MXPA06000786A - Non-glycosylated human alpha-fetoprotein, methods of production, and uses thereof - Google Patents

Abstract

The invention features non-glycosylated human alpha-fetoprotein, methods of production, and uses thereof.

Description

HUMAN NON-GLUCOSE ALPHA-FETOPROTEIN, PRODUCTION METHODS AND USES OF THE SAME BACKGROUND OF THE INVENTION This invention relates to non-glycosylated human alpha-fetoprotein, its production in transgenic animals and plants and uses thereof. Alpha-fetoprotein (AFP) is a 70 kDa glycoprotein produced by the yolk sac and fetal liver. AFP is present in fetal serum at milligram levels and, at birth, declines to nanogram levels normally found in adult serum: increased serum AFP levels in adult serum are indicative of a yolk sac tumor, a hepatoma or liver regeneration. The role of AFP during fetal development is not known, although it has been suggested that AFP protects a pregnant fetus against a maternal immune attack or against the effects of maternal estrogen. In vitro and in vivo experiments have shown that AFP has both stimulatory and growth inhibitory activities, depending on the target cell, the relative concentration of AFP and the presence of other cytokines and growth factors. For example, AFP can inhibit the growth of many types of tumor cells and, in particular, inhibits the growth of cells stimulated by estrogen. For him Otherwise, AFP stimulates the growth of normal embryonic fibroblasts. It has also been shown that AFP has immunosuppressive and immunoproliferative effects. In order to exploit the various biological properties of AFP, it will be necessary to obtain sufficient quantities of this molecule in an efficient and cost-effective manner. The expression of AFP in recombinant systems has proved difficult because the expression of AFP in eukaryotic cells generally results in the production of several isoforms due to differential glycosylation of AFP in an individual asparagine residue (amino acid 233). The expression of AFP in prokaryotic systems typically produces erroneously bent and inactive protein that is aggregated and does not have the correct internal disulfide bonds. The wrongly folded AFP must be purified and bent again under conditions that allow the formation of 16 disulfide sources, a time-consuming and difficult process, which results in a very low overall yield of active useful protein. Because the non-glycosylated form of AFP has the same biological properties as the glycosylated form and allows for a more standardized consistent product due to the lack of glycosylation variability, non-glycosylated AFP is preferred for commercial production. Therefore, there is a need for an efficient method to produce non-glycosylated human AFP for commercial and therapeutic applications.

BRIEF DESCRIPTION OF THE INVENTION The invention relates to a substantially pure nucleic acid molecule encoding non-glycosylated human alpha-fetoprotein (ng HuAFP) or a non-glycosylated fragment thereof. In one embodiment, the nucleic acid molecule encoding ng. HuAFP includes nucleotides 45-1874 of the nucleic acid sequence set forth in SEQ ID NO: 5. The invention also relates to a polypeptide comprising non-glycosylated human alpha-fetoprotein. In one embodiment of this feature of the invention, the polypeptide is substantially pure and has the amino acid sequence set forth in SEQ ID NO: 6. In another embodiment, the polypeptide is substantially pure and has the amino acid sequence set forth in SEQ ID NO: 8. The invention further includes biologically active fragments and analogs of non-glycosylated recombinant HuAFP. In one embodiment, the biologically active fragments of non-glycosylated recombinant HuAFP include the amino acid sequence set forth SEQ ID NO: 15 (Domain ll), SEQ ID NO: 16 (Domain l + ll), or SEQ ID NO: 17 (Domain ll) + lll), or two or more of the amino acid sequences. The invention also relates to a substantially pure nucleic acid molecule that includes (i) a nucleic acid molecule encoding ng. HuAFP including nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the sequence encoding ng. HuAFP and that allows the expression of ng. HuAFP, and (iii) a leader sequence encoding a protein secretory signal that allows secretion of ng. HuAFP by a cell. In one embodiment, the cell is a prokaryotic cell (e.g., E. coli) or a eukaryotic cell (e.g., a yeast cell (e.g., Pichia pastoris) or an animal cell (v. g., a mammalian cell, such as Chinese hamster ovary cell (CHO) .In a desired embodiment, the secreted ng.HuAFP cell in cell culture medium (i.e., a non-biological fluid). , the eukaryotic cell is a transgenic animal (e.g., a mammal, such as a goat, sheep, camel, cow, pig, rabbit, horse or llama.) In yet another embodiment, the cell is a fluid-producing cell In a biological animal in a transgenic animal, the promoter allows the expression of ng HuAFP in the biological fluid producing cell, and the leader sequence allows the secretion of ng HuAFP into a biological fluid (e.g., milk, urine, blood or lymph) of the transgenic animal In one embodiment, the cell expressing ng HuAFP is a transgenic animal, the promoter that pulses the expression of ng HuAFP is a specific promoter of milk producing cells that allows the expression of ng. HuAFP in a milk producing cell of the animal, and the leader sequence allows the secretion of ng. HuAFP in the animal's milk. In another embodiment, the cell expressing ng. HuAFP is in a transgenic animal, the promoter that drives the expression of ng. HuAFP is in a specific promoter of urine producing cell that allows the expression of ng. HuAFP in a cell producing the animal's urine and the leader sequence allows the secretion of ng. HuAFP in the animal's urine. In yet another embodiment, the cell expressing ng. HuAFP is in a transgenic animal, the promoter that drives the expression of ng. HuAFP is in a specific promoter of blood producing cell that allows the expression of ng. HuAFP in a blood-producing cell of the animal, and the leader sequence allows the secretion of ng. HuAFP in the animal's blood. In yet another embodiment, the cell expressing ng. HuAFP is in a transgenic animal, the promoter that drives the expression of ng. HuAFP is in a specific promoter of lymph promoter cells that allows the expression of ng. HuAFP in a lymph-producing cell of the animal, and the leader sequence allows the secretion of ng. HuAFP in the lymph of the animal. Another feature of the invention is a transgenic non-human organism that expresses and secretes ng. HuAFP in a biological fluid (eg, milk, urine, saliva, seminal or vaginal fluid, synovial fluid, lymphatic fluid, amniotic fluid, fluid within the yolk sac, corium, or the allantois of an egg, blood, sweat and tears, or an aqueous solution produced by a plant, including for example, exudates or guiding fluid, xylem, phloem, resin and nectar). In one embodiment, the transgenic organism is a mammal (e.g., a goat, sheep, camel, cow, pig, rabbit, horse or llama), a bird, a reptile, an amphibian or a plant. In another modality, the ng. HuAFP is expressed from a transgene that includes: (i) a nucleic acid molecule encoding ng. HuAFP that includes nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the sequence encoding ng. HuAFP in such a way that the promoter allows the expression of ng. HuAFP by cells of the organism that secrete a protein in a biological fluid; and (iii) a leader sequence that encodes a protein secretory signal that allows the secretion of ng. HuAFP in the biological fluid by the organism cell. In yet another embodiment, the promoter is a specific promoter of milk, urine, blood or lymph and the leader sequence allows the secretion of ng. HuAFP in milk, urine, blood or lymph, respectively of the organism. In another modality, the organism is a mouse or a goat. The invention also relates to milk, urine, blood or non-human lymph including ng. HuAFP. In one modality, the ng. HuAFP is soluble and is produced by a non-human transgenic mammal whose milk, urine, blood, or lymph producing cell expresses a transgene comprising: (i) a nucleic acid molecule encoding ng. HuAFP including nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a specific promoter of milk, urine, blood or lymph such that the promoter is operably linked to the coding sequence of ng . HuAFP and allows the expression of ng. HuAFP by milk, urine, blood or lymph producing cells of the mammal and (iii) a leader sequence encoding a protein secretory signal that allows secretion of ng. HuAFP by the milk, urine, blood or lymph producing cells in milk, urine, blood or lymph, respectively of the mammal.

The invention also relates to a method for producing ng. HuAFP by the following steps: (a) providing a transduced cell with a transgene comprising: (i) a nucleic acid molecule encoding ng. HuAFP including nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the sequence encoding ng. HuAFP in such a way that the promoter allows the expression of ng. HuAFP by the cell, and (iii) a leader sequence encoding a protein secretory signal that allows secretion of ng. HuAFP by the cell; and (b) growing the transduced cell in such a way that the cell expresses and secretes ng. HuAFP. In one embodiment, the cell is a prokaryotic cell (e.g., E. (70 //) or a eukaryotic cell (e.g., a yeast cell (e.g., Pichia pastoris) or a cell of mammal (e.g., a CHO cell, a milk, urine, blood or lymph producer cell)) The invention also relates to a method for producing ng. HuAFP by the following steps: (a) providing an organism transgenic (e.g., a mammal (e.g., a goat, sheep, camel, cow, pig, rabbit, horse or llama), a bird, a reptile, an amphibian or a plant) that includes a transgene that has (i) a nucleic acid molecule encoding ng HuAFP that includes nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the sequence encoding ng HuAFP in such a way that the promoter allows the expression of ng.HuAFP in a biological fluid-producing cell of the transgenic organism, and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by the biological fluid producing cell in a biological fluid of the transgenic organism; and (b) collecting the biological fluid that includes ng.HuAFP from the transgenic organism. In one modality, the biological fluid is milk, urine, saliva, seminal or vaginal fluid, synovial fluid, lymphatic fluid, amniotic fluid, fluid within the yolk sac, chorion, or the allantois of an egg, blood, sweat, or tears; or an aqueous solution produced by a plant, including, for example, exudates or guiding fluid, xylem, phloem, resin and nectar. In a desired embodiment, the biological fluid is milk, urine, blood or lymph, and ng.HuAFP is purified from milk, urine, blood or lymph, respectively. In another embodiment, the promoter is a specific promoter of milk, urine, blood or lymph that allows the expression of ng.HuAFP in milk, urine, blood or lymph producing cells, respectively, of the transgenic organism. In yet another embodiment, the transgenic organism expresses and secretes ng.HuAFP in two or more biological fluids (e.g., milk and urine, milk and blood, urine and blood, or milk, urine and blood). Another feature of the invention is a method for treating a patient in need of ng.HuAFP by administering to the patient a therapeutically effective amount of ng.HuAFP that is purified from a cell culture medium. Another feature of the invention is a method for treating a patient needing ng.HuAFP when administering to the patient a therapeutically effective amount of a biological fluid (eg, milk, urine, saliva, seminal or vaginal fluid, synovial fluid, lymphatic fluid, amniotic fluid, fluid within the sac) yolk, the chorion, or the allantois of an egg, blood, sweat and tears, or an aqueous solution produced by a plant, including, for example, exudates or guiding fluid, xylem, phloem, resin and nectar), or extract of the same, which includes ng.HuAFP which is obtained from a non-transgenic human organism (e.g., a mammal (e.g., a mouse, goat, sheep, camel, cow, pig, rabbit, horse, ox or llama) ), a bird, a reptile, an amphibian or a plant). In a desired embodiment, ng.HuAFP has the sequence set forth in SEQ ID NO: 8. In another embodiment, the biological fluid is milk. In another embodiment, ng.HuAFP is purified from the biological fluid of the transgenic non-human organism (e.g., ng.HuAFP purified from the milk, urine, blood or lymph of a mammal). In various desired embodiments, the method can be used to inhibit or treat an immunological disorder, e.g., infection with human immunodeficiency virus (HIV), cancer cell growth, to induce proliferation of bone marrow cells (e.g. after a bone marrow transplant or after the administration of a myelotoxic treatment such as chemotherapy or radiation treatment), or as an immunosuppressive agent (for example, to inhibit the proliferation of autoreactive immune cells, to inhibit the rejection of an organ transplanted (eg, graft versus host disease), or to inhibit or treat an autoimmune disorder, e.g., rheumatoid arthritis, muscular dystrophy, systemic lupus erythematosus, myasthenia gravis, multiple sclerosis, insulin-dependent diabetes mellitus or psoriasis). The invention also relates to a therapeutic composition including ng.HuAFP having the amino acid sequence set forth in SEQ ID NO: 8. The invention also relates to the use of ng.HuAFP having the amino acid sequence set forth in SEQ ID. NO: 8 in the manufacture of a medicament for treating an individual diagnosed with or suffering from a disease (e.g., cancer, rheumatoid arthritis, muscular dystrophy, systemic lupus erythematosus, myasthenia gravis, multiple sclerosis, insulin-dependent diabetes mellitus) or psoriasis). The invention also relates to the use of ng.HuAFP having the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medicament for increasing cell proliferation (e.g., to induce proliferation of bone marrow cells). (for example, after bone marrow transplantation or after administration of a myelotoxic treatment such as chemotherapy or radiation treatment)). The invention also relates to the use of ng.HuAFP having the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medicament for use as an immunosuppressive agent (e.g., to inhibit the proliferation of autoreactive immune cells; to inhibit the rejection of a transplanted organ (eg, graft disease versus host)). In one embodiment of all the features of the invention, the ng.HuAFP is recombinant (r.ng. HuAFP). In all features of the invention, the organism is an animal (e.g., a mammal, bird, reptile or amphibian) or a plant. Illustrative mammals include goats, sheep, camels, cows, pigs, rabbits, horses and you call. Illustrative birds include chickens, turkeys, geese, ostriches, quail and ducks. Illustrative plants include species of the genera Arabidopsis, Medicago, Fragaria, Vigna, Lotus, Onobrychis, Trifolium, Trigonella, Citrus, Linum, Geranium, Manihot, Daucus, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Hyoscyamus, Lycopersicon, Nicotiana, Solanum , Petunia, Digitalis, Majorana, Ciohorium, Helianthus, Lactuca, Bromus, Antirrhinum, Hererocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum, or Datura. The plant can also be selected from the group consisting of a conifer, petunia, tomato, potato, tobacco, lettuce, sunflower, oilseed rape, flax, cotton, sugar beet, celery, soybeans, alfalfa, lotus, cucumber, carrot, eggplant, cauliflower, radish, marigold, white poplar, walnut, apple, grape, asparagus, rice, corn, millet, onion, barley, orchard grass, oats, rye, wheat, corn, alfalfa, peat, azola, rice floating, water hyacinth and watermelon, or can be selected from aquatic plants capable of vegetative multiplication or plants with flowers that grow submerged in the water.

