MXPA02002768A

MXPA02002768A - Subunit optimized fusion proteins.

Info

Publication number: MXPA02002768A
Application number: MXPA02002768A
Authority: MX
Inventors: Dan Pollock
Original assignee: Genzyme Transgenics Corp
Priority date: 1999-09-17
Filing date: 2000-09-18
Publication date: 2002-08-30
Also published as: JP2003509038A; AU781462B2; CN1379782A; EP1237900A4; IL148549A0; AU3883101A; NZ517774A; EP1237900A1; CA2384766A1; NO20021244L; BR0014524A; KR20020039346A; RU2002110116A; NO20021244D0; WO2001019842A1; HUP0202702A2; WO2001019842A9

Abstract

A method of making a fusion protein having: a first member, fused to a second member wherein the first and second members are chosen such that the fusion protein assembles into a complex having a number of subunits which optimizes activity of the multimeric form of the second member.

Description

- OPTIMIZED FUSION PROTEINS IN SUB-UNITS Field of the Invention The invention relates to a fusion protein having first and second members, wherein the second member of the fusion protein is assembled into a multimer and the • another member is elected, or modified, in a way that promotes the assembly of the second member in a pre-selected number or an optimal number of sub-units. BACKGROUND OF THE INVENTION Fusion proteins can combine useful properties of different proteins. For example, a fusion protein can combine the objective property of an anti-body molecule with the cytotoxic effect of a toxin. SUMMARY OF THE INVENTION In general, the invention features a method of making a fusion protein having: a first member, e.g., a target moiety, e.g., an immunoglobulin subunit (e.g., an immunoglobulin heavy chain) or an immunoglobulin light chain, or a fragment of either) fused to a second member, e.g., an enzyme, e.g., a toxin (e.g., a subunit of enzyme or toxin). The first and second members are chosen so that the fusion protein is assembled in a complex having a «T«? A, > - JtAaL ... * .. M ?? ^ S. ^ UÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉÉ. In preferred embodiments, the first member, or fusion protein, is assembled into a form having the same number of subunits as are present in an active, eg, native, form of the second member. In preferred embodiments the first member, or the fusion protein, is assembled in a form having fewer units than are present in an active, eg, natural, form of the second member. In preferred embodiments, the fusion protein is assembled into a complex, for example, a multimeric di, tri, tetra, or higher complex. Preferably, the fusion protein is assembled into a dimer or a tetramer. • In preferred embodiments, the fusion protein is assembled into a complex having enzymatic activity. In a preferred embodiment, the first member is a monomer, for example, it is a species that is usually monomeric, or that has been modified, for example, by mutation of a site which modulates the formation or maintenance of a multimer of sub-units. In some embodiments ^^ the monomeric form is useful because it does not prevent the formation of a multimer by the second member. In another preferred embodiment, the first member is a dimer form, for example, a heterodimer or a homodimer. For example, it is a species that is usually dimeric, or the t. * ,? ? L. ¿M? *? Í, J, Julüa ^ m-. ... .. ».. . . -. -. ...-. * ... .. ~ .. which has been modified, for example, by mutation of a site that modulates the formation or maintenance of multimer subunits, to be dimeric. In some embodiments the dimeric form is useful because it does not prevent the formation of a multimer by the second member. In preferred embodiments, the fusion protein has the formula: R1-L-R2; R2-L-R1; R2-R1; or R1-R2, where R1 is the first member, e.g., an immunoglobulin subunit, L is a peptide linker and R2 is a second member, e.g., a subunit of enzyme. Preferably, R1 and R2 are covalently linked, for example, directly fused or linked via a peptide linker. (- In the preferred embodiments, the first or the second member of the fusion protein, or both are modified by, for example, substitution or deletion of a portion of the amino acid sequence In a particularly preferred embodiment the fusion protein includes a first member of a member of the immunoglobulin superfamily, preferably an immunoglobulin subunit, which has been modified to inhibit the formation of a multimeric form, eg, a ^^ tetramepca form. Preferably the modification, which may be a change, insertion, or deletion of one or more amino acid residues, results in a subunit that does not form a multimer or which forms a multimer of a lower order than it would normally form, For example, it forms a dimer instead of í. *.? ^ J ^. * J¡k ^ .é..L. ^ 1 *. a tetramer. Preferably, a region that mediates the formation or maintenance of a multimeric structure is modified and by this totally or partially inactivated. For example, a portion of an immunoglobulin subunit, e.g., a heavy chain, e.g., the hinge region, is • modify, for example, it is deleted. In those embodiments where the immunoglobulin binding region is modified, for example, removed, the modified immunoglobulin is monovalent. In the preferred embodiments, the modification of the first member inhibits the assembly of the first member, or the A fusion protein in a multimer, for example, results in the production of a monomer, or, for example, of a dimer, where a higher order multimer would otherwise be formed. In preferred embodiments, the first member is a target agent, for example, a polypeptide having a high affinity for a target, eg, an anti-body, a ^^ ligand, or an enzyme. In preferred embodiments, the first member is an immunoglobulin or a fragment thereof, for example, an antigen binding fragment thereof. Preferably, the immunoglobulin is a monoclonal anti-body, e.g., a human, murine (e.g., mouse) monoclonal body; hk * Ja ».? .. tlt ,? IjfciMO * ..,. ..... í ...... .... -. . .. J ... ... ... *. . .- ^ «» .. ~ * .á * t «Á.? or a recombinant monoclonal anti-body. Preferably, the monoclonal anti-body is a human anti-body. In other embodiments, the monoclonal anti-body is a recombinant anti-body, e.g., a chimeric anti-body or a humanized antibody (e.g., has a variable region, or at least a complementary determining region (CDR), derivative of a non-human anti-body (e.g., murine) with the remaining human portion (s) of origin, or a transgenically produced human anti-body (e.g., an anti-body produced by a hybridoma which includes a B cell obtained from a transgenic non-human animal, for example, a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.) In the preferred embodiments, the first member is a full-length anti-body (e.g., is an anti-body IgG1 or IgG4) or includes only an antigen binding portion (e.g., a Fab, F (abD) 2, Fv fragment or an Fv fragment of cad simple ena). ^^ In the preferred modalities, the first member is a 9 immunoglobulin sub-unit selected from the group consisting of a subunit of: IgG (eg, IgG1, IgG2, IgG3, IgG4), IgM, IgA1, IgA2, IgA.sub.sec, IgD, or IgE. Preferably, the immunoglobulin subunit is an IgG isotype, for example, IgG3.

In preferred embodiments, the first member is a monomer, for example, a single chain anti-body; or forms a dimer, for example, a dimer of an immunoglobulin heavy chain and a light chain. In preferred embodiments, the first member is a monovalent anti-body (e.g., includes a pair of heavy and light chains, or antigen binding portions of the • same). In other embodiments, the first member is a divalent antibody (e.g., includes two pairs of heavy and light chains, or antigen binding portions thereof). In the preferred modalities, the first member? includes an immunoglobulin heavy chain or a fragment thereof, for example, an antigen binding fragment thereof. Preferably, the immunoglobulin heavy chain or the fragment thereof (e.g., an antigen binding fragment thereof) is linked, e.g., linked via a peptide linker link or fused directly, to an enzyme.

Preferably, the enzyme-heavy chain fusion protein of ^^ immunoglobulin is capable of being assembled into a functional complex, ^^ for example, a di-, tri-, tetra-, or multimeric complex that has enzymatic activity. The most preferred form is dimeric. In preferred embodiments, the first member includes an immunoglobulin heavy chain or fragment thereof (e.g., an antigen binding fragment thereof), and a light chain or fragment thereof (e.g. antigen binding fragment thereof). Preferably, the immunoglobulin heavy chain is linked, for example, linked via a peptide linker or directly fused to an enzyme. Preferably, the fused immunoglobulin-enzyme fusion protein heavy chain is assembled with a light chain, for example, to produce a functional complex, for example, a di-, tri-, tetra-, or multimer complex having enzymatic activity . The most preferred form is dimeric. In preferred embodiments, the first member is an immunoglobulin that interacts with (e.g., binds to) a cell surface antigen on a target cell, e.g., a cancer cell. For example, the immunoglobulin binds to a tumor cell antigen, for example, a carcinoembryonic antigen (CEA), TAG-72, her-2 / neu, epidermal growth factor receptor, transferrin receptor, among others. In preferred embodiments, the first member ^^ locates, for example, increases the concentration of a fusion protein in proximity to a target cell, eg, a cancer cell. In preferred embodiments, the second member is a subunit of an enzyme, for example, an enzyme having one or more subunits (e.g., catalytic subunits).

Preferably, the enzyme includes one, preferably two, preferably three, more preferably four subunits. A preferred enzyme is β-glucuronidase, for example, a human beta-glucuronidase. The enzyme can be a homo- or a hetero-multimer. If the enzyme is a heteromultimer, two (or more) fusion proteins are necessary to form the active product. • In preferred embodiments, the second member is capable of converting a precursor drug, e.g., a prodrug, into a toxic drug. In preferred embodiments, the first member is a heavy and light chain immunoglobulin G (IgG), and the second member is a human β-glucuronidase fusion protein.

