fusion proteins with binding domain, as here provided that they are derived from any natural or artificial source, which includes polypeptides engineered with genetic engineering and / or mutated.

The present invention relates in part to the surprising observation that novel constructs, which include immunoglobulin fusion proteins with binding domain, described herein are capable of immunological activity. More specifically, these proteins retain the ability to participate in well-known immunological effector activities including, for example, antibody-mediated cell-mediated cytotoxicity (e.g., subsequent to antigen binding on a cell surface, coupling and induction of effector cells. Cytotoxic drugs that carry appropriate Fe receptors, such as Natural Killer cells that carry FcR? iII, under appropriate conditions) and / or complement fixation in complement-dependent cytotoxicity (for example, subsequent to antigen binding on the cell surface, recruitment and activation of cytolytic proteins that are components of the blood complement cascade) despite having structures they are not expected to be able to promote such effector activities or to promote such activities as described here. For reviews of ADCC and CDC see, for example, Carter, 2001 Nat. Rev. Canc. 1: 118; Sulica et al. , 2001 Int. Rev. Immunol. 20: 371; Maloney et al. , 2002 Semin. Oncol. 29: 2; Sondel et al. , 2001 Hematol Oncol Clin North Am 15 (4): 703-21; Maloney 2001 Anticanc. Drugs 12 Suppl. 2: 1-4. The IgA activation of complement by the alternative path is described, for example, in Schneiderman et al. , 1990 J. Immunol. 145: 233. As described in more detail below, ADCC, complement fixation, and CDC are unexpected functions for constructs, including fusion proteins, which comprise for example immunoglobulin heavy chain regions and which have the structures described herein, and in particular for immunoglobulin fusion proteins comprising, for example, immunoglobulin pivot region polypeptides which are compromised in their ability to form interchain homodimeric disulfide bonds.

Another advantage achieved by the present invention are the constructs, which include the immunoglobulin fusion polypeptides with binding domain, of the invention and which can be produced in substantial amounts that are typically greater than those routinely achieved with single chain antibody constructs. of the prior art, for example. In preferred modalities, the constructs, including the immunoglobulin fusion polypeptides with binding domain, of the present invention are recombinantly expressed in mammals or other desired and useful expression systems, which offer the advantage of delivering polypeptides that are stable in vivo (eg, under physiological conditions). According to non-limiting theory, such stability may derive in part from post-translational modifications, and specifically glycosylation. The production of the constructs, including immunoglobulin fusion protein constructs with binding domain, of the invention by means of recombinant mammalian expression have been achieved in static cell cultures at a level greater than 50 mg of protein per liter of supernatant of culture and have been routinely observed in such cultures at 10-50 mg / liter, so that preferably at least 10-50 mg / liter can be produced under static culture conditions, improved production is also contemplated, in all or in part, of the protein constructions of the invention using scale methodologies accepted by the art such as the production of "feed batch" (ie, non-static), where yields of at least 5-500 mg / l are obtained , and in some cases at least 0.5-1 gm / 1, depending on the particular protein product.

A construct, which includes a polypeptide with binding domain, according to the present invention can be, for example, any polypeptide having the ability to specifically recognize and bind a cognate biological molecule or complex of more than one molecule or assembly or aggregate, whether stable or transient, of such a molecule. Such molecules include proteins, polypeptides, peptides, amino acids, or derivatives thereof, lipids, fatty acids or the like, or derivatives thereof, carbohydrates, saccharides or the like or derivatives thereof; nucleic acids, nucleotides, nucleosides, purines, pyrimidines or related molecules, or derivatives thereof, or the like; or any combination of these such as, for example, glycoproteins, glycopeptides, glycolipids, and lipoproteins, proteolipids; or any other biological molecule that may be present in a biological sample. Biological samples can be supplied, for example, by obtaining a blood sample, biopsy specimen, tissue explant, organ culture, biological fluid or any other tissue or cell or other preparation of a subject or a biological source. The subject or biological source can, for example, be a human or non-human animal, a cell culture primary or a culture-adapted cell line that includes but is not limited to genetically engineered cell lines that may contain chromosomally integrated or episomal recombinant nucleic acid sequences, immortalized or immortalizable cell lines, somatic cell hybrid cell lines, differentiated or differentiable cell lines, transformed cell lines and the like, etc. In certain preferred embodiments of the invention, the subject or biological source may be suspected to have or be at risk of having a disease, or disorder or condition, which includes a malignant disease, disorder or condition of a B cell disorder, which in certain additional embodiments may be an autoimmune disease, and in certain other embodiments of the invention the subject or biological source may be known to be free of a risk or presence of such diseases, disorder or condition.

A binding region, which includes the polypeptide with binding domain, for example, can be any binding partner produced by natural, synthetic, semi-synthetic, and / or recombinant occurrence for a biological molecule or another that is the target structure of interest , some sometimes referred to herein as an "antigen" but intended in accordance with the present disclosure to comprise any biological objective or other molecule that is desirable to have as its subject of the invention, for example, a fusion protein, either bound or specifically bound. Constructs of the invention, including immunoglobulin fusion proteins with binding domain, are defined to be "immunospecific" or capable of binding to a desired degree, including specifically binding, if they bind to a desired target molecule such as a antigen as supplied herein, at a desired level, for example, with a Ka greater than or equal to about 104 M "1, preferably greater than or equal to about 105 M_1, more preferably greater than or equal to about 106 M" 1 and even more preferably greater than or equal to about 107 M "1. Even greater affinities of about 107 M" 1 are even more preferred, such as affinities equal to or greater than about 107 M "1, about 108 M-1, and about 109 M". 1, and approximately 1010 M-1. The affinities of the immunoglobulin fusion proteins with binding domain according to the present invention can be easily determined using conventional techniques, for example those described by Scatchard et al. , 1949 Ann. N. Y. Acad. Sci. 51: 660. Such a fusion protein determination that binds to target antigens of interest can also be developed using any of a number of known methods to identify and obtain proteins that interact specifically with other proteins or polypeptides, for example, a system of selection of two yeast hybrids such as that described in US Pat. No. 5,283,173 and U.S. Pat. No. 5,468,614, or the equivalent.

Preferred embodiments of the constructs of the subject invention, for example, immunoglobulin fusion proteins with binding domain, comprise binding regions or binding domains which may include, for example, at least one polypeptide with variable region of native immunoglobulin or worked with engineering, such as all or a portion or fragment of a native or engineered heavy chain and / or a native or engineered light chain region, provided that it is capable of specifically binding or binding an antigen or another desired target structure of interest at a desired level of binding and selectivity. In other modalities Preferred the binding region or the binding domain comprises, consists essentially of, or consists of, an Fv product derived from single chain immunoglobulin, for example, and scFv, which may include all or a portion of at least one V region of light chain of native or engineered immunoglobulin and all or a portion of at least one native or engineered immunoglobulin heavy chain V region and a linker fused or otherwise connected to the V regions; preparation and testing of such constructions as described in more detail here. Other preparation and test methods are well known in the art.

As described herein and known in the art, immunoglobulins comprise products from a family of genes members which exhibit a high degree of sequence conservation. The amino acid sequences of two or more immunoglobulins or immunoglobulin domains, or regions or portions thereof (eg, VH domains, VL domains, pivot regions, CH2 constant regions, CH3 constant regions) can be aligned and analyzed. The portions of the sequences corresponding to one another can be identified, for example, by homology of sequence. The determination of sequence homology can be determined with any of a number of sequence alignments and analysis tools, which include computation algorithms well known to those skilled in the art, such as the Align or BLAST algorithm.

(Altschul, 1991 J. Mol. Biol. 219: 555-565; Henikoff and Henikoff, 1992. Processing, Nat. Acad. Sci. USA 89: 10915-10919), which is available on the NCBI website. (http: //www/ncbi.nlm.nih.gov/cgi-bin/BLAST). You can use default parameters.

The portions, for example, of a particular immunoglobulin reference sequence and any one or more of the additional immunoglobulin sequences of interest which can be compared to a reference sequence. Sequences, regions, "corresponding" fragments or the like, can be identified based on the convention to number immunoglobulin amino acid positions according to Rabat, Seguences of Proteins of Immunological Interest, (5th ed. Bethesda, MD: Public Health Service , National Institutes of Health (1991)). For example, according to this convention, the immunoglobulin family to which an immunoglobulin sequence of interest It is determined based on the conservation 'of the invariant amino acid residues of the variable region polypeptide sequence, to identify a particular numbering system for the immunoglobulin family, and the sequence (s) of interest can then be aligned to transferring sequence position numbers to individual amino acids comprising such or such sequences. Preferably at least about 70%, more preferably at least 80% -85% or about 86-89%, and even more preferably at least about 90%, about 92%, about 94%, about 96%, about 98% or about 99% of the amino acids in a given amino acid sequence of at least about 1000, more preferably about 700-950, more preferably about 350-700, still more preferably about 100-350, still more preferably about 80-100, about 70 -80, approximately 60-70, approximately 50-60, approximately 40-50 or approximately 30-40 consecutive amino acids of a sequence, are identical to the amino acids located in the corresponding positions in a reference sequence such as those described in Rabat (1991) or in a similar compendium of related immunoglobulin sequences, such as can be generated from public databases (eg, Genbank, SwissProt, etc.) using sequence alignment tools such as, for example, agüellas described above. In certain preferred embodiments, an immunoglobulin sequence of interest or a region, portion, derivative or fragment thereof is greater than about 95% identical to a corresponding reference sequence, and in certain preferred embodiments such a sequence of interest may differ from a reference corresponding in no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid positions.

For example, in certain embodiments, the present invention is directed to a construct, which includes an immunoglobulin fusion protein with binding domain, comprising in the relevant part a human immunoglobulin heavy chain variable region polypeptide or other species that comprises a mutation, alteration or deletion of an amino acid at a site or sites corresponding to one or more of the amino acid positions 9, 10, 11, 12, 108, 110, 111 and 112 in, for example, the DE ID SEC N0: _, which comprises, for example, a sequence derived from murine VH. With a relatively limited number of immunoglobulin V H -sequence positions, for example, including position 11, conservation of the amino acid is observed in the preponderant majority of VH sequences analyzed through the lines of mammalian species (e.g., Leull, Val37, Gly44, Leu45, Trp47; Nguyen et al. , 1998 J. Mol. Biol 275: 413). Several such amino acid residues, and thus their side chains, are located on the surface of the variable domain (VH). They can contact residues of CH1 (eg, Leull) and VL domains (eg, Val37, GLy44, Leu45, and Trp47) and can, in the absence of light chains, contribute to the stability and solubility of proteins (see, for example, Chotia et al., 1985 J. Mol. Biol 186: 651, Muyldermans et al., 1994 Prot. Engineer 7: 1129, Desmyter et al., 1996 Nat. Struct. Biol. 3: 803; Davies et al. al., 1994 FEBS Lett 339: 285). In certain embodiments, for example, the present invention is also directed to a construct, which includes an immunoglobulin fusion protein with binding domain, which comprises in the relevant part an immunoglobulin light chain variable region polypeptide. human, or a light chain variable region polypeptide of immunoglobulin from other species which comprises a mutation, alteration or deletion at an amino acid at a site or sites corresponding to one or more amino acid positions 12, 80, 81, 82, 83, 105, 106, 107 and 108. In still other embodiments, for example, the present invention is directed to a construct, which includes an immunoglobulin fusion protein with binding domain, which comprises in the relevant part (1) a human immunoglobulin heavy chain variable region polypeptide, or a light chain variable region polypeptide of immunoglobulin of other species, which comprises, consists essentially of, or consists of, said heavy chain sequence having a mutation, alteration or deletion at a site or sites corresponding to one or more of amino acid positions 9, 10, 11, 12, 108, 110, 111, and 112, and (2) a region polypeptide light chain variable of human immunoglobulin, or a light chain variable polypeptide of immunoglobulin of other species, which comprises, consists essentially of, or consists of, said light chain sequences which have a mutation, alteration or deletion at a site or sites that correspond to one or more of the amino acid positions 12, 80, 81, 82, 83, 105, 106, 107, and 108.

As another example, in reference to the compendium of immunoglobulin sequences and databases such as those cited above, for example, the relationship of two or more immunoglobulin sequences to one another can easily and without undue experimentation be established in a manner which allows the identification of the animal species of origin, class and subclass (eg, isotype) of a polypeptide sequence with particular immunoglobulin or immunoglobulin region. Any polypeptide sequence with immunoglobulin variable region, including native and engineered VH and / or VL and / or single chain variable region (sFv) sequences or other native or engineered region V derived sequences or the like, they can be used as a binding region or a binding domain. Engineered sequences include immunoglobulin sequences from any species, preferably human or mouse, for example, which include, for example, a mutation, alteration or deletion at an amino acid at a site or sites corresponding to one or more of the amino acid positions 9, 10, 11, 12, 108, 110, 111, and 112 in a heavy chain variable region sequence or a scFv, and / or a mutation, alteration or deletion at a site or sites corresponding to one or more of the amino acid positions 12, 80, 81, 82, 83, 105, 106, 107, and 108 in the light chain variable region sequence or a scFv.

Several preferred embodiments include, for example, native or engineered immunoglobulin V region polypeptide sequences derived, for example, from antibodies that include monoclonal antibodies such as murine and other rodent antibodies, or monoclonal antibodies or antibodies derived from another source. such as goat, rabbit, equine, bovine, camelid or other species, which include transgenic animals, and also include humanized antibodies or monoclonal antibodies. Non-limiting examples include variable region polypeptide sequences from monoclonal antibodies such as those referenced herein and / or described in greater detail in the following Examples, for example, specific murine monoclonal antibodies or CD20 binding (eg, 2H7) , other monoclonal antibodies from murine specimens or CD20 binding which are not 1F5 antibodies, monoclonal antibody L6 (specific for a defined carbohydrate epitope and available from the American Type Culture Collection, Manassas, VA, as hybridoma HB8677), and monoclonal antibodies that bind to or are specific for CD28 (e.g., monoclonal antibody 2E12), CD40, CD80, CD137 (e.g., monoclonal antibody 5B9 or monoclonal antibody 1D8 which recognizes the murine homologue of CD137, 41BB) and CD152 (CTLA-4).

Other binding regions, including polypeptides with binding domain, can comprise any protein or portion thereof that retains the ability to bind or bind specifically to an antigen as supplied herein, which does not include immunoglobulin. Accordingly, the invention contemplates constructs, including fusion proteins, that comprise the binding region or the binding domain polypeptides that are derived from polypeptide ligands such as hormones, cytokines, chemokines, and the like; cell surface or soluble receptors for such polypeptide ligands; lectins; intercellular adhesion receptors such as specific leukocyte integrins, selectins, members of the immunoglobulin gene superfamily, intercellular adhesion molecules (ICAM-1, -2, -3) and the like; histocompatibility antigens; etc.

Examples of cell surface receptors useful in the preparation of, or as, binding regions, or that can deliver a polypeptide with binding domain, and which can also be selected as a target molecule or antigen to which a construct, including for example, a fusion protein with binding Ig domain of the present invention desirably binds, includes the following, or the like: HERI (eg, Genbank Access Nos. U48722, SEG_HEGFREXS, K03193), HER2 (Yoshino et al., 1994 J ". Immunol. 152: 2393; Disis et al., 1994 Canc. Res. 54: 16; see also, for example, Access GenBank Nos. X03363, M17730, SEG HUMHER20), HER3 (for example, Genbank Access We U29339, M34309), HER4 (Plowman et al., 1993 Nature 366: 473; see also for example, Genbank Access Nos. L07868, T64105), epidermal growth factor receptor (EGFR) (eg, Genbank Access Nos. U48722, SEG_HEGFREXS, K03193), endothelial cell growth factor vascular (for example, GenBank No. M32977), endothelial cell growth factor receptor vascular (VEGF) (eg, Genbank Access Nos. AF022375, 1680143, U48801, X62568), insulin-like growth factor I (eg, Genbank Access Nos. X00173, X56774, X56773, X06043, see also European Patent No. GB 2241703), insulin-like growth factor II (eg, Genbank Access Nos. X03562, X00910, SEGHUMGFIA, SEGHUMGFI2, M17863, M17862), transferrin receptor (Trowbridge and Omary, 1981 Proc. Nat. Acad. USA 78: 3039; see also for example, Genbank Access Nos. X01060, M11507), estrogen receptor (eg, Genbank Access Nos. M38651, X03635, X99101, U47678, M12674), progesterone receptor (eg, Access Gehbank Nos. X51730, X69068, M15716), follicle stimulating hormone receptor (FSH-R) (eg, Genbank Access Nos. Z34260, M65085), retinoic acid receptor (eg, Genbank Access Nos. L12060, M60909, X77664, X57280 , X07282, X06538), MUC-1 (Barnes et al., 1989 Proc. Nat. Acad. Sci. USA 86: 7159; see also eg, Genbank Access Nos. SEGMUSMUCIUS, M65132, M64928) NY-ESO-1 (eg, Genbank Access Nos. AJ003149, U87459), NA 17-A- (eg, European Patent No. WO 96140039), Melan -A / MART-1 (Kawakami et al. , 1994 Proc. Nat. Acad. Sci. USA 91: 3515; see also for example, Genbank Access Nos. U06654, U06452), tyrosinase (Topalian et al., 1994 Proc. Nat. Acad. Sci. USA 91: 9461, see also for example, Genbank Access Nos. M26729, SEG HUMTYRO, see also Weber et al., J Clin. Invest (1998) 102 : 1258), Gp-100 (Kawakami et al., 1994 Proc. Nat. Acad. Sci. USA 91: 3515, see also for example, GenBank Ace. No. S73003, see also European Patent No. EP 668350; al., 1994 J. Biol. Chem. 269: 20126), MAGE (van den Bruggen et al., 1991 Scieface 254: 1643; see also for example, Genbank Access Nos. U93163, AF064589, U66083, D32077, D32076, D32075 , U10694, U10693, U10691, U10690, U10689, U10688, U10687, U10686, U10685, L18877, U10340, U10339, L18920, U03735, M77481), BAGE (for example, GenBank Ace No. U19180; see also U.S. Patents Nos. 5,683,886 and 5,571,711), GAGE (eg, Genbank Access Nos. AF055475, AF055474, AF055473, U19147, U19146, U19145, U19144, U19143, U19142), any of the CTA class of recpeptors including in particular HOM-MEL antigen -40 encoded by the SSX2 gene (eg, Genbank Access Nos. X86175, U90842, U90841, X86174), carcinoembionic antigen (CEA, Gold and Freedman, 1985 J. Exp. Med. 121: 439; see also eg, Access Genbank Nos. SEGHUMCEA, M59710, M59255, M29540), and PyLT (eg, Genbank Access Nos. J02289, J02038).

Additional cell surface receptors which may be sources of binding domain or polypeptides of binding domain or portions thereof, or which may be targets, including target antigens, include the following, or the like: CD2 (eg, Genbank Access Nos. Y00023, SEGHUMCD2, M16336, M16445, SEG_MUSCD2, M14362), 4-lBB (CDwl37, Kwon et al., 1989 Proc. Nat. Acad. Sci. USA 86: 1963, ligand 4-1BB (Goodwin et al., 1993 Eur J. Immunol., 23: 2361; Melero et al., 1998 Eur. J. Immunol., 3: 116), CD5 (eg, Genbank Access Nos. X78985, X89405), CD10 (eg, Genbank Access Nos. M81591 , X76732) CD27 (for example, Genbank Access Nos. M63928, L24495, L08096), CD28 (June et al., 1990 Immunol., Today 11: 211; see also, for example, Genbank Access Nos. J02988, SEG_HUMCD28, M34563) , CD152 / CTLA-4 (eg, Genbank Access Nos. L15006, X05719, SEGHUMIGCTL), CD40 (eg, Genbank Access Nos. M83312, SEG_MUSC0 0A0, Y10507, X67878, X96710, U15637 , L07414), interferon-y (IFN-?); see, for example, Farrar et al. 1993 Aan. Rev. Immunol. 11: 571 and references cited here, Gray et al. 1982 Nature 295: 503, Rinderknecht et al. 1984 J. Biol. Chem. 259: 6790, DeGrado et al. 1982 Nature 300: 379), interleukin-4 (IL-4; see, for example, 53mo Forum in Immunology, 1993 Research in Immunol. 144: 553-643; Banchereau et al. , 1994 in The Cytokine Handbook, 2nd ed. , A. Thomson, ed. , Academic Press, NY, p. 99; Keegan et al. , 1994 J "Leukocyt, Biol. 55: 272, and references cited there), interleukin-17 (IL-17) (eg, Access Genbank Nos. U32659, U43088) and interleukin-17 receptor (IL-17R) (for example, Access Genbank Nos. U31993, U58917).

Notwithstanding the foregoing, the present invention expressly does not comprise immunoglobulin fusion proteins described in U.S. 5,807,734, or U.S. ,795,572.

Additional cell surface receptors that may be sources of binding domain or polypeptides of binding domain or portions thereof, or that may serve as targets including target antigens or binding sites include the following, or the like: CD59 (e.g. , Access Genbank Nos. SEG_HUMCD590, M95708, M34671), CD48 (for example, Genbank Access Nos. M59904), CD58 / LFA-3 (for example, GenBank Ace No. A25933, Y00636, E12817; see also JP 1997075090-A), CD72 (for example, Genbank Access Nos. AA311036, S40777, L35772), CD70 (for example, Genbank Access Nos. Y13636, S69339), CD80 / B7.1 (Freeman et al., 1989. "Immunol., 43: 2714; Freeman et al., 1991 J. Exp.

Med. 174: 625; see also for example, Access Genbank Nos.

U33208, 1683379), CD86 / B7. 2 (Freeman et al., 1993 J Exp.

Med. 178: 2185, Boriello et al. , 1995 J. Immunol. 155: 5490; see also, for example, Access. Genbank Nos.

AF099105, SEGMMB72G, U39466, U04343, SEGHSB725, L25606, L25259), B7-H1 / B7-DC (for example, Genbank Access Nos.

NM014143, AF177937, AF317088; Dong et al. , 2002 Nat. Med.

Jun 24 [epub ahead of print], PMID 12091876; Tseng et al. , 2001 J. Exp. Med. 193: 839; Tamura et al. , 2001 Blood 97: 1809; Dong et al. , 1999 Nat. Med. 5: 1365), ligand CD40 (for example, Genbank Access Nos. SEGHUMCD40L, X67878, X65453, L07414), IL-17 (for example, Genbank Access Nos.

U32659, U43088), CD43 (for example, Genbank Access Nos. X52075, J04536), ICOS (for example, Genbank Ace.

AH011568), CD3 (eg, Genbank Access Nos. NM-000073 (gamma subunit), NM-000733 (epsilon subunit), X73617 (delta subunit)), CD4 (for example, Genbank Access No.

NM000616), CD25 (for example, Genbank Access No. NM000417), CD8 (for example, Genbank Access No. M12828), CDllb (for example, Genbank Access No. J03925), CD14 (for example, Genbank Access No. XM_039364), CD56 (for example, Access Genbank No. U63041), CD69 (for example, Genbank Access No.

NM001781) and VLA-4 (aß7) (eg, Genbank Access Nos. L12002, X16983, L20788, U97031, L24913, M68892, M95632). The following cell surface receptors are typically associated with B cells: CD19 (eg, GenBank Access Nos. SEG_HUMCD19W0, M84371, SEG_MUSCD19W, M62542), CD20 (eg, Genbank Access Nos. SEG_HUMCD20, M62541), CD22 (eg. , Genbank Access Nos. 1680629, Y10210, X59350, U62631, X52782, L16928), CD30 (for example, Genbank Access Nos. M83554, D86042), CD153 (CD30 ligand, for example, Genbank Access Nos. L09753, M83554), CD37 (for example, Genbank Access Nos. SEGMMCD37X, X14046, X53517), CD50 (ICAM-3, for example, Genbank Access No. NM002162), CD106 (VCAM-1) (for example, Genbank Access Nos. X53051, X67783, SEG_MMVCAMlC , see also US Patent No. 5,596,090), CD54 (ICAM-1) (eg, Genbank Access Nos. X84737, S82847, X06990, J03132, SEGMUSICAMO), interleukin-12 (see, eg, Reiter et al, 1993 Cri Rev. Immunol 13: 1, and references cited there), CD134 (OX40, for example, Genbank Access No. AJ277151), CD137 (41BB, for example lo, Access GenBank No. L12964, NM_001561), CD83 (for example, Genbank Access Nos. AF001036, AL021918), DEC-205 (for example, Genbank Access Nos. AF011333, U19271).

The constructs, which include immunoglobulin binding domain fusion proteins, of the present invention comprise, for example, a binding domain, such as a binding domain polypeptide which, according to certain particularly preferred embodiments, is capable of specifically binding or binding at least one target, for example, a target antigen or other binding site that is present in an immune effector cell. According to the non-limiting theory, such constructs, which include for example immunoglobulin fusion proteins with binding domain, can advantageously recruit the function or functions of desired immune effector cells in a therapeutic context, where it is well known that effector cells Immune systems that have different specialized immune functions can be identified or distinguished from each other on the basis of their differential expression of a wide variety of cell surface antigens, including many of the antigens described herein to which the constructs of the invention include polypeptides with binding domain can bind specifically, as noted here, immune effector cells include any cell that is capable of mediating directly an activity that is a component of the function of the immune system, which includes cells that have such natural ability or as a result of genetic engineering.

In certain embodiments, an immune effector cell comprises a cell surface receptor for an immunoglobulin or other molecule that binds to a peptide, such as a receptor for an immunoglobulin constant region and that includes a class of receptors commonly referred to as "Fe receptors" ( "FcR"). A number of the FcRs have been structurally and / or functionally characterized and are well known in the art, including FcRs that have specific abilities to interact with a restricted subset of immunoglobulin heavy chain isotypes, or that interact with the Fe domains with variant affinities, and / or that can be expressed on restricted subsets of immune effector cells under certain conditions (eg, Kijimoto-Ochichai et al., 2002 Cell Mol. Life Sci. 59: 648; Davis et al., 2002 Curr. Top, Microbiol, Immunol, 266: 85, Pawankar, 2001, Curr Opin, All Clinical Immunol 1: 3, Radaev et al., 2002 Mol Immunol 38: 1073, Wurzburg et al., 2002 Mol.

Immunol. 38: 1063; Sulica et al. , 2001 Int. Rev. Immunol. 20: 371; Underhill et al. , 2002 Ann. Rev. Immunol. 20: 825; Coggeshall, 2002 Curr. Dir. Autoimm. 5: 1; Mimura et al. , 2001 Adv. Exp. Med. Biol. 495: 49; Baumann et al. , 2001 Adv. Exp. Med. Biol. 495: 219; Santoso et al. , 2001 Jtal. Heart J. 2: 811; Novak et al. , 2001 Curr. Opin. Immuno 1. 13: 721; Fossati et al. , 2001 Eur. J Clin. Invest. 31: 821).

Cells that are capable of mediating ADCC are preferred examples of immune effector cells according to the present invention. Other preferred examples include Natural Killer cells, tumor infiltrating T lymphocytes (TIL), cytotoxic T lymphocytes, and granulocytic cells such as cells that comprise allergic response mechanisms. Immune effector cells thus include, but are not limited to, cells of hematopoietic origin that include cells in various stages of differentiation within myeloid and lymphoid lineages and which may (but need not) express one or more types of cell surface FcR. functional, such as T lymphocytes, B lymphocytes, NK cells, monocytes, macrophages, dendritic cells, neutrophils, basophils, eosinophils, mast cells, platelets, erythrocytes, and precursors, progenitors (e.g., hematopoietic stem cells), as well as quiescent, activated, and mature forms of such cells. Other immune effector cells may include cells of non-hematopoietic origin that are capable of mediating immune functions, for example, endothelial cells, keratinocytes, fibroblasts, osteoclasts, epithelial cells, and other cells. Immune effector cells can also include cells that mediate cytotoxic or cytostatic events, or endocytic, phagocytic, or pinocytotic events, or that induce apoptosis, or that effect microbial immunity or neutralization of microbial infection, or cells that mediate allergic, inflammatory reactions , of hypersensitivity and / or autoimmune.

Allergic response mechanisms are well known in the art and include a specific component of antigen (e.g., allergen) such as an immunoglobulin (e.g., IgE), as well as cells and mediators that comprise sequelae to allergen find- immunoglobulin (e.g., IgE) (e.g., Ott et al., 2000 J. Allerg, Clin.Immunol 106: 429; Barnes, 2000 J All erg. Clin. Im unol. 106: 5; Togias, 2000 J. Allerg. Clin. Im unol. 105: S599; Akdis et al., 2000 Int. Arch. Allerg. Immuno 1. 121: 261; Beach, 2000 Occup. Med. 15: 455). Particularly with respect to the constructs, which include immunoglobulin fusion proteins with binding domain, of the present invention that interact with FcR, certain embodiments of the present invention contemplate constructs that include fusion proteins comprising one or more domains derived from IgE. which includes, for example, those that are capable of inducing an allergic response mechanism comprising FcR specific for IgE, or portions thereof, whose FcR specific for IgE include those noted above and described or identified in the articles cited. Without wishing to be bound by a particular theory or mechanism, and as described above, the constructs, including fusion proteins, of the present invention may comprise portions of heavy chain IgE Fe domain polypeptides, e.g., CH3 and CH4 domains IgE native or engineered, whether supplied or expressed as cell surface proteins (eg, with a plasma membrane anchoring domain) or soluble or otherwise non-cell-bound proteins (eg. example, without a plasma membrane anchor domain). In addition to the non-limiting theory, the recruitment and induction of an allergic response mechanism (for example, an immune effector cell that expresses FcR-epsilon) can proceed as a result of either or both of the presence of an IgE Fe domain or portion thereof as described above (eg, one which is capable of triggering an allergic mechanism by crosslinking FcR) and the presence of a target such as an antigen to which the binding region, eg, a binding domain, binds or it binds specifically. The present invention therefore exploits the induction of energetic response mechanisms in contexts hereinafter unappreciated, such as treatment of a malignant condition or B-cell disorder, which includes those described or referenced herein.

A polypeptide with immunoglobulin pivot region includes any naturally occurring pivot or polypeptide peptide, such as an artificial peptide or as a result of genetic engineering that is located, for example, in an immunoglobulin heavy chain polypeptide between the amino acid residues responsible to form unions disulfide with intrachain immunoglobulin domain in the CH1 and CH2 regions. Pivotal region polypeptides for use in the present invention may also include a polypeptide with a mutated or otherwise altered pivot region. Accordingly, for example, a polypeptide with immunoglobulin pivot region can be derived from, or can be a portion or fragment of (i.e., one or more amino acids in peptide bond, typically about 15-115 amino acids, preferably about 95-110, about 80-94, about 60-80, or about 5-65 amino acids, preferably about 10-50, more preferably about 15-35, even more preferably about 18-32, even more preferably about 20-30 , even more preferably approximately 21, 22, 23, 24, 25, 26, 27, 28, or 29 amino acids) an immunoglobulin polypeptide chain region classically considered to have a pivot function, including those described herein, but a polypeptide with pivot region for use in the present invention need not be restricted and may include one or more amino acids located (according to structure criteria) to transfer a particular residue to a particular domain that can vary, as is known in the art) in an adjunct immunoglobulin domain such as a CH1 domain and / or a CH2 domain in the cases of IgG, IgA and IgD (or in an adjunct immunoglobulin domain such as a CH1 domain and / or a CH3 domain in the case of IgE), or in the case of certain immunoglobulin constructs artificially engineered, an immunoglobulin variable region domain.

The wild-type immunoglobulin pivot region polypeptides include any known or subsequently discovered natural occurring pivot region that is located between the constant region domains, CH1 and CH2, of an immunoglobulin, eg, a human immunoglobulin (or between CH1 and CH3 regions of certain types of immunoglobulins, such as IgE). For use in the construction of a type of connection region, the wild-type immunoglobulin pivot region polypeptide is preferably a human immunoglobulin pivot region polypeptide, preferably comprising a pivot region from immunoglobulin IgG, IgA, or Human IgD (or the CH2 region of an IgE immunoglobulin), and more preferably, by example, a polypeptide with pivot region of a human IgGl isotype wild type or mutated as described herein.

As is known in the art, despite the tremendous overall diversity in the immunoglobulin amino acid sequences, the immunoglobulin primary structure exhibits a high degree of sequence conservation in particular portions of immunoglobulin polypeptide chains, notably in relation to the occurrence of cysteine residues which, by virtue of their sulfhydryl groups, offer the potential for disulfide bond formation with other available sulfhydryl groups. Accordingly, in the context of the present invention wild-type immunoglobulin pivot region polypeptides for use as connecting regions include those that characterize one or more highly conserved cysteine residues (eg, prevalent in a population of one statistically significant way), and in certain preferred embodiments a connecting region can comprise, or consists essentially of, or consists of, a polypeptide with a mutated pivot region that can be selected to contain less than the number of naturally occurring cysteines, for example , zero or one or two cysteine residues in the case of the IgG1 and IgG4 pivot regions, and which are derived from or constructed from (or utilize) such a sequence with wild-type pivot region.

In certain preferred embodiments wherein the region of connection is a polypeptide with pivot region and the polypeptide with pivot region is a polypeptide with pivot region of human IgGl immunoglobulin mutated, engineered or altered in another way that is derived or constructed From (or using) a sequence with a wild-type pivot region, it is noted that the polypeptide sequence with human IgGl wild-type pivot region comprises three non-adjacent cysteine residues, termed as the first cysteine of the wild-type pivot region, a second cysteine of the wild-type pivot region and a third cysteine of the wild-type pivot region, respectively, which proceed together with the pivot region sequence from the N-terminal polypeptide to the C-terminus. This can be referred to here as a "CCC" pivot (or a "WTH", ie wild type pivot). Examples of mutated or engineered pivot regions include those without cysteines, which can be referred to here as a "XXX" pivot (or, for example, as "MH-XXX", referring to a mutant or engineered pivot with three amino acids or other molecules instead of naturally occurring cysteines, such as, for example, "MH-SSS", which refer to a mutant pivot with three serine residues instead of the naturally occurring cysteine residues.The term "mutant" will be understood to refer only to the fact that a different molecule or molecules are present, or no molecule, in the position of a residue of natural occurrence and does not refer to any particular method by which such substitution, alteration, or deletion has been carried out. Accordingly, in certain embodiments of the present invention, the connection region can be a polypeptide with a pivot region and the polypeptide with a pivot region is a polypeptide with a mutated human IgGl immunoglobulin pivot region containing two cysteine residues. and wherein the first cysteine of the wild-type pivot region has not been changed or deleted, for example. This can be referred to as a "MH-CXX" pivot, for example, a "MH-CSC" pivot, in which case the cysteine residue has been replaced with a serine residue. In certain other modalities of the present invention the polypeptide with mutated human IgGl immunoglobulin pivot region contains no more than one cysteine residue and includes, for example, a "MH-CSS" pivot or a "MH-SSC" pivot or a "MH-CSC" pivot , and in certain other embodiments the polypeptide with mutated human IgGl immunoglobulin pivot region does not contain cysteine residues such as, for example, a "MH-SSS" pivot.

The constructs, which include immunoglobulin fusion proteins with binding domain, of the present invention expressly do not contemplate any fusion proteins that are described in U.S. Pat. No. 5,892,019. The U.S. Patent No. 5,892,019 refers to a human IgGl pivot region in which the first cysteine residue of the IgG1 pivot region has been changed or deleted, but retain both of the second and third cysteine residues of the IgG1 pivot region that correspond to the second and third cysteines of the wild type IgGl pivot region sequence. The patent states that the first cysteine residue of the wild-type IgGl pivot region is replaced to avoid interference by the first cysteine residue with proper assembly of the polypeptide described therein in a dimer. The patent requires that the second and third cysteines of the IgGl pivot region be retained to provide interchain interchain disulfide between two heavy chain constant regions to promote dimer formation such that the contents of the molecule have effector function such as capacity. to mediate ADCC.

In contrast and as described herein, the constructs, which include the immunoglobulin fusion proteins with binding domain, of the present invention, several of which are capable of ADCC, CDC and / or complement fixation, for example, do not they are thus limited and may comprise, for example, in the relevant part, (i) a polypeptide with a wild-type immunoglobulin pivot region, such as a polypeptide with a wild-type human immunoglobulin pivot region, eg, a polypeptide with a region human IgGl immunoglobulin pivot region, (ii) a polypeptide with mutated or otherwise altered immunoglobulin pivot region, such as a polypeptide with mutated or otherwise altered human immunoglobulin pivot region, eg, a polypeptide with a region pivot mutated or otherwise altered human IgGl immunoglobulin which, for example, is derived from or constructed from (or utilizes) a polypeptide with wild-type immunoglobulin pivot region or amino acid sequence having three or more cysteine residues, wherein the mutated or otherwise altered human IgGl immunoglobulin pivot region polypeptide contains two cysteine residues and wherein the first cysteine of the wild-type pivot region is not mutated or deleted, (iii) a polypeptide having a mutated or otherwise altered immunoglobulin pivot, such as a mutated or otherwise altered human immunoglobulin pivot region polypeptide, for example, a human IgGl immunoglobulin pivot region mutated or otherwise altered which, by example, whether or not a polypeptide with a wild-type immunoglobulin pivot region or acid sequence has been derived or constructed from (or using) nucleic having three or more cysteine residues, wherein the polypeptide with mutated or otherwise altered human IgGl immunoglobulin pivot region contains no more than one cysteine residue, or (iv) a polypeptide with mutated immunoglobulin pivot region or otherwise altered, such as a polypeptide with mutated or otherwise altered human immunoglobulin pivot region, for example, a polypeptide with mutated or otherwise altered human IgGI immunoglobulin pivot region, which is or has been derived or constructed from (or which uses) a polypeptide with a wild type immunoglobulin pivot region or nucleic acid sequence having three or more cysteine residues, wherein the polypeptide with human IgGl immunoglobulin pivot region mutated or otherwise altered (e.g., by amino acid change or deletion) does not contain cysteine residues. The present invention offers unexpected advantages associated with retention by means of constructs, including fusion proteins, described herein of the ability to mediate ADCC and / or CDC and / or complement fixation notwithstanding the ability to dimerize via interchain disulfide bonds of the IgG1 pivot region are suppressed or compromised by the removal or replacement of one, two or three cysteine residues from the pivot region, and even in constructions where the first cysteine of a pivot region IgGl, for example, it is not mutated or otherwise altered or suppressed.

A linkage region may comprise a polypeptide with immunoglobulin pivot region mutated or otherwise altered, which itself may comprise a pivot region that has its origin in an immunoglobulin of a species, an isotype or immunoglobulin class, or of an immunoglobulin subclass that is different from that of the tail region, eg, a tail region that comprises, or consists essentially of, or consists of, CH2 and CH3 domains (or IgE CH3 and CH4 domains). For example, in certain embodiments of the invention, a construct, for example, an immunoglobulin fusion protein with binding domain, can comprise a binding region such as a polypeptide with binding domain that is fused or otherwise connected. to a polypeptide with immunoglobulin pivot region comprising, or consisting essentially of, or consisting of, a wild-type human IgA pivot region polypeptide, or a human IgA pivot region mutated or otherwise altered that contains zero or only one or more cysteine residues (but less than the number of wild-type cysteines), as described herein, or a wild-type human IgG pivot region polypeptide, such as an IgGI pivot, or a polypeptide with an action region from wild type human IgE pivot, i.e. polypeptide with IgE CH2 region, or a polypeptide with human IgG pivot region mutated or otherwise altered, such as an IgGI pivot, which is either mutated or otherwise altered to contain zero, one or two cysteine residues wherein the first cysteine of the wild-type pivot region is not mutated or altered or deleted, as also described herein. Such a pivotal region polypeptide may be fused or otherwise connected to, for example, a tail region comprising, or consisting essentially of, or consisting of, a polypeptide with immunoglobulin heavy chain CH2 region of an isotype or class different, for example an IgA subclass or an igD or an IgG (or a CH3 region of an IgE subclass), which in certain preferred embodiments will be subclass IgGl or IgA or IgE and in certain other preferred embodiments may be one of the subclasses IgG2 , IgG3 or IgG.

For example, and as described in more detail herein, in certain embodiments of the present invention a link region can be selected to be a polypeptide with immunoglobulin pivot region, which is or has been derived from an IgA type pivot region. wild that naturally comprises three cysteines, wherein the polypeptide with selected pivot region is truncated or otherwise altered or substituted relative to the complete pivot region and / or natural occurrence such that only one or two cysteine residues remain ( for example, SEQ ID NO: 35-36). Similarly, in certain other embodiments of the invention, the construct can be an immunoglobulin fusion protein with binding domain comprising a polypeptide with binding domain that is fused or otherwise connected to a polypeptide with pivot region of immunoglobulin comprising a polypeptide with a mutated or otherwise altered pivot region in which the number of cysteine residues is reduced by substitution or deletion of amino acids, for example a mutated or otherwise altered IgGl pivot region containing zero , one or two cysteine residues as described herein, or an IgD pivot region containing zero cysteine residues.

A polypeptide with a mutated or otherwise altered pivot region can thus be derived or constructed from (or used) a wild-type immunoglobulin pivot region that contains one or more cysteine residues. In certain embodiments, a polypeptide with a mutated or otherwise altered pivot region may contain zero or only a cysteine residue, wherein the polypeptide with a mutated or otherwise altered pivot region is or has been derived from a pivot region. of wild-type immunoglobulin that contains, respectively, one or more or two or more cysteine residues. In the mutated or otherwise altered pivot region polypeptide, the cysteine residues of the wild-type immunoglobulin pivot region are preferably deleted or substituted with amino acids that are incapable of forming one. disulfide bond. In one embodiment of the invention, a polypeptide with a mutated or otherwise altered pivot region is or has been derived from a polypeptide with wild-type human IgG pivot region, which may include any of four subclasses of human igG isotype, IgGl, IgG2, TgG3, or IgG4. In certain preferred embodiments, the mutated or otherwise altered pivot region polypeptide is or has been derived from (or utilizes) a wild-type IgA or IgD pivot region. By way of example, a polypeptide with a mutated or otherwise altered pivot region that has been derived from a polypeptide with a region of Wild type IgGl or human IgA pivot may comprise mutations, alterations, or deletions in two of the cysteine residues in the wild-type immunoglobulin pivot region, or mutations, alterations, or deletions in all three cysteine residues.

The cysteine residues that are present in a wild-type immunoglobulin pivot region and that are removed or altered by mutagenesis or any other of the techniques according to particularly preferred embodiments of the present invention include cysteine residues that form, or which are able to form interchain disulfide bonds. Without wishing to be bound by a theory or mechanism of action, the present invention contemplates that the mutation, deletion, or other alteration of such cysteine residues from the pivot region, which are believed to be involved in the formation of interchain disulfide bridges , reduce the ability of the immunoglobulin fusion protein with binding domain object of the invention to be dimerized (or form higher oligomers) via the formation of interchain disulfide bond, although surprisingly not suppressing or undesirably compromising the capacity of a protein of fusion or another construction to promote ADCC, and / or CDC and / or fix complement. In particular, Fe receptors that mediate ADCC (eg, FcRIII, CDl6) exhibit low affinity for the immunoglobulin Fe domains, supporting the idea that the functional binding of Fe to FcR requires avidity stabilization of the Fc-FcR complex under of the heavy chain dimeric structure in a conventional antibody, and / or FcR aggregation and cross-linking by means of a conventional antibody Fe structure. Sonderman et al. , 2000 Nature 406: 267; Radaev et al. , 2001 J. Biol. Chem. 276: 16469; Radaev et al. , 2001 J. Biol. Chem. 276: 16478; Koolwijk et al. , 1989 J. Immunol. 143: 1656; Kato et al. , 2000 Immuno 1. Today 21: 310. Thus, constructs, which include for example immunoglobulin fusion proteins with binding domain, of the present invention provide the advantages associated with single chain constructs including single chain immunoglobulin fusion proteins. although also unexpectedly retaining one or more immunological activities. Similarly, the ability to fix complement is typically associated with immunoglobulins that are dimeric with respect to heavy chain constant regions such as those that comprise Fe, although several constructs, including immunoglobulin fusion proteins with binding domain, of the present invention, which may, due to the replacement or deletion of cysteine residues with pivotal region or due to other structural modifications as described aguí, for example, have compromised or suppressed abilities to form interchain disulfide bonds, exhibit the unexpected ability to fix complement. Additionally, according to certain embodiments of the present invention wherein a construct, which includes, for example, an immunoglobulin fusion protein with binding domain, may comprise a connection region and a tail region comprising, or consisting essentially of of, or consisting of, one or more of a human IgE pivot region of action, ie, a polypeptide with IgE CH2 region, a polypeptide with human IgE CH3 constant region, and a polypeptide with human IgE CH4 constant region, the constructs of the invention include fusion proteins that unexpectedly retain the immunological activity of mediating ADCC and / or of inducing an allergic response mechanism.

The selection of a polypeptide with immunoglobulin pivot region as a connection region according to certain embodiments of the constructs of the subject invention, such as the immunoglobulin fusion proteins with binding domain, can be related. with the use of a polypeptide sequence of "alternative pivot region", which includes a polypeptide sequence that is not necessarily derived from any immunoglobulin pivot region sequence per se. Instead, an alternative pivot region refers to a polypeptide with a pivot region comprising an amino acid sequence, or other molecular sequence, of at least about ten consecutive amino acids or molecules, and in certain embodiments at least about 11, 12 , 13, 14,, 15, 16, 17, 18, 19, 20, 21-25, 26-30, 31-50, 51-60, 71-80, 81-90, or 91-110 amino acids or molecules that are present in a sequence selected from any one of SEQ ID NO: _-_, for example a polypeptide sequence that is or has been derived from a region located between the immunoglobulin-like ring domains generated by intrachain member disulfide of the immunoglobulin gene superfamily such as CD2 (for example, Genbank Access No. NM_001767), CD4 (for example, Genbank Access No. NM_000616), CD5 (for example, Genbank Access No. BC027901), cD6 (for example, Genbank Access No. NM_006725), CD7 (for example, Genbank Access No. XM_046782, BC009293, NM_006137) or CD8 (eg, Genbank Access No. M12828), or other members of the Ig superfamily. By way of non-limiting example, an alternative pivot region used as the connecting region, for example, can deliver a glycosylation site as supplied herein, or it can deliver a polypeptide sequence derived from human gene for purposes of improving the degree of "humanization" of a fusion protein, or may comprise, or consist essentially of, or consist of, an amino acid sequence that eliminates or reduces the ability of a construct of the invention, such as a fusion protein, to form multimers or oligomers or aggregates or the like. Certain polypeptide sequences with alternative pivot region, including those described herein, can be derived or constructed from (or used) the polypeptide sequences of members of the immunoglobulin gene superfamily which are not in fact immunoglobulins per se. For example and according to the non-limiting theory, certain polypeptide sequences that are located between the immunoglobulin ring domain generated by intrachain disulfide of the member of the immunoglobulin gene superfamily can be used in whole or in part as the polypeptides of the alternative pivot region as supplied herein, or they can be further modified to such use.

As noted above, the constructs of the invention, which include immunoglobulin fusion proteins with binding domain, are believed, according to the non-limiting theory, to be compromised with the ability to dimerize via the disulfide bond formation of interchain, and additionally according to the theory, this property is a consequence, in whole or in part, of a reduction in the number of cysteine residues that are present in the polypeptide with selected immunoglobulin pivot region for inclusion in the construction of the construction, such as a fusion protein construct. The determination of the relative capacity of a polypeptide to be dimerized is from the knowledge of the relevant technique, where any number of established methodologies can be applied to detect protein dimerization (see, for example, Scopes, Protein Purification: Principies and Practice, 1987 Apringer-Verlag, New York). For example, biochemical separation techniques to solve proteins on the basis of molecular size (for example, gel electrophoresis, gel filtration chromatography, analytical ultracentrifugation, etc.), and / or the comparison of the physicochemical properties of proteins before and after the introduction of the sulfhydryl-active (e.g., iodoacetamide, N-ethylmaleimide) or disulfide reducing agents (e.g., 2-mercaptoethanol, dithiothreitol), or other equivalent methodologies, may all be employed to determine the degree of dimerization or polypeptide oligomerization, and to determine the possible contribution of the disulfide bonds to such potential quaternary structures. In certain embodiments, the invention relates to a construct, for example an immunoglobulin fusion protein with binding domain, that exhibits a reduced capacity (i.e., in a statistically significant way relative to an appropriate IgG-derived control, by example) to be dimerized, in relation to a polypeptide with a wild-type human immunoglobulin pivot region G as provided herein. Those familiar with the technique will be able of easily determining whether a particular protein fusion displays such reduced capacity to dimerize.

Compositions and methods for the preparation of immunoglobulin fusion proteins, for example, are well known in the art. See, for example, U.S. Pat. No. 5,892,019, which reports recombinant proteins that are the product of a single coding polynucleotide but are not constructs, including immunoglobulin fusion proteins with binding domain, according to the present invention.

In contrast, for example, in an immunoglobulin fusion protein of the invention which is intended for use in humans, any of the included Ig constant regions will typically be of human sequence origin, or humanized, to minimize an anti-human immune response. potential and provide appropriate and / or desired effector functions. The manipulation of the sequences encoding antibody constant regions are referenced in the PCT publication of Morrison and Oi, WO 89/07142. In particular preferred embodiments, a tail region is prepared from a heavy chain constant region of immunoglobulin in which the CH1 domain is or has been deleted (the CH1 and CH2 regions in the case of igE) and the carboxyl terminus of the binding domain, or where the binding domain comprises two polypeptides with immunoglobulin variable region, the second variable region (i.e., the one closest to terminal C) is attached to the amino terminal of CH2 through one or more connection regions, such as a pivot or altered region. A schematic diagram describing the structures of two immunoglobulin fusion proteins with exemplary binding domain is shown in FIG. 11. Interchain disulfide bonds are not present in particularly preferred embodiments, and in other embodiments a strict number of interchain disulfide bonds may be present relative to the number of such linkages that would be present if the polypeptides with wild-type pivot region were in your present place. In other embodiments, a construct of the invention, such as, for example, a fusion protein, comprises, or consists essentially of, or consists of, a polypeptide with a mutated or otherwise altered pivot region exhibiting a reduced ability to be dimerized, in relation to a wild-type human IgG pivot region polypeptide. Thus, a molecule of Isolated polynucleotide encoding such a single chain construct, such as an immunoglobulin fusion protein, has a binding region, for example, a domain that provides binding and selectivity of specific binding or otherwise desired for a target, such as an objective antigen.

The invention also contemplates for example, in certain embodiments, constructs including immunoglobulin fusion proteins with binding domain comprising polypeptide sequences fused or otherwise connected or portions thereof derived or prepared from a plurality of genetic sources, for example , according to molecular paradigms "domain exchange". Those who are familiar with the art will appreciate that the selection of such polypeptide sequences for assembly in a construct, such as the immunoglobulin fusion protein with binding domain, for example, may involve the determination of the appropriate functions of each sequence of component polypeptide, for example, based on structural and / or functional properties of each such sequence (see, for example, Carayannopoulos et al., 1996 J. Exp. Med. 183: 1579; Harlow et al. , Eds., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor (1988)). Component polypeptide sequences of which the construct, such as the fusion protein, is comprised or prepared can therefore comprise intact or full-length binding domain, immunoglobulin, linker and / or polypeptide sequences with anchor domain. plasma membrane, or truncated versions or variants thereof such as those provided herein. In accordance with these and related embodiments of the invention, any two or more of the candidate component polypeptides of which the subject constructs of the subject invention, eg, the fusion proteins, may be comprised will be derived or prepared from independent sources, such as as from immunoglobulin sequences of different alotype, isotype, subclass, class, or species of origin (eg, xenotype). Thus, in a non-limiting example, a polypeptide with binding domain (or its constituent polypeptide such as one or more polypeptides with variable region and / or a polypeptide linker), a polypeptide with pivot region, polypeptides with constant region CH2 and CH3 of immunoglobulin heavy chain and optionally a polypeptide with immunoglobulin heavy chain CH4 constant region as can be obtained from the heavy chain IgM or IgE, and a polypeptide with plasma membrane anchor domain can all be separately obtained from different genetic sources and engineered into a chimeric protein or fusion using well-known techniques according to the methodologies described herein, for example.

Accordingly, a construction of the invention, for example an immunoglobulin fusion protein with binding domain according to certain embodiments of the present invention, may therefore also comprise in the relevant part a polypeptide with CH3 constant region of Immunoglobulin heavy chain which is a wild-type IgA CH3 constant region polypeptide, or alternatively, which is a polypeptide with mutated or otherwise altered or truncated or mutated IgA CH3 constant region that is capable of associating with a J chain, or will not be associated in an undesired degree with a J string; preferably the IgA CH3 constant region polypeptides used in a portion of the tail region of a construct are of human origin or are humanized By way of brief background, IgA molecules are known to be released into secretory fluids by a mechanism involving the association of IgA in disulfide-linked polymers (eg, dimers) via a J-chain polypeptide (e.g. , Genbank Access Nos. XM_059628, M12378, M12759; Johansen et al., 1999 Eur. J. Immunol., 29: 1701) and the interaction of the complex thus formed with another protein that acts as a receptor for polymeric immunoglobulin, and which is known as a transmembrane secretory component (SC; Johansen et al., 2000 Se. J. Immunol., 52: 240; see also, for example, Sorensen et al., 2000 Int. Immunol 12: 19; Yoo et al., 1999 J Biol. Chem. 21 A: 33771; Yoo et al., 2002; J: Immunol., Meth. 261: 1; Corthesy, 2002 Trends Biotechnol., 20:65; Symersky et al., 2000 Mol. Immunol., 37: 133 Crottet et al., 1999 Biochem J. 341: 299). The interchain disulfide binding formation between the IgA Fe domains and the J chain is mediated through a penultimate cysteine residue at a C-terminal extension of amino acid 18 which is part of a heavy chain constant region CH3 polypeptide. IgA (Yoo et al., 1999; Sorensen et al., 2000). Certain embodiments of the constructions of the subject invention, which include for example fusion proteins, therefore contemplate the inclusion of the IgA wild-type heavy chain constant region polypeptide sequence, which is capable of associating with the J chain. Certain other embodiments of the invention, however, contemplate proteins of fusion comprising a polypeptide with mutated or otherwise altered or truncated IgA CH3 constant region that is unable to associate with a J chain. According to such modalities, for example, two or more C-terminal residues of a polypeptide constant region IgA CH3 such as a human IgA CH3 constant region polypeptide can be deleted to produce a truncated CH3 constant region polypeptide as provided herein. In the preferred embodiments as described in more detail herein, a polypeptide with mutated human IgA CH3 constant region that is unable to associate with a J chain comprises such C-terminal deletion of any four or 18 amino acids. However, the invention need not be so limited, so that the polypeptide with mutated IgA CH3 constant region can comprise a deletion of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21-25, 26-30 or more amino acids, as long as the construction, for example, the protein of fusion, is capable of specifically binding an antigen and of at least one immunological activity as provided herein. Alternatively, the invention also contemplates constructs, eg, fusion proteins, which have a tail region comprising a mutated CH3 IgA constant region polypeptide which is unable to associate with a J chain by virtue of the penultimate cysteine replacement, or by chemical modification of the amino acid residue, in a manner that prevents, or inhibits, the undesired level of interchain disulfide bonds or formation of multimers. Methods for determining whether a construct, e.g., a fusion protein, can be associated with a J chain will be known to those who are familiar with the art and are described or referenced herein.

As also described herein in accordance with methods known in the art, the construct, eg, a fusion protein, may also be routinely assayed for immunological activity, for example, in ADCC or CDC assays. As an illustrative example, a construct, for example a fusion protein, according to such embodiment may comprise a polypeptide with binding domain derived or constructed from (or utilizing) a native or engineered human heavy chain variable polypeptide sequence, a native or engineered human IgA derived polypeptide region with immunoglobulin pivot region , or a polypeptide sequence with engineered or engineered human IgGl immunoglobulin heavy chain CH2 constant region, or a native or engineered human IgG2 immunoglobulin heavy chain CH3 constant region polypeptide sequence, and optionally a sequence of polypeptide with human-engineered IgE immunoglobulin heavy chain constant region CH4 or engineered and / or native or engineered human-type TNF-a plasma receptor 1 (TNFRl) polypeptide with an engineered DNA comprising an cytoplasmic tail polypeptide that is capable of apoptotic signal or p otherwise reverse apoptosis. The invention therefore contemplates these and other embodiments in accordance with the present invention in which two or more polypeptide sequences which are present in a construct, eg, a fusion protein, have independent genetic origins.

As noted above, in certain embodiments the construct, e.g., an immunoglobulin fusion protein with binding protein, comprises at least one native or engineered immunoglobulin variable region polypeptide, which may be a polypeptide with variable chain region. light native or engineered or heavy chain native or engineered, and in certain embodiments the fusion protein comprises at least one such native or engineered light chain V regions and one such native heavy chain V region or engineered and at least one linker peptide that is fused or otherwise connected to each of the native or engineered V regions. The construction of such binding domains, for example single chain Fv domains, is known in the art and is described in more detail in the examples below, and has been described, for example, in several documents cited here; the selection and assembly of single chain variable regions and linker polypeptides that can be fused or otherwise connected to each of the V regions derived from heavy chain and a V region derived from light chain (by example, to generate a binding region, such as a binding domain comprising a single chain Fv polypeptide) is also known in the art and is described herein. See, for example, U.S. Pat. No. 5,869,620, 4,704,692, and 4,946,778. In certain embodiments, all or a portion or portions of the immunoglobulin sequence that is derived from a non-human source can be? > "humanized" according to the recognized procedures for generating humanized antibodies, i.e., immunoglobulin sequences in which human Ig sequences are introduced to reduce the degree to which the human immune system would perceive such proteins as foreign (see, for example, Patents US Nos. 5,693,762, 5,585,089, 4,816,567, 5,225539, 5,530,101, and documents cited here).

The constructs of the invention, which include immunoglobulin fusion proteins with junction domain, as described above, can, according to certain embodiments, desirably comprise sites for glycosylation, eg, covalent attachment of carbohydrate moieties such as, for example, , monosaccharides or oligosaccharides. The incorporation of amino acid sequences that supply substrates for glycosylation of polypeptide is within the scope of the relevant art, including, for example, the use of genetic engineering or protein engineering methodologies to obtain a polypeptide sequence containing, for example, the classical Asn-X-Ser / Thr site for glycosylation linked to N- (asparagine), or a sequence containing Ser or Thr residues that are suitable substrates for 0-linked glycosylation, or sequences susceptible to C-mannosylation, glyphiation / glycosylphosphatidylinositol modification, or phosphoglycation, all of which may be identical in accordance with the criteria established in the art (for example, Spiro, 2002 Glybiology 12: 43R). Without wishing to be bound by any particular theory or mechanism, glycosylated constructs such as fusion proteins which have particular amino acid sequences may beneficially possess attributes associated with one or more of improved solubility, improved stability in solution, improved physiological stability, improved bioavailability. which includes in vivo biodistribution, and superior protease resistance, all in a statistically significant manner, relative to the constructs, which include fusion proteins, which have the same or highly similar amino acid sequences but which are lacking glycosyl portions. In certain preferred embodiments the constructs of the subject invention, such as the fusion protein constructs, may comprise a glycosylation site which is present in a linker as delivered by agui, and in certain other preferred embodiments the construction of the subject invention , for example, a fusion protein, comprises a glycosylation site that is present in a connection region, such as a pivot region polypeptide sequence as supplied by agui.