In other desired embodiments of the invention, the biological fluid is milk, urine, saliva, seminal fluid, vaginal fluid, synovial fluid, lymphatic fluid, amniotic fluid, fluid radiated by the yolk sac, chorion or allantois of an egg, blood , sweat, tears, plant exudates, gutting fluid, xylem, phloem, resin or nectar. Desirably, the biological fluid is milk. In other desired embodiments of the invention, the organism is a mammal and ng.HuAFP is expressed by mammalian cells that are responsible for producing proteins that are secreted in a biological fluid of the organism (e.g., milk-producing cells, cells urine producers, blood producing cells, or lymph producing cells). In desired embodiments, ng.HuAFP is expressed by milk producing cells of the mammal under the control of a milk-specific promoter, which can be selected from the group consisting of an alpha S-1 casein promoter., an alpha S2-casein promoter, a beta-casein promoter, a gamma-casein promoter, a kappa-casein promoter, a serum acid-protein promoter (WAP), an alpha-lactalbumin promoter, a promoter of beta-lactoglobulin, and a long-terminal repeat (LTR) promoter of mouse mammary tumor virus (MMTV). The expression of ng.HuAFP under the control of any of these promoters allows the secretion of the polypeptide in the milk of the mammal. In other desired embodiments, ng.HuAFP is expressed by mammalian urine producing cells under the control of a promoter specific urine, which can be selected from the group consisting of an uropalcin II promoter and a uromodulin promoter. The expression of ng.HuAFP under the control of any of these promoters allows the secretion of ng.HuAFP in the urine of the mammal. In other desired embodiments ng.HuAFP is expressed by blood producing cells of the mammal under the control of a blood specific promoter (e.g., an albumin promoter and an alpha-fetoprotein promoter). In another desired embodiment, ng.HuAFP is expressed by blood producing cells of the mammal under the control of a lymphocyte-specific promoter. The expression of ng.HuAFP under the control of any of these promoters allows the secretion of ng.HuAFP to the blood of the mammal. In other desired embodiments, ng.HuAFP is expressed by lymph producing cells of the mammal under the control of a lymph-specific promoter. The expression of ng.HuAFP under the control of a lymph-specific promoter allows the secretion of ng.HuAFP in the lymph of the mammal. In still other embodiments, the organism is a bird and ng.HuAFP is expressed by cells of the bird under the control of a bird-specific promoter, which may be selected from the group consisting of an ovalbumin promoter or an apo-B promoter. The expression of ng.HuAFP under the control of any of these promoters allows the secretion of ng.HuAFP in amniotic fluid, or fluid radiated by the yolk sac, the chorion, or the allantois of an egg.

In further embodiments of the invention, the organism is a plant and ng.HuAFP is expressed by plant cells under the control of a plant-specific promoter, which can be selected from the group consisting of the 35S promoter of the mosaic virus of the plant. cauliflower (CaMV), the CaMV 19S promoter, the T-DNA mannopin synthase promoter, the glutathione-S-transferase promoter, sophorm 11 (GST-ll-27), the dexamethasone promoter (DEX), the promoter of cell, the chalcone synthase promoter (CHS), the PATATIN promoter, the nopaline synthase promoter (NOS), the octopine synthase promoter (OCS), the leaf / stem promoter of Solanum tuberosum (ST-LS) 1, the promoter of hsp 17.5-E of soybean heat shock protein, the hsp 17.3-B promoter, the hemoglobin promoter of Parasponia andersoni, the phenylalanine-ammonia-lyase promoter, the 5-enolpiruvilshikimato gene promoter -3-phosphate petosal tape, the promoter of sucrose synthase, the chlorophyll promoter aa / b (Cab), the corn rbcS promoter, the pea rbcS-3A promoter, the light inducible promoter of the small ribulose bisphosphate carboxylase subunit (ssRUBICSO), the acid sequence responsive gene promoter abscisic (ABA), the ABA-inducible HVA1 promoter, the ABA-inducible promoter of HVA22, the rd29A promoter, the 23-kDa zein gene promoter, the French bean β-phaseolin promoter, the promoter of vegetative storage protein (vspB), the cdc2a promoter from Arabidopsis, the SAG12 promoter from Arabidopsis, the promoter from pathogen-inducible PR-1, the b-1 promoter, 3-glucanase, the promoter from alcohol dehydrogenase (ADH) I, the ADH II promoter, the FIXD gene promoter from Rhizobium meliloti, the role A promoter, the B-role promoter, and the C-role promoter. The expression of ng.HuAFP under either These plant-specific promoters allow the production of ng.HuAFP in the leaf, stem, root or fruit of the plant, as well as the secretion of ng.HuAFP in an exudate or plant gut fluid, or the xylem, phloem, resin or nectar of the plant. In other embodiments, ng.HuAFP is expressed under the control of an inducible promoter, thus providing overexpression of temporal and / or spatial control. In a desired embodiment, an inducible promoter is selected from the group consisting of a heat shock protein promoter, a metallothionein promoter, a MMTV-LTR promoter and an ecdysone promoter. Other ways of regulating the expression of ng.HuAFP include the use of muristerone A and tetracycline / doxycycline selection. Other features and advantages of the invention will be apparent from the following detailed description and from the claims.

Definitions "Biological fluid" means an aqueous solution produced by an organism, such as a mammal, bird, amphibian or reptile, which contains proteins that are secreted by cells that are bathed in the aqueous solution. Examples of a biological fluid include, for example, milk, urine, saliva, seminal fluid, vaginal fluid, synovial fluid, lymphatic fluid, fluid amniotic, the fluid inside the yolk sac, the chorion and the allantois of an egg, blood, sweat and tears; as well as an aqueous solution produced by a plant, including, for example, exudates and guiding fluids, xylem, phloem, resin and nectar. In addition, extracts of animal tissue are included, as well as plant extracts, which include aqueous or organic extractions of any plant structure, including the stem, leaf, root, stem and seed. Plant extracts can also be derived from exudates or gutting fluids. By "biological fluid producing cell" is meant a cell that is varied by a biological fluid and that secretes a protein in the biological fluid. By "blood producing cell" is meant a cell (e.g., a liver epithelial cell, a spleen epithelial cell, a bone marrow cell, a thymic epithelial cell, a blood vessel endothelial cell, a cell of bone marrow (e.g., a lymphocyte (e.g., a B or T lymphocyte), and a red blood cell)) that secretes a protein in the blood. By "specific blood promoter" is meant a promoter that naturally directs the expression of a gene in a cell that secretes a protein in the blood (e.g., a liver epithelial cell, a spleen epithelial cell, a bone marrow, a thymic epithelial cell, a blood vessel endothelial cell and a lymphocyte (e.g., a B or T lymphocyte)). An example of a specific blood promoter is the albumin promoter / enhancer that has been described and can be used to achieve specific expression of liver of an exogenous gene (e.g., see, Shen et al., DNA 8: 101-108, 1989; Tan et al., Dev. Biol. 146: 24-37, 1991; McGrane et al., TIBS 17: 40-44, 1992, Jones et al., J. Biol. Chem. 265: 14684-14690, 1990, and Shimada et al., FEBS Letters 279: 198-200, 1991). The alpha-fetoprotein gene promoter is also particularly useful. By "embryonic cell" is meant a cell that is capable of being a progenitor for all cells of the somatic and germinal line of an organism. Exemplary embryonic cells are embryonic stem cells (ES cells) and fertilized oocytes. Preferably, the embryonic cells of the invention are mammalian embryonic cells. By "exogenous", as used herein with reference to the gene or a polypeptide, is meant a gene or polypeptide that is not normally present in an animal. For example ng.HuAFP is exogenous to a goat. By "expression vector" is meant plasmid or genetically engineered virus, derived from, for example, a bacteriophage, adenovirus, retrovirus, variola virus, herpes virus or artificial chromosome, which is used to transfer a coding sequence of ng.HuAFP , operably linked to a promoter, in a host cell, such that the r.ng, encoded HuAFP is expressed within the host cell. By "human alpha-fetoprotein" or "HuAFP" or rHuAFP "is meant a polypeptide having substantially the same amino acid sequence as the mature alpha-fetoprotein (amino acids 19-609) disclosed in access to Genbank No. V01514 (SEQ ID NO. : 4) and coded by nucleotides 99-1874 of the cDNA sequence set forth in access to Genbank No. V01514 (SEQ ID NO: 3) and reported in Morinaga et al. (Proc. Nati, Acad. Sci. USA 80: 4604-4608, 1983). By "fragment", as applied to a non-glycosylated HuAFP polypeptide, is meant at least 5 contiguous amino acids, preferably at least 10 contiguous amino acids, most preferably at least 20, 50 or 100 contiguous amino acids, and most preferably still at least 200 to 400 or more amino acids contiguous in length and desirably includes a glutamine residue in place of an aspargin residue at amino acid position 233 of SEQ ID NO: 4. HuAFP analogue fragments preferably retain biological activity . Fragments and analogs of HuAFP are described in, e.g., patents of E.U.A. Nos. 5,965,528 and 5,384,250. The recombinant HuAFP fragments of interest include but are not limited to domain I (amino acids 1 (Arg) -198 (Ser), SEQ ID NO: 9), domain II (amino acids 199 (Ser) -390 (Ser), SEQ ID NO: 15), domain III (amino acids 391 (Gln) ~ 591 (Val), SEQ ID NO: 11), domain l + ll (amino acids 1 (Arg) -390 (Ser), SEQ ID NO: 16), domain ll + lll (amino acids 199 (Ser) -591 (Val), SEQ ID NO: 17), and fragment 1 of rHuAFP (amino acids 267 (Met) -591 (Val), SEQ ID NO: 14). The numbering of the recombinant HuAFP fragments described above is based on the sequence of mature AFP lacking amino acids 1-18 of the signal sequence. Therefore, the arginine residue at position 1 of the fragments of HuAFP corresponds to the precursor amino acid 19 AFP. The HuAFP fragments described above can be generated as non-glycosylated fragments by substituting the aspargin residue at position 233 of SEQ ID NO: 4 for, eg, a glutamine. The activity of a fragment is evaluated experimentally using conventional techniques and tests. By "human alpha-fetoprotein precursor" is meant a polypeptide having substantially the same amino acid sequence as amino acids 1-509 exposed in access to Genbank No. V01514 (SEQ ID NO: 2) and encoded by nucleotides 45-1874 of the cDNA sequence set forth in access to Genbank No. V01514 (SEQ ID NO: 1). By "a leader sequence" or a "signal sequence" is meant a nucleic acid sequence that encodes a protein secretory signal and, when operably linked to a nucleic acid molecule towards the 3 'end encoding ng.HuAFP, directs the secretion of ng.HuAFP. The leader sequence may be the leader of native human alpha-fetoprotein, an artificially derived leader, or it may be obtained from the same gene as the promoter used to direct the transcription of coding sequence of ng.HuAFP, or of another protein that is normally secreted of a cell. By "lymph producing cells" is meant a cell (e.g., lymphatic vessel epithelial cells and lymph node cells, lymphocytes (e.g., B and T lymphocytes), and macrophages) that secretes a protein in the lymph node. the lymphatic fluid. By "lymph-specific promoter" is meant a promoter who it naturally directs the expression of a gene in a cell that secretes a protein in lymphatic fluid (e.g., epithelial cells of the lymphatic vessels and lymph node cells, lymphocytes (e.g., B and T lymphocytes), and macrophages ). By "milk producing cell" is meant a cell (e.g., a mammary epithelial cell) that secretes a protein in milk. By "milk-specific promoter" is meant a promoter that naturally directs the expression of a gene in a cell that secretes a protein in milk (e.g., a mammary epithelial cell) and includes, for example, the casein promoters , eg, alpha-casein protein (e.g., alpha S-1-casein promoter and alpha S-2-casein promoter), beta-casein promoter (e.g., the goat beta-casein gene (DiTullio, Biotechnology 10-74-77, 1992), gamma-casein promoter, and kappa-casein promoter, the serum acid promoter (WAP) (Gorton et al., BioTechnology 5 : 1183-1187, 1987), the beta-Iactoglobulin promoter (Clark et al., BioTechnology-7: 487-492, 1989), and the alpha-lactalbumin promoter (Soulier et al., FEBSLetts. 297: 13, 1992.) They also include promoters that are specifically activated in mammary tissue and therefore are useful in accordance with this invention, for example, the long-terminal repeat (LTR) promoter of the vir us of mouse mammary tumor (MMTV). By "operably linked" it is meant that a gene and one or more regulatory sequences are connected in such a way as to allow gene expression when the appropriate molecules (e.g., transcription activating proteins) are linked to the regulatory sequences.