• In preferred embodiments, the light chain of the first member has an amino acid sequence as shown in Figure IB (SEQ ID NO: 2); the light chain of the first member has an amino acid sequence of at least 60 percent, 70 percent, 75 percent, more preferably at least 85 percent, more preferably at least 90 percent, most preferably at least 95 percent, more w ^ m ^ preferably at least 98 percent, 99 percent sequence identity or homology with an amino acid sequence of Figure IB (SEQ ID NO: 2). In preferred embodiments, the light chain of the first member has an amino acid sequence that is Jt? .14. encoded by a nucleotide sequence as shown in Figure IB (SEQ ID N0: 1), or Figure 2 (SEQ ID N0: 37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60 percent, 70 percent, 75 percent, more preferably at least 85 percent, most preferably at least 90 percent, more preferably at least 95 percent, much more preferably at least 98 percent, 99 percent sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID NOs: 2, 3 or 4), or Figure 2 (SEQ ID NO: 37); the light chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions • to the nucleotide sequence shown in Figure IB. In preferred embodiments, the heavy chain of the first member has an amino acid sequence as shown in Figure 4B (SEQ ID NO: 6, 7, 8, 9, 10 and / or 11), or Figure 5 (SEQ ID NOs: 13, 14, 15 and / or 16); the heavy chain of the first member has an amino acid sequence at least 60 percent, 70 percent, 75 percent, more preferably when ^^ less 85 percent, more preferably at least 90 percent, more preferably at least 95 percent, much more preferably at least 98 percent, 99 percent sequence identity or homology with an amino acid sequence of the Figure 4B (SEQ ID NO: 6, 7, 8, 9, 10 and / or 11), or LA Figure 5 (SEQ ID NOs: 13, 14, 15 and / or 16). In preferred embodiments, the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence as shown in Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO: 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence at least 60 percent, 70 percent, 75 percent, more preferably at least 85 percent, most preferably at least 90 percent, more preferably at least 95 percent, much more preferably at least 98 percent, 99 percent sequence identity or homology with a nucleotide sequence shown in Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO. : 12); the heavy chain of the first member has an amino acid sequence that is encoded by a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure 4B, or 5. In a preferred embodiment, the fusion protein includes a peptide linker and the peptide linker has one or more of the following characteristics: a) it allows the rotation of the first and second members in relation to one another; b) it is resistant to digestion by proteases; c) does not interact with the first or the second; d) allows the fusion protein to form a complex (eg, a di-, tri-, tetra-, or multimeric complex) that retains the enzymatic activity; and e) promotes the doubling and / or assembly of the fusion protein in an active complex. In a preferred embodiment: the fusion protein includes a peptide linker and the peptide linker is from 5 to 60, more preferably, from 10 to 30, amino acids in length; the peptide linker is 20 amino acids in length; the peptide linker is 17 amino acids in length; each of the amino acids in the peptide linker is selected from the group consisting of Gly, Ser, Asn, Thr and Ala; the peptide linker includes a Gly-Ser element. In a preferred embodiment, the fusion protein includes a peptide linker and the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly) and where y is • 1, 2, 3, 4, 5, 6, 7, or 8. Preferably, the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-Gly) 3. Preferably, the peptide linker includes a sequence that has the formula ((Ser-Gly-Gly-Gly-Gly) 3-Ser-Pro). In preferred embodiments, the fusion protein is produced recombinantly, is produced in a host cell, (e.g., a cultured cell), or in a transgenic animal, ^^ for example, a transgenic mammal (eg, a goat, a cow, or a rodent (eg, a mouse) .In preferred embodiments, the fusion protein is produced in a transgenic mammal (eg, a goat) , a cow, or a rodent (for example, a mouse). i-I A? a.i-ÜtfeiA.t "., ^" ,, "" .. __: .. _ -... or - - .. -. . ... U.?L: method further includes: providing a transgenic animal, which includes a transgene that provides for the expression of a fusion protein transcribed herein; allowing the transgene to express itself; and, preferably, recovering the fusion protein, from the milk of the transgenic animal. For embodiments where the fusion protein is produced transgenically, the fusion protein may further include: a signal sequence which directs the secretion of the fusion protein, eg, a signal from the secreted protein (e.g. a signal from a protein secreted in milk, or an immunoglobulin secretory signal); and (optionally) a sequence that encodes a sufficient portion of the amino terminal coding region of the secreted protein, for example, a protein secreted in milk, or an immunoglobulin, to promote secretion, for example, in the milk of a transgenic mammal, of the fusion protein. In preferred embodiments, the fusion protein is made in a mammary gland of the transgenic mammal, for example, a ruminant, for example, a goat or a cow. In preferred embodiments, the fusion protein is secreted in the milk of the transgenic mammal, for example, a ruminant, eg, a dairy animal, eg, a goat or a cow. In preferred embodiments, the fusion protein is secreted in the milk of a transgenic mammal at concentrations of at least about 0.1 mg / ml 0.5 mg / ml, 1.0 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 5 mg / ml or greater. In preferred embodiments, the fusion protein is made under the control of a mammary gland-specific promoter, eg, a milk-specific promoter, eg, a whey protein or a casein promoter. The milk specific promoter can be a casein promoter, a β-lactoglobulm promoter, whey protein acid promoter, or a lactalbumin promoter. Preferably, the promoter is a goat β-casein promoter. In preferred embodiments, the transgene encoding the fusion protein is a nucleic acid construct which includes: (a) optionally, an isolate sequence; (b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter; (c) a nucleotide sequence encoding a signal sequence which can direct the secretion of the fusion protein, for example, a signal from a specific milk protein, or an immunoglobulin; optionally, a nucleotide sequence that encodes a sufficient portion of the coding region amino terminal of a secreted protein, for example, a protein secreted in milk, or an immunoglobulin, to allow the secretion, for example, in the milk of a transgenic mammal, of the fusion protein; (e) one or more nucleotide sequences encoding a fusion protein, for example, an immunoglobulin-enzyme fusion protein as described herein; and (f) (optionally) a 3U untranslated region of a mammalian gene, e.g., a specific mammary epithelial gene, (e.g., a milk protein gene). In the preferred embodiments, the elements a (if present), b, c, d (if present), and f of the transgene are of the same gene; the elements a (if present), b, c, d (if present) • present), and f of the transgene are of two or more genes. For example, the signal sequence, the promoter sequence and the untranslated sequence 3Ü may be of the mammary epithelial specific gene, eg, a whey protein or casein gene (eg, a β-casein gene). ). Preferably, the signal sequence, the promoter sequence and the untranslated sequence 3Ü are from a goat β-casein gene. In the preferred embodiments, the promoter of the transgene is a mammary epithelial specific promoter, for example, a whey protein or casein promoter (eg, a β-casein promoter). The milk-specific promoter can be a casein promoter, a β-lactoglobulin promoter, a ? -t ~ i 'ífcd A »&tJtaJJJ.« j £. ^. ateAmaL £ ,. * « -. *. & * «_ *» - * & # »* - * > ** • * •. < , - ... ... - ^ * fc * & -I''4J acid whey protein promoter, or a lactalbumin promoter. Preferably, the promoter is a goat β-casein promoter. In preferred embodiments, the signal sequence is encoded by the transgene is an amino terminal sequence that directs the expression of the protein outside of a cell, or towards the cell membrane. For example, the signal sequence can be obtained from an immunoglobulin protein. Preferably, the signal sequence is of a protein that is secreted in milk, for example, the milk of a transgenic animal. In preferred embodiments, the one or more nucleotide sequences that encode a fusion protein include one • or more than: a nucleotide sequence encoding a first member, eg, an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, eg, an enzyme; (optionally) a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one embodiment, the nucleotide sequences ^^ encoding the heavy chain and light chain fusion are operably linked in a single construct, eg, a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain and light chain fusion are introduced into a transgenic animal in separate constructs. Preferably, when they are linked, the nucleotide sequences are arranged in the following order: 5Ü-N1-3D linked to 5D-N2-3D; or 5-N2-3Ü linked to 5-N1-3 donde where NI is a first member, eg, an immunoglobulin heavy chain (or an antigen binding portion thereof) operably linked to a second member, eg, an enzyme; and N2 is an immunoglobulin light chain # (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, eg, sense / sense; inverse / inverse; sense / inverse; or inverse / sense. In preferred embodiments, the 3U untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, e.g., a specific mammary epithelial gene, e.g., a whey protein gene or casein gene. The 3U untranslated region can be obtained from a casein gene (eg, a β-casein gene), a β-lactoglobulin gene, whey protein acid gene, or lactalbumin gene. Preferably, the 3'-untranslated region is from a goat β-casein gene. In the preferred embodiments, the transgene, for example, the transgene as described herein, integrates into a germ cell and / or a somatic cell of the transgenic animal. In another aspect, the invention features a method for providing a transgeneically produced fusion protein, for example, a fusion protein as described herein, in milk, of a transgenic mammal. The method includes obtaining milk from a transgenic mammal, which includes a fusion protein encoding the transgene, for example, one that has been introduced into its germ line, eg, a nucleic acid construct as described herein, which results in the expression of the sequence encoding the protein of the fusion protein in the epithelial cells of the mammary gland, whereby the fusion protein is secreted in the milk of the mammal. In preferred embodiments the transgenic mammal is selected from the group consisting of sheep, mice, pigs, cows and goats. The preferred transgenic mammal is a goat. In preferred embodiments, the fusion protein is secreted in the milk of a transgenic mammal at concentrations of at least about 0.1 milligram / milliliter, 0.5 milligram / milliliter, 1.0 milligram / milliliter, 1.5 milligram / milliliter, 2 milligram / milliliter, 3 milligrams / milliliter, 5 milligrams / milliliter or greater. In the preferred embodiments, the transgene encoding the immunoglobulin-enzyme fusion protein is a nucleic acid construct that includes: (a) optionally, an isolating sequence; (b) a promoter, for example, a specific promoter ^ 1 ^ epithelial mammary, for example, a milk protein promoter; (c) a nucleotide sequence encoding a signal sequence that can direct the secretion of the fusion protein, for example, a signal from a milk-specific protein, or an immunoglobulin; (d) optionally, a nucleotide sequence that • encodes a sufficient portion of the amino terminal coding region of the secreted protein, for example, a protein secreted in milk, or an immunoglobulin, to allow secretion, for example, in the milk of a transgenic mammal, of the protein not secreted; (e) one or more nucleotide sequences encoding a fusion protein, eg, a fusion protein as described herein; and (f) optionally, a 3U untranslated region of a mammalian gene, for example, a specific mammary epithelial gene, (e.g., a milk protein gene). In the preferred embodiments, the elements a (if present), b, c, d (if present), and f of the transgene are of the ^^ same gene; the elements a (if present), b, c, d (if present), and f of the transgene are of two or more genes. For example, the signal sequence, the promoter sequence and the 3U untranslated sequence can be from a mammalian gene, for example, a specific mammary epithelial gene, for example, a fit 1 H f »» e > * > milk whey or casein gene (eg, a ß-casein gene). Preferably, the signal sequence, the promoter sequence and the 3U untranslated sequence are from a goat β-casein gene. In preferred embodiments, the transgene promoter is a mammary epithelial specific promoter, e.g., a whey protein or casein promoter (e.g., a β-casein promoter). The milk-specific promoter can be a casein promoter, a β-lactoglobulin promoter, a whey protein acid promoter, or a lactalbumin promoter. Preferably, the promoter is a goat β-casein promoter. In preferred embodiments, the signal sequence is encoded by the transgene is an amino terminal sequence that directs the expression of the protein outside of a cell, or towards the cell membrane. Preferably, the signal sequence is of a protein that is secreted in milk, for example, the milk of a transgenic animal. In preferred embodiments, the one or more nucleotide sequences encoding a fusion protein includes one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to a enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one modality, the nucleotide sequences encoding the heavy chain and the light chain fusion are operably linked in a single construct, eg, a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain and light chain fusion are introduced into a transgenic animal in separate constructs. Preferably, when they are linked, the nucleotide sequences are arranged in the following order: 5D-N1-3D linked to 5U-N2-3D; or 5U-N2-3D linked to 5U-N1-3U where NI is an immunoglobulin heavy chain (or an antigen binding portion thereof) linked to an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, eg, sense / sense; inverse / inverse; sense / inverse; or inverse / sense. In preferred embodiments, the 3U untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, eg, a mammary epithelial specific gene, (e.g., a ^^ milk or casein gene). The 3U untranslated region can be obtained from a casein gene (e.g., a β-casein gene), a β-lactoglobulin gene, an acid whey protein gene, or a lactalbumin gene. Preferably, the 3U untranslated region is from a goat β-casein gene.

In preferred embodiments, the transgene, e.g., the transgene as described herein, is integrated into a germ cell and / or a somatic cell of the transgenic animal. In another aspect, the invention features a transgene, for example, a nucleic acid construct, preferably, an isolated nucleic acid construct, which includes: (a) optionally, an isolator sequence; (b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk protein promoter; (c) a nucleotide sequence encoding a signal sequence which can direct the secretion of the fusion protein, for example, a signal sequence of a specific milk protein, or an immunoglobulin; (d) optionally, a nucleotide sequence that encodes a sufficient portion of the amino terminal coding region of a secreted protein, for example, a protein secreted in milk, or an immunoglobulin, to allow secretion, for example, in the milk of a transgenic w ^^ mammal, of the fusion protein; (e) one or more nucleotide sequences encoding a fusion protein, eg, a fusion protein as described herein; and (f) optionally, a 3 U region not translated from a mammalian gene, e.g., a mammary epithelial specific gene, (e.g., a milk protein gene). In the preferred embodiments, the elements a (if present), b, c, d (if present), and f of the transgene are from the same gene; the elements a (if present), b, c, d (if present), and f of the transgene are of two or more genes. For example, the signal sequence, the promoter sequence and the 3U untranslated sequence can be from a mammalian gene, for example, a specific mammary epithelial gene, eg, a whey protein or a casein gene. (for example, a ß-casein gene). Preferably, the signal sequence, the promoter sequence and the translated non-μm sequence are from a goat β-casein gene. In preferred embodiments, the transgene promoter is a mammary epithelial specific promoter, e.g., a whey protein or casein promoter (e.g., a β-casein promoter). The milk-specific promoter can be a casein promoter, a β-lactoglobulin promoter, a whey protein acid promoter, or a lactalbumin promoter. Preferably, the promoter is a goat ß- ^^ casein promoter. In preferred embodiments, the signal sequence is encoded by the transgene is an amino terminal sequence that directs the expression of the protein outside of a cell, or towards the cell membrane. Preferably, the sequence of lal-l .xi > i .. ± .í.? í?.? , ritelUMlÉl signals is a specific milk protein, or an immunoglobulin. Preferably, the signal sequence directs the secretion of the encoded fusion protein into the milk of a transgenic animal, eg, a transgenic mammal. In preferred embodiments, the one or more nucleotide sequences encoding a fusion protein includes one or more of: a nucleotide sequence encoding an immunoglobulin heavy chain (or an antigen binding portion thereof) fused to a enzyme; a nucleotide sequence encoding an immunoglobulin light chain (or an antigen binding portion thereof), or both. In one embodiment, the nucleotide sequences encoding the heavy chain and the light chain fusion are operably linked in a single construct, eg, a single cosmid. In another embodiment, the nucleotide sequences encoding the heavy chain and light chain fusion are introduced into a transgenic animal in separate constructs. Preferably, when they are linked, the nucleotide sequences are arranged in the following order: 5-N1-3D linked to 5D-N2-3Ü; or 5D-N2-3Ü linked to 5-2-9 N1-3Ü where NI is an immunoglobulin heavy chain (or an antigen binding portion thereof) linked to an enzyme; and N2 is an immunoglobulin light chain (or an antigen binding portion thereof). The nucleotide sequences can be in any orientation with respect to each other, j ^ tea¿ ° a * w for example, sense / sense; inverse / inverse; sense / inverse; or inverse / sense. In preferred embodiments, the 3U untranslated region of the transgene includes a polyadenylation site, and is obtained from a mammalian gene, eg, a mammary epithelial specific gene, (e.g., a whey protein gene) or casein gene). The 3U untranslated region can be obtained from a casein gene (eg, a β-casein gene), a β-lactoglobulin gene, an acid whey protein gene, or a lactalbumin gene . Preferably, the 3U untranslated region is from a goat β-casein gene. In another aspect, the invention features a nucleic acid molecule encoding a fusion protein, e.g., a fusion protein as described herein. In preferred embodiments, the nucleic acid has a nucleotide sequence as shown in Figure IB (SEQ ID NO: 1), Figure 2 (SEQ ID NO: 37), Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence of at least 60 percent, 70 percent, 75 percent ^^ cent, more preferably at least 85 percent, more preferably at least 90 percent, more preferably at least 95 percent, more preferably at least 98 percent, 99 percent sequence identity or homology with a nucleotide sequence shown in Figure IB (SEQ ID lal j «^, £ .9« ^ maMi = N0: 1); Figure 2 (SEQ ID NO: 37), Figure 4B (SEQ ID NO: 5), or Figure 5 (SEQ ID NO: 12); the nucleic acid has a nucleotide sequence that is capable of hybridizing under stringent conditions to the nucleotide sequence shown in Figure IB, Figure 2, Figure 4B, or Figure 5. In a preferred embodiment, the nucleic acid has a nucleotide sequence encoding an amino acid sequence as shown in Figure IA (SEQ ID NOs: 2, 3, 4), Figure 4B (SEQ ID N0: 6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO: 13, 14, 15, 16); the nucleic acid has a nucleotide sequence that encodes an amino acid sequence having at least 60 percent, 70 percent, 75 percent, more preferably at least 85 percent, more preferably at least 90 percent, most preferably at least 95 percent, more preferably at least 98 percent, 99 percent sequence identity or homology with an amino acid sequence of Figure IA (SEQ ID NO: 2, 3, 4), Figure 4B (SEQ ID NO: 6, 7, 8, 9, 10, 11), or Figure 5 (SEQ ID NO: 13, 14, 15, 16). In another aspect, the invention features a host cell, for example, an isolated host cell (for example, ^^ eg, a cultured cell), which includes a nucleic acid of the invention (eg, a nucleic acid, or a transgene, eg, a nucleic acid construct, as described herein). In another aspect, the invention features a protein of lÜ? .t? i * ~ ± li *. . . . .. .__, .__. The merger described herein, or a purified preparation thereof. In another aspect, the invention features a pharmaceutical or nutritional composition having a therapeutically effective amount of a fusion protein, e.g., a fusion protein as described herein, and a pharmaceutically acceptable carrier. In a preferred embodiment, the composition includes milk. In another aspect, the invention features a transgenic animal that includes a transgene encoding a fusion protein, for example, a transgene encoding a fusion protein described herein. • Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and amphibians. Suitable mammals include: ruminants; ungulates; domestic mammals; and dairy animals. Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, foxes, and llamas. Suitable birds include chickens, geese, and turkeys. When the transgenic protein w ^ is secreted in the milk of a transgenic animal, the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year. Preferably, the transgenic animal is a ruminant, for example, a goat, cow or sheep. More preferably, the transgenic animal is a goat. In the preferred embodiments, the transgenic mammals have germ cells and somatic cells that contain a transgene encoding a fusion protein, for example, a transgene encoding a fusion protein described herein. In preferred embodiments, the fusion protein expressed in the transgenic animal is under the control of a mammary gland-specific promoter, eg, a milk-specific promoter, for example, a whey protein or casein promoter. The milk-specific promoter can be a casein promoter, a β-lactoglobulin promoter, a ? . acid whey protein promoter, or a lactalbumin promoter. Preferably, the promoter is a goat β-casein promoter. In preferred embodiments, the transgenic animal is a mammal, and the fusion protein is secreted in the milk of the transgenic animal at concentrations of at least about 0.1 milligram / milliliter, 0.5 milligram / milliliter, 1.0 milligram / milliliter, 1.5 milligram / milliliter , 2 milligrams / milliliter, 3 milligrams / milliliter, 5 milligrams / milliliter or higher. In another aspect, the invention features a method of making a transgenic organism having a fusion protein transgene. The method includes providing or forming in a cell .t-A, i: i. of an organism, a fusion protein, for example, a transgene encoding a fusion protein described herein; and allow the cell, or a descendant of the cell, to give rise to a transgenic organism. In a preferred embodiment, the transgenic organism is a transgenic plant or animal. Preferred transgenic animals include: mammals; birds; reptiles; marsupials; and ^ amphibians. Suitable mammals include: ruminants; ungulates; domestic mammals; and dairy animals. Particularly preferred animals include: mice, goats, sheep, camels, rabbits, cows, pigs, horses, foxes, and llamas. Suitable birds include chickens, geese, and turkeys. - > When the transgenic protein is secreted in the milk of a transgenic animal, the animal should be able to produce at least 1, and more preferably at least 10, or 100, liters of milk per year. In preferred embodiments, the fusion protein is under the control of a mammary gland-specific promoter, for example, a milk-specific promoter, for example, a whey protein or casein promoter.