In certain preferred embodiments of the present invention, such as banners useful for gene therapy applications or in display systems or assays, such as screening tests (including 'library display systems and library selection tests), the construction, for example, an immunoglobulin fusion protein with binding domain, is a protein or glycoprotein that is capable of being expressed by a host cell in such a way that it localizes the cell surface. Constructs, such as immunoglobulin fusion proteins with binding domain, which localize the cell surface can do so in virtue of having naturally occurring or artificially introduced structural features that direct the fusion protein to the cell surface (eg, Nelson et al 2001 Trends Cell Biol. 11: 483; Ammon et al., 2002 Arch. Physiol. Biochem 110: 137; Kasai et al., 2001 J. Cell Sci. 114: 3115; Watson et al., 2001 Am. J. Physiol. Cell Physiol. 281: C215; Chatterjee et al., 200 J. Biol. Chem. 275: 24013) which includes by way of illustration and not limitation, secretory signal sequences, leader sequences, plasma membrane anchor domain polypeptides and transmembrane domains such as hydrophobic transmembrane domains (e.g., Heuck et al. ., 2002 Cell Biochem, Biophys 36: 89, Sadlish et al., 2002 Biochem J. 364: 777, Phoenix et al., 2002 Mol. Membrane Biol. 19: 1, Minke et al., 2002 Physiol. 82: 429) or glycosylphosphatidylinositol binding sites ("glipiation" sites, eg, Chatterjee et al., 2001 Cell Mol. Life Sci. 58: 1969; Hooper, 2001 Proteomics 1: 748; - Spiro, 2002 Glycobiol. 12: 43R), cell surface receptor binding domains, extracellular matrix binding domains, or any other structural feature that originates at least a desired portion of the population of fusion protein to localize in whole or in part, to the cell surface. Particularly preferred are fusion protein constructs comprising a plasma membrane anchor domain that includes a transmembrane polypeptide domain, typically comprising a membrane extension domain including a hydrophobic region capable of energetically favoring the interaction with the phospholipid fatty acyl tails that form the interior of the plasma membrane bilayer. Such features are known to those skilled in the art, who will be additionally familiar with the methods for introducing nucleic acid sequences encoding these characteristics into gene expression-engineered expression constructs, and with routine testing of such constructions to verify localization. of the cell surface of the product.

According to certain additional embodiments, a plasma membrane anchor domain polypeptide comprises such a transmembrane domain polypeptide and also comprises a cytoplasmic tail polypeptide, which refers to a region or portion of the sequence of polypeptide that comes in contact with the cytoplasmic face of the plasma membrane and / or is in contact with the cytosol or other cytoplasmic components. A large number of cytoplasmic tail polypeptides are known to comprise the intracellular portions of the plasma membrane transmembrane proteins, and the discrete functions have been identified by many such polypeptides, which include biological signal transmission (e.g. inhibition of protein kinases, protein phosphatases, G protein, cyclic nucleotides and other second messengers, ion channels, secretory pathways), release of biologically active mediator, stable or dynamic association with one or more components cytogenes ueleto, cell differentiation, cellular activation, mitogenesis, cytostasis, apoptosis and the like (eg, Maher et al., 2002 Immunol.Cell Biol.80: 131; El Far et al., 2002 Biochem J'365: 329; Teng et al., 2002 Genome Biol. 2REVIEWS : 3012; Simons et al., 2001 Cell Signal 13: 855; Furie et al., 2001 Thromb. Haemost 86: 214; Gaffen, 2001 Cytokine 14:63; Dittel, 2 000 Arch. Immuno 1. Ther. Exp. (Warsz.) 48: 381; Parnés et al. , 2000 Immunol. Rev. 176: 75; Moretta et al. , 2000 Semin. Immunol. 12: 129; Ben Ze'ev, 1999 Aim. N. Y. Acad.

Sci. 886: 37; Marsters et al. , Recent Program. Horm. Res. 54: 225).

Figure 70 illustrates the binding, for example, of FcRIII soluble fusion proteins (CDl6) conjugated with fluorcein to 2H7 scFv binding domain constructs that are bound to CD20, expressed by cells, CHO cells in this example. The binding of CD16 to a construct of the invention, for example, a scFv binding domain construct, provides an example of a screening tool that can be used to detect and / or quantify changes in CDl6 binding to altered constructions of the invention, including scFv binding domain constructs, which contain specific site or site mutations, substitutions, deletions or other alterations. Changes in CD16 binding properties can be reflected, for example, in changes in the binding of any high affinity protein CD16 (158V) or low affinity protein CD16 (158F) or both.

A schematic representation of an example of such selection processes is diagrammed in the second drawing of Figure 70, in which the constructions with domain of scFv junctions are displayed on the cell surface of mammalian cells. The molecules with scFv binding domain in this example are displayed on the cell surface through a molecule that serves as a transmembrane domain anchor. These molecules can represent, for example, a simple scFv binding domain construct or can be introduced into a population of mammalian cells as a library of such molecules. Transfected cells with altered binding properties can then be, for example, separated, sorted or otherwise isolated from other cells by altering the requirement of selection conditions or using CDl6 fusion proteins as a binding probe. Cells expressing the scFv-Ig molecules with altered binding to any high affinity allele CDl6 (158V) or low affinity allele CDl6 (158F) or both, for example, can be isolated.

This deployment system can be used, for example, to create a library of constructions of the invention with tail regions mutated or otherwise altered with short stretches of CH2 sequence replaced with randomized oligonucleotides or, for example, randomization of single residue with all possible amino acid substitutions, natural or unnatural, which includes synthetic amino acids. Once such a library is constructed, it can be transfected into appropriate cells, eg, COS cells, by methods known in the art. The transfectants can then be linked to, for example, labeled CD16 constructs, and separated or classified based on their relative or desired binding properties to multiple allelotypes / isoforms. The desired cells can be harvested, and the DNA, for example, plasmid DNA, isolated and then transformed into, for example, bacteria. This process can be repeated iteratively multiple times until the desired single clones are isolated from mammalian host cells. See Seed B and Aruffo A, Pro. Nat 'l Acad Sci USA 1987 84: 3365-3369; Aruffo A and Seed B, Pro. Nat 'l Acad Sci USA 1987 84: 8573-8577.

One such use of this type of selection system, for example, is for the identification and / or isolation of constructions of the invention which have tail regions, or tail regions, which bind equally well to both the high alleles. and low affinity of CD16 with the goal of improve effector functions mediated by scFv 'binding domain constructs in multiple subpopulations of patients. Constructs of the invention having tail regions, or tail regions with altered binding properties to other Fe receptors can also be selected using a deployment system, for example, the deployment system described. Other display systems that do not glycosylate proteins, for example, those that use bacteriophage or yeast, are not generally desired for the selection of constructs of the invention that have Ig-based tail regions, or Ig-based tail regions, with properties of FcR binding altered. Most non-mammalian systems, for example, do not glycosylate proteins.

The expression of the constructs of the invention, for example, the scFv binding domain constructs, expressed on the surface of a mammalian cell by the incorporation of an appropriate molecule in the construct, for example, the incorporation of a transmembrane domain or of a GPI anchor signal, they also have utility in the deployment system which are useful, for example, for the selection of constructions of the invention, for example, altered scFv binding domain molecules that will be produced at higher or desired levels. In one such embodiment, cells which are useful in the production of glycosylated proteins, for example, mammalian cells such as COS cells, are transfected with a library of scFv binding domain constructs in a plasmid which directs its expression to the cell surface. Cells, such as COS cells, which express the highest or desired level of the scFv binding domain molecules are selected by techniques known in the art (e.g. separation, sterile cell sorting, magnetic globule separation, etc.) , and DNA, for example, plasmid DNA, is isolated for transformation into other cells, for example, bacteria. After one or more rounds of single selection clones are isolated which encode scFv binding domain molecules capable of a higher or desired level of expression. The isolated clones can then be altered to remove the membrane anchor and expressed in an appropriate cell system, for example, a mammalian cell system, where the scFv binding domain constructs will be produced, for example, by secretion in the culture fluid to desired levels. Without wishing to be bound by any particular mechanism or theory, it is believed that they result from the common reguisite of secreted glycoproteins and cell surface glycoproteins for a signal peptide and process through golgi for expression. Thus, the selection of a molecule that shows improved expression levels on a cell surface will also result in the identification of a molecule that has an improvement in secreted protein levels. • These deployment systems using a construction of the invention can also be used to select and / or identify and / or isolate affinity variants of the binding domain with a construct.

Particularly preferred are such displays and / or selection systems, for example, which include or utilize constructs including (1) a polypeptide sequence with immunoglobulin variable region, which includes native and engineered VH and / or VL, and / or single-chain variable region (sFv) sequences, and including, for example, a mutation, alteration or deletion in an amino acid in a site or sites that correspond to one or more of the amino acid positions 9, 10, 11, 12, 108, 110, 111, and 112, in a VH region sequence (which includes in the VH region sequence within a scFv or other construct), and / or (2) a polypeptide sequence of variable region of immunoglobulin, which includes VH and / or VL native or engineered and / or single-chain variable region (sFv) sequences, and which include, for example, a mutation, alteration or deletion at a site or sites corresponding to one or more of the amino acid positions 12, 80, 81, 82, 83, 105, 106, 107, and 108 in a light chain variable region sequence (which includes a VL region sequence within the scFv or another construction). Especially preferred are such display and / or selection systems that include or use constructs that include a VH sequence engineered (whether or not in association with one or more other sequences, which include derived immunoglobulin or other contained sequences, e.g. , within a construct containing sFv or scFv), which includes a mutation, alteration or deletion of an amino acid at a site or sites corresponding to an amino acid position 11. The amino acid VH11, if substituted, it can be substituted with another amino acid as described herein, or by another molecule as desired.

In the context of other methods of using constructs of the invention, which include immunoglobulin fusion proteins with binding domain, for the treatment of a malignant condition or of a disorder or B cell disorders as provided herein, they include, for example , by one or more of the number of gene therapy methods and related construction delivery techniques, the present invention also contemplates certain embodiments wherein a construct, for example, an immunoglobulin fusion protein with binding domain comprising a polypeptide with Plasma membrane anchor domain is expressed (or is capable of expression) on a cell surface and can additionally comprise a cytoplasmic tail polypeptide comprising a polypeptide sequence signaling apoptosis. A number of polypeptide sequences signaling apoptosis are known in the art, as reviewed, for example, in When Cells Die: A Comprehensive Evaluation of Apoptosis and Programmed Cell Death (RA Lockshin et al., Eds., 1998 John Wiley & Sons, New York, see also, for example, Green et al., 1998 Science 281: 1309 and references cited there; Ferreira et al. , 2002 Clin. Canc. Res. 8: 2024; Gurumurthy et al. , 2001 Cancer Metastas. Rev. 20: 225; Kanduc et al. , 2002 Int. J Oncol. 21: 165). Typically a polypeptide sequence signaling apoptosis comprises all or a portion of, or is derived from or constructed of, a polypeptide with a receptor death domain, eg, FADD (eg, Genbank Access Nos. U24231, U43184, AF009616, AF009617, NM_012115), TRADD (for example, Genbank Access No. NM003789), RAIDD (for example, Genbank Access No. U87229), CD95 (FAS / Apo-1 for example, Genbank Access Nos. X89101, NM003824, AF344850, AF344856), TNF-α-receptor-1 (TNFRl, eg, Genbank Access Nos. S63368, AF040257), DR5 (eg, Genbank Access No. AF020501, AF016268, AF012535), an ITIM domain (eg, Genbank Access Nos. AF081675 , BC015731, N1VI 006840, NM006844, NM-006847, XM_017977, see, eg, Billadeau et al., 2002 J Clin Invest. 109: 161), an ITAM domain (eg, Genbank Access Nos. NM005843, NM003473, BC030586; see, for example, Billadeau et al., 2002), or other polypeptides of death domain receptors associated with apoptosis known in the art, for example, TNFR2 (eg, Genbank Access No. L49431, L49432), caspase / procaspase-3 (eg, Genbank Access No. XM_54686), caspase / procaspase-8 (e.g., AF380342, NM_004208, NM 001228, NM-033355, NM 033356, NM-033357, NM 033358), caspase / procaspase-2 (e.g., Genbank Access No. AF314174 , AF314175), etc.

Cells in biological samples suspected of suffering from apoptosis can be examined for morphological changes, permeability or other changes that are indicative of an apoptotic state. For example, by way of illustration and not limitation, apoptosis in many types of cells can cause altered morphological appearance such as plasma membrane bladders, cell shape changes, loss of substrate addition properties or other morphological ones that can be easily detected by a person having ordinary skill in the art, for example when using light microscopy. As another example, cells undergoing apoptosis may exhibit chromosome fragmentation and disintegration, which may be evident by microscopy and / or through the use of specific chromatin or DNA-specific dyes that are known in the art, including fluorescent dyes. Such cells may also exhibit membrane permeability properties of altered plasma or they can be easily detected through the use of vital dyes (for example, propidium iodide, trypan blue) or by detecting leakage of dehydrogenated lactate into the extracellular medium. These and other means for detecting apoptotic cells by morphological criteria, altered plasma membrane permeability, and related changes will be apparent to those familiar with the art.

In another embodiment of the invention wherein a construct, such as the immunoglobulin fusion protein with binding domain, which is expressed on a cell surface comprises a plasma membrane anchoring domain having a transmembrane domain and a cytoplasmic tail comprising an apoptosis signaling polypeptide, cells in a single sample can be assayed for transposition of phosphatidylserine (PS) from cell membrane of the interior to the outer flake of the plasma membrane, which can be detected, for example, by measure the outer leaflet that binds to the PS specific protein annexin. Martin et al. , J. Exp. Med. 182: 1545, 1995; Fadok et al. , J. Immunol 148: 2207, 1992. In still other related modalities of the invention, which include embodiments wherein a construct, such as an immunoglobulin fusion protein with binding domain, are expressed on the cell surface and comprise a plasma membrane anchor domain having a polypeptide that signals apoptosis and also that includes embodiments wherein the construct, such as an immunoglobulin fusion protein with binding domain, is a soluble protein that lacks a membrane anchoring domain and that is capable of inducing apoptosis, a cellular response to apoptosis determined by an assay for induction of specific protease activity in any member of a family of apoptosis-activated proteases known as caspases (see, e.g., Green et al., 1998 Science 281: 1309). Those of skill in the art are readily familiar with the methods for determining caspase activity, for example determining caspase-mediated cleavage of specifically recognized protein substrates. These substrates may include, for example, poly- (ADP-ribose) polymerase (PARP) or other peptides of natural or synthetic occurrence and olive proteins by caspases that are known in the art (Ellerby et al., 1997 J. Neurosci 17: 6165). He Synthetic peptide Z-Tyr-Val-Ala-Asp-AFC (SEQ ID NO.

NO .:;), wherein "Z" denotes a benzoyl carbonyl moiety and AFC indicates 7-amino-4-trifluoromethylcoumarin (Kluck et al., 1997 Science 275: 1132, Nicholson et al., 1995 Nature 376: 37), It is one such substratum. Other non-limiting examples of substrates include nuclear proteins such as Ul-70 kDa and DNA-PKcs (Rosen and Casciola-Rosen, 1997 J. Cell. Biochem. 64:50; Cohen, 1997 Biochem. J. 326: 1). Cellular apoptosis can also be detected by the determination of cytochrome c that has escaped the mitochondria in apoptotic cells (eg, Liu et al., Cell 86: 147, 1996.) Such detection of cytochrome c can be developed spectrophotometrically, immunochemically or by other well-established methods for determining the presence of a specific protein People who are ordinarily skilled in the art will readily appreciate that there could be other suitable techniques for quantifying apoptosis.

Particularly preferred embodiments of constructs useful for gene therapy applications, which include constructs that include a plasma membrane anchor domain and / or tail polypeptide cytoplasmic (which includes, for example, a sequence that signals apoptosis), are such constructions that include (1) a polypeptide sequence with immunoglobulin variable region, which includes native and engineered VH and / or VL and / or single chain variable region (sFv) sequences, and which include, for example, a mutation, alteration or deletion of an amino acid at a site or sites corresponding to one or more of amino acid positions 9, 10, 11, 12, 108, 110, 111, and 112 in a sequence of the VH region (including in a sequence of the VH region within a scFv or other construction), and / or (2) a polypeptide sequence or immunoglobulin variable region, which includes VH and / or native or engineered VL engineered and / or single-chain variable region (sFv) sequences, and which include, for example, a mutation, alteration or deletion at a site or sites corresponding to a or more than amino acid positions 12, 80, 81, 82, 83, 105, 106, 107, and 108 in a light chain variable region sequence (including in a VL region sequence within a scFv or other construct) . Constructs that include a VH sequence engineered (whether or not associated with one or more of the others) are particularly preferred. sequences, which include derived immunoglobulins and other sequences contained, for example, within a construct containing sFv or scFv), which includes a mutation, alteration, or deletion at an amino acid at a site or sites corresponding to an amino acid position 11. The amino acid VH11, if substituted, can be substituted with another amino acid as described herein, or by means of another molecule as desired.

Once a construct, such as for example an immunoglobulin fusion protein with binding domain, as provided herein has been designed, the polynucleotides that include the DNAs encoding the construct, where this or a relevant portion thereof is a polypeptide , they can be synthesized in whole or in part by way of oligonucleotide synthesis as described for example, in Sinha et al. , Nucleic Acids Res. , 12: 4539-4557 (1984); assembled via PCR as described, for example, in Innis, Ed., PCR Protocols, Academic Press (1990) and also in Better et al. J. Biol. Chem. 267: 16712-16118 (1992); cloned and expressed by standard procedures as described, for example, in Ausubel et al. , Eds., Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989) and also in Robinson et al. , Hum. Antibod. Hybridomas, 2: 84-93 (1991); and assayed for the desired activity, for example, bound to an objective, or specific antigen binding activity, as described, for example, in Harlow et al. , Eds., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (1988) and Munson et al. , Anal. Biochem. , 107: 220-239 (1980).

The preparation of single polypeptide chain binding molecules of the Fv region, single chain Fv molecules, are known in the art. See, for example, U.S. Pat. No. 4,946,778. In the present invention, single chain Fv-like molecules that can be included in constructions of the invention can be synthesized by encoding a first variable region of the heavy or light chain, followed by one or more linkers of the variable region of the corresponding light or heavy chain, respectively. The selection of several suitable linkers between the two variable regions is described in U.S. Pat. No. 4,946,778 (see also, for example, Huston et al., 1993 Int. Coating, Immunol.10: 195). An example linker described is (Gly-Gly-Gly-Gly-Ser) 3, but can be of any desired length. The linker is used to convert the light and heavy chains naturally added but chemically separated into the amino terminal antigen binding portion of a single polypeptide chain, for example, where this antigen binding portion will be bent into a structure similar to the original structure made of two polypeptide chains, or one that has otherwise the ability to bind to a target, e.g., a target antigen. For those constructs that include a scFv as a binding region, a native immunoglobulin pivot or engineered as a connection region, and one or more heavy chain constant regions native or engineered as a binding region, sequences of nucleotides encoding the variable regions of the heavy and light chains native or engineered, linked to a sequence encoding a linker, are linked to a nucleotide sequence encoding native or engineered antibody constant regions, as desired . The constant regions can be those that allow the resulting polypeptide to form interchain disulfide bonds to forming a dimer, and containing the desired effector functions, such as the ability to mediate ADCC, CDC, or fix complement, although native or engineered constant regions that do not favor the dimer or other multimer or aggregation function are preferred. For a construction, such as an immunoglobulin-like molecule of the invention that is intended for use in humans, including sequences that have cant regiand / or desired cant functiwill typically be human or substantially human or humanized to minimize a potential anti-human immune resp and to provide appropriate or desired effector functi The manipulation of the sequences encoding the cant regiof the antibody has been referenced in the PCT publication of Morrison and Oi, WO 89/07142. In preferred embodiments, the CH1 domain is deleted in whole or in part from a tail region that includes, or csts essentially of, or csts of, a native or engineered immunoglobulin cant region (e.g., the native cant region or engineered CH2 and / or CH3, or the native or engineered cant region CH2 and / or CH3 and / or CH4), and the carboxyl terminus of the ligated region, for example, a bound domain polypeptide such as an immunoglobulin variable region polypeptide, is attached to the amino terminus of, for example, a CH2 via a link region, eg, a native pivot region polypeptide or engineered according to supplied here.

As described above, the present invention provides recombinant expression constructs capable of directing the expression of constructs of the invention including immunoglobulin fusion proteins and binding domain, as provided herein. The amino acids that occur in the various amino acid sequences referred to herein are identified according to their single-letter abbreviations or their three well-known letters. The nucleotides, which occur in the various DNA sequences or fragments thereof referred to herein, are designated with the standard single-letter designations routinely used in the art. A given amino acid sequence may also involve similar but changed amino acid sequences, such as those having only minor changes, for example, by way of illustration and not as limitation chemical covalent modifications, insertions, deletions and substitutions, which they may additionally include conservative substitutions or substitutions with amino acids of non-natural occurrence. The amino acid sequences that are similar to one another may share substantial regions of sequence homology. Similarly, the nucleotide sequences may involve substantially similar nucleotide sequences having only minor changes, for example as a way of illustration and not as limitation, modifications, insertions, deletions and covalent chemical substitutions, which may additionally include silent mutations due to the degeneracy of the genetic code. Nucleotide sequences that are similar to one another may share regions of substantial sequence homology.

The presence of a malignant condition in a subject refers to the presence of dysplastic, cancerous and / or transformed cells in the subject, including, for example, transformed neoplastic, tumor cells, inhibited in contact or oncogenetically transformed or the like (e.g. melanoma, carcinomas such as adenocarcinoma, squamous cell carcinoma, small cell carcinoma oat cell carcinoma etc., sarcomas such such as chondrosarcoma, osteosarcoma, etc.) that are known in the art and for which the diagnostic and classification criteria have been established. In preferred embodiments contemplated by the present invention, for example, such as cancer cells are malignant hematopoietic cells, such as transformed cells of the lymphoid lineage and in particular B-cell lympholas and the like; cancer cells may in certain preferred embodiments also be epithelial cells such as carcinoma cells. The invention also contemplates disorders of B cells, which may include certain malignant conditions affecting B cells (for example B-cell lymphoma) but which is not intended to be limited to, and which is also intended to involve diseases autoimmune and in particular, diseases, disorders and conditions that are characterized by the production of autoantibodies, for example.

The autoantibodies are antibodies that react against their own antigens. Autoantibodies are detected in various autoimmune diseases (ie, a disease, disorder or condition where an immune system host generates an anti and inappropriate "auto" immune reaction) where they are involved in the activity of the disease. Current treatments for various autoimmune diseases include immunosuppressive drugs that require continued administration, lack specificity, and cause significant side effects. New teachings that can eliminate the production of autoantibodies with minimal toxicity will be directed to a medical need to an unsolved one of a spectrum of diseases that affect many people. The constructions of the subject invention, which includes ligand-immunoglobulin domain fusion proteins are designed, for example, for improved penetration into lymphoid tissues. B-cell depletion disrupts the cycle of production of autoantibodies, and allows the immune system to reposition itself as new B lymphocytes are produced from precursors in the bone marrow.

A number of diseases, disorders, and conditions have been identified for which the beneficial effects have been believed, according to a non-limiting theory, result from B-cell depletion therapy.

Disorders, diseases, and conditions include but are not limited to, Grave's disease, Hashimoto's disease, rheumatoid arthritis, systemic lupus erythematosus, Sjotrens purple thrombocytopenic immune syndrome, multiple sclerosis, severe myiastemia, scleroderma, psoriasis , Bowel Inflammation disease, including Crohn's disease and Ulcerative colitis. Inflammatory bowel disease including Crohn's disease and ulcerative colitis are autoimmune diseases of the digestive system.

The present invention further relates to nucleotide constructs encoding constructs of the invention, for example, domain-immunoglobulin binding fusion proteins and in particular methods for administering recombinant constructs encoding such proteins for gene therapy applications that can be express, for example, as analogous fragments and derivatives of such polypeptides.

The terms "fragments", "derivatives" and "analogs" when referring to constructions of the invention include, for example, fusion polypeptides or immunoglobulin-binding domain fusion proteins, refers to any construct such as a fusion polypeptide or immunoglobulin-binding domain fusion protein, which retains essentially the same biological function or biological activity as such. polypeptide. Thus, an analog includes a pro- or prepro-form of a construct, for example, a pro-protein that can be activated by breaking the pro-protein portion to produce an active construct, such as a fusion polypeptide. linked immunoglobulin-domain.

A fragment, derivative or analogue of a construct of the invention, eg, a fusion polypeptide or immunoglobulin-domain binding fusion protein, includes the fusion polypeptides or domain-immunoglobulin binding fusion proteins encoded by the cDNAs referred to herein, may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such a substituted amino acid residue may or may not be be coded by the genetic code, (ii) one in which one or more residues of amino acids includes a substituent group, or (iii) one of such additional amino acids are fused or otherwise connected to the construct, for example, a domain-immunoglobulin-binding fusion polypeptide, including amino acids that are employed for the detection or the specific functional alteration of the construct, including such constructs as a domain-immunoglobulin binding fusion polypeptide or a protein sequence. Such fragments, derivatives and the like are expected to be within the reach of those skilled in the art from the teachings given herein.

Constructs, including polypeptide constructs, of the present invention include, for example, fusion polypeptides and immunoglobulin-domain binding fusion proteins having binding regions such as the amino acid sequences of domain binding of the polypeptide that are identical or similar to sequences known in the art, or fragments or portions thereof. For example as a further illustration but not limitation, an extracellular domain of human molecule CD154 [SEQ ID No.:_] is contemplated for use in accordance with the present invention, as are the portions of such polypeptides and / or polypeptides having at least about 70% similarity (preferably greater than 70% identity) and more preferably about 90% similarity (more preferably greater than 90% identity) to the polypeptide reported and still more preferably about 9% similarity (still more preferably greater than 95% identity) to the reported polypeptides and portions of such polypeptides, wherein such portions of a domain-immunoglobulin binding fusion polypeptide, for example, generally contain at least about 30 amino acids and more preferably about 50 amino acids. Extracellular domains include, for example, portions of a cell surface molecule, and in particularly preferred embodiments cell surface molecules that are integral with membrane proteins or that comprise a transmembrane domain of plasma membrane expansion, which are constructed to extend beyond the outer leaflet of the phospholipid bilayer of the plasma membrane when the molecule is expressed on a cell surface, preferably in a manner that exposes the extracellular domain portion of such a molecule to the environment external of the cell, also known as extracellular medium. Methods for determining whether a portion of a cell surface molecule comprises an extracellular domain are well known in the art, and include, for example, experimental determination (e.g., direct or indirect labeling of the molecule, evaluation of whether the molecule can be structurally altered by agents in which the plasma membrane is not permeable such as proteolytic or lipolytic enzymes) or topological prediction based on the structure of the molecule (e.g., analysis of the amino acid sequence of a polypeptide) or other methodologies .

As used herein, an "amino acid" is a molecule having the structure wherein a central carbon atom (the (-carbon) atom is bonded to a hydrogen atom, a carboxylic acid group (the carbon atom of the carbon atom). which is referred to herein as a "carboxyl carbon atom"), an amino group (the nitrogen atom to which we refer here is an "amino-nitrogen atom"), and a side-chain group, R. When incorporated Within a peptide, polypeptide or protein, an amino acid loses one or more atoms of its amino and carboxylic groups in the reaction of Dehydration that links one amino acid to another. As a result, when it has been incorporated into a protein, an amino acid can also be called an "amino acid residue". In the case of naturally occurring proteins, a R group of the amino acid residue differs from the 20 amino acids of which the proteins are typically synthesized, although one or more amino acid residues in a protein can be derived or modified after incorporation within the protein in biological systems (eg, by glycosylation and / or by the formation of cystine through the oxidation of the thiol side chains of 2 non-adjacent cysteine amino acid residues, resulting in a covalent disulfide bond that frequently plays an important role in the stability of the folded conformation of a protein, etc.). As those skilled in the art will appreciate, amino acids of non-natural occurrence can also be incorporated into proteins, particularly those produced by synthetic methods, including solid state and automated synthesis methods. Examples of such amino acids include, without limitation, α-amino isobutyric acid, 4-amino butyric acid, L-amino butyric acid, 6-amino hexanoic acid, 2-amino acid isobutyric acid, 3-amino propionic acid, ornithine, norlensin, norvaline, hydroxproline, sarcosine, citraline, cysteic acid, t-butylgliin, t-butylalanine, phenylethycin, cyclohexylalanine, ß-alanine, fluoro-amino acids, designer amino acids (for example, β-methyl amino acids, α-methyl amino acids, Na-methyl amino acids) and amino acid analogs in general, in addition when one carbon atom has four different groups (as is the case with the 20 amino acids used by biological systems) to synthesize proteins, except for glycine, which has hydrogen atoms linked to the α-carbon atom), two enantiomerically designated forms of each amino acid are designated D and L. In mammals, only L amino acids are incorporated into naturally occurring polypeptides. The present invention visualizes proteins that incorporate one or more D- and L-amino acids as well as proteins comprised of only D or L residues of amino acids.

Here, the following abbreviations can be used for the following amino acids (and residues thereof): alanine (Ala, A); arginine (Arg, R); asparagin (Asn, N); aspartic acid (Asp, D); cytine (Cys, C); glycine (Gly, G); glutamic acid (Glu, E); glutamine (Gln, Q); histidine (His, H); isoleucine (lie, I); leucine (Leu, L); lysine (Lys, K); methionine (Met, M); phenylalanine (Phe, F); proline (Pro, P); serine (Ser, S); threonine (Thr, T); tryptophan (Trp, W); tyrosine (Tyr, Y); and Valina (Val, V).

Non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionines. Neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, sparagin, and glutamine. The positively charged basic amino acids include arginine, lysine and histidine. Acidic amino acids negatively charged include aspartic acid and glutamic acid.

"Proteins" refer to any polymer of two or more individual amino acids (whether of natural occurrence or not) linked by peptide bonding, and which occur when the carboxyl carbon atom of the carboxylic acid group bonded to the α-carbon of a The amino acid (or amino acid residue) becomes covalently bound to the amino-nitrogen atom of the amino group linked to the α-carbon of an adjacent amino acid. The term "proteins" is it understands that it includes the terms "polypeptides" and "peptides" (which can sometimes be used interchangeably here) within their meaning. In addition, proteins comprising multiple polypeptide subunits or other components are also understood to be included within the meaning of "proteins" as used herein. Similarly, protein fragments, peptides and polypeptides are also within the scope of the invention and can be referred to herein as "proteins".

In biological systems (whether they are in vivo or in vitro, including cell-free systems) the particular amino acid sequence of a given protein (ie, the "primary structure" of the polypeptide, when written from the amino terminal to the carboxy terminal) is determined by the nucleotide sequence of the coding portion of a mRNA, which in turn is specified by the genetic information, typically the genomic DNA (which, for purposes of this invention, is understood to include the DNA organelle, example, mitochondrial DNA and chloroplast DNA). Of course, any type of nucleic acid that constitutes the genome of a particular organism (for example, double-helical DNA in the case of most animals and plants, single helix RNA, or double helix in the case of some viruses etc.) is understood to code for the gene product of the particular organism. The messenger RNA is translated onto a ribosome, which catalyzes the polymerization of a free amino acid, the particular identity of which is specified by the particular codon (with respect to mRNA, three adjacent ribonucleotides A, G, C, or U in the region of mRNA coding) the mRNA is then translated, to a nascent polypeptide. Recombinant DNA techniques have allowed the large-scale synthesis of proteins and polypeptides (for example human insulin, human growth hormone, erytropoietin, granulocyte colony-stimulating factor, etc.) having the same main sequence as when produced naturally in living organisms. Additionally, such technology has allowed the synthesis of analogs of these and other proteins, said analogs may contain one or more deletions, insertions, and / or amino acid substitutions when compared with proteins. The recombinant DNA technology also allows the synthesis of completely new proteins.

In non-biological systems (for example, those that use solid state synthesis), the primary structure of a protein (which also includes localization of disulfide bonds (cystine)) can be determined by the user. As a result, polypeptides having a primary structure that duplicates that of a biologically produced protein can be achieved, as can analogs of such proteins. In addition completely novel polypeptides can also be synthesized, such as proteins that incorporate amino acids of non-natural occurrence.

As is known in the art, "similarity" between two polypeptides can be determined by comparing the amino acid sequences (including the amino acid substitutes conserved there) of a polypeptide with the sequence of a second polypeptide. The fragments or portions of the nucleic acids encoding the polypeptides of the present invention can be used to synthesize full-length nucleic acids of the present invention. How it is used here, "percent identity" refers to the percentage of identical amino acids located in the residue positions of corresponding amino acids when two or more polypeptides are aligned and t sequences are analyzed using, for example, a sparse BLAST algorithm (e.g.

Altschul et al., 1997 Nucí. Ac. Res .. 25: .3389; Altschul et al., 1990 J. Mol. Biol., 215: 403-410) which leaves the spaces of the sequences, and the errors of the sequence according to the default weights supplied by the National Institutes of Health / the NCBI database (Betesda, MD, see www.ncbi.nlm.nih.gov/cgi-bin/BLAST/nph-newblast). Other alignment methods include the BLITZ (MPsrch) (Sturrock &_ Collins, 1993), and FASTA (Pearson and Lipman, 1988 Proc. Nati Acad. Sci. USA. 85: 2444-2448).

The term "isolated" means, in the case of a material of natural occurrence, that the material is or has been removed from, or is no longer associated with, its natural or original environment. For example, a naturally occurring nucleic acid or protein or naturally occurring polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide separated from some or all of the materials coexisting in the natural system is isolated. Such nucleic acids could be part of a vector and / or such nucleic acids or polypeptides could be part of a composition, and still be isolated that Such a vector or composition is not part of its natural environment. The term "isolated", in the case of naturally occurring materials, such as a recombinantly manufactured construction of the invention, includes material that is substantially or essentially free of components that normally accompany it during manufacture, such as, for example, proteins and peptides that have been purified to a desired degree, preferably, for example, so that they are at least about 80% pure, more preferably at least 90% and still more preferably at least 95% as measured by techniques known in the art.

The term "gene" means a segment of DNA involved in the production of a polypeptide chain; it can also include preceding and subsequent regions to a polypeptide coding region, for example, a "leader or colero" as well as intervening sequences (introns) between relevant individual coding segments (exons).

As described herein, the invention provides constructs that include domain-immunoglobulin binding fusion proteins, which may be partially or completely encoded by nucleic acids having a binding region coding sequence such that, for example, a sequence The ligand domain coding is fused or otherwise is linked in frame to a sequence encoding a native immunoglobulin domain or engineered to deliver for the expression of, for example, a fused domain domain polypeptide sequence. or otherwise connected to an additional functional polypeptide sequence that allows, for example by way of illustration and not limitation, the detection, functional alteration, isolation and / or purification of the fusion protein. Such fusion proteins can allow the functional alteration of a binding domain by means of containing polypeptide sequences derived from additional immunoglobulin that influence the behavior of the fusion product, for example (and as described above) by means of reducing the availability of sulphydryl groups for participation in disulfide bond formation, and for means of conferring the ability to enhance ADCC and / or CDC and / or fixed complement.

The modification of a polypeptide can be effected by any means known to those skilled in the art. The preferred methods lie here in the modification of the DNA coding, for example, a fusion protein and expression of the modified DNA, encoding DNA of one of the constructions of the invention, for example, one of the domain-immunoglobulin binding fusions discussed herein, for example, can be altered or mutagenized using standard methodologies, including those described below. For example, cysteine residues that may otherwise facilitate the formation of multimers or promote particular molecular conformations may be removed from a polypeptide or replaced, for example cysteine residues that are responsible for or participate in the formation of aggregates. If necessary, for example, the identity of the cysteine residues that contribute to aggregate formation can be determined empirically, by removing and / or replacing a cysteine residue and ensuring that the protein is added in solutions containing physiologically acceptable buffers and salts. In addition, fragments of domain-immunoglobulin binding fusions can be constructed and used. As noted above, the anti-receptor / ligand binding domains for many immunoglobulin-domain binding fusion candidates have been delineated, so that a person skilled in the art can easily select the appropriate polypeptide domains for the inclusion 'in products encoded in the present expression constructs.

Conservative amino acid substitutions are well known and can be generally made without altering the biological activity of the immunoglobulin-domain binding fusion protein molecule. For example, such substitutions are generally made by means of exchanging within the groups of polar residues, charged residues, hydrophobic residues, small residues and the like. If necessary, such substitutions can be empirically determined purely by testing the resulting modified protein for ability to bind to surface receptors. suitable cells in in vitro biological assays, or to bind appropriate antigens or desired target molecules.

The present invention is further related to nucleic acids that hybridize to constructs of the invention, including for example, polynucleotide sequences encoding domain-immunoglobulin binding fusion proteins as supplied chimerically, or their complements, can be easily visible to those familiar with the technique, if there is at least about 70%, preferably about 80 to 85%, more preferably at least about 90%, and still more preferably at least about 95%, 9.6%, 97%, 98% or 99% identity between the sequences.

The present invention relates particularly to nucleic acids which hybridize under conditions that are astricted to, for example, the nucleic acids encoding the domain-immunoglobulin binding fusion as referred to herein. As used herein, to "hybridize" under conditions of a specified strict is used to describe the stability of hybrids formed between two single-stranded nucleic acid molecules. 'The strictness of Hybridization is typically expressed under conditions of ionic strength and temperature at which such hybrids are tuned and washed. The term "stringent conditions" refers to conditions that allow hybridization between polynucleotides. Stringent conditions can be defined by the salt concentration, the organic solvent concentration (for example formamide), the temperature, or other conditions well known in the art. In particular, the strict can be increased by reducing the salt concentration, increasing the concentration of organic solvents (for example formamide) or raising the hybridization temperature. For example, the stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Hybridization of stringent low can be obtained in the absence of organic solvent, for example, formamide, while very strict hybridization can be obtained in the presence of an organic solvent, (for example, at least about 35% formamide, more preferably at least 50% of formamide). Strict temperature conditions will ordinarily include temperatures of at least 30a C, more preferably at least about 37a C, and more preferably at least about 422C. Varying additional parameters, e.g., hybridization time, the Detergent concentration, for example, sodium dodecyl sulfate (SDS), and inclusion or exclusion of the DNA vehicle, are well known to those skilled in the art. Various levels of strictness are carried out by combining these various conditions as needed, and are within the skill of the art. Other typical stringent conditions "high", "medium" and "low" involve the following conditions or conditions equivalent to them: high rigor: 0.1 x SSPE or SSC, 0.1% SDS, 65 ° C; medium rigor: 0.2 x SSPE or SSC, 0.1% SDS, 50 ° C; and low stringency: 1.0 x SSPE or SSC, 0.1% SDS, 50 ° C. As is known to those skilled in the art, the variations of stringency of hybridization conditions can be achieved by altering the time, the temperature and / or the concentration of the solutions used for prehybridization, hybridization and washing steps, and suitable conditions may also depend in part on the sequence of particular nucleotides of the test specimen used, and the deletion, of the test nucleic acid sample. Accordingly, it will be appreciated that the proper conditions of rigor can be easily selected without undue experimentation where a desired selectivity of the specimen is identified based on its ability to hybridize to one or more sequences of some probands while not hybridizing to certain sequences of other probands.

As used herein, "preferred stringency conditions" generally refer to the hybridization that will occur if there is at least about 90 to 95% and more preferably at least about 97% identity between the sequences. Nucleic acid constructs that hybridize to, for example, the nucleic acids encoding the domain-immunoglobulin binding fusion are referred to herein, in preferred embodiments, polypeptides that encode which substantially retain the same biological function or activity as, for example, , the domain-immunoglobulin binding fusion polypeptides encoded by the cDNAs.

The nucleic acids of the present invention, also referred to herein as polynucleotides, can be in the form of RNA, for example, mRNA, or in the form of DNA, said DNA includes cDNA (also called "complementary DNA", which is a DNA molecule that is complementary to a specific messenger RNA), genomic DNA, and synthetic DNA. The DNA can be double-stranded or single-stranded, and if it is single-stranded, it can be the encoded or uncoded (antisense) chain. A coding sequence that encodes a construct of the invention, for example, a domain-immunoglobulin-binding fusion polypeptide for use in accordance with the invention may contain portions that are not identical to the coding sequence known in the art or described. here by portions thereof, or it may be a different coding sequence, which, as a result of the redundancy or degeneracy of the genetic code, encodes the same construction or portion thereof, including all or a portion of the bound fusion polypeptide of domain-immunoglobulin.

The nucleic acids encoding constructs of the invention, for example, fusion fusion polypeptides of Immunoglobulin domain, for use according to the invention may include, but not limited to: only the coding sequences for the construct such as a domain-immunoglobulin-binding fusion polypeptide; the coding sequence for the construct, such as a domain-immunoglobulin binding fusion polypeptide and additional coding sequence; the coding sequence for the construct, such as a domain-immunoglobulin binding fusion polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or 5 'and / or 3' sequences of non-coding the coding sequence for the domain-immunoglobulin binding fusion polypeptide or a portion or portions thereof, which for example may additionally include but not be limited to one or more regulatory nucleic acid sequences which may be a regulated promoter or regulatable, an enhancer, other transcriptional regulatory sequences, repressor binding sequence, regulatory regulatory sequence or any other regulatory nucleic acid sequence. Thus, the term "nucleic acid encoding" or "polynucleotide encoding" a construct, for example, a protein of Immunoglobulin-domain binding fusion, involves a nucleic acid that includes only coding sequence for, for example, a domain-immunoglobulin-binding fusion polypeptide as well as a nucleic acid that includes additional coding and / or non-coding sequences .

The nucleic acids and oligonucleotides for use as described herein can be synthesized by any method known to those skilled in the art (see, for example, WO 93/01286, US Patent Application Serial No. 07/723, 454; U.S. Patent No. '5, 218, 088; U.S. Patent No. 5, 175, 269; U.S. Patent No. 5, 109, 124). The identification of various oligonucleotides and nucleic acid sequences also involve methods known in the art. For example, the desired properties, lengths and other characteristics of the oligonucleotides useful for cloning are well known. In certain embodiments, synthetic oligonucleotides and nucleic acid sequences can be designed to resist degradation by nucleolytic enzymes of inbred host cells by containing such linkages as: phosphorothioate, methylphosphonate, sulfone, sulfate, cetyl, phosphorodithioate, phosphoramidate, phosphate esters, and other such bonds which have a proven utility in antisense applications. See, for example, Agrwal et al., Tetrehedron Lett. 28: 3539-3542 (1987); Miller et al., J. Am. Chem. Soc. 93: 6657-6665 (1971); Stec et al., Tetrehedron Lett. 26: 2191-2194 (1985); Moody et al., Nucí. Acids Res. 12: 4769-4782 (1989; Uznanski et al., Nucí. Acids Res. (1989); Letsinger et al., Tetrahedron 40: 137-143 (1984); Eckstein, Anne. Rev. Biochem. 367-402 (1985), Eckstein, Trends Biol. Sci. 14: 97-100 (1989), Stein In: Oligodeoxynucleotides, Antisense Inhibitors of Gene Expression, Cohen, Ed, Macmillan Press, London, pp. 97-117 (1989). ); Jager et al., Biochemistry 27: 7237-7246 (1988).

In one embodiment, the present invention provides truncated components (e.g., binding domain polypeptides, pivot region polypeptides, linkers, etc.) for use in a construct of the invention, e.g., a domain binding fusion protein. -immunoglobulin. In another embodiment of the invention, nucleic acids encoding a construction of the invention are provided, for example, a fusion protein of linked immunoglobulin domain having such truncated components. A truncated molecule can be any molecule that comprises less than the full-length version of the molecule of interest. The truncated molecules provided by the present invention can include truncated biological polymers and in preferred embodiments of the invention such molecules can be truncated nucleic acid molecules or chewed polypeptides. Truncated nucleic acid molecules have less than the full length of the nucleotide sequence as has been known or described in nucleic acid molecules, wherein such known or described nucleic acid molecule can be a nucleic acid molecule of natural occurrence , synthetic, or recombinant, provided that a person skilled in the art sees it as a full-length molecule. Thus, for example, truncated nucleic acid molecules corresponding to a gene sequence containing less than the full length of the gene wherein the gene comprises coding and non-coding sequences, promoters, enhancers and other regulatory sequences, sequences of flanking and the like, or other functional and non-functional sequences that are recognized as part of the gene. In another example, the acid molecules Truncated nucleic acids corresponding to a mRNA sequence contains less than the full length of mRNA transcript, which may include several translated or unknown regions as well as other functional and non-functional sequences.

In other preferred embodiments, the truncated molecules are polypeptides that comprise less than the full length of the amino acid sequence of a particular protein or polypeptide component. As used herein, "elimination" has the common meaning as understood by those skilled in the art, and can refer to molecules that lack one or more portions of a sequence from either the terminal or from a non-terminal region, relative to a corresponding molecule of full length, for example, as in the case of truncated molecules supplied herein. Truncated molecules that are linear biological polymers such as nucleic acid molecules or polypeptides can have one or more of the deletions from either the terminal of the molecules and / or one or more deletions from a non-terminal region of the molecule, wherein eliminations can be eliminations of between 1 to 1,500 nucleotides contiguous or amino acid residues, preferably between about 1 to 500 contiguous nucleotides or amino acid residue and more preferably between about 1 to 300 contiguous nucleotides or amino acid residue, including deletions from about, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31-40, 41-50, 51-74, 75-100, 101-150, 151-200, 201-250 or 251-299 contiguous nucleotides or amino acid residues. In certain preferred embodiments particularly truncated nucleic acid molecules can have a clearance of about 270 to 330 contiguous nucleotides. In certain more preferred embodiments, the truncated polypeptide molecules can have a deletion, for example, from about 80 to 140 contiguous nucleotides.

The present invention relates to variants of nucleic acids referenced herein that encode fragments, analogs and / or derivatives of a construct of the invention, eg, a domain-immunoglobulin-binding fusion polypeptide. The variants of the nucleic acids encoding the constructs of the invention, for example, ligand fusion proteins of immunoglobulin domain, can be allelic variants of natural occurrence of one or more portions of the nucleic acid sequences included there, or variants of non-natural occurrence of such sequences or portions or sequences, which include sequences varied by molecular engineering using, for example , methods known in the art for varying the sequences. As is known in the art, an allelic variant is an alternate form of a nucleic acid sequence which may have at least one of a substitution, a deletion or an addition of one or more nucleotides, any of which does not substantially alter or undesirably the function of the encoded domain-immunoglobulin binding fusion polypeptide.

The variants and derivatives of the constructs of the invention, for example, domain-immunoglobulin binding fusion protein, can be obtained by mutations of nucleotide sequences encoding, for example, domain-immunoglobulin-binding fusion polypeptides or any portion of them. Alterations of the native amino acid sequence can be carried out by any of a number of conventional methods. The Mutations can be introduced into particular sites, for example, by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites that allow binding to fragments of the native sequence. After binding, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution or deletion.

Alternatively, for example, site-specific mutagenesis procedures directed to the oligonucleotide can be employed to deliver an altered gene wherein the predetermined codons can be altered by substitution, deletion, or insertion. Exemplary methods of achieving such alterations have been described by Walder et al., 1986 Gene 42: 133; Bauer et al., 1985 Gene 37: 73; Craik, January 1985 BioTechniques 12-19; Smith et al., January 1985 Genetic Engineering: Principies and Methods BioTechniques 12-19; Costa 'GL, et al. , "Site-directed mutagenesis using a rapid PCR-based method," 1996 Methods Mol Biol. 57: 239-48; Rashtchian A., "Novel methods for cloning and engineering genes using the polymerase chain reaction," 1995 Curr Opin Biotechraol. 6 (1): 30-6; Sharon J, et al. , "Oligonucleotide-directed mutagenesis of antibody combining sites," 1993 lizt Rev Inziizunol. 10 (2-3): 113-27; Kunkel, 1985 Proc. Nati Acad. Sci. (JSA 82: 488; Kunkel et al., 1987 Methods in Enzymol 154: 367; and, U.S. Patent Nos. 4,518,584 and 4,737,462; As an example, DNA modification can be carried out by site-directed mutagenesis of the DNA encoding a combined protein with the use of DNA amplification methods using primers to introduce and amplify alterations in the DNA template, such as division by PCR by overlapping the extension (SOE). Site mutagenesis is typically adequate using a phage vector that has single chain or double chain forms, such as the M13 phage vectors, which are well known and commercially available. Other suitable vectors containing a single chain phage origin of replication can be used. See, for example, Veira et al., 1987 Meth. Enzymol. 15: 3. In general, site-directed mutagenesis is carried out by means of preparing a single chain vector encoding the protein of interest (for example all or a portion of the component of a binding domain-immunoglobulin binding protein given). An oligonucleotide primer containing the desired mutation within a region of DNA homology in the single chain vector is annealed over the vector followed by the addition of a DNA polymerase., such as polymerase I of E. coli DNA (Klenow fragment), which uses the double-stranded region as an initiator to produce a heteroduplex in which one strand encodes the altered sequence and the other the original sequence. The heteroduplex is introduced into the appropriate bacterial cells and clones including the desired mutation is selected. The resulting altered DNA molecules can be expressed recombinantly in appropriate host cells to produce the modified protein.

Equivalent DNA constructs that include the code for additions or substitutions of amino acid residues or sequences, or deletions of internal terminal or residues or sequences not required or desired for biological activity, for example, are also involved by the invention, for example, as discussed above, the sequences that encode Cys residues that are not desirable or essential for biological activity can be altered to cause the Cys residues to be removed or replaced with other amino acids for example, thus preventing the formation of incorrect or undesired intramolecular disulfide bridges after synthesis or renaturation .

A "host cell" or "recombinant host cell" is a cell that contains a vector, for example, an expression vector, or a cell that has otherwise been manipulated by recombinant techniques to express a protein of interest. Organisms include those organisms in which the recombinant production of constructs of the invention, for example, domain-immunoglobulin binding fusion products encoded by the recombinant constructs of the present invention can occur, such as bacteria (e.g., E. coli), yeasts (eg, Saccharomyces cerevisiae and Pichia pastoris), insect cells, and mammalian cells, including expression in vitro and in vivo. Host organisms may therefore include organism for construction, propagation, expression or other steps in the production of compositions supplied here. Hosts include subjects in whom immune responses take place, as described here. Currently preferred host organism for the production of constructs of the invention that produce glycosylated proteins are mammalian cells or other cell systems that allow the expression and recovery of glycosylated proteins. Other cell lines include inbred murine strains and murine cell lines, and human sand cell cell lines.

A DNA construct encoding a desired construction of the invention, for example, a domain-immunoglobulin binding fusion protein is introduced into a vector, eg, a plasmid, for expression in an appropriate host. In preferred embodiments, the host is a mammalian host, e.g., a mammalian cell line. The sequence encoding the ligand or the nucleic acid binding domain is preferably codon optimized for the expression of the particular host. Thus, for example, if a construct, for example, is a fusion of human immunoglobulin-domain binding and is expressed in bacteria, the codons can be optimized for bacterial use. For small coding regions, the gene can be synthesized as a single oligonucleotide. For larger proteins, the cleavage of multiple oligonucleotides, mutagenesis or other techniques known to those skilled in the art can be used. The nucleotide sequences in plasmids or other vectors that are regulatory regions, such as promoters and operators, are operationally associated with - > another for the transcription. The sequence of nucleotides encoding a domain-immunoglobulin binding fusion protein can also include DNA encoding a secretion signal, so long as the resulting peptide is a precursor protein. The resulting processed protein can be recovered from the periplasmic space or from the fermentation medium.

In preferred embodiments, the DNA plasmids can also include a transcription terminator sequence, as used herein, "a transcription terminator region is a sequence" that signals the termination of the transcript. The complete transcription terminator can be obtained from a gene that encodes the protein, which may be the same or different from the inserted immunoglobulin-domain binding fusion gene encoding the gene or source of the promoter. Transcription terminators are optional components in the expression systems herein, but are employed in the preferred embodiments.

Plasmids or other vectors used to chimeric include a promoter in operable association with the DNA encoding the protein or polypeptide of interest and are designated for the expression of proteins in suitable hosts as described above (eg, bacterial, murine or human) ) depending on the desired use of the plasmid (eg, administration of a vaccine containing sequences encoding the immunoglobulin-domain binding fusion) Suitable promoters for the expression of the proteins and polypeptides given herein are widely available and well known In the art, inducible constitutive promoters or promoters that are linked to regulatory regions are preferred.Such promoters include, for example, but not limited to, the T7 phage promoter and other T7-like phage promoters such as T3, T5. and the SP6 promoters, the trp, the lpp and lac promoters, such as lacUV5, from E. coli; the PIE or the polyhedrin gene promoter or the baculovirus / insect cell expression systems (see, for example, US Patent Nos. 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784) and inducible promoters from expression systems delivery eukaryotic For the expression of the proteins such promoters are inserted into the plasmid in operative linkage with a control region such as lac operon.

Preferred promoter regions are aguellas which are inducible and functional in mammalian cells, for example. Examples of inducible promoters and promoter regions suitable for bacterial expression include, but are not limited to: The lac operator of E. coli responsible for isopropyl β-D-thiogalactopyranoside (IPTG; see Nakamura et al., 1979 Cell 18: 1109-1117); The metallothionein promoter of metal regulatory elements responsible for the induction of heavy metals (e.g., zinc) (see, e.g., U.S. Patent No. 4,870,009); The lag T7 promoter lac responsible for the IPTG (see, U.S. Patent No. 4,952,496; and Studier et al., 1990 Meth Enzymol 185: 60-89) and the promoter TAC Depending on the expression host system to be used, the plasmids may optionally include a selectable marker gene or selectable marker genes that are functional in the host. Thus, for example, a selectable marker gene includes any gene that confers a phenotype on the bacterium that allows the transformed bacterial cells to be identified and grow selectively among a vast majority of untransformed cells. Selectable marker genes suitable for bacterial hosts, for example, include the ampicillin-resistant gene (Ampr), the tetracycline-resistant gene (Tcr) and the kanamycin-resistant gene (Kanr). The kanamycin-resistant gene is currently the preferred one for bacterial expression.

In various expression systems, plasmids or other vectors may also include DNA encoding a signal for secretion of the operably linked protein. Secretion signals suitable for use are widely available and are well known in the art. Prokaryotic and eukaryotic functional secretion signals in E. coli can be employed. Depending on the systems of expression, present in the preferred secretion signals may include, but not be limited to, those encoded by the following genes of E. coli ompA, ompT, ompF, ompC, beta-lactamase, and alkaline phosphatase and the like (von Heijne, J Mol. Biol. 184: 99-105, 1985). In addition, the secretion signal of bacterial pelB gene (Lei et al., J. Bacteriol. 169: 4379, 1987), the phoA secretion signal, and the functional cek2 in insect cells can be employed. The most preferred secretion signal for certain expression systems is the ompA secretion signal of E. coli. Other prokaryotic and eukaryotic secretion signals known to those skilled in the art may also be employed (see, for example, von Heijne, J. Mol. Biol. 184: 99-105, '1985). Using the methods described above, a person skilled in the art can substitute secretion signals that are functional, for example, in yeast, in insect or mammalian cells to secrete proteins from those cells.

Preferred plasmids for transformation of the E. coli cell include pET expression vectors (e.g., pET-lla, pET-12a-c, pET-15b; see, patent No. 4,952,496; available from Novagen, Madison, WI. ). Other preferred plasmids include plasmids pKK, particularly pKK 223-3, which contains the tac promoter (Brosius et al., 1984 Proc. Nati, Acad. Sci. 81: 6929; Ausubel et al., Current Protocols in Molecular Biology. US Patents Nos. 5, 22,463, 5,173,403, 5,187 153, 5,204,254, 5,212,058, 5,212,286, 5,215.907, 5,220,013, 5,223,483, and 5,229,279). Plasmid pKK has been modified by replacement of the gene with ampicillin resistance with a gene with kanamycin resistance (available from pharmacy, obtained from pUC4K, see, for example, Vieira et al. (1982 Gene 19: 259-268; and US Patent No. 4,719,179.) Baculovirus vectors, such as pBlueBac (also called pJVETL and derivatives thereof), particularly pBlueBac III (see, for example, US Patent Nos. 5,278,050, 5,244,805, 5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784, available from Invitrogen, San Diego) can also be used for the expression of polypeptides in insect cells Other plasmids include the pIN-IIIompA plasmids (see US Patent No. 4,575,013; see also Duffaud et al., Meth., Enz. 153: 492-507, 1987), such as pIN-IIIompA2.

Preferably, if one or more DNA molecules are replicated in bacterial cells, the preferred host is E. coli. The preferred DNA molecule in such a system also includes a bacterial origin of replication, to ensure maintenance of the DNA molecule from generation to generation of the bacterium. In this way, large quantities of the DNA molecule can be produced by replication in the bacteria. In such expression systems, preferred bacterial replication origins include, but are not limited to, fl-ori and col El as origins of replication. Preferred hosts for such systems contain chromosomal copies of the DNA encoding T7 RNA polymerase operably linked to an inducible promoter, such as the lacUV promoter (see U.S. Patent No. 4,952,496). Such hosts include, but are not limited to, the E. coli lysogenes strains HMS174 (DE3) pLysS, BL21 (DE3) pLysS, HMS174 (DE3) and BL21 (DE3). Strain BL21 (DE3) is preferred. The pLys strain provides low levels of lysozyme T7, a natural inhibitor of T7 RNA polymerase.

The DNA molecules provided may also contain a gene encoding a repressor protein. The repressor protein is capable of repressing the transcription of a promoter that has nucleotide sequences to which the repressor protein binds. The promoter can in turn be dammed by altering the physiological conditions of the cell. For example, the alteration can be carried out by adding to the growth medium a molecule that inhibits the ability to interact with the operator or with the regulatory protein or other regions of the DNA or by altering the temperature of the growth medium. Preferred repressor proteins include, but are not limited to, the lacl repressor of E. coli responsible for the induction of IPTG, the temperature-sensitive "cl857 repressor, and the like." Lacl repressor of E. coli is preferred.

In general, the recombinant constructs of the subject invention will also contain elements necessary for transcription and translation. In particular, such elements are preferred in which the recombinant expression construct contains nucleic acid sequences encoding binding fusion proteins of Immunoglobulin-domain are for the purpose of expression in a host cell or host organism. In certain embodiments of the present invention, the preferred cell type or specific cell type of expression of an immunoglobulin-domain binding fusion cell encoding the gene can be achieved by placing the gene under the regulation of a promoter. . The choice of the promoter will depend on the type of cell that is to be transformed and the degree or type of control desired. The promoters can be constitutive or active and can additionally be specific in the cell type, specific in the tissue, specific in individual cells, or specific in the event, specific temporarily or inducible. Specific promoters in cell type and promoters specific in type of events are preferred. Examples of constitutive or non-specific promoters include the SV40 early promoter (US Patent No. 5,118,627), the SV40 lost promoter (US Patent No. 5,118,627), the early CMV gene promoter (US Patent No. 5,168,062), and the promoter from adenovirus. In addition to viral promoters, cellular promoters are also traceable within the context of this invention. In particular the promoters Cells for monitoring genes are useful. Viral promoters are preferred, because they are generally stronger promoters than cellular promoters. The promoter regions that have been identified in the genes of many eukaryotes including high eukaryotes, such that promoters suitable for use in a particular host can be readily selected by those skilled in the art.

Inducible promoters can also be used. These promoters include MMTV LR (PCT WO 91/13160), inducible by dexamethasone; the promoter of metallothionein, inducible by heavy metals; and promoters with cAMP response elements, inducible by cAMP. By using an inducible promoter the nucleic acid sequence encoding a domain-immunoglobulin binding fusion protein can be delivered to a cell by the construction of the subject invention expression and will remain calm until the inducer is added. This allows additional control over the timing of the production of the gene product.

The promoters specific to the type of event are active and regulated only on the occurrence of an event, such as tumorigenicity or viral infection. The HIV LTR is a well-known example of an event-specific promoter. The promoter is inactive unless the gene product is present, which occurs after a viral infection. Some event-type promoters are also tissue-specific.

Additionally, promoters that are co-ordinated with a particular cell gene can be used. For example, promoters of genes that are co-expressed may be used when the expression of a particular binding construct of the invention, for example, a gene encoding a domain-immunoglobulin binding fusion protein is desired in concert with the expression of one or more genes introduced endogenously or exogenously additional. This type of promoter is especially useful when one knows the gene expression pattern relevant for the induction of an immune response of a particular tissue of the immune system, so that specific immunocompetent cells within that tissue can be activated or another way recruited to participate in the immune response.

In addition to the promoter, repressor sequences, negative regulators or tissue-specific silencers can be inserted to reduce the non-specific expression of genes encoding domain-immunoglobulin binding fusion proteins in certain situations, such as, for example, a host which is transiently immunocompromised as part of a therapeutic strategy. Multiple repressor elements can be inserted in the promoter region. The repression of the transcription is independent of the orientation of the repressor elements or of the distance from the promoter. A pipo of repressor sequence is an isolating sequence. Such sequences inhibit transcription. (Dunaway et al., 1997 Mol Cell Biol 17: 182-9; Gdula et al., 1996 Proc Nati Acad Sci USA 93: 9378-83, Chan et al., 1996 J Virol 70: 5312-28; Scott and Geyer , 1995 EMBO J 14: 6258-67; Kalos and Fournier, 1995 Mol Cell Biol 15: 198-207; Chung et al., 1993 Cell 74: 505-14) and will silence unwanted background transcripts.