By "plant" is meant an entire plant, a part of a plant, a plant cell or a group of plant cells. The class of plants that can be used in the method of the invention is generally as broad as the class of higher plants available for transformation techniques, including both monocotyledonous and dicotyledonous plants. It includes plants of a variety of ploidy levels, including polyploid, diploid and haploid. By "promoter" is meant a minimum sequence sufficient to direct transcription. Also included in the invention are those promoter elements that are sufficient to make gene expression dependent on a controllable promoter to be specific to the cell type, tissue-specific, temporally specific or inducible by signals from external agents.; said elements can be located in the 5 'or 3' sequence regions or intron of the native gene. By "purified" or "substantially pure" is meant that ng.HuAFP secreted in the biological fluid (e.g., milk, urine, blood, lymph, amniotic fluid, fluid surrounded by the yolk sac, chorion, or allantois) of an egg, guiding fluid, xylem, phloem, resin or sap) is partially or completely separated from other components (eg, proteins, lipids and water) naturally found in the biological fluid, which increases the effective concentration of ng .HuAFP in relation to unpurified ng.HuAFP found in a biological fluid. By "non-glycosylated human alpha-fetoprotein" or "ng.HuAFP" is means a polypeptide having the same substantially the same amino acid sequence as the mature human alpha-fetoprotein described above, except that it includes a mutation at amino acid position 233 of SEQ ID NO: 4 from an aspargin residue to a glutamine residue (as set forth in SEQ ID NO: 6), thereby eliminating the individual glycosylation site. The nucleic acid sequence of the non-glycosylated human alpha-fetoprotein precursor includes nucleotides 45 to 1874 of the sequence set forth in SEQ ID NO: 5. By "secretory signal of ng.HuAFP" or "signal peptide of ng.HuAFP" or "ng.HuAFP leader" or "ng.HuAFP signal sequence" is meant a polypeptide having the same amino acid sequence as amino acids 1-18 exposed in access to Genbank No. V01514 (encoded by nucleotides 45- 98). The secretory protein signal is digested from ng.HuAFP during protein maturation and extracellular secretion. By "substantially pure nucleic acid molecule" is meant a nucleic acid molecule that is free from genes that, in the genome that occurs naturally in the organisms from which the nucleic acid molecule of the invention is derived, flank the Gen. The term therefore includes, for example, a recombinant DNA molecule that is incorporated into a vector; in a plasmid or virus that replicates autonomously; or in the genomic DNA of a prokaryote or eukaryote; or that exists as a separate molecule (e.g., a cDNA or a genomic or cDNA fragment produced by PCR or digestion with restriction endonuclease) independent of other sequences. It also includes a recombinant DNA that is part of a hybrid gene that contains a nucleotide sequence non-native to the gene or that encodes an additional polypeptide sequence, as well as the corresponding mRNA. By "therapeutically effective amount" is meant an amount of non-glycosylated human alpha-fetoprotein or a fragment of the mass which, when administered to a patient, inhibits or stimulates a biological activity modulated by human alpha-fetoprotein. Such biological activities include inhibiting the proliferation of a neoplasm or an autoreactive immune cell, or stimulating the proliferation of a cell (e.g., a bone marrow cell). The therapeutically effective amount may vary depending on a number of factors, including medical indication, the length of time of administration, and the route of administration. For example, ng.HuAFP can be administered systemically in the range of 0.1 ng-10g / kg of body weight, preferably in the range of 1 ng-1 g / kg of body weight, most preferably in the range of 10 ng-100. mg / kg of body weight, and most preferably still in the range of 25 μg-10 mg / kg of body weight. By "transformation", "transfection", or "transduction" is meant any method for introducing foreign molecules into a cell. Lipofection, transfection mediated by DEAE-dextran, microinjection, nuclear transfer (see, e.g., Campbell et al., Biol Reprod. 49: 933-942, 1993; Campbell et al., Nature 385: 810-813, 1996 ), protoplast fusion, calcium phosphate precipitation, transduction (e.g., bacteriophage, retroviral adenoviral, or other viral supply), electroporation, and biolistic transformation are just some of the methods known to those skilled in the art that can be used. By "transformed cell", "transfected cell", or "transduced cell", is meant a cell (or a descendant of a cell) in which a nucleic acid molecule encoding ng.HuAFP has been introduced by means of Recombinant DNA The nucleic acid molecule can be stably incorporated into the host chromosome, or it can be maintained episomally. By "transgene" is meant any piece of a nucleic acid molecule that is inserted by an artifice into a cell or an ancestor thereof, and becomes part of the genome of the animal that develops from that cell. Said transgene can include a gene that is partially or completely exogenous (i.e., strange) to the transgenic animal, or it may represent a gene that has identity to an endogenous gene of the animal. By "transgenic" is meant any cell that includes a nucleic acid molecule that has been artifically inserted into a cell, or an ancestor thereof, and becomes part of the genome of the animal that develops from that cell. Preferably, the transgenic animals are transgenic mammals (e.g., mice, goats, sheep, camels, cows, pigs, rabbits, horses, oxen or llamas). Preferably, the nucleic acid molecule (transgene) is inserted by a artifice in the nuclear genome (ie, a chromosome), although the transgene may be episomally maintained (eg, carried out in a vector containing an origin of replication such as Epstein-Barr virus oriP. "urine producer" means a cell (e.g., a bladder or kidney epithelial cell, which secretes a protein in the urine.) "Urine specific promoter" is understood to be a promoter that naturally directs the expression of a gene in urine. a cell that secretes a protein in the urine (e.g., a bladder epithelial cell) Examples of a specific urinary promoter are the uropalcin II gene promoter and the uromodulin gene promoter.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a diagram showing manipulation of hAFP-containing vectors to produce the BC934 construct of β-casein expression of genomic hAFP. Figures 2A and 2B are diagrams showing the structure of a β-casein / rHuAFP transgene (Figure 2A) and a β-casein / ng transgene. HuAFP (Figure 2B) for expression and secretion of rHuAFP or ng.HuAFP in milk. Figure 3 is an image of a Western blot analysis showing the presence of rHuAFP in milk samples in transgenic mice. Strips 1-3: hAFP. Strip 1: 50 ng hAFP (0.5 mg / ml equivalent); lane 2: 100 ng hAFP (1.0 mg / ml equiv.); band 3: 200 ng hAFP (2.0 mg / ml equiv.); strip 4: negative (non-transgenic) mouse milk; fringes 5-10: rHuAFP. Strip 5: BC934-1-7, d9, (4 μl - 1:40); lane 6: BC934-1-8, d9, (4μl - 1:40); lane 7: BC934-1-56, d9, (4 μl - 1: 40); lane 8: BC934-1-59, d9, (4 μl - 1:40); lane 9: BC934-1-63, d9, (4 μl - 1:40); lane 10: BC934-1-64, d9, (4 μl - 1:40). Figure 4 is an image of a Western blot analysis showing the presence of ng.HuAFP in samples of transgenic mouse milk. Strip 1: hAFP (50 ng); lane 2: hAFP (100 ng); Strip 3: standard molecular weight; strip 4: negative (non-transgenic) mouse milk; stripes -10: ng.HuAFP. Strip 5: BC1055-1-9 (4 μl -1: 40); Strip 6: BC1055-1 -10 (4μl - 1: 400); lane 7: BC1055-1-37 (4 μl -1: 400); lane 8: BC1055-1-44 (4μl - 1: 40); lane 9: BC1055-1 -74 (4μl -1: 40); lane 10: BC1055-1 -85 (4 μl -1: 40). Figure 5 is a diagram showing a schematic of the BC1055 construct (ng.HuAFP) and the position of a 332 bp PCR product (labeled "PCR product") encompassing the binding of the 5 '- casein and 5 'ng.HuAFP. The position of the 3 'BC probe of the PCR primer, which is used for Southern blot analysis, is also indicated. Figures 6A and 6B are photographs showing the result of PCR analysis of blood and ear tissue taken from Founder Goat F093 containing ng.HuAFP transgene. Figure 6A shows the result of duplex PCR analysis using the pair of goat exon 7 initiators (product of 410 bp) with a pair of hAFP-specific primers (product of 332 bp). Figure 6B shows the result of PCR analysis using an initiator pair specific for hAFP alone. The template DNA in both experiments was the same. Strip 1: DNA size standards; Strip 2: non-transgenic goat blood sample; lane 3: goat cell line hAFP positive (clone 7); Strip 4: hAFP-positive abortion ear tissue, F026; Strip 5: F093 blood tissue; and strip 6: ear tissue of F093. Figure 7 is an image showing the result of a Southern blot analysis of Founder Goat F093. Five μg of DNA were digested with EcoRJ, separated by electrophoresis, and transferred to Genescreen Plus (New England Nuclear). The transfer was then hybridized with a goat β-casein probe, washed and autoradiographed. Strip 1:? HindIII, molecular weight markers; Strip 2: Non-transgenic goat ear tissue DNA; lane 3: abortion ear tissue DNA hAFP-positive F026; strip 4: founder goat blood DNA, F093. Figures 8A and 8B are photographs that show the result of fluorescence in situ hybridization (FISH) of Founder Goat F093. Figure 8A shows representative example of metaphase chromosomes of leukocytes cultured in F093. The transgene signal is indicated by the white point and the arrow. The chromosomes are visualized with DAPI staining. Amplification: 1000X. Figure 8B shows a representative field of leukocyte interface nuclei grown in F093. The transgene signals are white and indicated by the arrows. The DNA in the nuclei is visualized with DAPI staining. Amplification: 1000X.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to biologically active non-glycosylated human alpha-fetoprotein (ng.HuAFP), the nucleic acid sequence encoding ng.HuAFP, and methods for producing ng.HuAFP. Methods of the invention include the production of ng.HuAFP in a cell (e.g., a prokaryotic cell (e.g., E. coli) or a eukaryotic cell (e.g., a yeast cell (v. .gr., Pichia pastoris) or a mammalian cell)). The method for the production of rHuAFP in prokaryotic cells, which can be used to produce ng.HuAFP, can be found in the patents of E.U.A. Nos. 5,384,250 and 6,331,611, incorporated herein by reference. The methods that can be used to produce ng.HuAFP in mammalian cells can be found in E.U.A. series No. 09 / 936,020. A detailed description of the various mammalian expression systems and methods for expressing recombinant proteins in mammalian cells are provided in Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, Inc., New York, NY, pp. 16.12.1-16.20-16 and A.5.23-A.5.30, 1997). The methods of the invention also include the production of na. HuAFP in a transgenic organism, particularly a mammal, such as a ruminant (e.g., a cow, a sheep and a goat), a horse, a camel, an ox, a llama, a pig, a rabbit and a mouse , but also includes birds (eg, chickens, turkeys, geese, quails, ducks and ostriches), amphibians, reptiles and plants. The transgene contains ng.HuAFP, which includes human AFP coding region altered to contain a replacement of a glutamine with an asparagine position 251 of the precursor AFP or position 233 of the mature AFP lacking a signal sequence. The coding region of ng.HuAFP is fused to the 3 'end of a nucleic acid sequence containing a transcriptional promoter. Between the promoter and the protein coding region is a leader sequence encoding a protein secretory signal. Depending on the promoter and secretory signal used, the expression of ng.HuAFP allows the secretion in a biological fluid, for example milk, urine, blood, lymph, amniotic fluid, the fluid radiated by the yolk sac, the chorion, or the allantois of an egg, or a guiding fluid of the transgenic organism. Additional nucleic acid elements, such as transcription enhancers, transcriptional and translational terminator sequences, 3 'untranslated regions that improve mRNA stability, and introns that increase expression may also be included in the transgenic construct. Ng.HuAFP is expressed in the transgenic animal, secreted in a biological fluid (e.g., milk, urine, blood, lymph, etc.), which can be collected and purified from the fluid. The secretion of ng.HuAFP in a biological fluid of a transgenic organism (eg, milk, urine and lymph) facilitates its purification and obviates the removal of blood products and culture medium additives, some of which may be toxic, carcinogenic or infectious. In addition, milk containing ng.HuAFP can be consumed directly by humans or other mammals. The expression of ng.HuAFP in the urine allows the use of both male and female animals for the production of ng.HuAFP. In addition, ng.HuAFP is produced as soon as the animals begin to produce urine. Finally, purification of ng.HuAFP from urine is relatively straightforward, since urine normally contains a low protein content.

Transgene Constructs Useful promoters for the expression of a ng.HuAFP transgene in mammalian tissue include promoters that naturally promote the expression of breast-specific proteins, such as milk proteins, although any promoter that allows secretion can be used. of the transgenic product in milk. These include, eg, the promoters that naturally direct the expression of whey acid protein (WAP), alpha S1-casein, alpha S2-casein, beta-casein, kappa-casein, beta-lactoglobulin and alpha-lactalbumin. (see, e.g., Drohan et al., USPN 5,589,604; Meade et al., Patent of E.U.A. No. 4,873,316; and Karatzas et al., U.S. Patent. No. 5,780,009). Promoters useful for the expression of a ng.HuAFP transgene in urinary tissue are the promoters of uropalcin and uromodulline (Kerr et al., Nat. Biotechnol., 16: 75-79, 1998; and Zbikowska et al., Transgenic Res. 11: 425-435, 2002), although any promoter allowing the secretion of the transgene product in the urine can be used. The transgene construct preferably includes a leader sequence towards the 3 'end of the promoter. The leader sequence is a nucleic acid sequence that encodes a protein secretory signal, and, when operably linked to a nucleic acid molecule towards the 3 'end encoding ng.HuAFP, directs the secretion of ng.HuAFP. The leader sequence can be obtained from the same gene as the promoter used to direct the transcription of the nucleic acid molecule encoding ng.HuAFP (e.g., a gene encoding a milk-specific protein). Alternatively, a leader sequence encoding the native human AFP protein secretory signal can be used (amino acids 1-19 accessing Genbank No. V01514); nucleotides 45-101 accessing Genbank No. V01514 codes for the protein secretory signal of native human AFP. Other options include the use of a leader sequence that encodes a protein secretory signal of any other protein that is normally secreted from a cell, an artificial leader sequence that encodes an artificial protein secretory signal, or a hybrid leader sequence (v. ., a fusion of the goat ß-casein sequence and the leader sequence of human AFP). In addition, the transgene construct preferably includes a transcription termination site, a signal for polyadenylation of the transcribed mRNA, and a translation termination signal. The transgene can also encode any 3 'untranslated region (UTR), which increases the stability of ng.HuAFP mRNA, for example, a 3' UTR of the bovine growth hormone gene, a protein gene of the milk, or a globin gene.

The transgene construct may also include a transcriptional enhancer toward the 5 'end or toward the 3' end of the transcribed region of the transgene, such as an enhancer of a viral (eg, SV40) or mammalian gene (v. .gr., casein). The transgene construct can also include an intron that increases the expression level of the transgene. The intron may be placed between the transcription initiation site and the translation initiation codon, 3 'of the translation insertion codon, or within the coding region of the transgene. The intron must include a 5 'splice site (i.e., a donor site), a 3' splice site (i.e., an acceptor site), and preferably at least 100 nucleotides between the two sites. Any intron known in the art that increases the expression of a transgene (e.g., an intron of a ruminant casein gene) can be used. The ng.HuAFP transgene can be carried within a circular plasmid, a cosmid vector, or another vector such as a vector derived from a virus. The vector may contain additional sequences that facilitate its propagation in prokaryotic and eukaryotic cells, for example, selectable drug markers (e.g., for ampicillin resistance in E. coli or resistance to G-418 in mammalian cells) and origins of replication (e.g., colE1 for replication in prokaryotic cells, and oriP for replication in mammalian cells).

Animal Promoters Promoters useful for the expression of ng.HuAFP in mammary tissue include promoters that naturally promote the expression of breast-specific polypeptides, such as milk proteins, although any promoter allowing the secretion of ng.HuAFP can be used. in milk. These include, eg, promoters that naturally direct the expression of serum acid protein (WAP), alpha S1-casein, alpha S2-casein, beta-casein, kappa-casein, beta-lactoglobulin, alpha-lactalbumin (see , e.g., Drohan et al., U.S. Patent No. 5,589,604, Meade et al., U.S. Patent No. 4,873,316, and Karatzas et al., U.S. Patent No. 5,780,009), and others described in the patent. from the USA No. 5,750,172. Acid whey protein (WAP); access to Genbank No. X01153), the main serum protein in rodents, is expressed at high levels exclusively in the mammary gland during late gravidity and lactation (Hobbs et al., J. Biol. Chem. 257: 3598-3605, 1982). For additional information about specific mammary gland promoters, see, e.g., Richards et al., J. Biol. Chem. 256: 526-532, 1981 (rat a-lactalbumin); Campbell et al., Nucleic Acids Res. 12: 8685-8697, 1984 (Rat WAP); Jones et al., J. Biol. Chem. 260: 7042-7050, 1985 (rat ß-casein); Yu-Lee and Rosen, J. Biol. Chem. 258: 10794-10804, 1983 (? - rat casein); Hall, Biochem. J. 242: 735-742, 1987 (human a-lactalbumin); Stewart, Nucleic Acids Res. 12: 3895-3907, 1984 (a-sl cDNA and bovine-casein); Gorodetsky et al., Gene 66: 87-96, 1988 (bovine ß-casein); Alexander et al., Eur. J.