^^ The milk-specific promoter can be a casein promoter, a β-lactoglobulin promoter, a whey protein acid promoter, or a lactalbumin promoter. Preferably, the promoter is a goat β-casein promoter. In preferred embodiments, the organism is an amyloid, and the fusion protein is secreted into the milk of the transgenic animal at concentrations of at least about 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 5 mg / ml or higher. In another aspect, the invention features a method for selectively removing an aberrant or diseased cell that expresses on its surface a target antigen, for example, Ww a cancer cell expressing a cell surface antigen. The method includes: contacting the aberrant or diseased cell with an effective amount of a fusion protein, e.g., a fusion protein described herein, wherein either the first or the second member of the fusion protein recognizes the target antigen, so that elimination occurs selective cell. The present method can be used on cells in culture, for example, in vi tro or ex vivo (e.g., cultures comprising cancer cells). For example, the cells can be cultured in vi tro in culture medium and the passage of The contact can be made by adding the fusion protein of the ^ invention to the culture medium. Alternatively, the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of an in vivo protocol (e.g., therapeutic or prophylactic).

In another aspect, the invention presents a method for selectively removing an aberrant or diseased cell that expresses on its surface a target antigen, for example, a cancer cell that expresses an antigen on the cell surface. The method includes: introducing into the aberrant or diseased cell a nucleic acid encoding a fusion protein, for example, a fusion protein described herein, where either the first or the second member of the fusion protein recognizes the antigen objective, so that the selective elimination of the cell occurs. The present method can be used in cells in culture, for example, in vi tro or ex vivo (e.g., cultures comprising cancer cells). For example, the cells can be cultured in vitro in culture medium and the nucleic acids of the invention can be introduced into the culture medium. Alternatively, the method can be performed on cells (e.g., cancer cells) present in a subject, e.g., as part of a gene therapy protocol in vivo (e.g., therapeutic or prophylactic). In another aspect, the invention provides a method ^^ to treat in a subject a condition characterized by the growth or aberrant activity of a cell expressing on its surface a target antigen, for example, a cancer cell expressing a target antigen. The method includes administering to the subject an effective amount of a protein of fusion, or a nucleic acid encoding a fusion protein (e.g., a fusion protein described herein), wherein either the first or second member of the fusion protein recognizes the target antigen. In a preferred embodiment, the disease is characterized by the growth or aberrant activity of a cell, for example, a cancer cell, an immune cell. In yet another aspect, the present invention provides a method for detecting cultures in vi tro or in vivo the presence of a target antigen in a sample, for example, to diagnose a disease. The method comprises (i) contacting a control sample or sample under conditions that allow the interaction of a labeled fusion protein, e.g., a fusion protein as described herein, and (ii) detecting the formation of a complex. A statistically significant change in the formation of a complex between the anti-body of the fusion protein and the target antigen with respect to a control sample is indicative of the presence of the target antigen in the sample. ^^ In the preferred modalities, the second member is W ^ m ^ an enzyme, for example, horseradish peroxidase. The present invention features fusion proteins in which the ability of a first member of the fusion to form a multimer is chosen to optimize a characteristic, eg, activity or solubility, of the second member.

The terms peptides, proteins, polypeptides are used interchangeably herein. A purified preparation, substantially pure preparation of a polypeptide, or an isolated polypeptide as used herein, means a polypeptide that has been separated from at least some other protein, lipid, or nucleic acid with which it is presented in the cell or organism which expresses it, for example, from a protein, lipid or nucleic acid in the transgenic animal or in a fluid, for example, milk, or another substance, for example, an egg, produced by the transgenic animal. The polypeptide is preferably separated from substances, for example, anti-bodies or gel matrix, for example, polyacrylamide, which are used to purify it. The polypeptide preferably constitutes at least 10, 20, 50, 70, 80 or 95 percent dry weight of the purified preparation. Preferably, the preparation contains: sufficient polypeptide to allow protein sequencing; at least 1, 10, or 100 micrograms of the polypeptide; at least 1, 10, or 100 milligrams of the polypeptide. A substantially pure nucleic acid is a m-nucleic acid that is one or both of: not immediately contiguous with either or both of the sequences, e.g., coding sequences, with which it is immediately contiguous (i.e. one at the end 5Ü and another at the end 3Ü) in the naturally occurring genome of the organism from which the nucleic acid is derived; or which is substantially free of a nucleic acid sequence with which it occurs in the organism from which the nucleic acid is derived. The term includes, for example, a recombinant DNA that is incorporated into a vector, for example, into an autonomously replicating plasmid or virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (by example, a cDNA or a genomic DNA fragment produced by polymerase chain reaction or restriction endonuclease treatment) independent of other DNA sequences. The substantially pure DNA also includes a recombinant DNA that is part of a hybrid gene that encodes the sequence of additional fusion proteins. Homology, or sequence identity, as used herein, refers to the similarity of sequences between two polypeptide molecules or between two nucleic acid molecules. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous in that position (ie, as used in the ^^ present the "homology" of amino acid or nucleic acid is equivalent to the "identity" of amino acid or nucleic acid). The percentage of homology between two sequences is a function of the number of identical positions shared by the sequences (ie,% homology = # of identical positions / total # of ? J ¿. .ñ? positions x 100). For example, if 6 of 10, of the positions in two sequences match or are homologous then the two sequences are 60 percent homologous or have a sequence identity of 60 percent. By way of example, the DNA sequences ATTGCC and TATGGC share 50 percent homology or sequence identity. Generally, a comparison is made when two ^ sequences are aligned to give maximum homology or sequence identity. The comparison of sequences and the determination of the percentage of homology between two sequences can be carried out using a mathematical algorithm. A preferred non-limiting example of a mathematical algorithm used for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Nati Acad. Sci. USA 87: 2264-68, modified as in Karlin and Altschul (1993) Proc. Nati Acad. Sci. USA 90: 5873-77. This algorithm is incorporated into the NBLAST and XBLAST (version 2.0) programs of Altschul, et al. (1990) J. Mol. Biol. 215: 403- 10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, word length = 12 for ^^ obtain nucleotide sequences homologous to the ITALY nucleic acid molecules of the invention. Protein searches BLAST can be carried out with the XBLAST program, score = 50, word length = 3 to obtain amino acid sequences homologous to the ITALY protein molecules of the invention.

To obtain alignments with gaps for comparison purposes, Gapped BLAST can be used as described in Altschul et al., (1997) Nucleic Acids Res. 25 (17): 3389- 3402. When using the BLAST and Gapped BLAST programs, the default parameters of the respective programs (for example, XLBAST and NBLAST) can be used. You can consult http: // www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm used for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). This algorithm is incorporated into the ALIGN program (version 2.0) that is part of the GCG sequence alignment software package. When the ALIGN program is used to compare amino acid sequences, a weight residue table PAM120, a gap length penalty of 12, and a gap penalty of 4 can be used. As used herein, the term transgene means a nucleic acid sequence (encoding, for example, one or more fusion protein polypeptides), which is introduced into the genome of a transgenic organism. A transgene may include one or more transcription regulatory sequences w ^^ and other nucleic acids, such as introns, which may be necessary for optimal expression and secretion of a nucleic acid encoding the fusion protein. A transgene may include a sequence highlighter. A fusion protein sequence can be operably linked to a tissue-specific promoter, for example, a mammary gland-specific promoter sequence that results in the secretion of the protein in the milk of a transgenic mammal, a urine-specific promoter. , or a specific egg promoter. As used herein, the term "transgenic cell" refers to a cell that contains a transgene. A transgenic organism, as used herein, refers to a transgenic animal or plant. As used herein, a "transgenic animal" is a non-human animal in which one or more and preferably essentially all of the cells of the animal contain a transgene introduced through human intervention, such as by transgenic techniques known in the art. . The transgene can be introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by means of deliberate genetic manipulation, such as by micro-injection or by infection with a recombinant virus. Mammals are defined in the present as all animals, excluding humans, that have mammary glands and produce milk. As used herein, "dairy animal" refers to a non-human animal that produces milk that is larger than a rodent. In the preferred embodiments, the dairy animal produces large volumes of milk and has long lactation periods, for example, cows or goats.

LA A ü? ^ L Ju? & it. ^ Mí M, ^ - .. - ..... .. ^.? .. 1 ...?. Á, - As used in the present, the term "subject" includes human and non-human animals. The term "non-human animals" of the invention includes vertebrates, e.g., mammals and non-mammals, such as non-human primates, ruminants, birds, amphibians, reptiles and rodents, e.g., mice and rats. The term also includes rabbits. As used herein, a "transgenic plant" is • a plant, preferably a multi-cell plant or an upper plant, in which one or more, and preferably essentially all, of the cells of the plant contain a transgene introduced by means of human intervention, such as by transgenic techniques known in the art. countryside. As used herein, the term "plant" is W refers to either a complete plant, a part of the plant, a plant cell, or a group of plant cells. The class of plants that can be used in methods of the invention is generally as broad as the class of superior plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. Includes plants of a variety of ploid levels, including polyploid, ^^ diploid and haploid. As used herein, the term "immunoglobulin" and "anti-body" refers to a glycoprotein comprising at least two heavy chains (H) and two light chains (L) interconnected by disulfide bonds. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region. The heavy chain constant region is composed of three domains, CH1, CH2 and CH3. Each light chain is composed of a light chain variable region (abbreviated here as LCVR or VL) and a light chain constant region. The light chain constant region is composed of a domain, CL. The VH and VL regions can be further survived in regions of hypervariability, termed complementary determination regions (CDR), interspersed with regions that are more conserved, termed structure regions (FR). Each VH and VL is composed of three complementarity determination regions and four structure regions, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the anti-bodies can mediate the binding of the immunoglobulin to tissues or host factors, including different cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system. The term "antigen binding portion" of an antibody (or simply "anti-body portion"), as used herein, refers to one or more fragments of an anti-body that retains the ability to bind specifically yet antigen (for example a target antigen). It has been shown that the anti-body antigen binding function can be performed by full-length anti-body fragments. Examples of link fragments encompassed within the term "antigen binding portion" of an anti-body include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CH1 domains; (ii) a F (abD) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge in the joint region; (iii) a fragment Fd consisting of the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Na ture 341: 544-546), which consists of a domain VH; and (vi) a region of determination of complementarity (CDR). Also, although the two domains of the fragment Fv, VL and VH, are encoded for separate genes, can be linked, using recombinant methods, by means of a synthetic linker that allows them to be formed as a single protein chain in which the VL and VH regions are paired to form monovalent molecules (known as chain Fv) simple (scFv); see for example, Bird et al., (1988) ^ P Science 242: 423-426; and Huston et al., (1988) Proc. Na ti. Acad. Sci. USA 85: 5879-5883). These single chain anti-bodies also claim to be covered within the term "antigen binding portion" of an anti-body. These fragments of anti-body are obtained using conventional techniques known to those skilled in the art, and the fragments are selected for their usefulness in the same way as for intact anti-bodies. The term "monoclonal anti-body" as used herein refers to an anti-body molecule of a simple molecular composition. A monoclonal anti-body composition exhibits a simple binding specificity and affinity ^ by a particular epitope. In accordance with the foregoing, the term "human monoclonal anti-body" refers to anti-bodies exhibiting a single bond specificity having variable and constant regions derived from human germline immunoglobulin sequences. In one embodiment, human monoclonal anti-bodies are produced by a hybridoma that includes a • B cell obtained from a transgenic non-human animal, for example, a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell. The term "recombinant human anti-body", as used herein, is intended to include all human anti-bodies that are prepared, expressed, created or isolated by recombinant means, such as anti-bodies isolated from an animal. (e.g., a mouse) that is transgenic for the human immunoglobulin genes; anti-bodies expressed using a recombinant expression vector transfected in a host cell, anti-bodies isolated from a library of anti-human bodies i. The recombinant, combinatorial, or anti-bodies prepared, expressed, created or isolated by other means that involve dividing sequences of human immunoglobulin genes into other DNA sequences. These recombinant human anti-bodies have variable and constant regions derived from the human germline immunoglobulin sequences. In certain embodiments, however, these recombinant human anti-bodies are subject to in vitro mutagenesis (or, when a transgenic animal is used for the human immunoglobulin sequences, somatic mutagenesis in vivo) and thus, the Amino acid sequences of the VH and VL regions of the recombinant anti-bodies are sequences that, although they are derived from and relate ttk to the VH and VL sequences of the human germline, may not naturally exist within the repertoire of the line germline of anti-human bodies in vivo. A nucleic acid is "operably linked" when placed in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence. With respect to the sequences ^^ Transcriptional regulators, operably linked means that the DNA sequences being linked are contiguous and, when it is necessary to join two protein coding regions, they are contiguous and in reading frames. The terms "vector" or "construction", as used in l, Jkék.? - < A »* .. * Ji *» t.t. * »Jn» ~. «- i. .-t. ^ "1. The present invention is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA cycle in which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (eg, bacterial vectors having replication bacterial origin and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell after introduction É ~ in the host cell, and through which they are replicated together with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. These vectors are referred to herein as "recombinant expression vectors" (or simply, "expression vectors"). In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. To the present specification, "plasmid" and "vector" ^^ can be used interchangeably since the plasmid is the most commonly used form of vector. However, the invention is intended to include other forms of expression of vectors, such as viral vectors (e.g., retroviruses with replication defect, adenoviruses and adeno-associated vectors). ^ "-a," £ ..... * i & The term "recombinant host cell" (or simply "host cell"), as used herein, is intended to refer to a cell into which a recombinant expression vector has been introduced. It should be understood that these terms are intended to refer not only to the particular object cell but to the progeny of this cell. Because certain modifications may occur in successive generations due to either mutation or environmental influences, this progeny may in fact not be identical to the parent cell, but is still included within the scope of the term "host cell" as used at the moment. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. 15 Detailed Description The drawings are first described. Figure IA is a schematic diagram of a construct containing the genomic sequence of the light chain (LC) of the anti-carcinoembryonic antigen body.

Humanized 431. The location of the signal sequence or signal sequences and the light chain variable regions (Vk) and the Ck regions are also indicated. The location of the restriction enzyme sites is also indicated. Figure IB represents the nucleotide sequence and 25 amino acids for the light chain of the anti-body antigen M ^ * "» ^: ^ * h - ~ .. i. T.. ^. T,. _...__., _, ", .___«, _.!, ~~ a »^ ** J? * Humanized anti-carcinoembryonic 431. The location of the restriction enzyme sites is indicated, Figure 2 depicts the nucleotide sequence for the Sal I insert containing the coding sequence for the light chain of the anti-body humanized anti-carcinoembryonic antigen 431. Figure 3 is a schematic diagram of a construct (Be 458) that includes the Sal I insert containing the coding sequences for the anti-body anti-body light chain. humanized embryonic carcinoid 431. The location of the silencer, the untranslated region of ß-casein 5Ü, the light chain coding region, and the ? untranslated region β-casein 3Ü. Figure 4A is a schematic diagram of a construct containing the heavy chain (HC) genomic sequence of the humanized anti-carcinoembryonic antigen 431 antigen body linked to the β-glucuronidase sequence. The location of the signal peptide sequence (s) and the heavy chain variable (Vh) and CH1 are also indicated. The location of the restriction enzyme sites is also • ^^ in "di-can. Figure 4B depicts the nucleotide sequence of amino acids for the heavy chain of the anti-human anti-carcinoembryonic antigen 431. The location of the restriction enzyme sites is indicated.