The repressor elements have also been identified in the promoter regions in the genes for type II collagen (cartilage), choline acetyltransferase, albumin (Hu et al., 1992 J. Cell Growth Differ. 3 (9): 577- 588), phosphoglycerate kinase (PGK-2) (Misuno et al., 1992 Gene 119 (2): 293-297), and in the gene 6-phosphofructo-2-kinase / fructose-2,6-biphosphatase (Lemaigre et al., Mol Cell Biol. 11 (2): 1099-1106). Additionally, the negative regulatory element Tse-1 has been identified in a number of liver-specific genes, and has been shown to block the cAMP response element (CRE) by mediated induction of gene activation in hepatocytes (Boshart et al. ., 1990 Cell 61 (5): 905-916,).

In preferred embodiments, the elements that increase the expression of the desired product are incorporated into the construction. Such elements include internal ribosome binding sites (IRES, Wang and Siddiqui, 1995 Top Curriculum, Microbiol Immunol 203: 99, Ehrenfeld and Semler, 1995 Top Curriculum, Microbiol.I Munol 203: 65, Rees et al. , 1996 Biotechnique, 20: 102, Sugimoto et al., 1994 Biotechnology 12: 694). The IRES increases the efficiency of the translation. The same as other sequences can promote The expression. For some genes, the sequences, especially at the 5 'end, inhibit transcription and / or translation. These sequences are palindromic usually and can form hairpin structures. Any such sequences in the nucleic acid to be delivered are generally eliminated. The expression levels of the transcript or the translated product are tested to confirm or ensure which sequences affect the expression. The transcription levels can be assayed by any known method including Northerm staining hybridization, Rnasa specimen protection and the like. Protein levels can be assayed by any known method including ELISA, western spotting, immunocytochemistry and other well-known techniques.

Other elements may be incorporated within the constructions of the invention, for example, within constructs encoding the domain-immunoglobulin binding fusion protein of the present invention. In preferred embodiments, the construct includes a transcription terminator sequence, including a polyadenylation sequence, acceptor and donor sites of division, and an improver. Other useful elements for the expression and maintenance of the construct in cells of mammals or other eukaryotic cells can also be incorporated (for example, the origin of the replication). Because the constructions are conveniently produced in bacterial cells, the elements that are necessary for, or that improve, the propagation in the bacterium are incorporated. Such elements include an origin of replication, a selectable marker, and the like.

As provided herein, an additional level for controlling the expression of the constructs encoding the nucleic acids of the invention, for example, domain-immunoglobulin binding fusion proteins, delivered to cells for gene therapies, for example, can be supplied by means of simultaneously supplying two or more differentially regulated nucleic acid constructs. The use of such a multiple nucleic acid construct can allow the coordinated regulation of an immune response such as, for example, a space-time coordination that depends on the type of cell and / or the presence of other expressed coded components. Those familiar with the technique will be able to appreciate that multiple levels of regulated gene expression can be achieved in a similar manner by means of the selection of suitable regulatory sequences, including but not limited to, promoters, enhancers and other well-known gene regulatory elements.

The present invention also relates to vectors, and to constructs prepared from known vectors including nucleic acids of the present invention, and in particular to "recombinant expression constructs", including any of several known constructs, including delivery constructs, useful for gene therapy, which includes any nucleic acid encoding, e.g., immunoglobulin-domain binding fusion proteins and polypeptides according to the invention as provided by epi; for host cells which are genetically engineered with vectors and / or methods of administering expression or other constructs comprising nucleic acid sequences encoding, eg, polypeptides and domain-immunoglobulin binding fusion proteins of the invention, or fragments or variants thereof by means of recombinant techniques.

Various constructs of the invention, including for example, immunoglobulin-domain binding proteins, can be expressed in virtually any host cell, including host cells in vivo in the case of use in gene therapy, under the control of appropriate promoters, depending on of the nature of the construct (e.g., type of promoter, as described above), and about the nature of the desired host cells (e.g., whether they are terminally differentiated or actively divided postmitotic, e.g. expression occurs in the host cell as an episome or is integrated into the genome of the host cell).

Expression and cloning vectors suitable for use with prokaryotic and eukaryotic hosts are described, for example, by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, (1989); as noted here, in particularly preferred embodiments of the invention, recombinant expression is conducted in mammalian cells that have been transfected or transformed with the constructs of recombinant expression object of the invention. See also, for example, Machida, CA. , "Viral Vectors for Gene Therapy: Methods and Protocols "; Wolff, JA," Gene Therapeutics: Methods and Applications of Direct Gene Transfer "(Birkhauser 1994), Stein, U and Walther, W (Editions P, "Gene Therapy of Cancer: Methods and Protocols "(Humana Press 2000); Robbins, PD (ed.)," Gene Therapy Protocols "(Humana Press 1997); Morgan, JR (ed.), "Gene Therapy Protocols" (Humana Press 2002); Meager, A (ed.), "Gene Therapy Technologies, Applications and Regulations: From Laboratory to Clinic" (John Wiley &Sons Inc. 1999); MacHida, CA and Constant, and JG, "Viral Vectors for Gene Therapy: Methods and Protocols" (Humana Press 2002); "New Methods of Gene Therapy for Genetic Metabolic Diseases NIH Guide," Volume 22, Number 35, October 1, 1993. See also recent US patents related to gene therapy, including vaccines, which include US Patent Nos. 6,384,210 (" Solvent for biopolymer synthesis, microdroplet solvent and methods of use "); 6,384,203 ("Family of immunoregulators designated as leukocyte immunoglobulin (LIR) -like receptors"); 6,384,202 ("Specific active compounds to cells regulated by the cell cycle"), - 6,384,018 ("Polynucleotide vaccine for tuberculosis"); 6,383,814 ("Amfifilus cationicos for intracellular delivery of therapeutic molecules"); 6, 383, 811 ("Poliamfolitos for the supply of poliones to a cell"); 6,383,795 ("Efficient Adenovirus Purification"); 6,383,794 ("Methods for producing recombinant adeno associated virus with high titration"); 6,383,785 ("Controllable self-improved pharmacological expression systems"); 6, 383, 753 ("Yeast regulators of cell proliferation mammals"); 6,383,746 ("Functional promoter for CCR5"); 6,383,743 ("Method for serial analysis of gene expression"); 6,383,738 ("Herpes simpler ORF P virus is a repressor of viral protein synthesis"); 6,383,737 ("Oxalyl-CoA of human Decarboxylase"); 6,383,733 ("Methods for Screening Pharmacologically Active Compounds for the Treatment of Tumor Diseases"); 6,383,522 ("Reduced toxicity composition containing an antineoplastic agent and an extract of shark cartilage"); 6,383,512 ("Vesicular complexes and methods for making them and their uses"); 6,383,481 ("Method for transplantation of hemopoietic stem cells"); 6,383,478 ("Polymeric encapsulation system for promoting angiogenesis"); 6,383,138 ("Method for transdermal analyte sampling"); 6,380,382 ("Gene encoding a protein that has diagnosis, prevention, therapy, and other uses"); 6,380,371 ("Nucleic acid construction for the cell cycle regulated by expression of structural genes"); 6,380,369 ("Metal complex containing oligonucleoside partitioning compound and therapies"); 6,380,362 ("Polynucleotides, polypeptides expressed by polynucleotides and methods for their use"); 6,380,170 ("Nucleic acid construction for the cell cycle regulates the expression of structural genes"); 6,380,169 ("Complex metals containing oligonucleosides for the cleavage of compounds and therapies"); 6,379,967 ("Saimiri herpesvirus as viral vector"); 6,379,966 ("Intravascular supply of non-viral nucleic acid protease proteins, and use thereof").

Typically, for example, expression constructs are derived from plasmid vectors. A preferred construct is a pNASS vector (Clontech, Palo Alto, CA), which has nucleic acid sequences encoding an ampicillin-resistant gene, a polyanidenylation signal and a T7 promoter site. Other expression vectors Suitable mammals are well known (see, for example, Ausubel et al., 1995; Sambrook et al., supra; see also for example, Invitrogen catalogs, San Diego, CA; Novagen, Madison, WI; Pharmacy, Piscataway, NJ; and others) . Currently preferred constructs can be prepared from those that include a dihydrofolate reductase (DHFR) that encodes the sequence under appropriate regulatory control to promote or enhance production levels of the domain-immunoglobulin binding fusion protein, said levels resulting from the amplification of the genes after the application of an appropriate selection agent (for example, methotrexate).

Generally, recombinant expression vectors will include origins of replication and selectable markers that allow the transformation of the host cell, and a promoter derived from highly expressed genes to direct the transcription of. a downstream structural sequence, as described above. The heterologous structural sequence is assembled in the appropriate phase with the initiation of translation and termination sequences. Thus, for example, nucleic acids encoding binding fusion protein of Immunoglobulin domain as provided herein may include in any one of a variety of expression vector constructs as a recombinant expression construct for expressing a domain-immunoglobulin binding fusion polypeptide in a host cell. In certain preferred embodiments the constructs are included in formulations that are administered in vivo. Such vectors and constructs include chromosomal, non-chromosomal and synthetic DNA sequences, eg, SV40 derivatives; bacterial plasmids, phage DNA; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA, such as vaccines, adenoviruses, avian diphroviral virus, and seudorabies or deficient replication of compound retroviruses are described below. However, any other vector can be used for the preparation of a recombinant expression construct, and in preferred embodiments such a vector can be replicable and viable in the host.

Appropriate DNA sequences can be inserted into a vector, for example, by a variety of methods. In general, a DNA sequence is inserted into an appropriate restriction endonuclease site by methods known in the art. Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonuclease and the like, and various separation techniques are those known and commonly employed by those skilled in the art. in the technique. A number of standard techniques are described, for example, in Ausubel et al. (1993 Current Protocols in Molecular Biology, Greene Publ.

Assoc. Inc. & John Wiley & Sons, Inc., Boston, MA); Sambrook et al. (1989 Molecular Cloning, Second Ed., Cold Spring Harbor Laboratory, Plainview, NY); Maniatis et al. (1982 Molecular Cloning, Cold Spring Harbor Laboratory, Plainview, NY); Glover (Ed.) (1985 DNA Cloning Vol. I and II, IRL Press, Oxford, UK); Hames and Higgins (Eds.), (1985 Nucleic Acid Hybridization, IRL Press, Oxford, UK).

The DNA sequence in the expression vector is operably linked to at least one appropriate expression control sequence (eg, a constitutive promoter or a regulated promoter) to direct the synthesis of mRNA. Representative examples of such control sequences of expression include the promoters of eukaryotic cells or their viruses, as described above. The promoter regions can be selected from any desired gene using CAT vectors (chloramphenicol transferase) or other vectors with selectable markers. The eukaryotic promoters include the early CMV immediate, the HSV of thymi kinase, the early and late SV40, the retrovirus LTR, and the mouse metallothionein-l. The selection of the appropriate vector and promoter is well within the level of knowledge of those skilled in the art, and the preparation of particular preferred recombinant expression constructs comprises at least one regulated promoter or promoter operably linked to a nucleic acid encoding a Immunoglobulin-domain binding fusion polypeptide as described herein.

The transcription of the DNA encoding the proteins and polypeptides included within the present invention by high eukaryotes can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 bp that act on a promoter to increase its transcription Examples that include the SV40 enhancer on the late side of the replication origin bp 100 to 270, an early cytomegalovirus as enhancer and. promoter, the polyoma enhancer on the late side of the origin of replication, and adenovirus enhancers.

Gene therapy is the use of genetic material to treat diseases. This comprises strategies for replacing defective genes or adding new genes to cells and / or tissues, and is being developed for the application in the treatment of cancer, the correction of metabolic disorders and in the field of immunotherapy. Gene therapies of the invention include the use of various constructions of the invention, with or without a separate vehicle or delivery vehicle or constructs, for the treatment of diseases, disorders, and / or conditions noted herein. Such constructions may also be used as vaccines for treatment or prevention of diseases, disorders, and / or conditions noted herein. Administration vaccines, for example, can make use of polynucleotides that encode proteins and immunogenic nucleic acids determinants to stimulate the immune system against pathogens or tumor cells. Such strategies may stimulate either acquired or innate immunity or may involve the modification of immune function by means of cytokine expression. In vivo gene therapy involves direct injection of the genetic material into a patient or animal model of human disease. Vaccines and immune modification are systemic therapies. With tissue-specific in vivo therapies, such as those seeking to treat cancer, the delivery of localized genes and / or expression and expression systems / targets are preferred. The vectors for therapy of various genes have been designated for specific tissues as targets, and the procedures have been developed for specific physically objectified tissues, for example, using catheter-based technologies, all of which are contemplated herein. The ex vivo teachings for gene therapy are also contemplated here and involve the removal, genetic modification, expansion and readministration of a patient's own cells. Examples include bone marrow transplantation for the treatment of cancer or genetic modification of lymphoid progenitor cells. Ex vivo gene therapy is preferably applied to the treatment of cells that are easily accessible and can survive in culture during the gene transfer process (such as blood or skin cells).

Vectors for useful gene therapies include adenoviral vectors, lentiviral vectors, adeno associated virus vectors (AAV), simple Herpes virus vectors (Hsv), and retroviral vectors. Gene therapies can also carry using "naked DNA" lipomas-based delivery, and lipid-based delivery (including DNA attached to positively charged lipids), and electroporation.

As provided herein, in certain embodiments, including but not limited to gene therapy modalities, the vector may be a viral vector such as, for example, a retroviral vector. Miller et al. > 1989 BioTechniques 7: 980; Coffin and Varmus, 1996 Retroviruses, Cold Spring Harbor Laboratory Press, NY. For example retroviruses from which retroviral plasmid vectors can be derived, include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, virus of Harvey's sarcoma, avian leukosis virus, human immunodeficiency virus, adenovirus, myeloproliferative sarcoma virus, and mammary tumor virus.

Retroviruses are RNA viruses that can replicate and integrate into the genome of a host cell via the DNA intermediate. This DNA intermediate, or provirus, can be stably integrated into the DNA of the host cell. In accordance with certain embodiments of the present invention, an expression construct can comprise a retrovirus within which a foreign gene encoding a foreign protein is incorporated in place of the normal retroviral RNA. When the retroviral RNA enters the host cell coincident with the infection, the foreign gene is also introduced into the cell, and can then be integrated into the DNA of the host cell as if it were part of the retroviral genome. The expression of this foreign gene within the host results in the expression of the foreign protein.

Most of the retroviral vector systems that have been developed for gene therapy are based on Murine retrovirus. Such retroviruses exist in two forms, such as free viral particles referred to as virions, or as proviruses integrated into the DNA of the host cell. The virion form of the virus contains the structural and enzymatic proteins of the retrovirus (including the reverse transcriptase of the enzyme), two copies of RNA from the viral genome, and portions of the cell plasma membrane from source containing the viral envelope glycoprotein. The retroviral genome is organized into four main regions; the long terminal repeat (LTR), which contains cis-acting elements necessary for the initiation and termination of transcription and is located in both the 5 'and 3' coding genes, and the three gag coding genes, pol and env. These three gag, pol and env genes encode, respectively, internal viral structures, enzymatic proteins (such as integrase), and envelope glycoprotein (designated gp70 and pl5e) - conferring infectivity and host-specificity of the virus; same as the "R" peptide of indeterminate function.

Separate packaging cell lines and vectors that produce cell lines have been developed due to security concerns with respect to the uses of retroviruses including their use in expression constructs as provided by the present invention. Briefly, this methodology employs the use of two components, a retroviral vector and a packaging cell line (PCL). The retroviral vector contains long terminal repeats (LTR), the foreign DNA to be transferred and a packaging sequence (y). This retroviral vector will not reproduce itself because the genes encoding the structural and envelope proteins are not included within the genome of the vector. The PCL that contains genes that encode gag, pol and env, but that does not contain the "and" packaging signal. Thus, a PCL can only form empty virion particles by themselves. Within this general method, the retroviral vector is introduced into the PCL, thus creating a vector-producing cell line (VCL). This VCL manufactures virion particles that contain only the retroviral genome of the (foreign) vector, and has therefore previously been considered as a safe retrovirus vector for therapeutic use.

The "retroviral vector construct" refers to an assembly that is, within the preferred embodiments of the invention, capable of directing the expression of a sequence or gene of interest, such as nucleic acid sequences encoding the ligand fusion of Immunoglobulin domain. Briefly, the construction of the retroviral vector can include a 5 'LTR binding site, a tRNA, a packaging signal, an origin of a second DNA chain synthesis and a 3' LTR. A wide variety of heterologous sequences can be included within the construction of the vector, including for example, sequences that encode a protein (eg, the cytotoxic protein, antigen associated with disease, an accessory immune molecule, or urgently replaced), which with useful as a molecule itself (for example as a ribozyme or antisense sequence).

The retroviral vector constructs of the present invention can be easily constructed from a wide variety of retroviruses, including for example retroviruses type B, C, and D as well as foam viruses and lentiviruses (see, for example, Tumor Virus RNA, Second Edition, Cold Spring Harbor Laboratory, 1985). Such retroviruses can be easily obtained through depository or collections such as American Type Culture Collection ("ATCC"; Rockville, Maryland) or isolated from known sources using commonly available techniques. Any of the above retroviruses can be readily used to assemble or construct retroviral vector constructs, packaging cells, or producer cells of the present invention given the description provided herein, and standard recombinant techniques (eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, 1989; Kunkle, 1985 PNAS 82: 488).

Promoters suitable for use in viral vectors can generally include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., 1989 Biotechniques 7: 980-990, or any other promoter (eg, cellular promoters such as eukaryotic promoters including, but not limited to, histone, promoters pol III, and β-actin). Other viral promoters that can be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK), and parvovirus B1 promoters. The selection of a promoter will be apparent to those versed in the art from the teachings contained herein, and may be between regulated promoters or promoters as described above.

As described above, the retroviral plasmid vector is used to translate packaging cell lines to form producer cell lines. Examples of packaging cells that can be transfected include, but are not limited to, cell lines of PE501, PA317,? -2,? -AM, PA12, T19- 14X, VT-19-17-H2,? CRE ,? CRIP, GP + E-86, GP + envAml2, and DAN as described in Miller, Human Gene Therapy, 1: 5-14 (1990). The vector can translate the packaging cells by any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0 precipitation. In an alternative the retroviral plasmid vector can be encapsulated in a liposome, or coupled to a lipid, and then administered to a host.

The producer cell line generates infectious retroviral vector particles that include nucleic acid sequences that encode the immunoglobulin-domain binding fusion polypeptides or proteins. Such retroviral vector particles can be used to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence encoding the immunoglobulin-domain binding fusion polypeptide or protein. Eukaryotic cells that can be transduced include, but not limited to, embryonic stem cells, as well as haematopietic stem cells, hepatocytes, fibroblasts, mononuclear cells or peripheral blood polymorphonuclear cells including myelomonocytic cells, lymphocytes, myoblasts, tissue macrophages, dendritic cells, Kupffer cells , lymphoid and reticuloendothelial cells of the lymphatic and splenic nodes, keratinocytes, endothelial cells and bronchial epithelial cells.

As another example of an embodiment of the invention in which a viral vector is used to prepare, for example, a fusion fusion expression construct of Immunoglobulin domain, in a preferred embodiment, host cells transduced by a recombinant viral construct that directs the expression of the immunoglobulin-domain binding fusion polypeptides or proteins can produce viral particles containing polypeptides or domain binding fusion proteins. -inmunoglobulin expressed that are derived from portions of a host cell membrane incorporated by the viral particles during the viral outbreak.

In another aspect, the present invention relates to host cells containing what has been described herein as nucleic acid constructs, such as, for example, recombinant immunoglobulin-domain binding fusion expression constructs. Host cells are produced by genetic engineering (transduced, transformed or transfected) with the vectors and / or the expression constructs of this invention which may be, for example, a cloning vector, a carrier vector, an expression construct. The vector or construct can be, for example, in the form of a plasmid, a viral particle, a phage, etc. The host cells generated by Genetic engineering can be cultured in a modified conventional nutrient medium as appropriate to activate promoters, selective transformants or particular amplification genes such as genes encoding domain-immunoglobulin binding fusion polypeptides or domain binding fusion proteins -immunoglobulin. Culture conditions for particular host cells selected for expression, such as temperature, pH and the like, will be readily visible to those skilled in the art.

The host cell for the production or expression of a construct of the invention, for example, can be a larger eukaryotic cell, such as a cell of a mammal, or a minor eukaryotic cell, such as a yeast cell, or the cell The host can be a prokaryotic cell, such as a bacterial cell. Representative examples of appropriate host cells according to the present invention include, but need not be limited to, bacterial cells such as E. coli, Streptomyces, Salmonella tvphimurium, - fungal cells, such as yeast; Insect cells-, such as Drosophila S2 and Spodoptera Sf9; animal cells, such as CHO, COS or 293; adenovirus; plant cells or any suitable cell already adapted to in vitro propagation or established again. The selection of an appropriate host is within the scope of those skilled in the art from the teachings given herein.

Various mammalian cell culture systems can also be used to express recombinant proteins. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, 1981 Cell 23: 175, and other cell lines capable of expressing a compatible vector, for example, C127 cell lines. , 3T3, CHO, HeLa and BHK mammalian expression vectors comprise an origin of replication and a suitable promoter and suitable enhancer and also any ribosome binding sites, polyadenylation sites, donor and dividing acceptor sites, transcriptional termination sequences , Y. 5 'flanks of transcribed sequences, for example as described herein with respect to the preparation of domain-immunoglobulin-binding fusion expression constructs. DNA sequences derived from SV40 divisions, and polyadenylation sites can be used to supply the required non-transcribed genetic elements. The introduction of the construct into the host cell can be effected by a variety of methods with which those skilled in the art have familiarity, including but not limited to, for example, calcium phosphate transfection, DEAE-Dextran-mediated transfection, or electroporation (Davis et al., 1986 Basic Methods in Molecular Biology).

The constructs of the present invention, for example domain-immunoglobulin binding fusion proteins, or compositions comprising one or more polynucleotides encode the same, as described herein (eg, to be administered under conditions and for a sufficient time to allow the expression of a domain-immunoglobulin-binding fusion protein in a host cell in vivo or in vitro, for gene therapy, for example, among other things) can be formulated into pharmaceutical compositions for administration according to well-known methodologies . The pharmaceutical compositions generally comprise one or more recombinant expression constructs and / or expression products of such constructs, in combination with a pharmaceutically acceptable carrier, excipient or pharmaceutically acceptable diluent. Such vehicles can be non-toxic to the containers in dosages and concentrations employed. For formulations based on nucleic acid, or for formulations comprising expression products of the recombinant constructions object of the invention, about 0.01 μg / kg to about 100 mg / kg per body weight will be administered, for example, typically by an intradermal, subcutaneous, intramuscular or intravenous route, or by other routes. A preferred dosage, for example, is about 1 μg / kg to about 1 mg / kg with about 5 μg / kg to about 200 μg / kg particularly preferred. It will be apparent to those skilled in the art that the number and frequency of administration will depend on the response of the host. "Pharmaceutically acceptable carriers" for therapeutic use are well known in the pharmaceutical art, and are described, as for example in the Remingtons Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro, ed., 1985). For example, sterile saline, and phosphate buffered saline at a physiological pH can be used. Condoms, stabilizers, inks and even flavoring agents can be provided in the Pharmaceutical composition, for example, sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid can be added as preservatives. Go to 1449. Antioxidants and suspending agents may be used in addition. Id.

"Pharmaceutically acceptable salts" refers to salts of the compounds of the present invention derived from the combination of such compounds and an organic or inorganic acid (acid addition salts) or an organic or inorganic base (base addition salts). The compounds of the present invention can be used either in free base or in the form of salts, both with both forms being considered within the scope of the present invention.

Pharmaceutical compositions containing one or more of the nucleic acid constructs of the invention, for example, constructs encoding the domain-immunoglobulin binding fusion protein (its expressed products) can be in any form that allows the composition to be administered to a patient. For example, the composition may be in a liquid solid form or gas (aerosol). Typical administration routes include no limitation, oral, topical, parenteral (for example, sublingually or buccally), sublingual, rectal, vaginal and intranasal. The term parenteral is used as used herein, includes subcutaneous, intravenous, intramuscular, intrastémal, intracavernous, intrathecal, intrameatal, intraurethral or infusion techniques. The pharmaceutical composition is formulated so as to allow the active ingredients contained therein to be bioavailable after administration of the composition to a patient. The compositions that will be administered to a patient take the form of one or more dosage units, wherein, for example, a tablet can be a single dosage unit, and a container of one or more aerosolized compounds of the invention can contain a plurality of dosage units.

For oral administration, an excipient and / or binder may be present. Examples are sucrose, kaolin, glycerin, starch, dextrins, sodium alginate, carboxymethylcellulose, and ethyl cellulose. Dyestuffs and / or flavoring agents may also be present. A coating shell can be used.

The composition may be in the form of a liquid, i.e., an elixir, a syrup, a solution, an emulsion, or a suspension. The liquid may be for oral administration or for injection delivery, as two examples. When proposed for oral administration, preferred compositions contain, in addition to one or more domain-immunoglobulin binding fusion constructs or expressed products, one or more sweetening agents, preservatives, inks / dyes, and flavor improvers. In a composition to be administered by injection, one or more of surfactants, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers and isotonic agents, for example, may be included.

A liquid pharmaceutical composition as used herein, whether in the form of a solution, suspension or other similar form, may include one or more of the following adjuvants: sterile diluents such as water for injection, saline, physiological saline preferably, the solution of Ringer, isotonic sodium chloride, fixed oils such as mono or diglycerides synthetics which can serve as solvents or suspending media, polyethylene glycols, glycerin, propylene glycol, or other solvents; such antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium disulfide; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and tonicity adjusting agents such as sodium chloride or dextrose. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic. The 'physiological saline is a preferred adjuvant. A pharmaceutical injectable composition is preferably sterile.

It may also be desirable to include other components in the preparation, such as delivery vehicles including but not limited to aluminum salts, water-in-oil emulsions, biodegradable oil vehicles, oil-in-water emulsions, biodegradable microcapsules, and liposomes. Examples of immunostimulatory substances (adjuvants) for use in such vehicles include N-acetylmur'amil-L-alanine-D-isoglutamine (MDP), lipopolysaccharides (LPS), glucan, IL-12, GM-CSF, gamma interferon and IL-15.

While any known vehicle suitable for those skilled in the art can be employed in the pharmaceutical compositions of this invention, the type of vehicle will vary depending on the mode of administration and if a sustained release is desired. For parenteral administration, such as subcutaneous injection, the preferred vehicle comprises water, saline, alcohol, a fat, a wax or a buffer. For oral administration, any of the above vehicles or solid carrier such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc cellulose, glucose, sucrose and magnesium carbonate, may be employed. Biodegradable microspheres (eg, polylactic galactide) can also be employed as carriers for the pharmaceutical compositions of this invention. Suitable biodegradable microspheres have been described, in U.S. Patent Nos. 4,897,268 and 5,075,109. In this regard, it is preferable that the microsphere be larger at approximately 25 microns.

The pharmaceutical compositions may also contain diluents such as buffers, antioxidants such as ascorbic acid, low molecular weight polypeptides (less than 10 residues), proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral and buffered saline or saline mixed with nonspecific serum albumin are suitable illustrative diluents. Preferably, the product is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose) as diluents.

As described above, the subject invention includes compositions capable of delivering nucleic acid molecules that encode domain-immunoglobulin binding fusion proteins. Such compositions include recombinant viral vectors (e.g., retroviruses (See WO 90/07936, WO 91/02805, WO 93/25234, WO 93/25698, and WO 94/03622), adenovirus (see Berkner, 1988 Biotechniques 6: 616-627; Li et al., 1993 Hum. Gene tiller 4: 403-409; Vincent et al., Nat. Genet. 5: 130-134; and Kolls et al., 1994 Proc. Nati Acad. Sci. USA 91: 215-219), smallpox virus (see U.S. Patent No. 4,769,330, U.S. Patent No. 5,017,487, and WO 89/01973), nucleic acid molecules of construction of recombinant expression complexed to a polycationic molecule (see WO 93/03709), and nucleic acids associated with liposomes (see Wang et al., 1987 Proc. Nati, Acad. Sci. USA 84: 7851). In some embodiments, DNA may be linked to killed or inactivated adenovirus (see Curiel et al., 1992 Hun. Gene Ther 3: 147-154; Cotton et al., 1992 Proc. Nati. Acad. Sci. USA 89: 6094). Other suitable compositions include DNA ligand (see Wu et al., 1989 J: Biol. Chem. 264: 16985-16987) and lipid-DNA combinations (see Felgner et al., 1989 Proc. Nati. Acad. Sci. USA 84: 7413-7417).

In addition to direct in vivo procedures, ex vivo procedures can be used in which the cells are removed from a host, modified, and placed in the same or in another host animal. It will be apparent that one can use any of the compositions noted above for the introduction of the constructs of the invention, for example, domain-immunoglobulin binding fusion proteins or nucleic acid molecules encoding the domain binding fusion protein. -immunoglobulin in tissue cells in an ex-context alive. Protocols for viral, physical and chemical capture methods are well known in the art.

In accordance with the above, the present invention is useful for treating a patient having a B cellular disorder or a malignant condition, or for treating a cell culture derived from such a patient. As used herein the term "patient" refers to any warm-blooded animal, preferably a human. A patient may be afflicted with cancer or with a malignant condition such as B cell lymphoma, or may be normal (e.g., disease free and detectable infection). A "cell culture" includes any preparation amenable to an ex vivo treatment, for example a preparation containing immunocompetent cells or cells isolated from the immune system (including, but not limited to, T cells, macrophages, monocytes, B cells and dendritic cells). Such cells can be isolated by any of a variety of techniques well known to those fenced in the art (eg, Ficoll-hypaque density centrifugation). Cells can (but do not need to) have been isolated from a patient afflicted with a B cell disorder or a malignant condition, and can be reintroduced into a patient after treatment.

A liquid composition for the purpose of parenteral or oral administration should contain an amount of a construct of the invention, for example, a construct encoding a domain-immunoglobulin binding fusion protein or the expressed product, such that a suitable dosage be obtained. Typically, this amount is at least 0.01% by weight of a domain-immunoglobulin binding fusion construct or product expressed in the composition. When the purpose is an oral administration, this amount may vary to be between 0.1 and about 70% of the weight of the composition. Preferred oral compositions contain between about 4% and about 50% of the domain-immunoglobulin binding fusion construct or the expressed products. Preferred compositions and preparations so that, for example, a parenteral dosage unit contains between 0.01 to 1% by weight of the active compound.

The pharmaceutical composition may have the purpose of topical administration, in which case the vehicle may suitably comprise a solution, emulsion, ointment, or gel base. The base, for example, may comprise one or more of the following: petrolatun, lanolin polyethylene glycols, beeswax, mineral oils, diluents such as water and alcohol, and emulsifiers and stabilizers. Thickening agents may be frequent in a pharmaceutical composition for topical administration. If the purpose of this transdermal administration is, the composition may include a transdermal patch or an iontophoresis device. Topical formulations may contain a concentration of a construct of the invention, for example, a domain-immunoglobulin binding fusion construct or expressed product, between about 0.1 to 10% w / v (weight per unit volume).

The composition may have the purpose of a rectal administration, in the form, for example, of a suppository that will melt in the rectum and release the drug. The composition for rectal administration may contain an oleaginous base as a suitable excipient not irritating. Such bases include, without limitation, lanolin, cocoa butter and polyethylene glycol.

In the methods of the invention, a construct of the invention, for example, constructs encoding a domain-immunoglobulin binding fusion or expressed products, can be administered through the use of inserts, granules, timed release formulations, patches or fast-release formulations.

Constructs of the invention, e.g., antigen binding constructs of the invention, may be administered or co-administered to an animal or patient in combination with, or at the same time, or about the same time, with other compounds. In another aspect, one or more constructs, including for example one or more antigen binding constructs, are administered to an animal or patient in conjunction with one or more gutemoterapeutical compounds such as alkylating agents, nucleoside analogs, and the like. The administration or co-administration of one or more constructs including one or more antigen binding constructions, of the invention and one or more gutemoterapeutical agents may be used for the treatment of tumors or cancer in an animal or patient. Illustrative cancers include but are not limited to, head or neck cancer, breast cancer, colorectal cancer, gastric cancer, liver cancer, bladder cancer, cervical cancer, endometrial cancer, lung cancer (non-gum cells), cancer of the ovaries, pancreatic cancer, prostate cancer, choriocarcinoma (lung cancer); hair cell leukemia, chronic lymphocytic leukemia, acute lymphocytic leukemia (chest and bladder), acute myelogenous leukemia, meningeal leukemia, chronic myelogenous leukemia, erythroleukemia. Most commonly treated cancers include non-Hodgking's lymphoma (osteogenic sarcoma, adult soft tissue sarcoma), T-cell lymphoma, chronic lymphocytic leukemia, slow-growing non-Hodgking's lymphomas, Hodgking's lymphoma and ovarian cancer.

Examples of an alkylating agent that can be coadministered with one or more constructs, including one or more antigen binding constructs, of the invention, include mechlorethamine, chlorambucil, ifosfamide, melphalan, busulfan, carmustine, lomustine, procarbazine, dacardazine, cisplatin, carboplatin, mitomycin C, cyclophosphamide, isosfamide, hexamethylmelamine, thiotepa, and dacarbazine, and analogs thereof. See, for example, U.S. Pat. No. 3,046,301 which describes the synthesis of chlorambucil, latent U.S. No. 3,732,340 which describes the synthesis of ifosfamide, the U.S. patent. No. 3,018,302 for the synthesis of cyclophosphamide, U.S. Pat. No. 3,032,584 which describes melphalan synthesis, and Braunwald et al. , "Harrison's Principles of Internal Medicine, "15th Ed., McGraw-Hill, New York, NY, pp. 536-544 (2001) for clinical aspects of cyclophosphamide, chlorambucil, melphalan, ifosfamide, procarbazine, hexamethylmelamine, cisplatin, and carboplatin Examples of nucleoside analogs, include, but are not limited to, fludarabine, pentostatin, methotrexate, fluorouracil, fluorodeoxyuridine, CB3717, azacitidine, cytarabine, floxuridine, mercaptopurine, 6-thioguanine, cladribine, and analogues thereof. An example is the combination of constructions including ligament constructions with antigen that bind CD20.This construct acts as a chemosensitive agent and works together with chemotherapeutic agents, such that fewer chemotherapeutic agents are necessary to achieve anti-tumor or anti-cancer effects.For example, US Patent No. 3,923,785 describes the synthesis of pentostatin , The patent U.S. No. 4,080,325 describes the synthesis of methotrexate, U. S. Patent No. 2,802,005 describes the synthesis of fluorouracil, and Braunwald et al. , "Harrison's Principles of Internal Medicine," 15th Ed., McGraw-Hill, New York, NY, pp. 536-544 (2001) for clinical aspects of methotrexate, 5-fluorouracil, cytosine arabinoside, 6-mercaptopurine, 6-thioguanine, and fludarabine phosphate.

In another aspect, one or more constructs, including one or more antigen binding constructs of the invention, may be administered or co-administered with compounds that inhibit topoisomerase II or compounds that otherwise interact with nucleic acids in cells. Such compounds include, for example, doxorubicin, epirubicin, etoposide, teniposide, mitoxantrone, and analogs thereof. In one example, this combination is used in treatments to reduce the contamination of tumor cells of peripheral blood progenitor cells (PBSC) in conjunction with high dose chemotherapy and autologous stem cell support (HDC-ASCT). See U.S. patent 6,586,428 to Geroni et al.

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with therapeutic drugs. For example, Virulizina (Lorus Therapeutics), which is believed to stimulate the release of tumor necrosis factor, TNF-alpha, by tumor cells in vitro and the activation of macrophage cell styumalate. This can be used in combination with one or more constructions, including one or more antigen binding constructions, of the invention to increase cancer cell apoptosis and treat various types of cancers including pancreatic cancer, malignant melanoma, Kaposi's sarcoma ( KS), lung cancer, breast cancer, uterine, ovarian and cervical cancer. Another example is CpG 7909 (Coley Pharmaceutical Group), which is believed to activate NK cells and monocytes and promotes ADCC. This drug can be used in combination with cancer or tumor specific constructs, including antigen binding constructions, of the invention such as an anti-CD20 construct, to treat non-Hodgkin's lymphoma or other cancers.

One or more constructs, including one or more antigen binding constructs of the invention they can also be combined with angiogenesis inhibitors to increase the antitumor effects. Angiogenesis is the growth of new blood vessels. This process allows tumors to grow and metastasize. The inhibition of angiogenesis can help prevent metastasis and stop the spread of tumor cells. The de-angiogenesis inhibitors include, but are not limited to, angiostatin, endostatin, thrombospondin, platelet factor 4, cartilage-derived inhibitor (CDI), retinoids, Interleukin-12, metalloproteinase 1, 2 and 3 tissue inhibited (TIMP -1, TIMP-2, and TIMP-3) and proteins that block the angiogenesis signaling cascade, such as anti-VEGF (Vascular Endothelial Growt Factor) and iFN-alpha. Angiogenesis inhibitors can be administered or co-administered with tumor-specific constructs, including antigen binding constructs capable of mediating, for example, ADCC and / or complementary binding or binding with antigen conjugated with chemotherapy of the invention to combat various types of cancers , for example, solid tumor cancers such as lung or breast cancer.

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or coadministered with disease modifying antirheumatic agents (DMAR agents) for the treatment of rheumatoid arthritis, psoriasis, ulcerative colitis, Systemic lupus erythematosus (SLE), Crohn's disease, ankylosing spondylitis, and various inflammatory disease processes. In such treatments, constructs, e.g., antigen binding constructs, of the invention are commonly administered in conjunction with compounds such as azathiophrin, cyclosporin, gold, hydroxychloroquine, methotrexate, phenicalamin, sulfasalazine, and the like.

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with agents or compounds that contract the biological effects of interleukin-1 including, for example, interleukin-1 inhibitors and Interleukin-1 receptor antagonists. It has been thought that interleukin-1 has a role in the generation of rheumatoid arthritis (RA), inflammation, and destruction of the joints. IL-1 inhibitors they may also be in conjunction with the constructions, including antigen binding constructions, of the invention for treating arthritis, inflammation of the bowel disease, septic and septic shocks, ischemic damage, reperfusion, cerebral ischemic damage such as cerebral palsy and multiple sclerosis. See U. S. patent 6,159,460 issued to Thompson et al. In another aspect, for example, one or more constructs, including one or more antigen binding constructions, of the invention can be administered or co-administered to an animal or patient in conjunction with one or more glocorticoids, eg, methylprednisolone, desametaxone, hydrocortisone, and the like. Glucocorticoids have been used to induce apoptosis and inhibit growth, independent of ADCC and CDC. These compounds can be combined with constructs, including antigen binding constructs, of the invention capable of inducing apoptosis in cancer cells. In one example the ligand constructs with anti-CD20 antigen, and anti-CD40, which can be used to induce apoptosis in B cells, are combined with glucocorticoids to treat Hodgkin's B-cell lymphoma (NHL).

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with p38 inhibitors or antagonists. The protein kinase pathway activated by mitogen p38 is involved in a number of instrumental cellular processes for the development of rheumatoid arthritis. For example, the activation and infiltration of leukocytes as well as the product of inflammatory cytokines are dependent processes of p38.

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with compounds that promote the differentiation and proliferation of B cells. Cytokines such as interleukin-4 (IL -4) and interleukin-6 (IL-6), in addition to other biological activities, have been shown to stimulate antibody synthesis and secretion by activated B lymphocytes. In a particular aspect of the invention, the constructs, including one or more antigen binding constructs, which recognize and bind CD20 are co-administered with one or more interleukin-4 (IL-4) and interleukin-6 (IL-6).

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with interleukin-2 (IL-2). Interleukin-2 (IL-2) is a lymphokine that increases the product of effector cells, such as CD4 + T helper cells, CD8 cytotoxic cells, antibody-producing B cells, natural killer (NK) cells, and monocytes / macrophages. T cells that produce IL-2 aids, which in turn secrete more than IL-2 (an "autocrine loop"). IL-2 can be used to increase antibody-dependent cell-mediated cytotoxicity (ADCC) and inotherapy associated with constructs of the invention. In one example, an anti-CD20 construct of the invention and IL-2 are used to treat patients with relapsed or refractive follicular non-Hodgkin's lymphoma. In another example IL-2 is administered or co-administered with HIV immunotherapy to assist in the recovery of T cells.

In another aspect, one or more constructions, including one or more antigen binding constructs, of the invention can be administered or co-administered with interleukin-12 (IL-12). (IL-12) is known to promote the responses of cytolytic T cells, promote the development of helper T cells, promote the activity of natural killer (NK) cells, and induce the secretion of IFN-? in T and NK cells. IL-12 also increases many helper and effector cells that mediate apoptosis. In another aspect of the invention, one or more constructs, including one or more antigen binding constructs, are administered or co-administered with IL-12 in the treatment of an animal or patient with a tumor or cancer. For example, a construct that includes an antigen binding construct of the invention that binds CD20 'combined with IL-2 for the treatment of a patient with non-Hodgkin's B-cell lymphoma (NHL).

One or more constructs, including one or more antigen binding constructs, of the invention can also be combined with immunomodulators for enhance the efficiency of the antigen binding constructions of the invention. Immunomodulators include but are not limited to, Colonizing Stimulating Factors (CSF), Tumor Necrosis Factors (TNF), and Interferons (IFN).

CSFs may include granulocyte-macrophage CSF (GM-CSF), granulocyte-CSF (G-CSF), and macrophage CSF (M-CSF). GM-CSF is thought to regulate the development of neutrophils, macrophages, monocytes and eosinophils. G-CSF has been shown to induce the production of neutrophils, and the production of M-CSF. M-CSF has been shown to stimulate macrophages and monocytes. The use of CSFs to treat neutropenia in patients with cancer has been widely established. In one example, the constructs, including antigen binding constructs, of the invention can be combined construction GN-CSF, G-CSF or combinations thereof in order to accelerate the recovery of neutropenia in patients after a bone marrow transplant and of chemotherapy. Neutrophils play a major role in fighting. against microbes such as bacteria, fungi and parasites. Patients with neutropenia are particularly susceptible to bacteria and fungal infections of wide spread. In another example, a construct including an antigen binding construct of the invention can be combined with treated GM-CSF and neutrophils, monocytes and macrophages to increase activity against bacteria, fungi, etc. Including carinii pneumocystis of fear.

An example of an IFN is interferon alfa (IFN-a). IFN-a is naturally made by some types of white blood cells as part of the immune response when the body reacts against cancers or viral infections. This has two main modes of attack, interfering with the growth and proliferation of cancer cells and this potentiates the production of killer T cells or other cells that attack cancer cells. Interferon has also been thought to make it easier for cancer cells to generate chemical signals that may make them better targets for the immune system, and has been used in recent years for several different types of cancer, particularly kidney cancer, melanoma, multiple myeloma, and some types of leukemia. It has also been used to treat viral infections such as hepatitis. He interferon-alpha2a, for example, promotes ADCC and can be combined with one or more constructs, including antigen binding constructions, of the invention to increase the efficiency of ADCC activity associated with construction. In another example, one or more constructs, including antigen binding constructs, of the invention are administered or co-administered to an animal or patient with interferon-gamma (IFN-α), which has been shown to increase the number of anti-antigens. CD20 in B cells and in bone marrow plasma cells (BMPC). This is particularly useful in the treatment of patients with multiple myelomas, who have a reduced expression of CD20 in their B cells and in bone marrow plasma cells (BMPC). Accordingly, the treatment of patients with multiple myeloma with constructions, including antigen binding constructions, of the invention, in particular constructs that bind CD20 can be usefully coadministered in conjunction with IFN-α.

TNF is a class of natural chemicals with anticancer properties. An example of a TNF is TNF-alpha. TNF-alpha has also been shown to have effects synergists with IFN-gama and IL-12. In another example, TBF can be administered or co-administered with one or more tumor-specific constructs, including one or more antigen binding constructs., of the invention, and include ligand constructions with antigen conjugated with chemotherapy of the invention, together with IFN-gamma, IL-12 or various combinations thereof. TNF is also known as an anti-inflammatory regulatory molecule. TNF-alpha antibodies or antagonists can be combined with anti-T cell constructs, including antigen binding constructs, of the invention to treat patients with rheumatoid arthritis, psoriasis, ulcerative colitis, systemic lupus erythematosus (SLE), Crohn's disease , spondylitis ancilosia, and various processes of inflammatory disease.

In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with other antibody or antigen binding constructs of the invention. An example is a construction, for example, an antigen binding construct of the invention capable of binding the CD20 combined with a construct capable of bind the CD22, CD19 or combinations of them. This combination is effective as a treatment for indolent and aggressive forms of B cell lymphomas, and acute or chronic forms of lymphatic leukemia. See U.S. Patent 6,306,393 to Goldberg. In another example, constructs including antigen binding constructs of the invention are co-administered with other constructs such as antigen binding constructs of the invention that help mediate apoptosis. For example, a combination of one or more constructs, including one or more antigen binding constructs of the invention capable of binding to CD28, CD3, CD20 or a combination thereof. The combination of anti-CD28 and CD3 provides a method for prolonged proliferation of T cells. See U. S. Patent 6,352,694 issued to June et al. This prolonged proliferation of T cells increases the cytotoxicity of immuno-dependent efficiency, particularly those associated with anti-CD20 In another aspect, one or more constructs, including one or more antigen binding constructs, of the invention can be administered or co-administered with one or more regulatory molecules of the T cells. An example is a combination with interleukin-12 (IL-12). The cytokine IL-12 stimulates cell-mediated immunity, has angiostatic activity, and has significant antitumor effects in a variety of tumor models. IL-12 has also been shown to stimulate the production of interferon-gamma (IFN-γ). Accordingly, the treatment of patients with multiple myeloma with one or more constructions, including one or more antigen binding constructions, of the invention, in particular those that bind CD20, is expected to be more effective when they are co-administered in conjunction with IL-12. In another example, one or more constructs, including one or more of the antigen binding constructs, of the invention can be administered or co-administered with a ligand binding construct of the invention or another protein capable of binding CTLA-4 to promote antitumor immune response, by means of inhibiting the sub-regulated activation of T cells.

In another aspect, one or more constructs, including one or more antigen binding constructions, of the invention can be combined with therapies and genes. In one example, a conjugated construction with chemotherapy of the invention is administered or co-administered with the antisense oligonucleotide Bci-2. Bcl-2 is associated with tumor resistance to anticancer therapies, and it has been thought to block cell death induced by chemotherapy. In another example, one or more constructs, including one or more antigen binding constructs, of the invention is administered or co-administered with an adenovirus to deliver a "suicide gene". The adenoviruses insert the gene directly into the tumor cells, which makes these cells sensitive to an otherwise ineffective drug. The drug treatments then destroy the tumor cells, while leaving the healthy cells untouched. However, ONCE THE therapy is complete cancer cells that escape therapy can re-establish and metastatisarze. Gene therapy combined with one or more constructs, including one or more antigen binding constructs, will help kill the permanent cancer cells and minimize the reoccurrence of the cancer.

A similar combination can be used with palliative (not radical) to surgical removal of tumors. In this example one or more constructions, including one or more antigen binding constructs of the invention can be administered before and after surgical removal of tumors in order to increase the immune response and reduce the possibility of reoccurrence by killing any cancer cells that were not removed within Surgery.

Another aspect combines a cancer vaccine or antigen and T cell regulatory molecules. For example, the binding portion, e.g., an antigen binding portion, of a construct may be specific for a cancer cell or antigen. Or a protein fragment of a cancer cell or antigen. This can help mediate an immune response against a particular tumor or antigen. Such constructs can be combined with T cell regulators to increase the efficiency of the immune response.

In another example, one or more constructs, including one or more antigen binding constructs, of the invention are administered or co-administered with retinoids. Retinoids include vitamin A and its derivatives, which have the ability to stop cells from dividing and cause them to differentiate. Vitamin A is combined with an anticancer construct, including antigen-linked construction, of the invention to combat various forms of cancer.

The terms "binding construction" and "antigen binding construction" as used herein may refer to, for example, genetically engineered polypeptides, recombinant, synthetic, semi-synthetic polypeptides or other fusion proteins that are capable of binding a target. , for example, an antigen. The antigen binding constructs of the invention can be used in various applications, including those within the range of use to which antibodies or related immunoglobulin-like constructs can be placed. Constructs, including antigen binding constructs, can be used in in vivo or in vitro experiments for therapeutic, diagnostic, research or other purposes. Such uses include, the following.

Constructs, including antigen binding constructs of the invention can be used for Immunohistochemistry applications. For example, they can be used for immunolocalisation of a particular antigen or groups of antigens in a tissue. The tissue can be fixed or incubated with binding constructs with antigen of interest. These constructs can be located using a secondary antibody or binding construct of the invention attached to a label, for example, to a gold particle, or to an enzyme that gives a chemical reaction, similar to horseradish peroxidase or beta- galactosidase A secondary antibody or binding construct is often made reactive against, for example, a portion of the primary binding construct. Thus, for example, if the primary linker construct has a human tail portion, the secondary antibody or the linker construct could be, for example, a rabbit anti-mouse antibody or antigen binding construct that has been linked to beta-galactosidase. Alternatively, the antibody or binding construct of the invention can be purified and then conjugated with another molecule to produce a fluorescent antibody or binding construct.

Constructs, including antigen binding constructs of the invention can also be used to detect the localization of an antigen or antigens on the surfaces of cells or to detect the localization of intracellular materials using, for example, immunoelectric microscopy. Electron-dense materials such as ferritin or colloidal gold, for example, can be conjugated to an antigen binding construct. Scanning with electron microscopy can be used to detect the location of the antigen / bound agent construction complex.

Constructs, including antigen binding constructs of the invention may also be used to quantitate the presence of an antigen or antigens using a variety of immunoassay formats, for example, a radioimmunoassay format (RIA) or a test format. immunosorbent linked with enzymes (ELISA). There are many variants of these teachings, but those are based on the similar idea. For example, if an antigen can be bound to a support or solid surface,. or is in solution, this can be detected by means of reacting it with an antigen binding construct specific of the invention. The presence or amount of the construct can then be detected, or quantified by reacting it with, for example, a secondary antibody or a second antigen-binding construct of the invention by incorporating a label or tag directly into the antibody primary. Alternatively, for example, an antigen binding polypeptide of the invention can be ligated to a solid surface and the antigen added. A second antigen binding antibody or polypeptide of the invention that recognizes a different epitope on the antigen can then be added and detected. This technique has been commonly called "sandwich testing", which is frequently used to avoid high background problems or non-specific reactions, among other reasons.

Because the binding constructs of the invention can have high affinity / affinities and / or selectivity / selectivities for a particular epitope or epitopes, they can also be used as affinity reagents, for example, in proteins or antigen purification. In one example of such a process, the antigen binding constructs of the invention they are immobilized on a suitable support, for example, Sephadex resin or filter paper. The immobilized construct is exposed to a sample that contains, or is suspected to contain, a target protein or antigen. The support is rinsed with a suitable cushion that will remove unwanted materials. The support is washed with another buffer that will release the ligated protein or the bound antigen.

Because the particular binding constructs of the invention can be linked to proteins or other antigens with high affinity and selectivity they can also be used as a criterion for the importance of a particular enzyme or other macromolecule in a particular reaction. If an antigen binding construct of the invention can interfere with a reaction in a solution, this will indicate that the construct can be specifically linked to a protein or other antigenic material involved in that reaction.

Constructs, including the antigen binding constructs of the invention may also be used as receptor blockers or inhibitors or antagonists.

The constructions, including the antigen binding constructions of the invention can also be used in the identification and study of protein functions. If an antigen binding construct of the invention reacts with a specific protein, for example, that protein may subsequently be precipitated from a solution, for example. The precipitation is typically carried out using a secondary antibody or an antigen binding construct of the invention that binds to primary complexes together. Alternatively, the complex can be removed by reacting the solution either with a protein A or, for example, depending on the construct, an anti-Fc antibody, for example, which has been bound to granules, for example, which can be easily removed of the form of the solution.

Constructs, including antigen binding constructs of the invention can also be used in conjunction with gel change experiments to identify binding proteins with specific nucleic acid such as DNA binding proteins. For example, DNA binding proteins can be assayed for their ability to bind with high affinity to a particular oligonucleotide. Mobility of an oligonucleotide associated with the protein is quite different from the mobility of a free oligonucleotide and results in a gel and signal migration pattern that is commonly referred to as a gel change. The addition of the construction to the bonding test can have two effects. If the construct binds to a region of a protein that is not involved in DNA binding, it can result in a complex that has a much slower mobility and is detected as a large change in mobility (a superchange). Alternatively, if the construct binds to a region of the protein involved in recognizing the DNA then it can break the binding and eliminate the change. In any case, the data from these experiments can serve as a criterion to identify the DNA binding protein, for example.

It is also possible to use constructs, including antigen binding constructs of the invention to detect a protein by Western blotting after fractionation by SDS-PAGE, for example. Proteins fractionated are transferred to a membrane such as a sheet of nitrocellulose, they are exposed to a binding construction with particular antigen of the invention that specifically recognizes, or recognizes to a certain degree of selectivity, the proteins immobilized in the spot. This allows the particular proteins to be identified. This teaching is particularly useful if the mobility of the protein changes during an experiment. For example, the incorporation of a phosphate or a carbohydrate, or the division of the protein results in a change in mobility that can be followed directly by Western analysis. With appropriate controls, this teaching can be used to measure the abundance of a protein in response to experimental manipulations.

The combination of SDS gels and immunoprecipitation can also be extremely effective. If a particular protein can be immunoprecipitated in a solution, both the supernatant and the precipitated fractions can be deposited on an SDS gel and studied using antigen binding constructs of the invention.

Sometimes a ligand construction of the invention directed against a protein also precipitates a second protein that interacts with the first protein. The second protein, the same as the first, can be seen by staining the gel or by autoradiography. This relationship is often the first indication that a protein functions as part of a complex and can also be used to demonstrate a physical interaction of two proteins that are hypothesized to interact on the basis of other evidence (for example, two hybrid screening or one suppressor mutation). This teaching can be combined with Western spotting analysis in various ways that are estimated to be effective.

Thus, for example, the antigen binding constructs of the invention can be used in a combination of immunoprecipitation and Western analysis in the study, for example, of signal transduction and protein processing. For example, an immunoprecipitated protein can be subsequently studied by Western analysis using an antibody or binding construct with different antigen of the invention that binds to the protein. The most useful are those that are directed against determinants particular structures that may be present in a protein. Thus, an antibody or antigen binding construct of the invention directed against a region of the protein that is subjected to proteolytic processing may be useful for following proteolytic processing. Additionally, a construction of the invention or a mixture of binding constructs with antigen of the invention that recognizes phosphorylated peptides (e.g., anti-PY (phosphorylated tyrosine) can be used to track the degree of phosphorylation of a protein (using Western analysis) after it is precipitated, or vice versa. Glycosylation reactions can also be followed by antigen binding constructs of the invention directed against the carbohydrate epitope (or by lectins, ie proteins that recognize carbohydrates). Similarly, some antigen binding constructs of the invention can also be made to specifically recognize a phosphorylated epitope, for example, that they recognize a tyrosine or a serine residue after phosphorylation, but that they do not bind (or link detectably) to the epitope in the absence of phosphate. This teaching can be used to determine the phosphorylation status of a particular protein. By example, the phosphorylation of CREB (cAMP response element of the binding protein) can be followed by an antibody that specifically recognizes an epitope in a manner that is dependent on the phosphorylation of serine 133.

Constructs, including antigen binding constructs of the invention can also be used to screen expression libraries to isolate candidate polynucleotides that express or present a particular epitope, or that have a particular affinity or expression characteristic.

Constructs, including antigen binding constructs of the invention that bind to a cell surface can also be used as a marker to quantitate the fraction of cells expressing the label using flow cytometry. If the antigen binding constructs other than the invention / combinations with fluorescent inks are used, for example, the fraction of cells expressing various antigens can be determined.

Constructs, including antigen binding constructs of the invention that function as anti-idiotype antibodies, ie, antibodies against the binding domain of another antibody, can be used in any number of methods in which it would be desirable or useful to mimic the structure of an antigen. Such uses include for example, uses in cancer vaccines (including antigen binding constructs of the invention that incorporate a molecular adjuvant), such as test tubes for receptors, as receptor agonists as receptor antagonists, as blockers or receptor inhibitors, etc.

In another aspect, constructs, including antigen binding constructs of the invention can biospecify and therefore be capable of binding to two distinct epitopes, which may be present in the same or different cell types.

In vivo uses of constructs of the invention, including antigen binding constructs, include therapies, alone or in combination with one or more other therapies, for various diseases including cancers as well as B cell disorders including diseases autoimmune In some cases, the constructions of the invention are administered to a patient. In other cases, the constructs can be coupled to another molecule by techniques known in the art, for example, a fluorescent molecule to help visualize an objective, or a therapeutic drug and / or a toxin to help eliminate an objective.

For example, a labeled molecule or a labeled atom can be conjugated or otherwise linked to an antigen binding construct of the invention to help visualize it or as a diagnostic agent. These include, but are not limited to, enzymatic labels, radioisotopes, or radioactive compounds or radioactive elements, fluorescent compounds or metals, chemiluminescent compounds, and bioluminescent compounds. Thus, the ligand constructions or antigen binding constructions of the invention can be conjugated with a drug, which allows to objectify the specific drug and increase the efficiency once the drug reaches the target. This facilitates drug therapies while reducing systemic toxicity and side effects. This allows the use of drugs that would otherwise be unacceptable when administered systemically. The dosage depends on the potency of the drug and the effectiveness of the construction of the vehicle. Other examples of in vivo uses include the use of ligand constructions or antigen binding constructs of the invention in which a toxin is linked chemically or conjugated to a polypeptide of the invention to form, eg, molecules that can be called "immunoconjugated" "or" immunotoxins ". Typically, for example, such a toxin may include one or more radioisotopes (for example, Iodo-131, Itrium-90, Renio-186, Copper-67, and / or Bismuth-212), natural toxins, chemotherapy agents, biological response modifiers or other substances that are capable of helping to damage or kill target cells, inhibit the replication of target cells or is effective in breaking down a desired cellular function in a cell objective.

The toxin portion of the immunotoxin can be derived from various sources. Toxins are commonly derived from plants or bacteria, but toxins of human origin or synthetic toxins can also be used, for example. Examples of toxins derived from bacteria or plants include but are not limited to abrin, a-sarcin, diphtheria toxin, ricin, saporin, and pseudomonas exotoxin. Examples of mammalian enzymes include, but are not limited to, ribonucleases (RNAse) and deoxyribatoseases. Numerous immunotoxins that can be used with one or more constructions of the invention have been described in the art. See, for example, U.S. Patent No. 4,753,894 issued to Frankel et al .; U.S. Patent No. 6,099,842 to Pastan et al .; Nevelle, et al., 1982 Immunol Rev. 62: 75-91; Pastan et al., 1992 Aran Rev Biochem 61: 331-354; Chaudary et al., 1989 Nature 339: 394; and Batra et al., 1991 Mol. Cell. Biol. 11: 2200. The modified toxins described herein and those described in the various publications are also within the scope of the present invention.

Generally, immunotoxins and other therapeutic agents of this in v are administered in a concentration that is therapeutically effective to treat or prevent a particular disease, disorder, or condition, such as the treatment of tumors and malignancies, the treatment of autoimmune diseases, allergies and inflammation, etc. This dosage and effective mode of administration depends on the animal or patient being treated, the disease or condition being treated, the resistance of immunoconjugates or immunotoxins and the efficiency of the conjugate. To carry out this task, the immunotoxins can be formulated using a variety of acceptable formulations and excipients known in the art. Typically, for example, immunotoxins are administered by injection, either intravenously or intraperitoneally. The methods for carrying out this administration are known to those skilled in the art. In another aspect, the invention includes compositions administered topically or orally such as an aerosol, a cream or a patch that may be capable of transmission through the mucous membranes.