Biochem. 178: 395-401, 1988 (? -bovine casein); Brignon et al., FEBS Lett. 188: 48-55, 1977 (a-S2 bovine casein); Jamieson et al., Gene 61: 85-90, 1987, Ivanov et al., Biol. Chem. Hoppe-Seyler 369: 425-429, 1988, and Alexander et al., Nucleic Acids Res. 17: 6739, 1989 ( human beta-lactoglobulin); and Vilotte et al., Biochimie 69: 609-620, 1987 (a-bovine lactalbumin). The structure and function of the various milk protein genes are reviewed by Mercier & Vilotte, J. Dairy Sci. 76: 3079-3098, 1993. If the additional flanking sequences are useful in the optimization of expression, said sequences can be cloned using the existing sequences as probes. The specific regulatory sequences of mammary gland of different organisms can be obtained by selectively detecting libraries of said organisms using known cognate nucleotide sequences, or antibodies to cognate proteins as probes. The signal sequences useful for expression and secretion of ng.HuAFP in milk are specific signal sequences of milk. Desirably, the signal sequence is selected from specific milk signal sequences, ie, from a gene encoding a product secreted in milk. Most desirably, the specific signal sequence of the milk is related to a milk-specific promoter described above. The size of the signal sequence is not critical to this invention. All that is required is that the sequence be of sufficient size to effect the secretion of ng.HuAFP, e.g., in the tissue mammary. For example, signal sequences from genes encoding caseins, e.g., alpha, beta, gamma, or kappa caseins, beta lactoglobulin, serum protein and lactalbumin are useful in the present invention. The signal sequences of other secreted proteins can also be used, e.g., proteins secreted by liver cells, kidney cells, or pancreatic cells. Promoters useful for the expression of a recombinant polypeptide transgene in urine tissue are the uropalcin and uromodulin promoters (Kerr et al., Nat. Biotechnol., 16: 75-79, 1998; Zbikowska, et al., Biochem. 365: 7-11, 2002, and Zbikowski et al., Transgenic Res. 11: 425-435, 2002), although any promoter that directs the secretion of the transgene product in the urine can be used. A promoter useful for the expression and secretion of ng.HuAFP in the blood by blood producing cells and serum producing cells (e.g., liver epithelial cells) is the albumin promoter (see, e.g., Shen et al., DNA 8: 101-108, 1989, Tan et al., Dev. Biol. 146: 24-37, 1991, McGrane et al., TIBS 17: 40-44, 1992, Jones et al., J. Biol. Chem. 265: 14684-14690, 1990; and Shimada et al., FEBS Letters 279: 198-200, 1991), although any promoter allowing the secretion of the transgene product in the blood can be used. The native alpha-fetoprotein promoter can also be used (see, e.g., Genbank Access Nos .: AB053574; AB053573; AB053572; AB053571; AB053570; and AB053569). Promoters useful for the expression of ng.HuAFP in the semen are described in the patent of E.U.A. No. 6,201,167. The specific promoters of useful birds are the ovalbumin promoter and the apo-B promoter. Other bird-specific promoters are known in the art. The ovalbumin promoter can be used to direct the expression of ng.HuAFP which is then deposited in the egg white. The apo-B promoter can also be used to direct the expression of a recombinant polypeptide in the liver, where it will eventually be deposited in the egg yolk. The eggs of birds are an optimal vehicle to express large quantities of recombinant polypeptides for the following reasons: (1) a large amount of protein is packed in each egg, (2) the eggs are easy to collect non-invasively and can be store for prolonged periods, and (3) the eggs are sterile and, unlike milk, they do not contain bacterial contaminants. Specifically, for each egg, a bird can produce three grams of albumin in the oviduct, of which more than 50% is ovalbumin. Another three grams are produced in the liver (serum lipoproteins) and deposited in the egg yolk. In addition, since birds typically do not recognize mammalian proteins immunologically because of their evolutionary distance from mammals, the expression of ng.HuAFP in birds is less likely to have any deleterious effect on bird viability and health. Other promoters that are useful in the methods of the invention include inducible promoters. Generally, recombinant proteins are expressed in a constitutive manner in most systems of eukaryotic expression. The addition of inducible promoters or enhancer elements provides temporal or spatial control over the expression of ng.HuAFP, and provides an alternative expression mechanism. Inducible promoters include heat shock protein, metallothionein, and MMTV-LTR, while inducible enhancer elements include those for ecdysone, muristerone A, and tetracycline / doxycycline. The Tet-On and Tet-Off gene expression systems (Clontech) is an example of an inducible system that is useful in the methods of the invention. This system uses a tetracycline (Te) response element to maintain the expression of ng.HuAFP either in an on mode (constitutively switched off, induced with Te) or switched off (constitutively switched on, represented with Te or doxycycline). Selectable markers can also be incorporated into the ng.HuAFP transgene for easy identification of cells that have been transformed. Selectable markers generally fall into two functional categories: recessive and dominant. Recessive markers are generally genes that encode products that are not produced in host cells (cells that lack the product or function of the "marker"). The marker genes for thymidine kinase (TK), dihydrofolate reductase (DHFR), adenine phosphoribosyl transferase (APRT), and hypoxanthine-guanine phosphoribosyl transferase (HGPRT) are in this category. Dominant markers include genes that encode products that confer resistance to growth-suppressing compounds (antibiotics, drugs) and / or allow the growth of host cells in metabolically restrictive environments. Commonly used markers within this category include mutant DHFR gene that confers resistance to methotrexate; the gpt gene for xanthine-guanine phosphoribosyl transferase, which allows the growth of host cells in a medium containing mycophenolic acid / xanthine; and the neo gene for aminoglycoside 3'-phosphotransferase, which can confer resistance to G418, gentamicin, kanamycin and neomycin.

Generation of transgenic animals Transgenic constructs are usually introduced into cells by microinjection (Ogata et al., U.S. Patent No. 4,873,292). A microinjected embryo is then transferred to an appropriate female resulting in the birth of a transgenic or chimeric animal, depending on the stage of development of the embryo when the transgene is integrated. Chimeric animals can be reproduced to form true germline transgenic animals. In some methods of transgenesis, transgenes are introduced into the pronuclei of fertilized oocytes. For some animals, such as mice, fertilization is done in vivo and the fertilized eggs are surgically removed. In other animals, the ovules can be removed from live animals or recently dead animals (eg, on the trail) and fertilized in vitro. Alternatively, transgenes can be introduced into embryonic stem cells (ES cells). The transgenes can be introduced into said cells by electroporation, microinjection, nuclear transfer, or any other technique used for the transfection of cells that are known to the person skilled in the art. The transformed cells are combined with blast cells of the animal from which they originate. Transformed cells colonize the embryo and in some embryos those cells form the germline of the resulting chimeric animal (Jaenisch, R., Science 240: 1468-1474, 1988). ES cells containing a ng.HuAFP transgene can also be used as a source of nuclei for transplantation into an enucleated fertilized oocyte, thus giving rise to a transgenic animal. More generally, any diploid cell derived from embryonic, fetal or adult tissue and containing a rHuAFP transgene can be introduced into an enucleated fertilized egg. The cloned embryo is implanted and gestated within an appropriate female, thus resulting in a fully transgenic animal (Wilmut et al., Nature 385: 810-813, 1997). In general, the expression of any transgene depends on its integration position and copy number. After a transgenic animal having the appropriate transgene level and the tissue-specific transgene expression pattern is obtained by traditional methods (e.g., pronuclear injection or generation of chimeric embryos), the animal is reproduced in order to obtain progeny that have the same level and transgene expression pattern. There are several limitations to this approach.

First, the transmission of the transgene to the offspring does not occur in transgenic chimeras that lack transgenic germ cells. Second, because a transgenic heterozygous founder is reproduced with a non-transgenic animal, only half of the progeny will be transgenic. Third, the number of transgenic progeny is additionally limited by the length of gestation period, the number of offspring per gravidity. Finally, the number of useful transgenic progeny can be limited by gender: for example, only female animals are useful to produce ng.HuAFP expressed in milk. In view of these limitations, nuclear transfer technology provides the advantage of allowing, within a relatively short period of time, the generation of many female transgenic animals that are genetically identical. Animals expressing ng.HuAFP in their milk can also be generated by direct transfer of the transgene in the mammary tissue of post-partum animals (Karatzas et al., U.S. Patent No. 5,780,009). Said animals do not contain the transgene within its germ line, and therefore do not give rise to transgenic progeny. Any animal can be used in this invention. Desirably, animals that produce large volumes of a biological fluid (e.g., milk) are preferred. The desired animals are birds, reptiles and amphibians, as well as ruminants, ungulates, domesticated mammals, and milk-producing animals. Suitable birds include chickens, geese, turkeys, quail, ducks and ostriches. The animals particularly Desired include: mice, goats, sheep, camels, cows, pigs, rabbits, horses, oxen and llamas. Of course, each of these animals may not be as effective as the others with respect to ng.HuAFP expression. For example, a specific promoter of particular biological fluid (e.g., specific promoter of milk, urine, blood or lymph) or signal sequence may be more effective in a mammal than in others. However, one skilled in the art can easily make such choices by following the teachings of this invention and the teachings found in the prior art. Where the ng.HuAFP is secreted in the milk, urine, blood or lymph of a transgenic animal, the animal is capable of producing at least 1 liter, very desirably at least 10, 25 or 50 liters, and very desirably 100 , 500, 1000 or 10,000 liters or more of milk, urine, blood or lymph per year. Desirably, ng.HuAFP is recovered from a product produced by the organism, e.g., milk, urine, blood, amniotic fluid, or fluid surrounded by the yolk sac, chorion, or allantois of an egg, but can also be recovered from seeds, hair, tissue or eggs. A transgenic animal can be generated that produces ng.HuAFP in two or three biological fluids (e.g., in milk and urine, in milk and blood, or in milk, urine, and blood). One method to construct such an animal is to transform an embryonic cell of the animal into up to three constructions, in which the constructs are selected from nucleic acid molecule of ng.HuAFP that is driven by a promoter capable of expressing and secreting the polypeptide recombinant from a cell milk producer, a urine producing cell, or a blood-producing cell. In this method, the double or triply transformed cell is used to generate a transgenic animal capable of expressing ng.HuAFP in one or more of its biological fluids. Therefore, mammalian zygotes (e.g., ruminants) are microinjected (or co-microinjected) with two or three nucleic acid molecules that express ng.HuAFP under the control of one or more of a specific milk promoter. , a specific urine promoter, a blood specific promoter, or a lymph-specific promoter. The generated transgenic animal will secrete / produce ng.HuAFP in one or more of its milk, urine, blood or lymph. This will increase the total yield of ng.HuAFP produced per transgenic animal unit. A second method for producing said animal capable of producing ng.HuAFP in one or more biological fluids is to separately generate an embryonic stem cell carrying a construct capable of expressing and secreting ng.HuAFP in a biological fluid producing cell (v.gr). ., a milk producing cell, urine producer, blood producer or lymph producer). One or more of the transformed ES cell types are then combined with blasts from the animal from which they originated to produce chimeric animals, which can be reproduced for homozygosity. This type of double-expression or triple-expression animal has a number of advantages. First, animals of both genders will produce ng.HuAFP in, v.gr .., urine or blood, on a continuous basis from birth, and female animals may additionally produce ng.HuAFP in, e.g., milk, such as a lactating adult. Second, the amount of ng.HuAFP produced by any individual female animal can be increased (by inducing lactation) or reduced (by not inducing lactation) as the need for the recombinant polypeptide changes. Protocols for the production of transgenic animals can be found in, for example, White and Yannoutsos, Current Topics in Complement Research: 64th Forum in Immunology, pp. 88-94; Bader and Ganten, Clinical and Experimental Pharmacology and Physiology, Supp. 3: S81-S87, 1996; Transgenic Animal Technology, A Handbook, 1994, ed., Cari A. Pinkert, Academic Press, Inc .; patent of E.U.A. No. 5,523,226; patent of E.U.A. No. 5,530, 77; patent of E.U.A. No. 5,573,933; PCT application WO93 / 25071; and PCT application WO95 / 04744. Other methods for making transgenic animals are known in the art (see, e.g., Love et al., Biotechnology 12: 60-63, 1994, Naito et al., Mol. Reprod. Dev. 39: 153-161, 1994; Chang et al., Cell Biol. Int. 21: 495-499, 1997; Carscience et al., Development 117: 669-675, 1993; Pain et al., Cell, Tissues, Organs 165: 212-219, 1999; Pettite et al., Development 108: 185-189, 1990; Pettite et al., In Transgenic Animal Research Conference III (Tahoe City), pp. 32-33, 2001; Wright et al., BioTechnology 9: 830-83. , 1991; Pursel et al., J. Anim. Sci. 71 Suppl 3: 1-9, 1993; Wall et al., Theriogenology 5: 57-968, 1996; Campbell et al., Nature 380: 64-66, 1996; Wilmut et al., Nature 385: 810-813, 1997; Cibelli et al., Science 280: 1256-1258, 1998; and Wakayama et al., Nature 394: 369-374, 1998).

Selective detection for transgenic animals that express no. HuAFP After the candidate transgenic animals are generated, they must be detected selectively in order to detect animals whose cells contain and express the transgene. The presence of a transgene in animal tissues is typically detected by Southern blot analysis or using PCR amplification of DNA from candidate transgenic animals (see, e.g., Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1998; see also Lubon et al.,. U.S.P.N. 5,831, 141). The expression of ng.HuAFP in milk, urine, blood or lymph can be determined in any standard immunological test, eg, ELISA or Western blotting analysis, using an antibody directed against human AFP (see, e.g., Murgita et al., USPN ,384,250 and Ausubel et al., Supra). For an example of work on ELISA-based detection of protein encoded by transgene in milk, see Drohan et al., U.S.P.N. 5,589,604.