Y.. *. Figure 5 depicts the nucleotide and amino acid sequence for the mutant heavy chain of the anti-human anti-carcinoembryonic antigen body 431. The mutant heavy chain lacks region of articulation. The location of the restriction enzyme sites is indicated. Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of the humanized anti-carcinoembryonic antigen 431 antibody linked to the β-glucuronidase sequence. The location of the silencer, the untranslated ß-casein 5Ü region, the heavy chain mutant fusion coding region / β-glucuronidase, and the untranslated region of β-casein 3Ü. The location of the restriction enzyme sites is also indicated. Figure 7 is a top view of the construction of the heavy chain mutants. Figure 8 is an enlarged view of the mutations for β-glucuronidase. The present invention provides, at least in part, the transgenically produced fusion proteins where one member of the fusion protein is assembled into one multimer m ^ "and the other member is chosen, or modify, to promote the assembly in the optimal number of sub-units. In one embodiment, the fusion protein includes a subunit of immunoglobulin (e.g., a heavy or light immunoglobulin chain) fused to a toxin (e.g., a subunit of an enzyme). The immunoglobulin-enzyme fusion proteins described herein serve to direct a cytotoxic agent (e.g., the enzyme) to an undesirable cell, e.g., a tumor cell. For example, the fusion proteins described in the following example, (i.e., an anti-body against carcinoembryonic antigen (CEA) fused to an enzyme, eg, glucuronidase) can be used to target a cell of • tumor. After allowing sufficient time for the immunoglobulin-enzyme fusion to be located at the tumor site, a non-toxic prodrug can be administered. This prodrug is converted into a very cytotoxic drug by the action of the directed enzyme located at the tumor site, allowing to reach therapeutic levels of the drug without the unacceptable toxicity for the patients. Production of immunoglobulins A monoclonal anti-body against a target antigen, eg, a cell surface protein (eg, receptor) on a cell can be produced by a variety of techniques, including conventional monoclonal anti-body methodology, by example, the hybridization technique ^^ Standard Somatic Cell by Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell hybridization methods are preferred, in principle, other techniques can be used to produce monoclonal anti-bodies, for example viral or oncogenic transformation of B lymphocytes. l1 ^ ÍÍMMÍ IiBta ^ aaate? ¿? iá - & . &. "& i ^.

The preferred animal system for preparing hybridomas is the murine system. The production of hybridomas in the mouse is a very well established procedure. Immunization protocols and techniques for the isolation of splenocytes immunized for fusion are known in the art. Fusion participants (eg, murine myeloma cells) and fusion procedures are also known. • Human monoclonal anti-bodies (mAbs) directed against human proteins can be generated using transgenic mice that carry the entire immune system instead of the mouse system. Splenocytes from these transgenic mice immunized with the antigen of interest are used to produce hybridomas that secrete human anti-monoclonal antibodies against • specific affinities for epitopes of a human protein (see, for example, Wood et al, international publication WO 91/00906, Kucherlapati et al, international publication WO 91/10741, Lonberg et al., International publication WO 92/03918; collaborators, international publication 92/03917; Lonberg, N., et al., 1994 Nature 368: 856-859; Green, LL, et al., 1994 Nature Genet. ^^ 7: 13-21; Morrison, S.L. and collaborators, 1994 Proc. Nati Acad. Sci USA 81: 6851-6855; Bruggeman et al., 1993 Year Itpmunol 7: 33-40; Tuaillon et al., 1993 PNAS 90: 3720-3724; Bruggeman et al., 1991 Eur J Immunol 21: 1323-1326).

Monoclonal anti-bodies can also be generated by other methods known to those skilled in the art of recombinant DNA technology. An alternative method, known as the "combinatorial anti-body display" method, has been developed to identify and isolate fragments of anti-bodies that have a particular antigen specificity, and can be used to produce monoclonal anti-bodies • (for descriptions of combinatorial anti-body display see, for example, Sastry et al., 1989 PNAS 86: 5728, Huse et al., 1989 Science 246: 1275, and Orlandi et al., 1989 PANS 86: 3833). After immunizing an animal with an immunogen as described above, the repertoire of anti-bodies of the resulting B cell deposit • is cloned. Methods are generally known to obtain the DNA sequence of the variable regions of a diverse population of immunoglobulin molecules using a mixture of oligomer primers and polymerase chain reaction. For example, the mixed oligonucleotide primers corresponding to the forward sequences 5Ü (signal peptide) and / or the sequences of structure 1 (FR1), as well as the primer to a ^^ Conserved 3Ü constant region primer can be used for amplification by polymerase chain reaction of the heavy and light chain variable regions from various murine anti-bodies (Larrick et al., 1991, Biotechni - ques 11: 152-156). A similar strategy can also be used to amplify the human heavy and light chain variable regions from human anti-bodies (Larrick et al., 1991, Methods: Co-operation to Methods in Enzymology 2: 106-110). In an exemplary embodiment, the RNA is isolated from B lymphocytes, for example, peripheral blood cells, bone marrow, or spleen preparations, using standard protocols (e.g., U.S. Patent 4,683,202; Orlandi, et al., PNAS (1989) 86: 3833-3837; Sastry et al., PNAS (1989) 86: 5728-5732; and Huse et al., (1989) Science 246: 1275-1281). The first strand cDNA is synthesized using primers specific for the constant region of the heavy chain (s) and each of the light chains K and γ, as well as primers for the signal sequence. Using variable region polymerase chain reaction primers, the variable regions of both the heavy and light chains are amplified, either alone or in combination, and ligated into suitable vectors for further manipulation to generate the deployment packages. Oligonucleotide primers useful in amplification protocols can be unique or degenerate or incorporate inosma at degenerate positions. Restriction of endonuclease recognition sequences can also be incorporated into the primers to allow cloning of the amplified fragment into a vector in a predetermined reading frame for expression. The V-gen library cloned from the repertoire i ..? H «.J.iJa« i.,. , 3 .. = .- ii «****» «m * fa of anti-bodies derived from immunization can be expressed by a population of deployment packages, preferably filamentous phage derivatives, to form an anti-display library. -bodies Ideally, the deployment package comprises a system that allows sampling of very large anti-body display libraries varied, rapid classification after each round of affinity separation, and easy isolation of the anti-body gene from Purified deployment packages. In addition to commercially available games to generate phage display libraries (for example, the Recombinant Phage Antibody System, from Pharmacia, catalog number 27-9400-01, and the phage display kit) Stratagene's SurfZAP®, catalog number 240612), examples of methods and reagents particularly amenable to use to generate a varied anti-body display library can be found in, for example, Ladner et al., U.S. Patent 5,223,409; Kang et al., International publication WO 92/18619; Dower et al., International publication WO 91/17271; Winter et al., International publication WO 92/20791; Markland et al., International publication WO 92/15679; Breitling et al., International publication WO 93/01288; McCafferty et al., International publication WO 92/01047; Garrard et al., International publication WO 92/09690; Ladner et al., International publication WO 90/08209; Fuchs et al., (1991) Bio / Technology 9: 1370- . ^ A A ~ 1372; Hay and collaborators, (1992) Hum Antibod Hybrido as 3: 81-85; Huse et al. (1989) Science 246: 1275-1281; Griffths et al., (1993) EMBO J 12: 725-734; Hawkins and collaborators, (1992) J Mol Biol 226: 889-896; Clackson et al., (1991) Nature 352: 624-628; Gram et al., (1992) PNAS 89: 3576-3580; Garrad et al., (1991) Bio / Technology 9: 1373-1377; Hoogenboom et al., (1991) Nuc Acid Res 19: 4133-4137; Y ^ P Barbas et al., (1991) PNAS 88: 7978-7982. In certain embodiments, the V region domains of the heavy and light chains can be expressed in the same polypeptide, linked by a flexible linker to form a single chain Fv fragment, and the scFV gene subsequently? cloned into the desired expression vector or phage genome. As is generally described in McCafferty et al., Nature (1990) 348: 552-554, the complete VH and VL domains of an antibody, linked by a flexible linker (Gly4-Ser) 3 can be used to produce an anti-body single chain which can be returned to the separable deployment package based on antigen affinity. The isolated scFV anti-bodies immunoreactive with the antigen can then be formulated into a pharmaceutical preparation for use in the present method. As soon as the surface of the deployment package is deployed (eg, a filamentous phage), the anti-body library is selected with the target antigen, or the peptide fragment thereof, to identify and isolate e.¿ k? ai fc ü? j-Sxiá. packages that express an anti-body that has specificity for the target antigen. The nucleic acid encoding the selected antibody can be recovered from the deployment package (e.g., from the phage genome) and subcloned into other expression vectors by standard recombinant DNA techniques. Specific anti-body molecules with high affinities for a surface protein can be made according to methods known to those skilled in the art, for example, methods involving library selection (Ladner, RC, et al., US Pat. 5,233,409; Ladner, RC, et al., US Patent 5,403,484). In addition, the methods of these libraries can be used in selections to obtain binding determinants that are mimetic of the structural determinants of the anti-bodies. In particular, the Fv binding surface of a particular anti-body molecule interacts with its target ligand according to principles of protein-protein interactions, hence the sequence data for VH and VL (the latter of which may be of chain type K and?) is the basis for artificial protein design techniques known to those skilled in the art. The details of the protein surface comprising the binding determinants can be obtained from information on antibody sequences, by means of a modeling procedure using previously determined three-dimensional structures from other antigens.

J? a. «-« ... A..k, .a bodies obtained from studies of nuclear magnetic resonance or crystallographic data. See for example, Bajorath, J. and S. Sheriff, 1996, Proteins: Struct. , Funct. , and Genet. 24 (2), 152-157; Webster, D.M., and A.R. Rees, 1995, "Molecular modeling of antibody-combining sites", in S. Paul, Ed., Methods in Molecular Biol. 51, Antibody Engineering Protocols, Humana Press, Totowa, NJ, pages 17-49; and Johnson, G., Wu, T.T. and E.A. Kabat, 1995, "Seqhunt: A program to screen aligned nucleotide and amino acid sequences", in Methods in Molecular Biol. 51, op. , ci t. , pages 1-15. In one embodiment, a variable peptide library is expressed by a population of deployment packages to form ? a peptide display library. Ideally, the deployment package comprises a system that allows sampling of very large varied peptide display libraries, rapid classification after each round of affinity separation, and easy isolation of the gene encoding the peptide from packs of purified display. Peptide display libraries can be in, for example, prokaryotic organisms and viruses, which can be amplified W ^^ quickly, and are relatively easy to manipulate, and which allow the creation of a large number of clones. Preferred deployment packages include, for example, vegetative bacterial cells, bacterial spores, and more preferably, bacterial viruses (especially DNA viruses). Without i i k? íi .1.