The formulants may be added to immunoconjugates or immunotoxins of the invention prior to administration to a patient being treated. A liquid formulation is more common, but other formulations are within the scope of the invention. The formulants may include, for example, oils, polymers, vitamins, carbohydrates, amino acids, salts shock absorbers, albumin, surfactants or filling agents. Carbohydrates may include sugar or sugar alcohols such as mono, di, or plissaccharides, or water-soluble glycans. The saccharides or glucans can include for example fructose, dextrose, lactose, glucose, mannose, sorbose, xylose, maltose, sucrose, dextran, pullulan, dextrin, alpha and beta cyclodextrin, soluble starch, hydroxethyl starch and carboxymethylcellulose, or mixtures thereof. "Sugar alcohol" can be defined as a hydrocarbon with 4 to 8 carbons having an -OH group and includes, galactitol, inositol, mannitol, xylitol, sorbitol, glycerol, and arabitol. These sugars or sugar alcohols mentioned above can be used individually or in combination. There is no fixed limit to the amount that is used as long as the sugar or sugar alcohol is soluble in the aqueous preparation. In one aspect, sugar or sugar alcohol in its concentration is between 0.5 p / v% and 15 p / v%, typically between 1.5 p / v%, and 7 p / v%, more typically between 2.0 p / v % and 6.0 p / v%.

Illustrative amino acids include the Levorotary (L), camitine, arginine, and betaine forms. However, other amino acids can be added. The polymers commonly used include polyvinylpyrrolidone (PVP) with an average molecular weight between 2,000 and 3,000, for example, or polyethylene glycol (PEG) with an average molecular weight between 3,000 and 5,000, for example. A buffer that can be used in the composition to minimize pH changes in the solution before lyophilization or after reconstitution. Any physiological buffer can be used, but the most commonly used are citrate, phosphate, succinate and glutamate buffers or mixtures thereof. The concentration can be, for example, between 0.01 to 0.03 molar. Higher or lower concentrations can be used.

The immunotoxins of the invention can be chemically modified by covalent conjugation to a polymer to increase its average circulating life, for example. Illustrative polymers and methods for attaching them to peptides are referenced in U.S. Pat. Nos. 4,766,106 issued to Katre et al .; 4,179,337 to Davis et al .; 4,495,285 to Shimizu et al .; and 4,609,546 to Hiratani.

The following examples are offered as a way of illustration and not as a way of limitation.

EXAMPLE 1 CLONING OF VARIABLE REGIONS 2H7 AND THE CONSTRUCTION AND SEQUENCING OF 2H7SCFV-IG This example illustrates the cloning of the cDNA molecules encoding the variable regions of the heavy chain and the light chain of the monoclonal antibody 2H7. This example also demonstrates the construction, sequencing, and expression of 2H7scFv-Ig.

Before harvesting, cells expressing the monoclonal antibody 2H7 that specifically binds to CD20 are maintained in daily growth for several days in RPMI-1640 medium from Invitrogen / Life Technologies, Gaithersburg, MD) supplemented with glutamine, pyruvate, amino acids of non-essential DMEM, and penrcillin-streptomycin. The cells are pelleted by centrifugation from the culture medium, and 2x107 cells are used to prepare the RNA. The RNA is isolated from the 2H7-producing hydridoma cells using the Pharmingen total RNA isolation kit (San Diego, CA) (catalog No. 4552OK) according to the manufacturer's instructions.

I came with the kit. One microgram (1 μg) of the total RNA is used as a template to prepare the cDNA by reverse transcription. The RNA and 300 ng of random primers are combined and denatured at 722 C for 10 minutes before the addition of the enzyme. The Superscript II reverse transcriptase (Life Technologies) is added to the RNA plus the initiator mixture in a total volume of 25 μl in the presence of 5X second charge and 0.1 M DTT provided with the enzyme. The reverse transcription reaction is allowed to proceed at 422 C for one hour.

The 2H7 cDNA that is generated in the randomly primed reverse transcriptase reaction and the V region specific primers were used to PCR amplify the variable regions for the light and heavy chain of the 2H7 antibody. The region V-specific primers were designed using the published sequence Genbank access numbers M17954 for VL and M17953 for VH) with a guide. The two variable chains were designated with compatible end sequences so that one scFv can be assembled by ligating the two V regions after the amplification and digestion of the restriction enzyme.

A peptide linker (GlySer) 3 to be inserted between the two V regions is incorporated by adding extranucleotides in the antisense primer pair to the VL of 2H7. A Sac I restriction site is also introduced at the junction between the two V regions. The sense primer used to amplify the VL of 2H7, which includes a HindIII restriction site and the light chain leader peptide is 5 '- gtc aag ctt gcc gcc atg gat ttt ca gtg cag att ttt cag c-3 '(SEC ID No._).' The antisense initiator is 5 '-gtc gtc gag etc cea ect cect ce ce ce ce ce ce ce cec ceg cea cect ect ttc age tec age ttg gtc cc-3' (SEC ID No.: _). The reading frame of the V region is indicated in bold, and the codon underlined. The HindIII and Sacl sites are indicated by underlined sequence and are placed in sloping letters.

The VH domain is amplified without a leader peptide, but a 5? Restriction site is included. Sacl for fusion to the VL and a Bcll restriction site at the 3 'end for fusion with various tails, including the human IgGl Fe domain and the truncated forms of the CD40 ligand, CD154. The sense initiator is 5'-gct gct gag etc tea ggc tta tet here gca agt ctg g-3 '(SEC ID No._). The Sacl site is indicated in an inclined and underlined font, and the codon reading frame for the first amino acid of the VH domain is indicated in bold, underlined type. The antisense initiator is 5'-gtt gtc tga tea gag acg gtg acc gtg gtc cc-3 '(SEQ ID No._). The Bcll site is indicated in sloped and underlined letters and the last serine in the VH domain sequence is indicated in bold and underlined type.

The scFv-Ig is assembled by inserting the HindIII-Bcll scFv fragment from 2H7 into PUC19 containing the human IgGl pivot, the CH2, and CH3 regions, which are digested with restriction enzymes, HindIII-BcII. After ligation, the ligation products were transformed into the DH5a bacterium. Positive clones are screened or picked for the appropriately inserted fragments using the Sacl site at the VL-VH junction of 2H7 as a diagnostic site. The 2h7scFv-Ig cDNA is subjected to a sequencing cycle in a PE9700 thermocycler using a program of 25 cycles by means of denaturing at 96 ° C for 10 seconds, annealing at 50 ° C for 30 seconds, and extending at 72 ° C for 4 minutes. . The sequencing primers are direct forward pUC primers and reverse and an internal primer that tunes to the human CH2 domain in the IgG constant region portion. The sequencing reactions are carried out using the Ready Sequencing Mix (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Samples were subsequently purified using Centrisep columns (Catalog No. CS-901, Princeton Separations, Adelphia, • N. J-), the eluates were dried in a Savant vacuum dryer, denatured in the Template Suppression Reagent (PE-ABI), and analyzed in an ABI 310 genetic analyzer Genetic Analyzer (PE-Applied Biosystems). The sequence is edited, translated and analyzed using the Vector Nti version 6. 0 (Informax, North Bethesda, MD). Figure 1 shows the cDNA and predicts the amino acid sequence of the 2H7scFv-Ig construct.

EXAMPLE 2 EXPRESSION OF 2H7 SCFV-IG IN LINES OF STABLE CHO CELLS This example illustrates the expression of 2H7scFv-Ig in a eukaryotic cell line and the characterization of the 2H7scFv-Ig expressed by SDS-PAGE and by functional assays, including ADCC and complementary ion.

The HindIII-Xbal 2H7scFv-Ig (approximately 1.6 kb) as a fragment with the correct sequence is inserted into the mammalian expression vector pDl8, and the location DNA of positive clones is amplified using the QIAGEN plasmid preparation kits (QIAGEN, Valencia, CA). The DNA of the recombinant plasmid (100 μg) is then linearized in a non-essential region by digestion with AscI, purified by extraction of phenol, and resuspended in a tissue culture medium, Excell 302 (Catalog No. 14312-79P, JRH Biosciences, Lenexa, KS). The cells for transcription, the CHO cells of DG44, are maintained in logarithmic growth, and 107 cells were harvested for each transfection reaction. The linearized DNA is added to the CHO cells in a total volume of 0.8 ml for electroporation.

The stable product of the scFv-Ig fusion protein of 2H7 (SEQ ID NO: 10) is achieved by electroporation of a selectable amplifiable plasmid pDl8, which contains the cDNA of the 2H7 scFv-Ig under the control of the CMV promoter, in Chinese Hamster Ovary (CHO) cells (all cell lines of the American Type Culture Collection, Manassas, VA, unless otherwise stated). The expression cassette 2H7 is subcloned downstream of the CMV promoter within the multiple vector cloning site as an approximately 1.6 kb HindIII-Xbal fragment. The pDl8 vector is a modified version of pcDNA3 that encodes the DHFR selectable marker with an attenuated promoter to increase the selection pressure for the plasmid. The plasmid DNA is prepared using the Qiagen maxiprep kits and the pure plasmid is linearized into a unique AscI site before phenol extraction and precipitation with ethanol. The DNA of salmon sperm (Sigma-Aldrich, St. Louis, MO) is added as carrier DNA, and 100 μg of each of the plasmid DNA and the carrier are used to transfect 107 DG44 cells of the CHO by electroporation. The cells are grown in logarithmic phase in an Excell 302 medium (JRH Biosciences) containing glutamine (4mM), pyruvate, recombinant insulin, penicillin-streptomycin, and non-essential amino acids DMEM 2X (all from Life Technologies, Gaithersburg, Maryland), hereinafter referred to as the medium "Excel 302 complete" means for non-transfected cells it also contains HT (diluted from a l'OOX solution of hypoxanthine and thymidine) (Invitrogen / Life Technologies). The medium for transitions under selection contains various levels of methotrexate (Sigma.Aldrich) as a selective agent in a range between 50 nM to 5 μM. The electroporations are carried out at 275 volts, 950 μF. The transfected cells are allowed to recover overnight in a nonselective medium prior to selective plating in 96-well flat bottom plates (Costar) in various serial dilutions ranging from 125 cells / well to 2,000 cells / well. The culture medium for cell cloning is complete Excel 302, which contains 100 nM of methotrexate. Once clonal growth is sufficient, serial dilutions of the culture supernatants from the master wells are selected for binding to transfected CD20-CHO cells. The clones with the highest production of the fusion protein are expanded in T25 flasks and then T75 to supply the appropriate numbers of cells for freezing and for measuring the production of 2H7scFv-Ig. The production levels are further increased in cultures from three clones by means of progressive amplification in methotrexate containing the culture medium. In each In successive passage of cells, the complete Excel 302 medium contains an increased concentration of methotrexate, so that only the cells that amplified the DHFR plasmid can survive.

Supernatants are harvested from CHO cells expressing 2H7scFv-Ig, filtered through 0.2 Pm express PES filters (Nalgene, Rochester, NY) and passed over a protein A-agarose column (IPA 300 cross-linked agarose (Repligen, Needham, NA). The column is washed with PBS, and then the bound protein is eluted using 0.1 citrate buffer, pH 3.0. The fractions are harvested and the eluted protein is neutralized using a 1M Tris, pH 8.0, before overnight dialysis in PBS. The concentration of pure 2H7scFv-Ig (SEQ ID No.:_) is determined by absorption at 280 nm. An extinction coefficient of 1.77 is determined using the protein analysis tools in the Nti Vector software package and version 6.0 (Informax, North Bethesda, MD). This program uses the data of the amino acid composition to calculate the extinction coefficients.

The production levels of 2H7scFv-Ig by stable transfected CHO cells are analyzed by flow cytometry. Pure 2H7scFv-Ig to CHO cells allows binding to CHO cells expressing CD20 (CD20 CHO) and is analyzed by flow cytometry using a second-stage reagent of conjugated anti-human IgG fluorescein (Catalogs No. H10101 and H10501 , CalTag, Burlinga e, CA). Figure 2 (upper) shows a standard curve that is generated by titration of 2H7scFv-Ig that binds to CD20 CHO. At each concentration of 2H7scFv-Ig, the average brightness of the fluorescein signal in linear units is shown. The supernatants that are collected from the T flasks containing stable CHO cell clones expressing 2H7scFv-Ig allow them then to bind to the CD20 CHO and the ligand is analyzed by flow cytometry. The fluorescein signal is generated by 2H7scFv-Ig contained in the supernatants is measured and the concentration 2H7scFv-Ig in the supernatants is calculated from the standard curve (figure 2, lower).

The purified 2H7scFv-Ig (SEQ ID No._) is analyzed by electrophoresis on SDS-Polyacrylamide gels. The samples of 2H7scFv-lg purified by the runs in column of A-agarose independent protein, boiled in a SDS sample buffer wit reduction of the disulfide bonds and applied to the SDS 10% Tris-Bis gels (Catalog No. NP0301, Novex, Carlsbad, CA). Twenty micrograms of each purified batch are loaded onto the gels. Proteins are visualized after Coomassie Blue staining electrophoresis (Pierce Gel Code Blue Stain Reagent, Catalog No. 24590, Pierce, Rockford, IL), and stained in distilled water. Molecular markers are included in the same gel (Kaleidoscope Prestained Standards, Catalog No. 161-0324, Bio-Rad, Hercules, CA). The results are presented in Figure 3. The numbers above the tracks designate the independent purification runs. The molecular weights in kilodaltons of the size markers are indicated on the left side of the figure. Additional experiments with alternative sample preparation conditions indicate that the reduction of disulfide bonds by boiling the protein in the SDS sample buffer containing DTT or 2-mercaptoethanol causes the 2H7scFv-Ig to aggregate.

Any number of other immunological parameters can be monitored using routine tests that are well known in the art. These may include, for example, ADCC antibody-dependent cell-mediated cytotoxicity, antibody secondary responses in vitro, immunocytofluorometric flow analysis and of various mononuclear or lymphoid cell populations or peripheral blood using established marker antigen systems, immunohistochemistry or other relevant trials. These and other assays can be found, for example, in Rose et al. (Eds.), Maslual of Cli72ical Laborato7-and Immunology, 5th Ed., 1997 American Society of Microbiology, Washington, DC.

The ability of 2H7scFv-Ig to kill CD20 positive cells in the presence of complement is assayed using Ramos and Bjab B cell lines. The rabbit complement (Pel-Freez, Rogers, AK) is used in the assay at a final dilution of 1/10. Purified 2H7scFv-Ig is incubated with B cells and the complemneto for 45 minutes at 37 ° C, followed by counting live and dead cells by blue tryptin exclusion. The results in Figure 4 show that in the presence of rabbit complement 2H7scFv-lg breaks B cells expressing CD20.

The ability of 2H7scFv-Ig to kill CD20 positive cells in the presence of peripheral blood mononuclear cells (PBMC) is assayed by measuring 51Cr release from labeled Bjab cells in a 4 hour assay using a 100: 1 ratio of PBMC to Bjab cells. The results shown in Figure 4B indicate that 2H7scFv-Ig can mediate antibody dependent cellular cytotoxicity (ADCC) because the 51Cr release is greater in the presence of both PBMC and 2H7scFv-Ig than in the presence of any PBMC or 2H7scFv-Ig alone.

EXAMPLE 3 EFFECT OF THE SIMULTANEOUS LIGATION OF CD20 AND CD40 ON THE GROWTH OF NORMAL B CELLS, AND ON CD95 EXPRESSION, AND INDUCTION OF APOPTOSIS This example illustrates the effect on cell proliferation of the crosslinking of CD20 and CD40 expressed on the surface of the cell.

The remaining dense B cells are isolated from human tonsils by a Percoll lid gradient and the T cells are removed by roseate by E. Proliferation of the B cells of the remaining dense tonsils are measured by a 3 [H]] -thymidine shot during the last 12 hours of a four-day experiment. Proliferation is measured in quadrupled cultures with means and standard deviations as shown. The anti-human murine CD20 monoclonal antibody (anti-CD20) is used alone or cross-linked with anti-murine monoclonal antibody K 187.1 (anti-CD20XL). Activation of CD40 is carried out using soluble human CD154 which is fused with murine CD8 (CD154) (Hollenbaugh et al., EMBO J. 11: 4212-21 (1992)), and crosslinked CD40 is carried out using antibody Monoclonal CD8 53-6 anti-murine (CD154XL). This procedure allows the simultaneous crosslinking of CD20 and CD40 on the cell surface. The results are given in figure 5.

The effect of the crosslinking of CD20 and CD40 on .cells Ramos, a line of B lymphoma cells, is examined. Ramos cells are analyzed for CD95 expression (Fas) and percentage of apoptosis eighteen hours after treatment (no goat anti-mouse IgG (GAM)) and / or cross-linking (+ GAM) using murine monoclonal antibodies that specifically bind CD20 (IF5) and CD40 (G28-5 ).

The control cells are treated with a non-ligand isotype control (64.1) specific for CD3.

The treated Ramos cells were harvested, incubated with FITC-anti-CD95, and analyzed by flow cytometry to determine the level of relative expression of Fas on the cell surface after cross-linking of CD20 or CD40. The data are plotted as mean fluorescence of cells after treatment with the indicated stimulus (Figure 6A).

Ramos cells treated from the same experiment were harvested and annexin V ligated were measured to indicate the percentage of apoptosis in the treated cultures. Apoptosis is measured by Annexin V binding 18 hours after the crosslinking of CD20 and CD40 using 1F5 and G28-5 followed by cross-linking with GAM '. The binding of Annexin V is measured using a FITC-Annexin V kit (Catalog No .: PN-IM2376, Immunotech, Marseille, France,). The binding of Annexin V is known to be an early event in the progression of cells towards apoptosis. Apoptosis, or programmed cell death is a process characterized by a cascade of catabolic reactions that lead to cell death by suicide. In the early phase of apoptosis before the cells change their morphology and hydrolyze the DNA, the integrity of the cell membrane is maintained but the cells lose the asymmetry of their membrane phospholipids, and exposing negatively charged phospholipids, such as phosphatidylserine, on the cell surface. Annexin V, a protein bound in calcium and phospholipid, binds preferentially and with a high affinity to phosphatidylserine. The results demonstrate the effect of crosslinking both CD20 and CD40 on the expression of the FAS receptor (CD95) and are presented in Figure 6B. The effect of crosslinking both CD20 and CD40 on the binding of Annexin V to the cells is shown in Figure 6B.

EXAMPLE 4 CONSTRUCTION AND CHARACTERIZATION OF FUSION PROTEINS SCFV-CD154 DEL 2H7.

To construct a molecule capable of binding to both CD20 and CD40, the cDNA encoding the 2H7 scFv is fused with the cDNA encoding CD154, and the CD40 ligand. He cDNA of the 2H7 scFv which is encoded on the HindlII-BclI fragment is removed from the scFvIg construct of 2H7, and inserted into a pDl8 vector together with a BamHI-Xbal cDNA fragment encoding the extracellular domain of human CD154. The extracellular domain is encoded at the carboxy terminal of CD154, similar to the other type II membrane proteins.

The extracellular domain of human CD154 is amplified by PCR using the cDNA generated with random primers and RNA of human T lymphocytes activated with PHA (phytohemagglutinin). The primer systems include two different 5 'or sense primers that create fusion junctions at two different positions within the extracellular domain of CD154. The two different fusion junctions are designed so as to result in a short or truncated form (S4 form) that includes amino acids 108 (Glu) -261 (Leu) + (Glu), and a long or complete form (form 12) including amino acids 48 (arg) -261 (leu) + (Glu), from the extracellular domain of CD154, both constructed as BamHI-Xbal fragments. The sense primer that fuses the two extracellular truncated domains other than 2H7scFv includes a BamHI site for the cloning the sense primer for the S4 form of the cDNA of the CD154 is designated as sequence identifier No .: 11 or CD154BAM48 and encodes a mer 34 with the following sequence: 5 '-gtt gtc gga tcc aga aaa cag ctt tga aat gca a -3 ', while the antisense initiator is designated as sequence identifier No .: 12 or CD154XBA and encodes a mer 44 with the following sequence: 5' -tttttttttct aga tta tea etc gag ttt gag taa gcc aaa gga cg- 3 ' .

The oligonucleotide primers used in the amplification of the long form (L2) of the CD154 extracellular domain encode amino acids 48 (Arg) -261 (Leu) + (Glu), which are as follows: The sense initiator designated CD154BAM48 (ID. SEC No .: 13) encodes a 35-mer with the following sequence: 5 '-gtt gtc gga tcc aag aag gtt gga ca ga gat aga ag-3'. The antisense initiator designated as CD154XBA (SEQ ID No._) encodes the 44-mer: 5 '-gtt gtt tct aga tta tea etc. gag ttt gag taa gcc aaa gga cg-3'. Other conditions of the PCR reaction have been identical to those used to amplify the 2H7 scFv (see example 1). The PCR fragments are purified by PCR rapid kits (QIAGEN, San Diego, CA) and eluted in 30 μl of ddH20, and digested with BamHl restriction endonucleases. and Xbal (Roche) in a reaction volume of 40 μl and 37 ° C for three hours. The fragments are purified by gel, purified using QIAEX kits according to the manufacturer's instructions (QIAGEN), and ligated together with the HindlII-BclI fragment of 2H7 into the expression vector pDl8 which is digested with HindIII + Xbal. The ligation reactions are transformed into chemically competent bacteria of DH5-alpha and plated on LB plates containing 100 μg / ml of ampicillin. The transformants were made, grown overnight at 37 ° C, and the isolated colonies used to inoculate 3 ml of liquid cultures in Luria Broth contained 100 μg / ml of ampicillin. The clones were screened after miniplasmid preparations (QIAGEN) for the insertion of both the 2H7 scFv and the extracellular domain fragments CD154.

The cDNAs of the 2H7scFv-CDl54 construct are subjected to sequencing cycle on a Thermocycler For example 9700 using a program of 25 cycles including denaturation at 96a C 10 seconds, annealing at 50a C for 5 seconds, and extending at 60aC during 4 minutes The sequencing primers used were direct pD18 (SE ID No. 5_-gtctatataagcagagctctggc-3 ') and reverse pDl8 (SEC ID No.:_ 5'-cgaggctgatcagcgagctctagca-3 '). In addition, an internal initiator is used which has homology to the human CD154 sequence (SEQ ID NO: 1: 5'-ccgcaatttgaggattctgatcacc-3 '). Sequencing reactions include primers at 3.2 pmol, approximately 200 ng DNA template, and 8 μl of cleavage mixing. Sequencing reactions are carried out using the Big Dye Terminator Ready Sequencing Mix (PE Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The samples are subsequently purified using Centrisep columns (Princeton Separations, Adelphia, NJ). The eluates are dried in a Savant speed vacuum dryer, denatured in 20 μl of Template Suppression Reagent (ABI) at 95 ° C for 2 minutes and analyzed on an ABI 310 Genetic Analyzer (PE-Applied Biosystems). The sequence is edited, translated and analyzed using version 6.0 of Vector Nti (Informax, North Bethesda, MD). The cDNA sequence of the 2H7scFv-CDl54 L2 and the predicted amino acid sequence is presented in Figure 7A, and the cDNA sequence 2H7scFv-CDl54 S4 and the predicted amino acid sequence are presented in Figure 7B.

The binding activity of the fusion proteins of scFv-CD154 from 2H7 (SEQ ID No.:_y_) to CD20 and CD40 is simultaneously determined by flow cytometry. The assay uses CHO target cells that express CD20. After a 45-minute incubation of CD20 CHO cells with supernatants from cells transfected with the scFv-CDl54 expression plasmid of 2H7, CD20 CHO cells are washed twice and incubated with biotin-conjugated CD40-Ig fusion protein. in PBS / 2% FBS. After 45 minutes, the cells are washed twice and incubated with labeled estrepavidin-phycoerythrin (PE) at 1: 100 in PBS / 2% FBS (Molecular Probes, Eugene OR). After an additional 30-minute incubation the cells are washed 2X and analyzed by flow cytometry. The results show that the scFv-CDl54 molecule of 2H7 is able to bind to CD20 on the cell surface and capture the CD40 conjugated with biotin from the solution (Figure 8).

To determine the effect of 2H7scFv-CDl54 on the growth and viability of lymphoma B and lymphoblastoid cell lines, cells are incubated with 2H7scFv-CDl54 L2 (SEQ ID No._) for 12 hours and then are examined for the binding of Adexin V. Adexin V binding is measured using a FITC-Annexin V kit (Im unotech, Marseille, France, Catalog No .: PN-IM2376). The B cell lines are incubated in 1 ml cultures with dilutions of concentrated and dialyzed supernatants from cells expressing secreted forms of the 2H7scFv-CDl54 fusion proteins. The results are given in figure 9.

The growth rate of the B Ramos lymphoma lines in the presence of 2H7scFv-CDl54 is examined by a 3H-thymidine intake during the last 6 hours of a 24-hour culture. The effect of 2H7scFv-CDl54 on cell proliferation is shown in Figure 10.

EXAMPLE 5 CONSTRUCTION AND CHARACTERIZATION OF ANTIBODY DERIVATIVES CITOXB The CitoxB antibodies are prepared in the scFv-IgG polypeptide of 2H7. The scFv of 2H7 (see Example 1) is ligated to the human IgGl Fe domain via an altered pivot domain (see Fig. 11). The cysteine residues in the pivot region were replaced by serine residues by site-directed mutagenesis and other methods known in the art. The mutant pivot is either a natural or wild type Fe domain to create a construct, designated CitoxB-MHWTGlC or is fused with a mutated Fe domain (CitoxB-MHWTGlC) having additional mutations introduced into the CH2 domain. The amino acid residues in CH2 that are involved in effector function are illustrated in FIG. 11. Mutations of one or more residues can reduce the binding to the FcR and the mediation of the effector functions. In this example, the leucine residue 234 known in the art as important for the binding of the Fe receptor is mutated in the scFv fusion protein of 2H7, CitoxB- [MG1H / MG1C]. In another construction, the human IgGl pivot region is replaced with a portion of the human IgGl pivot, which is fused to the wild type human Fe domain (CitoxB-IgAHWTHGlC). (See figure 11). This "mutated" pivot region allows the expression of a mixture of monomeric and dimeric molecules which retains properties of the CH2 and CH3 domains of human igGl. The expression cassettes of the synthetic recombinant cDNA for these molecules were constructed and the polypeptides were expressed in CHODB44 cells according to the methods described in example 2.

Purified fusion protein derivatives of CitoxB-scFvIg molecules are analyzed by SDS-PAGE according to the methods described in Example 2. Polyacrylamide gels are run under non-reducing and reducing conditions. Two sets of different molecule weight markers, Biorad pre-stained markers (BioRAD, Hercules, CA) and Novex Multimark molecular weight markers are loaded onto each gel. The migration patterns of the different constructions and Rituximab ™ are presented in Figure 12.

The ability of different derivatives of the CitoxB-scFvIg molecules to mediate ADCC is measured using the Bjab B-lymphoma cells as the target and freshly prepared human PBMC as the effector cell. (See example 2). The proportions of effector to target are varied as follows: 70: 1, 35: 1 and 18: 1, with the number of Bjab B cells per well that remains constant but the number of PBMC is varied. Bjab B cells are labeled for 2 hours with 51 Cr and aliquoted to a cell density of 5 x 104 cells / well for each well of the 96-well flat bottom plates purified fusion proteins or Rituximab are added at a concentration of 10 μg / ml to the various dilutions of PBMC. Spontaneous release is measured without the addition of PBMC or fusion protein, and release m. { axina is measured by the addition of detergent (1% NP-40) to the appropriate wells). The reactions are incubated for hours and 100 μl of culture supernatant is harvested in a Lumaplate (Packard Instruments) and allowed to dry overnight before counting the cpm released. The results are presented in figure 13.

The complement-dependent cytotoxicity (CDC) activity of the CitoxB derivatives is also measured. The reactions were carried out essentially as described in example 2. The results are presented in figure 14 as percentages of dead cells with respect to the total cells for each concentration of the fusion protein.

EXAMPLE 6 IN VIVO STUDIES IN MACACO The initial in vivo studies derived from CitoxB have been carried out in non-human primates. Figure 15 shows the data that characterize the average life of the serum of CitoxB in monkeys. Measurements are carried out on serum samples obtained from two different macaques (J99231 and K99334) after doses of 6 mg / kg are administered to each monkey on the days indicated by the arrows. For each sample, the level of 2H7scFvIg present is estimated by comparison with a standard curve generated by the binding of the purified CitoxB- (MHWTGlC) Ig fusion protein to CD20 CHO cells (see example 2). The data is tabulated in the lower panel of Figure 15.

The effect of the CitoxB- (MHWTGlC) Ig fusion protein on the levels of more ciating CD40 cells in macaques was investigated. Complete blood counts are carried out on each of the days indicated in Figure 16. In addition, the FACS assays (fluorescence-activated cell sorting) are carried out on peripheral blood lymphocytes using fluorescein-specific CD40 conjugated with antibody to hold B cells within the cell population. The percentage of positive cells is then used to calculate the number of B cells in the original samples. The data is plotted as thousands of B cells per microliters of blood measured on the days indicated after the injection (Figure 16).

EXAMPLE 7 CONSTRUCTION AND EXPRESSION OF AN FUSION PROTEIN SCFv-Ig ANTI-CD19 An anti-CDl9 scFv-Ig fusion protein is constructed, transfected into prokaryotic cells and expressed according to the methods presented in Examples 1, 2 and 5 and standard in the art. The variable heavy chain and variable light chain regions are cloned from the isolated RNA from hybridoma cells that produce the HD37 antibody, which specifically binds to CD19. The expression levels of an HD37 scFV-IgAHWTGlC and an HD37scFv-IgMHWTGlC are measured and compared to a standard curve generated using purified HD37 scFvIg. The results are given in figure 17.

EXAMPLE 8 CONSTRUCTION AND EXPRESSION OF AN FUSION PROTEIN SCFv-Ig ANTI-L6 A scFv-Ig fusion protein is constructed using variable regions derived from an anticarsinoma L6 monoclonal match. The fusion protein is constructed, transfected into eukaryotic cells, and expressed according to the methods presented in Examples 1, 2 and 5 and standard of the art. The expression levels of scFv-IgAH WCH2 CH3 L6 and L6 scFv- (SSS-S) H WCH2 WCH3 are measured and compared to a standard curve generated using the scFvIg L6. The results are presented in figure 18.

EXAMPLE 9 CHARACTERIZATION OF VARIOUS FUSION PROTEINS SCFV-Ig In addition to the scFv-Ig fusion protein already described, the fusion proteins G28-1 (anti-CD37) scFv-Ig are prepared essentially as described in examples 1 and 5. The variable regions of the heavy and light chains they are cloned according to methods known in the art. The ADCC activity of 2H7-MHWTGlC, 2H7-IgAHWTGlC, G28-1-MHWTG1C, G28-1 IgAHWTGlC, HD37-MEIWTG1C, and HD37 ~ IgAHWTGlC it is determined according to the methods described above (see example 2). The results are given in Figure 19. The ADCC activity of L6scFv-IgAHWTGlC and LdscFv-IgMHWTGlC are measured using a 2981 human lung carcinoma cell line. The results are given in Figure 20. The monoclonal antibody L6 from murine is known to does not exhibit ADCC activity.

The purified proteins are analyzed by SDS-PAGE under reducing and non-reducing conditions. The samples are prepared and the gels are run essentially as described in examples 2 and 5. The results for the fusion protein L6 and 2H7 sdFv-Ig are presented in figure 21 and the results for the fusion protein G28-1 and HD37sdFv-Ig are presented in Figure 22.

EXAMPLE 10 CONSTRUCTION AND EXPRESSION OF FUSION PROTEINS ANTI-CD20 SCFv-LLAMAIG This example illustrates the cloning of constant region domains called IgGl, IgG2, and IgG3 and the construction of Immunoglobulin fusion proteins with each of the three constant regions and anti-CD20scFv.

The constant regions of the immunoglobulins called IgGl, IgG2, and IgG3 immunoglobulins are cloned and inserted into mammalian vector constructs containing a single anti-CD20 chain Fv, 2H7scFv. Total RNA is isolated from peripheral blood mononuclear cells (PBMC) from flame blood (Triple J Farms, Bellingham, WA) by lysate lymphocytes in TRIzol® (Invitrogen Life Technologies, Carlsbad, CA) according to manufacturer's instructions. One microgram (1 μg) of the total RNA is used as a template to prepare cDNA by reverse transcription. The RNA and 200 ng of random primers were combined and denatured at 72 ° C for 10 minutes before the addition of the enzyme. The Superscript II reverse transcriptase (Invitrogen Life Technologies) is added to the RNA plus the primer mix in a total volume of 25 μl in the presence of a 5X second chain buffer and 0.1 M DTT provided with the enzyme. The reverse transcription reaction is allowed to proceed at 42 ° C for 1 hour. The cDNA is amplified by PCR using specific primers to sequence. The 5 'primers were designated according to the sequences published by the VHH and VH domains of camelids. The 3 'primer, which is used to amplify all three isotypes, is designated using the sequences of the mammalian CH3 domain as a guide. The following specific primers are used. The sites Bcll and Xbal are indicated by sequence in underlined letter. 'primer for LLGl-5'bgl flame constant region: 5' -gtt gtt gat caa gaa cea cat gga gga tgc acg tg-3 '(SEQ ID No.: _) 5' primer for IgG2 constant region flame LLG2-5'bgl: 5 '-gtt gtt gat caa gaa ecc aag here cea aaa cc-3' (SEC ID NO .::) 5 'primer for flame IgG3 constant region LLG3-5'bgl: 5' -gtt gtt gat ca gcg falls falls age gaa gac ccc-3 '(SEC ID NO .::) 3' primer for constant regions IgGl, IgG2, and flame IgG3 LLG123-3'X: 5 '-gtt gtt tct aga tta cta ttt acc cga aga ctg ggt gat gga-3' (SEC ID No.: _) PCR fragments of expected size were cloned into TOPO® cloning vectors (Invitrogen Life Technologies) and then excised. The forward sequence primer, Llseqsense, has the sequence 5 'ctg aga tcg agt gct g-3' (SEC ID No._ :), and the antisense initiator, LLseqAS, has the sequence 5'-ect ect ttg gct ttg tct c-3 '(SEC ID No.__ :). The sequencing is carried out as described in example 1. Figure 23 compares the amino acid sequence of the three isotypes of flame constant regions containing the pivot, the CH2, and CH3 domains with the amino acid sequence of the IgGl pivot. human and the CH2 and CH3.

After checking the sequence, the amplified products that are digested with restriction enzymes Bcll and Xbal to create compatible restriction sites. The digested fragments are then gel purified, and the DNA is eluted using a QIAquick gel extraction kit ((QIAGEN, Valencia, CA). mammal 2H7scFv-Ig pDl8 (example 2) is digested with Bcll and Xbal to remove the human IgG pivot, the CH2 and CH3 domains. The pDl8 vector is a modified pCDNA3 derivative containing an attenuated DHFR gene, which serves as a selectable marker for mammalian expression (Hayden et al., Tissue Antigens 48: 242-54 (1996)). PCR products of the IgG1 constant region, TgG2, and purified flame IgG3 are ligated by T4 DNA ligase (Roche Molecular Biochemicals, Indianapolis, IN) in double digested vector 2H7 scFv-pDl8 at room temperature overnight according to the manufacturer's instructions. After ligation, the ligation products are transformed into E.coli DH5a bacteria (BD Biosciences, Palo Alto, CA) and plated according to standard molecular biology procedure and manufacturer's instructions. The isolated colonies were chosen to screen the transformants containing the correct inserts.

For expression of the polypeptides that are encoded, plasmid DNA from positive clones is transiently transfected into COS-7 cells using DEAE-dextran (Hayden et al., Ther Immunol., 1: 3-15 (1994)). The COS-7 cells are seeded at approximately 3 x 106 cells per 150 mm of plate and are grown overnight at night so that the cells are close to 75% confluent. The beads are then washed once with serum free DMEM (Invitrogen Life Technologies, Grand Island, NY). The transfection supernatant (10 ml) contains 400 μg / ml of DEAE-dextran, 0.1 ml of chloroquine, and 5 μg / ml of DNA constructs are added to the cells, which are then incubated at 37 ° C for 3 to 4 hours. hours. After incubation, the cells are pulsed with 10 ml of 10% dimethyl sulfoxide (DMSO) in 1 x PBS at room temperature for 2 minutes. The cells are then put back into DMEM / 10% fully supplemented FBS (1% L-glutamine, 1% pecinicilin / streptomycin, 1% sodium pyruvate, 1% MEM of essential amino acids) (Invitrogen Life Technologies ). After 245 hours the medium is replaced with completely serum-free DMEM supplemented (Invitrogen Life Technologies), and the cells are maintained for up to 21 days with changes in the medium every 3 to 4 days.

The Ig fusion proteins are purified by passing the culture supernatants of the COS cells by protein A-agarose ((Repligen, Cambridge, MA) into columns of the pre A-agarose. After application of the culture supernatant the protein A columns are then washed with Ix PBS (Invitrogen Life Technologies). The ligated Ig fusion proteins were eluted with 0.1 M citric acid (pH 2.8), and the fractions that are harvested are immediately neutralized with Tris base (pH 10.85). The fractions containing the protein are identified by measuring the optical density (A28o) and then mixed, dialyzed against ix PBS, (Invitrogen Life Technologies) and filtered through a 0.2 μm filter.

The purified Ig fusion proteins are analyzed by SDS-PAGE. Aliquots of the flame 2H7 scFv IgGl, the flame 2H7 scFv IgG2, the flame 2H7 scFv IgG3, and Rituxan® (D (Rituximab, anti-CD20 antibody, Genentech, Inc. and IDEC Pharmaceuticals Corp .) (5 μg of protein) which is combined with 25 μl 2x NuPAGE SDS as sample buffer (Invitrogen Life Technologies) (non-reduced samples) Samples of each protein are also prepared in reduced sample buffer containing 5% of 2-mercaptoethanol (Sigma-Aldrich, St. Louis, MO) Molecular weight markers (Invitrogen Life Technologies) are applied to gels in non-reduced shocks. Proteins are fractionated on NUAGE® 10% Bis-Tris gels (Invitrogen Life Technologies). After electrophoresis (approximately 1 hour), the gels are washed three times, 5 minutes each, with Distilled Water (Invitrogen Life Technologies) and then stained in 50 ml of the Bio-Safe Coommassie stain (BioRad, Hercules, CA) overnight at room temperature. After a wash in distilled water, the gels are photographed. The migration pattern of each Ig fusion protein is presented in figure 24.

The ability of the Ig fusion proteins of the flame 2H7 scFv to bind to the cells expressing in CD20 is demonstrated by flow cytometry. Serial starting dilutions at 25 μg / ml IgGl from purified flame 2H7 scFv, and IgG2 from the flame 2H7 scFv, and flame 2H7 scFv IgG3 are prepared and incubated with CHO cells (CD20 +) CD20- transfected (from the laboratory of Dr. S. Skov, Institute of Medical Microbiology and Immunology, Copenhagen Denmark in 1% FBS lx PBS medium (Invitrogen Life Technologies) for one hour on ice.

After incubation, the cells are centrifuged and wash with 1% FBS in Ix PBS. To detect the Ig of the bound flame 2H7 scFv, the cells are incubated for 1 hour on ice with fluorescein-conjugated goat anti-camelid IgG (light and heavy chain) (1: 100) (Triple J Farms). The cells are then centrifuged and resuspended in 1% FBS-lx PBS and analyzed using a Coulter Epics XL cell sorter (Beckman Coulter, Miami, FL). The data (percentage of maximum brightness) are presented in figure 25.

EXAMPLE 11 EFFECTIVE FUNCTION OF THE IG FUSION PROTEINS OF THE FLAME ANTI-CD20 SCFV This example demonstrates the ability of IgG1, IgG2, and IgG3 as an anti-CD20 fusion protein to mediate complement-dependent cytotoxicity (CDC) and antibody-dependent cell-mediated cytotoxicity (ADCC).

The ability of the Ig fusion proteins of the flame 2H7 scFv to kill CD20 positive cells in the presence of complement is tested using the B cell line Bjab The rabbit complement is obtained from rabbits 3 to 4 weeks old (Pel-Freez, Brown Deer, WI). The BJAB cells (2 x 106 cells / ml) are combined with the rabbit complement (final dilution 1:10) and the Ig fusion proteins of the 2H7 are purified. Purified flame 2H7 scFv IgG1, flame 2H7 scFv IgG2, llama 2H7 scFv and human scFv IgG2 from wild type 2-H7 pivot-Ch2CH3) (example 1) are added to dilutions serial 1: 3 initiating a concentration of 30 μg / ml. After 1 hour at 37 ° C the cell viability is determined by counting the live and dead cells by the blue trypan exclusion (0.4%) (Invitrogen Life Technologies) using a hemacytometer (Bright-line, Horsham, PA). The percentage of deaths is calculated by dividing the number of CESL killed by the total number of cells (dead + living cells). The data presented in Figure 26 shows that all the Ig fusion proteins have CDC activity.

The ADCC activity of the IgG fusion proteins of the 2H7 flame scFv is determined using Bjab cells as human mononuclear and peripheral blood flame target cells and cells (PBMC) as effector cells. The Bjab cells are pre-incubated for approximately 2 hours with 51 Cr (100 μCi) (Amersham Biosciences, Piscataway, NJ) in fully supplemented IMDM (Invitrogen Life Technologies) containing 15% FBS. The cells are mixed intermíteteme during the period of pre-incubation. The remaining fresh human PBMC is purified from blood using lymphocyte separation medium (LSM) (ICN Pharmaceuticals, New York, NY). The PBMC is combined with labeled Bjab cells (5 x 104 cells per well of a 96-well tissue culture plate) in proportions of 25: 1, 50: 1 and 100: 1. To each combination is added 10 μg / ml IgG1 from the purified 2H7 flame scFv, IgG2 from the 2H7 flame scFv, and IgG3 from the 2H7 flame scFv, Rituximab, or non-anti-CD20 antibody. The mixtures are incubated for 6 hours at 37 ° C. The supernatant of each 51 Cr-containing reaction released from the used cells that were harvested on a LumaPlate-96 filter plate (Packard, Meiden, CT), and dried overnight . The amount of 51Cr is measured by a TopCount NXT plate reader (Packard). FIGURE 27 shows that the IgG2 fusion protein of flame scFv of 2H7 is the most effective fusion fusion protein in mediating ADCC. Each data point represents the average measure of tripled wells.

ADCC activity is affected by the source of the effector cells. The flame PBMC is isolated from the flame blood (Triple J Farms) using LSM. The flame effector cells are added in the same proportions to the BJAB target cells as described for the ADCC assay using human effector cells. The cells are combined with 10 μg / ml purified scFv IgG1 from purified 2H7, IgG2 from the 2H7 flame scFv, IgG3 from the 2H7 flame scFv, Rituximab, or non-anti-CD20 antibody. The results are given in figure 28.

EXAMPLE 12 CONSTRUCTION AND CHARACTERIZATION OF IGF FUSION PROTEINS OF SCFV EXPRESSED ON CELLULAR SURFACES This example describes a retroviral transfection system for ectopic expression on surfaces of genetically engineered cell surface receptors composed of scFvs that bind to co-stimulatory receptors. The example also demonstrates the effector function of these various Ig fusion proteins of the scFv expressed on the surface of the target cells.

The variable regions of the heavy and light chains are cloned from murine antibody specific for various co-stimulatory receptors, and the single chain Fv constructs are prepared essentially as described in example 1. Antibodies including 2H7, anti-CD20 human; 40.2.220, anti-human CD40; the anti-human CD28 2E12; 10A8, anti-human CD-152 (anti-CTLA-4); and 500A2, anti-murine CD3. The variable regions of the heavy and light chains of each antibody are cloned according to standard methods for the cloning of immunoglobulin genes and as described in Example 1. The single chain Fv constructs are prepared as described in Example 1 by inserting a nucleotide sequence encoding a peptide linker (gly4ser) 3 between the VL region of the nucleotide sequence of 40.2.220, 2E12, 10A8, and 500A2 respectively (SEQ ID NO: _, respectively) and the VH region of the nucleotide sequence of 40.2.220, 2E12, 10A8, and 500A2, respectively (SEQ ID No., respectively). The polypeptide sequence for VL of 40.2.220, 2E12, 10A8, and 500A2 is set forth in SEQ ID NO: _, respectively, and the polypeptide sequence for VH of the 40. 2,220, 2E12, 10A8, and 500A2 are set forth in SEQ ID No._, respectively. Each scFV polynucleotide (SEQ ID No.:_ for 40.2.220, 2E12, 10A8, and 500A2, respectively) is fused to the mutant pivot human IgGl (CCC? SSS) and mutant CH2 (mutation of proline to serine in the residue 238 (238 is numbered according to the EU nomenclature, Ward et al., 1995 Therap, Immunol.2: 77-94, residue 251 according to Kabat et al.) And the wild-type CH3 domain according to the methods described in Example 5 and 11. Each mutant IgG1 fusion polynucleotide sequence of scFv is then fused in frame to the sequences encoding the transmembrane domain and the cytoplasmic tail of human CD80 (SEQ ID No.:_), such that when the fusion protein is expressed in the transfected cell, CD80 provides an anchor for the surface expression of the Ig fusion protein of the scFv.The cDNAs encode the scFv-IgG-CD80 fusion proteins (SEQ ID. No.:_ for 4.2.220-, 2E12-, 10A8-, and 500A2 -scFv-IgG-CD80, respectively) of insert in the pLNCX retroviral vector (BD Biosciences Clontech, Palo Alto, CA) according to standard molecular biology procedures and vendor instructions. The scFv-Ig-CD80 cDNAs are inserted between the promoter sequences of the CMV gene with resistance to 5'LTR-neomycin and the 3 'LTR sequence Retroviral constructs are transfected into Reh, an acute lymphocytic leukemia cell line (ATCC CRL-8286). The transfected celes are screened to select clones that express the scFV-Ig fusion proteins on the cell surface.

The CDC and ADCC assays are carried out with the transfected Reh cells to determine whether the expression of the scFv-Ig polypeptides on the cell surface increases the effector cell function. Reh cells expressing the anti-human CD152 mutant scFv-IgG (SEc ID No: _); the anti-human CD28 scFv mutant IgG-CD80 (SEQ ID No._); the iG mutant-CD80 of the anti-human Reh CD28 scFv (SEQ ID No.:__); the mutant IgG-CD80 scFv of the anti-human Reh CD40 (SEQ ID No.:_); the mutant IgG-CD80 of the anti-human CD20 scFv of the Reh (SEQ ID No._) are combined with human PBMC (see example 11) and rabbit complement (10 μg / ml) for one hour 37 ° C. Untransfected Reh cells are included as a control viability of the cells that are determined by trypan blue exclusion, and the percentage of dead cells is calculated (see example 11). Figure 29 shows the effectiveness of scFv-IgG-CD80 fusion proteins when expressed on the cell surface of tumor cells to mediate complement-dependent cytotoxicity.

The same transfected Reh cells that are tested in the CDC assay plus the Reh cells transfected with the constructs of the polynucleotide encoding the anti-murine CD3-scFv-lg-CD80 (SEQ ID NO: 1) are analyzed for ADCC activity (see example 11). Untransfected and transfected Reh cells are pre-labeled with 51 Cr (100, μCi) (Amersham) for two hours at 37 ° C. The human PBMC serves as effector cells and is added to the Reh target cells (5 x 104 cells per well of the plate 96 wells) in proportions of 5: 1, 2.5: 1, and 1.25: 1. After five hours at 37 ° C, the culture supernatants are harvested and analyzed as described in Example 11. The specific percentage of deaths is calculated according to the following equation: ((Release of the experiment minus spontaneous release) / ( maximum release minus spontaneous release)) x 100. The data are presented in Figure 30. Each data point represents the average of quadrupled samples.

Using the same procedures described above, the same results with other binding domains are obtained using the following monoclonal antibodies as scFv sources: for CD20, 1F5 (Genbank AY 058907 and AY058906); for CD40, 2.36 and G28.5; for CD28, 9.3.

The cell surface expression of the binding domains of the antibody is carried out by melting the scFvs antibody to the IgA pivot and the IgE pivot region, ie IgE CH2, and the constant regions.

Polynucleotides that encode an anti-4-lBB scFv, 5B9 (4-1BB anti-human) scFv, and 2el2 (anti-human CD40) is fused with IgAH T4 IgA (four-terminal deleted CH3 residues) that fuse to the transmembrane CD80 and the cytoplasmic domains and IgE Fe regions that are show in SEC ID No._. The encoded polypeptides are shown in SEQ ID No._.

EXAMPLE 13 CONSTRUCTION AND SEQUENCE OF MUTANTS CH2-CH3-PIVOTE HUMAN AND MUTANTS OF VARIBLE REGION 2H7 This example describes the construction of scFv fusion protein containing mutant human IgGl and IgA constant regions. This example also describes the construction of a 2H7 scFv mutant with a single point mutation in the variable heavy chain region. The mutations are introduced into the constant variable region domains according to the methods described herein and known in the molecular biology art. Figure 312 presents the nomenclature for the constructions of the constant region Ig.

The human IgGl pivot region of the CH2-CH3-human IgG1 pivot fusion proteins are mutated by substituting cysteine residues which in a complete immunoglobulin are involved in forming disulfide bonds between two heavy chain molecules. A mutant, scFv of 2H7 is fused to a human IgGI pivot region in which all three cysteine residues were mutated to serine residues ((MTH (SSS)), is prepared as described in Example 5 (designated in Example 5 as CitoxB-MHWTGlC (which includes the CH2 and CH3 domains of the wild-type IgGl)) (now referred to as MTH (SSS) WTCH2CH3 of the scFv of 2H7) and comprises the polynucleotide sequence ID of SEC No.:_ encoding the polypeptide as set forth in SEQ ID No._. The polynucleotide sequence encoding this mutant (SEQ ID NO: 1) is used as a template to create mutant pivot regions in which the first two cysteine residues are substituted with serine residues (MTH IgG (SSC)). The oligonucleotide is designed to replace the third serine residue with a cysteine and has the following sequence: 5'-gtt gtt gat cag gag ccc aaa tct tct gac aaa act falls tc ce ce tgc cea gca ect g-3 '(HuIgGMHncs3 , SEC ID No.:_) A second mutant is prepared in which the mutant pivot has serine residues substituting the first and third residues of (MTH IgG (SCS).) The sequence of the oligonucleotide to create this mutant is like follows: 5'-gtt gtt gat cag gag ccc aaa tct tct gac aaa act falls here tcc cea ccg-3 '(HuIgGMHncs2, SEC ID No.:_) A third mutant is prepared with substituted cysteine residues in the second and third position (MTH IgG (CSS)), also using the mutant IgG MTH (SSS) as plan tilla, and an oligonucleotide having one of sequence, 5 '- gtt gtt gat cag gag ccc aaa tct tgt gac aaa act cac-3' (HuIgGMHncsl, SEC ID No.: _).

The oligonucleotides that introduce the mutations within the pivot region are combined with the template and a 3 'oligonucleotide containing an Xbal site (underlined and in slanted letters (5' -ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt ctt ctg cgt gta g-3 '(ID' of SEC No.:_)) to amplify the wild-type (WT) -CH2-CH3 sequences by the mutant pivot by PCR The mutant sequences MTH IgG CCS and IgG MTH SCS amplify for 25 cycles with a denaturation profile of 90a C, annealing at 52a C for 30 seconds and extension at 72a for 30 seconds.The mutant IgG MTH SSC sequence is amplified under slightly different conditions: denaturation profile of 94a C, tempered at 45 ° C for 30 seconds and extension at 72 ° C for 45 seconds. The amplified polynucleotides are inserted into the cloning vector TOPO® (Invitrogen Life Technologies) and then sequenced as described in example 1 to confirm the presence of the mutation. The pDl8 vector containing the 2H7 scFV is digested to remove the constant region sequences essentially as described in example 10. The wild-type CH2-CH3 regions of the mutant pivot are inserted into the frame within the DNA of the vector that is digested to get the vectors that comprise the MTH (CSS) WTCH2CH3 of the scFv of 2H7 encoding the DNA (SEQ ID.?: _); MTH (SCS) WTCH2CH3 of the 2H7 scFv encoding the DNA (SEQ ID No._); and MTH (SSC) WTCH2CH3 of the scFv of 2H7 encoding the DNA (SEQ ID No._).

A mutation from leucine to serine at position 11 in the first region of structure of the heavy chain variable region (numbered according to Kabat et al., Sequences of Proteins of Immunological Intents, 5th ed. Bethesda, MD: Public Health Service , National Institutes of Health (1991)) is introduced into the MTH protein fusion (SSS) WTCH2CH3 of the 2H7 scFv (SEC ID N?: _). The wild-type leucine residue is replaced with serine by site-directed mutagenesis using the oligonucleotide Vhserll: 5 '-gga ggt ggg age tct cag gct tat cta cag cag tct ggg gct gag teg gtg agg cc-3' (id. SEC No.: _) (this sequence, or an amino acid sequence that encodes it, may optionally be excluded from the particular embodiments claimed in the present invention). The 3 'primer for PCR is huIgGl-3'that has the sequence 5' -gtc tct aga cta tea ttt acc cgg aga cag-3 '(SEC ID No._) (the Xbal site underlined and in sloping font) . After the PCR amplification, the fragments they are inserted into the TOPO® cloning vector and sequenced to confirm the presence of leucine N-Vll to serine. DNA encoding 2H7 scFv-IgG MTH (SSS) WTCH2CH3 is sent in cloning vector PSL1180 (Biotech Pharmacy, Inc., Piscataway, NJ). The PSL1180-2H7 scFv-IgG MTH (SSS) construction WTCH2CH3 is digested with Sac and Xbal to remove the wild-type VH domain and the pivot and CH2 and CH3 domains. The PCR product comprising the VHll mutant is digested with Sac and Xbal and then inserted into the PSL1180 construct which is digested with standard molecular biology procedures. The construct is then digested with HindIII and Xbal, and inserted into the mammalian expression vector pDl8 (see methods described in example 1 and example 10). The mutant is designated as 2H7 scFv VHllSERIgGMTH (SSS) WTCH2CH3 (Figure 31). The polynucleotide sequence is provided in SEQ ID No., and the encoded polypeptide sequence is provided in SEQ ID No.: (these sequences can optionally be excluded from the particular embodiments claimed of the present invention).

Four constructs containing IgA constant region domains are prepared. One construct contains the wild-type IgA pivot fused to the human CH2 and CH3 IgGl (IgG IgG WTCH2CH3) (Figure 31). Sequential PCR amplifications are carried out to replace the human IgGl pivot of the 2H7 scFv construct with the nucleotide sequences coding for the IgA pivot. The 5 'oligonucleotide primer (huIgA / Gchim5) for the first PCR reaction having the sequence, 5' -cea tct ccc tea actua ect accect tct ccc te tgc gca ect gaa etc ctg-3 '(SEC ID No .: _). The primer (huIgAhg-5 ') for the second PCR reaction to add more specific IgA pivot sequence and add a Bcll restriction enzyme site (in tilted and underlined letter) has the sequence, 5' -tttttttttttttt ccc tea act cea ect acc cea tct ccc caa ct-3 ' (SEC ID No.: _). The 3 'primer for both amplification steps is huIgGl-3' and having the sequence, 5 '-gtc tct aga cta tea ttt acc cgg aga cag-3' (SEQ ID No._).

The sequence of the PCR product is confirmed by cloning TOPO® as described above. The gel-purified fragment is digested with Bcll and Xbal and then inserted into the 2H7 scFv-pDl8 vector that had been digested with Ball and Xbal to remove all domains IgG.L constant region is carried out as described in Example 10 to deliver a mammalian expression vector comprising the nucleotide sequence (SEQ ID NO: 1) encoding a 2H7 polypeptide scFv IgA pivot-IgGl CH2-CH3 (SEC ID N?::).

A second mammalian expression vector pDl8 is constructed which has a polynucleotide sequence (SEQ ID NO: 1) encoding a 2H7 scFv that is fused to the wild-type IgA pivot, CH2, and CH3 as domains (ID SEC No.: _). The sequences of human IgA constant regions are obtained using random primers to reverse transcribe isolated total RNA from the human tonsils followed by PCR amplification of the cDNA using sequence specific primers, essentially as described in example 10. The sequence nucleotide pivot IgA-CH2-CH3 human (SEQ ID No.: _) encoding the IgA-CH2-CH3 (IgAH IgACH2CH3 ,. Figure 31) polypeptide (SEQ ID No.: _) is amplified using the oligonucleotide 5 'huIgAhg-5' (SEQ ID No .: (same as antes_) and a 3 'oligonucleotide huIgA3' 'having the sequence, 5' -gtt gtt tct aga tta gta gca ggt gcc gtc tea falls cgc cat gac etc aac-3 '(SEC ID No._) The secretion of a 2H7-IgA pivot-IgA CH2-CH3 polypeptide of transfected mammalian cells requires the coexpression of the human J chain that is covalently linked to two IgA CH3 domains via disulfide bonds. The total RNA is isolated from the B cells of the tonsils and is reverse transcribed to generate the cDNA as described above. PCR amplification of the nucleotide sequence encoding the J chain takes just with J chain specific primers: The 5 'PCR HUJCH5nl, having the sequence, 5' -gtt gtt aga tct caa gaa gat gaa agg att gtt ctt-3 '(SEC ID No.: _), and the sequence of the 3' initiator, HUJCH3, which is 5 '-gtt gtt tct aga tta gtc agg ata gca ggc ate tgg-3' (SEC ID No .: _). The cDNA was cloned into TOPO to sequence it as described in Example 10. The cDNA encoding the J chain (SEQ ID No.:__) is then inserted into the pDl8 and dcDNA3-Hygro (+) vector (Invitrogen Life Technology) For the cotransfection with the constructions 2H7 scFv IgA pivot-CH2-CH3. Chain J has the predicted amino acid sequence that is stable in SEQ ID No.: _.

The secretion of a constant region scFv IgA in the absence of the chain is carried out by engineering of a truncated CH3 domain with a deletion of the four carboxy terminal amino acids (GTCY, SEQ ID No._) (IgAH IgA-T4, Figure 31), which includes a cysteine residue that forms a disulfide bond with the J chain. The IgA-CH2-CH3 pivot nucleotide sequence containing the CH3 elimination (SEQ ID NO: _) is prepared by a 5 'PCR primer (huIg-Ahg-5') having the sequence 5'- gtt gtt gat cag cea gtt ccc tea act cea ect acc cea tct ccc tea act-3 '(SEC ID No.: _) (the Bcll site is underlined and placed in sloping font), and a 3' PCR primer (HUIGA3T1) which has the sequence 5 '- gtt gtt tct aga tta tea gtc falls etc cgc cat gac aac aga cac-3' (SEC ID Do not.:_). This constant region nucleotide sequence mutated IgA is inserted into a vector 2H7 scFv pDl8 as described for the generation of 2H7 scFv Ig constructs previous (see Example 1 and this example) gue comprises the polynucleotide sequence (SEQ ID No.:_) a polynucleotide encoding gue 2H7 IgAH IgAT4 (SEQ ID No.: _).

A fourth construct is prepared and encodes a 2H7 scFv-IgA constant region fusion protein with an additional 14 amino acid deletion, most of which are hydrophobic residues, from the carboxy terminal. of IgA CH3. The polynucleotide encoding the 2H7 scFv-IgAH lgA-T4 is used as a template to engineered a deletion of the nucleotide sequence encoding PTHVNVSWMAEVD (SEQ ID No._). The oligonucleotide primer 5 'has the sequence 5' gat cag gtt -gtt gtt ccc tea act cea cea cea tct ccc acc ect tea ACT- 3 '(SEQ ID No.:_) (BclI shown as underlined and letter inclined). The 3 'oligonucleotide sequence is 5'-gtt gtt tct aga tta tea ttt acc cgc ca gcg gtc gat ggt ctt-3 '(SEC ID No._). The deleted IgA CH3 region is amplified using the above oligonucleotides to amplify the IfgA constant region of the RNA isolated from human tonsils such that the cDNA contains the region coding for the deleted carboxyl terminal for the 18 amino acids. The IgAH IgA-T18 constant region is inserted into the vector 2H7 scFv pDld comprising the polynucleotide sequence (SEQ ID NO: 1) encoding a IgH IgA-T18 2H7 polynucleotide (SEQ ID NO: 1) as described earlier.

EXAMPLE 14 EFFECTIVE FUNCTION OF THE CTLA-IGG FUSION PROTEINS The example compares the effector functions of the CTLA-4 Ig fusion proteins in CDC and ADNN assays.