Transgenic plants Any number of host plants can be used to produce ng.HuAFP using the constructions of the invention, including without Limitation, algae, tree species, ornamental species, temperate fruit species, tropical fruit species, vegetable species, legume species, crucifera species, monocotyledonous, dicotyledonous or in any plant of commercial or agricultural importance. Particular examples of suitable host plants include, but are not limited to, conifers, petunia, tomato, potato, tobacco, lettuce, sunflower, oilseed rape, flax, cotton, sugar beet, celery, soybeans, alfalfa, lotus, cucumber, carrot, eggplant, cauliflower, horseradish, marigold, white poplar, walnut, apple tree, grape, asparagus, rice, corn, millet, onion, barley, orchard grass, oats, rye, wheat, corn, alfalfa, peat, aquatic plants capable of vegetative multiplication, azola, floating rice, water hyacinth, watermelon, flowering plants submerged in water, and species of the genus Arabidopsis, Medicago, Vigna, Fragaria, Lotus, Onobrychis, Trífolium, Trigonella, Citrus , Linum, Geranium, Manihot, Daucus, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciohorium, Helianthus, Lactuca, Bromus, Antirrhinum, Hererocallis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus , Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum and Datura. The plant extracts can be derived from any transgenic plant capable of producing ng.HuAFP. In addition, as described below, transgenic constructs can be expressed in a plant for the production of ng.HuAFP which can be isolated from plant tissue, or from a secretion of the plant.

Plant promoters Various plant promoters have been identified and isolated from different plants, as described in various patents, such as the U.S. Patents. Nos. 5,391, 725; 5,536,653; 5,589,583; 5,608,150; 5,898,096; 6,072,050; 6,184,440; and 6,331, 663. Promoters of desired plants include strong and non-tissue-specific or developmental plant promoters (e.g., a promoter that strongly expresses in many or all types of plant tissue). The desired plant promoters include the 35S (CaMV 35S) and 19S (CaMV 19S) cauliflower mosaic virus gene promoters, which allow expression at a high level in virtually all plant tissues (Benefey et al., Science 250: 959-966, 1990, Odell et al, Nature 313: 810-812, 1985, Jensen et al., Nature 321: 669-674, 1986, Jefferson et al., EMBO J. 6: 3901-3907, 1987. and Sanders et al., Nuc Acids Res. 14: 1543-1558, 1987). Within a 35S CaMV promoter, expression conferred by domain A (-90 to +8) was found to be particularly strong in root tissue, whereas expression conferred by domain B (-343 to -90) seemed be stronger in the cotyledons of seeds and seedlings and in the vascular tissue of the hypocotyl (Benfey et al., EMBO J. 8: 2195-2202, 1989). In addition, the activity of this promoter can be increased (i.e., 2-10 fold) by duplication of the CaMV 35S promoter (see, e.g., Kay et al., Science 236: 1299, 1987; Ow et al. , Proc. Nati. Acad. Sci., USA 84: 4870, 1987; and Fang et al., Plant Cell 1: 141, 1989). Other desirable plant promoters include, for example, the T-DNA manopin synthetase promoter and various derivatives, an inducible promoter, such as the isoform II corn glutathione-S-transferase gene promoter (GST-ll-27), which is activated in response to application of exogenous protector (WO93 / 01294, ICI Ltd); the GST-ll-27 gene promoter, which has been shown to be induced by certain chemical compounds that can be applied to growing plants; the dexamethasone (DEX) promoter (Aoyama et al., Plant Journal 11: 605-612, 1997); a specific lengthening tissue promoter (e.g., cell promoter); a chalcone synthase (CHS) promoter; and the potato PATATIN promoter (Rocha-Sosa et al., EMBO J. 8: 23-29, 1989) which can be used when expression is desired in tissues and organs of elongation. Other suitable plant promoters include, for example, the nopaline synthase (NOS) and octopine synthase (OCS) promoters (which are carried on Agrobacterium tumefaciens tumor-inducing plasmids; Ha and An, Nucleic Acids Res. 17: 215-224. , 1989; and An et al., Plant Physiol. 88: 547-552, 1988); the ST-LS 1 gene from leaf / stem of Solanum tuberosum of potato (Stockhaus et al .., Plant Cell 1: 805-814, 1989); the hsp 17.5-E or hsp 17.3-B promoters of soybean heat shock protein (Gurley et al., Mol Cell Biol. 6: 559-565, 1986); the hemoglobin promoter from Paraponia andersoni (Landsmann et al., Mol. Gen. Genet, 214: 68-73, 1988); the phenylalanine ammonia-lyase promoter, which appears to be active in cell types specific ones that accumulate phenylpropanoid derivatives in response to wounds and also during the normal development of xylem and flower (Bevan et al., EMBO J. 8: 1899-1906, 1989); the promoter of 5-enoliruvilshiquimato-3-phosphate synthase gene from petunia (Benfey and Chua, Science 244: 174-181, 1989); and the sucrose synthase promoter. All of those promoters have been used to create various types of DNA constructs that have been expressed in plants (see, for example, PCT publication WO84 / 02913). For certain applications, it may be desirable to regulate the production of ng.HuAFP in an appropriate plant tissue, at an appropriate level or at an appropriate development time. For this purpose, there is a classification of gene promoters, each of which with its own distinctive features modalized in its regulatory sequences, shown to be regulated in response to the environment, hormones, and / or developmental cues. These include promoters of genes that are responsible for the expression of the thermal-regulated gene (see, e.g., Takahashi and Komeda, Mol.Gen. Gen. 219: 365-372, 1989); light-regulated gene expression (e.g., Cab2 photosynthetic specific promoter from Arabidopsis; the rbcS promoter from maize described by Schaffner and Sheen, Plant Cell 3: 997-1012, 1991; pea rbcS-3A; the light-inducible promoter of the small subunit of ribulose bisphosphate carboxylase (ssRUBISCO, a very abundant plant polypeptide, Coruzzi et al., EMBO J. 3: 1671-1679, 1984, and Herrera-Estrella et al., Nature 310: 115-120, 1984); chlorophyll a / b binding protein (Cab) of the chlorophyll-protein complex under light harvest (Apel et al., Eur. J. Biochem. 85: 581-588, 1978; Stiekema et al., Plant Physiol. 72: 717-724, 1983, Thompson et al., Plant 158: 487-500, 1983; and Jones et al., EMBO J. 4: 2411-2418, 1985); or the chlorophyll a / b binding protein gene found in pea described by Simpson et al., EMBO J. 4: 2723, 1985); hormone-regulated gene expression (e.g., the abscisic acid response (ABA) sequences of the wheat Em gene described by Marcotte et al., Plant Cell 1: 969-976, 1989, the HVA1 and HVA22 promoters, and rd29A inducible by ABA described for barley and Arabidopsis by Straub et al., Plant Mol. Biol. 26: 617-630, 1994, Shen et al., Plant Cell 7: 295-307, 1995, and wound-induced gene expression ( for example, from wunl described by Siebertz et al., Plant Cell 1: 961-968, 1989), organ-specific gene expression, the 23-kDa corn zein gene, or the bean β-phaseolin gene French described by Bustos et al., Plant Cell 1: 839-853, 1989, the vegetative storage protein promoter (soy vspB) described by Sadka et al., Plant Cell 6: 737-749, 1994), promoters of cyclization (e.g., the cdc2a Arabidopsis promoter described by Hemerly et al., Proc. Nati, Acad. Sci. USA 89: 3295-3299, 1992); specific promoters of senescence (e.g., the SAG12 promoter of Arabidopsis described by Gan et al, Science 270: 1986-1988, 1995); seed-specific promoters (eg, endosperm-specific or embryo-specific promoters); or pathogen-inducible promoters (e.g., PR-1 or b-1, 3-glucanase promoters).

Two other promoters that have been widely used in plant cell transformations are those of the genes encoding alcohol dehydrogenase, Adhl and Adhll. Both genes are induced after the onset of anaerobiosis. In yet another embodiment of the present invention, it may be advantageous to transform a plant with a ng.HuAFP transgene construct operably linked to a modified or artificial plant promoter. Typically, said promoters, constructed by recombining structural elements from different plant promoters, have unique patterns and / or expression levels not found in natural plant promoters (see, Salina et al., Plant Cell 4: 1485-1493, 1992, for examples of artificial promoters constructed by combining cis-regulatory elements with a promoter core). Certain bacterial promoters have also been observed to be expressed in plants, including a FIXD gene promoter from Rhizobium meliloti described in the U.S. patent. No. 4,782,022. Several promoter sequences called rol A, B and C promoters have been identified in Agrobacterium rhizogenes (see, e.g., Schmulling et al., Plant Cell 1: 665-670, 1989; and Sugaya et al., Plant Cell Physiol. 30: 649-654, 1989). The C-role promoter described by Sugaya et al., Supra, located in the bacterial Ri plasmid, has been observed to be expressed in phloem cells. Other suitable promoters will be known to those skilled in the art. Also in accordance with the invention, ng.HuAFP can be secreted from expressing plant cells that are achieved by fusing the ng.HuAFP nucleic acid sequence to any suitable secretory signal peptide. The materials for expressing the construction of the ng.HuAFP transgene of the invention are suitable from a wide range of sources including American Type Culture Collection (Rockland, MD); or from any of a number of seed companies, for example, W. Atlee Burpee Seed Co. (Warminster, PA), Park Seed Co. (Greenwood, SC), Johnny Seed Co. (Albion, ME) or Northrup King Seeds. (Harstville, SC). Methods for transgenic plants are described, e.g., in Ausubel et al., Supra; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990; Kindle, Proc. Nati Acad. Sci., USA 87: 1228-1232, 1990; Potrykus, Annu. Rev. Plant Physiol. Plant Mol. Biology 42: 205, 1991; and BioRad (Hercules, CA) Technical Bulletin # 1687 (Biolistic Particle Delivery Systems). Expression vehicles can be chosen from those provided, e.g., in Cloning Vectors: A Laboratory Manual (Pouwels et al., 1985, Suppl. 1987), Clontech Molecular Biology Catalog (Catalog 1992/93 Tools for the Molecular Biologist , Palo Alto, CA); and references cited above. Other expression constructs are described in Fraley et al., (U.S. Patent No. 5,352,605). A number of suitable vectors for the establishment of transgenic plants are available to the public; these vectors are described in Pouwels et al., previously, Weissbach and Weissbach, previously and Gelvin et al., supra. These plant expression vectors can be modified for use in the invention and include (1) a nucleic acid sequence encoding ng.HuAFP, (2) a promoter (e.g., inducible or constitutive expression, pathogen-induced or wounding , environmentally regulated or by development, or cell or tissue specific), (3) a signal sequence that directs the secretion of ng.HuAFP, (4) a dominant detectable marker, (5) a site of onset of transcription, (6) a ribosome binding site, (7) an RNA processing signal, (8) a transcription termination site and / or (9) a polyadenylation signal. The promoter and the signal sequence are operably linked to the nucleic acid sequence of ng.HuAFP. For applications where expression of developmental, cell, tissue, hormonal or environmental is desired, the appropriate non-coding regions to the 5'-end are obtained from other genes, eg, from genes regulated during the development of the meristem, development of the seed, development of the embryo or development of the leaf. Plant expression vectors may also optionally include RNA processing signals, e.g., introns, which have been shown to be important for efficient RNA accumulation synthesis (Callis et al., Genes and Dev. 1: 1183-1200, 1987). The location of RNA splicing sequences can drastically influence the level of transgene expression of ng.HuAFP in plants. In view of this fact, a Intron can be located towards the 5 'end or towards the 3' end of the regulator coding sequence in the ng.HuAFP transgene to modulate gene expression levels. In addition, expression vectors can include 5 'and 3' regulatory control sequences that are generally present in the 5 'and 3' regions of plant genes (An et al., Plant Cell 1: 115-122, 1989 ). For example, the 3 'terminator region can be included in the expression vector to increase the stability of the mRNA. The terminator region of this type can be derived from the bl-ll terminator region of the layer. In addition, other commonly used terminators are derived from the signals of octopine or nopaline cintasa. The plant expression vector also typically contains a dominant selectable marker gene to identify those cells that have been transformed. Selectable genes useful for plant systems include genes that encode antibiotic resistance genes, for example, those encoding resistance to hygromycin, kanamycin, bleomycin, G418, streptomycin or spectinomycin. The genes required for photosynthesis can also be used as selectable markers in deficient photosynthetic strains. Finally, the genes that code for herbicide resistance can be used as selectable markers; useful herbicide resistance genes include the bar gene encoding the enzyme phosphinothricin acetyltransferase and confer resistance to the broad spectrum of BASTA® herbicide; (Hoechst AG, Frankfurt, Germany).

The efficient use of selectable markers is facilitated by a determination of the susceptibility of a plant cell to a particular selectable agent and a determination of the concentration of this agent that effectively kills most, if not all, of the transformed cells. Some useful concentrations of antibiotics for tobacco transformation include, e.g., 75-100 μg / ml (kanamycin), 20-50 μg / ml (hygromycin), or 5-10 μg / ml (bleomycin). A useful strategy for the selection of transformants for herbicide resistance is described, e.g., in Vasil IK, Cell Culture and Somatic Cell Genetics of Plants, Vol I, II, III Laboratory Procedures and Their Applications Academic Press, New York, 1984.