However, the present invention also contemplates the use of eukaryotic cells, including yeasts and their spores, as potential deployment packages. The phage display libraries are described above. Other techniques include affinity chromatography with a suitable "receptor", e.g., a target antigen, followed by the identification of the isolated P binding agents or ligands by conventional techniques (e.g., mass spectrometry and nuclear magnetic resonance) . Preferably, the soluble receptor is conjugated to a tag (eg, fluorophores, colorimetric enzymes, radioisotopes, or luminescent compounds) that can be detected to indicate ligand binding. Alternatively, the immobilized compounds can be selectively released and allowed to diffuse through a membrane to interact with a receptor. Combinatorial libraries of the compounds can also be synthesized with "tags" to encode the identity of each member of the library (see, for example, W. C. Still and co-workers, International Application WO 94/08051). In In general, this method characterizes the use of inert but easily detectable labels, which are attached to the solid support or to the compounds. When an active compound is detected, the identity of the compound is determined by the identification of the unique accompanying label. This method of labeling allows the l «Hf j l l ..J» ^. ». . ^ . - - > - - -. - - ------- t-i-? J synthesis of large libraries of compounds that can be identified at very low levels among the total set of all the compounds in the library. The term "modified anti-body" is also intended to include anti-bodies, such as monoclonal anti-bodies, anti-chimeric bodies, and humanized anti-bodies that have been modified by, for example, suppressing, adding, or replacing portions of the anti-body. -body. For example, an antibody can be modified by suppressing the region of articulation, thereby generating a monovalent anti-body. Any modification is within the scope of the invention as long as the anti-body has at least one specific antigen binding region. Chimeric mouse-human monoclonal anti-bodies (ie, chimeric anti-bodies) can be produced by recombinant DNA techniques known in the art. For example, a gene encoding the constant region Fc of an anti-murine molecular body molecule (or another species) is digested with restriction enzymes to remove the region encoding the murine Fc, and the equivalent portion of a gene that f encodes a constant region Fc human is replaced. (See Robinson et al., International publication PCT / US86 / 02269; Akira, et al., European publication 184,187; Taniguchi, M., European publication 171,496; Morrison and collaborators, European publication 173,494; Neuberger and collaborators, international publication WO 86/01533; Cabilly et al., US Patent 4,816,567; Cabilly et al., European publication 125,023; Better et al. (1988 Science 240: 1041-1043); Liu et al., (1987) PNAS 84: 3439-3443; Liu et al., 1987, J. Im unol. 139: 3521-3526; Sun et al. (1987) PNAS 84: 214-218; Nishimura et al., 1987, Canc. Res. 47: 999-1005; Wood et al. (1985) Nature 314: 446-449; and Shaw et al., 1988, J. Na ti Cancer Inst. , 80: 1553-1559). The chimeric anti-body can be further humanised by replacing variable region Fv sequences that are not directly involved in the antigen binding with? equivalent sequences from variable regions of human Fv. General reviews of chimeric anti-bodies humanized are provided by Morrisson, S.L., 1985, Science 229: 1202-1207 and by Oi et al., 1986 Bio Techniques 4: 214. Those methods include isolating, manipulating, and expressing the nucleic acid sequences that encode all or part of the immunoglobulin Fv variable regions from ^^ at least one heavy or light chain. The sources of this ^^ nucleic acid are well known to those skilled in the art, and, for example, a hybridoma which produces the anti-GPIIbIIIa anti-body can be obtained from 7E3. The recombinant DNA encoding the chimeric anti-body, or fragment thereof, is can then clone into a suitable expression or. The Suitable humanized anti-bodies alternatively can be produced by substitution of complementarity determining region, US Patent 5,225,539; Jones et al., 1986 Nature 321: 552-525; Verhoeyan et al., 1988 Science 239: 1534; and Beidler et al., 1988 J. Immunol. 141: 4053-4060. All regions of complementarity determination of a particular human anti-body can be replaced with at least a portion of a region of determination of human complementarity or only some of the regions of determination of complementarity can be replaced with regions of complementarity determination not human It is only necessary to replace the number of complementary determination regions required to link the humanized anti-body to the Fc receptor. An anti-body can be humanized by any method, which is capable of replacing at least a portion of a region of complementarity determination of a human antibody with a region of determination of complementarity-derived from a non-human body anti-body. Winter describes a method which can be used to prepare the humanized anti-bodies of the present invention (UK patent application GB 2188638A, filed March 26, 1987), the content of which is expressly incorporated by reference. Inc. The regions of determination of complementarity are Iti A? ? A. LA ni-»alil * (* t * J can be substituted with regions of non-human complementarity determination using oligonucleotide site-directed mutagenesis.) Also within the scope of the invention are the chimeric and humanized anti-bodies in the which specific amino acids have been replaced, deleted or added in. In particular, the preferred humanized antibodies have • amino acid substitutions in the region of the structure, so that they improve the binding to the antigen. For example, in a humanized anti-body having regions of mouse complementarity determination, the amino acids located in the region of human structure can be replaced with the amino acids located in the corresponding positions in the • Anti-body mouse. These substitutions are known to improve the binding of humanized anti-bodies to the antigen in some cases. Anti-bodies in which amino acids have been added, deleted, or substituted are known herein as modified antibodies or altered anti-bodies. Obiective antigens In preferred embodiments, the first member of the fusion proteins of the present invention is a target agent, for example, a polypeptide having a high affinity for a target, for example, an anti-body, a ligand, or an enzyme In accordance with the above, the fusion proteins of the invention can be used to selectively direct (eg, localize) the second member of the fusion protein in the vicinity of an undesirable cell. For example, the first member may be an immunoglobulin that interacts with (e.g., binds to a target antigen). In certain embodiments, the target antigen is present on the surface of a cell, for example, an aberrant cell such as a hyperproliferative cell (e.g., a cancer cell). Exemplary target antigens include the carcinoembryonic antigen (CEA), TAG-72, her-2 / neu, the epidermal growth factor receptor, the transferrin receptor, among others. As used herein, "target cell" can mean any undesirable cell in a subject (e.g., a human or an animal) that can be reached by a fusion protein of the invention. Exemplary target cells include tumor cells, such as carcinoma cells or cells derived from adenocarcinoma (e.g., colon, breast, prostate, ovarian and endometriotic cancer cells) (Thor, A., and collaborators, (1997) Cancer Res 46: 3118; Soisson AP, et al., (1989) Am. J ". Obstet Gynecol.: 1258_63) The term" carcinoma "is recognized in the art and refers to tissue malignancies. epithelial or endocrine tumors that include carcinomas of the respiratory system, carcinomas of the gastrointestinal system, carcinomas of the genitourinary system, testicular carcinomas, carcinomas of the breast, carcinomas .s t 1 í »i i ** & *. ovarian, prostatic carcinomas, carcinomas of the endocrine system, and melanomas. Exemplary carcinomas include those that form from tissues of the cervix, lung, prostate, chest, head and neck, colon and ovary. The term also includes carcinosarcomas, for example, which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term "sarcoma" is recognized in the art and refers to malignant tumors of mesenchymal derivation. Production of fusion proteins The first and second members of the fusion protein can be linked together, preferably via a linker sequence. The linker sequence should separate the first and second members of the fusion protein by a sufficient distance to ensure that each member suitably be bent in its secondary and tertiary structures. The preferred linker sequences (1) should adopt a flexible extended conformation, (2) they should not exhibit a propensity to W ^ B ^ develop an ordered secondary structure which could interact with the first and second functional members, and (3) should have a minimal or loaded hydrophobic character, which could promote interaction with functional protein domains. Typical surface amino acids in the flexible protein regions include Gly, Asn and Ser. The permutations of amino acid sequences containing Gly, Asn and Ser would be expected to satisfy the above criteria of a linker sequence. Other nearby neutral amino acids, such as Thr and Ala, can also be used in the linker sequence. A 20 amino acid linker sequence length can be used to provide convenient separation of functional protein domains, although longer or shorter linker sequences can also be used. The length of the linker sequence separating the first and second member may be from 5 to 500 amino acids of mW length, or more preferably from 5 to 100 amino acids in length. Preferably, the linker sequence is about 5-30 amino acids in length. In preferred embodiments, the linker sequence is from about 5 to about 20 amino acids, and advantageously is from about 10 to about 20 amino acids. The sequence of amino acids useful as linkers of the first and second member include, but are not limited to, (SerGly4) and where w ^^ Y is greater than or equal to 8, or Gly4SerGly5Ser. A preferred linker sequence has the formula (SerGly4) 4. Another preferred linker has the sequence ((Ser-Ser-Ser-Gly) 3-Ser-Pro). The first and second members can be merged directly into a linker sequence. Linker sequences are not necessary when the proteins being fused have non-essential N- or C-terminal amino acid regions which can be used to separate the functional domains and avoid steric interference. In the preferred modes, the C term of the first member can be merged directly to the N term of the second member, or vice versa. Recombinant production ^ A fusion protein of the invention can be prepared with recombinant DNA techniques using a nucleic acid molecule encoding the fusion protein. A nucleotide sequence encoding a fusion protein can be synthesized by standard DNA synthesis methods. A nucleic acid that encodes a fusion protein • a cell of a primary or immortalized cell line can be introduced into a host cell, for example. The recombinant cells can be used to produce the fusion protein. A nucleic acid encoding a fusion protein can be introduced into a host cell, for example, by homologous recombination. In most cases, a nucleic acid encoding the fusion protein is incorporated into a recombinant expression vector. The nucleotide sequence encoding a fusion protein can be operably linked to one or more regulatory sequences, selected based on the host cells to be used for expression. The term "operably linked" means that the sequences encoding the fusion protein compound are linked to the regulatory sequence (s) in a manner that allows expression of the fusion protein. The term "regulatory sequence" refers to promoters, enhancers and other expression control elements (e.g., polyadenylation signals). These regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990), the content of which is incorporated herein by reference. Regulatory sequences include those which direct the constitutive expression of a nucleotide sequence in many types of host cells, which direct the expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) and which they direct the expression in an adjustable manner (for example, only in the presence of an inducing agent). It will be appreciated by those skilled in the art that the design of the expression vector may depend on factors such as the choice of the host cell to be transformed, the level of expression of the desired fusion protein, and the like. The expression vectors of the fusion protein can be introduced into the host cells to thereby produce fusion proteins encoded by nucleic acids. The recombinant expression vectors can be design for the expression of fusion proteins in prokaryotic or eukaryotic cells. For example, fusion proteins can be expressed in bacterial cells such as E. coli, insect cells (e.g., in the baculovirus expression system), yeast cells or mammalian cells. Some convenient host cells are further mentioned in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Examples of expression vectors in yeasts S. cerevisiae include pJRY88 ((Schuitz et al., (1987) Gene 54: 113-123), and pYES2 (Invitrogen Corporation, San Diego, CA) Baculovirus vectors available for the expression of fusion proteins in cultured insect cells ( by • example, Sf 9 cells) include pAc cells (Smith et al., (1983) Mol Cell. Biol. 2: 2156-2165) and the pVL series (Lucklow, VA, and Summers, MD, (1989) Viroloq ? 170: 31-39). Examples of mammalian expression vectors include pCDM8 (Seed, B., (1987) Nature 329: 840) and pMT2PC (Kaufman et al., (1987), EMBO J. 6: 187-195). When used in mammalian cells, vector control functions of m ^^ expression are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simio Virus 40. In addition to the regulatory control sequences discussed previously, recombinant expression vectors may contain additional nucleotide sequences. For example, the recombinant expression vector can encode a selectable marker gene to identify host cells that have been incorporated into the vector. Even more, to facilitate the secretion of the fusion protein from a host cell, in particular mammalian host cells, the recombinant expression vector can encode a signal sequence operably linked to sequences encoding the amino terminus of the fusion protein so that after expression, the fusion protein is synthesized with the signal sequence fused at its amino terminus. This signal sequence directs the fusion protein towards the secretory path of the cell and dissociates there, allowing the release of the mature fusion protein (i.e., the fusion protein without the signal sequence) from the host cell . The use of a signal sequence to facilitate the secretion of proteins or peptides from mammalian host cells is known in the art. The vector DNA can be introduced into cells W ^^ procari -o * ti -cas or in cé-l-, ul -, eucap.o.ti.cas saw conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to a variety of field-related techniques for introducing foreign nucleic acid (e.g., DNA) into a . .: "X &host cell, including coprecipitation of calcium phosphate or calcium chloride, DEAE-dextran mediated transfection, lipofection, electroincorporation, microinjection, and viral mediated transfection Convenient methods to transform or transfect host cells can be found in Sambrook et al., {Molecular Cloning: A Labora tory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals, often only a small fraction of mammalian cells integrate foreign DNA into their genome. In order to identify and select these integrants, a gene encoding a selectable marker (e.g., resistance to antibiotics) can be introduced into the host cells together with the gene encoding the fusion protein.) Preferred selectable markers include those that confer resistance to drugs, such as G418, hygromycin and methotrex The nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as the one encoding the fusion protein or can be introduced on a separate vector. Stably transfected cells with the introduced nucleic acid can be identified by drug selection (for example, cells that have incorporated the selectable marker gene will survive, while the other cells die). A recombinant expression vector can be transcribed l? k. k. ^ s. A ^ í. Bt eíá i? . *. * -. *. . . ^ ^ ^ ¿A .. ,,. ^ .. ^ I, bir and translate in vi tro, for example using regulatory sequences of the T7 promoter and T7 polymerase. Transgenic Mammals Methods for generating transgenic non-human animals are described herein. DNA constructs can be introduced into the germ line of a mammal to make a transgenic mammal. For example, one or several copies of the construct can be incorporated into the genome of a mammalian embryo by standard transgenic techniques. It is often desirable to express the transgenic protein of the milk of a transgenic mammal. Mammals that produce large volumes of milk and have long lactation periods are preferred. Preferred mammals are ruminants, for example, cows, sheep, camels or goats, for example, goats of Swiss origin, for example, goats of the Alpina, Saanen and Toggenburg breeds. Other preferred animals include oxen, rabbits and pigs. In an exemplary embodiment, a transgenic non-human animal is produced by introducing a transgene into the germ line of a non-human animal. Transgenes can be introduced into embryonic target cells in various stages of development. Different methods are used depending on the stage of development of the embryonic target cell. The specific lines or lines of any animal used, if possible, should be selected to have good health in general, good embryo production, , ^ ^ ^. (^^^^ ^ ^ ^ ^ ^. .. ^ .. ^ .. ^. ^ ^. -.tt ^. ^. .. .. ^ ^ LÜJ good pronuclear visibility in the embryo, and good reproductive status. introduction of the fusion protein transgene into the embryo can be carried out by any variety of means known in the art such as microinjection, electroincorporation, or lipofection.For example, a transgene of fusion proteins can be introduced into a mammal by • microinjection of the construction in the pronucleus of the fertilized mammalian egg (s) to cause one or more copies of the construct to be retained in the cells of the developing mammals. After the introduction of the transgene construction in the fertilized egg, the egg may be incubated in vi tro for varying amounts of time, or reimplanted in the substitute host, or both. A common method is to incubate embryos in vi tro for approximately 1-7 days, depending on the species, and then reimplant it in the substitute host. The progeny of the transgenically engineered embryos can be tested for the presence of the construct by Southern staining analysis of a m ^^ fragment of tissue. An embryo having one or more copies of the cloned construct exogenously stably integrated into the genome can be used to establish a permanent transgenic mammal line that carries the transgenically added construct.

Lads of transgenically altered mammals can be tested after birth to determine the incorporation of the construct into the genome of the offspring. This can be done by hybridizing a probe corresponding to the DNA sequence encoding the fusion protein or a segment thereof on a chromosomal material of the progeny. Mammalian progeny that are found to contain at least one copy of the construct in their genome are raised to maturity. The female species of this progeny will produce the desired protein in or along with their milk. The transgenic mammals can be used to produce another transgenic progeny useful for producing the desired proteins in their milk. Transgenic females can be examined for • determine protein secretion in milk, using assay techniques known in the art, eg, Western blotting or an enzymatic assay. Other transgenic animals The fusion protein can be expressed from a variety of transgenic animals. A protocol for the production of a transgenic pig can be found in White and ^ Yannoutsos, Current Topics in Complement Research; 64 th Forum in Immunology, pages 88-94; US Patent 5,523,226; US patent ,573,933; international application WO 93/25071; and international application WO 95/04744. A protocol for the production of transgenic mice can be found in the US patent ?? ? ± J. A .Í? T ?? i &t ?. »^ .j • - '-' - *« - * - »" '' - ^ - - - - - * - «* • * - • 5,530,177 A protocol for the production of transgenic rats can be found in Bader and Ganten, Clinical and Experimental Pharmacology and Physiology, Supp. 3: S81-S87, 1996. A protocol for the production of a transgenic cow can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Cari A. Pinkert, Academic Press, Inc. A protocol for the production of a transgenic sheep can be found in Transgenic Animal Technology, A Handbook, 1994, ed., Cari A. Pinkert, Academic Press, Inc. A protocol for the production of a rabbit transgenic can be found in Hammer et al., Nature 315: 680-683, 1985 and Taylor and Fan, Frontiers in Bioscience 2: d298- 308, 1997. Production of transgenic protein in the milk of a transgenic animal. Specific promoters of milk Promoters of useful transcription are those promoters that are preferentially activated in mammary epithelial cells, including the promoters that control the genes encoding milk proteins, such as caseins, β-lactoglobulin (Clark et al., (1989) Bio / Technology w ^^ 7.:487-492), protein of whey acid (Gorton et al., (1987) Bio / Technology 5: 1183-1187), and lactalbumin (Soulier et al., (1992) FEBS Let ts 297: 13). The a, ß, Y or O K casein gene promoter of any mammalian species can be used to provide mammary expression; a preferred promoter is the promoter of the goat β-casein gene (DiTullio, (1992) Bio / Technology 10: 74-77). The milk-specific protein promoter or promoters that are specifically activated in mammary tissue can be isolated from cDNA or genomic sequences. Preferably, they are of genomic origin. DNA sequence information is available for specific genes of the mammary gland listed above, and at least one, and frequently in several organisms. See, for example, Richards et al., J.

Biol. Chem. 256, 526-532 (1981) (rat -lactalbumin); Campbell et al., Nucleic Acids Res. 12, 8685-8697 (1984) á-Sk (rat WAP); Jones et al., J ". Biol. Chem. 260, 7042-7050 (1985) (rat ß-casein); Yu-Lee and Rosen, J. Biol. Chem. 258, 10794-10804 (1983) (? - rat casein), Hall, Biochem J. 242,735-742 (1987) (human α-lactalbumin), Stewart, Nucleic Acids Res. 12, 389 (1984) (asl cDNA and bovine K casein); Gorodetsky et al., Gene 66, 87-96 (1988) (bovine ß-casein), Alexander et al, Eur. J. Biochem. 178, 395-401 ^^ (1988) (bovine casein K), Brignon et al., FEBS Lett w ^^ 188, 48-55 (1977) (aS2 bovine casein), Jamieson et al.