Two CTLA-4 Ig fusion proteins are constructed. A fusion protein comprises the extracellular domain of the CTLA-4 Ig fused to the wild type pivot .IgGl human, and the domains CH2, CH3 and its designated CTLA-4 Ig WTH (CCC) WTCH2CH3 (SEQ ID No.:_) . A mammalian pD18 expression vector comprising a polynucleotide sequence encoding CTLA-4 IgG WTH (CCC) WTCH2CH3 (SEQ ID NO: _) is prepared by fusing the nucleotide sequence encoding the extracellular domain of CTLA-4 Ig (SEQ ID No._) (see US Patent No. 5,844,095) to the nucleotide sequence encoding WTH IgG (CCC) WTCH2CH3 (SEQ ID No._) according to the methods described in Examples 1 and 10. The extracellular domain nucleotide sequence also comprises a Bcll restriction enzyme site at the 3 'end, and a leader peptide nucleotide sequence (SEQ ID NO: _) which encodes a leader oncoM peptide (SEQ ID No. J) A second CTLA-4 IgG fusion protein, designated CTLA-4 MTH IgG (SSS) MTCH2WTCH3, contains the extracellular domain of CTLA-4 (plus the leader peptide sequence) oncoM) fused to a igG mutant pivot in which all three cysteine residues are replaced with serine residues. The pivotal region fused to a mutant IgGl CH2 domain having a nutation in the isotype position 238 (EU numbering, Ward et al., Supra, (position 251 using the numbering according to Kabat et al., Supra; Position 209 when the numbering begins with the first IgGl CH1 residue, ie, PAPELLDGPS (SEQ ID No._) of wild type igGl CH2 is modified aPAPELLDGSS (SEQ ID No._)), which is fused to IgGl CH3 type wild type (US Patent No. 5,844,095) The CTTH-4 IgG MTH (SSS) polynucleotide MTCH2WTCH3 comprises the nucleotide sequence in SEQ ID NO: and the deduced amino acid sequence comprises the sequences provided in SEQ ID No.: The CTLA-4 Ig fusion proteins are also prepared using CTLA-4 extracellular membrane coding sequences without the leader peptide (SEQ ID NO: _).

To measure CDC activity, purified CTL, -4 WTH IgG (CCC) WTCH2CH3 (2 μg / ml) or CTLA-4. MTH IgG (SSS) MTCH2WTCH3 (2 μg / ml) is added to Reh cells (see Example 12) and to Reh cells transfected with the costimulatory molecule CD80 so that CD80 is expressed on the cell surface (Reh CD80.10, see Doty et al., 1998 J. Immunol. 161: 2700; Doty et al., 1996 J. Immunol. 157: 3270), in the presence or absence of rabbit complement (10 μg. / ml). The CTLA Ig fusion proteins are prepared from culture supernatants of transiently transfected CHO cells according to the methods described in example 10. The assays are carried out essentially as described in examples 11 and 12. The data which shown in Figure 32 show that only Reh cells transfected with CD80 were killed in the presence of complement and CTLA-4 IgG WTH (CCC) WTCH2CH3 fusion protein.

The purified CTLA-4 Ig fusion proteins are also tested in ADCC assays. Human PBMC, which serves as effector cells, are added to the Reh or Reh CD80.1 target cells at a ratio of 1.25: 1, 2.5: 1, 5.0: 1 and 10: 1. The cells are labeled and the assay is carried out essentially as described in Examples 11 and 12. The results are given in Figure 33. Each data point represents the average of four independent culture wells in each effector ratio: Target cell The data shows that only the CTLA-4 IgG WTH (CCC) WTCH2CH3 significantly mediates the ADCC of Reh CD80.10 cells.

EXAMPLE 15 EFFECTIVE FUNCTION OF FUSION PROTEINS CTLA-4 IgA The CTLA-4 IgA fusion proteins are prepared as described for the IgG fusion proteins (see Examples 1, 13, and 14). The extracellular domain nucleotide sequence of CTLA-4 (SEQ ID NO: 1) is fused in an open reading frame to nucleotides encoding IgAH IgACH2CH3 (SEQ ID NO: 1) to deliver the nucleotide sequence (SEQ ID No.:_) which encodes a CTLA-4 IgAH fusion protein IgACH2CH3 (SEQ ID No.:_). The fusion protein is expressed transiently in COS cells (see Example 10) or stably expressed in CHO cells (see Example 1). The secretion of the CTLA-4 IgG IgACH2CH3 fusion protein regulates cotransfection with a construct containing a polynucleotide sequence (SEQ ID NO: _) encoding the human J chain (SEQ ID NO: _). The CTLA-4 IgAH IgACH2CH3 protein is isolated as described in examples 10 and 14. To express a CTLA-4 IgA construct without the presence of the J chain, a CTLA-4 IgAH IgA-T4 construct is prepared and transfected into mammalian cells. In a similar manner as described for the CTLA-4 extracellular fragment fused to the wild-type IgA-CH2CH3 pivot, the CTLA-4 extracellular domain nucleotide sequence (SEQ ID NO: _) is fused into a reading frame open to the nucleotide sequence (SEQ ID No.:_) which encodes an IgAH IgA-T4 polypeptide (SEQ ID NO: _) to deliver a nucleotide sequence comprising (SEQ ID No.:_) encoding a CTLA-4 IGAH IgA-T4 polypeptide (SEQ ID No.:_). The effector function of each construct is evaluated by CDC and ADCC as described in example 14. EXAMPLE 16 FIBER PROTEIN LINE IG HUMANES OF ANTI-CD20 SCFV IN CHO CELLS EXPRESSING CD20 This example describes the binding of the 2H7 scFv Ig fusion proteins to CHO cells expressing CD20. The analysis is carried out by flow cytometry. The culture supernatant is harvested from transiently transfected COS cells expressing 2H7 scFv IgG WTH '(CCC) WTCH2CH3 (SEQ ID NO: 1); 2H7 scFv IgG MTH (CSS) WTCH2CH3 (ID of SEC N?.: _); 2H7 scFv IgG MTH (SCS) WTCH2CH3 (SEC ID N?: _); and 2H7 scFv VHSERll WTH WTCH2CH3 (SEC ID N?: _), and serial two-fold dilutions that are prepared. Serial two-fold dilutions of purified 2H7 scFv igG MTH (SSC) WTCH2CH3 (SEQ ID NO: _) is prepared from a concentration of 5 μg / ml. Culture supernatants and purified fusion protein samples were incubated with cells (CD20 +) CHO for one hour on ice. The cells are washed twice and then incubated with 1: 100 FITC conjugated goat anti-human IgG (CalTag) for 40 minutes. The unbound conjugate is then removed by washing the cells and the flow cytometric analysis is carried out using a Coulter Epics XL cell sorter. The results are given in Figure 34.

EXAMPLE 17 IMMUNOMANCHED ANALYSIS OF IGG FUSION PROTEINS? IGA HUMANAS ANTI-CD20 SCFV This example describes the immunoblot analysis of the 2H7 scFv IgG and 2H7 scFv IgA fusion proteins that are immunoprecipitate from culture supernatants of transfected cells.

COS cells were transected transiently with plasmids comprising the nucleotide sequences for 2H7 scFv IgG WTH (CCC) WTCH2CH3 (SEQ ID NO: 1); 2H7 scFv IgG MTH (CSS) WTCH2CH3 (SEC ID N?: _); 2H7 SCFv IgG MTH (SCS) WTCH2CH3 (SEQ ID No.:_); 2H7 scFv IgA-H IgG WTCH2CH3 (SEQ ID N?: _); and SCFv IgG MTH (SSS) WTCH2CH3 (SEQ ID No.:_) essentially conformed to the method described in example 10. The cells are also transfected with only vector. After 48 to 72 hours at 37 ° C, cell culture supernatants are harvested and combined with protein A-agarose pellets (Repligen) for one hour at 4 ° C. The pellets are centrifuged and washed several times in TNEN [20]. mM Base Tris, 100 mM NaCl, 1 mM EDTA, and 0.05% NP-40, pH 8.0). The immunoprecipitates are combined with 25 μl 2x NUPAGE® SDS as a sample buffer (Invitrogen Life Technologies) (non-reduced samples). The proteins are fractionated on Bis-Tris 10% NUPAGE® gels (Invitrogen Life Technologies). After electrophoresis (approximately 1 hour), the proteins are transferred from the gel to a membrane of polyvinylidene fluoride Immobilon P (PVDF) (Millipore, Bedford, MA) using a semi-dry stain (Ellard Instrumentation, Monroe, WA). The PVDF membrane is blocked with PBS containing 5% nonfat milk and then assayed with goat anti-human IgG conjugated with HRP (specific to Fe) (CalTag). After washing the immunoblot several times in PBS, staining is developed using ECL (Amersham Biosciences). The results are shown in Figure 35.

EXAMPLE 18 LIGATE OF THE HUMAN FUSION PROTEINS OF THE SCFV ANTI-CD20 TO CELLS CD20 + CHO This example describes the immunocytofluorimetry analysis of the binding flow of 2H7 scFv IgAH IgACH2CH3 (SEQ ID NO: 1) and 2H7 scFv IgAH IgAT4 (SEQ ID NO: 1) as fusion proteins to cells (CD20 +) CHO .

The COS cells are cotransfected transiently as described in Example 10 with the plasmid DNA comprising a polynucleotide sequence (SEQ ID NO: 1) encoding the 2H7 scFv IgAH IgACH2CH3 polypeptide (SEQ ID NO: 1).

SEC. No.:_) and with a separate plasmid comprising a polynucleotide sequence (SEQ ID NO: 1) encoding a human J-chain polypeptide (SEQ ID NO: 1). COS cells are also transfected with a polynucleotide sequence (SEQ ID NO: 1) encoding a 2H7 scFv IgA fusion protein having a deletion of four amino acids at the carboxy terminus of CH3 (2H7 scFv IgAH IgA-t4, SEC ID No.: _). The transfections are carried out as described in example 10. The culture supernatants of the COS cells are combined with cells (CD20 +) CHO (see Example 1) and incubate for one hour on ice. The cells are washed twice with PBS-2% FBS and then combined with goat anti-human IgA chain conjugated with FITC (CalTag) (1: 100) for 40 minutes. The cells are washed again and then analyzed by flow cytometry using a Coulter Epics XL cell sorter. Figure 36 shows that cotransfection with the J chain is not required for the secretion of the fusion protein 2H7 scFv IgAH IgAT4, the fusion protein 2H7 IgA with the carboxy terminus CH3 (SEQ ID NO: _) EXAMPLE 19 EF EFFECTIVE FUNCTION THE HUMAN IGA FUSION PROTEINS OF SCFV ANTI-CD20 This example will illustrate the ADCC activity of the IgG and IgA fusion proteins of 2H7 against cells expressing CD20. BJAB cells are pre-labeled with 51Cr (100 J.Ci) (Amersham) for two hours at 37 ° C. The effector cells are obtained from fresh human whole blood at rest, which is diluted in an equal volume of Alsever's solution to prevent coagulation. The fusion proteins 2H7 scFv MTH IgG (SSS) WTCH2CH3 (SEQ ID No.:_); 2H7 scFv IgG MTH (SCS) WTCH2CH3 (SEC ID No.:_); 2H7 scFv IgG WTH (CCC) WTCH2CH3 (SEC ID N?:: __); and 2H7 SCFV IgAH IgACH2CH3 (SEQ ID No._) are purified from supernatants of COS cells that are transfected transiently (100-200 ml) by protein A chromatography as described in example 10. COS cells that are transfected with the plasmid encoding the 2H7 scFv IgAH IgACH2CH3 are cotransfected with a plasmid encoding the human J chain as described in Example 18. Double serial dilutions of the purified 2H7 Ig fusion proteins are started at 5 μg / ml are added to BJAB cells (5 x l-O4 per well of a 96-well culture plate) in the presence of blood Complete (100 μl of whole blood diluted 1: 1 in Alsever's solution, final solution 1: 4) and incubated for five hours at 37 ° C. Culture supernatants are harvested and analyzed as described in example 11 The specific percentage of samples is calculated according to the following equation: ((Release of the experiment minus spontaneous release) / (maximum release minus spontaneous release)) x 100. The data are given in Figure 37. Each data point represents the average of quadrupled samples.

In a second ADCC assay, the labeled BJAB target cell number is kept constant in each sample, and whole blood is added at the dilutions of 0.25, 0.125, and 0.0625. The purified igG and igA fusion proteins of 2H7 are added at a concentration of 5 μg / ml. BJAB cells, whole blood, and fusion proteins are incubated, supernatants are collected, and the specific percentage of deaths is calculated as described above. The specific percentage of deaths for each of the 2H7 fusion proteins is presented in Figure 38.

The ADCC activity of the 2H7 scFv IgG. Purified MTH (SSS) WTCH2CH3 (5 μg / ml) and purified 2H7 scFv IgAH lgACH2CH3 (5 μg / ml) is compared in the presence of different effector cell populations. The PBMC is isolated from whole blood as described in Examples 11 and 12. The PBMCs are combined with labeled BJAB target cells (5 x 10 4 per well of a 96-well tissue culture dish) in 50: 1 proportions., 25: 1, and 12.5: 1. The test is carried out and the data analyzed as described above. Figure 39A shows that only the fusion protein 2H7 scFv IgG MTH (SSS) WTCH2CH3 has ADCC activity when PBMCs serve as effector cells. Figure 39B shows that both 2H7 scFv IgG MTH (SSS) WTCH2CH3 and 2H7 scFv IgAH IgACH2CH3 exhibit ADCC activity when whole blood is the source of effector cells as illustrated in Figure 38).

EXAMPLE 20 EXPRESSION LEVEL OF FUSION PROTEIN 2H7 SCFV VH11SEREGG MTH (SSS) WTCH2CH3 This example compares the level of expression of the 2H7 fusion protein scFv VHllSer IgG MTH (SSS) WTCH2CH3 (SEQ ID No._) with other 2H7 scFv IgG constructs that do not contain the mutation in the heavy variable chain domain. The mammalian expression vector pDl8 comprises the nucleotide sequences 2H7 scFv IgG MTH (SSS) WTCH2CH3 (SEQ ID No._); 2H7 scFv IgG MTH (CSS) WTCH2CH3 (SEC ID N?: _); 2H7 scFv MTH IgG (SCS) WTCH2CH3 (SEQ ID No.:_); 2H7 scFv IgG WTH (CCC) WTCH2CH3 (SEQ ID No.:_); and 2H7 scFv VHSERll IgG MTH (SSS) WTCH2CH3 (see examples 1 and 13) are transfected transiently in COS cells as described in example 10. After 72 hours at 37 ° C, culture supernatants are harvested and 1 μl of each supernatant is combined with a non-reductive sample buffer (see method described in Example 10). Samples of culture supernatant and aliquots of 2H7 scFv IgG MTH (SSS) WTCH2CH3 (40 ng, 20 ng, 10 ng / 5 ng, and 2.5 ng) are fractionated on 10% Bis-Tris (MOPS) NuPAGE® gels (Invitrogen Life Technologies). The MultimarK® protein standards (Invitrogen Life Technologies) are also separated in the gel. The proteins are transferred to a PDVF membrane and immunostained as described in Example 17. The immunoblot is presented in Figure 40.

The amounts of the fusion proteins are quantified by densitometry analysis of the spots using Scionlmage software for Windows and the comparison with the standard curve is made. The 2H7 scFv IgG WTH (CCC) construction WTCH2CH3 produces approximately 12 ng / ul or 12 micrograms / ml, and the 2H7 scFv IgG MTH (CSS) WTCH2CH3 produces approximately 10 ng / ul or 10 micrograms / ml, the 2H7 scFv IgG MTH ( SCS) WTCH2CH3 produces approximately 1 ng / ul or 1 microgram / ml, and the construction 2H7 scFv VHSERll IgG MTH (SSS) WTCH2CH3 produces approximately 30 ng / ml or 30 micrograms / ml. In particular embodiments claimed of the present invention, an amino acid sequence of 2H7 scFv VHSERll IgG MTH (SSS) WTCH2CH3, or a polynucleotide sequence encoding 2H7 scFv VHSERll IgG MTH (SSS) WTCH2CH3 can optionally be excluded from the present invention. Similarly, the amino acid sequence of 2H7 scFv VHSERll-IgG WTH (CCC) WTCH2CH3, or a polynucleotide sequence encoding 2H7 scFv VHSERll igG WTH (CCC) WTCH2CH3 may optionally be excluded from the particular claimed embodiments of the present invention. Additionally, an amino acid substitution of a leucine at position 11 to serine in the variable heavy chain domain, or polynucleotides that encode an amino acid substitution of a leucine at position 11 to serine in the variable heavy chain domain, may be optionally excluded from the particular embodiments claimed of the present invention.

EXAMPLE 21 CONSTRUCTION OF A FUSION PROTEIN 2H7 SCFV IGG WITH A MUTATING DOMAIN CH3 Amino acid mutations are introduced into the CH3 domain of a 2H7 IgG fusion protein. The pDl8 vector comprising 2H7 scFv IgG MTH (SSS) WTCH2CH3 (SEQ ID NO: _) is digested with Bell and Xbal to remove the MTH fragment WTCH2CH3 (SEQ ID No._) which is then subcloned into a vector pvehicle (BD Biosciences Clontech, Palo Alto, CA) that is digested twice with Bell and Xbal. The subcloning is carried out in a vector resistant to kanamycin because the gene with ampicillin resistance has an Xmnl site, which is required for this cloning procedure. Five constructions are prepared with the following substitutions: (1) a phenylalanine residue at position 405 (numbering according to with Kabat et al. supra) is substituted with tyrosine using oligonucleotide CH3Y405; (2) the phenylalanine at position 405 is replaced with an alanine residue using oligonucleotide CH3A405; (3) the tyrosine residue at position 407 is replaced with an alanine using oligonucleotide CH3A407; (4) both wild type amino acids at positions 405 and 407 are substituted with tyrosine and alanine, respectively using oligonucleotide CH3Y405A407; and (5) both wild type amino acids at positions 405 and 407 are substituted with alanine using oligonucleotide CH3A405A407. The oligonucleotides are 3 'primers for the PCR amplification of a portion of the CH3 domain. The nucleotide sequences for each 3 'oligonucleotide are the following: CH3Y-405: 5 '-gtt gtt gaa gac gtt ccc ctg ctg cea ect gct ctt gtc falls ggt gag ctt gta gta gag gta gga gcc-3' (SEC ID: __) CH3A405: 5 '-gtt gtt gaa gac gtt ccc ctg ctg cea ect gct ctt gtc falls ggt gag ctt gct gta gag ggc gaa gga gcc-3 '(SEC ID: _) CH3A407: 5 '-gtt gtt gaa gac gtt ccc ctg ctg cea ect gct ctt gtc falls ggt gag ctt gct ggc gag gaa gaga gga gcc-3' (ID SEC No.: _) CH3Y405A407: 5'-gtt gtt gaa gac gtt ccc ctg ctg cea ect gct ctt gtc falls ggt gag ctt gct ggc gag gta gaa gga gcc-3 '(SEC ID No.: _) CH3A405A407: 5 '-gtt gtt gaa gac gtt ccc ctg ctg cea ect gct ctt gtc drops ggt gag ctt gct ggc gag ggc gaa gga gcc-3' (SEC ID No.:) The template is human IgGl with pivot MHWTCH2CH3. The 5'-PCR oligonucleotide primer is huIgGMHWC, [SEQ ID No.:_. The amplified products are cloned with TOPO® and sequenced as described in examples 1 and 10. The DNA of the clones with the correct sequence is digested with Bcll and SMI and transferred to the plethelicle containing the MTH sequence WTCH2CH3, which also is digested with the same restriction enzymes. The mutated IgG sequences are then removed by digestion with Bell and Xbal and inserted into a pDld vector containing 2H7 scFv which is also digested with Bell and Xbal. The polynucleotide sequences for the mutated CH3 domains, MTCH3 Y405, MTCH3 A405, MTCH3 A407, MTCH3 Y405A407, and MTCH3 A405A 07 show in the SEC ID No: -, respectively, and the sequences of the polypeptides for each are shown in SEQ ID No._, respectively. The sequences of the polynucleotide for the 2H7 scFv MTH WTCH2 MTCH3 Y405, 2H7 SCFv MTH WTCH2 MTCH3 A405, scFv MTH WTCH2 MTCH3 A407, ScFv MTH WTCH2 MTCH3 Y405A407, and SCFv MTH WTCH2 MTCH3 A405A407, respectively, and the deduced amino acid sequences are shown in SEC ID NOs No.: _, respectively.

EXAMPLE 22 CONSTRUCTION OF FUSION PROTEINS 2H7 SCFV IGG WITH PIVOT MUTATIONS A 2H7 scFv IgG fusion protein is constructed with the third cysteine residue in the IgGI pivot region which is replaced with a serine residue. The template for the introduction of the mutations is a polynucleotide encoding 2H7 scFv WTH WTCH2CH3 (SEQ ID NO:.). The oligonucleotide that introduces the mutations is an initiating oligonucleotide HIgGMHcys3 with 5 'PCR having the sequence 5'-gtt gtt gat cag gag ccc aaa tct tgt .gac aaa act acca tgt cea ceg tcc cea gca cct-3'. The oligonucleotide that introduces the mutation in the region of pivot is composed bined with the template and a 3 'oligonucleotide containing an Xbal site (underlined and written with sloping letters) (5' - gtt tct aga tea ttt acc cgg aga cag gga gag gct ctt ctg cgt gta g-3 ' (SEC ID No.:_) to amplify the wild-type mutant pivot (WT) -CH2-CH3 by PCR.The IgG MTH CCS mutant sequence is amplified for 30 cycles with a denaturation profile of 94 ° C, 50 ° C for 30 seconds, and extension at 72 ° C for 30 seconds The amplified polynucleotides are inserted into the cloning vector TOPO® (Invitrogen Life Technologies) and then sequenced as described in example 1 to confirm the presence of The vector pdl8 which contains 2H7 scFv is digested to remove the constant region sequences essentially as described - in Example 10. The CH2-CH3 mutant pivot wild type regions are inserted into the frame within the vector DNA digested to get the v ectors comprising DNA encoding 2H7 scFv MTH (CCS) WTCH2CH3 (SEQ ID NO:.). The deduced polypeptide sequence is shown in SEQ ID NO: _.

EXAMPLE 23 CONSTRUCTION OF FUSION PROTEINS ANTI-CD20 IGE A binding domain is fused to the IgE constant region sequences such that the expressed polypeptide is capable of inducing an allergic response mechanism. The single chain Fv nucleotide sequence of 40.2.220 (SEQ ID No.:_), an anti-CD20 antibody, is fused to IgE CH2-CH3-CH4 according to the methods described for other immunoglobulin scFv constant region constructs (see examples 1, 5, 10, and 13). For PCR amplification, the IgE domains CH2-CH3-CH4, a 5 'oligonucleotide primer, hIgE5Bcl, which has the sequence 5'-gtt gtt gat cae gtc tgc tcc agg gac ttc acc cc-3', and an initiator of 3 'oligonucleotide, stop hIgE3, having the sequence 5' -gtt gtt tct aga tta act ttt acc ggg att tac aga falls cgc teg ctg g-3 '.

The retroviral transfection system for ectopic surface expression of genetically engineered cell surface receptors composed of scFvs composed of the co-stimulatory receptors described in example 12 is used to construct a 40.2.220 scFv IgE-CD80 fusion protein. The sequence of fusion polynucleotide 40.2.220 scFv IgE is fused in structure to sequences encoding the cytoplasmic chain and the transmembrane domain of human CD80 (SEQ ID NO: 1), so that when the fusion protein is expressed in the transfected cell, CD80 provides an anchor for the surface expression of the scFv Ig fusion protein. The cDNA encoding the anti-CD40 scFv-IgE-CD80 fusion proteins (SEQ ID No._) is inserted into the pLNCX retroviral vector (BD Biosciences Clontech) according to standard molecular biology procedures and vendor instructions. The 40.2.220 scFv-Ig-CD80 cDNA is inserted into the promoter sequence of the CMV gene of 5'LTR-neomycin resistance and the 3 'LTR sequence. The retroviral constructs are transfected into a cell line of carcinoma, and the cells Transfected samples are selected to select clones expressing the fusion protein 40.2.220 scFv-Ig-CD80 on the cell surface.

EXAMPLE 24 CONSTRUCTION OF IGA-T4 MUTANTS EXPRESSED ON THE CELLULAR SURFACE The retroviral transfection system for ectopic surface expression of the genetically engineered cell surface receptors composed of scFv compounds that bind the co-stimulatory receptors described in example 12 are used to construct an IgA-T4-CD80 fusion protein pivot 2H7 scFv IgA The sequence of fusion polypeptide 2H7 scFv IgAH IgA-T4 (SEQ ID NO: _) is functional in the structure to the sequences encoding the transmembrane domain and the cytoplasmic tail of CD80-human (SEQ ID NO: _), such that when the fusion protein is expressed in the transfected cell the CD80 provides an anchor for surface expression of the IgG scFv fusion protein. The cDNA encoding the fusion protein 2H7 scFv IgAH IgA-T4-CD80 (SEQ ID No._) is inserted into the retroviral vector pLNCX (BD Biosciences Clontech) according to standard molecular biology procedures in the vendor's instructions. The cDNA 2H7 scFv IgAH IgA-T4-CD80 is inserted into the CMV gene promoter sequences of 5'LTR-neomycin resistance and the 3 'LTR sequence. The retroviral construct is transfected into Reh, an acute lymphocytic leukemia cell line (ATCC CRL-8286). The transfected cells are chosen to select clones expressing 2H7 scFv-Ig fusion proteins on the cell surface. EXAMPLE 25 CHARACTERIZATION OF A SCFV IG-CD80 ANTI-4-1BB FUSION PROTEIN EXPRESSED IN THE CELLULAR SURFACE OF TUMOR CELLS AND GROWTH OF IN VIVO TUMOR CELLS This example describes the construction of a 4-1BB (CD137) anti-murine scFv fusion protein having one. wild-type IgG pivot and CH2 and CH3 domains that fuse to the cytoplasmic and transmembrane CD80 domains. The example also illustrates the effect of cell surface expression of the anti-4-lBB scGv IgG scFv polypeptide when the transfected tumor cells are transplanted into mice.

The light and heavy chain variable regions of a rat anti-4-lBB monoclonal antibody (CD137) (1D8) are cloned, and a single chain Fv construct is prepared essentially as described in example 1. The variable regions of light and heavy chain of each antibody are cloned according to the standard methods for cloning immunoglobulin genes and as described in FIG.

Example 1. The single chain Fv construct is prepared as described in Example 1 by inserting a nucleotide sequence encoding a peptide linker (gly4ser) 3 between the nucleotide sequence of the VL region of 1D8 (SEC ID). No.: _) and the nucleotide sequence of the VH region of 1D8 (SEQ ID No.:_). The polypeptide sequence for 1D8 VL is shown in • SEC ID No.: _, and the polypeptide sequence for the VH domain is shown in SEQ ID No._. The scFv polynucleotide (SEQ ID NO: 1) is then fused to the wild type pivot-CH2-CH3 IgGl domains according to the methods described in Example 1. The IgG1 scFv fusion polynucleotide sequence is then fused to structure to the sequences coding for the cytoplasmic tail and the transmembrane domain of human CD80 (SEQ ID No.:_) essentially as described in example 12, such that when the fusion protein is detected. expressed in the transfected cell, the CD (0 provides an anchor for the surface expression of the Ig scFv protein region.) The cDNA encoding the scFv-IgG-CD80 fusion protein (SEQ ID No.:_) is inserted into the retroviral pLNCX vector (BD Biosciences Clontech) according to standard molecular biology procedures in Seller's instructions. The scFv-lg-CD80 cDNA is inserted between the promoter sequences of the CMV gene of 5 'LTR-neomycin resistance and the 3' LT sequence.

The retroviral constructs are transfected into the metastatic M2 clone of K1735, a melanoma cell line supplied by Dr. I. Hellstrom, PNRI, Seattle, WA. The transfected cells are chosen to select clones expressing the scFv-Ig fusion proteins on the cell surface. To demonstrate that the 1D8 scFv IgG-CD80 construct is expressed on the cell surface of the tumor cells, the transfected cells are analyzed by flow immunocitofluorimetry. The transfected cells (K1735-1D8) are incubated for one hour on ice in phycoerythrin-conjugated goat antihuman IgG (ab '). The unbound conjugate is then removed by washing the cells and flow cytometric analysis is developed using a Coulter Epics XL cell sorter the results are presented in Figure 41A.

Growth of transfected K1735-1D8 cells is examined in vivo. K1735-WT cells grow progressively when transplanted subcutaneously (s.c.) in native C3H mice. Although the same dose of K1735-1D8 cells initially forms tumors from a surface area of approximately 30 mm2, tumors begin to regress near day 7 and have disappeared by day 20 as shown in Figure 41B. Tumor cells that are transfected as a similar vector encode an unbound scFv, a human anti-CD28 scFv, growth construct as well as tumor cells that have not been transfected. The presence of a foreign protein, which is human IgGl constant domain or rat variable regions, that do not make immunogenic transfection of K1735-WT cells; the growth of K1735-1D8 cells in C3H mice is identical to that of K1735-WT cells (untransfected).

To investigate the roles of NK cells and CD4 + and CD8 + T lymphocytes in the regression of K1735-1D8 tumors, na? Ve mice were injected intraperitoneally (ip) with monoclonal antibodies (monoclonal antibodies, typically 50 μg in a volume of 0.1 ml ) to remove CD8 +, CD4 + or both CD4 + and CD8 + T cells, or injected with anti-asialo-GMl rabbit antibodies Remove NK cells. Twelve days later, when the flow cytometry analysis of spleen cells from identically treated mice showed that the target T cell populations were depleted, the K1735-1D8 cells were sc transplanted to each depleted group of T cell. K1735-1D8 has growth similar to kinetics in mice that have been injected with the anti-CD8 MAb or rat control IgG while removing the cells. T CD4 + results in the growth of K1735-1D8 with the same K1735-WT kinetics. This failure to inhibit tumor growth after removal of CD4 + T cells is observed with respect to the presence or absence of CD8 + T cells. Growth of K1735-1D8 in all depleted NK mice, although more slowly than in the CD4-depleted group. The results are presented in Figure 41C.

EXAMPLE 26 THERAPEUTIC EFFECT OF TUMOR CELLS EXPRESSING FUSION PROTEIN ANTI-4-1BB SCFV IGG-CD80 This example examines the ability of transfected K1735-ID8 tumor cells expressing an anti-CD137 scFv on the cell surface to generate a response sufficient immune in mice to mediate rejection of established non-transfected wild type tumors. C3H mice are transplanted with K1I35-WT tumors (2xl06 cells / animal) and with growth of approximately six days. The experiment is carried out using mice with established K1735-WT tumors with a surface area of 30 mm2. The mice are vaccinated by s.c. injection. of K1735-11D8 irradiated K1735-WT cells on the contralateral side. Identical injections are repeated at the time points indicated in Figure 42. A group of animals are given four weekly injections of K1735-1D8 cells. According to the same calendar, another given group is irradiated (12,000 rads) with K1735-WT cells and a third group is injected with PBS. The data area is plotted in Figure 42. WT tumors grew progressively in all control mice and in all mice that received irradiated K1735-WT cells. In contrast, tumors were reduced in 4 out of 5 mice that were treated by immunization with K1735-1D8. The animals remain tumor free and without signs of toxicity when the experiment is finished three months later. In the fifth mouse the tumor nodule is reduced in size to the extent that the mouse receives K1735-1D8 cells, but tumor growth returns after the therapy is completed.

In another experiment with 5 mice / group, the mice were injected intravenously (i.v.) with 3 x 10 5 K1735-WT cells to initiate lung metastasis. Three days later, K1735-1D8 cells are transplanted s.c. This procedure is repeated once weekly for one month; the control mice were injected with PBS. The experiment ends when a mouse in the control group has died, 37 days after it receives the K1735-WT cells. At that time the lungs of each control mice have > 500 metastatic foci. In contrast, less than 10 metastatic foci occur in the lungs of immunized mice.

In a third experiment, mixtures of K1735-WT cells and K1735-1D8 cells are injected with immunocomponent synergistic C3H moieties. Mice are injected subcutaneously only with K7135-WT cells or with a mixture of 2 x 10 6 K1735-WT cells and 2 x 10 5 K1735-1D8 cells. The growth of the tumor is monitored at 5-day intervals.

EXAMPLE 27 EXPRESSION OF A FUSION PROTEIN ANTI-4-1BB SCFV IGG-CD80 ON THE CELLULAR SURFACE OF SARCOMA CELLS This example demonstrates the expression of an anti-CDI37 scFv on the cell surface of a second type of tumor cell by transfecting a murine sarcoma cell line with an anti-CD1337 scFv IgG-CD80 construct.

The 1D8 SCFv IgG WTH WTCH2CH3-CD80 polynucleotide (SEQ ID No.:_) is transferred from the pLNCX vector into the pCDNA3-hygro vector which uses restriction enzyme digestion and ligation steps according to standard molecular biology methods. The construct is cut with HindIII + Clal fragments and thesFv is filled with Klenow (Roche) and the blunt end fragment ligated into the EcoR5 site of pcDNA3. Murine sarcoma tumor cells Ag44 are transfected with pCDNA3-hygro vectors containing the 1D8 fusion protein scFv IgG CD80. Hygromycin-resistant clones are selected by flow cytometry using an anti-human FITC IgG antibody to detect transgene expression. Only about 15% of the resistant clones have initially detectable fusion protein. Positive cells identified by flow cytometry are repeatedly filtered in bottles covered with immobilized anti-human IgG (10 μg / ml) according to standard methods. The filtrate is developed by incubation cells in covered plates for 30 min at 37 C; the plates are then washed 2-3x i in versenne or PBS. After each round, cells are assayed for IgG expression by FACS. The histogram in figure 44 shows the pattern of dyeing after four rounds of filter against anti-human IgG (black) Untransfected cells are stained and indicated in gray. All cells in the population are positive.

EXAMPLE 28 CONSTRUCTION AND CHARACTERIZATION OF A SCFV IG BISPECTIVE FUSION PROTEIN AND SCFV IG FUSION PROTEINS WITH A MUTATION IN THE IGGI CH2 DOMAIN An anti-CD20 (2H7) scFv IgG fusion protein having a mutant pivot (MT (SSS)) and a mutant CH2 domain in which the proline in residue (position number 238 according to Ward et al., supra) is replaced with a serine. The polynucleotide that codes 2H7 scFv MTH IgG (SSS) MTCH2WTCH3 (SEQ ID NO: _) is constructed essentially according to the methods described in Examples 1, 5, and 13. The CH3 domains of wild-type CH2 pivot mutants IgG are also fuses to a bispecific scFv anti-CD20 (2H7) -anti-CD40 (40.2.220). The polynucleotide sequence of anti-CD20-anti-CD40 scFv IgG MTH (SSS) MTCH2WTCH3 is shown in SEQ ID NO: and the encoded polypeptide is shown in SEQ ID NO: _.

COS cells are transiently transfected with vectors comprising the polynucleotide coding sequence 2H7 scFv IgG MTH (SSS) MTCH2WTCH3 (SEQ ID No.::_); anti-CD20-anti-CD40 ScFv IgG MTH (SSS) MTCH2WTCH3 (SEQ ID No.:_); 2H7 SCFv IgG MTH (SSS) WTCH2CH3 '(SEC ID N?: _); and 2H7 scFv IgAH IgG WTCH2CH3 (SEQ ID NO: 1) as described in Example 10. Culture supernatants are harvested and the fusion proteins are purified by protein A chromatography (see Example 10). The purified polypeptides are fractionated by SDS-PAGE according to the method described in example 10. Rituximab (anti-CD20 monoclonal antibody); and pre-dyed molecular weight standards Bio-Rad (Bio-Rad, Hercules, CA), and Multimark® molecular weight standards. (Invitrogen Life Technologies) also apply to the gel. The results are presented in figure 45.

The 2H7 scFv Ig fusion protein containing a mutation in the CH2 domain is compared to the fusion proteins having the wild type CH2 domain in an ADCC assay. The assays are performed essentially as described in Examples 11 and 19. Fresh PBMC (effector cells) are added at rest to 51Cr-labeled BJAB cells (target cells) in the proportions indicated in Figure 46. The 2H7 scFv IgG MTH ( SSS) MTCH2WTCH3, 2H7 scFv IgG MTH (SSS) WTCH2CH3, 2H7 scFv IgAH purified WTCH2CH3 IgG, and Rituximab, each 10 μg / ml are added to the effector / target cell mixtures and incubated for five hours at 37 ° C The supernatants are harvested and the amount of free chromium is determined as described in Examples 11 and 19. The specific percentage of deaths for each fusion protein is presented in Figure 46.

EXAMPLE 29 EXPRESSION OF CELLULAR SURFACE OF A FUSION PROTEIN CD3 SCFV IGG ANT-HUMANA An anti-human CD80 scFv Ig CD80 fusion protein is prepared essentially as described in Examples 1 and 12. The fusion protein comprises a wildtype IgGl wild-type anti-human scFv CD3 (SEQ ID NO: _) and CH2. wild type (SEQ ID No.:_) and CH3 domains (SEQ ID No.:_) fused to cytoplasmic and transmembrane domains CD80 (SEQ ID No.:_) to allow expression of the anti cell surface -CD3 scFv. The polynucleotide CD3 scFv IgG WTH WTCH2CH3-CD80 anti-human (SEQ ID No.:_) encoding the polypeptide (SEC ID) No.:_) is transfected into Reh cells and T51 cells (lymphoblastoid cell line). The expression of the CD3 scFv anti-human IgG fusion protein is detected by flow cytometry using FITC conjugated goat anti-human IgG (see methods in Examples 4, 10, 16, 18). Figure 47A illustrates the expression of the anti-human CD3 fusion protein on the cell surface of the Reh cells, and Figure 47B shows the expression of the fusion protein on the T41 cells.

ADCC assays are developed with transfected Reh • and T51 cells to determine whether the expression of scFv-Ig polypeptides on the surface increases the -function of effector cells. Transfected and untransfected Reh cells and transfected and untransfected T51 cells are pre-tagged with 51 Cr (100 μCi) (Amersham) for two hours at 37 ° C. Human PBMC serves as effector cells and is added to target cells (5 x 104 per well of 96 well plate) in proportions of : 1, 10: 1, 5: 1, and 2.5: 1. After four hours at 37 ° C, the culture supernatants are harvested and analyzed as described in Examples 11 and 12. The specific kill percentage is calculated as described in example 12.

The results are presented in figure 48.

EXAMPLE 30 INDUCTION OF EXPRESSION OF CYTOKIN IN TUMOR CELLS EXPRESSING ANTI-CD28 SCFV ON THE CELLULAR SURFACE This example describes the effect of scFv expressed on the cell surface on induction of cytokine mRNA in co-stimulated lymphocytes with tumor cells transfected with a CD28 anti-human IgG-CD80 scFv fusion protein.

Real-time PCR analysis is performed on RNA sample of human PBMC stimulated with Reh, Reh-anti-CD28 (2el2) (see example 12 for construction of 2el2 scFv IgG WTH WHTCH3CH2-CD80 and transfection of Reh cells), and Reh- CD80 (see example 14) in order to measure the effects of expressed surface scFv on cytokine production by PBMC effector cells. The real-time PCR assay uses SYBR Green (QIAGEN) (Morrison et al., Biotechtziques 24: 954-8, 960, 962 (1998)) and is measured by an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) that measures the formation of PCR product after each amplification cycle. Cells are harvested from cultures and total RNA is prepared using QIAGEN RNA kits, which includes a granulator column purification system to homogenize cell lysates, and mini Rneasy® columns for RNA purification. The transcribed cDNA is reversed using equal amounts of RNA from each cell type and Superscript II reverse transcriptase (Life Technologies). Real-time SYBR Green PCR analysis is developed using cDNA prepared as a template and specific primer pairs for groups of cytokine genes. The average length of the PCR products that are amplify vary from 150-250 base pairs. The cDNA levels for many activation response molecules include IFN ?, TNFa, GM-CSF, IL-4, IL-5, IL-6, IL-8, IL-10, IL-12, IL-15, ICOSL , CD80 and CD86 are tested. The control reference cDNA for constitutively expressed genes, including GAPDH, β-actin, and CD3D are measured in each assay. The most important induction of mRNA is observed for IFN- ?, and more modest induction is observed for CTLA-4 and ICOS.

EXAMPLE 31 CLONING AN ANTI-HUMAN ANTIBODY 4-lBB AND CONSTRUCTION OF A FUSION PROTEIN 4-lBB ANTI-HUMAN SCFV A line of hybridoma cells expressing a monoclonal anti-human mouse antibody (designated 5B9) is obtained from Dr. Robert Mittler, Emory University Vaccine Center, Atlanta. The light and heavy variable chain regions are cloned according to the known methods for cloning immunoglobulin genes and as described herein-the cells were grown in FBS medium (Invitrogen Life Technologies) IMDM / 15% for several days. Cells with logarithmic growth are harvested from cultures and RNA total prepared using QIAGEN kits, which includes a QIA granulator column purification system to homogenize cell lysates, and Rneasy® mini columns for RNA purification according to the manufacturer's instructions. The reverse transcribed cDNA that uses random hexamer primers and Superscript II transcriptase (Invitrogen Life Technologies).

The cDNA is tail anchored using terminal transferase and dGTP. The PCR is then developed using a complementary tail anchor primer and an primer that specifically anneals the antisense strand and the constant region of either Ck (for VL amplification) or the appropriate mouse CHl isotype (for VH amplification). The TOPO® amplified variable region fragments were cloned (Invitrogen Life Technologies), and the clones with inserts of the correct size were then sequenced. The sequence consesus for each variable domain is determined from the sequence of at least four independent clones. The polynucleotide sequences 5B9 VL and VH are shown in the SEC ID Nos: _ and _, and the deduced amino acid sequences are shown in SEQ ID sequences No: _ and _.

The scFv is constructed by a PCR method that it uses overlapping primers containing a synthetic linker domain (Gly4Ser) 3 between the variable regions of light and heavy chain (see example 1). The 5B9 scFv (SEQ ID No.:_) is encoded by the polynucleotide sequence comprising SEQ ID NO: __.

The polynucleotide sequence 5B9 scFv is fused to the structure for the encoded polynucleotide sequence of the mutant pivot human IgG CH2 and wild-type CH3 (MTH (SSS) WTCH2CH3, SE ID No._) according to the methods described in Examples 5, 10, and 13. The COS cells were transiently transfected with a vector comprising the polynucleotide sequence 5B9 scFv IgG MTH (SSS) WTCH2CH3 (SEQ ID No._). The supernatant is collected at the binding of the polypeptide 5B9 scFv IgG MTH (SSS) WTCH2CH3 (SEQ ID No._) is measured by immunocytofluorimetry flow essentially as described in examples 4, 10, 16, and 18. The supernatant Culture of the hybridoma cell line 5B9 is also included in the binding assay. Fresh human PBMC is incubated in the presence of immobilized anti-CD3 for four days before the binding experiment to induce CD137 expression on the surface of T cells activated. The stimulated PBMC is washed and incubated with the hybridoma culture supernatant or COS containing the fusion protein 5B9 scFv IgG or murine monoclonal antibody 5B9 respectively, for one hour on ice. Binding of 5B9 scFv IgG or murine 5B9 monoclonal antibody is detected with FITC conjugated anti-human IgG or anti-mouse IgG, respectively. The results are presented in figure 49.

EXAMPLE 32 CONSTRUCTION OF FUSION PROTEINS 2H7 SCFV IGG WITH ARTICULATION MUTATIONS The 2H7 scFv IgG fusion proteins are constructed with the first cysteine residue and the second cysteine in the substituted IgGl pivot region is a serine residue to supply MTH (SCC) and MTH (CSC). The template for the introduction of the mutations in a polynucleotide encoding 2H7 SCFv WTH WTCH2CH3 (SEQ ID NO:. _) the oligonucleotide that introduces the mutations are the 5 'primers oligonucleotides PCR HIgGMHcysl (SEQ ID NO: _) and HIgGMHcys2 (SEQ ID NO .: _). The constructions are prepared as described in (SEQ ID No.:_). The polypeptides that encode the mutants are expressed in SEQ ID NO: _) and the polypeptide sequence is provided in SEQ ID NO: _).

EXAMPLE 33 CONSTRUCTION OF 2H7 VTRLLS SCFV (SSS-S) H CH2 WCH3 A change from leucine to serine in position 11 in the heavy chain variable region (numbering according to Kabat et al., Sequences of Proteins of Immunological Intents, 5th ed. Bethesda, MD: Public Health Service, National Institutes of Health (1991)) is introduced into the fusion protein 2H7 scFv MTH (SSS) WTCH2CH3 (SEQ ID No._). The wild-type leucine residue is replaced by serine by site-directed mutagenesis using the Vhserll oligonucleotide. : 5'-gga ggt ggg age tct 'cag gct tat cta cag cag tct ggg gct gag teg gtg agg cc-3' (SEC ID No._). The 3 'primer for the PCR is huIgGl-3' having the sequence 5 '-gtc tct aga cta tea ttt ac cgg aga cag-3' (SEQ ID No.: _) (Xbal site underlined and in italics). After PCR amplification, the fragments are inserted into the TOPO cloning vector and sequenced to confirm the presence of the VHll leucine to mutation of serine. The 2H7 scFv-IgG (SSS-S) H WCH2 WCH3 encoding DNA is released into the cloning vector PSL1180 (Pharmacia Biotech, Inc., Piscataway, NJ). The construction PSL1180-2H7 scFv-lgG (SSS-S) H WCH2 WCH3 is digested with Sac and Xbal to remove the wild-type VH domain and the connection region and the CH2 and CH3 domain. The PCR product comprising the VHll mutant is digested with Sac and Xbal and then inserted into the PSL1180 construct according to standard molecular biology procedures. The construct is then digested with HindIII and Xbal, and inserted into the mammalian expression vector pDl8 (see methods described in Example 1 and Example 10). The mutant is designated 2H7 scFv VH LllS IgG (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID NO: 1.

EXAMPLE 34 EXPRESSION AND OF 2H7 SCFV VHLllS (SSS-S) H CH2 CH3 IN CHO STABLE LINES CHO DG44 cells were transfected by electroporation with approximately 150 micrograms of linearized expression plasmid encoding 2H7 VH LllS scFv (SSS-S) H WCH2 WCH3. The cultures were plated in selection medium containing 100 nM methotrexate, in 96 well flat bottom tissue culture plates in various cell numbers / well, ranging from 125 to 2000. The methotrexate-resistant clones were selected and the culture supernatants were selected for the highest fusion protein expressors using a CD20CHO binding assay similar to that described for Figure 1. The clones were amplified after initial selection at gradually increased doses of methotrexate. The cells were passaged through two passages at a higher concentration before adjusting the concentration to the next higher dose. The clones were amplified to a final concentration of 1 micromolar methotrexate.

Figure 50B illustrates production levels of 2H7 VH LllS scFv (SSS-S) H WCH2 WCH3. The spent supernatants of amplified CHO cells expressing this molecule and growing in stationary T25 bottles were assayed for quantitative binding to CD20 CHO cells by flow cytometry. The activity was converted to protein concentration by generating a standard curve using the same molecule purified from supernatants with protein A affinity chromatography (Figure 50A). The concentration of the purified protein was determined by A280 using an extinction coefficient supplied by the amino acid composition of the recombinant protein (Vector NIT). Although production levels vary among the clones tested, multiple clones produced about 1 mg / ml. This level of protein expression is about 10 times higher than the identical molecule except for the amino acid change in VH.

Figure 51 illustrates production levels of 2H7 VHLIIS scFv (SSS-S) H WCH2 WCH3 by semi-quantitative analysis on SDS-PAGE. Ten microliters of spent supernatant from the amplified CHO cells expressing this molecule and growing in stationary T25 bottles are mixed with 10 microliters of SDS 2X sample buffer without reduction, running on SDS-PAGE gels, and stained with coomassie blue.

EXAMPLE 35 CAPACITY OF UNION AND CONSTRUCTION PE THE CONSTRUCTIONS G28-1 SCFv IG The construction of G28-1 (anti-CD37) scFv is developed using total RNA isolation of the G28-1 hybridoma using Trizol reagent (Invitrogen) according to the manufacturer's instructions. The cDNA was prepared using random primers and the previously described protocol for 2H7 cloning in Example 1. The variable domains of the scFv were cloned using one or two methods: the first method uses a degenerate 5 'oligonucleotide family specific for each family of V region gene and a specific 3 'primer for each constant region of any of the methods using light or heavy chain and primers described in (Ig-Prime Kit Mousse Ig-Primer Set, Novagen). The second approach uses the tail anchor methods and the primers described in (Gilliland LK et al, Tissue Antigens 47: 1-20 (1995).) In any case, the PCR-amplified products are cloned into the cloning vector TOPO (Invitroge?). The clones are digested with EcoRI and selected for interest. of the appropriate size The positive clones are sequenced as described above in Example 1.

The specific primers are then designed for each V region, one with the leader sequence and one without the leader sequence. The primers are also designed to include desired linkers and / or restriction sites at the ends of the primer. PCR reactions are carried out in the cloned TOPO DNA, which uses a program of 25 cycles with the following profile: 94C, 30 sec; 55C, 30 sec; 72C, 30 sec followed by a final extension of 72C for 8 minutes. The PCR products are gel purified and the recovered fragments use a QIAQUICK gel extraction kit (QIAGEN, Valencia, CA). The fragments are diluted 1:50 and 1 microliter is used for SEWING PCR reactions according to the methods described in Example 1. The following oligonucleotides are used for the secondary PCR reactions of the VL domain for the G28-1 scFv: 'primers with the SalI site without leader: 5' -GTTGTTGTCGACATCCAGATGACTCAGTCTCCA3 '(SEQ ID NO: _) 5' primer with HindIII site and leader sequence: 5 '-GTCAAGCTTGCCGCCATGGTATCCACAGCTCAGTTCCTTGG3' (SEC ID NO: _) initiator 3 ': '- GCCACCCGACCCACCACCGCCCGAGCCACCGCCACCTTTGATCTCCAGTTCGGTGCC-3 '(SEC ID N0_) The initiators that use the VH domain are shown below: 'Sense primer: TCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCGTCAGCGGTCCAGCTGCAGCAGTCTGG A-3' (SEQ ID NO: _) 3 'Antisense primer with Bcll site: 5'-TCAGTGCTGATCAGAAGAGACGGTGACTGAGGTTCCTTG-3' (SEC ID DO NOT:_) A change from leucine to serine at position 11 in the heavy chain variable region (Rabat numbering) is introduced into the G28-1 scFv by site-directed mutagenesis. The wild-type form of the G28-1 scFv was initially constructed by sewing / overlapping the PCR to insert a linker (gly4ser) 3 between the VL and VH domains as described above. However, no Sac I site was introduced as a part of this merger of the variable domains, as an alternative, the sites of Close restriction (Haell and PvuII) near leucine 11 are used to synthesize the mutated VH + VH domain. The primers are designed to contain one of these sites and the DNA sequence that includes the L by S change, followed by the wild-type base pair 12. Several attempts at this strategy failed, as well as an alternative strategy using the Genetailor method ( Invitrogen) of site-directed mutagenesis as used to introduce the desired mutation. Mutagenesis is carried out according to the manufacturer's instructions. In summary, the procedure involves the methylation of the DNA plasmid with the DNA methylase, the amplification of the DNA in a mutagenesis reaction with two overlapping primers, one of which contains the target mutations, transformation of the wild type E. coli plasmid that digests all the methylated DNA and leaves only the non-methylated, the mutated amplification product. Both primers are approximately 30 nucleotides in length (it does not include the mutation site in the mutagenic primer, with a 5 'end overlap region of 15-20 nucleotides, for the purpose of efficient binding of the mutagenesis product.) The template of the mutagenesis reaction was 100 ng of a plasmid that contains the G28-1 wild type scFvIg construct, and the primers used for the G28-1 VH mutagenesis are as follows: Front Initiator: 5 '-GCAGCAGTCTGGACCTGAGTCGGAAAAGCCTG-3' (SEC ID N0: _) Reverse Starter: 5 '-CTCAGGTCCAGACTGCTGCAGCTGGACCGC-3' (SEC ID N0_) PCR reactions were developed using 15 ng of methylated template, the above initiator, and the usual reaction components as previously described. A program of 20 cycles with the following profile is used for the amplification: 94C, 30 sec; 55C, 30 sec; 68C, 8 min, followed by a final extension stage of 68C for 10 minutes. The PCR products are transformed into wild-type bacteria, and colonies are selected for sequencing. Clones with only the desired mutation are isolated and the plasmids are prepared as previously described in Example 33. The mutant is designated G28-1 scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

The level of expression of G28-1 fusion proteins is confirmed using Immunblot analysis according to the methods described in Example 17. Figure 53 illustrates a large increase in protein expression in VH mutant G28-1 fusion proteins. LllS compared to G28-1 fusion protein without the mutation.

The G28-1 scFv Ig fusion proteins are transiently transfected and expressed in COS cells according to the methods described in Example 10. Figure 52 illustrates the capacity of the G28-1 scFv Ig fusion proteins of COS supernatants. to join the CD37. The Ramos and BJAB cells both express human CD37, and are therefore used for the selection of G28-1 supernatants for functional activity. The binding of G28-1 scFv (SSS-S) H WCH2 WCH3 and G28-1 scFv VH LllS (SSS-S) H WCH2 WCH3 to Ramos CD37 + cells is used by cytometry according to the methods described in Example 2. Each point on the graph represents the means of five replicate transfections. The graph illustrates that the G28-1 scFv VH LllS (SSS-S) H WCH2 WCH3 is capable of binding the CD37 + Ramos cells.

The addition constructions were made in different connection regions. The vector pDl8 G28-1 scFv VHLllS (SSS-S) H WCH2 WCH3 is digested with Bcll and Xbal to remove the connection region CH2 and CH3. These are replaced with each different connection region CH2 and CH3 according to the methods described in Example 13. The new constructions are designated: G28-1 scFv VHLllS (CSS-S) H WH2 WH3 (SEQ ID NO), G28 -1 scFv VHLllS (CSC-S) H WH2 WH3 (SEC ID NO_), G28-1 SCFv VHLllS (CSS-S) H WH2 WH3 (ID OF SEC NO), G28-1 SCFv VHLllS (SSC-P) H WH2 WH3 (SEC ID NO_), G28-1 scFv VHLllS (SCS-S) H WH2 WH3 (SEC ID NO_), G28-1 SCFv VHLllS (CCS-P) H WH2 WH3 (SEC ID NO_), and G28-1 SCFv VHLllS ( SCC-P) H WH2 WH3 (SEC ID NO_).

The G28-1 scFv also adheres to a binding region IgA, CH2, CH3 and an IgE CH2, CH3, CH4. Plasmid pDl8 G28-1 scFv VHLllS (SSS-S) H WCH2 WCH3 is digested using the above methods to remove the CH2 and CH3 connection region. The IgA regions are inserted using methods described in Example 13. The construction is designated G28-1 SCFv VHLIIS IgAH IgACH2 T4CH3 (SEQ ID NO: 0). The IgE CH2 CH3 CH4 region is inserted into the digested pDl8 vector above using the methods described in Example 39. The construction is designated G28-1 scFv VHL11S IgECH2 CH3 CH4 (SEQ ID NO).

EXAMPLE 36 Characterization of mutant fusion proteins 2H7 scFv R Figure 54 illustrates the binding capacity of purified 2H7 scFv Ig constructs to CD20 + CHO cells.

The proteins are transfected into stable CHO cells according to the methods described in Example 2. The binding is determined using flow cytometry according to the methods described in Example 2. The graph in Figure 54 illustrates that these proteins retain the CD20 binding function with altered connection regions. The comparative results obtained in each of the mutants 2H7 scFv VHL11S with each type of altered connection region (the results are omitted).

The capacity of 2H7 scFv-lg constructs with mutated connection regions to kill CD20 positive cells in the presence of peripheral blood mononuclear cells (PBMC) through ADCC are assayed by measuring the 51 Cr release of labeled BJAB cells in a 4 hour assay using 100: 1 ratio of PBMC to BJAB cells. The results shown in Figure 55 indicate that the 2H7 scFv-lg mutants can mediate antibody-dependent cellular cytotoxicity (ADCC), because the release of 51 Cr was significantly higher in the presence of both PBMC and 2H7scFv-Ig than in the presence of PBMC or 2H7scFv-Ig alone. The comparative results are obtained in each of the 2H7 scFv VHLllS mutants with each type of altered connection region (the results are omitted).

The ability of mutant 2H7 scFv-Ig fusion proteins to kill CD20 positive cells in the presence of complement is tested by using Ramos target cells from B cell lines. The rabbit complement was purchased from Pel-Freez (Rogers, AK) , and was used in the test at a final concentration of 1/10. The purified 2H7scFv-Ig was incubated with B cells and supplemented for 45 minutes at 37 ° C, followed by counting live and dead cells by trypan blue exclusion. The results in Figure 56 show that the 2H7scFv-Ig mutants in the Presence of rabbit complements the lysed B cells expressing CD20.

EXAMPLE 37 COMPARATIVE BUILDING UNION IGA, IGG, AND IGE 2H7 SCFV The binding capacity of IgA, IgG and IgG constructs was measured using flow cytometry according to the methods described in Example 2, which uses a commercially available specific second step (Caltag) for each Ig tail. The results in Figure 57 show that all IgE constructs were available to bind to CD20 + CHO cells comparable to the IgG and igA capacities. These results also demonstrate that IgE constructs are detected with the second stage IgE, but not the second stage IgA or IgG.

EXAMPLE 38 CONSTRUCTION AND CHARACTERIZATION OF CONSTRUCTIONS 2H7 VH LllS IGE The IgE tail RNA was isolated from SKO-007 cells (ATCC) using RNA minikits and QIAGEN QIAshredder homogenization. The randomly initiated cDNA was generated according to the usual protocol, with 4 microliters of RNA eluted from the QIAGEN columns. Human IgE from the start of CH1 to CH4 (approximately 1.2 kb) was isolated by PCR amplification of 5 microliters of cDNA, with an amplification profile of 94C, 60 sec; 72C, 2 minutes for 35 cycles and the following initiators: initiator 5 ': 5-' ggatccacccgctgctgcaaaaacattccctccaatgccacctccgtgac-3 '(SEC ID NO_) initiator 3': 5'-tcatttaccgggatttacagacaccgctcgctggacggtctgtgaggggctcgctgc-3 '(SEC ID NO: _) The PCR fragments were ligated into the PCR 2.1-TOPO vector, and the transformants selected for inserts of the correct size by EcoRI digestion according to the methods described in Example 1. One of the clones with the correct sequence is used as template for amplify the CH2-CH4 domains with the appropriate restriction sites adhered for subcloning as cell surface or soluble forms (ORF). The following primers were used with an amplification profile of 94C, 60 sec; 55C, 60 sec; 72C, 2 min; for 35 cycles to amplify a fragment of approximately 950 bp: 'primer: (attaches the Bcll site to the 5' end of the CH2 domain of IgE) 5 '-gttgttgatcacgtctgctccagggacttcacc-3' (SEC ID NO_) initiator 3 ': (adheres the parade codon and the Xbal site to the 3' end) of CH4 of IgE) 5 '-gttgtttctagattatcatttaccaggatttacagacaccgctcgctg-3' (ID of SEC NO_) initiator 3 ': (adheres Sful and BamHI to extreme 3' CH4 without a stop codon) 5 '-gttgttttcgaaggatccgctttaccagatttacagacaccgctcgctg-3' (ID FROM SEC NO_) The IgE CH2CH3CH4 tail with a stop codon was digested with Bcll and Xbal and inserted into a vector pDl8 containing 2H7 VHLllS scFv. This construction was designated 2H7 IgECH2CH3CH4. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _. The tail IgEG2CH3CH4 without stop codon (ORF) was digested with Bcll and Sful and inserted into a vector pDl8 containing 2H7 VHLIIS scFv. This construction was designated 2H7 IgeCH2CH3CH4 (ORF). The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

Human IgE is also amplified as a fragment of both CH1 and CH2 domains, only with the CH3 and CH4 domains adhered to the human IgG1 pivot. Sequential PCR reactions using overlapping 5 'oligonucleotides are used to attach the IgGl pivot to the CH3 domain of human IgE. The primers for the first stage of the PCR reaction: initiator 5 ': 5' -actcacacatccccaccgtccccagcatccaacccgagaggggtgagc-3 '(SEC ID NO_) Initiators for the second stage of each PCR reaction: initiator 5 ': 5' -tctgatcaggagcccaaatcttctgacaaaactcacacatccccaccg-3 '(SEC ID NO_) initiator 3': 5 '-gitttotagattatcatttaccaggatttacagacacogetogOtg-3' (SEC ID NO_) The PCR product was digested with EcoRI and sequenced according to the methods described in Example 1. Positive clones were inserted into plasmid pDl8 containing 2H7 VHLIIS scFv (SSS-S) H. The construct was designated 2H7 VHLIIS scFv (SSS -S) H IgE CH3CH4. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

The binding capacity of 2H7 scFv VH LllS IgECH2 CH3 CH4, was measured using flow cytometry, essentially according to Example 2. The protein was purified using MEP HyperCel, (Cipergen, Catalog # 12035-010, Lot # 200920/0271 ) chromatography resin and Hydrophobic Charge Induction Chromatography (HCIC). The absorbent HCIC is a high capacity, high selectivity absorber designed to capture and purify monoclonal and polyclonal antibodies from various sources including cell culture supernatants. The columns are packed with a 10 ml volume of MEP Hypercel bed, and equilibrated with PBS, pH 7.4 containing 0.1% NaN3. Approximately 1 liter of culture supernatant 2H7 scFv VHL11S IgE CH2CH3CH4 CHO after running on the column. A series of citrate buffers varying from pH 3-6 are prepared to elute the protein fusion. The column was washed in PBS. The protein was eluted in fifteen 1 ml fractions at pH 6, 5, and 4. A final 15 ml fraction was collected at pH 3.5. The aliquots of each fraction were analyzed for A280 and also subjected to SDS-PAGE, loading roughly 10 micrograms / well based on reading A280. The results of these two analyzes indicate that the mass of the protein does not elute in citrate buffers at higher pH, but eluates at pH 4, and the post elution wash at pH 3.5 also contains significant amounts of protein.