Plant transformation Under construction of plant expression vector, several standard methods are available for the introduction of the vector in a host plant, thus generating a transgenic plant. See, in general, Methods in Enzymology Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press and European Patent Application EP 693554. These methods include (1) transformation mediated by Agrobacterium (A. tumefaciens or A. rhizogenes) (see, eg, Lichtenstein and Fuller, in: Genetic Engineering, Vol. 6, PWJ Rigby, ed, London, Academic Press, 1987; Lichtenstein, C. P., and Draper, J ,. in: DNA Cloning, Vol II, D.M. Glover, ed, Oxford, IRI Press, 1985; Horsch et al., Science 233: 496-498, 1984; and Fraley et al., Proc. Nati Acad. Sci. USA 80: 4803, 1983); (2) the particle delivery system (see, eg, Gordon-Kamm et al., Plant Cell 2: 603, 1990; and Klein et al., Nature 327: 70-73, 1987); or BioRad Technical Bulletin 1687, supra); (3) microinjection protocols (see, e.g., Green et al., Supra); (4) polyethylene glycol (PEG) processes (see, e.g., Draper et al., Plant Cell Physiol., 23: 451, 1982; Paszkowski et al., EMBO J. 3: 2712-2722, 1984; and Zhang. and Wu, Theor, Appl. Genet, 76: 835, 1988); (5) liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol. 25: 1353, 1984); (6) electroporation protocols (see, eg, Gelvin et al., Supra; Dekeyser et al., Supra; Fromm et al., Proc. Nati. Acad Sci. USA 82: 5824, 1985; Fromm et al. ., Nature 319: 791, 1986; Sheen, Plant Cell 2: 1027, 1990; and Jang and Sheen, Plant Cell 6: 1665, 1994); and (7) the swirl method (see, e.g., Kindle, supra), and floral immersion method (see, e.g., Clough and Bent, Plant J. 16: 735-743, 1998). The transformation method is not critical to the invention. Any method that provides efficient transformation can be used. Since newer methods are available to transform crops or other host cells, they can be applied directly. The following is an example that delineates a particular technique, a plant transformation mediated by Agrobacterium. By this technique, the general procedure for manipulating genes that are to be transferred to the genome of plant cells is carried out in two phases. First, the DNA cloning and coding steps are carried out in E. coli, and the plasmid containing the gene construct of interest is transferred by conjugation or electroporation to Agrobacterium. Second, the resulting Agrobacterium strain is used to transform plant cells. Therefore, for the generalized plant expression vector, the plasmid contains an origin of replication that allows it to replicate in Agrobacterium and a high-copy copy number origin of origin in E. coli. This allows the easy production and testing of transgenes in E. coli before transfer to Agrobacterium for subsequent introduction into plants. Resistance genes can be carried in the vector, one for selection of bacteria, for example, streptomycin, and another that will work in plants, for example, a gene that encodes kanamycin resistance or herbicide resistance. Also present in the vector are restriction endonuclease sites for the addition of one or more transgenes and directional T-DNA border sequences which, when recognized by the Agrobacterium transfer functions, delineate the region of DNA that will be transferred to the plant. In another example, plant cells can be transformed by firing them into the tungsten microprojectiles of cells in which the cloned DNA is precipitated. In the biolistic apparatus (Bio-Rad) used for firing, a powder charge (22-gauge power piston tool charge) or an air-driven blast drives a plastic macroprojectile through a gun cylinder. An aliquot of a suspension of tungsten particle in which the DNA has been precipitated is placed in the front part of the plastic macroprojectile. The latter is fired on an acrylic stop plate that has a hole through it that is too small for the macroprojectile to pass through. As a result, the plastic macroproject is projected against the stop plate and the tungsten microprojectiles continue towards their objective through the hole in the plate. For the present invention, the target can be any plant cell, tissue, seed or embryo. The DNA introduced into the cell in the microprojectiles is integrated into either the nucleus or the chloroplast. In general, the transfer and expression of transgenes in plant cells is now a routine practice for those skilled in the art., and has become an important tool in studies of gene expression in plants and to produce improved plant varieties of agricultural or commercial interest. Transgenic lines can be evaluated for expression levels of ng.HuAFP. The expression at the RNA level is initially determined to identify and quantify positive expression plants. Standard techniques for RNA analysis are used and include PCR amplification assays using oligonucleotide primers designed to amplify only transgene RNA templates and hybridization assays using transgene-specific probes (see, e.g., Ausubel et al. ., supra). RNA positive plants are then analyzed for protein expression by Western immunoblot analysis using specific antibodies (see, e.g., Ausubel et al., Supra). In addition, in situ hybridization and Immunocytochemistry according to standard protocols can be done using nucleotide probes specific for ng.HuAFP and antibodies, respectively, to localize expression sites within transgenic tissue.

Regeneration of transgenic plants Plant cells transformed with a plant expression vector can be regenerated, for example, from individual cells, callus tissue or leaf discs in accordance with standard plant tissue culture techniques. It is well known in the art that several cells, tissues and organs of almost any plant can be successfully cultivated to regenerate an entire plant; said techniques are described, e.g., in Vasil et al., supra; Green et al., Supra; Weissbach and Weissbach, supra; Gelvin et al., Supra; Methods in Enzymology Vol. 153, Wu and Grossman Eds., Academic Press, 1987; and Methods in Enzymology, Vol. 118, Wu and Grossman Eds., Academic Press, 1987. Regeneration of plants from culture protoplasts is described in Evans et al., Handbook of Plant Cell Cultures 1: 124-176, MacMillan Publishing Co. New York, 1983; Davey, Protoplasts (1983) -Lecture Proceedings, pp. 12-29, Birkhauser, Basal, 1983; Dale, Protoplasts (1983) -Lecture Proceedings, pp. 31-41, Birkhauser, Basel, 1983; and Binding, Plant Protoplasts, pp. 21-73, CRC Press, Boca Ratón, 1985.

Purification of AFP from a biological fluid The ng.HuAFP can be purified from the biological fluid of a transgenic organism using standard protein purification techniques, such as affinity chromatography (see, e.g., Ausubel et al. , Current Protocols in Molecular Biology, John Wiley &Sons, New York, NY, 1998; see also Lubon et al., U.S.P.N. 5,831, 141) or other methods known to those skilled in the art of protein purification. Once isolated, ng.HuAFP can be, if desired, further purified by, eg, high performance liquid chromatography (HPLC; e.g., see Fisher, Laboratory Techniques in Biochemistry and Molecular Biology, eds. .

Work and Burdon, Elsevier, 1980). After purification, the ng.HuAFP is at least 80% pure, preferably 90% pure, most preferably 95% pure, and most preferably 99% pure.

Use of purified ng.HuAFP from the biological fluid of a transgenic organism The ng.HuAFP that is secreted in a biological fluid (e.g., milk, urine, blood or lymph) of a transgenic organism (e.g. a mammal) or that is purified from a biological fluid can be used as a therapeutic agent. For example, ng.HuAFP produced by the methods of the invention can be administered to a patient in need thereof to inhibit growth of cancer cells, to induce proliferation of bone marrow cells (e.g., after a bone marrow transplant). or after administration of a myelotoxic treatment such as chemotherapy or radiation treatment), or as an immunosuppressive agent (e.g., to inhibit the proliferation of autoreactive immune cells, to inhibit rejection of a transplanted organ (e.g. graft versus host), or to treat rheumatoid arthritis, muscular dystrophy, systemic lupus erythematosus, myasthenia gravis or insulin dependent diabetes mellitus). The ng.HuAFP present in or purified from a biological fluid (e.g., milk, urine, blood or lymph) can be administered in an effective amount either alone or in combination with a pharmaceutically acceptable carrier or diluent, or in combination with other therapeutic agents by any convenient methods known to those skilled in the art. Pharmaceutical formulations of a therapeutically effective amount of ng.HuAFP, or a pharmaceutically acceptable salt thereof, can be administered orally, parenterally (e.g., intramuscular, intraperitoneal, intravenous or intradermal), by subcutaneous injection, by inhalation or through the use of optical drops or an implant), nasally, vaginally, rectally, sublingually or topically, in admixture with a pharmaceutically acceptable vehicle adapted for the route of administration. Pharmaceutical formulations containing a therapeutically effective amount of ng.HuAFP are desirably administered subcutaneously, intramuscularly or intravenously.

Methods well known in the art for making formulations are found, for example, in Remington's Pharmaceutical Sciences (18th edition), ed. A. Gennaro, 1990, Mack Publishing Company, Easton, PA. Compositions designed for oral use can be prepared in solid or liquid forms in accordance with any method known in the art for the manufacture of pharmaceutical compositions. The composition may optionally contain sweetening, flavoring, coloring, perfume and / or preservative agents in order to provide a more palatable preparation. Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In such solid forms, the ng.HuAFP is mixed with at least one inert pharmaceutically acceptable carrier or excipient. These may include, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, sucrose, starch, calcium phosphate, sodium phosphate or kaolin. Binders, pH regulating agents and / or lubricating agents (e.g., magnesium stearate) can also be used. Tablets and pills can be prepared additionally with enteric coatings. Compositions designed for oral use can be prepared with an enhancer to facilitate the absorption of ng.HuAFP in the bloodstream of the recipient. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups and soft gelatine capsules. These forms contain inert diluents commonly used in the art, such as water or an oily medium. In addition to said inert diluents, the compositions may also include adjuvants, such as wetting agents, emulsifying agents and suspending agents. Formulations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions or emulsions. Examples of suitable carriers include propylene glycol, polyethylene glycol, vegetable oils, gelatin, hydrogenated naphthalenes and injectable organic esters such as ethyl oleate. Said formulations may also contain adjuvants such as preservatives, humectants, emulsifiers and dispersing agents. The biodegradable, biocompatible lactide polymer, lactide / glycolide copolymer or polyoxyethylene-polyoxypropylene copolymers can be used to control the release of ng.HuAFP or other active compounds in the composition. Other potentially useful parenteral delivery systems for a composition containing ng.HuAFP include ethylene-vinyl acetate copolymer particles, osmotic pumps, implantable infusion systems and liposomes. The liquid formulations can be sterilized, for example, by filtration through a bacteria retention filter, by incorporating sterilizing agents into the compositions or by irradiating or heating the compositions. Alternatively, it can also be manufactured in the form of sterile solid compositions which can be dissolved in sterile water or other sterile injectable medium immediately before use.

Compositions for rectal or vaginal administration are desirably suppositories which may contain, in addition to active substances, excipients such as cocoa butter or a suppository wax. Compositions for nasal or sublingual administration are also prepared with standard excipients known in the art. The formulations for inhalation may contain excipients, for example, lactose or they may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycolate and deoxycholate, or they may be oily solutions to be administered in the form of nasal drops or aspersion or as a gel. The amount of ng.HuAFP present in the composition can be varied. One skilled in the art will appreciate that the exact individual doses can be adjusted a bit depending on a variety of factors, including the time of administration, the route of administration, the nature of the formulation, the rate of excretion, the nature of the conditions of the subject, and the age, weight, health and gender of the patient. In general, dose levels of between 0.1 μg / kg to 100 mg / kg of body weight are administered daily as a single dose or divided into multiple doses. For most treatments, it is contemplated that a parenteral dose of between 10 μg / kg to 5.0 mg / kg body weight will be administered once or twice a week. The administration of high doses (up to 5 mg / kg) for some diseases is considered to allow a dosage once a month. Wide variations in the necessary dose are expected in view of the different efficiencies of the various routes of administration and the disease to be treated. For example, it would generally be expected that oral administration would require higher dose levels than administration by intravenous injection. Variations in those dose levels can be adjusted using standard empirical routines for optimization, which are well known in the art. In general, the precise therapeutically effective dose of ng.HuAFP will be determined by the attending physician in consideration of the previously identified factors. Ng.HuAFP can be administered in a sustained release composition such as those described, for example, in the US patent. No. 5,672,659 and US patent. No. 5,595,760. The use of immediate or sustained release composition depends on the type of condition being treated. If the condition consists of an acute or overactive disorder, a treatment with an immediate release form will be desired over a prolonged release composition. Alternatively, for preventive or long-term treatments, a sustained release composition will generally be desired.

EXAMPLE The following example is intended to illustrate the invention. It is not intended to limit the invention in any way.

EXAMPLE 1 Generation of transgenic animals expressing recombinant human AFP ((rHuAFP) and non-glycosylated human AFP (ng.HuAFP) Materials and methods Recombinant DNA procedures The recombinant DNA methods were performed according to Sambrook, Fritsch, and Maniatis (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, 1989). Genomic and cDNA libraries were selectively detected with radiolabeled olionucleotide probes derived from coding exons at the beginning (51), the middle and the end (31) of the human AFP gene (access to GenBank # M16110). The sequences of these probes are shown below: AFP1: 5 * -ATGAAGTGGGTGGAATCAATTTTTTTAATT-3 '(SEQ ID NO: 18) AFP2: 5'-ATTCATTTATGAGATAGCAAGAAGGCAT-3' (SEQ ID NO: 19) AFP3: d'-AAAAAATCATGTCCTACATATGTTCTCAA-S '(SEQ ID NO: 20) Cloning of the human AFP gene The gene for AFP encompasses approximately 19 kb and contains 15 exons (coding, 14) separated by 14 introns. The complete sequence of the human AFP gene has been reported by Gibbs et al. (Biochemistry 26: 1332-1343,1987) and exposed in access to GenBank No. M16610. The gene was initially cloned into two fragments of approximately 15 kb, which were then combined to combine the expressed protein. A human placental genomic library (Stratagene, La Jolla, CA), with an average insert size of between 9 and 23 kb, was initially detected selectively with a series of complementary oligonucleotide probes that recognize exons at the beginning, middle and end of the human AFP gene. The first screening did not produce any positive clones. Two larger DNA probes were made using the polymerase chain reaction (PCR) to amplify regions of the start and end of the AFP gene from human genomic DNA. Subsequent screening of the library with these probes yielded two overlapping lambda (?) Phage clones of approximately 15 kb, which together span the length of the human AFP gene (Figures 2A and 2B). A DNA fragment containing the full-length coding region of human AFP and lacking the translation start sequence is obtained by performing amplification by polymerase chain reaction (PCR) using a plasmid containing the HuAFP cDNA (access to Genbank No. J00077), such as pHuAFP (described in Murgita et al., USPN 5,384,250) as a template and the following oligonucleotide primers: NH2 (5'-AAA CTC GAG AAG TGG GTG GAA-3 '; SEQ ID NO : 21) and COOH (5'-AAA CTC GAG TTA AAC TCC CAA AGC-3 '; SEQ ID NO: 22).

Each PCR reaction contains 34 μl of DNA template, 10 μl of 10 pmol / μl 5'-initiator, 10 μl 10X of reaction pH regulator, 20 μl of 1mM dNTPs, 2 μl of DMSO and 1 μl of DNA template, 10 μl of 10 pmol / μl of 10 pmol / μl 5 'primer, 10 μl of 10 pmol / μl 3! initiator, 1 μl of glycerol, 10 μl of DMSO and 1 μl of Pfu DNA polymerase. The tempering, extension and denaturation temperatures are 50 ° C, 72 ° C and 94 ° C, respectively, for 30 cycles, using the Gene Amp PCR System 9600. The 1783-bp DNA obtained from the PCR reactions is digested with Xho I and then purified by isolating the fragment from a 0.7% TAE agarose gel, followed by gel extraction using the Geneclean method (Bio 101; Vista, CA) in accordance with the manufacturer's instructions.