Gene 61, 85-90 (1987), Ivanov et al., Biol. Chem. Hoppe-Seyler 369, 425-429 (1988), Alexander et al., Nucleic Acids Res. 17, 6739 (1989) (bovine ß-lactoglobulin); Vilotte et al., Biochimie 69, 609-620 (1987) (a-lactalbumin A l? Aaílu aíimí a bovina). The structure and function of different milk protein genes are performed by Mercier & Vilotte, J. "Dairy Sci. 76, 3079-3098 (1993) (incorporated by reference in its entirety for all purposes.) If additional flanking sequences are useful to optimize expression, these sequences can be cloned using existing sequences as The specific regulatory sequences of the mammary P gland of different organisms can be obtained by selecting libraries of these organisms using known cognate nucleotide sequences, or anti-bodies for the cognate proteins as probes Mmi signal sequences Useful signal sequences are milk-specific signal sequences or other signal sequences that result in the secretion of eukaryotic or prokaryotic proteins Preferably, the signal sequence is selected from specific milk signal sequences, ie, it is from a gene which encodes a product secreted in milk, more preferably, the sequence of The specific milk is related to the specific promoter of the milk used in the expression system of this invention. The size of the signal sequence is not critical to this invention. All that is required is that the sequence be of sufficient size to effect the secretion of the desired recombinant protein, for example, in the breast tissue. For example, the sequence of ? íí, .j at A ..- *. i.?*. r ^ __ ,,, aaataáa? .aite ^ b ^ Éadü.MArfÉUWLái ^ signals of genes encoding caseins, for example, a, ß, and / or K caseins, β-lactoglobulin, whey acid protein, and lactalbumin are useful in the present invention. A preferred signal sequence is the goat β-5 casein signal sequence. Signal sequences from other secreted proteins, for example, immunoblogulins, or proteins secreted by WF liver cells, kidney cells, or pancreatic cells can also be used. 10 Insulating Sequences The DNA constructs of the invention further comprise at least one insulating sequence. The terms "insulator", "insulator sequence" and "insulator" are used interchangeably herein. An insulating element is a control element that isolates the transcription of genes placed within its range of action but that does not disturb the expression of the gene, either negatively or positively. Preferably, an insulator sequence is inserted on either side of the DNA sequence to be transcribed. For example, him The insulator can be placed approximately 200 base pairs up to about 1 kb, 5U from the promoter, and at least about 1 kb to 5 kb from the promoter, at the 3'-end of the gene of interest. The distance of the promoter insulator sequence and the 3U end of the gene of interest can be determined by the technicians in the field, depending on the JIGTG tiiiiMirri MTtt ¡Jttj ^ ti relative sizes of the gene of interest, the promoter and the enhancer used in the construction. In addition, more than one 5U insulator sequence can be placed from the promoter or at the 3u end of the transgene. For example, two or more insulator sequences can be placed in the promoter. The insulator or insulators at the 3'-end of the transgene can be placed at the 3'-end of the gene of interest, or at the 3'-end of a regulatory sequence. • 3Ü, for example, a non-translated region 3Ü (UTR) or a flanking sequence 3Ü. A preferred isolator is a DNA segment that spans the 5'-end of the chicken β-globin site and corresponds to the constitutive hypersensitive site of chicken as described in FIG.

M% International publication WO 94/23046, the content of which is incorporated herein by reference. DNA Constructs A fusion protein can be expressed from a construct which includes a promoter specific for mammary epithelial cells, for example, casein promoter, for example, a promoter of beta-casein goat, a specific signal sequence of milk, for example, a signal sequence of W ^^ casein, for example, a ß-casein signal sequence, and a DNA that encodes a fusion protein. A construct can also include an untranslated region downstream of the DNA sequence encoding the non-secreted protein. These regions can stabilize the RNA transcription of the expression system and thereby increase the production of the desired protein from the expression system. Among the untranslated regions useful in the constructions of this invention are the sequences that provide a poly A signal. These sequences can be derived, for example, from the small SV40 antigen, the 3U untranslated region from casein or other untranslated sequences. 3Ü well known in the field. Preferably, the untranslated region 3Ü is derived from a milk-specific protein. The length of the 3U untranslated region is not critical but the stabilizing effect of this poly A transcript seems important for stabilizing the RNA of the expression sequence. ? m A construction can include a non-translated region 5Ü between the promoter and the DNA sequence encoding the signal sequence. These non-translated regions can be from the same control region from which the promoter is taken or they can be from a different gene, for example, they can be derived from other synthetic, semi-synthetic or natural sources. Again its specific length is not critical, however, ^^ seems to be useful in improving the level of expression. w ^^ A construct also includes approximately 10 percent, 20 percent, 30 percent, or more of the N-terminal coding region of a gene preferentially expressed in mammary epithelial cells. For example, the N-terminal coding region may correspond to the promoter used, for example, an N-terminal coding region of goat β-casein, the methods of the prior art may include make a construct and test it to determine the ability to produce a product in cultured cells before placing the construct in a transgenic animal Surprisingly, the inventors have found that this protocol may not be of predictive value in determining whether a protein does not normally secreted can be secreted, e.g., in the milk of a transgenic animal. therefore, it may be desirable to test constructs directly in transgenic animals, e.g., transgenic mice, as some constructs which are not secreted in CHO cells are secreted in the milk of transgenic animals Purification from milk Transgenic fusion protein can be produced in milk relatively high concentrations and in large volumes, providing a high continuous level production of normally processed peptide that is easily harvested from a renewable resource. There are several different methods known in the matter for the isolation of proteins from milk. Milk proteins are usually isolated by a combination of processes. The raw milk is first fractionated to remove fats, for example, by cream formation, centrifugation, sedimentation (H.E. Swaisgood, M MA 4 t Í? é * aAm ^ .. ^ «^, - * - - • - • ** - -» - .i -. ^. i .. *. - Developments in Dairy Chemistry, I: Chemistry of Milk Protein, Applied Science Publishers, NY, 1982), acid precipitation (US patent 4,644,056) or enzymatic coagulation with renin or chymotrypsin (Swaisgood, ibid.). Next, the major milk proteins can be fractionated into either a clear solution or a volume precipitate from which the protein of specific interest can be easily purified. US patent application Serial No. 08/648, 235 describes a method for isolating a component of the soluble milk, such as a peptide, in its biologically active form from the whole milk or a milk fraction by tangential flow filtration. Unlike previous isolation methods, this eliminates the need for a first fractionation of whole milk to remove fat and casein micelles, which simplifies the process and prevents recovery losses and bioactivity. This method can be used in combination with additional purification steps to further remove contaminants and purify the component of interest. ^^ Production of transgenic protein in the eggs of a transgenic animal. A fusion protein can be produced in tissues, secretions, or other products, for example, an egg, from a transgenic animal. For example, fusion proteins can be produced in the eggs of a transgenic animal, preferably a transgenic turkey, duck, goose, ostrich, guinea fowl, peacock, partridge, pheasant, pigeon, and most preferably a transgenic chicken, using methods known in the art (Sang et al., Trends Biotechnology, 12: 415-20, 1994) . Genes encoding proteins specifically expressed in the egg, such as yolk protein genes and albumin protein genes, can be modified to direct expression of the fusion protein. Egg-specific promoters The useful transcription promoters are those promoters that are preferentially activated in the egg, including the promoters that control the genes they encode ? the egg proteins, for example, ovalbumin, lysozyme and avidin. Promoters of chicken ovalbumin, lysozyme or avidin genes are preferred. Promoters of egg-specific protein or promoters that are specifically activated in egg tissue may be from cDNA sequences or genomic sequences. Preferably, the egg-specific promoters are of genomic origin. ^^ The DNA sequences of egg-specific genes are ^^ they know about the subject (see, for example, Burley et al, "The Avian Egg", John Willey and Sons, page 472, 1989, the content of which is incorporated herein by reference). If additional flanking sequences are useful to optimize expression, these sequences can be cloned using the existing sequences as probes. Egg-specific regulatory sequences from different organisms can be obtained by screening libraries of these organisms using known cognate nucleotide sequences, or anti-bodies for the cognate proteins as probes. Transgenic plants # A fusion protein can be expressed in a transgenic organism, for example, a transgenic plant, for example, a transgenic plant in which the DNA transgene is inserted into the nuclear or plastid genome. The transformation of plants is known in the art. See, in general, Methods -. Enzymology Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press and European patent application EP 693554. Foreign nucleic acid can be introduced into plant cells or protoplasts by various methods. For example, the nucleic acid can be transferred mechanically by microinjection directly into the cells of the plant by the use of micropipettes. The strange nucleic acid ^^ can also be transferred to a plant cell using polyethylene glycol which forms a precipitation complex with the genetic material that is absorbed by the cell (Paszkowski et al., (1984) EMBO J. 3: 2712-22). The foreign nucleic acid can be introduced into a plant cell by electroincorporation (Fromm et al., (1985) Proc. Na ti. Acad. Sci. USA 82: 5824). In this technique, the protoplasts of the plant are electro-incorporated in the presence of plasmids or nucleic acids that contain the relevant genetic construction. The high field strength electrical impulses reversibly permeabilize the biomembranes allowing the introduction of the plasmids. The protoplasts of the electroincorporated plant "^ reform the cell wall, divide, and form a plant callus.The selection of the cells of the transformed plant with the transformed gene can be carried out using phenotypic markers. it can be used as a vector for introducing foreign nucleic acid into plant cells (Hohn et al., (1982) "Molecular Biology of Plant Tumors", Academic Press, New York, pages 549-560; Howell, US Patent 4,407,956). The CaMV viral DNA genome is inserted into a parent bacterial plasmid creating a recombinant DNA molecule which can be propagated in the bacterium.The recombinant plasmid can be further modified by introducing the desired DNA sequence. The modified plasmid of the recombinant plasmid is separated from the parent bacterial plasmid, and used to inoculate the cells of the plant or the plants. at speed by small particles can be used to introduce nucleic acid ¿Feaáa ^ ali. strange in plant cells. The nucleic acid is arranged within the matrix of small beads or particles, or on the surface (Klen et al., (1987) Nature 327: 70-73). Although typically only a single introduction of a new nucleic acid segment is required, this method also provides multiple introductions. A nucleic acid can be introduced into a plant cell by infection of a plant cell, explant, meristem or seed with Agrobacterium tumefa-ciens transformed with the nucleic acid. Under suitable conditions, the transformed plant cells are grown to form suckers, roots, and then grown as plants. Nucleic acids can be introduced into the cells of plants, for example, by the Ti plasmid of the Agrobacteri a tumefaciens. The Ti plasmid is transmitted to plant cells after infection by Agrojbacterium tumefaciens, and is stably integrated into the plant genome (Horsch et al., (1984) "Inheritance of Functional Foreign Genes in Plants", Science 233: 496-498; Fraley et al., (1983) Proc. Nati, Acad. Sci. USA 80: 4803). w ^^ The plants from which the protoplasts can be isolated and cultivated to give the whole regenerated plants can be transformed so that the whole plants are recovered containing the foreign gene transferred. Some convenient ones include, for example, species of the genus Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linun, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciohorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Hewrerocalis, Nemesia, Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum, and Datura. The regeneration of plants from protoplasts Cultures are described in Evans et al., "Protoplasts Isolation and Culture," Handbook of Plant Cell Cul tures 1: 124-176 (MacMillan Publishing Co., New York 1983); M. R. Davey, "Recent Developments in the Culture and Regeneration of Plant Protoplasts", Protoplasts (1983) -Lecture Proceedings, pages 12-29, (Birkhauser, Basal 1983); P.J. Dale, "Protoplast Culture and Plant Regeneration of Cereals and Other Recalcitrant Crops", Protoplasts (1983) -Lecture Proceedings, pages 31-41, (Birkhauser, Basel 1983); and H. Binding, "Regeneration of Plants", Plant Protoplasts, pages 21-73, (CRC Press, Boca Ratón 1985). 20 ^^ Regeneration from protoplasts varies from one ^^ species to another of plants, but in general a suspension of transformed protoplasts containing copies of the exogenous sequence is generated first. In certain species, embryo formation can then be introduced from the suspension of protoplasts, up to the stage of maturation and germination as HU i _i_i natural embryos. The culture medium can advantageously contain various amino acids and hormones, such as auxin and cytokinin. It may also be advantageous to add glutamic acid and proline to the medium, especially for species such as corn and alfalfa. Sprouts and roots usually develop simultaneously. Efficient regeneration will depend on the medium, the genotype and the history of the crop. If these three variables are controlled, then the regeneration is completely reproducible and repeatable. In vegetatively propagated crops, mature transgenic plants can be propagated by taking cuttings or by cultivation techniques to produce multiple identical plants for trials, such as testing production characteristics. The selection of a desirable transgenic plant is made and new varieties are obtained by this, and propagated vegetatively for commercial sale. In propagated seed crops, mature transgenic plants can cross with themselves to produce a homozygous inbred plant. The inbred plant produces seeds that contain the gene for the activity level of the newly introduced foreign gene. These seeds can be grown to produce plants that have the selected phenotype. Plants crossed with themselves according to this invention can be used to develop new hybrids. In this method a selected cross-linked plant line is crossed with another self-cross plant line to produce the hybrid. The parts obtained from a transgenic plant, such as flowers, seeds, leaves, branches, fruit, and the like are covered by the invention, provided that these parts include cells that have been transformed in this manner. Progeny and variants, and mutants of regenerated plants are also included within the scope of this invention, provided that these parts comprise the introduced DNA sequences. Progeny and variants, and mutants of regenerated plants are also included within the scope of this invention. The selection of transgenic plants or plant cells can be based on a visual test, such as observing color changes (for example, a white flower, variable pigment production, and uniform color pattern in flowers or in irregular patterns), but it can also include biochemical assays either of enzyme activity or product quantification. Transgenic plants or plant cells are grown in plants that carry the part of the plant of interest and the activities of the gene are monitored, such as by visual appearance (to see flavonoid genes) or biochemical assays (Northern blotting); stained Western; Enzyme assays and flavonoid compound assays include spectroscopy, see, Harborne et al., (Eds.), (1975) The Flavonoids, Vol. 1 and 2, [Acad. Press]). The right plants are they select and evaluate themselves additionally. Methods for the generation of technically engineered plants are further described in US Patent 5,283,184, US Patent 5,482,852, and European Patent Application EP 693 554, all of which are hereby incorporated by reference. The embodiments of the invention are illustrated additional¬ • through the following examples that should not be considered as limiting. The contents of all cited references (including references to the literature, issued patents, published patent applications, and pending joint patent applications) cited throughout this application are hereby expressly incorporated by reference. • Examples 1 and 2 below describe the generation of two constructs: a light chain construct, and fusion constructs of a heavy chain / β-glucuronidase. Two plasmids, one containing a clone of an anti-body heavy / human chain (ß-glucuronidase fusion protein and the other obtaining a light chain sequence kapa were received from Behringwerke AG. ^^ EXAMPLE 1: Elaboration of the construction of the light chain (LC) The Example describes the generation of a light chain nucleic acid construct using the light chain nucleotide sequence from a monoclonal anti-body. _g__j ______ M _______ ^ ___ ÉÉÉÉ¡t.A.i, *. ,. ___, tíAÁ L¡L i,. "Í .. ..__" ___,. . ___. . ___. i? ? Humanized antigen against the carcinoembryonic antigen (431) subcloned into a mammary specific expression vector (Bcl63) and a commercial mammalian expression vector (pcDNA3). Briefly, a Hind III-Eco Rl fragment containing the light chain sequence was subcloned into pGEM3z to facilitate further manipulation. Two mutations were made: a) To create a consensus sequence Sal I, Xho I, and Kozak at the beginning of the coding region; and b) To create a Sal I site immediately after the termination codon. The original construction contained approximately 1300 bases of unknown sequence. To remove the unknown sequences, the Gapped Heteroduplex method was used to create a Sal I site just after the stop codon. Sac I sites just before the termination codon and near the Eco Rl site were used to make the hole, which was filled using the Klenow fragment, deoxynucleotides, T4 DNA ligase, and the following oligonucleotide: TGT TAG AGG TCG ACG CCC CAC (SEQ ID NO: 21) Term Sal I The hollow region (through the termination codon and the new Sal I site) was then sequenced to confirm that no changes were made in the sequence. A second Neo I site was found in the unknown sequence that was removed for a sub-step described ?,? "L i later. To remove this site, the construction containing the new Sal I site was digested with Eco Rl, the ends were filled with Klenow fragment and deoxynucleotides, and ligated to a Sal I linker, purchased from New England Biolabs after procedures. experimental routines. This construction containing two Sal I sites was then digested with Sal I-y religated, removing the unknown sequence that • contained the second Neo I site. A Sal I site and Kozak consensus sequence were inserted immediately after the initial methionine codon (instead of simply changing the Hind III site) because there were several ATG sequences before the start codon of correction that could possibly have been used as alternative start sites. Although these ATG sequences did not appear to be a problem in tissue culture, the safest route was to remove this region. These ATG sequences were removed by separating the Hind III Neo I site and replacing it with a HindlII-- Nco I adapter containing Sal I and Xho I and a Kosak consensus sequence. The replaced region was also confirmed by ^^ sequencing. ^^ The sequence changes were as follows: The original region 5Ü had the nucleotide sequence (the ATG sequences that are in uppercase letters, ATG corresponding to the initial methionine is indicated in bold): aagctt ATG aat ATG caaatcctgctc ATG aat ATG caaatcctctga lti ??. A -í * t. itiiA *? í __, &__ ». . ._J »^. & .. . ? s »-a? ATG gtaaatataggtttgtctataccacaaacagaaaaac ATG agat cacagttctctctacagttactgaccacacagagactcacc ATG (SEQ ID NO: 22) The original sequence was replaced with the following replacement sequence: Hind III Sal I Xhol AAGCTT GTCGAC CTCGAG CCACCATG Kozak (consensus sequence) (SEQ ID NO: 23) Sal I fragment containing the entire coding region of the light chain was subcloned into the Xho I site of Bcl63, a mammary specific expression vector and pcDNA3, a commercial mammalian expression vector. The orientation was determined by restriction enzyme analysis and / or sequencing. Figure IA is a schematic diagram of the light chain construction (431A). The nucleotide and amino acid sequences are shown in Figure IB. Figure 2 depicts the nucleotide sequence for the Sal I insert containing the coding sequences for the anti-carcinoembryonic antigen 431 anti-body light chain. Figure 3 shows a schematic diagram of a construction ^ ( Be 458) which includes the Sal I insert containing the coding sequences for the humanized anti-carcinoembryonic antigen 431 anti-body light chain. The location of the silencer, the untranslated ß-casein 5Ü region, is also indicated. of light chain coding, and the untranslated region of β-casein 3Ü. EXAMPLE 2: Fabrication of the heavy chain / β-glucuronidase fusion construct The Example describes the generation of the heavy chain / β-glucuronidase fusion construct using the heavy chain nucleotide sequence from a monoclonal anti-body humanized antigen against carcinoembryonic antigen (431) ^ 9 subcloned into a mammary specific expression vector (Bcl63) and a mammalian expression vector of commercial origin (pcDNA3). The Hind II I-Xba I fragment containing the heavy chain fusion sequence / β-glucuronidase was subcloned into pGEM3z Am to facilitate additional handling. Three mutations were made to the coding region of the heavy chain / β-glucuronidase fusion construct: a) To create a Sal I, Xho I, and Kozak consensus sequence at the beginning of the coding region; b) To change the sequence to the internal Sal I site while retaining the correct amino acid sequence; and VP c) To create a Sal I site immediately after the termination codon. The signal sequence that was used for the light chain was also used for the heavy chain. Again, the region between the Hind III and Neo I sites was removed and replaced with the same set of oligonucleotides used in the light chain to create a Sal I site and Kozak consensus sequence immediately before the initial methionine codon. (See above). The internal Sal I site had to be changed for the purpose of subcloning the fragment into a β-casein expression vector. Asn Gly Val Asp Thr Leu (SEQ ID NO: 24) ^^ original sequence AAT GCG GTC GAC ACG CTA (SEQ ID NO: 25) new sequence GTC GAT (SEQ ID NO: 26) Val Asp The flanking sequence 3Ü contained two polyadenylation signal sites and a chain of 16 adenine residues Am between the translation detection codon and the Xba I site. To remove these sequences, a Sal I site was inserted just after the stop codon. Phe Thr * * * original sequence TTT ACT TGA GCA AGA CTG (SEQ ID NO: 27) new sequence TTT ACT TGA GGT CGA CTG (SEQ ID NO: 28) Salt I ^ ^ The Gapped Heteroduplex method was used to make the previous changes . The original plan was to hollow out the DNA between the Not I and Xba I sites and change the internal Sal I site and add the Sal I 3Ü site at the same time. This was found to be difficult to do so first the site 3Q Sal I was added and a new gap was made between the two Bgl II sites for - ^ A - '.MA ?? *, Í .... i¿ ^ ¿^^^ i change the internal Sal I site. The recessed regions were completely sequenced to confirm that no changes were made to the sequence. The only difference found was in the fourth intron, to 1673 bases of the initial ATG. A cytosine was found in both the mutated and the original plasmid instead of adenine, as shown in the previously printed sequence.