The ability of these purified proteins 2H7 VH LllS IgE to bind CD20 + CHO cells is determined using cytometry of flow according to the methods described in Example 2 using FITC-conjugated goat anti-human IgE. Figure 58A illustrates that both purified proteins are capable of binding CD20 + CHO cells.

The ability of these purified 2H7 VH LllS IgE proteins to mediate ADCC against BJAB target cells with PMRC effectors is measured according to the methods described in Example 2. Figure 58B illustrates that both proteins are capable of mediating ADCC at similar levels.

EXAMPLE 39 CAPACITY OF UNION AND CONSTRUCTION OF MUTANTS SCFv VH LllS WITH REGIONS OF IGA COLLECTION AND IGE OF MOUSE Murine IgA was cloned from murine spleen RNA using essentially the same methods used to clone the human IgE tails in Example 38. PCR reactions are run at 94 ° C 60 sec; 52C 60 sec; 72C 2 min of amplification profile for 35 cycles. The PCR primers used to clone the CHl-CH4 regions were: initiator 5 ': 5'-atctgttctcctcctactactcctcctccacct-3' (SEC ID NO) initiator 3 ': 5' -tcagtagcagatgccatctccctctgacatgatgacagacacgct-3 '(SEC ID NO_) PCR initiators used to eliminate the CHl region: initiator 5 ': 5' -gttgttgatcacatctgttctcctcctactactcctcctccacct-3 '(SEQ ID NO_) initiator 3' with a stop codon, site Xbal at the end of the tail Ig, and mutation T4 in the region CH3: 5 '-gttgtttctagattatcaatctccctctgacatgatgacagacac- 3 '(SEC ID NO_) initiator 3' for the ORF, a Sful and BamHI site, and mutation T4 in the CH3 region: 5 '-gttcttcgaaggatccgcatctccctctgacatgatgac-3' (SEC ID DO NOT_) The mouse IgACH2 T4CH3 tail with a stop codon was digested with Bcll and Xbal and inserted into a vector pDl8 containing 2H7 VHLIIS scfv and IgAH. This construction designated 2H7 VHLIIS scFv IgAH mIgACH2 T4CH3. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

The tail of mouse IgACH2 T4CH3 without stop codon (ORF) was not digested with Bcll and Sful and inserted into vector pDl8 containing 2H7 VHLIIS scFv and IgAH. This construction was designated 2H7 VHLIIS scFv IgAH mIgACH2 T4CH3 (ORF). The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

The murine IgE was cloned IgE La2 (ATCC) murine RNA essentially according to the methods described in Example 38. PCR reactions were developed with a 94C 60 sec; 54C 60 sec; 72C 2 min of amplification profile for 35 cycles. The initial PCR primers were used to clone CH1-CH4: 'primer: 5' -tctatcaggaaccctcagctctaccccttgaagccctg-3 '(SEC ID DO NOT_) initiator 3 ': 5' -gttgtttctagattatcaggatggacggagggaggtgttaccaaggct-3 '(ID FROM SEC NO_) PCR initiators to remove the CHl region: initiator 5 ': 5' -gttgttgatcacgttcgacctgtcaacatcactgagcccacc-3 '(SEC ID NO_) 3 'primer with stop codon in the Xbal site: 5' -gttgtttctagattatcaggatggacggagggaggtgtaccaaggct-3 '(ID DE SEC NO_) initiator 3 'ORF, Sful and BamHI: 5' -gttgttttcgaaggatccgcggatggacggagggaggtgtta-3 '(SEC ID NO_) The IgE CH2CH3CH4 tail with a stop codon was digested with Bcll and Xbal and inserted into the vector pDl8 containing 2H7 VHLIIS scFv. This construction was designated 2H7 VHLllS mIgECH2CH3CH4. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

The mouse IgE CH2CH3CH4 tail without stop codon (ORF) was digested with Bcll and Sful and inserted into the vector pDld containing 2H7 VHLIIS scFv. This construction was designated 2H7 VHL11S scFv mIgECH2CH3CH4 (ORF). The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

The binding capacity of 2H7 VH LllS mlgE and the mlgA (without mouse tail regions) to CD20 + CHO cells were also measured by flow cytometry according to the methods described in Example 2 using reagents (Caltag) Second stage IgE or IgA commercially available. Each point in Figure 59 represents the mean of a population with brightness corrected by subtraction from the junction of the second stage alone. This Figure illustrates that these constructions have the ability to bind CD20 + CHO cells.

EXAMPLE 40 HPLC PROFILES OF MUTATING FUSION PROTEINS 2H7 SCFv IG HPLC analysis of mutant fusion proteins 2H7 scFv-lg purified with CH3 and altered connection regions. Each protein is purified by Protein A affinity chromatography of supernatants from transfected COS or CHO cells. Twenty-five to fifty micrograms of each sample is run at 1 ml / min in PBS on a 30 cm column TSK-GEL G3000SWXL (Tosoh Biosep, Stuttgart, Germany). The arrow near the beginning of each profile represents the sample injection point. Gel filtration standards (Bio-Rad) include trioglobulin (670 kDa), gamma globulin (158 kDa), ovalbumin (44 kDa), myoglobin (12.5 kDa), and vitamin B-12 (1.35 kDa). The standards were run at the beginning and end of each experiment. The migration positions of the standards are shown and do not vary between experiments. (Figures 60-62) EXAMPLE 41 UNIT CAPACITY OF MUTATING FUSION PROTEINS 2H7 VHLllS The binding effects of the mutant CH3 are compared to the non-mutated CH3 fusion protein. The constructs are transfected into COS cells and purified from the supernatant using protein purification techniques of Protein A column described in Example 2. Figure 63 illustrates the differential effects of CH3 mutations on the binding using flow cytometry according to the methods described in Example 2. This Figure illustrates that some binding capacity is lost when the double mutation point is introduced into the CH3 region.

The binding of mutant fusion proteins 2H7 VH LllS conjugated with fluorescein isothiocyanate (FITC) was determined using flow cytometry. A 1 mg / ml solution of FITC was prepared in DMSO. The fusion proteins were dialyzed in bicarbonate buffer of pH 9.3 overnight at 4C in a volume of 2 liters. The concentration of the protein was adjusted to 1-5 mg / ml before conjugation. A series of 5 ml tubes Falcon was configured with FITC variant for protein ratios, ranging from 15-60, but minimally proportions of 20 and 40. The conjugation reactions were incubated at 37C for 30 minutes protected from light. The protein is separated from the free fluorescence on a 2 ml Sephadex G-25 column equilibrated with PBS, 0.5 NaCl, and 1% NaN3. The protein is labeled with fluorescein eluate from the First column is collected in a 5 ml tube. The degree of labeling is determined by measuring the absorbance of the conjugate diluted at 280 and 494 nm, and using the forms that are supplied by technical services in Molecular Probes (Eugene, OR). The data has been corrected for FITC: protein index. Figure 64 illustrates that these constructions do not lose the binding capacity when conjugated with a fluorescent label.

The purified 2H7 VH LllS constructs ran on an SDS gel without reduction according to the methods described in Example 2. The migration patterns are presented in Figure 65.

EXAMPLE 42 CHARACTERIZATION OF 2H7 SCFV VH LllS (CSC-S) H CH2 WCH3 IN CELLS LEC13 CHO 2H7 scFv VH LllS (CSC-S) H WCH2 WCH3 is transiently transfected and expressed in Lecl3 CHO cells. Lecl3CHO cells were used as hosts of mammalian cells for the 2H7 scFv VHSll hlgGl (CSS-S) H WCH2 WCH3 and (CSC-S) H WCH2 WCH3 expressing plasmids in transfections Side to side. All transfections were developed in 100 mm tissue culture dishes. Cells were transfected when approximately 90% confluent uses lipofectamine 2000 (Invitrogen, Catalog #: 11668-027, 0.75 ml), following the manufacturer's instructions. Both cell lines grew in the presence of serum to promote and maintain adherence to cell culture dishes, simplifying transfection, washing, and harvest manipulations of the supernatant. DNA: lipofectamine complexes are allowed to form in the absence of sera and antibiotics, following the suggested protocol / conditions recorded in the product insert. Culture supernatants were harvested 72 hours after transfection, and then 72 hours after the first harvest. The fusion protein of the two CHO sources is isolated by protein A purification as previously described and used in the CD20 and DAC binding assays.

The ability of the mutated fusion protein to mediate DAC in CD20 positive cells is determined by using the methods described in Example 2. Constructs expressed in Lecl3 CHO cells exhibit better binding to the CD20 CHO target cells and also show significantly enhanced activity in the DAC assays related to the CHO DG44-derived proteins at equivalent concentrations as illustrated in Figure 67.

EXAMPLE 43 CONSTRUCTION OF ALLOYS CDl6 HIGH AND LOW AFFINITY The alleles of low (V) and high (F) affinity at position 158 of the human CD16 extracellular domain were cloned from the cDNA derived from the human PBMC using a PCR assay. PCR reactions utilize randomly initiated cDNA made from stimulated PBMC for 3 days with immobilized anti-CD3 antibody (64.1) before harvesting. PCR reactions included 2, 4, 6 or 8 microliters of cDNA, each primer at 25 pmol, and an amplification profile of 94C 60 sec; 55C 60 sec; 72C 2 min, for 35 cycles. The PCR primers are listed below: Initiator 5'- without leader peptide: 5'-GTTGTTACCGGTGCAATGCGGACTGAAGATCTCCC AAAGGCTGTG-3 '(SEQ ID No.: _) 3' antisense initiator: 5'- GTTGTTTGATCAGCCAAACCTTGAGTGATGGTGATGTTCACA-3 '(SEQ ID NO.: _) The clones are sequenced and inserted into a vector containing an efficient leader peptide and the tail human IgG (SSS-S) H P238SCH2 WCH3. Two different versions of CD16 ED fusion proteins are expressed. The first contains F158 (high affinity) and the second contains the allele V158 (low affinity). The constructs are cloned into a plasmid (SSS-S) H P238S CH2 WCH3 pDl8 and expressed in COS and CHO cells as described above in Examples 1 and 10. The CHO clones were selected for expression using an ELISA interspersed IgG assay for determine the relative expression levels of the fusion proteins in the culture supernatant using the following protocol: Immulon IV plates were covered in 4C with 0.4 microgram / ml of goat antihuman IgG (mouse adsorbed), (Carrag, Catalog #; H10500) in PBS buffer. The plates were then blocked in PBS / 1.5% nonfat milk at 4C overnight. Plates were washed three times in PBS / 0.1% Twen 20, then incubated with 100 microliter dilution series of CHO clone culture supernatant at room temperature during 3 hours . Four dilutions per clone were added to successive wells, diluting in 5 times increments of 1: 5 to 1: 375. In addition a standard curve is derived using CTLA4 hlgGl (SSS-S) H P238SCH2 WCH3 as a standard concentration. The dilution series used 5 times dilutions starting at 0.5 micrograms / ml; a second set of 8 wells is used to make 2-fold dilution series starting at 0.34 micrograms / ml. Plates are washed three times in PBS 0.1% Twen 20 and incubated with goat antihuman IgG conjugated to horseradish peroxidase (GAH IgG-HRP) at l: 5000, in PBS / 0.5% BSA for 1 hour. The plates are washed four times with PBS / 0.1% Tween 20, then chromagen TMB substrate (BD-Pharmingen) is added for 10 minutes, and the reactions are stopped by the addition of 100 microliters of 1N sulfuric acid. The plates were then read at 415 nm on a SpectraCount plate reader as it appears there. The concentrations of the fusion protein are estimated by comparing the ODs in the linear range to the run of the CTLA4lg standard curve in each dish.

Proteins are purified using purification of protein A and conjugated directly to isothiocyanate of fluorescein (FITC) as described in example 42. These proteins are run on SDS gels under reduced and unreduced conditions according to the methods described in example 2. The migration of these proteins is presented in figure 68.

The ability of the high and low alleles CD16 to join 2H7 VHlllS (CSC-S) H WCH2 WCH3 or join 2H7 VHlllS (SSS-S) H (P238S) CH2 WCH3 which is expressed on the cell surface of the CD20 + CHO target cell is determined by using flow cytometry according to the methods described in example 2. The results in Figure 69 demonstrate the low and high affinity of the alleles that are capable of binding to 2H7 VHLllS (CSC-S) H WCH2 WCH3 (SEC ID N?::) and the loss of some binding capabilities when the P238S mutation is introduced into the CHO region of the construct ( ID of S? C No.:_).

EXAMPLE 44 MAMMALIAN EXHIBITION SYSTEM The diagrams in Figure 70a show FITC conjugates of FcRIII (CD16) soluble fusion proteins - which bind to 2H7 scFv-lg constructs that adhere to CD20 expressed by CHO cells. CD16 binding to a scFv-Ig provides a screening tool for detecting changes in CD16 binding to an altered scFv-Ig construct containing target or site-specific nutations. Changes in CD16 binding properties can be changes in the binding of the high affinity CD16 protein (158F) or low affinity protein CD16 (158V) or both.

A schematic representation of such a selection process is diagrammed in Figure 70b, wherein the scFv-Ig constructs are displayed on the cell surface of mammalian cells. The scFv-lg molecules in this example are displayed on the cell surface because they contain a transmembrane domain anchor. These molecules can represent a single scFv-lg construction or can be introduced into a population of mammalian cells as a library of such molecules. Transfected cells with altered binding properties can then be filtered, sorted, or otherwise isolated from other cells by altering the restriction of selection conditions and using CDl6 fusion proteins as the binding probe. The cells that express the scFv-lg molecules with altered binding to the high affinity allele CD16 (158F) or low affinity allele CD16 (158V) or both can be isolated. For example, the display system can be used to create a library of mutated Ig tails with short stretches of the CH2 sequence replaced with randomized oligonucleotides or possible randomization of a single residue with all possible amino acid substitutions, including synthetic amino acids. Once such a library is constructed it can be transfected into CHO cells by methods well known in the art. The transfectants can then be bound to labeled CD16 constructs, and filtered or sorted based on their binding properties relative to multiple allelotypes / isoforms. The filtered and harvested cells, and the DNA plasmids are isolated and then transformed into bacteria. This process can be repeated iteratively multiple times until single clones are isolated from mammalian host cells (see Seed B and Aruffo A, PNAS 84: 3365-3369 (1987) and Aruffo A and Seed B, PNAS 84: 8573-8577 (1987)). One such use of this type of selection can isolate Ig queues that bind equally well to the high and low affinity alleles of CDl6 with the goal of improving functions effector-mediated scFv-lg constructs in multiple sub-populations of patients. Ig queues with altered binding properties to other Fe receptors can also be selected using the described display system. Other display systems for example those using bacteriophages or yeast are not suitable for selection of Ig-tails with altered FcR binding properties due to glycosylation requirements in the Ig CH2 domain that can not occur in non-mammalian systems.

This system is also useful for the selection of altered scFv-lg molecules that will occur at high levels. In this example, mammalian cells such as COS cells can be transfected with a library of scFv-Ig constructs in a plasmid which directs its expression to the cell surface. COS cells expressing the highest levels of the scFv-Ig molecules can be selected by techniques well known in the art (eg filtration, sterile cell sorting, magnetic bed separation, etc.), and the plasmid DNA is isolates for transformation into bacteria. After several rounds of selection of single clones are isolated by coding scFv-lg molecules capable of high level of expression. When the isolated clones are altered to remove the membrane anchor and then expressed in mammalian cells, the scFv-Ig constructs will be secreted into the culture fluid at high levels. This reflects the common requirement of secreted glycoproteins and cell surface glycoproteins for a signal peptide and processing through the golgi for expression, such that selection for a molecule that illustrates an improvement in cell surface expression levels will also select for the molecule that illustrates an improvement in levels of secreted protein.

EXAMPLE 45 CHARACTERIZATION OF G28-1 MABS AND SCFVs The ability of G28-1 mAbs and scFvs to induce apoptosis is measured by Annexin V binding, which uses the methods described in Example 3. The results in Figure 71 demonstrate that Annexin V binding of G28-1 antibodies and scFV is increased when treated together with 2H7 antibodies and scFv constructs.

EXAMPLE 46 CONSTRUCTION OF CONSTRUCTIONS FC2-2 SCFV The construction of FC2-2 (anti-CDl6) scFv is developed using total RNA isolated from the hybridoma FC2-2 and is cloned using the methods described in Example 35. The polynucleotide sequence is supplied in the SEC ID.

No.: _, and the encoded polypeptide sequence is provided in SEQ ID No.: _. The specific primers for the secondary PCR reaction are listed below. The following are primers for the light variable string region: Initiator 5 'with HindIII site without leader: 5'- GTTGTTAAGCTTGCCGCCATGGATTCAC AGGCCCAGGTTCTT-3 '(ID of S? C N?::) 5' Initiator with site Salí and leader: 5'- GTTGTTGTCGACATTGTGATGTCACAGTCTCC ATCCTCCCTA-3 '(SEC ID N?::) 3' Initiator: 5 '-TCAGTGCTGATCATGAGGAGACGGTGACTGAGGTTCCTT-3' (SEC ID) The following are primers for the heavy chain variable region: Primer 5 ': 5' - TCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCGTCACAGGTGCAGTTG AAGGGAGTCAGGA-3 '(SEQ ID No.: _) 3' Initiator: 5'-ACCCGACCCACCACCGCCCGAGCCACCGCCACCTTTTATTTCCAGCTTG GTGCCACCTCCGAA-3 '(SEQ ID No.: _) A change from leucine to serine at position 11 in the heavy chain variable region (Kabat numbering) is introduced into FC2-2 scFv by site-directed mutagenesis according to the methods described in Example 33. The scFv adheres to the tail (SSS-S) H WCH2 WCH3 IgG according to the methods described in example 33. The mutant is designated FC2-2 scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID No., and the polypeptide sequence. encoded is provided in SEC ID No.: _.

EXAMPLE 47 CONSTRUCTION OF CONSTRUCTIONS 5B9 scFV The construction of 5B9 (anti-CDl37) scFv is developed using total RNA isolated from hybridoma 5B9 and cloned using the methods described in Example 35. The polynucleotide sequence is supplied in the SEC ID No.: __, and the encoded polypeptide sequence is provided in SEQ ID No.:_. The specific primers for the secondary PCR reaction are listed below. The following are initiators of the light variable chain region: 5 'primer with HindIII site without leader: 5'- GTTGTTAAGCTTGCCGCCATGAGGTTCT CTGCTCAGCTTCT-3' (SEC ID.?: _) 5 'primer with SalI site and leader: 5 '- GTTGTTGTCGACATTTGTGATGACGCAGGCTG CATTCTCCAATT -3 '(SEC ID N?::) Initiator 3': 5 '- TCAGTGCTGATCAGAGGAGGACGGTGACTGAGGTTCCTTG-3' (SEC ID No.: _) The following are primers for the heavy chain variable region: 5 'primer: 5' -CGGGCGGTGGTGGGTCGGGTGGCGGCGGATCGTCACAGGTGCAGCTGA AGCAGTCAGGA -3 '(SEQ ID NO: 3): 5' -CCGACCCACCACCGCCCGAGCCACCGCCACCCTTCAGCTCCAGCTTG GTGCCAGCACC-3 '(SEC ID No.: _) A change from leucine to serine at position 11 in the heavy chain variable region (Kabat numbering) is introduced into 5B9 scFv by site-directed mutagenesis and adheres to the (SSS-S) H WCH2 WCH3 according to the methods described in example 33. This construction is designated 5B9 scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 48 CONSTRUCTION OF CONSTRUCTIONS UCHLl SCFV The construction of UCHL1 (anti-CD45RO) scFv is developed using total RNA isolated from hybridoma UCHL1 and cloned using the methods described in example 35. The polynucleotide sequence is provided in SEQ ID NO: _, and the sequence of encoded polypeptide is provided in SEQ ID No._. The following are primers for the light variable chain region: 5 'primer with HindIII site: 5' - GTTGTTAAGCTTGCCGCCATGAAGTTGCCTGTTAGGCTG TTGGTGCTG-3 '(SEQ ID NO: _) 3' Initiator with Sac site: 5'-AGAGCTCCCACCTCCTCCAGATCCACCACCGCCCGAGCCAC CGCCATCTTTGATTTCCAGCTTGGT-3 '(SEC ID N?: _) The following are primers for the heavy chain variable region: Initiator 5 ': 5' -TTTCAGAGTAATCTGAGAGCTCCCACCTCCTCCAGATCCACCACCGCCCGA-3 '(SEQ ID NO: _) 3' Initiator: 5'-TCAGTGCTGATCATGCAGAGAGACAGTGACCAGAGTCCC-3 '(SEQ ID NO: _) A change from leucine to serine at position 11 in the heavy chain variable region (Kabat numbering) is introduced into the 5B9 scFv by site-directed mutagenesis and connected to a (SSS-S) H WCH2 WCH3 according to the methods described in Example 33. The mutant is designated UCHLl scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID NO. : EXAMPLE 49 L6 VHLllS SCFv (SSS-S) H CH2 WCH3 A change from leucine to serine in position 11 in the heavy chain variable region (Kabat numbering) is introduced in the L6 VHLllS scFv (SSS-S) H WCH2 WCH3 (constructed according to the methods described in Example 106) by site-directed mutagenesis according to the methods described in Example 33. The plasmid LdscFvIg (SSS-S) H WCH2 WCH3 pDl8 used as a template is used. Positive clones were inserted into plasmid pDl8 containing (SSS-S) H WCH2 WCH3 according to the methods described in Example 33. The mutant is designated L6 scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID NO: 1. PCR primers are listed below: 5 'primer with restriction site PstI: 5'-ggcggatctctgcagatccagttggtgcagtctggacctgagtcgaagaagcct ggagag-3' (SEC ID No._) 3 ': 5' ggacagtgggagtggcacc-3 '(SEC ID No.: _).

EXAMPLE 50 CONSTRUCTION OF CONSTRUCTION HD37 SCFv VHLllS A change from leucine to serine at position 11 in the heavy chain variable region (Kabat numbering) is introduced into the HD37 scFv by site-directed mutagenesis according to the methods described in example 33. Plasmid HD37 scFv (SSS) -S) H WCH2 WCH3 pDl8 is used as a template. Positive clones were inserted into the plasmid pDl8 containing (SSS-S) H WCH2 WCH3 according to the methods described in Example 33. The mutant is designated HD37 scFv VH LllS (SSS-S) H WCH2 WCH3. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _. The PCR primers are listed below: Initiator 5 ': 5' -caggttcagctgcagcagtctggggctgagtcggtgaggcctgg-3 '(SEC ID No.:_) Initiator 3': 5'-ggaggattcgtctgcagtcagagtggc-3 '(SEC ID No.: _) EXAMPLE 51 CONSTRUCTIONS 2H7 SCFv VHLllS Additional 2H7 VHLllS constructions were made with different connection regions. The vector pDl8 2H7 scFv VHLllS (SSS-S) H WCH2 WCH3 is digested with Bell and Xbal to remove the connection region, CH2 and CH3. These were replaced with each different connection region, CH2 and CH3 according to the methods described in example 13. The new constructions were designated: 2H7scFv VHL11S (CSS-S) H WH2 WH3 (SEC ID N?: _), 2H7scFv VHLllS (CSC-S) H WH2 WH3 (SEC ID No.:_). The 2H7 scFv VHLllS also adheres to a binding region IgA, CH2, CH3 and an IgE CH2, CH3, CH4. Plasmid pDl8 2H7 scFv VHLllS (SSS-S) H WCH2 WCH3 is digested using the above methods to remove the CH2, CH3 connection region. The IgA regions are inserted using the methods described in example 13. The construction is designated 2H7 scFv VHLIIS IGAH IgACH2 T4CH3 (SEQ ID No._). The IgE CH2 CH3 CH4 region is inserted into the above-digested pDl8 vector using the methods described in Example 39. The construct is designated 2H7 scFv VHL IS IgECH2 CH3 CH4 (SEQ ID NO: _).

EXAMPLE 52 2H7 SCFv VH LllS (CSC-S) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connected to a human IgGl connection region, CH2 and CH3 region, where the second cysteine and the proline in the connection region have been changed to serines (SSS-S) as described in Example 32. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID No.:_.

EXAMPLE 53 2H7 SCFv VH LllS IGE CH2 CH3 CH4 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This region adheres to the human IgE constant region containing CH2, CH3 and CH4 as described in Example 38. The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID. Do not . : _.

EXAMPLE 54 2H7 SCFv VH LllS MicE CH2 CH3 CH4 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in Example 33. This binding region is adhered to a mouse IgE constant region containing CH2, CH3 and CH4 as described in Example 39. The polynucleotide sequence is provided in SEQ ID No._, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 55 2H7 scFv VH LllS MGAH WIGACH2 T4CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in Example 33. This binding region adheres to an IgA connecting region as described in Example 5. This connection region adheres to the mouse IgA constant region of a wild-type CH2 region and a mutated CH2 region. wherein there is a truncation of the 4 amino acid residues before the 3 'stop codon as described in example 39. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is supplied in SEC ID No.:_.

EXAMPLE 56 2H7 SCFv VH LllS (SSS-S) H K322S CH2 CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connects to a mutated human IgG connection region, where all the cysteines and one proline have been changed to serines (SSS-S), according to the methods described in example 5. The connection region is adhered to an igG region CH2 mutated and a wild type IgG CH3 region. The K322S mutation in the CH2 region is at a residue 322, where a lysine has been changed to a serine using an overlapping PCR assay. A template (SSS-S) H WCH2 WCH3 IgGl in vector pDl8 is used for PCR amplification, to create derivatives (SSS-S) H containing these CH2 mutations. PCR reactions use a cyclic profile of 94C, 30 sec; 55C, 30 sec; 72C, 30 sec, for 37 cycles to complete the reactions. This IgG1 derivative is constructed by using sequential PCR reactions with overlapping oligonucleotides in the primary and secondary reactions. The primary amplification primers introduce the mutations, but they eliminate one end of the Fe domain. The secondary reaction primers readh these ends using overlapping primers. The first overlapping initiator is added at the beginning of the PCR, the reactions are allowed to proceed for 12 cycles, paused and then a second overlapping initiator is added to the reactions followed by 25 cycles more to complete the overlap extension PCR reactions. Initiators for the first PCR reaction: Initiator 5 ': 5' -ggagatggttttctcgatgggggctgggagggctttgttggagaccccgcacttgtact cc-3 '(SEC ID No.:_J Initiator 3': 5'-ggacagtgggagtggcacc-3 '(SEC ID No.: _) The PCR products were cloned into the TOPO vector and sequenced for verification. The positive vectors were used as templates for the second overlapping PCR reaction.

Initiator 5 ': 5' ccgtctctgatcaggagcccaaatcttctgacaaaactcacacatccccaccgtcccca gc-3 '(SEC ID N?::) Initiator 5' overlapping initiator: 5'-tccccaccgtccccagcacctgaggggatcgtcagtcttcctcttccccc caaaacc-3 '(SEC ID No.:_) Initiator 3': 5 ' -caggaaacagctatgac-3 '(SEC ID No.:_) The PCR product is cloned in the TOPO vector and sequenced. The polynucleotide sequence is supplied in the ID of SEC #: _, and the encoded polypeptide sequence is provided in SEQ ID No.:_.

EXAMPLE 57 2H7 SCFv VH Ll IS (CSS-S) H K322S CH2 CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region adheres to a mutant IgG connection region, where the second and third cysteines have been changed to serines and the proline has been changed to serine (CSS-S), according to the methods described in example 13. The connection region adheres to a mutated CH2 IgG region and a wild type IgG CH3 region. The K322S mutation in the CH2 region is in a 322 residue, where the lysine has been changed to a serine using an overlapping PCR assay. The region adheres to a igG CH2 mutated region and a wild type CH3 region region. The mutation in the CH2 region is added by overlapping PCR reaction essentially according to example 57, with the vector (CSS-S) H WCH2 WCH3 IgGl pDl8 as a template in the first PCR reaction and different primers in the second PCR reaction that are listed below.

Initiator 5 'overlap: 5' -tccccaccgtccccagcacctgaactcctggggggatcgtcagtcttcctcttccccca aaacc-3 'Initiator 3': 5 '-caggaaacagctatgac-3' (SEC ID: _) The PCR products are cloned into the TOPO vector and sequenced. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 58 2H7 scFWH LllS (SSS-S) H P331S CH2 CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connected to a mutated human IgGl connection region, in where all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in example 5. The connection region adheres to a mutated CH2 IgGl region and a wild type IgG CH3 region. The P331S mutation in the CH2 region where the proline at residue 331 has been changed to a serine, is incorporated using a simple PCR reaction using a template (SSS-S) H WCH2 WCH3 and a cyclic profile of 94C, 30 sec; 55C, 30 sec; 72C, 30 sec, for 37 cycles. Specific primers for reaction are listed below.

Initiator 5 ': 5' ccgtctctgatcaggagcccaaatcttctgacaaaactcacacatccccaccgtcccca gc-3 '(SEC ID No.: _) Initiator 3': 5'-gcagggtgtacacctgtggttctcggggctgccctttggctttggagatggttttctcg atggaggctgggagg-3 '(SEC ID No.: _) The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 59 2H7 scFv VH LllS (CSS-S) H P331S CH2 WCH3 This binding region adheres to a mutant igG connection region, where the second and third cysteines have been changed by serines and the proline has been changed to serine (CSS-S), according to the methods described in example 13 The connection region adheres to a mutated CH2 IgG region and a wild type IgG CH3 region. The P331S mutation in the CH2 region, where the proline at residue 331 has been changed to a serine, is incorporated using a simple PCR region using a pallet (CSS-S) H WCH2 WCH3? Dl8 and a cyclic profile of 94C 30 sec; 55C, 30 sec; 72C, 30 sec, for 37 cycles. Specific primers for reaction are listed below.

Initiator 5 ': 5' ccgtctctgatcaggaccccaaatcttgtgacaaaactcacacatccccaccgtcccca gc-3 '(SEC ID No.: _) Initiator 3': 5'-gcagggtgtacacctgtggttctcggggctgccctttggctttggagatggttttctcg atggaggctgggagg-3 '(SEC ID No.:_) The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID NO: 1.

EXAMPLE 60 2H7 scFv VH LllS (SSS-S) H T256N CH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connected to a mutated human IgG connection region, where all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in example 5. The connection region adheres to a region CH2 IgG mutated and a wild type IgG CH3 region. The T256N mutation in the CH2 region, the threonine in the 256 residue has been changed to an asparagine, which uses the overlapping PCR methods described in example 56. The specific primers are listed below.

Initiators for the first PCR reaction: Initiator 5 ': 5' -ttcctcttccccccaaaacccaaggacaccctcatgatctcccggaaccctgaggtcac -3 '(SEC ID No.: _) Initiator 3: 5' -ggacagtgggagtggcacc-3 '(SEC ID No.: __) The PCR product is cloned in the TOPO vector and sequenced.

This product is used as the template in the second PCR reaction. The primers for the second PCR reaction: Initiator 5 ': • 5' -ccgtctctgatcaggagcccaaatcttctgacaaaactcacacatccccaccgtcccca gc-3 '(SEC ID No._) Overlapping Initiator 5': 5 '-tccccaccgtccccagcacctgaggggatcgtcagtcttcctcttcccccc aaaacc-3' (SEC ID No .: _) Initiator 3: 5 '- caggaaacagctatgac-3 '(SEC ID No.: _) The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is provided in SEQ ID NO: 1.

EXAMPLE 61 2H7 scFv VH LllS (SSS-S) H RTPE / QNAK (255-258) CH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connected to a mutated human igG connection region, where all cysteines and a proline have been changed by serines (SSS-S), according to the methods described in example 5. The connection region adheres to a mutated CH2 IgG region and a wild type IgG CH3 region. The RTPE / QNAK mutation in the CH2 region, where residues 255-258 have mutated from arginine, threonine, proline, glutamic acid to glutamine, asparagine, alanine and lysine respectively using the overlapping PCR reactions described in Example 56. Specific initiators are listed below.

Initiators for the first PCR reaction: Initiator 5 ': 5' -ttcctcttccccccaaaacccaaggacaccctcatgatctcccagaacgctaaggtcac atgc-3 '(SEC ID No._) Initiator 3 ': 5' -ggacagtgggagtggcacc-3 '(SEC ID No.:_) The PCR product is cloned into the TOPO vector, sequenced and used as a template for the second PCR reaction. The primers for the second PCR reaction: Initiator 5 ': 5' -ccgtctctgatcaggagcccaaatcttctgacaaaactcacacatccccaccgtcccca gc-3 '(SEC ID No.: _) Overlapping Initiator 5': 5'-tccccaccgtccccagcacctgaggggatcgtcagtcttcctcttcccccc aaaacc-3 '(SEC ID No.:_) Initiator 3': 5 '- caggaaacagctatgac-3 '(SEC ID No ..: _) The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 62 2H7 scFv VH LllS (SSS-S) H K290Q CH2 CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation point in the amino acid residue 11 in the variable region of heavy chain, wherein the leucine has been changed to a serine, as described in example 33. This binding region is connected to a mutated human IgGl connection region, where all the cysteines and one proline have been changed by serines (SSS -S), according to the methods described in example 5. The connection region adheres to a mutated CH2 IgGl region and a wild type IgGl CH3 region. The K290Q mutation in the CH2 region, where the lysine at residue 290 has been changed to glutamine, which uses single PCR reactions according to the methods described in example 58. The specific primers used in this reaction are listed below .

Initiator 5 ': 5'-ccgtctctgatcaggagcccaaatcttctgacaaaactcacacatccccaccgtcccca gc-3' (SEC ID No.:_) Initiator 3 ': 5' -gctcccgcggctgtgtcttggc-3 '(SEC ID No.: _) The PCR products are cloned into the TOPO vector and sequenced. The polynucleotide sequence is supplied in SEQ ID No.:_, and the encoded polypeptide sequence is provided in SEQ ID No.:_.

EXAMPLE 63 2H7 SCFv VH LllS (SSS-S) H A339P CH2 CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine, as described in example 33. This binding region is connected to a mutated human IgGl connection region, where all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in example 5. The connection region adheres to a mutated human CH2 IgGl region and a human wild type igGl CH3 region. The A339P mutation in the CH2 region, wherein the alanine at residue 339 has been changed to a proline, which uses a simple PCR reaction according to the methods described in example 58. The specific primers used in this reaction are listed below .

Initiator 5 ': 'ccgtctctgatcaggagcccaaatcttctgacaaaactcacacat ccccaccgtccccagc-3 * (SEC ID NO) initiator 3': 5 '-ggaggtgggcagggtgtacacctgtggttctcggggctgccct ttgggtttggagatgg-3' (SEC ID NO) The PCR products were cloned into TOPO and sequenced. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 64 G28-1 SCFv (SSS-S) H WCH2 WCH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) made in accordance with the methods described in Example 35. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is connected to a wild type human IgGl CH2 and CH3 region as described in Example 1. This construction has been previously referred to as G28-1-MHWTG1C and G28-1 scFv Ig, both having the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 65 G28-1 SCFv IGAH CH2 CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) made in accordance with the methods described in Example 35. This binding region is connected to a human IgA binding region and the IgG CH2 constant regions. and wild type human CH3 as described in Example 5. This construction has previously been referred to as: G28-l-IgAHWTGlC. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 66 G28-1 scFv VH LllS (SSS-S) H CH2 CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region is connected to a mutated human IgG1 connection region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This The connecting region is adhered to a human wild-type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in DE ID. SEC NO: _.

EXAMPLE 67 G28-1 SCFv VH LllS (CSS-S) H CH2 CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region is adheres to a mutant human IgGl connection region, wherein the second and third cysteines have been changed by serines and the proline has been changed by serine (CSS-S), according to the methods described in Example 13. This region of The linkage is adhered to a human wild-type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: 1. : _.

EXAMPLE 68 G28-1 SCFv VH LllS (CSC-S) H CH2 WCH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region is adhered to a mutant human IgGl connection region where the second cysteine and proline have been changed by serines (CSC-S), according to the methods described in Example 32. This connection region adheres to a human-like wild type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 69 G28-1 SCFv VH LllS (SSC-P) H CH2 CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region adheres to a mutant human IgG1 connection region wherein the first and second cysteines have been changed by serines (SSC-P), according to the methods described in Example 13. This The connecting region is connected to a human wild-type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the DE ID. SEC N0: _.

EXAMPLE 70 CTLA4 (SSS-S) H P238SCH2 CH3 This construct has the extracellular CTLA-4 binding region as described in Example 14. This binding region is connected to a human-mutated IgG1 binding region where all cysteines and a proline have been changed to serine (SSS-). S) according to the methods described in Example 5. This pivot region adheres to the mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced using a PCR assay. PCR reactions are developed using randomly initiated cDNA prepared from human tonsil B cell RNA. The PCR amplifications use an amplification profile of 94C 4 min; [94C 1 min; 55C 1 min; 72C 1 min; for 30 cycles followed by a final extension stage for 6 minutes at 72C. The PCR fragments were cloned TOPO and clones with approximately 800 bp EcoRI inserts were sequenced as described in Example 1. The primers used for the PCR are listed below: Initiator 5 ': 5' -gttgttgatcaggagcccaaatcttctgacaaaactcacaca tctccaccgtccccagcacctgaactcctgggtggaccgtcagtcttcc-3 '(SEC ID NO) Initiator 3 ': 5' gttgtttctagattatcatttacccggagacag-3 '(SEC ID NO) This construction has previously been referred to as CTLA-4 IgG MTH (SSS) MTCH2WTCH3, which has the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 71 CTLA4 (CCC-P) WH CH2 CH3 This construct has a binding region -CTLA-4 as described in Example 14. This binding region is adhered to a wild-type human IgGl connection region (CCC-P) as described in Example 1. This region of The connection is connected to a human wild-type IgGl CH2 and CH3 region as described in Example 1. This construction has previously been referred to as CTL-4 WTH IgG (CCC) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 72 FC2-2 SCFv (SSS-S) H WCH2 WCH3 This construct has a FC2-2 single chain Fv (anti-CDl6) made in accordance with the methods described in Example 46. This binding region is connected to a mutated human IgGI connection region where all the cysteines and a proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region is connected to a wild-type human IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 73 FC2-2 SCFv VHLllS (SSS-S) H WCH2 WCH3 This construct has a single chain Fv FC2-2 (anti-CDl6) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 46. This binding region is connected to a mutated human IgG1 connection region where all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region is connected to a human wild-type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the ID. FROM SEC NO: _.

EXAMPLE 74 UCHL- SCFv (SSS-S) H WCH2 WCH3 This construct has a single chain Fv UCHL-1 (anti-CD45RO) made in accordance with the methods described in Example 48. This binding region is connected to a mutated human IgGI connection region where all the cysteines and a proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region is connected to a wild-type human IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is supplied in the ID DE SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 75 UCHL-1 SCF VHLllS (SSS-S) H WCH2 WCH3 This construct has a single chain Fv UCHL-1 (anti-CD45RO) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 48. This binding region is connected to a mutated human IgGl connection region where all the cysteines and a proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region it is connected to a human wild-type IgGl CH2 and CH3 region as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the S? C ID. DO NOT:_.

EXAMPLE 76 5B9 SCFv (SSS-S) H WCH2 WCH3 This construct has a single chain Fv 5B9 (anti-CDl37) made in accordance with the methods described in Example 47. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region is connected to a human-type wild type IgGl CH2 and CH3 constant region as described in Example 1. This construction has previously been referred to as 5B9 scFv MTH IgG (SSS) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

EXAMPLE 77 5B9 SCFv VHLllS (SSS-S) H WCH2 WCH3 This construct has a single chain Fv 5B9 (anti-CDl37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 47 This junction region connects with a mutated human IgGl connection region wherein all the cysteines and one proline have been changed by serines (SSS-S), according to the methods described in Example 5. This connection region is connected to a constant region IgGl CH2 and wild-type human CH3 as described in Example 1. This polynucleotide sequence is supplied in the S? C ID NO: _, and the encoded polypeptide sequence is supplied in ID D? S? C NO: _.

EXAMPLE 78 2H7 SCFv (SSS-S) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human IgGI binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is connected to a constant region IgGl CH2 and CH3 wild type as described in Example 1. This construction has been previously referred to as 2H7-MHWTGlC, CytoxB- (MHWTGlC) -Ig, anti-CD20 scFv IgG MTH (SSS) WTCH2CH3, CytoxB-MHWTGlC, 2H7 scFv-human IgGl wild type pivot- CH2-CH3, and 2H7 scFv IgG MTH (SSS) WTCH2CH3, which all have the same sequence as the previous construction. The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO: _.

EXAMPLE 79 2H7 scFv (SSS-S) H P238SCH2 WCH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline they have been changed to serines (SSS-S) according to the methods described in Example 5. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed to serines ( SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70.? construction has previously been referred to as 2H7 scFv MTH IgG (SSS) MTCH2WTCH3, anti-CD20 SCFv MTH IgG (SSS) MTCH2CH3, and CytoxB-MHMGlC which all have the same sequence as the previous construct. The polynucleotide sequence is provided in the ID DB S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO: _.

EXAMPLE 80 2H7 SCFv IgAH WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a human IgA binding region and to human-like wild type IgGl CH2 and CH3 regions. as described in Example 5. This construction has previously been referred to as 2H7 scFv IgAH IgG WTCH2CH3, 2H7 scFv IgA pivot-IgGl CH2-CH3, and CytoxB-IgAHWTHGlC, which all have the same sequence as the above construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

EXAMPLE 81 2H7 SCFv IgAH WIgACH2 T4CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a human IgA binding region as described in Example 5 This connection region adheres to a human igA constant region consisting of a wild type CH2 region and a mutated CH3 region where there is a truncation of 4 amino acid residues before the 3 'stop codon as described in the Example 13. This construction has previously been referred to as 2H7 scFv IgAH IgAT4, which has the same sequence as the previous construction. The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? SEC NO: _.

? JEMPLO 82 2H7 SCFv IGAH WIGACH2 WCH3 + CADENAJ This construction has a single strand Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is adhered to a wild type human IgA binding region as described in Example 5. This The binding region is adhered to a human wild-type IgA CH2 and CH3 constant region according to the methods described in Example 13. The constant region adheres to a J-chain region as described in Example 13. The sequence of Polynucleotide is supplied in ID D? S? C NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 83 2H7 SCFv (CCC-P) WH WCH2 WCH3 This construct has a binding region Fv of 'single chain 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a wild type human IgGl binding region (CCC-P) as described. in Example 1. This connection region adheres to the human IgGl CH2 and CH3 constant regions wild type as described in Example 1. This construction has previously been referred to as 2H7 scFv Ig WTH (CCC) WTCH2CH3, 2H7 scFv IgG WTH WTCH2CH3, and 2H7 scFv-lg, both of which have the same sequence as the previous construct. The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is provided in the SE ID NO: _.

? JEMPLO 84 2H7 scFv (SSS-S) H WCH2 F405YCH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to a wild type human IgGl CH2 and a mutated human CH3 IgGl region. The F405Y mutation, wherein the phenylalanine at residue 405 has been changed to a tyrosine, is introduced according to the methods described in Example 21. This construct has previously been referred to as 2H7 scFv MTH WTCH2 MTCH3 Y405, which has the same sequence as the previous construction. The polynucleotide sequence is provided in the DE ID SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 85 2H7 SCFv (SSS-S) H WCH2 F405ACH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human igGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to a wild type human IgGl CH2 and a mutated human CH3 IgGl region. The F405A mutation, wherein the phenylalanine at residue 405 has been changed to an alanine, is introduced according to the methods described in Example 21. This construction has previously been referred to as 2H7 scFv MTH WTCH2 MTCH3 A405, which has the same sequence as the previous construction. The polynucleotide sequence is supplied in the SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

EXAMPLE 86 2H7 scFv (SSS-S) H WCH2 Y407ACH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This binding region is adhered to a wild type human IgGl CH2 and a mutated human CH3 IgGl region. The Y407A mutation, where the tyrosine at residue 407 has been changed to an alanine, is introduced according to the methods described in example 21. This construction has previously been referred to as MTH scThT WTCH2 MTCH3 A407, which has the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in ID D? SEC NO: _.

EXAMPLE 87 2H7 SCFv (SSS-S) HWCH2 F405A, Y407ACH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human igGl connection region where all the cysteine and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to a wild type human IgGl CH2 and a mutated human CH3 IgGl region. The mutation F405A and Y407A, wherein the phenylalanine at residue 405 has been changed to an alanine and the tyrosine at residue 407 has been changed to an alanine, is introduced according to the methods described in Example 21. This construction has previously referred to as MTH WTCH2 scfv MTCH3 A405A407, which has the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 88 2H7 scFv (CSS-S) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1.

This binding region adheres to a mutated human IgGl connection region, where the second and third cysteines have been changed by serines and the proline has been changed by serine (CSS-S), according to the methods described in Example 13. This connection region adheres to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. This construction has previously been referred to as 2H7 scFv MTH (CSS) 'WTCH2CH3, which has the same sequence as the previous construction. The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

Example 89 2H7 scFv (SCS-S) H WCH2 WCH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a mutant human IgGl binding region, where the first and third cysteines have been changed for serines and proline has been changed to serine (SCS-S), according to the methods described in Example 13. This region of connection is adheres to igGl constant CH2 and CH3-human wild type regions as described in Example 1. This construction has previously been referred to as 2H7 scFv MTH IgG (SCS) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is supplied in the D ID? S? C N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 90 2H7 SCFv (SSC-P) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a mutant human IgGl connection region, wherein the first and second cysteines are have been changed by serines (SSC-P), according to the methods described in Example 13. This connection region is adhered to the wild-type IgGl CH2 and CH3 constant regions as described in Example 1. This construction it has previously been referred to as 2H7 scFv MTH (SSC) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is supplied in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 91 2H7 SCFv (CSC-S) H WCH2 WCH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a mutant human IgGl binding region, where the second cysteine and proline are have been changed to serine (CSC-S), according to the methods described in Example 32. This connection region adheres to the wild type human IgGl CH2 and CH3 constant regions as described in Example 1.? sta construction has previously been referred to as 2H7 scFv MTH (CSC) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is supplied in the SEQ ID NO: _, and the encoded polypeptide sequence is provided in the D ID? SEC NO: _.

EXAMPLE 92 2H7 SCFv (CCS-P) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a mutant human IgGl binding region, wherein the third cysteine has been changed to a serine (CCS-P), according to the methods described in Example 22. This connection region is adhered to the wild-type IgGl CH2 and CH3 constant regions as described in Example 1. This construction has been previously referred to as 2H7 s'cFv MTH (CCS) WTCH2CH3, which has the same sequence as the previous construction. The polynucleotide sequence is provided in the SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 93 2H7 SCFv (SCC-P) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to a mutant human IgGl binding region, wherein the first cysteine has been changed to a serine (SCC-P), according to the methods described in Example 32. This connection region is adheres to the constant human IgGl CH2 and CH3 constant regions as described in Example 1. This construction has previously been referred to as 2H7 scFv MTH (SCC) WTCH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? JEMPLO 94 2H7 SCFv VH LllS (SSS-S) H WCH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 33. This binding region is connected to a mutated human IgGI connection region, where all the cysteines and a proline have been changed to serine (SSS-S), according to the methods described in Example 5. This connection region adheres to human IgGl CH2 and CH3 constant regions wild type as described in Example 1. This construction has previously been referred to as 2H7 scFv VHllSER IgG MTH (SSS) WTCH2CH3 and 2H7 scFv VHSERll WTH WTCH2CH3, which have the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 95 2H7 SCFv VH LllS (CSS-S) H WCH2 WCH3 This construction has an Fv junction region of. single chain 2H7 (anti-CD20) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 33. This binding region is adheres to a mutant human IgGl connection region, wherein the second and third cysteines have been changed to serine and the proline has been changed to serine (CSS-S), according to the methods described in Example 13. This region connection is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. The polynucleotide sequence is supplied in the ID D? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? SEC NO:.

EXAMPLE 96 G28-1 SCFv VH LllS (SCS-S) H WCH2 WCH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine like is described in Example 35. This binding region adheres to a mutant human IgGl connection region, wherein the first and third cysteines have been changed by serines and the proline has been changed to serine (SCS-S), according to the methods described in Example 13. This connection region adheres to the human wild type igGl CH2 and CH3 constant regions as described in Example 1. The polynucleotide sequence is supplied in the ID D? S? C NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 97 G28-1 SCFv VH LllS (CCS-P) H WCH2 WCH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region adheres to a mutant human IgGl connection region, where the third cysteine has been changed to a serine (CCS-P), according to the methods described in the Example 22. This binding region adheres to the human wild type IgGl CH2 and CH3 constant regions as described in Example 1. The polynucleotide sequence is supplied in the SEQ ID NO: _, and the encoded polypeptide sequence is supplied in SEC ID NO: _.

EXAMPLE 98 G28-1 SCFv VH LllS (SCC-P) H WCH2 WCH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region adheres to a mutant human IgGl connection region, in wherein the first cysteine has been changed to a serine (SCC-P), according to the methods described in Example 32. This connecting region is adhered to the human wild type IgGl CH2 and CH3 constant regions as described in Example 1. The polynucleotide sequence is supplied in ID D? SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 99 G28-1 SCFv VH LllS MIGE CH2 CH3 CH4 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine like is described in Example 35. This binding region is adhered to an IgE region CH2 CH3 and CH4 of wild-type mouse using the methods described in Example 39. The polynucleotide sequence is provided in the ID DE S? C N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

? J? MPLO 100 G28-1 SCFv VH LllS MIGAH WIGACH2 T4CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine like is described in Example 35. This binding region adheres to a mouse IgA-binding region as described in Example 39. This connection region adheres to a mouse IgA constant region consisting of a CH2-type region. wild type and a mutated CH3 region where there is a truncation of 4 amino acids in residues as described in Example 39. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is supplied in the ID. D? SEC NO: _.

EXAMPLE 101 G28-1 SCFv VH LllS HIG? CH2 CH3 CH4 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation point in the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 35. This binding region adheres to a constant region Ig? human wild type containing CH2, CH3 and CH4 as described in Example 38. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in ID D? S? C N0: _.

? JEMPLO 102 G28-1 SCFv VH LllS HIGAH WIGACH2 T4CH3 This construct has a single chain Fv binding region G28-1 (anti-CD37) with a mutation site at amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine like is described in Example 35. This binding region is adhered to a human IgA binding region as described in Example 5. This connection region adheres to a human IgA constant region consisting of a wild-type CH2 region and a CH3 mutated region where there is a truncation of 4 amino acid residues before the 3 'stop codon as described in Example 13.

The polynucleotide sequence is supplied in the D ID? S? C N0: _, and the encoded polypeptide sequence is provided in the ID? S? C N0: _.

EXAMPLE 103 HD37 SCFv IGAH WCH2 WCH3 HD37 scFv was cloned from HD37 hybridoma using the Novagen-Ig family primer sets, cloning and sequencing TOPO and tissue PCR assay. For the initial PCR reactions before weaving the TOPO clone templates HD37 VH C-1 and HD37 KVL B-9 were used at 1: 100 with an amplification profile of 94C 30 sec; 55C, 30 sec; 72C, 30 seconds for 25 cycles. To supply templates for the secondary SBWING PCR reactions, the primary reaction products were QIAQUICK purified gel, and the eluates diluted 50 times. VL and VH overlapping templates of one microliter are added to the PCR reactions with the following amplification profile: 94C, 60 sec; SSC, 60 sec; 72C, 60 sec; for 30 cycles. After two cycles, the machine was paused, and the flanking 5'VL and 3'VH primers were added to the reactions at 25 pmol each, and the PCR reactions were they summarized. The PCR products were checked on a gel for the presence of a 750-800 bp fragment, and the products of the QIAQUICK reactions purified and digested with the restriction enzymes appropriate for insertion into the pDl8 Ig expression vectors.

PCR of the VL domain with native leader peptide and part of the glyser linker: Initiator 5 ': 5' -gttgttaagettgccgccatggagacagacacactcct getatgg-3 '(SEC ID NO) Initiator 3': 'gccacccgacccaccaccgcccgagccaccgccacctttgattt ccagcttggtgcctcc-3' (SEC ID NO) PCR of the VL domain without leader peptide (Site Salí) and part of the glyser linker: Initiator 5 ': 5' -gttgttgtcgacattgtgctgacccaatctcca-3 '(SEC ID NO) Initiator 3': 5 '-gccacccgacccaccaccgcccgagccaccgccacctttgatt tccagcttggtgcctcc-3' (SEC ID NO) The VH domain PCR with part of the glyser linker and Bcll site for tail fusion -Ig.

Initiator 5 ': 5' -tcgggcggtggtgggtcgggtggcggcggatcgtcacaggttca gctgcagcagtctgg-3 '(ID of SEC NO) Initiator 3': 5 '-tcagtgctgatcagaggagacggtgactgaggttccttg-3' (ID OF S? C NO) This binding region is connected to a wild-type human IgA connection region and to human-like wild type IgG CH2 and CH3 constant regions as described in Example 5. This connection region adheres to human type IgGl CH2 and CH3 constant regions wild type as described in Example 1. This construction has previously been referred to as HD37 scFv-IgAHWTGlC and HD37-IgAHWTGlC, which have the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 104 HD37 SCFV (SSS-S) H WCH2 WCH3 This construction has a single chain HD37 Fv as described in Example 103. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to with the methods described in Example 5. This connection region adheres to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. This construction has previously been referred to as HD37-MHWTGlC and HD37 scFv-IgMHWTGlC, which have the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 105 HD37 scFvVH LllS (SSS-S) H WCH2 WCH3 This construct has a single chain HD37 Fv with a mutation in the heavy chain variable region - at amino acid residue 11, where the leucine has been changed to serine according to the methods described in Example 50. This binding region is connected to a mutated human IgGl connection region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This region of connection is adhered to the IgGl CH2 and CH3 constant wild-type human regions as described in Example 1. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO. DO NOT:_.

EXAMPLE 106 L6 SCFv IGAH WCH2 WCH3 The L6 scFv was cloned from the L6 hybridoma (I Hellstrom) using the tail anchor method described in the Tissue Antigens Paper of 1996. The PCR profile was 94C, 1 min; 50C, 2 min; 72C, 2 min; for 35 cycles. A consensus sequence was obtained for the VL and VH regions from at least 4 TOPO clones, the primers were ordered for the PCR reactions before the S? WING PCR reactions as follows: For the initial PCR reactions before sewing, the templates clones TOPO L6VK and L6VH were used at 1: 100 with an amplification profile of 94C 30 sec; 55C, 30 sec; 72C, 30 seconds for 25 cycles. To provide templates for secondary SEWING PCR reactions, the primary reaction products were purified gel, QIAQUICK purified, and the eluates diluted 50 times. One microliter was added to each overlay template VL and VH for PCR reactions with the following amplification profile: 94C, 60 sec; 55C, 60 sec; 72C, 60 sec; for 30 cycles. After two cycles, the machine was paused, and the 5'VL and 3'VH primers were added to the reactions at 25 pmol each, and the PCR reactions were resumed. The PCR products were checked on a gel for the presence of a 750-800 bp fragment, and the QIAQUICK reaction products purified and digested with the appropriate reaction enzymes for insertion into the pDl8 Ig expression vectors.

The VL domain PCR with the native leader peptide and part of the glyser linker: L6VLHindIII: 5 '-gttgttaagcttgccgccatggattttcaagtgcagattttcagc ttc-3' (SEQ ID NO) L6VLLK3: 5 '-gccacccgacccaccaccgcccgagccaccgccaccagagagctcttt cagctccagcttggt-3' (ID D? SEC NO) VL domain PCR without leader peptide (SaLI site) and part of the glyser linker: Initiator 5 ': 5' -gttgttgtcgacattgttcttcccagtctccagcaat cctgtctg-3 '(ID of S? C NO) Initiator 3': 5 '-gccacccgacccaccaccgcccgagccaccgccaccaga gagctctttcagctccagcttggt-3' ( ID D? S? C NO) VH domain PCR with part of the glyser linker and the Bcll site for Ig tail fusion. ': 5'-tcgggcggtggtgggtcgggtggcggcggatctctgcagatccagttggtgca gtct-3' (ID DB SEC NO) 3 'Bel: 5' -tcagtgctgatcagaggagactgtgagagtggtgccttg-3 (ID OF S? C NO) This binding region is connected to a human IgA connection region and human wild type IgGl CH2 and CH3 constant regions as described in Example 5 .. This region of connection is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. This construction has been previously referred to as L6 scFv-IgAHWTGlC, having the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 107 L6 SCFv VHLllS (SSS-S) H WCH2 WCH3 This construct has a single L6 Fv chain with a mutation in the heavy chain variable region at amino acid residue 11, where the leucine has been changed by serine according to the methods described in Example 49. This binding region is connects to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the constant regions IgGl CH2 and wild type human CH3 as described in Example 1. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? SEC N0: _.

? JEMPLO 108 2H7 SCFv-FLAME IGG1 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to CH2 and CH3 regions, pivot called IgGl according to the methods described in? Example 10. The polynucleotide sequence is supplied in ID D? SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 109 2H7 SCFv-FLAME IGG2 This construction has a binding region Fv of single chain 2H7 (anti-CD20) as described in Example 1. This binding region adheres to CH2 and CH3 regions, pivot called IgG2 according to the methods described in Example 10. The polynucleotide sequence is supplied in the ID of S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? J? MPLO 110 2H7 SCFv-LLAMA IGG3 This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region adheres to CH2 and CH3 regions, pivot called IgG3 according to the methods described in Example 10. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

? J? MPLO 111 CD16 LOW (? D) (SSS-S) H P238SCH2 WCH3 This construct has the extracellular low affinity CDl6 allele binding domain as described in Example 43. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This region of pivot is adhered to a mutated human CH2 IgGl region and to a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The polynucleotide sequence is provided in SEQ ID NO: _, and the sequence of encoded polypeptide is provided in SEQ ID NO: _.