Construction of genomic DNA constructs Two overlapping lambda phage clones were identified, which spanned the length of the rHuAFP coding sequence. These phage inserts were subcloned into a supreme vector for subsequent manipulations (Figure 1, gtc913 and gtc912). Additional sequences of the 5'-flanking region, towards the 5 'end of the initiator ATG in gtc913, and additional 3'-flanking sequences towards the 3' end of the last exon in gtc912 were removed. In addition, at the 5 'terminal, a Kozak sequence was added to ensure efficient translation initiation. This was accomplished by inserting restriction enzyme "linkers" into the gene sequences for subsequent excision of the appropriate sequences, leaving intact the flanking sequences (figure 1). Second, the 5 'and 3' pieces were cut from their respective vectors using a common enzyme for the two inserts that allows them to be joined together to form the complete gene. The Bgll enzyme was used since it cuts once at the 3 'end of the piece 5' and once, at the same site, at the 5 'end of the piece 3'. The two resulting fragments were then ligated into the β-casein expression vector (GBC350) at the Xhol site to create BC934. By separately manipulating the internal Blpl fragment of BC934, the normal glycosylation site at position 233 was loaded (N to Q) through the use of space mutagenesis. The three Blpl fragments were then re-ligated in the proper orientation to create BC1055 (Figures 2A and 2B). The transgene vector (see Figure 1, see Meade et al., U.S.P.N. 5,827,690) contains a goat β-casein gene altered with an Xho I site in place of the coding portion of the gene. The deleted portion of the goat β-casein gene extends from the Taq 1 site in exon 2 to the Ppu Ml site in exon 7. Exon 2 contains the translation initiation codon in addition to a secretion signal of 15 amino acids. To generate the goat β-casein / human AFP transgene, the Xho \ IXho I HuAFP cDNA was ligated between exons 2 and 7 of the goat β-casein gene at the Xho I site. The complete transgene contains 6.2 kb of the 5 'goat ß-casein sequence, the 1.8 kb cDNA of HuAFP and the goat β-casein flanking sequence of 7.1 kb 3'.

Preparation of DNA for microinvection and transfection Transgene DNA was separated from the base structure of the vector by digesting the plasmid until complete with Sali and Notl (New England Biolabs, Beverly, MA). The digestions were then subjected to electrophoresis in an agarose gel, using 1 X TAE (Maniatis et al., 1982) as a regulator of current pH. The region of the gel containing the DNA fragment corresponding to the expression cassette was visualized under UV light (long wave). The band containing the DNA of interest was cut and the DNA was isolated by electroelusion in 1X TAE. This procedure was applied for each expression cassette. After electroelusion, the DNA fragments were concentrated and further purified. The final elution was performed using 125 μl of microinjection pH regulator (10 mM Tris pH 7.5, 0.2 mM EDTA). The aliquots of microinjection supply solution were diluted in microinjection pH regulator immediately before the microinjection so that the final concentration of each fragment was 0.5 ng / ml.

Transgenic Mouse Generation: Embryo Collection, Nuclear Transfer and Embryo Transfer For nuclear transfer, somatic cells were isolated either from fetal tissues or skin biopsies, transduced and further characterized as described above. Somatic cells Transduced and characterized constructs containing constructs of rHuAFP or ng.HuAFP were placed in culture for use in the nuclear transfer procedure. The male pronuclei were microinjected with DNA diluted in regulator of microinjection pH. The female CD1 mice were superovulated and the fertilized ovules recovered from the oviduct. The recovered oocytes were enucleated through mechanical removal of the metaphase plate of the Mil oocyte. The enucleated oocytes (cytoplasts) were then reconstructed with an isolated single transduced somatic cell (carioplast). Once reconstituted the pair (enucleated oocyte and somatic cell) were fused together by an electrical pulse with embryo simultaneously activated and reconstructed. The activated embryo was then placed in culture. The reconstructed embryo was then maintained in culture for 24-48 hours (in a CZB medium) and evaluated for embryo viability and development prior to embryo transfer, or was immediately transferred to the oviduct of female CD1 recipient pseudopregnant mice. After the nuclear transfer and embryo culture procedure, viable and developing embryos were transferred to suitable recipient animals. Twenty to thirty 2-cell embryos or forty to fifty embryos from a 1-cell were transferred to each female receptor in the oviduct, ipsilateral to CL, in a small volume of medium by precise cannulation of the oviduct with a glass pipette and let it proceed to term.

Identification of founding animals Genomic DNA was isolated from mouse tail tissue by digestion with proteinase K followed by extraction with NaCl and ethanol precipitation and analyzed by polymerase chain reaction (PCR) to detect DNA binding sequences of ß -casein / alpha-fetoprotein present in transgenes. Ear tissue and goat white blood cells were processed in a similar manner but the DNA was extracted successively with saturated phenol, phenol: isoamylic alcohol and chloroform before precipitation with ethanol. For PCR reactions, approximately 250 ng of genomic DNA was diluted in 50 ml of PCR buffer (20 mM Tris pH 8.3, 50 mM KCl, and 1.5 mM MgCl2, 100 mM deoxynucleotide triphosphate, and each initiator at a concentration of 600 nM) with a 1.0 unit Taq polymerase and amplified on an MJ Research DNA Engine DNA machine using PCR cycling conditions. The following primers were used in the PCR reactions: Oligo GTC 17 GATTGACAAGTAATACGCTGTTTCCTC (SEQ ID NO: 23); Oligo AFP-PCR3 TTTGTAAACCTCTTGTAAAGTTACAAG (SEQ ID NO: 24); Oligo GEX7F CCAGGCACAGTCTCTAGTCTA (SEQ ID NO: 25); and Oligo GEX7R GGACAGGACCAAGTACAGGCT (SEQ ID NO: 26).

Southern Blot Analysis Five μg of genomic DNA was digested with 100 units of EcoRI followed by electrophoresis through a 0.8% agarose gel. He group was then transferred to a loaded nylon membrane (Genescreen Plus, New England Nuclear) by capillary action of a 0.4N NaOH and UV interlacing (Stratalinker, Sratagene). After prehybridization in hybridization pH buffer (5X SSC, 50% formamide, 10% dextran sulfate, 20 mM sodium phosphate, 1X Denhardt's, 0.5% SDS) containing 20 μg / ml sperm DNA of denatured herring, a probe was added and the transfer was incubated overnight at 42 ° C. The blots were washed as follows: once in 1X SSC, 1% SDS at room temperature for 20 minutes, once in 0.5X SSC, 0.5X SDS at room temperature for 20 minutes and three times in 0.1X SSC, 0.1% SDS at 65 ° C for 20 minutes each time. After the washings, the transfers were autoradiographed.

Western Blotting Harlow and Lane immunoblotting procedures (Antibodies: A Laboratory Manual, Cold Spring Laboratory, 1988) were used for the immunodetection of proteins. Milk samples were diluted 1: 20 in PBS, then mixed 1: 1 with 2X SDS of gel charge buffer (50 mM Tris HCl, pH 6.8, 2% SDS, 10% glycerol, 10% ß -mercaptoethanol), were heated at 65 ° C for two minutes and subjected to SDS-PAGE. The proteins in the gel were transferred into Immobilon P membranes in transfer buffer (50 mM Tris, 380 mM glycine, 0.1% SDS, 20% methanol) by electroblotting. For immunostaining, the The membrane was incubated with a pH regulator (4% dry skim milk, BioRad, Hercules, CA, in PBS containing 0.01% Tween-20) at room temperature (RT) for 1 hour. The membranes were then incubated with anti-hAFP antibody (1: 5000 in blocking pH buffer) for 1 hour at room temperature. After three short washes in dH2O, the membranes were incubated with secondary antibody ((1: 10000 in blocking pH regulator) for 1 hour at room temperature.The membranes were then washed three times in dH2O for 4 minutes each, once in PBS / Tween-20 and finally six times in dH2O before development with the chemiluminescent substrate (ECL) followed by autofluorography.

Analysis of transgenic mice derived from genomic DNA constructs Transgenic female mice derived from the genomic construct, BC1055, were identified by PCR and are listed in Table I. Milk from these animals was analyzed by Western blot and expression levels were stimulated comparing with hAFP standards of known concentration. The results of this expression analysis are shown in Table I and II in Figures 3 (rHuAFP) and 4 (ng.HuAFP). Expression analysis is usually carried out in second generation females of the original founder animals to test for transgene transmission and mosaicism. The reduced expression levels in the second generation is thought to be due to the segregation of multiple transgene integration sites with the lowest expression site in these cases passed to the next generation.

TABLE I Results of expression of mouse milk - construction BC934 TABLE II Results of expression of mouse milk - construction BC1055 Isolation of goat fetal fibroblasts and transfection of transgene nq. HuAFP Goat fetal fibroblast cells were isolated from fetal bovine tissue of pregnant goats (Genzyme Transgenic Corporation). The DNA fragments of the ng.HuAFP transgene (BC1055) and the neomycin resistance gene were prepared and co-transduced into goat fetal fibroblasts using LipofectAmine at 1-2 μg of transgene DNA fragments / 10 6 cells. Colonies of neomycin-resistant cells were isolated after the selection of G418. The isolated clones were expanded and the selected cell lines were cryopreserved. These cell lines were subjected to PCR analysis using BC1055-specific primers to determine the presence of transgene. In addition, the FISH analysis of the cell lines was carried out to confirm the integration of the transgenes (see below).

Generation of transgenic founder goats Transgenic goats were generated by injecting, in the pronucleus from harvested embryos, the 15.1 kb fragment of the purified goat ß-casein-HuAFP from prokaryotic DNA at a concentration of 1.0 μg / ml in 10 mM Tris, pH 7.5, 0.1 mM EDTA. The injected embryos were transferred to recipient females. A founder transgenic goat (Fo) was identified by analyzing genomic DNA from the blood by polymerase chain reaction (PCR) and by Southern blot analysis in order to detect the presence of a transgene. For analysis . of PCR, the same two oligonucleotides that were used to generate the HuAFP cDNA were used in the reaction. For Southern blot analysis, the DNA was fractionated on a 1% TBE agarose gel, transferred to nitrocellulose and probed with a randomly initiated 1.8 Kb H-labeled HuAFP cDNA. The identified founder can now reproduce with a non-transgenic animal to produce transgenic offspring. Alternatively, the transgenic offspring can be obtained by nuclear transfer, as described above. The transmission of the transgene can be detected by analyzing genomic DNA from blood and other tissues as described above.

Genetic analysis of founder goat F093 A healthy female goat (F093) was born on March 11, 2002. To determine if this goat carries the ng.HuAFP transgene, PCR analysis of blood and ear tissue was performed. Initially, two pairs of PCR primers were used at the same time. The first pair, as shown in the diagram of Figure 5, is specific for the transgene, and the The resulting 332 bp product covers the binding of the sequences of 5 'ß-casein and 5' ng.HuAFP. The second pair of primers recognizes the exon of goat β-casein seven that is not present in the transgene construct and yields a product of 439 bp. Figures 6A and 6B show that the ng.HuAFP transgene is present in the F093 goat, both in blood and ear samples. A transduced cell line that had been characterized initially was used as a positive control. The ear tissue of an abortion that had been shown to carry the ng.HuAFP transgene was also used as a positive control. After confirming the genotype, analysis of Southern Blot to estimate the number of copies and regulate the gross transgene predispositions (figure 7). The DNA probe used was an Xhol / IHindIII fragment of the 3 'β-casein gene (Figures 2A and 2B, 3'BC probe) found in the transgene and the endogenous goat β-casein gene. By comparing the relative intensities of the transgene and the endogenous transgene, the number of transgene copies can be estimated. The endogenous gene signal represents two copies of the gene in a diploid genome. As can be seen in Figure 7, the two bands in the F093 sample look very similar in intensity. Scanning Densitometry (Molecular Dynamics) confirms a one-to-one relationship (the abortion of F026 has a ratio of 13: 1 by densitometry).

Fluorescence in situ hybridization assay (FISH) Culture procedures and standard preparations were used to obtain metaphase and interphase nuclei of cultured blood lymphocytes of F093 goat. the nuclei were deposited on slides and hybridized with a probe labeled with digoxigenin derived from a construct containing 8kb of the genomic sequence for human AFP.

The bound probe was amplified using antibody conjugated with horseradish peroxidase and was detected with fluorescein isothiocyanate conjugated with tyramide (FITC, green fluorochrome). The nuclei were counterstained with 4 ', 6-diamidino-2-phenylindole (DAPI, blue dye). FISH images were obtained using MetaMorph software. FISH images of metaphase chromosomes and nuclei of Map which showed the transgene are shown in Figures 8A and 8B. The transgene signal is located towards the terminal end "q" on an autosomal chromosome of medium to large size. The FISH analysis is consistent with the existence of an individual transgene integration site.

Lactation induction Female animals 12 months of age or older were induced to lactate by hormone therapy and manual stimulation for a period of 12 days. During the first 4 days, the animal received subcutaneous injections of 0.1 mg / kg of estradiol 17-ß and 0.25 mg / kg of progesterone dissolved in 100% ethanol. This daily amount is divided between Injections in the morning and at night. The udder is palpated once a day and the nipples are stimulated manually for 5-10 minutes each morning. The transgenic lactating females are milked manually twice a day and the milk is stored under freezing at -20 ° C.