F The Sal I fragment containing the entire coding region of the heavy chain fusion protein-glucuronidase was subcloned into the Xho I site of Bcl63, a mammary specific expression vector and pcDNA3, a mammalian expression vector of commercial origin . The orientation was determined by restriction enzyme analysis and / or sequencing. Figure 4A is a schematic diagram of light chain construction (43AA). The nucleotide and amino acid sequences are shown in Figure 4B. EXAMPLE 3: Generation of linked construction This example describes the generation of a construct that includes the fusion of light chain and the heavy chain / β-glucuronidase, together with their corresponding sequences of ß- ^^ casein upstream and downstream linked together in a single cosmid. In order to eliminate the possibility of integrating only one chain of a two-chain protein, such as an anti-body, if it has been co-injected into mice or into other species, both chains together with their own sequences ilJ l. corresponding ß-casein upstream and downstream were ligated together in a single cosmid. To achieve this, this supine I (Stratagene) was modified by inserting the following oligonucleotides into the Bam Hl site: Pvu I Pvu I ^^ T3 ... GAT CAC CGA TCG TCG CAC TCG CGGAT GAT CGA ... T7 (SEQ ID NO : 29) ^^ TG GCT AGC AGC TGG GCG AGC TCG CTA GCT ACT AG (SEQ ID NO: 30) Sal I Xho I These modifications create a new supraser plasmid, designated supreme 334, with sites exclusive to Sal I and Xho I. The sites of Pvu I, Not I, and Eco Rl flank these Aw sites and the Barn Hl site is destroyed. The Sal I fragments of Bcl74 or Bcl75, containing the modified light chain and the heavy chain / β-glucuronidase coding regions within the flanking regions of β-casein 5Ü and 3Ü respectively, were inserted into the Xho I site of supreme 334. Three clones were isolated and prepared. Orientation was determined by analysis of the restriction enzyme. Clone # name insert orientation 1 LC14 LC inverse 2 LC13 LC sense 11 HC9 HC inverse The Sal I fragments complementary to Bcl74 and Bcl75 .JL í t, (previously used) were linked in the Sal I site of the previous constructions. (The heavy chain fragment in LC13 and LC14, the light chain fragment in HC9). The resulting ligatures were then large enough to pack in vi tro into lambda phage particles (Amersham Game number 334) and were used to infect E.coli XLl Blue.

F Three versions were generated and one of each of these clones was isolated and prepared: clone # name insert orientation 1 Bcl80 HC / LC reverse / inverse 9 Bcldl HC / LC sense / direction 20 Bcl82 LC / HC reverse / inverse wm Although made Through two different paths, Bcl81 and Bcl82 essentially are the same insert when they are separated from the vector. When viewed in the direction sense, then both contain the Sal I heavy chain / β-glucuronidase cassette followed by and bound to the light chain Sal I cassette. Each cassette Sal I contains the ß-casein promoter region 5Ü, the anti-body coding region, and the flanking sequence of β-casein 3Ü. In essence, two species were made: the light chain cassette followed by the heavy chain cassette, or the heavy chain cassette followed by the light chain cassette. EXAMPLE 4: Characterization of light chain and heavy chain / β-glucuronidase constructs The manipulated DNA fragments were tested in tissue culture using the pcDNA3 constructs described above transfected into cos 7 cells using the standard Lipofectamine protocol using Opti-MEN (Gibco-BRL). Conditioned medium (DMEM-10% FBS) was removed after 48 hours and run on 10-20 percent SDS-PAGE gel for Western blotting. ™ The Western blots were carried out following standard procedures. Briefly, for the heavy chain / β-glucuronidase, samples were run in triplicate under reducing conditions and electro-spiked on microcellulose. The nitrocellulose was cut into three sections and incubated? during the night with each of the monoclonal anti-bodies: Mab 2149/80, Mab 2156/94, and Mab 2156/215. The secondary anti-body used for detection was from Cappel (catalog number 55570), horseradish peroxidase affinity was purified with conjugated goat anti-mouse IgG. The detection was made with the ECL game from Amersham. Mab 2149/80 was the only anti-body that showed a signal on Western blotting. ^^ For the light chain, the samples were again run under reducing conditions and electrotroped on nitrocellulose. The nitrocellulose was incubated overnight with horseradish peroxidase conjugated with goat anti-human kappa chain anti-body (Cappel number 55233). The detection was with the ECL game from Amersham. .fc > a, a .J. j.

EXAMPLE 5: Production of transgenic animals Microinjection fragments were prepared by cutting the β-casein Bcl74 (light chain) and Bcl75 (heavy chain) constructs with Sal I to release the bacterial sequences. The fragments were gel purified then exchanged with regulator and concentrated using the Wizard system by Promega.

^^ Micro-injections of nucleotide sequences ^^ originals were tested in the mouse model system using an expression vector containing the upstream goat ß-casein and coding sequences. Two separate constructs were made and co-injected into mouse embryos, from which founder lines were identified and further tested. The original DNA sequences were also co-injected with an "isolating" sequence that allowed us to produce a higher percentage of lines of higher production animals. For example, without insulation generally one of three lines would be a relatively high producer. With the insulation, in many cases, almost all production lines were high expression lines. ^^ Two sets of injections were carried out as follows: For the first set of injections, 1249 embryos were injected, of which 838 survived, and 737 were transferred to pseudo-pregnant females. Of these females 80 live young were born, of which 8 were transgenic, 7 of the which carried both chains. For the second set of injections, 508 embryos were injected, of which 435 survived, and 426 were transferred to pseudo-pregnant females. Of these females were born 44 live young, of which 2 were transgenic, both carried both chains. Bcldl was injected for three days. In this set, 840 embryos were injected, of which 641 survived, and 618 were transferred to pseudo-pregnant females. Of these females were born 39 live young, of which 5 were transgenic, 3 of which carried both chains. Due to the repetition of the flanking ß-casein sequences, it seems that in some cases recombination occurs by suppressing one chain or the other. Bcl81 was co-injected with the silencer fragment for four days. In this case, 1495 goat embryos were injected, of which 1183 survived, and 1073 were transferred to pseudo-pregnant goat females. Of these, 111 live offspring were born and 10 of these were transgenic, six carrying both chains. Two of the young had both the silencing fragment and the two chains of anti-bodies. EXAMPLE 5: Generation of heavy chain fusion / β-glucuronidase mutants In an attempt to increase the expression of active molecules, two mutations were carried out to casein L?? ^ •• * '• *' ****** - »- a * ¿A¡¡L. . , heavy chain fusion. The first mutation was to remove the articulation region of the construction. The second mutation removes the linkage and the linker sequence (ala-ala-ala-ala-val) (SEQ ID N0: 31) at the beginning of the coding sequence of β-glucuronidase, fusing the CH2-ß- glucuronidase. ^^ To achieve this, mutagenesis was used again "" »* Heteroduplex with free space. The Behring HC5 construct (which contained the fusion protein in pGem3Z with both ends modified and an internal Sal I site removed) was aligned with (Xba I). A second aliquot was cut with BstE2 plus Not I. When boiled together and some of each annealing of ^ B chain were formed together the heteroduplex contained a single-chain gap, in this case between the BstE2 and Not I sites. Two new constructions were then made, sequencing over the recessed portion to ensure that no other mutations were made inadvertently. GCT # 403: using the oligonucleotide "Behr alternating articulation" (in bold later) removes the region of ^^ articulation and part of the immediately preceding introns and after it. ccaaactctctactcACTCAGCTCA CGCATCCACCtccatcccagatccccgt (SEQ ID NO: 32) Intron GTC # 406 intron: using the oligonucleotide "Behr joint / linker" (in bold later) removes the joint region and the ala-ala-ala-ala-ala-val linker, fusing the CH2 and the coding regions of ß-glucuroni dasa. agcaacaccaaggtgGACAAGAGAGTT CAGGGCGGGATGctgtacccccaggag CH2 ß-glucuronidase coding sequence (SEQ ID NO: 33) The mutated fusion protein encoding the sequence can be separated using Sal I and subcloning into a suitable expression vector. High expression levels of the encoded proteins were obtained with a vector consisting of a silencer (or isolate) fragment followed by the goat β-casein promoter, the DNA insert, and the 3U untranslated regions of goat β-casein . Both mutant heavy chains and the light chain were subcloned into a vector, Bc450, which was flanked by the Sal I sites that released the entire injection fragment.

BC454: Bc450 with 403 heavy chain mutant (less joint) Bc456: Bc450 with 406 heavy chain mutant (less linker / linker).

Bc458: Bc450 with light chain. Figure 5 depicts the nucleotide and amino acid sequences for the mutant heavy chain of the humanized anti-carcinoembryonic antigen anti-body 431 lacking the articulation region. Figure 6 is a schematic diagram of a construct (Be 454) containing the mutant heavy chain of the anti-human anti-carcinoembryonic antigen 431 linked ? .. i.?.A? .A ... ^ A ^ ... i ^ ** m? ... Í i i to the sequence of β-glucuronidase. The location of the silencer, the untranslated region of β-casein 5β, the mutant heavy chain / β-glucuronidase fusion coding region, and the untranslated region of β-casein 3Ü. EXAMPLE 6: Characterization of transgenic animals The above examples describe the tests of the original fusion protein ^^ and two heavy chain mutants in the ^^ milk expression system. The original fusion proteins were tested both without the insulator and were also coinjected with isolating fragments separately. The heavy chain mutants, on the other hand, were tested with the insulator built into the construct. W Initially, the concentration of the fusion protein produced in the milk was estimated by comparing the signal of a sample with that of a standard on a Western blot. Then, experiments measured the activity instead of the concentration based on Western spotting. The activity measurements were more accurate. Except for the first set of constructions, Bcl74 + Bcl75, estimates of protein concentration by Western spotting are coarse estimates. In general, lines that express well appear to be in the range of 1-2 milligrams / milliliter. The expression data is summarized below, with more detailed data sets for each annexed construction. ^^^^^^ ^^ - ^ ^ ^ ~ _ A. Í í * ConstrucADN Ais;.? Lante Activity Western tions (HC) Maximum .mu.g / ml .mu.g / ml estimated Bcl74 / Bcl75 not Original Original 800 20 Bcldl, no 1000- 2000 Bcldl bonded Nd + aisoriginal, Fraigmento 1000 100 lante linked coi .nyectado Bc456 / Bc458 Less whichopened 1000- 8 culation / 2000 linked Bc454 / Bc458 yes Less 1000- 800 ^ P joint 2000 Essentially the results shown here indicate that although high levels of protein can be made in milk, most of this protein is not active. This inactivity can be due to a fold problem or a problem in the tetramer assembly. The removal of the joint and the linker also produced a protein with low activity. In contrast, a substantial amount of enzymatic activity was achieved after removal of the joint only. Approximately 8 milligrams of this protein had been produced in mouse milk. Currently isolated protein is being tested in in vivo studies ("human CEA positive colon cancer metastasis model"). • A summary of the data regarding the mice produced and the analysis done follows, in tabular form. A. Founders Bcl74 / 175 Original DNA without the insulator Line 2a. PCR sex Copy # Western Activity Gene. Μg / ml μg / ml * LC HC LC HC HC 2 F + + 10 10 0.14 4 F + + 1 1 < 0.1 10 F + + 10 10 ~ 800 18 142 F + + ~ 800 22 F + + 10 10 < 0.1 154 F + + ~ 800 23 F + + 50 50 ~ 400 4 200 F + + 0.0 40 M + + 100 100 < 0.1 62 F + + + + < 0.1 81 M + n.a. 85 F + + 25 25 116 M + + 5 5 216 F + + ~ 800 221 F + + ~ 800 n.a. = not analyzed (the line only carries one string) B. Founders Bcldl The original DNA without the insulator; a fusion of injection fragments Be 174 and Bcl75 I? í * .... i. ± j .... ^: -i ....