EXAMPLE 112 CD16-9 HIGH (ED) (SSS-S) H P238SCH2 WCH3 This construct has the extracellular high affinity CDl6 allele binding domain as described in Example 43. This binding region is connected to a mutated human IgGl linkage region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and to a human CH3 IgGl region of the silvestr type. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The polynucleotide sequence is supplied in the ID of S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? JEMPLO 113 2el2 scFv (SSS-S) H P238SCH2 WCH3- CD8OTM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGl binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to a mutated human CH 2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, where a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a cytoplasmic and human CD80 transmembrane tail region (hCD80 TM). / CT). The hCDdO TM / CT was cloned using randomized initialized cDNA derived from the BJAB cell line according to the methods described in Example 12. This TM / CT region was adhered to an Ig CH3 region with an open reading frame (ORF). ). The reading table versions Open of the scFvIg constructs of interest were created by replacing the soluble versions of each tail -Ig with ORF (open reading frame versions) of these queues. PCR primers were designed for existing clones of soluble Ig queues that remove the stop codon and add one or more restriction sites to the 3 'end of the new Ig-cassette. The desired cytoplasmic and transmembrane tail sequences can then be subcloned downstream of these new Ig-cassettes. Each construct uses the existing available 5 'BCLI oligonucleotide used in the amplification of the soluble version of the tails for the PCR reactions. The 3 'oligonucleotides replace the stop codon without the frame restriction sites fused to the coding region for the protein domains involved in the regulation of apoptosis.

PCR amplifications were carried out with 25 pmol of each primer, standard PCR reagents, and varying volumes of cloned domains or cDNA obtained from PBMC, spleen, or thymus RNA. The reactions used a cyclization profile of 94 C, 60 sec; 55C, 60 sec, 72C, .2 min, for 35 cycles. The primers for the IgG ORF are listed below.

Initiator 5 ': 5' -gttgtagatcaggagcccaaatcttctgacaaaactcac acatctccaccgtccccagcacctgaactcctgggggaccgtcagtcttcc-3 '(SEC ID NO) Initiator 3': 5 '-gttgttttcgaaggatccgctttacccgggagcagggagaggct cttctgcgtgtagtg-3' (ID D? S? C NO) The polynucleotide sequence is supplied in the D ID? SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 114 10A8 SCFv (SSS-S) H P238SCH2 WCH3-HCD8OTM / CT This construct has a single chain Fv binding region 10A8 (anti-CD2152) described in Example 12. This binding region is connected to a mutated human IgGI binding region where all the cysteines and proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, where a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. This CH3 region adheres to an 'hCD80 TM / CT according to the methods described in Example 113. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 115 40.2.220 SCFv (SSS-S) H P238SCH2 WCH3-HCD80TM / CT This construction has an Fv junction region of. single chain 40.2.220 (anti-CD40) described therein example 12. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serinae (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, where a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. This CH3 region is adhered to an hCD80 TM / CT according to the methods described in Example 113. The polynucleotide sequence is provided in SEQ ID NO: 1, and the encoded polypeptide sequence is supplied in ID D? S? C N0: _.

EXAMPLE 116 2H7 scFv (SSS-S) H P238SCH2 WCH3-HCD80TM / CT This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline they have been changed to serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. This CH3 region adheres to an hCD80 TM / CT according to the methods described in Example 113. This construction was previously referred to as: The polynucleotide sequence is supplied in the ID DE S? C N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

EXAMPLE 117 G19-4 scFv (SSS-S) H P238SCH2 WCH3-HCD80TM / CT This construct has a single chain Fv binding region G19 (anti-CD3) described in Example 29. This binding region is connected to a mutated human IgG1 binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. This CH3 region adheres to a hCD80 TM / CT according to the methods described. in Example 113. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 118 2E12 SCFv (SSS-S) H WCH2 WCH3-HCD80TM / CT This construct has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGI binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. This CH3 region adheres to a hCD80 TM / CT according to the methods described in Example 113. This construction has previously been referred to as 2el2 scFv IgG WTH WHTCH3CH2-CD80, which has the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

? J? MPLO 119 2? 12 SCFv IGAH IGACH2 T4CH3-HCD8OTM / CT This construction has a single chain Fv junction region 2el2 (anti-CD28) described in Example 12. This The binding region adheres to a human IgA binding region as described in Example 5. This connection region adheres to a human IgA constant region consisting of a mutated CH3 region and a wild type CH2 region wherein there is a trituration of the four amino acid residues for the 3 'stop codon as described in Example 13. This CH3 region is adhered to an hCD80 TM / CT according to the methods described in Example 113. The specific primers used- Create an IgA ORF are listed below.

Initiator 5 ': 5'-gttgttgatcagccagttccctcaactccacctacc-3' (SEC ID NO) Initiator 3 ': 5' -gttgttttcgaaggatccgcgtccacctccgccatgacaacaga (SEC ID NO) The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 120 2? 12 SCFv IG? CH2CH3CH4-HCD80TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This region adheres to the human IgE constant region containing CH2, CH3 and CH4 as described in Example 38. This region CH4 adheres to an hCD80 TM / CT essentially in accordance with the methods described in Example 113. The specific primers used to create an IgE ORF are listed below.

Initiator 5 ': 5' -gttgttgatcacgtctgctccagggacttcacc-3 '(ID D? S? C NO) Initiator 3': 5 '-gttgttttcgaaggatccgctttaccagatttacagacaccg ctcgctg-3' (ID D? S? C NO) The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 121 2E12 SCF (SSS-S) H P238SCH2 WCH3-MFADD-TM / CT This construction has a single chain Fv junction region 2? 12 (anti-CD28) described in Example 12. This binding region is connected to a mutated human igGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region is adhered to a human IgGl CH2 region mutated and to a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a cytoplasmic and transmembrane region of mouse FADD (mFADD ™ / CT). This region is cloned using essentially the same methods described in Example 113. The domain was PCR amplified from randomly initialized cDNA of mouse spleen RNA. The specific initiators are listed below.

Initiator 5 ': 5' -gttgtggatccttcgaacccattcotggtgctgctgcac tcgctg-3 '(SEC ID NO) Initiator 3': 5 '-gttgttatcgatctcgagtcagggtgtttctgaggaagac acagt-3' (SEC ID NO) The specific primers used to create a igG mouse ORF are listed below.

Initiator 5 ': 5' -gttgtagatctggagcccagagggcccacaatcaagccctctcc tccaagcaaaagccca-3 '(SEC ID NO Initiator 3': 5 '-gttgttttcgaaggatccgctttacccggagtccgggagaag-3' (SEC ID NO) The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? J? MPLO 122 2? 12 SCFv (SSS-S) H WCH2 WCH3-MFADD-TM / CT This construct has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGI binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. The region CH3 adheres to an mFADD TM / TM region according to the methods described in Example 113 and 121. The polynucleotide sequence is supplied in ID D? SEC N0: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

? J? MPLO 123 2? 12 SCFv (SSS-S) H WCH2 WCH3-MCASP3-TM / CT This construction has a single chain Fv junction region 2el2 (anti-CD28) described in Example 12. This junction region is connected to a mutated human IgGl link region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to human wild-type IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region adheres to a specific region. of cytoplasmic tail and transmembrane casp3 of mouse according to the methods described in Examples 113 and 121. The specific primers used to isolate the mcasp3 TM / CT region are listed below.

Initiator 5 ': 5' -gttgttggatccttcgaacatggagaacaacaaaacctcagt ggattca-3 '(ID of SEC NO) Initiator 3': 5 '-gttgttatcgatctcgagctagtgataaaagtacagttc tttcgt-3' (ID OF S? C NO) The polynucleotide sequence is supplied in the D ID? SEC NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO: _.

EXAMPLE 124 2E12 scFv (SSS-S) H P238SCH2 WCH3-MCASP3-TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, where a proline at residue 238 is changed to a serine is introduced according to the methods described in Example 70. The CH3 region is connected to a mcasp3 region.

TM / CT according to the methods described in Examples 113, 121 and 123. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? J? MPLO 125 2? 12 SCFv (SSS-S) H WCH2 WCH3MCASP8-TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the wild type IgGl CH2 and CH3 constant regions as described in Example 1. The region CH3 adheres to a region of cytoplasmic tail and transmembrane mouse casp8 (mcaspd TM / CT) essentially in accordance with the methods described in Example 113 and 121. The specific primers used to clone the mcaspd TM / CT region are listed ahead.

Initiator 5 ': 5' -gttgtttcgaacatggatttccagagttgtctttatgctatt gctg-3 '(SEC ID NO) initiator 3': 5 '-gttgttatcgatctcgagtcattagggagggaagaagagctt Cttccg-3' (SEC ID NO) The polynucleotide sequence is provided in the ID of S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? SEC NO:.

? J? MPLO 126 2? 12 scFv (SSS-S) H P238SCH2 WCH3-MCASP8-TM / CT This construct has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGI binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine is introduced according to the methods described in Example 70. The CH3 region adheres to a mcaspd region TM / CT according to the methods described in Examples 113, 121 and 125. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? JEMPLO 127 2? 12 SCFv (SSS-S) H WCH2 WCH3-HCASP3-TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the wild type IgGl CH2 and CH3 constant regions as described in Example 1. The region CH3 adhered to a region of cytoplasmic tail and transmembrane human casp3 (hcasp3 TM / CT) essentially according to the methods described in Example 1Í3. The specific primers used to clone the hcasp3 TM / CT region are listed below. initiator 5 ': 5' -gttgtggatccttcgaacatggagaacactgaaaact cagtggat-3 '(ID D? S? C NO) initiator 3': 5 '-gttgttatogatctogagttagtgataaaaatagagttct tttgtgag-S (ID D? S? C NO) The polynucleotide sequence is supplied in the D ID? SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

EXAMPLE 128 2E12 SCFv (SSS-S) H P238SCH2 WCH3-HCASP3-TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine is introduced according to the described methods. in? example 70. The CH3 region adheres to a hcasp3 region TM / CT according to the methods described in Examples 113 and 127. The polynucleotide sequence is supplied in ID D? SEC N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 129 2? 12 SCFv (SSS-S) H WCH2 WCH3-HCASP8 - TM / CT This construction has a single chain Fv junction region 2el2 (anti-CD28) described in Example 12. This binding region is connected to a mutated human IgGI binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. The region CH3 adhered to a region of cytoplasmic tail and human casp8 transmembrane (hcaspd TM / CT) essentially in accordance with the methods described in Example 133. The specific primers used to clone the hcaspd TM / CT region are listed below.

Initiator 5 ': 5' -gttgtggatccttcgaacatggacttcagcagaaatcttt atgat-3 '(ID D? S? C NO) initiator 3': 5 '-gttgttatcgatgcatgctcaatcagaagggaagacaagttt ttttct-3' (ID D? S? C NO) The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? J? MPLO 130 2? 12 scFv (SSS-S) H P238SCH2 WCH3-HCASP8-TM / CT This construction has a single chain Fv junction region 2el2 (anti-CD28) described in Example 12. This junction region is connected to a mutated human igGl link region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, where a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a hcaspd region TM / CT according to the methods described in Examples 113 and 129. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? J? MPLO 131 1D8 SCFv (SSS-S) H P238SCH2 WCH3-HCD80TM / CT This construction has a single chain FV binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGI binding region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a hCD80 TM / CT region according to the methods described in Example 113. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the SEQ ID NO:.

? J? MPLO 132 1D8 SCFv (SSS-S) H WCH2 WCH3-HCD8QTM / CT This construction has a single chain Fv binding region lDd (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to the wild-type IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region is adheres to a hCDdO TM / CT region according to the methods described in Example 113. This construct has previously been referred to as 1D8 scFv WTH IgG WTCH2CH3-CD80, which has the same sequence as the previous construct. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? JEMPLO 133 1D8 SCFv-MIGAH WIGA CH2 T4CH3-HCD8OTM / CT This construction has a single chain Fv binding region ID8 (anti-4-lBB) described in Example 25. This binding region adheres to a human IgA binding region as described in Example 5. This region of The linkage is adhered to a mouse IgA constant region consisting of a wild type CH2 region and a mutated CH3 region where there is a truncation of 4 amino acid residues before the 3 'stop codon as described in Example 39. CH3 region can be adhered to a hCD80 TM / CT region according to the methods described in the? 113 examples that use primers that create an IgA ORF.

EXAMPLE 134 1D8 SCFv IG? CH2CH3CH4-HCD80TM / CT This construction has a single chain Fv binding region 1D8 (anti-4-lBB) described in Example 25. This binding region adheres to a human constant IgE region containing CH2, CH3 and CH4 as described in Example 38. The CH4 region is adhered to an hCD80 TM / CT according to the methods described in Examples 113 and 120. The polynucleotide sequence is supplied in the ID.

DE SEC N0: _, and the encoded polypeptide sequence is supplied in ID D? S? C N0: _.

? J? MPLO 135 1D8 SCFv (SSS-S) H P238SCH2 WCH3-MFADD-TM / CT This construction has a single chain Fv binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGI binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to an mFADD TM / TM region according to the methods described in Example 113 and 121. The polynucleotide sequence is supplied in ID D? S? C NO: __, and the encoded polypeptide sequence is supplied in ID D? S? C NO: _.

? J? MPLO 136 1D8 SCFv (SSS-S) H WCH2 WCH3-MFADD-TM / CT This construction has a single chain FV binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGI binding region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the human IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region is adheres to a mFADD TM / TM region according to the methods described in Example 113 and 121. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO: _.

? J? MPLO 137 1D8 SCFv (SSS-S) H WCH2 WCH3-mcasp3-TM / CT This construct has a single chain Fv binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgG1 binding region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the wild-type IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region adheres to a mcasp3 TM / TM region according to the methods described in Example 113, 121 and 123. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in the ID. D? S? C NO: _.

? J? MPLO 138 1D8 SCFv (SSS-S) H P238SCH2 WCH3-MCASP3-TM / CT This construction has a single chain FD binding region iDd (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGl connection region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a human wild type IgGl CH3 region. The P233S mutation, where a proline in residue 233 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a mcasp3 TM / TM region according to the methods described in Example 113, 121 and 123. The polynucleotide sequence is supplied in the ID of S? C N0: _, and the sequence of encoded polypeptide is supplied in ID D? S? C NO: _.

? J? MPLO 139 1D8 scFv (SSS-S) H WCH2 WCH3-MCASP8 - TM / CT This construction has a single chain FD binding region iDd (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGl connection region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region adheres to the wild-type IgGl CH2 and CH3 constant regions as described in Example 1. The region CH3 adheres to a mcaspd TM / TM region according to the methods described in Example 113, 121 and 125. The polynucleotide sequence is supplied in ID D? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO:.

? J? MPLO 140 1D8 SCFv (SSS-S) H P238SCH2 WCH3-MCASP8-TM / CT This construction has a single strand Fv binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgG1 binding region where all the cysteines and one proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to a mutated human CH2 IgGl region and a wild-type human IgGl CH3 region. The P238S mutation,. wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a mcaspd TM / TM region according to the methods described in the example. 113, 121 and 125. The polynucleotide sequence is supplied in ID D? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO: _.

? J? MPLO 141 1D8 SCFv (SSS-S) H WCH2 WCH3-HCASP3 - TM / CT This construction has a single chain Fv binding region ID8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGI binding region where all the cysteines and one proline have been linked. changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region is adhered to a hcasp3 TM / CT region according to the methods described in Example 113, and 127. The polynucleotide sequence is supplied in ID D? S? C NO: _, and the encoded polypeptide sequence is supplied in the D ID? S? C NO: _.

? J? MPLO 142 1D8 SCFv (SSS-S) H P238SCH2 WCH3-HCASP3-TM / CT This construction has a single chain Fv binding region 1D3 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGl binding region where all the cysteines and a proline are have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to the mutated human CH2 IgGl region and to a human wild type IgGl CH3 region. The P233S mutation, wherein a proline at residue 233 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region adheres to a hcasp3TM / CT region according to the methods described in Example 113, and 127. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 143 1D8 SCFv (SSS-S) H WCH2 WCH3-HCASP8 - TM / CT This construct has a single chain Fv binding region lDd (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been linked. changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. The CH3 region is adhered to a hcaspd TM / CT region according to the methods described in Example 113, and 129. The sequence of polynucleotide is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in ID D? SEC N0: _.

EXAMPLE 144 1D8 SCFv (SSS-S) H P238SCH2 WCH3-HCASP8-TM / CT This construction has a single chain Fv binding region 1D8 (anti-4-lBB) described in Example 25. This binding region is connected to a mutated human IgGI binding region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This pivot region adheres to the mutated human CH2 IgGl region and to a human wild type IgGl CH3 region. The P238S mutation, wherein a proline at residue 238 is changed to a serine, is introduced according to the methods described in Example 70. The CH3 region is adhered to a hcasp8 TM / CT according to the methods described in Example 113, and 129. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

EXAMPLE 145 L6 SCFv (SSS-S) H WCH2 WCH3 This construct has a L6 scFv binding domain as described in Example 105. This binding region is connected to a mutated human IgGl connection region where all the cysteines and one proline have been changed by serines (SSS-S ) according to the methods described in Example 5. This connection region is adhered to the wild-type human IgGl CH2 and CH3 constant regions as described in Example 1. This construction has previously been referred to as L6 scFv-IgMHWTGlC , which has the same sequence as the previous construction. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in ID D? SEC NO: _.

? JEMPLO 146 2H7 SCFv CD154 (L2) This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region has adhered to the extracellular domain CD154 according to the methods described in Example 4. The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? JEMPLO 147 2H7 SCFv CD154 (S4) This construction has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region has adhered to the CD154 extracellular domain according to the methods described in Example 4, such as the adhesion methods result in a truncated version compared to the construction described in Example 146. The polynucleotide sequence is supplied in ID D? SEC NO: _, and the encoded polypeptide sequence is supplied in ID D? SEC NO: _.

EXAMPLE 148 CTLA4 IGAH IGACH2CH3 This construction has the extracellular CTLA-4 binding region as described in Example 14. This region of The binding is adhered to a wild-type human IgA binding region as described in Example 5. This binding region adheres to the human wild-type IgA CH2 and CH3 constant regions according to the methods described in Example 13. This region constant adheres to a J chain region as described in Example 13. This construction has previously been referred to as CTLA-4 IgAH IgACH2CH3, which has the same sequence as the previous construct. The polynucleotide sequence is supplied in the SEQ ID NO: _, and the encoded polypeptide sequence is provided in the D ID? S? C NO: _.

? JEMPLO 149 CTLA4 GAH IGACH2 T4CH3 This construct has a binding region, extracellular CTLA-4 as described in Example 14. This binding region adheres to a human IgA binding region as described in Example 5. This connection region is adheres to the human IgA constant region consisting of a wild type CH2 region and a mutated CH3 region where there is a truncation of 4 amino acid residues before the 3 'stop codon as described in Example 13. This construction has previously been referred to as CTLA-4 IgA IgA-T4, which has the same sequence as the previous construct. The polynucleotide sequence is supplied in the D ID? S? C N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 150 2H7 SCFv GAH IGACH2CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region has been adhered to the wild type human IgA binding region as described in? Example 5. This connection region is adhered to a human wild-type IgA CH2 and CH3 constant region according to the methods described in Example 13. The polynucleotide sequence is supplied in ID D? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? SEC NO: _.

? J? MPLO 151 2H7 SCFv IGAH IGAHCH2 T18CH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1. This binding region has been adhered to the human IgA binding region as described in Example 5. This region connection is adhered to a human IgA constant region consisting of a wild type CH2 region and a mutated CH3 region where there is a truncation of 18 amino acid residues before the 3 'stop codon as described in Example 13. The sequence of polynucleotide is provided in SEQ ID NO:, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 152 2H7-40.2.220 SCFv (SSS-S) H WCH2 WCH3 A bispecific fusion protein is constructed between 2H7 scFv (anti-CD20) and 40.2.220 (anti-CD40), which with both target B cell receptors. The construction 2H7 scFv hlgGl (SSS-S) H WCH2 WCH3 in the expression vector pDl8 was passed through dam bacteria "in order to allow cleavage at the Bcll site. Bl plasmid olive was treated with alkaline phosphate before ligation to a Bcll cut scFv-CD40 fragment scFv. This fragment was synthesized at from the existing 40.2.220 scFv through successive PCR reactions with overlapping primers. The bonded binder is a patented helical type binder (BMS patent) with a high number of glutamic acid and glycine residues. The scFv for CD40 was PCR amplified without the leader peptide as a Sall-Bcll fragment, but included the tail in an existing scFvIg construct for CD20 (constructions 2H7 scFv hlgGl). The 3 'end was similar to the other VH scFv molecules with a Bcll frame site output fused to the VTVSS type sequence at the end of the VH domain.

Oligos PCR: 40.2.220 scFv: Initiator 5 '-40.2.220S5: 5' -gttgttgtcgacattgttctgactcagtct ccagccaccctgtc-3 '(SEC ID NO) Initiator 3' - 0.2.220Bcl3: 5 '-gttgttgatcagagacagtgaccagtgt CCCttgg-3' (ID DB S ? C NO) Linker Initiators: The Bcll-Sall frfagment created by the complementary hybridization of oligonucleotides. This fragment is then ligated into the digested vector Bcll with a Sall-Bcll scFv to create the (linker-scFv) fragment Bcll desired for shuttle.

Initiator 5 ': 5' -gatcaatccaactctgaagaagcaaagaaagaggaggccaaaaa ggaggaagccaagaaatctaacagcg-3 '(ID DB S? C NO) Initiator 3': 5 '-tcgacgctgttagatttcttggcttcctcctttttggcctcc tctttctttgcttcttcagagttggatt-3' (SEC ID NO) This Bcll fragment was then ligated downstream of 2H7 scFv in pDl8-Ig. Transformants were selected for the presence of a 2.4 kb HindIII-Xba insert and positive clones were sequenced before for further studies. Transient COS cell transfections were developed with this construct and the culture supernatants selected for the presence of protein of predicted size and to bind to CD20 cells and to CD40 transfected CHO cells.

New bispecific constructions can be created by designing pivot-type linkers that incorporate one or preferably two rest sites at either end of the linker, which facilitates asymmetric digestion and the transfer of cassettes (linker-scFv) or (scFv-linker) between different constructions. These constructs will also incorporate the VH LllS region and other V region substitutions, which presumably facilitate proper folding and result in an increased expression of the molecules in which they are inserted.

This binding region is connected to a mutated human IgGl connection region where all the cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This connection region is adhered to the same human wild type IgGl CH2 sequence as the previous construction. The polynucleotide sequence is supplied in the D ID? S? C NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 153 2H7 SCFv IGAH IGACH2 T4CH3-HCD80 TM / CT This construct has a single chain Fv binding region 2H7 (anti-CD20) as described in Example 1.

This binding region adheres to the human IgA binding region as described in Example 5. This binding region adheres to a human IgA constant region consisting of a wild-type CH2 region and a mutated CH3 region where there is a truncation of 4 amino acid residues before the 3 'stop codon as described in Example 13. This CH3 region adheres to an hCD80 TM / CT according to the methods described in Example 113 and 119. This construct is previously reported as 2H7 scFv IgA pivot IgA-T4-CD80 and 2H7 scFv IgAH IgA-T4-CD80, which have the same sequence as the previous construct. The polynucleotide sequence is supplied in the D ID? S? C NO: __, and the encoded polypeptide sequence is supplied in ID D? S? C N0: _.

? JEMPLO 154 G19-4 SCFv (CCC-P) WH WCH2 WCH3-HCD80 TM / CT This construct has a single chain Fv binding region G19 (anti-CD3) described in Example 29. This binding region is adhered to the wild-type human IgG1 binding region (CCC-P) as described in Example 1. This connection region adheres to regions human IgGl CH2 and CH3 constants wild type as described in Example 1. This CH3 region is adhered to an hCDdO TM / CT according to the methods described in Example 113. The polynucleotide sequence is provided in SEQ ID NO. : _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 155 2? 12 SCFv (CCC-P) WH WCH2 WCH3-HCD80 TM / CT This construction has a single chain Fv binding region 2el2 (anti-CD2d) described in Example 12. This binding region adheres to the wild-type human IgGl binding region (CCC-P) as described in FIG. Example 1. This connection region adheres to human-like wild type IgGl CH2 and CH3 constant regions as described in Example 1. This CH3 region adheres to a hCDdO TM / CT according to the methods described in Example 113. The polynucleotide sequence is supplied in ID D? SEC N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 156 2H7 VHLllS SCFv (SSS-S) IG? CH3CH4 This construction has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 33. This binding region is connected to a mutated human igGl connection region where all cysteines and a proline have been changed by serines (SSS-S) according to the methods described in Example 5. This region Connection is attached to the constant region Ig? CH3 and CH4 human. This truncated constant region was created according to the methods described in Example 38. The polynucleotide sequence is supplied in the ID of S? C N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 157 PIVOT IGD An alternative pivot region can be isolated from the human IgD immunoglobulin pivot region to use PCR assay to isolate the desired region. The PCR reaction is the same as used in Example 1. This pivot was truncated by the 6 amino acid residues at the 3 'end. The primers used in this PCR reaction are listed below.

Initiator 5 ': 5' -GTGGATCCAGGTTCGAAGTCTCCAAAGGCACAGGCC-3 ' (SEC ID NO) Initiator 3 ': 5' -GTTGI 'CGACTGCACCGGTCTTTGTCTCTCTCTCTTC-3' (SEC ID NO) The polynucleotide sequence is provided in SEQ ID NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO:.

? J? MPLO 158 HCP28 TM / CT For some of the cell surface ORF constructs, the transmembrane domain of CD80 was substituted with the transmembrane domain of human CD28 because it forms a dimer on the cell surface unlike a monomer such as CD80. Several of the molecules that direct the apoptotic program require oligomerization / trimerization to form a signaling complex; therefore, it is important to be able to control the initiation of signaling by controlling the degree of oligomerization of these recombinant receptors on the cell surface.

The primers used in the PCR amplification of the CD28 tail are given below: initiator 5 ': 5' -gttgtggatccttcgaaccccttttgggtgctggtgg tggttggtgga-3 '(SEC ID NO) initiator 3': 5 '-gttgttatcgatctcgagtcaggagcgataggctgcgaagtc-3' (SEC ID DO NOT) The polynucleotide sequence is provided in the DE ID SEC NO: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 159 2H7 SCFv VH LllS (SSS-S) H K322L CH2 WCH3 This construction has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at amino acid residue 11 in the heavy chain variable region, wherein the leucine has been changed to a serine as described in Example 33. This binding region is connected to a mutated human igG connection region where all the cysteines and a proline have been changed to serines (SSS- S) according to the methods described in Example 5. The connection region adheres to the mutated CH2 IgG region and a wild type IgG CH3 region. The K322L mutation in the CH2 region is in a 322 residue, where a Lysine has been changed to a leucine using overlapping PCR described in Example 56, but with different primers for the first PCR reaction, which is. list ahead.

Initiator '5': 'ttcctcttccccccaaaacccaaggacaccctcatgatctcccgg aaccctgaggtcac-3' (SEC ID NO) Initiator 3 ': 5' -ggacagtgggagtggcacc-3 '(SEC ID NO) The PCR product was cloned into the TOPO vector and sequenced. The polynucleotide sequence is supplied in the D ID? SEC N0: _, and the encoded polypeptide sequence is provided in SEQ ID NO: _.

? J? MPLO 160 2H7 SCFV VH LllS (CSS-S) H K322L CH2 WCH3 This construct has a single chain Fv binding region 2H7 (anti-CD20) with a mutation site at the amino acid residue 11 in the heavy chain variable region, where the leucine has been changed to a serine as described in Example 33. This binding region is adhered to a mutant IgG connection region, where the second and third cysteines have been changed by serines and the proline has been changed by serine (CSS-S), according to the methods described in Example 13. The connection region adheres to the mutated CH2 IgG region and a wild type IgG CH3 region. The K322L- mutation in the CH2 region is in a 322 residue, where a Lysine has been changed to a leucine using overlapping PCR described in Example 56, which uses primers from Example 159 in the first PCR reaction and the initiators of the Example 57 for the second PCR reaction.

The PCR products were cloned into the TOPO vector and sequenced. The polynucleotide sequence is supplied in the D ID? S? C N0: _, and the encoded polypeptide sequence is supplied in the D ID? S? C N0: _.

? JMPLO 161 BLOCK OUT PE B C LIVE IN VIVE THROUGH 2H7 SCFv (SSS-S) H WCH2 WCH3 AND 2H7 scFv (SSS-S) H P238SCH2 WCH3 This example describes experiments that relate to ADCC effector mechanisms in the depletion of B cells through the comparison of the activities of an anti-CD20 construct (2H7 scFv (SSS-S) H WCH2 WCH3) and an anti-aging construct. CD20 with a proline for amino acid substitution serine in the CH2 domain (2H7 scFv (.SSS-S) H P238SCH2 WCH3). Figure 72 shows the results of an experiment on the induction of apoptosis by these constructions. The results indicate that both molecules bind CD20 and induce apoptosis mediated by the activation of caspase 3.

Figure 73 illustrates that anti-CD20 constructs mediate CDC activity towards positive target cells CD20. A construction 2H7 scFv (SSS-S) H WCH2 WCH3, a 2H7 scFv construct (SSS-S) H P238SCH2 WCH3, or Rituximab were incubated to increase concentrations with 104 cells target Bjab cells and a 1:10 dilution of rabbit complement (PelFreez) in a volume of 100 microliters for 60 minutes. The aliquots were stained with trypan blue (Invitrogen), and counted using a hemacytometer to determine the percentage of dead cell population during the treatment. Negative controls with cells and only one reagent are also included. Figure 74 illustrates that the construction 2H7 scFv (SSS-S) H WCH2 WCH3 was effective in ADCC with peripheral blood mononuclear cells. The ADCC activity of 2H7 scFv (SSS-S) H WCH2 WCH3 or Rituximab was measured in vi tro against the lymphoma cell line BJAB as the target cells, and using fresh human PBMC as effector cells. The effector for objective proportions was varied as follows: 100: 1, 50: 1, and 25: 1, with the number of BJAB cells per constant well remaining but varying the number of PBMC. The BJAB cells were labeled for 2 hours with 51 Cr and distributed in aliquots at a cell density of 5 x 10 4 cells / well for each well of 96-well flat-bottomed plates. The purified fusion proteins or Rituximab were added at a concentration of 10 μg / ml, and the PBMC was pooled at 1.25 x 106 cells / well (25: 1), 2.5 x 106 cells / well (50: 1), or 5 x 106 cells / well ( 100: 1), in a final volume of 200 μl. Natural killing was measured in each effector: target ratio by omitting the construction or MAb. Spontaneous release was measured without the addition of PBMC or fusion protein, and the maximum release was measured by the addition of detergent (1% NP-40) for the appropriate wells. The reactions were incubated for 5 hours, and the culture supernatant of 100 μl harvested to a Lumaplate (Packard Instruments) and allowed to dry overnight before continuing to release cpm on a NXT Microplate Scintillation Counter of Upper Count. Packard. Figure 75 illustrates that the 2H7 scFv (SSS-S) H WCH2 WCH3 construct binds the soluble CDl6 fusion protein (constructed from high or low affinity alleles (158V / F)), while the 2H7 scFv construct (SSS) -S) H P238SCH2 WCH3 shows no detectable binding. CD20 CHO cells (106) are incubated with saturation amounts of 2H7 scFv (SSS-S) H WCH2 WCH3 or 2H7 scFv (SSS-S) H P238SCH2 WCH3 (10 ug / ml) for one hour on ice in FBS PBS / 2%. The cells were washed in FBS PBS / 2% and were incubated with serial dilutions of 0.5 mg / ml of FITC-CD16 for one hour on ice. The cells were washed and the specific binding was measured by flow cytometry using a Beckman-Coulter Bpics C machine. The results are analyzed using xpo analysis software and the normalized fluorescence units were plotted as a function of concentration. Figure 76 illustrates an experiment on the ability of the 2H7 scFv (SSS-S) H WCH2 WCH3 and 2H7 scFv (SSS-S) H P238SCH2 WCH3 constructs to bind to U937 cells. U937 cells (106) expressing CD64 are incubated in FBS PBS / 2% for one hour on ice with 2H7 scFv (SSS-S) H WCH2 WCH3 or 2H7 scFv (SSS-S) H P238SCH2 WCH3. The cells were washed and incubated for one hour on ice with anti-FITC IgGl (specific Fe) (Caltag) in a final dilution of 1: 100. The cells were washed and the fluorescence analyzed on a Beckman-Coulter BpicsC flow cytometer. The data were analyzed using xpo analysis software, and the fluorescence intensity was plotted as a function of the concentration of 2H7 scFv (SSS-S) H WCH2 WCH3 or 2H7 scFv (SSS-S) H P238SCH2 WCH3. This Figure shows that both the construction 2H7 scFv (SSS-S) H WCH2 WCH3 and the construction 2H7 scFv (SSS-S) H P233SCH2 WCH3 binds to U937 cells with equivalent titration curves. The results indicate that the construction 2H7 scFv (SSS-S) H P238SCH2 WCH3 does not deteriorate in its binding to the high affinity Fe receptor FcγRI (CD64). The fact that the binding of the high affinity Fc? RI on U937 cells was similar for the two molecules in this experiment indicates that the amino acid change P238S selectively reduces binding to Fc? RIII. Figure 77 illustrates depletion of the B cell in macaques mediated by the anti-CD20 construct (2H7 scFv (SSS-S) H WCH2 WCH3) and an anti-CD20) scFv with a CH2 domain mutation. The 2H7 scFv (SSS-S) H WCH2 WCH3 or 2H7 scFv (SSS-S) H P233SCH2 WCH3 were administered to macaques (M. fasicularis) by intravenous injection at 6 mg / kg, with two infusions given one week apart. The effect of circulating B cells was measured by detection of CD40 positive B cells in peripheral blood. Blood samples were removed from animals injected on days 7, 0, 1, 3, 7, d, 10, 14, 28 and 43. Depletion of B cells was estimated by performing CBC (blood count) complete) and flow cytometric analysis of two colors in monkey blood. FITC or PE conjugates of antibodies against CD40, CD19, CD20, IgG, CD3, CDd were used in various combinations. The data are plotted as the number of CD40 positive blood B cells tabulated in thousands of cells per microliter for the time relative to the initial B cell preinjection time point level (maximum). This experiment shows that the injection of 2H7 scFv (SSS-S) H WCH2 WCH3 scFv results in complete and rapid depletion of circulating B cells that lasted more than 28 days after the second injection. Injection of 2H7 scFv (SSS-S) H P238SCH2 WCH3 scFv did not completely deplete B cells although the CD20 epitopes were saturated. A slow reduction in B cells for approximately 50% of the initial levels was observed during the first two weeks, but the B cells quickly returned to the starting levels in these animals. These results indicate that the ability to bind high affinity FC? RI and to mediate complement dependent cytotoxicity is not sufficient for a CytoxB20G molecule to completely deplete circulating B cells, and that ADCC mediated by the interaction with CDl6 is equally necessary for rapid and sustained B cell depletion.

These experiments indicate that the 2H7 scFv (SSS-S) H WCH2 WCH3 scFvs is able to drive the depletion functions of the B cell through three different mechanisms of action (1) induction of apoptosis, (2) CDC effector mechanisms, and (3) ADCC effector mechanisms. All three mechanisms probably contribute to the depletion of B cells in vivo. The data indicate that the complete and sustained exhaustion of B cells requires intact ADCC effector mechanisms. However, the partial depletion obtained with a negative ADCC mutant also indicates that apoptosis and CDC mechanisms contribute to mediating a portion of the total B-cell depletion effects. The results support the use of 2H7 scFv (SSS-S) H WCH2 WCH3 scFv in patients with an autoimmune disease or CD20 positive B-cell malignancy.

EXAMPLE 162 INPUCTION PE APOPTOSIS? C CELLS BURIAL CONSTRUCTION? S ANTI-CP37 GS-1 VLllS SCFV (SSS) H WCH2WCH3 In this Example, the anti-CD37 constructs GS-1 VLllS scFv (SSS) H WCH2WCH3 is evaluated for its ability to bind target cells and for their ability to induce apoptosis. The constructions were also physically characterized by size exclusion chromatography (SBC). Figure 7d illustrates the SEC profile of the G28-1 (anti-CD37) constructs having SSC pivot domain forms (GS-1 VLllS scFv (SSC) H WCH2WCH3). Constructs G28-1 (anti-CD37) were purified from the CHO culture supernatants by protein A affinity chromatography. The purified aliquots of 10-25 mg were subjected to HPLC on a Tosoh Biosep, Inc. TSK 3000 SWXL HPLC column , pore size 5 mm. The flow rate was 1 ml / min, in PBS, pH 7.2 stroke buffer. The migration rates of the molecular weight standards are indicated in front of the plot. The construction GS-1 VLllS scFv (SSS) H WCH2WCH3 is indicated in blue, while the construction GS-1 VLllS scFv (SSC) H WCH2WCH3 is indicated in red. The construction GS-1 VLllS scFv (SSS) H WCH2WCH3 generates a uniform peak of approximately 75-100 kDa, while the construction GS-1 VLllS scFv (SSC) H WCH2WCH3 generates a smaller form and other heterogeneous forms, which include a form of high molecular weight greater than 200 KDa. Figure 79 illustrates the binding of G28-1 (anti-CD37) constructs to B-cell lymphoma cell lines. serial dilutions of GS-1 VLllS scFv (SSS) H WCH2WCH3 or GS-1 VLllS scFv (SSC) H WCH2WCH3 were incubated with 10 6 cells of each cell type for 60 minutes on ice in FBS PBS / 2%. Samples were washed-twice, and incubated with a mixture of FITC goat anti-human IgG and FITC goat anti-human IgG F (ab ') 2 (CalTag) at 1: 100 each, on ice for 45 minutes . The samples were washed and analyzed by flow cytometry using a FACsCalibur (Becton-Dickinson). The results of this experiment show that both constructs GS-1 VLllS scFv (SSS) H WCH2WCH3 and GS-1 VLllS scFv (SSC) H WCH2WCH3 bind to BJAB and Ramos cells, and moderately to WIL-2 cells. Molecules of G28-1 (anti-CD37) (SSS) H G scFv or G28-1 (SSC) H G scFv molecules bind Raji and Namalwa cells at lower levels in these experiments. The binding to all the lines was significant because of the background of fluorescence that has been subtracted from the data shown in Figure 79. Figure 80 illustrates the binding of annexin and iodide of v-propidium to Ramous cells after incubation during the night with forms GS-1 VLllS scFv (SSS) H WCH2WCH3 or GS-1 VLllS scFv (SSC) H WCH2WCH3 from scFvs. The staining of AnnexinV-PI from -Ramos cells was incubated for 24 hours with G28-1 (anti-CD37) scFvs. Ramos B cells were incubated at 106 cells / ml in 12 well dishes for 24 hours with G28-1 (anti-CD37) scFvs in 10 mg / ml, in a total volume of 2 ml. The cells were stained with annexinV and propidium iodide with a kit obtained from Immunotech, according to the manufacturer's instructions. Samples were analyzed by two-color flow cytometry using a FACsCalibur flow cytometer (Becton-Dickinson). The total% of cells in each quadrant is indicated next to each plot point. Figure 83 shows the binding of AnnexinV-propidium iodide to cells after incubation overnight with GS-1 VLllS scFv (SSS) H WCH2WCH3 or GS-1 VLllS scFv (SSC) H WCH2WCH3. The results indicated that both constructs GS-1 VLllS scFv (SSS) H WCH2WCH3 and GS-1 VLllS scFv (SSC) H WCH2WCH3 were able to induce apoptosis, but that the SSC form induces more apoptosis than the SSS form. Figure 81 illustrates the inhibition of Ramos cell growth proliferation in the presence of G28-1 (anti-CD37) constructs. Ramos B cells were incubated with serial dilutions of purified G28-1 (anti-CD37) constructs containing the IgGI pivot identified as (SSS) H or (SSC) H. The cultures were incubated in flat bottom tissue culture dishes of 96 wells (Costar) at 37 ° C, 5% C02 for 36 hours before pressing with 3H-thymidine for at least 12 hours of a 48-hour incubation (0.75 mCi / well). Cells were harvested in 96-well GFC plates using a Packard harvester, dried, and 25 ml of Microscint scintillation fluid was added to each well before continuing the TopCount NXT microplate scintillation counting (Packard). The data is plotted as protein concentration versus incorporated cpm. Each construct shows increased inhibition of proliferation with increased protein concentration. Figure 82 illustrates the induction of apoptosis in Ramos B cells cultured in the presence of 2H7 (anti-CD20) and G28-1 (anti-CD37) constructs. Ramos B cells were incubated with CD20 and / or CD37 target constructs (10 mg / ml) in solution for 20 hours. The cells were then harvested, washed, and incubated in annexinV and propidium iodide using a Munotech I dyeing kit before two-color flow cytometry using a FACsCalibur flow cytometer (Becton-Dickinson). The graph shows the percentage of annexin V positive cells identified by their dyeing in the right quadrant of the dot plot. The results of this experiment indicate that both constructs G28-1 were more efficient than construction 2H7 and that construction G28-1 VLllS scFv (SSS) H WCH2 WCH3 was more efficient than construction G28-1 VLllS scFv (SSC) H WCH2 WCH3. However, the amount of Ramos cell apoptosis was greater when construction 2H7 and G28-1 were used in combination. Figure 83 illustrates the killing of Ramos cells by complement dependent cytotoxicity (CDC) induced by 2H7 (anti-CD20) and G28-1 (anti-CD37) constructs with pivot region mutations. The 2H7 scFv (CSS-S) H WCH2 WCH3 (anti-CD20), G28-1 scFv (SSS) HG, G28-1 (SCS) H (anti-CD37-scFv), G28-1 (CSS) H (antl -CD37-scFv), or G28-1 (SSC) H (anti-CD37-scFv) were incubated at 10 mg / ml with 104 Ramos Target Cells and a 1:10 dilution of rabbit complement (PelFreez) in a volume of 150 ml for 90 minutes. The aliquots were stained with trypan blue (Invitrogen), and counted using a hemacytometer to determine the percentage of the population of dead cells during treatment. Negative controls with cells and only one reagent are also included. Both G28-1 (SSS) (anti-CD37 scFv) and G28-1 (SSC) (anti-CD37 scFv) rapidly killed Ramos cells in the presence of rabbit complement in this experiment. The activity of G28-1 (SSC) (anti-CD37 scFv) was greater than that of G28-1 (SSS) (anti-CD37 scFv), and was nearly as potent in this assay as the CD20-directed 2H7 scFv molecule (CSS-S ) H WCH2 WCH3 scFv. Figure 64 illustrates the induction of ADCC from Ramos cells incubated with G28-1 (anti-CD37) scFvs. Constructs G28-1 (anti-CD37) at 10 mg / ml were incubated in 96-well flat-bottomed plates with 104 Ramos 51Cr-labeled cells and resting human PBMC in different effector: target ratios ranging from 0 to 100. All incubations were developed in triplicate in each effector: target ratio. The natural killing was measured in each effector: objective ratio by omitting the constructions. Spontaneous release was measured without the addition of PBMC or fusion protein, and maximum release was measured by the addition of detergent (1% NP-40) to the appropriate wells. The reactions were incubated for 6 hours, and 100 ml of the culture supernatant harvested to a Lumaplate (Packard Instruments) and allowed to dry overnight before cpm count was released on a Packard Top Count NXT Microplate Scintillation Counter. The results of these experiments indicate that the G28-1 (anti-CD37) constructs bind to target cells, which they induce apoptosis in the B cell lines, and that they mediate effector functions that include CDC and ADCC.

From the foregoing, it will be appreciated that, although specific embodiments of the invention have been described herein for purposes of the illustration, various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the present invention is not expected to be limited by the appended claims.

All patents, patent applications, publications, scientific articles, web sites, and other documents and materials referenced or mentioned herein are indicators of the levels of experience of those skilled in the art to which the invention pertains, and each such Referred documents and material is hereby incorporated as a reference for the same scope as systems that would have been incorporated as a reference in their entirety individually or fully established here. Additionally, all the claims in this application, and all the requests. of priority, which include but are not limited to the original claims, are incorporated here completely within and they are part of, the written description of the invention. Applicants reserve the right to physically incorporate within this specification any and all materials and information of any such patents, applications, publications, scientific articles, websites, electronically available information, and other reference materials or documents. Applicants reserve the right to physically incorporate within any part of this document, which includes any part of the written description of the claims referred to above which include but are not limited to any original claims.

The specific methods and compositions described herein are representative of the preferred embodiments and are exemplary and are not intended to be limitations on the scope of the invention. Other objects, aspects, and embodiments will occur to those skilled in the art upon consideration of this disclosure, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that several substitutions and Modifications can be made to the invention described herein without departing from the scope and spirit of the invention. The invention described in illustrative form herein suitable can be practiced in the absence of any element or elements, or limitation or limitations, which are not specifically described here as essential, as for example, in each instance here, in the modalities or examples of the present invention, any of the terms "comprising", "consisting essentially of", and "consisting of" may be replaced with any of two other terms in the description. Also the terms "comprising", "including", "containing", etc., are to be read widely and without limitation. The illustrative methods and processes suitably described herein may be practiced in different orders or steps, and they are not necessarily restrictive to the orders or steps indicated herein or in the claims. Also as used herein and in the appended claims the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, a "host cell" includes a plurality (e.g., a culture or population) of such host cells and so forth. According to circumstances the patent may be construed as limited to the specific examples or modalities or methods specifically described herein. Under no circumstances can it be construed as limited by any statement made by any examiner or by any other official or employee of the trademark and patent office unless such a statement is specific and without qualification or express reservation adopted in a written response by the applicants .

The terms and expressions that have been used are used as terms of description and not limitation, and there is no attempt to use such terms and expressions to exclude any equivalent of the features shown and described or portions thereof. But it is recognized - that several modifications are possible within the scope of the invention as reinvidica. Thus, it will be understood that the present invention has been specifically described by preferred methods and optional features, modifications or variations of the concepts described herein can be reclassified by those skilled in the art, and that such modifications and variations are they are within the scope of this invention as defined by the appended claims.

The invention has been described broadly and in general form here. Each of the narrowest species and subgeneric groupings fall within the generic description are also part of the invention. This includes the description of the invention with a negative condition or limitation of removing any subject matter of the genre, with respect to whether or not the material is excised is specifically described herein. For example, the subject matter of the present invention can optionally exclude any subject matter or sequences described or included in the related application published as U.S.S.N. 2003 / 0118592A1 of June 26, 2003 (and the sequence listing of SEQ ID NO: 1-427 published by the USPTO), by Ledbetter et al. Entitled "Binding Domain-Immunoglobulin Fusion Proteins".

Other embodiments are within the following claims. Additionally, wherein the features or aspects of the invention are described in terms of Markush groups, those skilled in the art. they will recognize that the invention is also described in terms of any individual member 'or subgroup of members of the Markush group.

Claims (5)

1. NOVEPAP OF THE INVENTION Having described the present invention, it is considered as a novelty, and therefore, the content of the following is claimed as property: CLAIMS 1. A non-naturally occurring single chain protein characterized by comprises: i) a first polypeptide having a binding domain polypeptide capable of binding a target molecule, said binding domain polypeptide comprising a heavy chain variable region, said heavy chain variable region comprises an amino acid substitution or depletion in one or more amino acid residue; ii) a second polypeptide comprising a binding region adhered to said first polypeptide; and iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said non-naturally occurring single chain protein is capable of at least one immunological activity.
2. 2. A protein of claim 1 characterized in that said Fv binding domain polypeptide is a single chain.
3. 3. A protein of claim 1 characterized in that the substitution or elimination of one or more amino acids in said heavy chain variable region is effective to increase the expression or stability of said protein related to a protein without said depletion or substitution.
4. 4. A protein of claim 1 characterized in that said binding domain polypeptide comprises an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.
5. 5. A protein of claim 4 which further comprises a second binding domain polypeptide capable of binding a second target molecule, said second binding domain polypeptide comprising a light chain variable region polypeptide of immunoglobulin and an immunoglobulin heavy chain variable region polypeptide.

   6. A protein of claim 5 characterized in that the first target molecule and the second target molecule are different.

   7. A protein of claim 5 characterized in that the first target molecule and the second target molecule are the same.

   8. A protein of claim 1 characterized in that said Fv binding domain polypeptide is a single chain comprising one or more amino acid substitutions at positions 9, 10, 11, 12, 108, 110, 112 in said variable region of heavy chain .

   9. A protein of claim 1 characterized in that said Fv binding domain polypeptide is a single chain comprising an amino acid substitution at position 11 in said heavy chain variable region.

   10. A protein of claim 9 characterized in that the amino acid substituted for the amino acid at position 11 of the heavy chain variable region Fv single chain is selected from serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, - lysine, arginine, and histidine.

   11. A protein of claim 9 characterized in that a leucine at position 11 of the single chain heavy chain variable region Fv is replaced with an amino acid other than serine.

   12. A protein of claim 9 characterized in that leucine is replaced by serine in position 11, and characterized in that said protein is capable of antibody-dependent cell-mediated cytotoxicity and complement fixation, and is capable of binding said target molecule by reducing a number of target cells.

   13. A protein of claim 9 characterized in that leucine is replaced by des-leucine in position 11.

   14. A protein of claim 12 having an increased or stable recombinant expression related to said protein does not have an amino acid substitution at position 11.

   15. A protein of claim 14 characterized in that the expression of said protein has an amino acid substitution at position 11 is 10-100 times greater than said protein without a substitution at position 11.

   16. A protein of claim 14 characterized in that said expression is in mammalian cells.

   17. A protein of claim 1 characterized in that said Fv binding domain polypeptide is a single chain and the amino acid at position 11 of the heavy chain variable region of said single chain Fv has been deleted.

   18. A protein of claim 1 characterized in that said Fv binding domain polypeptide is a single chain and said binding domain polypeptide comprises a light chain variable region wherein said light chain variable region has an amino acid removal or substitution in a or more of amino acid positions 12, 80, 81, 83, 105, 106 and 107.

   19. A protein of claim 18 characterized in that the amino acid of position 106 has been. replaced or removed.

   20. A protein of claim 2 characterized in that said binding domain polypeptide binds to a tumor antigen.

   21. A protein of claim 2 characterized in that said binding domain polypeptide binds to an antigen or an immune sensing cell.

   22. A protein of claim 2 characterized in that said binding domain polypeptide binds to a cancer cell antigen.

   23. A protein of claim 22 characterized in that said cancer cell antigen is a surface antigen.

   24. A protein of claim 22 characterized in that said cancer cell antigen is an intracellular antigen.

   25. A protein of claim 1 characterized in that said binding domain polypeptide binds to a B cell antigen.

   26. A protein of claim 25 characterized in that said B-cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CD80 and CD86.

   27. A protein of claim 2 characterized in that said single chain Fv binds to a B cell antigen.

   28. A protein of claim 27 characterized by said B-cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CD80 and CD6.

   29. A protein of claim 2d characterized in that said single chain Fv is selected from single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, and single chain Fv 4.4.220. -

   30. A protein of claim 2 characterized in that said single chain Fv is selected from single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, FC2-2, UCHL-1, 5B9, L6, 10ad, 2el2, 40.2.36, G19-4, 1D8, and single chain Fv 4.4.220.

   31. A protein of claim 1 characterized in that said binding domain polypeptide is a scFv that binds to a B cell differentiation antigen.

   32. A protein of claim 31 characterized in that said B cell antigen is selected from CD19, CD20, CD22, CD37, and CD40.

   33. A protein of claim 1 characterized in that said binding domain polypeptide binds to a target selected from CD2, CD3, CD4, CD5, CD6, CDd, CD10, CD14, CD14, CD19, CD20, CD21, CD22, CD23, CD24 , CD25, CD28, CD30, CD37, CD40, CD43, CD50 (ICAM3), CD54 (ICAMl), CD56, CD69, CD80, CD36, CD134 (OX40), CD137 (41BB), CD152 (CTLA-4), CD153 ( . ligand CD30), CD154 (ligand CD40), ICOS, L6, B7-H1, and HLA class II.

   34. A protein of claim 1 characterized in that said protein is capable of forming a complex comprising two or more of said proteins.

   35. A protein of claim 34 characterized in that said complex is in dimer.

   36. A protein of claim 1 characterized in that said protein is a monomer.

   37. A protein of claim 1 coupled to a drug, toxin, immunomodulator, polypeptide effector, isotope, tag or effector portion.

   38. A protein of claim 1 characterized by said at least immunological activity is selected from antibody-dependent cell-mediated cytotoxicity, complement fixation, induction of apoptosis, induction of one or more biological active signals, induction of one or more immune effector cells, activation of cell differentiation, cellular activation, release of one or more molecules. biologically active, and neutralization of an infectious agent or toxin.

   39. A protein of claim 38 characterized in that said immunological activity comprises two immunological activities selected from antibody-dependent cell-mediated cytotoxicity, complement fixation, induction of apoptosis, induction of one or more biologically active signals, induction of one or more cells immune effectors, activation of cellular differentiation, cellular activation, release of one or more biologically active molecules, and neutralization of an infectious agent or toxin.

   40. A protein of claim 38 which is capable of induction of biologically active signals by activation or inhibition of one or more molecules selected from protein kinase, protein phosphates, G-proteins, cyclic nucleotides or other second messengers, ion channels, and protein components. secretory pathway, or that is capable of induction of one or more immune effector cells selected from NK cells, monocytes, macrophages, B cells, T cells, mast cells, neutrophils, eosinophils, and basophils.

   41. A protein of claim 40 characterized in that said induction of one or more immune effector cells leads to antibody-dependent cell-mediated cytotoxicity or the release of one or more biologically active molecules.

   42. A protein of claim 38 that is capable of cellular activation, characterized in that said activation leads to changes in cellular transcriptional activity.

   43. A protein of claim 42 characterized in that said cellular transcriptional activity is increased. Four . A protein of claim 42 characterized in that said cellular transcriptional activity is reduced.

   45. A protein of claim 38 characterized in that said one or more biologically active molecules is a protease.

   46. A protein of claim 38 characterized in that said one or more biologically active molecules is a cytokine.

   47. A protein of claim 46 characterized in that said cytokine is selected from monokines, lymphokines, chemokines,. growth factors, colony stimulating factors, interferons, and interleukins.

   48. A protein of claim 38 which is capable of neutralizing an infectious agent, characterized in that said infectious agent is a bacterium, a virus, a parasite, or a fungus.

   49. A protein of claim 38 which is capable of neutralizing a toxin, characterized in that said toxin is selected from endotoxins and exotoxins.

   50. A protein of claim 38 which is capable of neutralizing a toxin, characterized by said toxin being an exotoxin selected from anthrax toxin, cholera toxin, diphtheria toxin, perthusis toxin, labile-heat toxin E. coli LT, heat stable toxin E Coli ST, Shiga toxin Pseudo ofaas Exotoxin A, botilinu toxin, tetanus toxin, Bordetella pertussis toxin AC, and Bacillus anthracis BF.

   51. A protein of claim 38 which is capable of neutralizing a toxin, characterized in that said toxin is an endotoxin selected from saxitoxins, tetrodotoxin, fungal toxins, aflatoxins, pyrrolizidine alkaloids, phytomagglutinins, and grayanotoxins.

   52. A protein of claim 1 characterized in that said protein is capable of binding to an intracellular target to effect a cellular function.

   53. A protein of claim 1 characterized in that said binding domain polypeptide comprises a light chain variable region adhered to said light chain variable region by a binding domain linker wherein said binding domain linker comprises one or more peptides that It has a Gly-Gly-Gly-Gly-Ser sequence.

   54. A protein of claim 53 comprising three peptides Gly-Gly-Gly-Gly-Ser.

   55. A protein of claim 1 characterized in that said binding domain polypeptide comprises wild-type or engineered immunoglobulin variable region obtained from the species selected from human, murine, rat, pig, and monkey.

   56. A protein of claim 1 characterized in that said binding domain polypeptide comprises a variable region of humanized immunoglobulin.

   57. A protein of claim 2 characterized by said N-terminal truncated immunoglobulin heavy chain constant region polypeptide comprises a IgG CH2 constant region polypeptide adhered to an immunoglobulin heavy chain igG CH3 constant region polypeptide.

   58. A protein of claim 2 characterized by said N-terminal truncated immunoglobulin heavy chain constant region polypeptide consists essentially of a region polypeptide CH2 IgG constant adhered to a IgG CH3 constant chain polypeptide of immunoglobulin heavy chain.

   59. A protein of claim 2 characterized by said N-terminal truncated immunoglobulin heavy chain constant region polypeptide comprises a IgG CH2 constant region polypeptide adhered to an IgG CH3 immunoglobulin heavy chain constant region polypeptide.

   60. A protein of claim 2 characterized in that said truncated N-terminal immunoglobulin heavy chain constant polypeptide consists essentially of a IgG CH2 constant region polypeptide adhered to a IgG CH3 heavy chain immunoglobulin constant region polypeptide.

   61. A protein of claim 1 characterized in that said binding domain polypeptide is a single chain Fv comprising at least a portion of a human constant region.

   62. A protein of claim 2 characterized in that said binding domain polypeptide is a single chain Fv comprising at least a portion of a human constant region.

   63. A protein of claim 1. characterized in that said connection region comprises a naturally occurring pivot region selected from a human pivot or portion thereof, human IgG pivot or a portion thereof, human IgA pivot or a portion thereof, pivot Human IgE or a portion thereof, camelid pivot region or a portion thereof, IgGl flame pivot region or a portion thereof, nurse shark pivot region or portion thereof, and ratfish pivot region or a portion of this.

   64. A protein of claim 1 characterized in that said connection region comprises a pivot Human IgE or a portion of it.

   65. A protein of claim 1 characterized in that said connection region comprises a pivot region igG1, IgG2, IgG3 or IgG4 having any one or zero cysteine residue.

   66. A protein of claim 1 characterized in that said connection region comprises an IgG4 pivot region having between zero and two cysteine residues.

   67. A protein of claim 1, characterized in that said connection region comprises one. human IgGl immunoglobulin pivot region wild type.

   68. A protein of claim 1 characterized in that said connection region comprises a glycosylation site.

   69. A protein of claim 1 characterized in that said connection region has no cysteine residues capable of forming disulfide bonds.

   70. A protein of claim 1 characterized in that said connection region has a cysteine residue.

   71. A protein of claim 1 characterized in that said connection region comprises a mutated wild-type immunoglobulin pivot region polypeptide comprising no more than one cysteine residue.

   72. A protein of claim 1 characterized in that said connection region is altered in such a way that said protein has a reduced ability to dimerize.

   73. A protein of claim 1 characterized in that said connection region comprises three cysteine residues and one proline residue, wherein one or more said cysteine residues are removed or replaced and said proline residue is replaced or eliminated.

   74. A protein of claim 1 characterized in that said connection region comprises a mutated wild-type immunoglobulin pivot region polypeptide comprising first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine wherein said first cysteine residue is replaced or deleted.

   75. A protein of claim 74 characterized in that wild-type pivot region polypeptide is human IgGl.

   76. A simple chain protein of non-natural occurrence comprises: i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprising a heavy chain variable region comprising one or more amino acid deletions or substitution at positions 9, 10, 11, 12, 108, 110, 112; ii) a second polypeptide comprising a connection region adhered to said first polypeptide; and iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said unnaturally occurring single chain protein is capable of at least one immunological activity, and wherein said protein has an increased recombinant expression or stability relative to said protein does not have an amino acid removal or substitution. A non-naturally occurring single chain Fv protein comprising: i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule in a target cell, said binding domain polypeptide comprising a variable region of heavy chain wherein the leucine at position 11 in the first region of structure in the heavy chain variable region is deleted or replaced with another amino acid; ii) a second polypeptide comprising a binding region adhered to said first polypeptide; and iii) a third polypeptide comprising a heavy chain constant region polypeptide of N-terminal truncated immunoglobulin adhered to the second polypeptide, wherein said single-stranded non-naturally occurring protein (1) is capable of binding to said target molecule, and (2) is capable of antibody-mediated cell-dependent cytotoxicity and binding of complement, and (3) is able to reduce the number of target cells.

   78. A protein of claim 77 further comprising a substitution or removal of the amino acid at position 10 in the first region of structure in the heavy chain variable region.

   79. A protein of claim 77 characterized in that the amino acid substitution at position 11 is effective to increase the expression or stability of said single chain Fv protein related to a single chain Fv protein without said elimination or substitution. JO. A protein of claim 77 characterized in that the number of residues is the EU index according to Kabat.

   81. A protein of claim 77 characterized in that said connection region comprises a proline and first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine said first cysteine residue is N-terminal to said proline residue.

   82. A protein of claim 77 characterized in that said connection region comprises an IgA pivot or a portion thereof.

   83. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma 2H7, wherein said second cysteine residue is replaced by serine and said proline residue is replaced by serine in the region of connection, and said heavy chain constant region comprises CH2 and CH3 domains of IgGi. \

   86. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein the connection region said second and third cysteine residue is replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprises the CH2 and CH3 domains of IgGa wherein the lysine is replaced by serine at position 322 in said CH2 region.