Protein purification Transgenic goat milk containing rHuAFP or ng.HuAFP is clarified by tangenital flow filtration to remove miscella of casein and other contaminating proteins. The resulting filtrate (serum fraction) containing rHuAFP or ng.HuAFP is filtered through a 22 μm filter. The pH and ionic concentration are adjusted by adding an equal volume of 20 mM imidazole, pH 6.7, and the rHuAFP or ng.HuAFP is purified from the serum fraction by passing the solution through a column containing Pharmacia flow spheres Blue SEPHAROSE® 6 Fast equilibrated with 20 mM imidazole, pH 6.7. The rHuAFP or ng.HuAFP in the flow is captured with a column containing Pharmacia Q HP spheres equilibrated with 20 mM imidazole pH 6.7. The rHuAFP or ng.HuAFP is eluted with a gradient of 0 to 250 mM NaCl in 20 mM imidazole, pH 6.7. Fractions containing rHuAFP or ng.HuAFP, determined by western blot, ELISA, or SDS-PAGE gel stained with coomassie, are placed in stock and the NaCl concentration is adjusted to 725 mM. These stock-stored fractions are then applied to a column containing Pharmacia Phenyl HiSub spheres equilibrated with 1 M NaCl, 20 mM imidazole, pH 6.7. The rHuAFP or ng.HuAFP is eluted with a gradient of 1 to 10 mM NaCl in 20 mM imidazole, pH 6.7. Fractions containing rHuAFP or ng.HuAFP, determined by western blot, ELISA, or SDS-PAGE gel stained with coomassie, are stored in stock and concentrated by ultrafiltration. The final purification of rHuAFP or ng.HuAFP is achieved by applying the concentrated sample on a SUPERDEX® 200 HR column equilibrated in phosphate-buffered saline. Fractions containing rHuAFP or ng.HuAFP, determined by western blot, ELISA, or SDS-PAGE gel stained with coomassie are stored in stock. The results presented above demonstrate the native recombinant human AFP, as well as a recombinant non-glycosylated form of human alpha-fetoprotein (ng.HuAFP) were cloned and expressed in the milk of several lines of transgenic mice as a genomic "mini-gene". The expression of this gene is under the control of goat ß-casein controlling elements. Expression levels in non-mosaic mice (mice capable of passing the transgene to subsequent generations) ranged from 1.0 to 20 mg / ml. As predicted from previous studies, genomic expression constructs appear to give higher levels of ng.HuAFP expression, although the expression of ng.HuAFP was also very high (5-10 mg / m) in animals derived from cDNA constructs. The transgene products of all constructs were immunoreactive with hAFP-specific antibody. The inventors of the present have also generated a goat founder transgenic that has the same genomic transgene used to express high levels of ng.HuAFP in mice. Genetic analysis of several tissues of this goat, F093, confirms that it is in fact transgenic and carries approximately two copies of the ng.HuAFP transgene in a single integration site.

Other modalities The publications listed below describe the generation, detection and analysis of transgenic animals that secrete recombinant proteins in milk, as well as purification of recombinant proteins. These publications are incorporated herein by reference: Hurwitz et al., U.S.P.N. 5,648,243 (goats); Meade, et al., U.S.P.N. 5,827,690 (goats); DiTullio et al., U.S.P.N. 5,843,705 (goats); Clark et al., U.S.P.N. 5,322,775 (sheep); Garner et al., U.S.P.N. 5,639,940 (sheep); Deboer et al., U.S.P.N. 5,633,076 (cows); and Drohan et al., U.S.P.N. 5,589,604 (pigs and mice). Kerr et al., Nat. Biotechnol. 16: 75-79, 1998, incorporated herein by reference, describe the generation and analysis of transgenic animals that excrete recombinant proteins in the urine, as well as the purification of recombinant proteins. All publications and patent applications mentioned in this specification are incorporated herein by reference to the same degree as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.

Although the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of undergoing further modifications and this application is intended to cover any variations, uses or adaptations of the invention by following, in general, the principles of the invention and including said deviations from the present description that fall within the known or customary practice within the technique to which the invention is directed and can be applied to the essential features set forth above.

Claims (76)

NOVELTY OF THE INVENTION CLAIMS

1. - A nucleic acid molecule encoding non-glycosylated human alpha-fetoprotein (ng.HuAFP) or a non-glycosylated fragment thereof.

2. The nucleic acid molecule according to claim 1, further characterized in that it comprises nucleotides 45-1874 of the sequence set forth in SEQ ID NO: 5.

3. A nucleic acid molecule comprising: (i) a nucleic acid sequence encoding ng.HuAFP, (ii) a promoter that is operably linked to the sequence encoding ng.HuAFP that allows the expression of ng.HuAFP , and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by a cell.

4. The nucleic acid molecule according to claim 3, further characterized in that the cell is E. coli.

5. The nucleic acid molecule according to claim 3, further characterized in that the cell is a eukaryotic cell.

6. The nucleic acid molecule according to claim 5, further characterized in that the eukaryotic cell is a yeast cell or an animal cell.

7.- The nucleic acid molecule according to the claim 6, further characterized in that the animal cell is in a transgenic animal.

8. The nucleic acid molecule according to claim 7, further characterized in that the transgenic animal is a mammal.

9. The nucleic acid molecule according to claim 8, further characterized in that the mammal is a goat, sheep, camel, cow, pig, rabbit, horse or llama.

10. The nucleic acid molecule according to claim 3, further characterized in that the cell is a biological fluid producing cell in a transgenic animal; the promoter allows the expression of ng.HuAFP in the biological fluid producing cell, and the leader sequence allows the secretion of ng.HuAFP in a biological fluid of the transgenic animal.

11. The nucleic acid molecule according to claim 10, further characterized in that the biological fluid is milk, urine, blood or lymph.

12. The nucleic acid molecule according to claim 3, further characterized in that the cell is in a transgenic animal, the promoter is a milk-specific promoter that allows the expression of ng.HuAFP in a milk-producing cell of the animal , and the leader sequence allows the secretion of ng.HuAFP in the milk of the animal.

13.- The nucleic acid molecule according to the claim 3, further characterized in that the cell is in a transgenic animal, the promoter is a urine specific promoter that allows the expression of ng.HuAFP in an animal urine producing cell, and the leader sequence allows the secretion of ng.HuAFP in the animal's urine.

14. The nucleic acid molecule according to claim 3, further characterized in that the cell is in a transgenic animal, the promoter is a blood-specific promoter that allows the expression of ng.HuAFP in a blood-producing cell of the animal , and the leader sequence allows the secretion of ng.HuAFP in the blood of the animal.

15. The nucleic acid molecule according to claim 3, further characterized in that the cell is in a transgenic animal, the promoter is a lymph-specific promoter that allows the expression of ng.HuAFP in a lymph-producing cell of the animal , and the leader sequence allows the secretion of ng.HuAFP in the lymph of the animal.

16. Non-glycosylated HuAFP (ng.HuAFP) comprising a glutamine residue at position 233 of SEQ ID NO: 4.

17. A polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 6.

18.- A substantially pure biologically active fragment of non-glycosylated human alpha-fetoprotein.

19. The polypeptide according to claim 18, further characterized in that the fragment comprises the amino acid sequence set forth in SEQ ID NO: 15 (Domain II), SEQ ID NO: 16 (Domain l + ll) or SEQ ID NO: 17 (Domain ll + lll), or two or more of said amino acid sequences.

20. A transgenic non-human eukaryotic organism that expresses and secretes ng.HuAFP in a biological fluid.

21. The transgenic organism according to claim 20, further characterized in that the transgenic organism is a mammal.

22. The transgenic organism according to claim 21, further characterized in that the mammal is a goat, sheep, camel, cow, pig, rabbit, horse or llama.

23.- The transgenic organism in accordance with the. claim 21, further characterized in that the biological fluid is milk, urine, blood or lymph.

24. The transgenic organism according to claim 21, further characterized in that said ng.HuAFP is expressed from a transgene comprising: (i) a nucleic acid sequence encoding ng.HuAFP, (ii) a promoter that is operably linked to the sequence encoding ng.HuAFP that allows the expression of ng.HuAFP by cells of the transgenic organism secreting protein in a biological fluid, and (iii) a leader sequence that encodes a protein secretory signal that allows secretion of ng.HuAFP in said biological fluid by the cells of the transgenic organism.

25.- The transgenic organism in accordance with the claim 24, further characterized in that the promoter is a specific promoter of milk, urine, blood or lymph and the leader sequence allows the secretion of ng.HuAFP in milk, urine, blood or lymph, respectively.

26. The transgenic organism according to claim 24, further characterized in that the promoter is a milk-specific promoter and the leader sequence allows the secretion of ng.HuAFP in milk.

27. The transgenic organism according to claim 26, further characterized in that the transgenic organism is a goat.

28. The transgenic organism according to claim 24, further characterized in that the promoter is a urine-specific promoter and the leader sequence allows the secretion of ng.HuAFP in urine.

29. The transgenic organism according to claim 28, further characterized in that the mammal is a goat.

30. The transgenic organism according to claim 24, further characterized in that the promoter is a blood specific promoter and the leader sequence allows the secretion of ng.HuAFP in blood.

31. The transgenic organism according to claim 30, further characterized in that the mammal is a goat.

32.- The transgenic organism in accordance with the claim 24, further characterized in that the promoter is a lymph-specific promoter and the leader sequence allows the secretion of ng.HuAFP in lymph.

33. The transgenic organism according to claim 32, further characterized in that the mammal is a goat.

34. Non-human mammalian milk comprising ng.HuAFP.

35. The milk according to claim 34, further characterized in that said ng.HuAFP is soluble and is produced by a transgenic non-human mammal whose milk-producing cells express a transgene comprising: (i) a nucleic acid sequence that encodes ng.HuAFP, (ii) a milk-specific promoter that is operably linked to the sequence encoding ng.HuAFP, and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by the milk producing cells of said mammal.

36.- Non-human mammal urine comprising ng.HuAFP.

37. The urine according to claim 36, further characterized in that the ng.HuAFP is soluble and is produced by a transgenic non-human mammal whose urine-producing cells express a transgene comprising: (i) a nucleic acid sequence that encodes ng.HuAFP, (ii) a specific urine promoter that is operably linked to the sequence encoding ng.HuAFP, and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by the urine-producing cells of said mammal.

38.- Non-human mammal blood comprising ng.HuAFP.

39.- The blood according to claim 38, further characterized in that the ng.HuAFP is soluble and is produced by a transgenic non-human mammal whose blood producing cells express a transgene comprising: (i) a nucleic acid sequence that encodes ng.HuAFP, (ii) a blood-specific promoter that is operably linked to the sequence encoding ng.HuAFP, and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by the blood producing cells of said mammal.

40. Non-human mammalian lymph comprising ng.HuAFP.

41. The lymph according to claim 40, further characterized in that the ng.HuAFP is soluble and is produced by a transgenic non-human mammal whose lymph-producing cells express a transgene comprising: (i) a nucleic acid sequence that encodes ng.HuAFP, (ii) a lymph-specific promoter that is operably linked to the sequence encoding ng.HuAFP, and (iii) a leader sequence that encodes a protein-secreting signal that allows the secretion of ng.HuAFP by the lymph producing cells of said mammal.

42.- A method to produce ng.HuAFP, said method comprises the steps of: (a) providing a transduced cell with a transgene comprising: (i) a nucleic acid molecule encoding ng.HuAFP comprising nucleotides 45 to 1874 of the nucleic acid sequence set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the molecule that encodes ng.HuAFP and that allows the expression of ng.HuAFP by the cell, and (iii) a leader sequence that encodes a protein secretory signal that allows the secretion of ng.HuAFP by the cell; and (b) growing the transduced cell, wherein said cell expresses and secretes the ng.HuAFP.

43.- The method according to claim 42, further characterized in that the cell is E. coli.

44. The method according to claim 42, further characterized in that the cell is a eukaryotic cell.

45. The method according to claim 44, further characterized in that the eukaryotic cell is a yeast cell or an animal cell.

46. The method according to claim 45, further characterized in that the yeast is Pichia pastoris.

47. The method according to claim 43, further characterized in that the cell secretes ng.HuAFP in a cell culture medium.

48. The method according to claim 45, further characterized in that the animal cell is a milk producing cell, urine producer, blood producer or lymph producer.

49. - A method for producing ng.HuAFP, said method comprising the steps of: (a) providing a transgenic organism comprising (i) a nucleic acid molecule encoding ng.HuAFP comprising nucleotides 45 to 1874 of the acid sequence nucleic acid set forth in SEQ ID NO: 5, (ii) a promoter that is operably linked to the molecule encoding ng.HuAFP and that allows the expression of ng.HuAFP in a biological fluid-producing cell of the transgenic organism, and (iii) a leader sequence encoding a protein secretory signal that allows the secretion of ng.HuAFP by the biological fluid producing cell; and (b) collecting the biological fluid comprising ng.HuAFP from the transgenic organism.

50.- The method according to claim 49, further characterized in that the biological fluid is milk, urine, blood or lymph.

51. The method according to claim 50, further characterized in that the biological fluid is milk.

52. The method according to claim 51, further characterized in that said ng.HuAFP is purified from the milk.

53. The method according to claim 49, further characterized in that the promoter is a milk-specific promoter that allows the expression of ng.HuAFP in milk producing cells of the transgenic organism.

54.- The method according to claim 50, further characterized in that the biological fluid is urine.

55. - The method according to claim 54, further characterized in that said ng.HuAFP is purified from the urine. 56.- The method according to claim 49, further characterized in that the promoter is a urine specific promoter that allows the expression of ng.HuAFP in urine producing cells of the transgenic organism. 57. The method according to claim 50, further characterized in that the biological fluid is blood. 58. The method according to claim 57, further characterized in that said ng.HuAFP is purified from the blood. 59. The method according to claim 49, further characterized in that the promoter is a blood-specific promoter that allows the expression of ng.HuAFP in blood-producing cells of the transgenic organism. 60. The method according to claim 50, further characterized in that the biological fluid is lymph. 61.- The method according to claim 60, further characterized in that said ng.HuAFP is purified from the lymph. 62. The method according to claim 49, further characterized in that the promoter is a lymph-specific promoter that allows the expression of ng.HuAFP in lymph-producing cells of the transgenic organism. 63.- The use of purified ng.HuAFP from a culture medium of cells comprising said ng.HuAFP, to prepare a medicament for treating a patient in need of ng.HuAFP. 64.- The use of non-human mammalian milk comprising ng.HuAFP, to prepare a medicament to treat a patient who needs ng.HuAFP. 65.- The use of ng.HuAFP purified from the biological fluid of a non-human mammal comprising ng.HuAFP, to prepare a medicament for treating a patient in need of ng.HuAFP. 66.- The use claimed in claim 65, wherein the biological fluid is milk, urine, blood or lymph. 67.- A therapeutic composition comprising ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8. 68.- The use of ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medication for the treatment of an immune disorder. 69.- The use claimed in claim 68, wherein said immunological disorder is HIV. The use of ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medicament for the treatment of an autoimmune disorder. 71. The use claimed in claim 70, wherein said autoimmune disorder is rheumatoid arthritis, muscular dystrophy, systemic lupus erythematosus, myasthenia gravis, multiple sclerosis, diabetes mellitus. Insulin dependent or psoriasis. 72.- The use of ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of an immunosuppressive agent. 73. The use claimed in claim 72, wherein the immunosuppressive agent inhibits or treats the proliferation of autoreactive immune cells or graft versus host disease. 74.- The use of ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medicament to mitigate the side effects of chemotherapy and radiation therapy. 75.- The use of ng.HuAFP comprising the amino acid sequence set forth in SEQ ID NO: 8 in the manufacture of a medicament for improving cell proliferation. The method according to claim 44, further characterized in that said ng.HuAFP secret cell in a cell culture medium.