PCR Copy # Western Activity μg / ml μg / ml * Line Fl Sex LC HC LC HC HC 6 M + + 12 12 49 F 0.0 50 F 0.0 52 F > 1000 39 60 F > 1000 41 25 F + + 15 15 0.0 29 F + n.a. n.a. 0.0 33 M + n.a. n.a. n.a. 36 f + + 100 100 0.0 n.a. = not analyzed C. Founders Bcldl + insulation The original DNA (fusion of injection fragments Be 174 and Be 175) co-injected with the insulator ís? .s..í., i ^?. ^ A.l. t -... ÜB & s = PCR Copy # Wes- Activid. tern μg / ml * μg / ml Line 2a Sex LC HC Sil LC HC sil HC gene 9 M + n.a. 0 1 n.a. 13 M + n.a. 2 0 n.a. 15 F + n.a. 3 0 n.a. 33 F + + n.a. 3 3 -800 40 M + n.a. 0 2 n.a. 58 M + + n.a. 2 10 ^^ 2- F + + -800 43 A9 139 ™ 2- F + + -800 31 140 66 F + + n.a. 1 1 + 78 F + + n.a. 1 1 0.0 81 M + + n.a. 1 1 Does not pass 90 M + + n.a. 20 20 + 2- F + + + -1000 -100 123 2- F + + + -1000 60 • 124 2- F + + Low 15 126 n.a. = not analyzed: adc D. Founders Be: 456 + Bc458 Mutation that removes the joint and the linker: Ia 2 a Western HC Sex Activity μg / ml Generation Generation 6 F none 0 8 F 0 13 F none 0 18 F 0 24 F none 0 57 F good 2 65 F good 8 66 F low 0 138 M 175 F 152 F none 9 Bc454 + Bc45 í Mutation that removes only the articulation Ia Western HC Sex Activity GeneraGeneraGeneraμg / ml tion tion 162 section died C 4 F High 66 180 F Good 177 11 F 133 12 F 185 182 M 15 F Good 83 187 M They did not pass the gene 193 M 27 F High 836 57 F 829 58 F 742 59 F 944 60 F 574 61 F 752 62 F 534 201 F Good 416 215 F (died) 219 MF 220 MF EXAMPLE 7: Generation and characterization of transgenic goats The sections outlined below briefly describe the most important steps in the production of transgenic goats. Species and breeds of goats: Goats of Swiss origin, for example, the Alpine breeds, Saanen, and Toggenburg, are preferred in the production of transgenic goats.

JA ^ .A? J .A AÍAÍ & ^^^^ - "" * * * - * "" 'ÍÍ.IJ.

Super-ovulation of goats: The duration of donors' estrus is synchronized on Day 0 through subcutaneous ear implants of norgesto- met 6 milligrams (Syncromate-B, CEVA Laboratories, Inc., Overland Park, Kansas, United States) . Prostaglandin is administered after the first seven to nine days to complete the endogenous progesterone synthesis. Beginning on Day 13 after ^^ W of the implant insertion, a total of 18 milligrams of follicle stimulating hormone (FSH - Schering Corp., Kenilworth, New Jersey, United States) is given intramuscularly for three days in injection twice a day. The implant is removed on Day 14. Twenty-four hours after the removal of the • implant donor animals mate several times with fertile males for a period of two days (Selgrath, et al., Theriogenology, 1990, pages 1195-1205). Embryo collection: Surgery for embryo collection occurs the second day after mating (or 72 hours after the removal of the implant). The super-ovulated females are separated ^^ from food and water 36 hours before surgery. The females are given 0.8 milligrams / kilogram of Diazepam (Valium®) intravenously, followed immediately by 5.0 milligrams / kilogram of ketamine (Keteset), intravenously. Halothane (2.5 percent) is given during surgery in 2 liters / minute of oxygen via an endotracheal tube. The reproductive system is externalized through an incision of the midline device. The corpus luteum, unbroken follicles larger than 6 millimeters in diameter, and ovarian cysts are counted to evaluate the results of super-ovulation and to predict the number of embryos that should be collected by washing the oviduct. A cannula is placed in the ostium of the oviduct and held in place with a temporary ligature of simple 3.0 wm? Proleny A 20 gauge needle is placed in the uterus approximately 0.5 centimeters from the uterotubal junction. After 10 a 20 milliliters of sterile phosphate buffered saline (PBS) is circulated through the canalized oviduct and collected in a Petri dish. This procedure is repeated • opposite side and then the reproductive system is replaced in the abdomen. Before closing, pour a glycerol solution with sterile saline 10-20 milliliters in the abdominal cavity to avoid adhesions. The linea alba is closed with simple interrupted sutures of 2.0 Polidioxanone or Supramid and the skin is closed with sterile staples for wounds. The fertilized goat eggs are collected from ^ washing of the oviduct with phosphate bued solution on a stereo-microscope, and then washing in F12 Ham medium (Sigma, St. Louis, Missouri, United States) containing 10 percent fetal bovine serum (FBS) purchased in Sigma. In cases where the pronuclei are visible, the embryos are immediately micro-inject. If the pronuclei are not visible, the embryos can be placed in Ham's F12 medium containing 10 percent fetal bovine serum during a short-term culture at 37 ° C in a humidified gas chamber containing 5 percent C02 in air until the pronuclei become visible ( Selgrath, et al., Theriogenology, 1990, pages 1195-1205). Micro-injection procedure: Goat embryos from a cell are placed in a micro-dropper of medium low oil on a slide with glass depression. Fertilized ovules with two visible pronuclei are immobilized in a flame-polished micro-pipette in a Zeiss vertical microscope with a fixed step using Normarski optics. It is micro-injected W pronucleus with the construction of DNA of interest, for example, a BC355 vector containing the fusion protein gene operably linked to the regulatory elements of the goat β-casein gene, in injection bu (Tris-EDTA) using a fine glass micro needle (Selgrath et al., Theriogenology, 1990, pages 1195-1205). Embryo development: After micro-injection, the surviving embryos are placed in a culture of Ham's F12 containing 10 percent fetal bovine serum and then incubated in a humidified gas chamber containing 5 percent C02 in air at 37 ° C until the recipient animals are ready for embryo transfer (Selgrath, et al., Therioge- ***,? rJ- f liü'ii H »* '* - ^« * - ~ ^. . sLJr. i? ^ nology, 1990, pages 1195-1205). Preparation of the receptors: The synchronization of estrus in the recipient animals is induced by 6 milligrams of implants in the ear of norgestomet (Syncromate-B). On Day 13 after insertion of the implant, the animals are given a single non-super-ovulatory injection (400 international units) of pregnant female serum gonadotropin (PMSG) obtained in Sigma. The recipient females are mated with vasectomized males to ensure estrus synchronization (Selgrath et al., Theriogenology, 1990 pages 1195-1205). Embryo transfer: All embryos of a donor female are kept together and transferred to a single recipient when possible. The surgical procedure is identical to that indicated for the embryo collection indicated above, except that the oviduct is not channeled, and the embryos are transferred in a minimum volume of Ham's F12 solution containing 10 percent fetal bovine serum in the lumen. of the oviduct via the fimbria using a glass micro-pipette. Animals that have more than six to eight ovulation points above the ovary are considered inadvisable as receptors. The incision lock and post-operative care are the same for donor animals (see, for example, Selgrath et al., Theriogenology, 1990, pages 1195-1205). .i.a. ^^ E ^^. 1 Monitoring of pregnancy and delivery: Pregnancy is determined by ultrasound 45 days after the first day of estrus. On Day 110, a second ultrasound examination is carried out to confirm the pregnancy and assess the fetal tension. On Day 130 the pregnant female recipient is vaccinated with tetanus toxoid and with C & D Clostridium. He is given intramuscularly Selenium and ^ vitamin E (Bo-Se) and subcutaneously given Ivermectin. The females move to a clean stable on Day 145 and are allowed to acclimate to this environment before inducing labor on Day 147. Labor is induced on Day 147 with 40 milligrams of PGF2a (Lutalyse®, Upjohn Company, Kalamazoo, Michigan, United States Ww United). This injection is given intramuscularly in two doses, a dose of 20 milligrams followed by a dose of 20 milligrams four hours later. The female is under observation periodically during the day and the afternoon after the first injection of Lutalyse® on day 147. Observations increase every 30 minutes beginning on the morning of the second day. The delivery occurs between 30 and 40 hours after the first injection. After the birth, the female is milked to collect the colostrum and the passage of the placenta is confirmed. Verification of the transgenic nature of the animals Fn: To select the F0 transgenic animals, genomic DNA is isolated from two different cell lines to avoid losing any transgenic mosaic. An animal is defined mosaic like any goat that does not have at least one copy of the transgene in each cell. Therefore, a sample of tissue from the ear (mesoderm) and a blood sample from a two-day-old F0 animal are taken for the isolation of genomic DNA (Lacy et al., A Laboratory Manual, 1986, Cold Springs Harbor , NY, and Hermann and Frischauf, Methods Enzymology, . ^ k 1987. 152: pages 180-183). The DNA samples are analyzed W * by the polymerase chain reaction (Gould et al., Proc. Nati, Acad. Sci, 1989. 86: pages 1934-1938) using primers specific for the fusion protein gene and by analysis Southern spotting (Thomas, Proc Nati, Acad. Sci., 1980. 77: 5201-5205) using a first member or second random barley member cDNA probe (Feinberg and Vogelstein, Anal. Bioc., 1983. 132 : pages 6-13). The sensitivity of the assay is estimated as the detection of a copy of the transgene in 10 percent of the somatic cells. Generation and selection of production cattle The procedures described above can be used for the production of transgenic founder goats (F0), át. as well as other transgenic goats. The F0 transgenic founder goats, for example, are raised to produce milk, if they are female, or to produce transgenic female offspring if it is a male founder. This male transgenic founder, can be crossed with non-transgenic females, to produce female transgenic daughters. ÍA A.sk .é ^ í. ? ^? ? . . ^ .... ^ .... WrtM., ». . ...... ^ ... t ......... ^ .. _. - .. .. ... ^ *** ^. , ... A..f ?? - Transgene transmission and relevant characteristics Transmission of the transgene of interest, in the line of the goat is analyzed in the tissue of the ear and in the blood by polymerase chain reaction and analysis of Spotted Southern. For example, the Southern spotting analysis of the founder male and three transgenic offspring shows no rearrangement or change in the number of copies between generations. The Southern spotted mt are probed with an immunoglobulin-enzyme fusion protein cDNA probe. The smears are analyzed in a Betascope 603 and the number of copies is determined by comparison of the transgene against the endogenous gene of goat β-casein. Evaluation of expression levels The level of expression of the transgenic protein, in the milk of the transgenic animals, is determined using enzymatic assays or Western spotting. Other embodiments are within the following claims.

Claims

CLAIMS 1. A method of making a fusion protein having a first member, fused to a second member, comprising: selecting a first member and a second member, such that the first member or the fusion protein is assembled in a complex which has a number of subunits that optimizes the activity of the multimeric form of the second member; produce the fusion protein; and allowing the fusion protein to be assembled in the complex having a number of subunits that optimizes the activity of the multimeric form of the second member. The method of claim 1, wherein the first member Ww, or fusion protein, is assembled in a form having the same number of subunits that are present in an active form of the second member. 3. The method of claim 1, wherein the first member includes a sub-unit Ig. 4. The method of claim 1, wherein the second member is distinct from an Ig sub-unit. 5. The method of claim 1, wherein the first member has been modified at a site that modulates the formation or preservation of a multimer of subunits. 6. The method of claim 1, wherein the first member forms a dimer. 7. The method of claim 1, wherein the first .. £ al ** - «.- -, i gj g g member includes a sub-unit Ig, which has been modified to inhibit the formation of a multimeric form. The method of claim 7, wherein the modification is a change, an insertion, or deletion of one or more amino acid residues, and results in a subunit that does not form a multimer or that forms a multimer of order # lower than would normally be formed. The method of claim 7, wherein the region of articulation of the immunoglobulin is modified. The method of claim 7, wherein the modification results in a dimeric Ig structure. 11. The method of claim 10, wherein the dimer • includes a heavy chain fusion and a light chain fusion. The method of claim 1, wherein the second member includes β-glucuronidase. The method of claim 1, wherein the first member is a heavy or light immunoglobulin (Ig) chain, and the second member is the human ß-glucuronidase U fusion protein. The method of claim 1, wherein the fusion protein is produced in a transgenic mammal. 15. A method for providing a transgenically produced fusion protein of claim 1, comprising obtaining milk from a transgenic mammal, including a fusion protein that encodes a transgene that results in the expression of the sequence encoding the protein of the fusion protein in the epithelial cells of the mammary glands, thereby secreting the fusion protein in the milk of the mammal. 16. A nucleic acid construct, which includes: • (a) optionally, an insulating sequence; (b) a promoter, e.g., a promoter specific to the mammary epithelium, e.g., a milk protein promoter; "(c) a nucleotide sequence that encodes a signal sequence that can direct the secretion of the fusion protein, e.g., a signal sequence of a protein W ^^% specific milk, or an immunoglobulin; (d) optionally, a nucleotide sequence that encodes a sufficient portion of the amino terminal coding region of a secreted protein, e.g., a protein secreted into milk, or an immunoglobulin, to allow secretion, v.gr ., in the milk of the transgenic mammal, of the fusion protein; k (e) one or more nucleotide sequences encoding a fusion protein, e.g., a fusion protein as described herein; and (f) optionally, a 3 'untranslated region of a specific gene to the mammary epithelium, e.g., a protein gene d eleche. 17. A nucleic acid construct, including a nucleic acid molecule encoding a fusion protein of claim 1. 18. A fusion protein described in claim 1. 19. A transgenic animal that includes a transgene encoding a protein of fusion of claim 1. • • ü.ti j.tAm .... ... ». -...... ^^. aaam ^