   87. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein the said first, second, and third cysteine residue connection region is replaced by serine, and said The proline residue is replaced by serine, said heavy chain constant region comprising the CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 331 in said CH2 region.

   88. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein said second connection region, and third cysteine residue is replaced by serine, and said residue of proline is replaced by serine, said heavy chain constant region comprising the CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 331 in said CH2 region.

   89. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said residue of proline is replaced by serine, said heavy chain constant region comprising the CH2 and CH3 domains of IgGi wherein the threonine is replaced by asparagine at position 256 in said CH2 region.

   90. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said residue of proline is replaced by serine, said heavy chain constant region comprises the Fv CH2 and CH3 domains of single chain 2H7 of IgGi wherein in the CH2 domain the arginine is replaced by glutamine at position 255, the threonine is replaced by asparagine in the position 256, proline is replaced by alanine at position 25, and glutamic acid is replaced by lysine at position 258.

   91. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprising the CH2 domains and CH3 of IgGi wherein the lysine is replaced by glutamine at position 290 in said CH2 region.

   92. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprising the CH2 and CH3 domains of IgGi wherein the alanine is replaced by proline at position 339 in said CH2 region.

   93. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the said first, second, and third connection region cysteine residues are replaced by serine , and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi. \

   94. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the connection region said second, and third cysteine residues are replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of igGi.

   95. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the connection region said second cysteine residue is replaced by serine, and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   96. A protein of claim 1 said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the said connection region first, and second cysteine residues are replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   97. A protein of claim 81 said single chain protein comprises a single chain Fv binding domain of an FC2-2 hybridoma, characterized in that in the said first, second, and third connection region, cysteine residues are replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgG ?.

   98. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma UCHL-1, wherein in the said first, second, and third connection region cysteine residues are replaced by serine , and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   99. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma 5B9, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said proline residue is replaced by serine, wherein said heavy chain constant region comprises domains

   100. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   101. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma 2H7, wherein in the connection region said second, and third cysteine residues are replaced by serine, and said proline residue is replaced by serine, wherein said heavy chain constant region comprises CH2 and CH3 domains of IgG ?.

   102. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the said connection region first, and third cysteine residues are replaced by serine, and said proline residue is replaced by serine, said region, heavy chain constant comprising CH2 and CH3 domains of IgGi.

   103. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, comprising a connection region wherein said third cysteine residue is replaced by serine, and said residue of proline replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGx.

   104. A protein of claim 81 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein in the connection region said first cysteine residue is replaced by serine, said constant region of Heavy chain comprises CH2 and CH3 domains of IgGi.

   105. A protein of claim 62 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein said connection region comprises a murine IgA pivot region, said heavy chain constant region it comprises CH2 and CH3 domains of murine IgA, and said CH3 comprises a deletion or substitution at the four amino acids that gives the IgA heavy chain constant region unable to associate with a J-chain polypeptide.

   106. A protein of claim 82 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein said connection region comprises a human IgA pivot region, and said heavy chain constant region it comprises CH2 and CH3 domains of human IgA, wherein said CH3 comprises a deletion or substitution at the four amino acids that gives the IgA heavy chain constant region unable to associate with a J chain polypeptide.

   107. A protein of claim 1 characterized in that said single chain protein comprises a single chain Fv binding domain of an HD37 hybridoma, wherein in the said first, second, and third connection region, cysteine residues are replaced by serine, and said proline residue is replaced by serine, and said heavy chain constant region comprises CH2 and CH3 domains of IgGi. \

   108. A protein of claim 8i characterized in that said single chain protein comprises a single chain Fv binding domain of an L6 hybridoma, wherein in the said first, second, and third connection region cysteine residues are replaced by serine, and said proline residue is replaced by serine, and said heavy chain constant region comprises CH2 and CH3 domains of IgG ?.

   109. A single chain Fv protein of non-natural occurrence comprises: i) a first polypeptide which has a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprises a variable region of heavy chain wherein the leucine it is replaced by serine at position 11 in the first region of heavy chain variable region structure wherein said protein has an increased expression or stability in mammalian cells related to a protein that does not have said amino acid substitution; ii) a second polypeptide- comprising a binding region adhered to said first polypeptide; and iii) a third polypeptide that It comprises an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said uncharacterized single chain Fv protein is capable of at least one immunological activity.

   110. A single chain Fv protein of non-natural occurrence characterized in that it comprises: i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprises a variable region of heavy chain wherein leucine is replaced by serine at position 11 in the first region of structure of the heavy chain variable region; and ii) a second polypeptide comprising an IgE truncated IgE immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said unnaturally occurring single chain protein is capable of at least one immunological activity.

   111. A protein of claim 110 characterized in that the amino acid substitution at position 11 is effective to increase the expression or stability of said single chain Fv protein related to a single chain Fv protein without said elimination or substitution.

   112. A protein of claim 110 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma and said heavy chain constant region comprises Ig CH2 and CH3 domains.

   113. A protein of claim 110 characterized by said single chain protein comprising a single chain Fv binding domain of a hybridoma 2H7 and said heavy chain constant region comprising CH2, CH3, and murine CH4 domains.

   114. A protein of claim 110 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma G26-1, wherein said heavy chain constant region comprises CH2, 'CH3, and CH4 domains of murine IgE.

   115. A protein of claim 110 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein said heavy chain constant region comprises human IgE CH2, CH3, and CH4 domains.

   116. A single-stranded, non-natural chain protein that includes a first polypeptide comprising a binding domain polypeptide capable of binding to a target molecule, a second polypeptide comprising a binding region adhered to said first polypeptide, a third polypeptide comprising a N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine residue and said second cysteine is N-terminal to said third cysteine, wherein one or both of said second and third cysteine residues is replaced or deleted, and wherein said single chain protein of unnatural occurrence is capable of at least one immunological activity.

   117. A protein of claim 116 characterized in that said binding domain polypeptide is a single chain Fv.

   118. A protein of claim 116 characterized in that said binding domain polypeptide comprises an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.

   119. A protein of claim 118 further comprising second binding domain polypeptide capable of binding a second objective molecule, said second binding domain polypeptide comprising a light chain variable region polypeptide of immunoglobulin and an immunoglobulin heavy chain variable region polypeptide.

   120. A protein of claim 116 characterized in that said binding domain polypeptide is a single chain Fv comprising a heavy chain variable region, wherein said heavy chain variable region has an amino acid substitution or deletion in one or more of the amino acid positions 9, 10, 11, 12, 108, 110, 112.

   121. A protein of claim 117 characterized in that said binding domain polypeptide is a single chain Fv comprising a light chain variable region, wherein said light chain variable region has an amino acid removal or substitution in one or more of the amino acid positions 12, 80, 81, 83, 105, 106, and 107.

   122. A protein of claim 116 characterized in that said binding domain polypeptide is a single chain Fv comprising a heavy chain variable region, wherein said variable region of Heavy chain has an amino acid substitution at amino acid position 11.

   123. A protein of claim 122 characterized in that the acid at position 11 of the single chain heavy chain variable region Fv is selected from serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid, lysine, arginine, and histidine.

   124. A protein of claim 122 characterized in that the amino acid substituted for the amino acid at position 11 of the single chain heavy chain variable region Fv is selected from serine, threonine, cysteine, tyrosine, sparagin, and glutamine.

   125. A protein of claim 122 characterized in that leucine is replaced by serine in position 11.

   126. A protein of claim 122 characterized in that leucine is replaced by des-leucine in position 11.

   127. A protein of claim 116 characterized in that said binding domain polypeptide is a single chain Fv and the amino acid at position 11 in the heavy chain variable region of said single chain Fv has been deleted.

   128. A protein of claim 121 characterized by leucine is replaced by serine at position 106.

   129. A protein of claim 117 characterized in that said binding domain polypeptide binds to a tumor antigen.

   130. A protein of claim 117 characterized in that said binding domain polypeptide binds to an antigen in an immune sensing cell.

   131. A protein of claim 117 characterized in that said binding domain polypeptide binds to a cancer cell antigen.

   132. A protein of claim 131 characterized in that said cancer cell antigen is a surface antigen.

   133. A protein of claim 131 characterized by said cancer cell antigen is an intracellular antigen.

   134. A protein of claim 116 characterized in that said binding domain polypeptide binds to a B cell antigen.

   135. A protein of claim 135 characterized in that said B-cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CD80, and CD6.

   136. A protein of claim 117 characterized in that said single chain Fv binds to a B cell antigen.

   137. A protein of claim 136 characterized in that said B-cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CD80, and CD86.

   138. A protein of claim 137 characterized by said single chain Fv is selected from Single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, and single chain Fv 4.4.220.

   139. A protein of claim 117 characterized in that said single chain Fv is selected from single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, FC2-2, UCHL-1, 5B9, L6, 10A8, 2el2, 40.2.36, G19-4, 1D8, and single chain Fv 4.4.220.

   140. A protein of claim 116 characterized in that said binding domain polypeptide is a scFv that binds to a B cell differentiation antigen.

   141. A protein of claim 136 characterized in that said B cell antigen is selected from CD19, CD20, CD22, CD37, and CD40.

   142. A protein of claim 116 characterized in that said binding domain polypeptide binds to a target selected from CD2, CD3, CD4, CD5, CD6, CD8, CD10, CD14, CD14, CD19, CD20, CD21, CD22, CD23, CD24 , CD25, CD28, CD30, CD37, CD40, CD43, CD50 (ICAM3), CD54 (ICAMl), CD56, CD69, CD80, CD6, CD134 (OX40), CD137 (41BB), CD152 (CTLA-4), CD153 ( ligand CD30), CD154 (ligand CD40), ICOS, L6, B7-H1, and HLA class II.

   143. A protein of claim 116 characterized in that said protein is capable of forming a complex comprising two or more of said proteins.

   144. A protein of claim 143 characterized in that said complex is a dimer.

   145. A protein of claim 116 characterized in that said protein is a monomer.

   146. A protein of claim 116 coupled to a drug, toxin, immunomodulator, effector polypeptide, isotope, tag, or effector portion.

   147. A protein of claim 116 characterized in that said immunological activity is selected from antibody-dependent cell-mediated cytotoxicity, complement fixation, induction of apoptosis, induction of one or more biologically active signals, induction of one or more immune effector cells, activation of cellular differentiation, cellular activation, release of one or more biologically active molecules, and neutralization of an infectious agent or toxin. 14d.A protein of claim 147 which is capable of induction of biologically active signals by activation or inhibition of one or more molecules selected from protein kinase, protein phosphatase, G-proteins, cyclic nucleotides or other second messengers, ion channels, and components of secretory trajectory.

   149. A protein of claim 147 that is capable of inducing one or more immune effector cells selected from NK cells, monocytes, macrophages, B cells, T cells, mast cells, neutrophils, eosinophils, and basophils.

   150. A protein of claim 149 characterized in that said induction of one or more immune effector cells leads to antibody-dependent cell-mediated cytotoxicity or the release of one or more biologically active molecules.

   151. A protein of claim 147 that is capable of cellular activation, wherein said activation leads to changes in cellular transcriptional activity.

   152. A protein of claim 151 characterized in that said cellular transcriptional activity is increased.

   153. A protein of claim 151 characterized in that said cellular transcriptional activity is reduced.

   154. A protein of claim 147 characterized in that said one or more biologically active molecules is a protease.

   155. A protein of claim 147 characterized in that said one or more biologically active molecules is a cytokine.

   156. A protein of claim 155 characterized in that said cytokine is selected from monoquinas, lymphokines, chemokines, growth factors, colony stimulation factors, interferons, and interleukins.

   157. A protein of claim 147 which is capable of neutralizing an infectious agent, wherein said infectious agent is a bacterium, a virus, a parasite, or a fungus. 15d.A protein of claim 147 protein A that is capable of neutralizing a toxin, wherein said toxin is selected from endotoxins and exotoxins.

   159. A protein of claim 147 which is capable of neutralizing a toxin, wherein said toxin is an exotoxin selected from anthrax toxin, cholera toxin, diphtheria toxin, pertussis toxin, E. coli LT heat-labile Toxin, Heat stable toxin E coli ST, Pseudomonas exotoxin shiga A toxin, botulinum toxin, tetanus toxin, Bordetella pertussis Toxin AC, and Bacillus anthracis EF. '

   160. A protein of claim 147 which is capable of neutralizing a toxin, characterized in that said toxin is an endotoxin selected from saxitoxins, tetrodotoxin, fungus toxins, aflatoxins, pyrrolizidine alkaloids, phytohemagglutinins, and grayanotoxins.

   161. A protein of claim 116 characterized in that said binding domain polypeptide it comprises a light chain variable region adhered to said heavy chain variable region by a binding domain linker, wherein said binding domain linker comprises one or more peptides having a Gly-Gly-Gly-Gly-Ser sequence.

   162. A protein of claim 116 comprising three Gly-Gly-Gly-Gly-Ser peptides.

   163. A protein of claim 116 characterized in that said binding domain polypeptide comprises engineered or wild-type immunoglobulin variable region obtained from selected species of human, murine, rat, pig, and monkey.

   164. A protein of claim 116 characterized in that said protein is capable of binding to an intracellular target to effect a cellular function. \

   165. A protein of claim 116 characterized in that said truncated N-terminal immunoglobulin heavy chain constant polypeptide comprises an IgG CH2 constant region polypeptide adhered to a immunoglobulin heavy chain IgG CH3 constant region polypeptide.

   166. A protein of claim 116 characterized in that said immunoglobulin heavy chain constant region polypeptide is -without a functionally active CHl domain.

   167. A protein of claim 116 said truncated N-terminal immunoglobulin heavy chain constant polypeptide consists essentially of an IgG CH2 constant region polypeptide adhered to an IgG CH3 immunoglobulin heavy chain constant region polypeptide.

   168. A protein of claim 116 which comprises at least a portion of a human constant region.

   169. A protein of claim 116 characterized in that said connection region comprises a pivotal region of natural occurrence selected from a human pivot or portion thereof, human IgG pivot or a portion thereof, human IgA pivot or a portion thereof, IgE pivot human or a portion thereof, camelid pivot region or a portion thereof, Flame pivot region IgGl or portion thereof, nurse shark pivot region or portion thereof, and ratfish pivot region or portion thereof this.

   170. A protein of claim 116 characterized in that said connection region comprises a human IgE pivot or a portion thereof.

   171. A protein of claim 116 characterized in that said connection region comprises a pivot region IgG1, IgG2, IgG4 or human IgG4 having one or zero cysteine residue.

   172. A protein of claim 116 characterized in that said connection region comprises a region \ of human IgGA pivot that has between zero and two cysteine residues.

   173. A protein of claim 116 characterized in that said connection region comprises a wild type human IgGl immunoglobulin pivot region.

   174. A protein of claim 116 characterized in that said connection region comprises a glycosylation site.

   175. A protein of claim 116 characterized in that said connection region has no cysteine residues capable of forming disulfide bonds.

   176. A protein of claim 116 characterized in that said connection region has a cysteine residue.

   177. A protein of claim 116 characterized in that said connection region comprises an immunoglobulin pivot region polypeptide mutated wild type comprising no more than a cysteine residue.

   178. A protein of claim 116 characterized in that said connection region is altered such that said protein has a reduced ability to dimerize.

   179. A protein of claim 116 characterized in that said connection region comprises a proline and first, second, and third residues of cltein, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said cysteine. said third cysteine, said third cysteine residue is N-terminal to said proline residue.

   180. A protein of claim 179 characterized in that said single chain protein comprises a CTL-4 single chain Fv binding domain, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGI wherein the proline is replaced by serine at position 238 in said CH2 domain.

   181. A protein of claim 179 characterized in that said single chain protein comprises a CTL-4 single chain Fv binding domain and said heavy chain constant region comprises CH2 and CH3 domains of IgGI.

   182. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain FC2-2, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGj.

   183. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain UCHL-1, where in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises IgG-CH2 and CH3 domains.

   184. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 5B9, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgCi.

   185. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7 scFv, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   186. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said proline residue is replaced by serine, said heavy chain constant region comprises CH2 domains and CH3 of IgGi.

   187. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv 2H7 comprising a connecting region wherein said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi wherein phenylalanine is replaced by tyrosine at position 405 in said CH3 region.

   188. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGx wherein phenylalanine is replaced by alanine at position 405 in said CH3 region.

   189. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi where tyrosine is replaced by alanine at position 407 in said CH3 region.

   190. A protein of claim 189 having an apparent molecular weight of about 75 kDa.

   191. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein \ in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of igGi wherein phenylalanine is replaced by alanine at position 405 and tyrosine is replaced by alanine at position 407 in said CH3 region.

   192. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGx.

   193. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said first and third cysteine residues are replaced by serine and said The proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   194. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said first and second cysteine residues are replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi.

   195. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv 2H7 comprising a connecting region wherein said second cysteine residue is replaced by serine and said proline residue is replaced by serine, said constant region Heavy chain comprises CH2 and CH3 domains of IgG ?.

   196. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv 2H7 comprising a region of Wherein said third cysteine residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi.

   197. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7, wherein in the connection region said first cysteine residue is replaced by serine, and wherein said heavy chain constant region it comprises the Fv CH2 and CH3 domains of single chain 2H7.

   198. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain HD37, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi.

   199. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7 and said heavy chain constant region comprises CH2 and CH3 constant region polypeptides of IgGi flame.

   200. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7 and said heavy chain constant region comprises CH2 and CH3 constant region polypeptides of flame IgGl.

   201. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2H7 and said heavy chain constant region comprises CH2 and CH3 constant region polypeptides of flame IgG3.

   202. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain CD-16-6, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region .

   203. A protein of claim 179 characterized in that said single chain protein comprises a CD-16 receptor binding domain, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region.

   204. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain 2el2, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said proline residue it is replaced by serine, \ said heavy chain constant region comprises igGi CH2 and CH3 domains where the proline is replaced by serine at position 238 in said CH2 region, and wherein said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane tail domains CD80 .

   205. A protein of claim 179. characterized in that said single chain protein comprises a single chain Fv binding domain 10A8 scFv, wherein in the connection region said first, second, and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprises IgGi CH2 and CH3 domains where the proline is replaced by serine at position 23d in said CH2 region, and wherein said CH3 domain adheres to a gue polypeptide. it comprises domains of cytoplasmic and transmembrane tail CD80.

   206. A protein of claim 179 characterized by said single chain protein comprising a single chain Fv binding domain of a hybridoma 40.2.36, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGa where the proline is replaced by serine at position 238 in said CH2 region, and wherein said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane CD80 tail domains.

   207. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region, and wherein said CH3 domain adheres to a polypeptide \ which comprises domains of cytoplasmic and transmembrane tail CD80.

   208. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a G19-4 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region, and wherein said CH3 domain adheres to a polypeptide which comprises domains of cytoplasmic and transmembrane tail CD80.

   209. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a G19-4 hybridoma, said heavy chain constant region comprising CH2 and CH3 domains of IgG? wherein said CH3 domain adheres to a gue polypeptide it comprises domains of cytoplasmic and transmembrane CDdO tail.

   210. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgG ?, wherein said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane domains CDdO.

   211. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 domains and IgGi CH3 wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain adheres to a polypeptide comprising the cytoplasmic tail and mFADD transmembrane domains.

   212. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgG ?, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic tail and mFADD transmembrane domains.

   213. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridel 2el2, wherein in the connection region said first, second and third residues- \ cysteine are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains mcasp3 .

   214. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising IgGi CH2 and CH3 domains where the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain adheres to a polypeptide comprising the domains of cytoplasmic and transmembrane tail mcasp3.

   215. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises domains CH2 and CH3 of igGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and mcaspd transmembrane tail domains. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 236 in said CH2 region and said CH3 domain is adhered to a polypeptide comprising the cytoplasmic and transmembrane tail mcaspd. \

   217. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp3.

   213. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp3.

   219. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of i Gi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp8.

   220. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said region Heavy chain constant comprises CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain is adhered to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp8.

   221. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2 hybridoma, said heavy chain constant region comprising the CH2 and CH3 domains of IgGi wherein said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane CD80 tail domains.

   222. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma lDd, wherein in the connection region said first, second and third, cysteine residues are replaced by serine and said proline residue is replaced by serine, said region Heavy chain constant comprises CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain is adhered to a polypeptide comprising cytoplasmic and transmembrane domains CDdO.

   223. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 scFv hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said The proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane CD80 domains.

   224. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma lDd, wherein in the connection region said first, second and third residues of cysteine are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain is adhered to a polypeptide comprising the cytoplasmic tail and transmembrane mFADD domains.

   225. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and mFADD transmembrane tail domains.

   226. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of an IDd hybridoma, wherein in the connection region said first, second and third 'residues of cysteine are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane domains mcasp3. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of an iDd hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising IgGi CH2 and CH3 domains where the proline is replaced by serine at position 23d in said CH2 region and said CH3 domain adheres to a polypeptide comprising the domains of cytoplasmic and transmembrane tail mcasp3.

   226. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane mcaspd tail domains.

   229. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains mcaspd.

   230. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp3.

   231. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of an iDd hybridoma, wherein in the connection region said first, second and third 'residues of cysteine are replaced by serine and said proline residue is replaced by serine, said region . Heavy chain constant comprises CH2 and CH3 domains of IgGa wherein the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain is adhered to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcasp3.

   232. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said residue of proline is replaced by serine, said heavy chain constant region comprising CH2 and CH3 domains of IgGi, wherein said CH3 domain adheres to a polypeptide comprising the cytoplasmic and transmembrane tail domains hcaspd.

   233. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D3 hybridoma, wherein in the connection region \ said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises IgGi CH2 and CH3 domains where the proline is replaced by serine at position 238 in said CH2 region and said CH3 domain adheres to a polypeptide comprising the cytoplasmic tail and transmembrane hcaspd domains.

   2. 34. A protein of claim 179 characterized in that said single chain protein comprises a single chain Fv binding domain L6, wherein in the connection region said first, second and third cysteine residues are replaced by serine and said proline residue is replaced by serine, said heavy chain constant region comprises CH2 and CH3 domains of IgGi.

   235. A protein of claim 179, characterized in that said single chain protein comprises a single chain Fv G26-1 comprising a connection region where said first, second, and third cysteine residues are replaced by serine and said proline residue is replaced by serine, wherein said heavy chain constant region comprises the single chain Fv CH2 and CH3 domains G28-1.

   236. A method for reducing a population of target cells in a subject comprising administering to said subject a therapeutically effective amount of a protein that is less than about 150kD comprising the steps of a) treating the target cell population with a first protein or peptide that binds to cells within said target cell population, and b) treat the target cell population with a second protein or peptide that is capable of at least one of i) binding a Fe receptor, ii) inducing cell apoptosis target, or iii) fix complements, wherein said first protein or peptide molecule is directly connected to said second protein or peptide molecule or, optionally, said first protein or peptide molecule and said second protein or peptide molecule are linked by a third protein molecule or peptide, and wherein said protein molecule is not an antibody, a member of the TNF family or the TNF receptor family, and is not conjugated with a bacterial toxin, a cytotoxic drug, or a radioisotope.

   237. A method for reducing a population of target cells in a subject comprising administering to said subject a therapeutically effective amount of a protein that is less than about 150kD consisting essentially of the steps of a) treating the target cell population with a first protein or peptide that binds to cells within said target cell population; and b) treat the target cell population with a second protein or peptide that is capable of at least one of i) binding a Fe receptor, ii) inducing apoptosis of target cell, or iii) fix complement, wherein said first protein or peptide molecule is directly connected to said second protein or peptide molecule or, optionally, said first protein or peptide molecule and said second protein or peptide molecule is they bind by a third molecule of protein or peptide, and wherein said protein molecule is not an antibody, a member of the TNF family or the TNF receptor family, and is not conjugated with a bacterial toxin, a cytotoxic drug, or a radioisotope.

   238. A non-naturally occurring single chain protein comprising i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprising a light chain variable region comprising one or more eliminations or amino acid substitutions; ii) a second polypeptide comprising a binding region adhered to said first polypeptide; and iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said unnaturally occurring single chain protein is capable of at least one immunological activity.

   239. A non-naturally occurring single chain protein comprising i) a first polypeptide having a binding domain polypeptide capable of binding to a target molecule, said binding domain polypeptide comprising a light chain variable region comprising one or more amino acid deletions or substitutions at positions 12, 80, 81, 83, 105, 106, and 107; ii) a second polypeptide comprising a binding region adhered to said first polypeptide; and iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said unnaturally occurring single chain protein is capable of at least one immunological activity.

   240. A protein of claim 238 characterized in that one or more amino acid deletions or substitutions in said light chain variable region is effective to increase the expression or stability of said protein related to a protein without said elilmination or substitution. \

   241. A protein of claim 238 characterized in that said binding domain polypeptide is a single chain Fv.

   242. A protein of claim 238 characterized in that said binding domain polypeptide comprises an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.

   243. A protein of claim 242 further comprising a second binding domain polypeptide capable of binding a second target molecule; said second binding domain polypeptide comprises an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.

   244. A protein of claim 241 characterized in that said binding domain polypeptide is a single chain Fv and said light chain variable region of said single chain Fv has a elimination or substitution of amino acid at position 106.

   245. A protein of claim 241 characterized in that said binding domain polypeptide is a single chain Fv and the amino acid at position 106 of the heavy chain variable region of said single chain Fv has been deleted.

   246. A protein of claim 238 characterized in that said binding domain polypeptide is a single chain Fv and said light chain variable region of said single chain Fv has an amino acid substitution at position 106.

   247. A protein of claim 244 characterized in that the leucine is replaced by serine at the position of 106.

   248. A protein of claim 244 characterized by leucine is replaced by des-leucine at the position of 106.

   249. A protein of claim 244 characterized by the amino acid being replaced by the amino acid at position 106 of the light chain variable region single chain Fv is selected from serine, threonine, cysteine, tyrosine, asparagine, glutamine, aspartic acid, glutamic acid , lysine, arginine, and histidine.

   250. A protein of claim 244 characterized by said binding domain polypeptide is a single chain Fv comprising a heavy chain variable region, wherein said heavy chain variable region has an amino acid substitution at amino acid position 11.

   251. A protein of claim 241 characterized in that said -union domain polypeptide binds to a tumor antigen.

   252. A protein of claim 241 characterized in that said binding domain polypeptide binds to an antigen in an immune effector cell.

   253. A protein of claim 241 characterized in that said binding domain polypeptide binds to a cancer cell antigen.

   254. A protein of claim 253 characterized in that said cancer cell antigen is a surface antigen.

   255. A protein of claim 253 characterized in that said cancer cell antigen is an intracellular antigen.

   256. A protein of claim 238 characterized in that said binding domain polypeptide binds to a B-cell antigen.

   257. A protein of claim 256 characterized in that said B cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CDdO, and CDd6. 25d.A protein of claim 241 characterized in that said single chain Fv binds to a B cell antigen.

   259. A protein of claim 258 characterized in that said B-cell antigen is selected from CD19, CD20, CD22, CD37, CD40, CD80, and CD86.

   260. A protein of claim 259 characterized by said single chain Fv is selected from Single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, and single chain Fv 4.4.220.

   261. A protein of claim 238 characterized by said binding domain polypeptide is a -scFv that binds to a B cell differentiation antigen.

   262. A protein of claim 261 wherein said B-cell antigen is selected from CD19, CD20, CD22, CD37, and CD40.

   263. A protein of claim 238 characterized by said binding domain polypeptide is attached to a target selected from CD2, CD3, CD4, CD5, CD6, CD8, CD10, CDII, CD14, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD28, CD30, CD37, CD40, CD43, CD50 (ICAM3), CD54 (ICAMl), CD56, CD69, CDdO, CD6, CD134 (OX40), CD137 (41BB) CD152 (CTLA-4), CD153 (ligand CD30), CD154 (ligand CD40), ICOS, L6, B7-H1, and HLA class II.

   264. A protein of claim 238 characterized in that said protein is capable of forming a complex comprising two or more of said proteins.

   265. A protein of claim 264 wherein said complex is a dimer.

   266. A protein of claim 238 characterized by said protein is a monomer.

   267. A protein of claim 238 characterized by said immunological activity is selected from antibody-dependent cell-mediated cytotoxicity, complement fixation, induction of apoptosis, induction of one or more biologically active signals, induction of one or more cells immune effectors, activation of cellular differentiation, cellular activation, release of one or more biologically active molecules, and neutralization of an infectious agent or toxin.

   268. A protein of claim 267 that is capable of induction of biologically active signals by activation or inhibition of one or more molecules selected from protein kinase, protein phosphatase, G-proteins, cyclic nucleotides or other second messengers, ion channels, and protein components. secretory trajectory.

   269. A protein of claim 267 that is capable of inducing one or more immune effector cells selected from NK cells, monocytes, macrophages, B cells, T cells, mast cells, neutrophils, eosinophils, and basophils.

   270. A protein of claim 267 characterized in that said induction of one or more immune effector cells leads to cell-mediated cytotoxicity \ dependent on antibody or the release of one or more biologically active molecules.

   271. A protein of claim 267 that is capable of cellular activation, wherein said activation leads to changes in cellular transcriptional activity.

   272. A protein of claim 271 characterized in that said cellular transcriptional activity is increased.

   273. A protein of claim 271 characterized in that said cellular transcriptional activity is reduced.

   274. A protein of claim 267 characterized in that said one or more biologically active molecules is a protease.

   275. A protein of claim 267 characterized in that said one or more biologically active molecules is a cytokine.

   276. A protein of claim 275 characterized in that said cytokine is selected from monoquinas, lymphokines, chemokines, growth factors, colony stimulation factors, interferons, and interleukins.

   277. A protein of claim 267 which is capable of neutralizing an infectious agent, wherein said infectious agent is a bacterium, a virus, a parasite, or a fungus.

   278. A protein of claim 267 that is capable of neutralizing a toxin, characterized in that said toxin is selected from endotoxins and exotoxins.

   279. A protein of claim 267 which is capable of neutralizing a toxin, wherein said toxin is an exotoxin selected from anthrax toxin, cholera toxin, diphtheria toxin, pertussis toxin, LT toxin heat-resistant E. coli, heat stable toxin E coli ST, shiga toxin Pseudoinones Exotoxin A, botulinum toxin, tetanus toxin, Bordetella pertussis Toxin AC, and Bacillus anthracis EF.

   280. A protein of claim 267 which is capable of neutralizing a toxin, characterized in that said toxin is an endotoxin selected from saxitoxins, tetrodotoxin, fungal toxins, aflatoxins, pyrrolizidine alkaloids, phytohemagglutinins, and grayanotoxins.

   281. A protein of claim 238, characterized in that said protein is capable of binding to an intracellular target to effect a cellular function.

   282. A protein of claim 238 characterized in that said truncated N-terminal immunoglobulin heavy chain constant polypeptide comprises an IgG CH2 constant region polypeptide adhered to a immunoglobulin heavy chain IgG CH3 constant region polypeptide.

   283. A protein of claim 23d characterized in that said truncated N-terminal immunoglobulin heavy chain constant polypeptide consists essentially of an IgG CH2 constant region polypeptide adhered to an IgG CH3 immunoglobulin heavy chain constant region polypeptide.

   284. A protein of claim 238 comprising at least a portion of a human constant region.

   285. A protein of claim 23d characterized in that said connection region comprises a pivotal region of natural occurrence selected from a human pivot or portion thereof, human IgG pivot or a portion thereof, human IgA pivot or a portion thereof, pivot igE or a portion thereof, camelid pivot region or a portion thereof, flame pivot region IgGl or portion thereof, nurse shark pivot region or portion thereof, and ratfish pivot region or portion thereof this.

   286. A protein of claim 238 characterized in that said connection region comprises a human IgE pivot or a portion thereof.

   287. A protein of claim 238 characterized in that said connection region comprises a pivot region IgG1, IgG2, IgG3 or human IgG4 having either zero or a cysteine residue.

   288. A protein of claim 238 characterized in that said connection region comprises a human IgGA pivot region having between zero and two cysteine residues.

   289. A protein of claim 238 characterized in that said connection region comprises a wild type human IgGl immunoglobulin pivot region.

   290. A protein of claim 238 characterized in that said connection region comprises a glycosylation site.

   291. A protein of claim 238 characterized in that said connection region has no cysteine residues capable of forming disulfide bonds.

   292. A protein of claim 238 characterized by said connection region having a cysteine residue.

   293. A protein of claim 238 characterized in that said connection region comprises a mutated wild-type immunoglobulin pivot region polypeptide comprising no more than one cysteine residue.

   294. A protein of claim 236 characterized in that said connection region is altered so that said protein has a reduced ability to dimerize.

   295. A protein of claim 238 characterized in that said connection region comprises a proline and first, second, and third cysteine residues, wherein said first cysteine residue is N- terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine, said third cysteine residue being N-terminal to said proline residue.

   296. A single chain unnatural occurrence protein, which includes a first polypeptide comprising a binding domain polypeptide capable of binding to a target molecule, a second polypeptide comprising a binding region adhered to said first polypeptide, said binding region comprises at least a portion of an IgA pivot region, a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, and wherein said non-naturally occurring single chain protein is capable of of at least one immunological activity.

   297. A protein of claim 296 characterized in that said binding domain polypeptide comprises a chain variable region polypeptide light immunoglobulin and an immunoglobulin heavy chain variable region polypeptide.

   298. A protein of claim 297 further comprising a second binding domain polypeptide capable of binding a second target molecule, said second binding domain polypeptide comprising an immunoglobulin light chain variable region polypeptide and a variable chain region polypeptide heavy immunoglobulin.

   299. A protein of claim 296 characterized in that said connection region consists essentially of at least a portion of an IgA pivot region.

   300. A protein of claim 296 characterized in that said connection region consists essentially of an IgA pivot region.

   301. A protein of claim 300 which is expressed as a protein having an apparent molecular of at least about 70 kDa.

   302. A protein of claim 300 that is expressed as a protein having an apparent molecular of between about 70 kDa and about 700 kDa.

   303. A protein of claim 296 characterized in that said connection region comprises between 10 to 50 amino acids.

   304. A protein of claim 296 characterized in that said connection region comprises a modified human IgA immunoglobulin pivot region polypeptide.

   305. A protein of claim 296 characterized in that said connection region has only one cysteine residue.

   306. A protein of claim 296 characterized in that said connection region has two cysteine residues.

   307. A protein of claim 296 characterized in that said N-terminal truncated immunoglobulin heavy chain constant region polypeptide in the third polypeptide comprises immunoglobulin IgA heavy chain constant regions.

   308. A protein of claim 307 comprises CH2 and CH3 domains of immunoglobulin IgA heavy chain constant regions.

   309. A protein of claim 308 characterized by said constant region domain IgA CH3 comprises a substitution or deletion in one or more amino acids that gives the IgA heavy chain constant region unable to associate with a J chain polypeptide.

   310. A protein of claim 308 characterized in that said IgA heavy chain constant region is capable of associating with a J chain polypeptide.

   311. A protein of claim 309 characterized in that said IgA CH3 region domain comprises a deletion between four and twenty amino acids.

   312. A protein of claim 309 characterized in that said IgA region domain comprises a deletion of four amino acids.

   313. A protein of claim 309 characterized. because said IgA region domain comprises a deletion of twenty amino acids.

   314. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain L6, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprising CH2 domains and CH3 of IgGi.

   315. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of an L6 hybridoma, wherein the connection region \ comprising an igA pivot region or portion thereof, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   316. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a CTLA-4 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said constant region of Heavy chain comprises murine IgA CH2 and CH3 domains.

   317. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a CTLA-4 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said constant region of Heavy chain comprises CH2 and CH3 domains of murine IgA and said CH3 comprises a deletion or substitution at four amino acids which gives the IgA heavy chain constant region unable to associate with a J chain polypeptide.

   318. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprises CH2 and CH3 domains of murine IgA.

   319. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, said connection region comprising an IgA pivot or portion thereof, and said heavy chain constant region comprising CH2 domains. and IgA CH3, wherein said CH3 comprises an elimination or substitution at eighteen amino acids that gives the IgA heavy chain constant region unable to associate with a J-chain polypeptide.

   320. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma 2el2, said connection region comprises a igA pivot or portion thereof, and said heavy chain constant region comprises IgA CH2 and CH3 domains, wherein said CH3 comprises a deletion or substitution at four amino acids that gives the chain constant region Heavy IgA unable to associate with a J chain polypeptide and said CH3 domain adheres to a polypeptide comprising cytoplasmic and transmembrane CDdO tail domains. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridel 2el2, said connection region comprising an IgA pivot or portion thereof, said heavy chain constant region comprising CH2 domains and CH3 of IgA, wherein said CH3 comprises a deletion or substitution at four amino acids that gives the IgA heavy chain constant region unable to associate with a J chain polypeptide and said CH3 domain adheres to a polypeptide comprising cytoplasmic tail domains and transmembrane CD80.

   322. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a 1D8 hybridoma, said connection region comprising an IgA pivot or portion thereof, said heavy chain constant region comprising CH2 domains and CH3 of IgA, wherein said CH3 comprises a deletion or substitution at four amino acids that gives the IgA heavy chain constant region unable to associate with a J chain polypeptide and said CH3 domain adheres to a polypeptide comprising cytoplasmic tail domains and transmembrane CD80.

   323. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a G28-1 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said constant region of Heavy chain comprises CH2 and CH3 domains of IgGi.

   324. A protein of claim 296 characterized by said single chain protein comprises a \ single chain Fv binding domain of a 2H7 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprising CH2 and CH3 domains of IgGi.

   325. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2H7 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprises CH2 and CH3 domains of IgA, wherein said CH3 comprises a deletion or substitution at four amino acids that gives the IgA heavy chain constant region unable to associate with a J chain polypeptide and said CH3 domain adheres to a polypeptide comprising domains of cytoplasmic and transmembrane tail CD80.

   326. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of a hybridoma 2H7, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprising IgA CH2 and CH3 domains, wherein the IgA heavy chain constant region is capable of associating with a polypeptide chain J.

   327. A protein of claim 296 characterized in that said single chain protein comprises a single chain Fv binding domain of an HD37 hybridoma, wherein the connection region comprises an IgA pivot region or portion thereof, said heavy chain constant region comprises CH2 and CH3 domains of IgA.

   328. A non-naturally occurring single chain protein comprising i) a first polypeptide comprising a binding domain polypeptide capable of binding to a target molecule, and ii) a second polypeptide comprising at least a portion of a constant region polypeptide heavy chain immunoglobulin Ig? adhered to the second polypeptide, wherein said single chain protein of Unnatural occurrence is capable of at least one immunological activity.

   329. A protein of claim 328 characterized in that said binding domain polypeptide comprises a non-Ig? Variable region.

   330. A protein of claim 328 characterized by said binding domain polypeptide is a single chain Fv selected from single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, FC2-2, UCHL-1, 5B9, L6, 10A8, 2el2, 40.2.36, G19-4, 1D8, and single chain Fv 4.4.220.

   331. A protein of claim 328 characterized in that said binding domain polypeptide comprises an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.

   332. A protein of claim 331 which further comprises a second binding domain polypeptide capable of binding a second target molecule, said second binding domain polypeptide comprising an immunoglobulin light chain variable region polypeptide and an immunoglobulin heavy chain variable region polypeptide.

   333. A protein of claim 332 characterized in that said heavy and light immunoglobulin chains comprise heavy and light chains of immunoglobulin IgG or a portion thereof.

   334. A protein of claim 328 characterized in that said binding domain polypeptide comprises at least a portion of a variable region of immunoglobulin IgG.

   335. A protein of claim 334 characterized by said variable region IgG comprises a heavy chain variable region and a light chain variable region.

   336. A protein of claim 328 which is capable of binding to a specific Fe receptor for IgE.

   337. A protein of claim 328 which has no variable chain region IgE.

   338. A protein of claim 328 characterized in that the binding domain consists essentially of a light chain region of igG immunoglobulin and a heavy and light chain region of immunoglobulin IgG.

   339. A protein of claim 328 characterized in that said IgE immunoglobulin heavy chain constant region polypeptide comprises CH2 and CH3 domains.

   340. A protein of claim 328 characterized in that said immunoglobulin Ig? Heavy chain constant region polypeptide. it comprises the domains CH2, CH3 and CH.

   341. A protein of claim 328 characterized in that said binding domain polypeptide is a single chain Fv comprising a variable region of heavy chain, wherein said heavy chain variable region has an amino acid substitution at amino acid position 11.

   342. A protein of claim 328 characterized in that said single chain protein is a single chain Fv selected from single chain Fv HD37, single chain Fv 2H7, single chain Fv G28-1, and single chain Fv 4.4.220.

   343. A protein of claim 328 characterized in that said single chain protein is a single chain Fv comprising a single chain Fv 2H7 or a single chain Fv G28-1.

   344. A method for reducing a target cell population in a subject comprising administering to said subject a therapeutically effective amount of a single chain non-naturally occuring protein, said protein comprises a first polypeptide comprising a binding domain polypeptide, said Binding domain polypeptide comprises at least a portion of a variable region IgG and is capable of binding to a target molecule, a second polypeptide comprises a binding region adhered to said first polypeptide, a third polypeptide comprises a IgG immunoglobulin heavy chain constant region polypeptide. adhered to the second polypeptide, wherein said single-stranded protein of unnatural occurrence is capable of at least one immunological activity.

   3. 4. 5. The method of claim 344 characterized in that said protein is administered into the blood stream to a patient.

   346. The method of claim 344 characterized by monocytes being activated but mast cells are not activated as a result of the administration of the protein.

   347. The method of claim 344 characterized by the protein being administered or co-administered with a histamine release blocker.

   348. A method for depleting cells in an animal that comprises administering a modified IgE protein into the bloodstream of an animal.

   349. The method of claim 348 characterized in that the modified IgE protein is administered or coadministered with a histamine release blocker.

   350. A protein of claim 328 characterized in that said connection region comprises an IgG pivot or portion thereof, and said heavy chain constant region of IgE and comprises the CH2, CH3, and CH4 domains without a CH2 domain.

   351. A protein of claim 328 characterized in that said single chain protein comprises a single chain Fv binding domain of a 2el2, and said heavy chain constant region comprises the Ig? CH2, CH3, and CH4, and wherein said heavy chain constant region adheres to a polypeptide comprises the cytoplasmic tail and CD80 transmembrane domains.

   352. A single-stranded protein of non-natural occurrence comprises: i) a first polypeptide which has a binding domain polypeptide capable of binding a target molecule; ii) a second polypeptide comprising a binding region adhered to said first polypeptide, said connection region comprising three cysteine residues and one proline residue, wherein one or more said cysteine residues are removed or replaced; and iii) a third polypeptide comprising an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said unnaturally occurring single chain protein is capable of at least one immunological activity.

   353. A protein of claim 352 characterized in that said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine , where said The third cysteine residue is not replaced or eliminated, and wherein said second and third cysteine are replaced or eliminated.

   354. A protein of claim 353 characterized in that said second and third cysteine residues are replaced by another amino acid.

   355. A protein of claim 354 characterized in that said second and third cysteine residues are replaced by serine residues.

   356. A protein of claim 352 which is expressed as a homogeneous protein having an apparent molecular weight of about 75 kDa.

   357. A protein of claim 352 characterized in that said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine , wherein said first cysteine residue is replaced or eliminated.

   358. A protein of claim 352 characterized in that said second and third cysteine residues in said connection region are not replaced or eliminated.

   359. A protein of claim 352 characterized in that said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N-terminal to said third cysteine , wherein said second cysteine residue is replaced or eliminated.

   360. A protein of claim 352 characterized in that said first and third cysteine residues in said connection region are not replaced or eliminated.

   361. A protein of claim 352 characterized in that said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine and said second cysteine is N- terminal to said third cysteine, wherein said third cysteine residue is replaced or deleted.

   362. The protein of claim 10 characterized in that said first and second cysteine residues in said connection region are not replaced or eliminated.

   363. A protein of claim 352 characterized in that said connection region comprises between 5 and 65 amino acids.

   364. A protein of claim 352 characterized in that said connection region comprises between 10 and 50 amino acids.

   365. A protein of claim 352 characterized in that said connection region comprises between 15 and 35 amino acids.

   366. A protein of claim 352 characterized in that said connection region comprises at least five amino acids of consecutive pivot region.

   367. A protein of claim 352 characterized in that said connection region comprises at least ten consecutive pivot region amino acids.

   368. A protein of claim 352 characterized in that said connection region comprises at least fifteen amino acids of consecutive pivot region.

   369. A protein of claim 353 characterized in that said second and third cysteines are replaced by serine residues and said connection region comprises at least a portion of an IgGi pivot region.

   370. A protein of claim 369 characterized in that said connection region comprises at least 5 consecutive amino acids of an IgGi pivot region.

   371. A protein of claim 353 characterized in that said second and third cysteines are replaced by serine residues and said region of \ The connection comprises at least a portion of a pivot region IgG2.

   372. A protein of claim 371 characterized in that said connection region comprises at least 5 consecutive amino acids of a pivot region IgG2.

   373. A protein of claim 353 characterized in that said second and third cysteine residues are replaced by serine residues and said connection region comprises at least a portion of an IgG3 pivot region.

   374. A protein of claim 373 characterized by said connection region comprising at least 5 consecutive amino acids of an IgG3 pivot region.

   375. A protein of claim 353 characterized in that said second and third cysteine residues are replaced by serine residues and said region connection comprises at least a portion of a pivot region IgG4.

   376. A protein of claim 375 characterized in that said connection region comprises at least 5 consecutive amino acids of an IgG4 pivot region.

   377. A protein of claim 352 characterized in that said second and third cysteine residues are substituted or deleted and said proline residue is replaced or deleted, wherein said heavy chain constant region polypeptide comprises a CH3 domain where tyrosine is replaced by alanine at position 407, and wherein said protein has an apparent molecular weight of about 75 kDa.

   378. A protein of claim 352 characterized in that said first and third cysteine residues are substituted or deleted and said proline residue is replaced or deleted, wherein said heavy chain constant region polypeptide. comprises a CH3 domain where tyrosine is replaced by alanine at position 407, and wherein said protein has an apparent molecular weight of about 75 kDa. A single chain unnatural occurrence protein, which includes a first polypeptide comprising a binding domain polypeptide capable of binding to a target molecule, a second polypeptide comprising a binding region adhered to said first polypeptide, a third polypeptide that comprises an N-terminal truncated immunoglobulin heavy chain constant region polypeptide adhered to the second polypeptide, wherein said connection region comprises first, second, and third cysteine residues, wherein said first cysteine residue is N-terminal to said second cysteine residue and said second cysteine is N-terminal to said third cysteine, wherein one of both of said second and third cysteine residues is replaced or deleted, and wherein said single-stranded protein of unnatural occurrence is capable of at least one immunological activity.

   380. A protein of claim 352 characterized in that said connection region comprises a modified human IgGl immunoglobulin pivot region polypeptide.

   381. A protein of claim 352 characterized in that said connection region only has a cysteine residue.

   382. A protein of claim 381 characterized in that said connection region comprises a modified human IgGl immunoglobulin pivot region polypeptide.

   383. A protein of claim 352 characterized in that. said N-terminal truncated immunoglobulin heavy chain constant polypeptide comprises an IgG CH2 constant region polypeptide adhered to an immunoglobulin heavy chain TgG CH3 constant region polypeptide.

   384. A protein of claim 352 characterized in that said polypeptide of constant region of The N-terminal truncated immunoglobulin heavy chain consists essentially of an IgG CH2 constant region polypeptide adhered to an immunoglobulin heavy chain IgG CH3 constant region polypeptide.

   385. A single chain unnatural occurrence protein, which includes a first polypeptide comprising a binding domain polypeptide capable of binding to a target molecule, a second polypeptide comprising a binding region adhered to said first polypeptide, and a third polypeptide comprising an immunoglobulin heavy chain CH2 constant region polypeptide and an immunoglobulin heavy chain CH3 constant region polypeptide, said CH3 constant region polypeptide comprises one or more amino acid substitutions or deletion that inhibits two such associated proteins together to form a non-covalent dimer, wherein said single-stranded protein of unnatural occurrence is capable of at least one immunological activity.

   386. A single-stranded protein of unnatural occurrence includes a first polypeptide comprising a polypeptide binding domain capable of binding to a target molecule, a second polypeptide comprising a binding region adhered to said first polypeptide, a third polypeptide comprising an immunoglobulin heavy chain CH2 constant region polypeptide and an immunoglobulin heavy chain CH3 constant region polypeptide, said CH3 constant region polypeptide comprises one or more amino acid substitutions or deletion at positions 405 and 407, wherein said protein Simple chain of non-natural occurrence is capable of at least one immunological activity.

   387. A protein of claim 252 or 253 comprising amino acid substitutions at position 405 and 407. 38d.A protein of claim 387 characterized in that phenylalanine is replaced with alanine in the position 405 and tyrosine is replaced with alanine at position 407.

   389. A protein of claim 387 having an apparent molecular weight of between about 40 kDa and about 50 kDa.

   390. A protein of claim 387 having a biological activity of an agonist or antagonist.

   391. A protein of claim 390 having a biological activity of an antagonist.

   392. A protein of claim 387 characterized in that only one amino acid at positions 405 and 407 is substituted.

   393. A protein of claim 392 having an apparent molecular weight of between about 70 kDa and about 80 kDa.

   394. A protein of claim 387 characterized in that phenylalanine is replaced by alanine at position 405.

   395. A protein of claim 387 characterized in that phenylananine is replaced by tyrosine at position 405.

   396. A protein of claim 386 characterized in that the tyrosine is replaced by alanine at position 407.

   397. A protein of claim 386 comprising amino acid substitutions at position 405 and 407.

   398. A protein of claim 393 characterized in that phenylananine is replaced by alanine at position 405 and tyrosine is replaced by alanine at position 407.

   399. A polynucleotide encoding a protein according to any one of claims 1, 8, 9, 12, 18, 30, and 112-109.

   400. A polynucleotide encoding a protein according to any one of claims 116, 120, 121, and 180-235.

   401. A polynucleotide encoding a protein according to any one of claims 238, 239, 296, 328, 352, 353, 385, and 366.

   402. A polynucleotide encoding a protein according to any one of claims 399-401 which is operably linked to a promoter or other sequence that enhances the expression of the polynucleotide in a cell.

   403. A cell containing a polynucleotide of any one of claims 399-401.

   404. A recombinant vector capable of expressing a protein according to any of claims 1, 8, 9, 12, ld, 30, and 112-109.

   405. A recombinant vector capable of expressing a protein according to any of claims 116, 120, 121, and ldO-235.

   406. A method for expressing a protein according to any one of claims 1, 8, -9, 12, 18, 30, and 1 12-109 according to conditions, in which the protein is expressed.

   407. A method for expressing a protein according to any one of claims 116, 120, 121, and 180-235 under conditions in which the protein is expressed.

   408. A method for expressing a protein according to any one of claims 238, 239, 296, 328, 352, 353, 385, and 386 according to conditions in which the protein is expressed.

   409. A composition comprising a protein according to any one of claims 238, 239, 296, 328, 352, 353, 385, and 386 in combination with one or more additional therapeutic compounds.

   410. A method for treating a subject comprising the steps of administering to said subject one or more first compounds according to any one of claims 238, 239, 296, 328, 352, 353, 385, and 386, administering or co-administering a second compound to the subject or in combination with said first compound, wherein the treatment is effective to treat or prevent a disease, insufficiency, or undesired condition.

   411. The method according to claim 410 characterized in that the second compound is selected from a chemotherapeutic compound, therapeutic drug, angiogenesis inhibitors, B cell activating steroids, T cell activators, colony stimulation factors, necrosis factor tumor, interferons, antibody, binding construct of the invention, gene therapy, retinoids, surgical procedures, alkylating agents, nucleoside analogs, topoisomerase II, VEGF, IFN-alpha, DMAR agents, interlukin-1, glucocorticoids, p3d inhibitors, interlukin-4, interluquina-6, interluquina-2 , interluquina-12, IFN- ?, GM-CSF, G-CSF, M-CSF, anti-CTLA-4, Bcl-2 antisense, vitamin A, anti-CDl9, anti-CD20, anti-CD22, anti-CD28 or anti-CD3.

   412. A method for displaying recombinant molecules, such molecules include an immunoglobulin heavy chain variable region constructed by engineering or native, the enhancement comprising an immunoglobulin heavy chain region that includes one or more mutations, substitutions, alterations and / or deletions. in one or more amino acid residues corresponding to positions 9, 10, 11, 12, 108, 110, and 112 in said heavy chain variable region.

   413. A non-naturally occurring single chain antigen binding protein comprises protein having a formula selected from 2H7 scFv VH Ll IS (CSC-S) H WCH2 WCH3, 2H7 scFv VH LHL 1 S IgE CH2 CH3 CH2CH3 CH2H7 scFv VH Lll S mlgE CH2 CH3 CH4, 2H7 scFv VH LllS WIgACH2 T4CH3, 2H7 scFv VH Ll 1S (SSS-S) H K322S CH2 WCH3, 2H7 scFv ßlH Ll I S- (CSS-S) H K322S CH2 WCH3, 2H7 scFv VH LllS (SSS-S) H P331S CH2 WCH3, 2HU scFv VH LllS (CSS-S) H P331S CH2 WCH3, 2H7 scFv VH LllS (SSS-S ) H T256N CH2 WCH3, 2H7 scFv VH Ll IS (SSS-S) H RTPE / QNAK (255-258) CH2 WCH3, 2H7 scFv VH LllS (SSS-S) H K290Q CH2 WCH3, 2H7 scFv VH Ll IS (SSS- S) H A339P CH2 WCH3, G28-1 scFv (SSS-S) H WCH2 WCH3, G28-1 scFv IgAH WCH2 WCH3, G28-1 scFv VH LllS (SSS-S) H WCH2 WCH3, G28-1 scFv VH Ll IS (CSS-S) H WGH2 WCH3, G28-1 scFv VH Ll IS (CSC-S) H WCH2 WCH3, G28-1 scFv VH LllS (SSC-P) H WCH2 WCH3, 'CTLA4 (SSS-S) H P23dSCH2 WCH32 , CTLA4 (CCC-P) WH WCH2 WCH3, FC2-2 scFv (SSS-S) H WCH2 WCH3, FC2-2 scFv VHL11S (SSS-S) H WCH2 WCH3, UCHL-1 SCFv (SSS-S) H WCH2 WCH3 , UCHL-1 scFv VHLllS (SSS-S) H WCH2 WCH3, 5B9 scFv (SSS-S) H WCH2 WCH3, 5B9 SCFv VHLllS (SSS-S) H WCH2 WCH3, 2H7 sc Fv (SSS-S) H WCH2 WCH3, 2H7 scFv (SSS-S) H P238SCH2 WCH3, 2H7 scFv IgAH WCH2 WCH3, 2H7 scFv IgAH WIgACH2 T4CH3, 2H7 scFv IgAH WIgACH2 WCH3 + JChain, 2H7 scFv (CCC-P) WH WCH2 WCH3, 2H7 scFv (SSS-S) H WCH2 F405YCH3, 2H7 scFv (SSS-S) H WCH2 F405ACH3, 2H7 scFv (SSS-S) H WCH2 Y407ACH3, 2H4 scFv (SSS-S) HWCJH2 F405A, Y407ACH3, 2H7 scFv (CSS-S) H WCH2 WCH3, 2H7 scFv ( SCS-S) H WCH2 WCH3, 2H7 scFv (SSC-P) H WCH2 WCH3, 2H7 scFv (CSC-S) H WCH2 WCH3, 2H7 scFv (CCS-P) H WCH2 WCH3, 2H7 scFv (SCC-P) H WCH2 WCH3, 2H7 scFv VH Ll IS (SSS-S) H WCH2 WCH3, 2H7 scFvVHLl IS (CSS-S) H WCH2 WCH3, G28-1 SCFv VH LllS (SCS-S) H WCH2 WCH3, G28-1 scFv VH LllS ( CCS-P) H WCH2 WCH3, G28-1 scFv VH Ll IS (SCC-P) H WCH2 WCH3, G28-1 scFv VH LllS mlgE CH2 CH3 CH4, G2d-1 scFv VH Ll IS mlgAH WIgACH2 T4CH3, G26-1 scFv VH Ll IS hlg? CH2 CH3 CH4, G26-1 scFv VH LllS hlgAH WIgACH2 T4CH3, HD37 scFv IgAH WCH2 WCH3, HD37 scFv (SSS-S) H WCH2 WCH3, HD37 scFv VH LllS (SSS-S) H WCH2 WCH3, L6 scFv IGAH WCH2 WCH3, L6 scFv VHL11S (SSS-S) H WCH2 WCH3, 2H7 scFv-flame IgG1, 2H7 scFv-flame IgG2, 2H7 scFv-flame IgG3, low CD16-6 (? D) (SSS-S) H P238SCH2 WCH3, high CD16-9 (? D) (SSS-S) H P238SCH2 WCH3, 2el2 scFv (SSS-s) H P238SCH2 WCH3-hCD80TM / CT, 10A8 scFv (SSS- s) H P23dSCH2 WCH3-hCD80TM / CT, 40. 2. 36 scFv (SSS-s) H P238SCH2 WCH3-hCDdOTM / CT, 2H7 scFv (SSS-s) H P23dSCH2. WCH3-hCD80TM / CT, G19-4 scFv (SSS-s) H P238SCH2 WCH3- hCD80TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3-hCD80TM / CT, 2el2 scFv IgAH IgACH2 T4CH3-hCD80TM / CT, 2el2 scFv IgE CH2CH3CH4-bCD80TM / CT, 2el2 scFv (SSS-s) H P238SCH2 WCH3-mFADD -TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3-mFADD-TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3 - mcasp3-TM / CT, 2el2 scFv (SSS-s) H P238SCH2 WCH3 -mcasp3-TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3-mcaspd-TM / CT, 2el2 scFv (SSS-s) H P238SCH2 WCH3-mcasp8-TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3-hcasp3-TM / CT, 2el2 scFv (SSS-s) H P236SCH2 WCH3-hcasp3-TM / CT, 2el2 scFv (SSS-s) H WCH2 WCH3-hcasp8-M / CT, 2el2 scFv (SSS-s) H P238SCH2 WCH3hcaspd-TM / CT, 1D8 scFv-hIgGl (SSS-s) H P233SCH2 WCH3-hCD80TM / CT, 1D8 scF -hlgGl (SSS-s) H WCH2 WCH3-hCD80TM / CT, 1D8 scFv-mIgAT4-hCD80TM / CT, 1D8 scFv-hIgE-hCD80TM / CT, 1D8 scFv-hlgGl (SSS-s) H P238SCH2 WCH3-mFADD-TM / CT, 1D8 SCFv-hlgGl (SSS-S) H WCH2 WCH3-mFADD-TM / CT, 1D8 scFv-hlgGl (SSS-s) H WCH2 WCH3- mcasp3 TM / CT, 1D8 scFv-hlgGl (SSS-s) H P238SCH2 WCH3-mcasp3-TM / CT, 1D8 scFv-hlgGl (SSS-s) H WCH2 WCH3-mc asp8 - TM / CT, 1D6 scFv - hIgGl (SSS-s) H P238SCH2 WCH3-mcasp8-TM / CT, 1D8 scFv-hlgGl (SSS-s) H WCH2 WCH3- hcasp3-TM / CT, 1D8 scFv-higGl (SSS-s) H P238SCH2 WCH3-hcasp3-TM / CT, 1D8 scFv-hlgGl (SSS-s) H WCH2 WCH3-hcasp8-TM / CT, 1D6 scFv-hIgGl (SSS-s) H P238SCH2 WCH3-hcasp8-TM / CT, L6 scFv (SSS-S) H WCH2 WCH3, 2H7 SCFv CD154 (L2), 2H7 scFv CD154 (S4), CTLA4 IgAH IGACH2CH3, CTLA4 IgAH IgACH2 T4CH3, 2H7 scFv IgAH IgACH2CH3, 2H7 scFv IgAH IgAHCH2 T18CH3, 2H &-40. 2. 220 scFv (SSS-S) H WCH2 WCH3 (anti-ccd20-anti-cd40 biespécifico), 2H7 scFv IgAH IgACH2 T4CH3-hCD89 TM / CT, G19-4 scFv (CCC-P) WH WCH2 WCH3-hCD89 TM / CT, and 2el2 scFv (CCC-P) WH WCH2 WCH3-hCDd9 TM / CT.